Sample records for atca fru devices

  1. Development of high-availability ATCA/PCIe data acquisition instrumentation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Correia, Miguel; Sousa, Jorge; Batista, Antonio J.N.

    2015-07-01

    Latest Fusion energy experiments envision a quasi-continuous operation regime. In consequence, the largest experimental devices, currently in development, specify high-availability (HA) requirements for the whole plant infrastructure. HA features enable the whole facility to perform seamlessly in the case of failure of any of its components, coping with the increasing duration of plasma discharges (steady-state) and assuring safety of equipment, people, environment and investment. IPFN developed a control and data acquisition system, aiming for fast control of advanced Fusion devices, which is thus required to provide such HA features. The system is based on in-house developed Advanced Telecommunication Computing Architecturemore » (ATCA) instrumentation modules - IO blades and data switch blades, establishing a PCIe network on the ATCA shelf's back-plane. The data switch communicates to an external host computer through a PCIe data network. At the hardware management level, the system architecture takes advantage of ATCA native redundancy and hot swap specifications to implement fail-over substitution of IO or data switch blades. A redundant host scheme is also supported by the ATCA/PCIe platform. At the software level, PCIe provides implementation of hot plug services, which translate the hardware changes to the corresponding software/operating system devices. The paper presents how the ATCA and PCIe based system can be setup to perform with the desired degree of HA, thus being suitable for advanced Fusion control and data acquisition systems. (authors)« less

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fernandes, Ana; Pereira, Rita C.; Sousa, Jorge

    The Instituto de Plasmas e Fusao Nuclear (IPFN) has developed dedicated re-configurable modules based on field programmable gate array (FPGA) devices for several nuclear fusion machines worldwide. Moreover, new Advanced Telecommunication Computing Architecture (ATCA) based modules developed by IPFN are already included in the ITER catalogue. One of the requirements for re-configurable modules operating in future nuclear environments including ITER is the remote update capability. Accordingly, this work presents an alternative method for FPGA remote programing to be implemented in new ATCA based re-configurable modules. FPGAs are volatile devices and their programming code is usually stored in dedicated flash memoriesmore » for properly configuration during module power-on. The presented method is capable to store new FPGA codes in Serial Peripheral Interface (SPI) flash memories using the PCIexpress (PCIe) network established on the ATCA back-plane, linking data acquisition endpoints and the data switch blades. The method is based on the Xilinx Quick Boot application note, adapted to PCIe protocol and ATCA based modules. (authors)« less

  3. Novel Developmental Genes, fruCD, of Myxococcus xanthus: Involvement of a Cell Division Protein in Multicellular Development

    PubMed Central

    Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2003-01-01

    Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development. PMID:12754229

  4. Identification and functional analysis of the gene cluster for fructan utilization in Prevotella intermedia.

    PubMed

    Fuse, Haruka; Fukamachi, Haruka; Inoue, Mitsuko; Igarashi, Takeshi

    2013-02-25

    Fructanase enzymes hydrolyze the β-2,6 and β-2,1 linkages of levan and inulin fructans, respectively. We analyzed the influence of fructan on the growth of Prevotella intermedia. The growth of P. intermedia was enhanced by addition of inulin, implying that P. intermedia could also use inulin. Based on this finding, we identified and analyzed the genes encoding a putative fructanase (FruA), sugar transporter (FruB), and fructokinase (FruK) in the genome of strain ATCC25611. Transcript analysis by RT-PCR showed that the fruABK genes were co-transcribed as a single mRNA and semi-quantitative analysis confirmed that the fruA gene was induced in response to fructose and inulin. Recombinant FruA and FruK were purified and characterized biochemically. FruA strongly hydrolyzed inulin, with slight degradation of levan via an exo-type mechanism, revealing that FruA is an exo-β-d-fructanase. FruK converted fructose to fructose-6-phosphate in the presence of ATP, confirming that FruK is an ATP-dependent fructokinase. These results suggest that P. intermedia can utilize fructan as a carbon source for growth, and that the fructanase, sugar transporter, and fructokinase proteins we identified are involved in this fructan utilization. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. The fruRBA Operon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood

    PubMed Central

    Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.

    2016-01-01

    Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724

  6. Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

    PubMed

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-12-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  7. Streptococcus mutans: Fructose Transport, Xylitol Resistance, and Virulence

    PubMed Central

    Tanzer, J.M.; Thompson, A.; Wen, Z.T.; Burne, R.A.

    2008-01-01

    Streptococcus mutans, the primary etiological agent of human dental caries, possesses at least two fructose phosphotransferase systems (PTSs), encoded by fruI and fruCD. fruI is also responsible for xylitol transport. We hypothesized that fructose and xylitol transport systems do not affect virulence. Thus, colonization and cariogenicity of fruI− and fruCD− single and double mutants, their WT (UA159), and xylitol resistance (Xr) of S. mutans were studied in rats fed a high-sucrose diet. A sucrose phosphorylase (gtfA−) mutant and a reference strain (NCTC-10449S) were additional controls. Recoveries of fruI mutant from the teeth were decreased, unlike those for the other strains. The fruCD mutation was associated with a slight loss of cariogenicity on enamel, whereas mutation of fruI was associated with a loss of cariogenicity in dentin. These results also suggest why xylitol inhibition of caries is paradoxically associated with spontaneous emergence of so-called Xr S. mutans in habitual human xylitol users. PMID:16567561

  8. Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-01-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

  9. Drosophila female-specific Ilp7 motoneurons are generated by Fruitless-dependent cell death in males and by a double-assurance survival role for Transformer in females.

    PubMed

    Garner, Sarah Rose C; Castellanos, Monica C; Baillie, Katherine E; Lian, Tianshun; Allan, Douglas W

    2018-01-08

    Female-specific Ilp7 neuropeptide-expressing motoneurons (FS-Ilp7 motoneurons) are required in Drosophila for oviduct function in egg laying. Here, we uncover cellular and genetic mechanisms underlying their female-specific generation. We demonstrate that programmed cell death (PCD) eliminates FS-Ilp7 motoneurons in males, and that this requires male-specific splicing of the sex-determination gene fruitless ( fru ) into the Fru MC isoform. However, in females, fru alleles that only generate Fru M isoforms failed to kill FS-Ilp7 motoneurons. This blockade of Fru M -dependent PCD was not attributable to doublesex gene function but to a non-canonical role for transformer ( tra ), a gene encoding the RNA splicing activator that regulates female-specific splicing of fru and dsx transcripts. In both sexes, we show that Tra prevents PCD even when the Fru M isoform is expressed. In addition, we found that Fru MC eliminated FS-Ilp7 motoneurons in both sexes, but only when Tra was absent. Thus, Fru MC -dependent PCD eliminates female-specific neurons in males, and Tra plays a double-assurance function in females to establish and reinforce the decision to generate female-specific neurons. © 2018. Published by The Company of Biologists Ltd.

  10. The fruRBA Operon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood.

    PubMed

    Valdes, Kayla M; Sundar, Ganesh S; Vega, Luis A; Belew, Ashton T; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M; Le Breton, Yoann; McIver, Kevin S

    2016-04-01

    Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes(the group A Streptococcus[GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the frulocus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fruoperon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-D-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

    PubMed

    Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

    2017-11-01

    The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and express virulence-related traits. Mutants lacking the FruR regulator or a particular phosphofructokinase, FruK, display changes in expression of a large number of genes encoding transcriptional regulators, enzymes required for energy metabolism, biofilm development, biosynthetic and degradative processes, and tolerance of a spectrum of environmental stressors. Since fructose is a major component of the modern human diet, the results have substantial significance in the context of oral health and the development of dental caries. Copyright © 2017 American Society for Microbiology.

  12. Control of male sexual behavior and sexual orientation in Drosophila by the fruitless gene.

    PubMed

    Ryner, L C; Goodwin, S F; Castrillon, D H; Anand, A; Villella, A; Baker, B S; Hall, J C; Taylor, B J; Wasserman, S A

    1996-12-13

    Sexual orientation and courtship behavior in Drosophila are regulated by fruitless (fru), the first gene in a branch of the sex-determination hierarchy functioning specifically in the central nervous system (CNS). The phenotypes of new fru mutants encompass nearly all aspects of male sexual behavior. Alternative splicing of fru transcripts produces sex-specific proteins belonging to the BTB-ZF family of transcriptional regulators. The sex-specific fru products are produced in only about 500 of the 10(5) neurons that comprise the CNS. The properties of neurons expressing these fru products suggest that fru specifies the fates or activities of neurons that carry out higher order control functions to elicit and coordinate the activities comprising male courtship behavior.

  13. Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2003-01-01

    Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461

  14. Development of an ATCA IPMI controller mezzanine board to be used in the ATCA developments for the ATLAS Liquid Argon upgrade

    NASA Astrophysics Data System (ADS)

    Dumont Dayot, Nicolas

    2012-01-01

    In the context of the LHC upgrade, we develop a new Read Out Driver (ROD) for the ATLAS Liquid Argon (LAr) community. ATCA and μTCA (Advanced/Micro Telecom Computing Architecture) is becoming a standard in high energy physics and a strong candidate to be used for boards and crates. We work to master ATCA and to integrate a large number of high speed links (96 links at 8.5 Gbps) on a ROD evaluation ATCA board. A versatile ATCA IPMI controller for ATCA boards which is FPGA Mezzanine Card (FMC) compliant has been developed to control the ROD evaluation board.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santos, Bruno; Carvalho, Paulo F.; Rodrigues, A.P.

    The ATCA standard specifies a mandatory Shelf Manager (ShM) unit which is a key element for the system operation. It includes the Intelligent Platform Management Controller (IPMC) which monitors the system health, retrieves inventory information and controls the Field Replaceable Units (FRUs). These elements enable the intelligent health monitoring, providing high-availability and safety operation, ensuring the correct system operation. For critical systems like ones of tokamak ITER these features are mandatory to support the long pulse operation. The Nominal Device Support (NDS) was designed and developed for the ITER CODAC Core System (CCS), which will be the responsible for plantmore » Instrumentation and Control (I and C), supervising and monitoring on ITER. It generalizes the Enhanced Physics and Industrial Control System (EPICS) device support interface for Data Acquisition (DAQ) and timing devices. However the support for health management features and ATCA ShM are not yet provided. This paper presents the implementation and test of a NDS for the ATCA ShM, using the ITER Fast Plant System Controller (FPSC) prototype environment. This prototype is fully compatible with the ITER CCS and uses the EPICS Channel Access (CA) protocol as the interface with the Plant Operation Network (PON). The implemented solution running in an EPICS Input / Output Controller (IOC) provides Process Variables (PV) to the PON network with the system information. These PVs can be used for control and monitoring by all CA clients, such as EPICS user interface clients and alarm systems. The results are presented, demonstrating the fully integration and the usability of this solution. (authors)« less

  16. Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways

    PubMed Central

    Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz

    2017-01-01

    ABSTRACT The glucose/mannose-phosphotransferase system (PTS) permease EIIMan encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EIIFru, respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EIIMan. Expression of genes for EIIMan and EIIFru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN. Carbohydrate transport by EIIMan had a negative influence on expression of manLMN but not fruRKI. In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR. Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and express virulence-related traits. Mutants lacking the FruR regulator or a particular phosphofructokinase, FruK, display changes in expression of a large number of genes encoding transcriptional regulators, enzymes required for energy metabolism, biofilm development, biosynthetic and degradative processes, and tolerance of a spectrum of environmental stressors. Since fructose is a major component of the modern human diet, the results have substantial significance in the context of oral health and the development of dental caries. PMID:28821551

  17. Central cavity of fructose-1,6-bisphosphatase and the evolution of AMP/fructose 2,6-bisphosphate synergism in eukaryotic organisms.

    PubMed

    Gao, Yang; Shen, Lu; Honzatko, Richard B

    2014-03-21

    The effects of AMP and fructose 2,6-bisphosphate (Fru-2,6-P2) on porcine fructose-1,6-bisphosphatase (pFBPase) and Escherichia coli FBPase (eFBPase) differ in three respects. AMP/Fru-2,6-P2 synergism in pFBPase is absent in eFBPase. Fru-2,6-P2 induces a 13° subunit pair rotation in pFBPase but no rotation in eFBPase. Hydrophilic side chains in eFBPase occupy what otherwise would be a central aqueous cavity observed in pFBPase. Explored here is the linkage of AMP/Fru-2,6-P2 synergism to the central cavity and the evolution of synergism in FBPases. The single mutation Ser(45) → His substantially fills the central cavity of pFBPase, and the triple mutation Ser(45) → His, Thr(46) → Arg, and Leu(186) → Tyr replaces porcine with E. coli type side chains. Both single and triple mutations significantly reduce synergism while retaining other wild-type kinetic properties. Similar to the effect of Fru-2,6-P2 on eFBPase, the triple mutant of pFBPase with bound Fru-2,6-P2 exhibits only a 2° subunit pair rotation as opposed to the 13° rotation exhibited by the Fru-2,6-P2 complex of wild-type pFBPase. The side chain at position 45 is small in all available eukaryotic FBPases but large and hydrophilic in bacterial FBPases, similar to eFBPase. Sequence information indicates the likelihood of synergism in the FBPase from Leptospira interrogans (lFBPase), and indeed recombinant lFBPase exhibits AMP/Fru-2,6-P2 synergism. Unexpectedly, however, AMP also enhances Fru-6-P binding to lFBPase. Taken together, these observations suggest the evolution of AMP/Fru-2,6-P2 synergism in eukaryotic FBPases from an ancestral FBPase having a central aqueous cavity and exhibiting synergistic feedback inhibition by AMP and Fru-6-P.

  18. Hepatocyte growth factor and transforming growth factor beta regulate 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase gene expression in rat hepatocyte primary cultures.

    PubMed Central

    Joaquin, M; Rosa, J L; Salvadó, C; López, S; Nakamura, T; Bartrons, R; Gil, J; Tauler, A

    1996-01-01

    Hepatocyte growth factor (HGF) and transforming growth factor beta (TGF-beta) are believed to be of major importance for hepatic regeneration after liver damage. We have studied the effect of these growth factors on fructose 2,6-bisphosphate (Fru-2,6-P2) levels and the expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (6PF2K/Fru-2,6-BPase) in rat hepatocyte primary cultures. Our results demonstrate that HGF activates the expression of the 6PF2K/Fru-2,6-BPase gene by increasing the levels of its mRNA. As a consequence of this activation, the amount of 6PF2K/Fru-2,6-BPase protein and 6-phosphofructo-2-kinase activity increased, which was reflected by a rise in Fru-2,6-P2 levels. In contrast, TGF-beta decreased the levels of 6PF2K/Fru-2,6-BPase mRNA, which led to a decrease in the amount of 6PF2K/Fru-2,6-BPase protein and Fru-2,6-P2. The different actions of HGF and TGF-beta on 6PF2K/Fru-2,6-BPase gene expression are concomitant with their effect on cell proliferation. Here we show that, in the absence of hormones, primary cultures of hepatocytes express the F-type isoenzyme. In addition, HGF increases the expression of this isoenzyme, and dexamethasone activates the L-type isoform. HGF and TGF-beta were able to inhibit this activation. PMID:8660288

  19. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    PubMed

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  20. Central Cavity of Fructose-1,6-bisphosphatase and the Evolution of AMP/Fructose 2,6-bisphosphate Synergism in Eukaryotic Organisms*

    PubMed Central

    Gao, Yang; Shen, Lu; Honzatko, Richard B.

    2014-01-01

    The effects of AMP and fructose 2,6-bisphosphate (Fru-2,6-P2) on porcine fructose-1,6-bisphosphatase (pFBPase) and Escherichia coli FBPase (eFBPase) differ in three respects. AMP/Fru-2,6-P2 synergism in pFBPase is absent in eFBPase. Fru-2,6-P2 induces a 13° subunit pair rotation in pFBPase but no rotation in eFBPase. Hydrophilic side chains in eFBPase occupy what otherwise would be a central aqueous cavity observed in pFBPase. Explored here is the linkage of AMP/Fru-2,6-P2 synergism to the central cavity and the evolution of synergism in FBPases. The single mutation Ser45 → His substantially fills the central cavity of pFBPase, and the triple mutation Ser45 → His, Thr46 → Arg, and Leu186 → Tyr replaces porcine with E. coli type side chains. Both single and triple mutations significantly reduce synergism while retaining other wild-type kinetic properties. Similar to the effect of Fru-2,6-P2 on eFBPase, the triple mutant of pFBPase with bound Fru-2,6-P2 exhibits only a 2° subunit pair rotation as opposed to the 13° rotation exhibited by the Fru-2,6-P2 complex of wild-type pFBPase. The side chain at position 45 is small in all available eukaryotic FBPases but large and hydrophilic in bacterial FBPases, similar to eFBPase. Sequence information indicates the likelihood of synergism in the FBPase from Leptospira interrogans (lFBPase), and indeed recombinant lFBPase exhibits AMP/Fru-2,6-P2 synergism. Unexpectedly, however, AMP also enhances Fru-6-P binding to lFBPase. Taken together, these observations suggest the evolution of AMP/Fru-2,6-P2 synergism in eukaryotic FBPases from an ancestral FBPase having a central aqueous cavity and exhibiting synergistic feedback inhibition by AMP and Fru-6-P. PMID:24436333

  1. What does the fruitless gene tell us about nature vs. nurture in the sex life of Drosophila?

    PubMed

    Yamamoto, Daisuke; Kohatsu, Soh

    2017-04-03

    The fruitless (fru) gene in Drosophila has been proposed to play a master regulator role in the formation of neural circuitries for male courtship behavior, which is typically considered to be an innate behavior composed of a fixed action pattern as generated by the central pattern generator. However, recent studies have shed light on experience-dependent changes and sensory-input-guided plasticity in courtship behavior. For example, enhanced male-male courtship, a fru mutant "hallmark," disappears when fru-mutant males are raised in isolation. The fact that neural fru expression is induced by neural activities in the adult invites the supposition that Fru as a chromatin regulator mediates experience-dependent epigenetic modification, which underlies the neural and behavioral plasticity.

  2. Sex-switching of the Drosophila brain by two antagonistic chromatin factors

    PubMed Central

    Ito, Hiroki; Sato, Kosei; Yamamoto, Daisuke

    2013-01-01

    In Drosophila melanogaster, the fruitless (fru) gene encoding BTB-Zn-finger transcription factors organizes male sexual behavior by controlling the development of sexually dimorphic neuronal circuitry. However, the molecular mechanism by which fru controls the sexual fate of neurons has been unknown. Our recent study represents a first step toward clarification of this mechanism. We have shown that: (1) Fru forms a complex with the transcriptional cofactor Bonus (Bon), which recruits either of two chromatin regulators, Histone deacetylase 1 (HDAC1) or Heterochromatin protein 1a (HP1a), to Fru-target sites; (2) the Fru-Bon complex has a masculinizing effect on single sexually-dimorphic neurons when it recruits HDAC1, whereas it has a demasculinizing effect when it recruits HP1a; (3) HDAC1 or HP1a thus recruited to Fru-target sites determines the sexual fate of single neurons in an all-or-none manner, as manipulations of HDAC1 or HP1a expression levels affect the proportion of male-typical neurons and female-typical neurons without producing neurons of intersexual characteristics. Here, we hypothesize that chromatin landscape changes induced by ecdysone surges direct the HDAC1- or HP1a-containing Fru complex to distinct targets, thereby allowing them to switch the neuronal sexual fate in the brain. PMID:23519136

  3. Functional Dissection of the Neural Substrates for Sexual Behaviors in Drosophila melanogaster

    PubMed Central

    Meissner, Geoffrey W.; Manoli, Devanand S.; Chavez, Jose F.; Knapp, Jon-Michael; Lin, Tasha L.; Stevens, Robin J.; Mellert, David J.; Tran, David H.; Baker, Bruce S.

    2011-01-01

    The male-specific Fruitless proteins (FruM) act to establish the potential for male courtship behavior in Drosophila melanogaster and are expressed in small groups of neurons throughout the nervous system. We screened ∼1000 GAL4 lines, using assays for general courtship, male–male interactions, and male fertility to determine the phenotypes resulting from the GAL4-driven inhibition of FruM expression in subsets of these neurons. A battery of secondary assays showed that the phenotypic classes of GAL4 lines could be divided into subgroups on the basis of additional neurobiological and behavioral criteria. For example, in some lines, restoration of FruM expression in cholinergic neurons restores fertility or reduces male–male courtship. Persistent chains of males courting each other in some lines results from males courting both sexes indiscriminately, whereas in other lines this phenotype results from apparent habituation deficits. Inhibition of ectopic FruM expression in females, in populations of neurons where FruM is necessary for male fertility, can rescue female infertility. To identify the neurons responsible for some of the observed behavioral alterations, we determined the overlap between the identified GAL4 lines and endogenous FruM expression in lines with fertility defects. The GAL4 lines causing fertility defects generally had widespread overlap with FruM expression in many regions of the nervous system, suggesting likely redundant FruM-expressing neuronal pathways capable of conferring male fertility. From associations between the screened behaviors, we propose a functional model for courtship initiation. PMID:21705753

  4. Application of 2-Aminothiazoline-4-carboxylic Acid as a Forensic Marker of Cyanide Exposure.

    PubMed

    Rużycka, Monika; Giebułtowicz, Joanna; Fudalej, Marcin; Krajewski, Paweł; Wroczyński, Piotr

    2017-02-20

    Cyanides are infamous for their highly poisonous properties. Accidental cyanide poisoning occurs frequently, but occasionally, intentional poisonings also occur. Inhalation of fumes generated by fire may also cause cyanide poisoning. There are many limitations in direct analysis of cyanide. 2-Aminothiazoline-4-carboxylic acid (ATCA), a cyanide metabolite, seems to be the only surrogate that is being used in the detection of cyanide because of its stability and its cyanide-dependent quality in a biological matrix. Unfortunately, toxicokinetic studies on diverse animal models suggest significant interspecies differences; therefore, the attempt to extrapolate animal models to human models may be unsuccessful. The aim of the present study was to evaluate the use of ATCA as a forensic marker of cyanide exposure. For this purpose, post-mortem materials (blood and organs) from fire victims (n = 32) and cyanide-poisoned persons (n = 3) were collected. The distribution of ATCA in organs and its thermal stability were evaluated. The variability of cyanides in a putrid sample and in the context of their long-term and higher temperature stability was established. The presence of ATCA was detected by using an LC-MS/MS method and that of cyanide was detected spectrofluorimetrically. This is the first report on the endogenous ATCA concentrations and the determination of ATCA distribution in tissues of fire victims and cyanide-poisoned persons. It was found that blood and heart had the highest ATCA concentrations. ATCA was observed to be thermally stable even at 90 °C. Even though the cyanide concentration was not elevated in putrid samples, it was unstable during long-term storage and at higher temperature, as expected. The relationship between ATCA and cyanides was also observed. Higher ATCA concentrations were related to increased levels of cyanide in blood and organs (less prominent). ATCA seems to be a reliable forensic marker of exposure to lethal doses of cyanide.

  5. Simultaneous quantification of twenty Amadori products in soy sauce using liquid chromatography-tandem mass spectrometry.

    PubMed

    Katayama, Hiroshi; Tatemichi, Yuki; Nakajima, Ayako

    2017-08-01

    A liquid chromatography-tandem mass spectrometry method using a pentafluorophenylpropyl-bonded silica column was developed to simultaneously quantify twenty Amadori products (APs), including N-(1-Deoxy-d-fructosyl-1-yl)-l-isoleucine (Fru-Ile) and N-(1-Deoxy-d-fructosyl-1-yl)-l-leucine (Fru-Leu), in soy sauce, without the need for an ion-pairing reagent or sample derivatization. The method was applied to six types of soy sauce, to determine the total AP levels and the levels of individual APs. The level of total APs widely varied between the eight samples, from 358mg/L to 24347mg/L. The concentrations of N-ε-(1-deoxy-d-fructosyl-1-yl)-l-lysine (Fru-Lys) and N-(1-deoxy-d-fructosyl-1-yl)-l-pyroglutamic acid (Fru-pGlu) were the highest among the APs and the level of Fru-pGlu was similar to that of Fru-Lys. Furthermore, fermentation periods of up to six months greatly influenced AP levels in soy sauce but the levels remained constant thereafter. Thermal treatment of soy sauce had little effect on AP levels. Copyright © 2017. Published by Elsevier Ltd.

  6. Interaction of tomato lycopene and ketosamine against rat prostate tumorigenesis.

    PubMed

    Mossine, Valeri V; Chopra, Pankaj; Mawhinney, Thomas P

    2008-06-01

    Prior investigations on the beneficial effect of dietary processed tomato products and lycopene on prostate cancer risk suggested that lycopene may require the presence of other constituents to exert its chemopreventive potential. We investigated whether ketosamines, a group of carbohydrate derivatives present in dehydrated tomato products, may interact with lycopene against prostate tumorigenesis. One ketosamine, FruHis, strongly synergized with lycopene against proliferation of the highly metastatic rat prostate adenocarcinoma MAT-LyLu cell line in vitro. The FruHis/lycopene combination significantly inhibited in vivo tumor formation by MAT-LyLu cells in syngeneic Copenhagen rats. Energy-balanced diets, supplemented with tomato paste, tomato powder, or tomato paste plus FruHis, were fed to Wistar-Unilever rats (n = 20 per group) treated with N-nitroso-N-methylurea and testosterone to induce prostate carcinogenesis. Survival from carcinogenesis was lowest in the control group (median survival time, 40 weeks) and highest in the group fed the tomato paste/FruHis diet (51 weeks; P = 0.004, versus control). The proportions of dying rats with macroscopic prostate tumors in the control, tomato paste, tomato powder, and tomato paste/FruHis groups were 63% (12 of 19), 39% (5 of 13), 43% (6 of 14), and 18% (2 of 11), respectively. FruHis completely blocked DNA oxidative degradation at >250 micromol/L in vitro, whereas neither ascorbate nor phenolic antioxidants from tomato were effective protectors in this assay. FruHis, therefore, may exert tumor-preventive effect through its antioxidant activity and interaction with lycopene.

  7. ATCA/muTCA for Physics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jezynski, Tomasz; /DESY; Larsen, Raymond

    ATCA/{mu}TCA platforms are attractive because of the modern serial link architecture, high availability features and many packaging options. Less-demanding availability applications can be met economically by scaling back speed and redundancy. The ATCA specification was originally targeted for the Telecom industry but has gained recently a much wider user audience. The purpose of this paper is to report on present hardware and software R and D efforts where ATCA and {mu}TCA are planned, already being used or in development using selected examples for accelerator and detectors in the Physics community. It will present also the status of a proposal formore » physics extensions to ATCA/{mu}TCA specifications to promote inter-operability of laboratory and industry designs for physics.« less

  8. Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

    PubMed Central

    Yoder-Himes, Deborah R.; Kroos, Lee

    2006-01-01

    The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

  9. An homolog of the Frz Phosphoenolpyruvate:carbohydrate phosphoTransferase System of extraintestinal pathogenic Escherichia coli is encoded on a genomic island in specific lineages of Streptococcus agalactiae.

    PubMed

    Patron, Kévin; Gilot, Philippe; Camiade, Emilie; Mereghetti, Laurent

    2015-06-01

    We identified a Streptococcus agalactiae metabolic region (fru2) coding for a Phosphoenolpyruvate:carbohydrate phosphoTransferase System (PTS) homologous to the Frz system of extraintestinal pathogenic Escherichia coli strains. The Frz system is involved in environmental sensing and regulation of the expression of adaptation and virulence genes in E. coli. The S. agalactiae fru2 region codes three subunits of a PTS transporter of the fructose-mannitol family, a transcriptional activator of PTSs of the MtlR family, an allulose-6 phosphate-3-epimerase, a transaldolase and a transketolase. We demonstrated that all these genes form an operon. The fru2 operon is present in a 17494-bp genomic island. We analyzed by multilocus sequence typing a population of 492 strains representative of the S. agalactiae population and we showed that the presence of the fru2 operon is linked to the phylogeny of S. agalactiae. The fru2 operon is always present within strains of clonal complexes CC 1, CC 7, CC 10, CC 283 and singletons ST 130 and ST 288, but never found in other CCs and STs. Our results indicate that the fru2 operon was acquired during the evolution of the S. agalactiae species from a common ancestor before the divergence of CC 1, CC 7, CC 10, CC 283, ST 130 and ST 288. As S. agalactiae strains of CC 1 and CC 10 are frequently isolated from adults with invasive disease, we hypothesize that the S. agalactiae Fru2 system senses the environment to allow the bacterium to adapt to new conditions encountered during the infection of adults. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Risk Decision Making Model for Reservoir Floodwater resources Utilization

    NASA Astrophysics Data System (ADS)

    Huang, X.

    2017-12-01

    Floodwater resources utilization(FRU) can alleviate the shortage of water resources, but there are risks. In order to safely and efficiently utilize the floodwater resources, it is necessary to study the risk of reservoir FRU. In this paper, the risk rate of exceeding the design flood water level and the risk rate of exceeding safety discharge are estimated. Based on the principle of the minimum risk and the maximum benefit of FRU, a multi-objective risk decision making model for FRU is constructed. Probability theory and mathematical statistics method is selected to calculate the risk rate; C-D production function method and emergy analysis method is selected to calculate the risk benefit; the risk loss is related to flood inundation area and unit area loss; the multi-objective decision making problem of the model is solved by the constraint method. Taking the Shilianghe reservoir in Jiangsu Province as an example, the optimal equilibrium solution of FRU of the Shilianghe reservoir is found by using the risk decision making model, and the validity and applicability of the model are verified.

  11. Inhibiting effects of fructanase on competence-stimulating peptide-dependent quorum sensing system in Streptococcus mutans.

    PubMed

    Suzuki, Yusuke; Nagasawa, Ryo; Senpuku, Hidenobu

    2017-09-01

    Streptococcus mutans produces glucosyltransferases encoded by the gtfB and gtfC genes, which synthesize insoluble glucan, and both insoluble and soluble glucans by conversion of sucrose, and are known as principal agents to provide strong biofilm formation and demineralization on tooth surfaces. S. mutans possess a Com-dependent quorum sensing (QS) system, which is important for survival in severe conditions. The QS system is stimulated by the interaction between ComD {Receptor to competence-stimulating peptide (CSP)} encoded by the comD and CSP encoded by the comC, and importantly associated with bacteriocin production and genetic competence. Previously, we found enzyme fructanase (FruA) as a new inhibitor for the glucan-dependent biofilm formation. In the present study, inhibiting effects by FruA on glucan-independent biofilm formation of S. mutans UA159, UA159.gtfB - , UA159.gtfC - , and UA159.gtfBC - were observed in sucrose and no sucrose sugars-supplemented conditions using the plate assay. The reduction of UA159.comC - and UA159.comD - biofilm formation were also observed as compared with UA159 in same conditions. These results suggested that inhibitions of glucan-independent and Com-dependent biofilm formation were involved in the inhibiting mechanism by FruA. To more thoroughly investigate effects by FruA on the QS system, we examined on CSP-stimulated and Com-dependent bacteriocin production and genetic transformation. FruA inhibited bacteriocin production in collaboration with CSP and genetic transformation in bacterial cell conditions treated with FruA. Our findings show that FruA has multiple effects that inhibit survival functions of S. mutans, including biofilm formation and CSP-dependent QS responses, indicating its potential use as an agent for prevention of dental caries. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. Functional analysis of fructosyl-amino acid oxidases of Aspergillus oryzae.

    PubMed

    Akazawa, Shin-Ichi; Karino, Tetsuya; Yoshida, Nobuyuki; Katsuragi, Tohoru; Tani, Yoshiki

    2004-10-01

    Three active fractions of fructosyl-amino acid oxidase (FAOD-Ao1, -Ao2a, and -Ao2b) were isolated from Aspergillus oryzae strain RIB40. N-terminal and internal amino acid sequences of FAOD-Ao2a corresponded to those of FAOD-Ao2b, suggesting that these two isozymes were derived from the same protein. FAOD-Ao1 and -Ao2 were different in substrate specificity and subunit assembly; FAOD-Ao2 was active toward N(epsilon)-fructosyl N(alpha)-Z-lysine and fructosyl valine (Fru-Val), whereas FAOD-Ao1 was not active toward Fru-Val. The genes encoding the FAOD isozymes (i.e., FAOAo1 and FAOAo2) were cloned by PCR with an FAOD-specific primer set. The deduced amino acid sequences revealed that FAOD-Ao1 was 50% identical to FAOD-Ao2, and each isozyme had a peroxisome-targeting signal-1, indicating their localization in peroxisomes. The genes was expressed in Escherichia coli and rFaoAo2 showed the same characteristics as FAOD-Ao2, whereas rFaoAo1 was not active. FAOAo2 disruptant was obtained by using ptrA as a selective marker. Wild-type strain grew on the medium containing Fru-Val as the sole carbon and nitrogen sources, but strain Delta faoAo2 did not grow. Addition of glucose or (NH(4))(2)SO(4) to the Fru-Val medium did not affect the assimilation of Fru-Val by wild-type, indicating glucose and ammonium repressions did not occur in the expression of the FAOAo2 gene. Furthermore, conidia of the wild-type strain did not germinate on the medium containing Fru-Val and NaNO(2) as the sole carbon and nitrogen sources, respectively, suggesting that Fru-Val may also repress gene expression of nitrite reductase. These results indicated that FAOD is needed for utilization of fructosyl-amino acids as nitrogen sources in A. oryzae.

  13. Jejunal Infusion of Glucose Decreases Energy Intake to a Greater Extent than Fructose in Adult Male Rats12

    PubMed Central

    Moghadam, Alexander A; Moran, Timothy H; Dailey, Megan J

    2016-01-01

    Background: Intestinal nutrient infusions result in variable decreases in energy intake and body weight based on nutrient type and specific intestinal infusion site. Objective: The objective was to test whether an intrajejunal fructose infusion (FRU) would lower energy intake and body weight and induce similar increases in gut hormones as those found after intrajejunal glucose infusions (GLU). Methods: Male Sprague-Dawley rats received an intrajejunal infusion of either an equal kilocalorie load of glucose or fructose (11.4 kcal) or saline (SAL) for 5 d while intake of a standard rodent diet was continuously recorded; body weight was measured daily. Immediately after the infusion on the final day, rats were killed and plasma was collected to measure hormones. Results: Daily energy intake was significantly lower in the GLU group than in the SAL group, but the FRU group did not differ from the GLU or SAL groups when the 11.4 kcal of the infusate was included as energy intake. Lower energy intake was due to smaller meal sizes during the infusion period in the GLU group than in the FRU and SAL groups; the FRU and SAL groups did not differ. The percentage of change in body weight was lower in the GLU group than in the FRU and SAL groups. Plasma glucagon-like-peptide 1 (GLP-1) concentrations were greater in the GLU group than in the SAL group; the FRU group did not differ from the GLU or SAL groups. The plasma insulin concentration was greater in the FRU group than in both the GLU and SAL groups. Conclusion: These results demonstrate that glucose induces a greater decrease in energy intake and increase in GLP-1 at distal intestinal sites than fructose in rats, which may explain differential effects of these monosaccharides between studies when delivered orally or along the proximal to distal axis of the intestine. PMID:27581579

  14. Acute ethanol responses in Drosophila are sexually dimorphic

    PubMed Central

    Devineni, Anita V.; Heberlein, Ulrike

    2012-01-01

    In mammalian and insect models of ethanol intoxication, low doses of ethanol stimulate locomotor activity whereas high doses induce sedation. Sex differences in acute ethanol responses, which occur in humans, have not been characterized in Drosophila. In this study, we find that male flies show increased ethanol hyperactivity and greater resistance to ethanol sedation compared with females. We show that the sex determination gene transformer (tra) acts in the developing nervous system, likely through regulation of fruitless (fru), to at least partially mediate the sexual dimorphism in ethanol sedation. Although pharmacokinetic differences may contribute to the increased sedation sensitivity of females, neuronal tra expression regulates ethanol sedation independently of ethanol pharmacokinetics. We also show that acute activation of fru-expressing neurons affects ethanol sedation, further supporting a role for fru in regulating this behavior. Thus, we have characterized previously undescribed sex differences in behavioral responses to ethanol, and implicated fru in mediating a subset of these differences. PMID:23213244

  15. Recent developments for the upgrade of the LHCb readout system

    NASA Astrophysics Data System (ADS)

    Cachemiche, J. P.; Y Duval, P.; Hachon, F.; Le Gac, R.; Réthoré, F.

    2013-02-01

    The upgraded LHCb readout system aims at a trigger-free readout of the entire detector at the bunch-crossing rate. This implies a major architectural change for the readout system that must capture the data at 40 MHz instead of 1 MHz. One of the key components of this upgrade system is the readout board. The LHCb collaboration has chosen to evaluate the ATCA architecture as form-factor for the readout board. The readout system architecture relies on a unique board able to satisfy all the requirements for data transmission, timing and fast control as well as experiment control system. A generic ATCA carrier board has been developped. It is equipped with four dense AMC mezzanines able to interface a total of 144 bidirectional optical links at up to 10 Gbits/s. This board embeds 4 high end Stratix V GX devices for data processing and a programmable set of commutation functions allowing to reconfigure the connectivity of the system in a flexible way. The overall architecture will be presented and how the cards map over each functionality. First results and measurements will be described in particular those related to the use of new highly integrated optical devices. At last we will present the incremental development methodology used in this project.

  16. Akt-dependent Activation of the Heart 6-Phosphofructo-2-kinase/Fructose-2,6-bisphosphatase (PFKFB2) Isoenzyme by Amino Acids*

    PubMed Central

    Novellasdemunt, Laura; Tato, Irantzu; Navarro-Sabate, Aurea; Ruiz-Meana, Marisol; Méndez-Lucas, Andrés; Perales, Jose Carlos; Garcia-Dorado, David; Ventura, Francesc; Bartrons, Ramon; Rosa, Jose Luis

    2013-01-01

    Reciprocal regulation of metabolism and signaling allows cells to modulate their activity in accordance with their metabolic resources. Thus, amino acids could activate signal transduction pathways that control cell metabolism. To test this hypothesis, we analyzed the effect of amino acids on fructose-2,6-bisphosphate (Fru-2,6-P2) metabolism. We demonstrate that amino acids increase Fru-2,6-P2 concentration in HeLa and in MCF7 human cells. In conjunction with this, 6-phosphofructo-2-kinase activity, glucose uptake, and lactate concentration were increased. These data correlate with the specific phosphorylation of heart 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase (PFKFB2) isoenzyme at Ser-483. This activation was mediated by the PI3K and p38 signaling pathways. Furthermore, Akt inactivation blocked PFKFB2 phosphorylation and Fru-2,6-P2 production, thereby suggesting that the above signaling pathways converge at Akt kinase. In accordance with these results, kinase assays showed that amino acid-activated Akt phosphorylated PFKFB2 at Ser-483 and that knockdown experiments confirmed that the increase in Fru-2,6-P2 concentration induced by amino acids was due to PFKFB2. In addition, similar effects on Fru-2,6-P2 metabolism were observed in freshly isolated rat cardiomyocytes treated with amino acids, which indicates that these effects are not restricted to human cancer cells. In these cardiomyocytes, the glucose consumption and the production of lactate and ATP suggest an increase of glycolytic flux. Taken together, these results demonstrate that amino acids stimulate Fru-2,6-P2 synthesis by Akt-dependent PFKFB2 phosphorylation and activation and show how signaling and metabolism are inextricably linked. PMID:23457334

  17. Identification of octopaminergic neurons that modulate sleep suppression by male sex drive

    PubMed Central

    Machado, Daniel R; Afonso, Dinis JS; Kenny, Alexandra R; Öztürk-Çolak, Arzu; Moscato, Emilia H; Mainwaring, Benjamin; Kayser, Matthew; Koh, Kyunghee

    2017-01-01

    Molecular and circuit mechanisms for balancing competing drives are not well understood. While circadian and homeostatic mechanisms generally ensure sufficient sleep at night, other pressing needs can overcome sleep drive. Here, we demonstrate that the balance between sleep and sex drives determines whether male flies sleep or court, and identify a subset of octopaminergic neurons (MS1) that regulate sleep specifically in males. When MS1 neurons are activated, isolated males sleep less, and when MS1 neurons are silenced, the normal male sleep suppression in female presence is attenuated and mating behavior is impaired. MS1 neurons do not express the sexually dimorphic FRUITLESS (FRU) transcription factor, but form male-specific contacts with FRU-expressing neurons; calcium imaging experiments reveal bidirectional functional connectivity between MS1 and FRU neurons. We propose octopaminergic MS1 neurons interact with the FRU network to mediate sleep suppression by male sex drive. DOI: http://dx.doi.org/10.7554/eLife.23130.001 PMID:28510528

  18. Prevention of anemia alleviates heart hypertrophy in copper deficient rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lure, M.D.; Fields, M.; Lewis, C.G.

    1991-03-11

    The present investigation was designed to examine the role of anemia in the cardiomegaly and myocardial pathology of copper deficiency. Weanling rats were fed a copper deficient diet containing either starch (ST) or fructose (FRU) for five weeks. Six rats consuming the FRU diet were intraperitoneally injected once a week with 1.0 ml/100g bw of packed red blood cells (RBC) obtained from copper deficient rats fed ST. FRU rats injected with RBC did not develop anemia. Additionally, none of the injected rats exhibited heart hypertrophy or gross pathology and all survived. In contrast, non-injected FRU rats were anemic, exhibited severemore » signs of copper deficiency which include heart hypertrophy with gross pathology, and 44% died. Maintaining the hematocrit with RBC injections resulted in normal heart histology and prevented the mortality associated with the fructose x copper interaction. The finding suggest that the anemia associated with copper deficiency contributes to heart pathology.« less

  19. ATCA for Machines-- Advanced Telecommunications Computing Architecture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Larsen, R.S.; /SLAC

    2008-04-22

    The Advanced Telecommunications Computing Architecture is a new industry open standard for electronics instrument modules and shelves being evaluated for the International Linear Collider (ILC). It is the first industrial standard designed for High Availability (HA). ILC availability simulations have shown clearly that the capabilities of ATCA are needed in order to achieve acceptable integrated luminosity. The ATCA architecture looks attractive for beam instruments and detector applications as well. This paper provides an overview of ongoing R&D including application of HA principles to power electronics systems.

  20. High-Fructose Intake Impairs the Hepatic Hypolipidemic Effects of a High-Fat Fish-Oil Diet in C57BL/6 Mice.

    PubMed

    Wooten, Joshua S; Nick, Tayler N; Seija, Andrew; Poole, Kaylee E; Stout, Kelsey B

    2016-12-01

    Overnutrition of saturated fats and fructose is one of the major factors for the development of nonalcoholic fatty liver disease. Because omega-3 polyunsaturated fatty acids (n-3fa) have established lipid lowering properties, we tested the hypothesis that n-3fa prevents high-fat and fructose-induced fatty liver disease in mice. Male C57BL/6J mice were randomly assigned to one of the following diet groups for 14 weeks: normal diet (ND), high-fat lard-based diet (HFD), HFD with fructose (HFD + Fru), high-fat fish-oil diet (FOD), or FOD + Fru. Despite for the development of obesity and insulin resistance, FOD had 65.3% lower ( P  < 0.001) hepatic triglyceride levels than HFD + Fru, which was blunted to a 38.5% difference ( P  = 0.173) in FOD + Fru. The lower hepatic triglyceride levels were associated with a lower expression of lipogenic genes LXRα and FASN, as well as the expression of genes associated with fatty acid uptake and triglyceride synthesis, CD36 and SCD1, respectively. Conversely, the blunted hypotriglyceride effect of FOD + Fru was associated with a higher expression of CD36 and SCD1. During overnutrition, a diet rich in n-3fa may prevent the severity of hepatic steatosis; however, when juxtaposed with a diet high in fructose, the deleterious effects of overnutrition blunted the hypolipidemic effects of n-3fa.

  1. Supplementation of glycerol or fructose via drinking water to grazing lambs on tissue glycogen level and lipogenesis.

    PubMed

    Volpi-Lagreca, G; Duckett, S K

    2017-06-01

    Lambs ( = 18; 40.1 ± 7.4 kg BW) were used to assess supplementation of glycerol or fructose via drinking water on growth, tissue glycogen levels, postmortem glycolysis, and lipogenesis. Lambs were blocked by BW and allocated to alfalfa paddocks (2 lambs/paddock and 3 paddocks/treatment). Each paddock within a block was assigned randomly to drinking water treatments for 30 d: 1) control (CON), 2) 120 g fructose/L of drinking water (FRU), or 3) 120 g glycerol/L of drinking water (GLY). Lambs grazed alfalfa with free access to water treatments for 28 d and then were fasted in indoor pens for a final 2 d with access to only water treatments. Data were analyzed using the MIXED procedure of SAS with water treatment and time (when appropriate) in the model. During the 28-d grazing period, ADG was greater ( < 0.05) for GLY than for CON or FRU. During the 2-d fasting period, BW shrink was lower ( < 0.05) for GLY compared with CON or FRU. Hot carcass weight was greater ( < 0.05) for GLY than for FRU. The interaction for glycogen content × postmortem time was significant ( = 0.003) in LM and semitendinosus (ST) muscles. Glycogen content in the LM was greater ( < 0.05) for GLY at 2 and 3 h and for FRU at 1 h postmortem compared with CON. Glycogen content in ST did not differ between treatments ( > 0.05). Liver glycogen content was over 14-fold greater ( < 0.05) for GLY compared with FRU or CON. Liver free glucose was greater ( < 0.05) for GLY than for CON, whereas liver lipid content was higher ( < 0.05) for CON than for GLY. Supplementation with GLY increased ( < 0.05) odd-chain fatty acids in LM, subcutaneous fat (SQ), and the liver. Stearic acid (C18:0) concentrations were reduced in LM ( = 0.064) and subcutaneous adipose tissue (SQ; = 0.018), whereas oleic acid (C18:1 -9) concentration tended to be increased ( = 0.066) in SQ with FRU and GLY. Linolenic acid (C18:3 -3) was reduced ( = 0.031) and all long-chain -3 fatty acid (eicosapentaenoic acid, docosapentaenoic acid, and docosahexaenoic acid) concentrations were increased ( < 0.05) with FRU and GLY compared with CON. Glycerol supplementation upregulated ( < 0.05) stearoyl-CoA desaturate () and fatty acid synthase () mRNA by over 40-fold in the SQ and 5-fold in the liver. Glycerol supplementation also upregulated ( < 0.05) glucose transporters and glycogen branching enzyme in the liver. Overall, glycerol supplementation improved growth, reduced BW shrink during fasting, increased glycogen content in muscle and the liver, and stimulated de novo lipogenesis.

  2. Design of an AdvancedTCA board management controller (IPMC)

    NASA Astrophysics Data System (ADS)

    Mendez, J.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.

    2017-03-01

    The AdvancedTCA (ATCA) standard has been selected as the hardware platform for the upgrade of the back-end electronics of the CMS and ATLAS experiments of the Large Hadron Collider (LHC) . In this context, the electronic systems for experiments group at CERN is running a project to evaluate, specify, design and support xTCA equipment. As part of this project, an Intelligent Platform Management Controller (IPMC) for ATCA blades, based on a commercial solution, has been designed to be used on existing and future ATCA blades. This paper reports on the status of this project presenting the hardware and software developments.

  3. Sulfonation and anticoagulant activity of botryosphaeran from Botryosphaeria rhodina MAMB-05 grown on fructose.

    PubMed

    Mendes, Simone Ferreira; dos Santos, Osvaldo; Barbosa, Aneli M; Vasconcelos, Ana Flora D; Aranda-Selverio, Gabriel; Monteiro, Nilson K; Dekker, Robert F H; Sá Pereira, Mariana; Tovar, Ana Maria F; Mourão, Paulo A de Souza; da Silva, Maria de Lourdes Corradi

    2009-10-01

    Botryosphaeran (EPS(FRU)), an exopolysaccharide of the beta-(1-->3,1-->6)-d-glucan type with 31% branching at C-6, is produced by the fungus Botryosphaeria rhodina MAMB-05 when grown on fructose as carbon source. Botryosphaeran was derivatized by sulfonation to induce anticoagulant activity. The effectiveness of the sulfonation reaction by chlorosulfonic acid in pyridine was monitored by the degree of substitution and FT-IR analysis of the sulfonated EPS(FRU) (once sulfonated, EPS(FRUSULF); and re-sulfonated, EPS(FRURESULF)). Activated partial thromboplastin time (APTT) and thrombin time (TT) tests of EPS(FRURESULF) indicated significant in vitro anticoagulant activity that was dose-dependent. EPS(FRU) did not inhibit any of the coagulation tests.

  4. Advanced composite fuselage technology

    NASA Technical Reports Server (NTRS)

    Ilcewicz, Larry B.; Smith, Peter J.; Horton, Ray E.

    1993-01-01

    Boeing's ATCAS program has completed its third year and continues to progress towards a goal to demonstrate composite fuselage technology with cost and weight advantages over aluminum. Work on this program is performed by an integrated team that includes several groups within The Boeing Company, industrial and university subcontractors, and technical support from NASA. During the course of the program, the ATCAS team has continued to perform a critical review of composite developments by recognizing advances in metal fuselage technology. Despite recent material, structural design, and manufacturing advancements for metals, polymeric matrix composite designs studied in ATCAS still project significant cost and weight advantages for future applications. A critical path to demonstrating technology readiness for composite transport fuselage structures was created to summarize ATCAS tasks for Phases A, B, and C. This includes a global schedule and list of technical issues which will be addressed throughout the course of studies. Work performed in ATCAS since the last ACT conference is also summarized. Most activities relate to crown quadrant manufacturing scaleup and performance verification. The former was highlighted by fabricating a curved, 7 ft. by 10 ft. panel, with cocured hat-stiffeners and cobonded J-frames. In building to this scale, process developments were achieved for tow-placed skins, drape formed stiffeners, braided/RTM frames, and panel cure tooling. Over 700 tests and supporting analyses have been performed for crown material and design evaluation, including structural tests that demonstrated limit load requirements for severed stiffener/skin failsafe damage conditions. Analysis of tests for tow-placed hybrid laminates with large damage indicates a tensile fracture toughness that is higher than that observed for advanced aluminum alloys. Additional recent ATCAS achievements include crown supporting technology, keel quadrant design evaluation, and sandwich process development.

  5. Functional analysis of fruitless gene expression by transgenic manipulations of Drosophila courtship

    PubMed Central

    Villella, Adriana; Ferri, Sarah L.; Krystal, Jonathan D.; Hall, Jeffrey C.

    2005-01-01

    A gal4-containing enhancer–trap called C309 was previously shown to cause subnormal courtship of Drosophila males toward females and courtship among males when driving a conditional disrupter of synaptic transmission (shiTS). We extended these manipulations to analyze all features of male-specific behavior, including courtship song, which was almost eliminated by driving shiTS at high temperature. In the context of singing defects and homosexual courtship affected by mutations in the fru gene, a tra-regulated component of the sex-determination hierarchy, we found a C309/traF combination also to induce high levels of courtship between pairs of males and “chaining” behavior in groups; however, these doubly transgenic males sang normally. Because production of male-specific FRUM protein is regulated by TRA, we hypothesized that a fru-derived transgene encoding the male (M) form of an Inhibitory RNA (fruMIR) would mimic the effects of traF; but C309/fruMIR males exhibited no courtship chaining, although they courted other males in single-pair tests. Double-labeling of neurons in which GFP was driven by C309 revealed that 10 of the 20 CNS clusters containing FRUM in wild-type males included coexpressing neurons. Histological analysis of the developing CNS could not rationalize the absence of traF or fruMIR effects on courtship song, because we found C309 to be coexpressed with FRUM within the same 10 neuronal clusters in pupae. Thus, we hypothesize that elimination of singing behavior by the C309/shiTS combination involves neurons acting downstream of FRUM cells PMID:16179386

  6. The Tug-of-War between Cash Flow and Institutional Values in a College-Seminary Merger

    ERIC Educational Resources Information Center

    Osland, Asbjorn; Ankeny, Mark

    2007-01-01

    This case study documents the merger of a liberal arts college and a seminary, with particular attention to fiscal aspects of the venture. The interaction of Friends Regional University (FRU) with its seminary offers important theoretical lessons because of the interplay of three factors: 1) FRU has a strong institutional context based on the…

  7. The pH dependence of the allosteric response of human liver pyruvate kinase to fructose-1,6-bisphosphate, ATP, and alanine

    PubMed Central

    Fenton, Aron W.; Hutchinson, Myra

    2009-01-01

    The allosteric regulation of human liver pyruvate kinase (hL-PYK) by fructose-1,6-bisphosphate (Fru-1,6-BP; activator), ATP (inhibitor) and alanine (Ala; inhibitor) was monitored over a pH range from 6.5 to 8.0 at 37°C. As a function of increasing pH, hL-PYK's affinity for the substrate phosphoenolpyruvate (PEP), and for Fru-1,6-BP decreases, while affinities for ATP and Ala slightly increases. At pH 6.5, Fru-1,6-BP and ATP elicit only small allosteric impacts on PEP affinity. As pH increases, Fru-1,6-BP and ATP elicit greater allosteric responses, but the response to Ala is relatively constant. Since the magnitudes of the allosteric coupling for ATP and for Ala inhibition are different and the pH dependences of these magnitudes are not similar, these inhibitors likely elicit their responses using different molecular mechanisms. In addition, our results fail to support a general correlation between pH dependent changes in effector affinity and pH dependent changes in the corresponding allosteric response. PMID:19467627

  8. ATCA-based ATLAS FTK input interface system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okumura, Yasuyuki; Liu, Tiehui Ted; Olsen, Jamieson

    The first stage of the ATLAS Fast TracKer (FTK) is an ATCA-based input interface system, where hits from the entire silicon tracker are clustered and organized into overlapping eta-phi trigger towers before being sent to the tracking engines. First, FTK Input Mezzanine cards receive hit data and perform clustering to reduce data volume. Then, the ATCA-based Data Formatter system will organize the trigger tower data, sharing data among boards over full mesh backplanes and optic fibers. The board and system level design concepts and implementation details, as well as the operation experiences from the FTK full-chain testing, will be presented.

  9. Dinuclear copper(II) complexes with {Cu2(mu-hydroxo)bis(mu-carboxylato)}+ cores and their reactions with sugar phosphate esters: A substrate binding model of fructose-1,6-bisphosphatase.

    PubMed

    Kato, Merii; Tanase, Tomoaki; Mikuriya, Masahiro

    2006-04-03

    Reactions of CuX2.nH2O with the biscarboxylate ligand XDK (H2XDK = m-xylenediamine bis(Kemp's triacid imide)) in the presence of N-donor auxiliary ligands yielded a series of dicopper(II) complexes, [Cu2(mu-OH)(XDK)(L)2]X (L = N,N,N',N'-tetramethylethylenediamine (tetmen), X = NO3 (1a), Cl (1b); L = N,N,N'-trimethylethylenediamine (tmen), X = NO3 (2a), Cl (2b); L =2,2'-bipyridine (bpy), X = NO3 (3); L = 1,10-phenanthroline (phen), X = NO3 (4); L = 4,4'-dimethyl-2,2'-bipyridine (Me2bpy), X = NO3 (5); L = 4-methyl-1,10-phenanthroline (Mephen), X = NO3 (6)). Complexes 1-6 were characterized by X-ray crystallography (Cu...Cu = 3.1624(6)-3.2910(4) A), and the electrochemical and magnetic properties were also examined. Complexes 3 and 4 readily reacted with diphenyl phosphoric acid (HDPP) or bis(4-nitrophenyl) phosphoric acid (HBNPP) to give [Cu2(mu-phosphate)(XDK)(L)2]NO3 (L = bpy, phosphate = DPP (11); L = phen, phosphate = DPP (12), BNPP (13)), where the phsophate diester bridges the two copper ions in a mu-1,3-O,O' bidentate fashion (Cu...Cu = 4.268(3)-4.315(1) A). Complexes 4 and 6 with phen and Mephen have proven to be good precursors to accommodate a series of sugar monophosphate esters (Sugar-P) onto the biscarboxylate-bridged dicopper centers, yielding [Cu2(mu-Sugar-P)(XDK)(L)2] (Sugar-P = alpha-D-Glc-1-P (23a and b), D-Glc-6-P (24a and b), D-Man-6-P (25a), D-Fru-6-P (26a and b); L = phen (a), Mephen (b)) and [Cu2(mu-Gly-n-P)(XDK)(Mephen)2] (Gly-n-P = glycerol n-phosphate; n = 2 (21), 3 (22)), where Glc, Man, and Fru are glucose, mannose, and fructose, respectively. The structure of [Cu2(mu-MNPP)(XDK)(phen)2(CH3OH)] (20) was characterized as a reference compound (H2MNPP = 4-nitrophenyl phosphoric acid). Complexes 4 and 6 also reacted with d-fructose 1,6-bisphosphate (D-Fru-1,6-P2) to afford the tetranuclear copper(II) complexes formulated as [Cu4(mu-D-Fru-1,6-P2)(XDK)2(L)4] (L = phen (27a), Mephen (27b)). The detailed structure of 27a was determined by X-ray crystallography to involve two different tetranuclear complexes with alpha- and beta-anomers of D-Fru-1,6-P2, [Cu4(mu-alpha-D-Fru-1,6-P2)(XDK)2(phen)4] and [Cu4(mu-beta-D-Fru-1,6-P2)(XDK)2(phen)4], in which the D-Fru-1,6-P2 tetravalent anion bridges the two [Cu2(XDK)(phen)2]2+ units through the C1 and C6 phosphate groups in a mu-1,3-O,O' bidentate fashion (Cu...Cu = 4.042(2)-4.100(2) A). Notably, the structure with alpha-D-Fru-1,6-P2 demonstrated the presence of a strong hydrogen bond between the C2 hydroxyl group and the C1 phosphate oxygen atom, which may support the previously proposed catalytic mechanism in the active site of fructose-1,6-bisphosphatase.

  10. Advanced technology commercial fuselage structure

    NASA Technical Reports Server (NTRS)

    Ilcewicz, L. B.; Smith, P. J.; Walker, T. H.; Johnson, R. W.

    1991-01-01

    Boeing's program for Advanced Technology Composite Aircraft Structure (ATCAS) has focused on the manufacturing and performance issues associated with a wide body commercial transport fuselage. The primary goal of ATCAS is to demonstrate cost and weight savings over a 1995 aluminum benchmark. A 31 foot section of fuselage directly behind the wing to body intersection was selected for study purposes. This paper summarizes ATCAS contract plans and review progress to date. The six year ATCAS program will study technical issues for crown, side, and keel areas of the fuselage. All structural details in these areas will be included in design studies that incorporate a design build team (DBT) approach. Manufacturing technologies will be developed for concepts deemed by the DBT to have the greatest potential for cost and weight savings. Assembly issues for large, stiff, quadrant panels will receive special attention. Supporting technologies and mechanical tests will concentrate on the major issues identified for fuselage. These include damage tolerance, pressure containment, splices, load redistribution, post-buckled structure, and durability/life. Progress to date includes DBT selection of baseline fuselage concepts; cost and weight comparisons for crown panel designs; initial panel fabrication for manufacturing and structural mechanics research; and toughened material studies related to keel panels. Initial ATCAS studies have shown that NASA's Advanced Composite Technology program goals for cost and weight savings are attainable for composite fuselage.

  11. ATCA digital controller hardware for vertical stabilization of plasmas in tokamaks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Batista, A. J. N.; Sousa, J.; Varandas, C. A. F.

    2006-10-15

    The efficient vertical stabilization (VS) of plasmas in tokamaks requires a fast reaction of the VS controller, for example, after detection of edge localized modes (ELM). For controlling the effects of very large ELMs a new digital control hardware, based on the Advanced Telecommunications Computing Architecture trade mark sign (ATCA), is being developed aiming to reduce the VS digital control loop cycle (down to an optimal value of 10 {mu}s) and improve the algorithm performance. The system has 1 ATCA trade mark sign processor module and up to 12 ATCA trade mark sign control modules, each one with 32 analogmore » input channels (12 bit resolution), 4 analog output channels (12 bit resolution), and 8 digital input/output channels. The Aurora trade mark sign and PCI Express trade mark sign communication protocols will be used for data transport, between modules, with expected latencies below 2 {mu}s. Control algorithms are implemented on a ix86 based processor with 6 Gflops and on field programmable gate arrays with 80 GMACS, interconnected by serial gigabit links in a full mesh topology.« less

  12. The genes and enzymes of sucrose metabolism in moderately thermophilic methanotroph Methylocaldum szegediense O12.

    PubMed

    But, Sergey Y; Solntseva, Natalia P; Egorova, Svetlana V; Mustakhimov, Ildar I; Khmelenina, Valentina N; Reshetnikov, Alexander; Trotsenko, Yuri A

    2018-05-01

    Four enzymes involved in sucrose metabolism: sucrose phosphate synthase (Sps), sucrose phosphate phosphatase (Spp), sucrose synthase (Sus) and fructokinase (FruK), were obtained as his-tagged proteins from the moderately thermophilic methanotroph Methylocaldum szegediense O12. Sps, Spp, FruK and Sus demonstrated biochemical properties similar to those of other bacterial counterparts, but the translated amino acid sequences of Sps and Spp displayed high divergence from the respective microbial enzymes. The Sus of M. szegediense O12 catalyzed the reversible reaction of sucrose cleavage in the presence of ADP or UDP and preferred ADP as a substrate, thus implying a connection between sucrose and glycogen metabolism. Sus-like genes were found only in a few methanotrophs, whereas amylosucrase was generally used in sucrose cleavage in this group of bacteria. Like other microbial fructokinases, FruK of M. szegediense O12 showed a high specificity to fructose.

  13. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  14. Constraining the excitation conditions of the molecular gas in the most distant submillimetre galaxy at z=4.76

    NASA Astrophysics Data System (ADS)

    Coppin, Kristen; Weiss, Axel; van der Werf, Paul; Menten, Karl; De Breuck, Carlos; Walter, Fabian; Loenen, Edo; Edge, Alastair; Emonts, Bjorn; Huynh, Minh; Swinbank, Mark; Smail, Ian; Schinnerer, Eva; Greve, Thomas; Chapman, Scott; Danielson, Alice; Knudsen, Kirsten; Dannerbauer, Helmut; Brandt, Niel; Berciano Alba, Alicia; Strom, Allison

    2010-10-01

    We propose to use ATCA to measure CO(5-4) emission in the currently highest redshift submm-selected galaxy (SMG) known: LESS J033229 at z=4.755. Combined with our previous successful ATCA observations of the CO(2-1) transition in this SMG, we will be able to start building up the CO SED excitation ladder and so gain new insight on the excitation conditions of the molecular gas which is fuelling a massive burst of star formation at a time when the Universe was only 1 Gyr old. ATCA is currently the only available facility that can provide these data, giving us a sneak-preview of the capabilities of ALMA for studying the youngest galaxies in the very distant Universe.

  15. Real-Time Processing System for the JET Hard X-Ray and Gamma-Ray Profile Monitor Enhancement

    NASA Astrophysics Data System (ADS)

    Fernandes, Ana M.; Pereira, Rita C.; Neto, André; Valcárcel, Daniel F.; Alves, Diogo; Sousa, Jorge; Carvalho, Bernardo B.; Kiptily, Vasily; Syme, Brian; Blanchard, Patrick; Murari, Andrea; Correia, Carlos M. B. A.; Varandas, Carlos A. F.; Gonçalves, Bruno

    2014-06-01

    The Joint European Torus (JET) is currently undertaking an enhancement program which includes tests of relevant diagnostics with real-time processing capabilities for the International Thermonuclear Experimental Reactor (ITER). Accordingly, a new real-time processing system was developed and installed at JET for the gamma-ray and hard X-ray profile monitor diagnostic. The new system is connected to 19 CsI(Tl) photodiodes in order to obtain the line-integrated profiles of the gamma-ray and hard X-ray emissions. Moreover, it was designed to overcome the former data acquisition (DAQ) limitations while exploiting the required real-time features. The new DAQ hardware, based on the Advanced Telecommunication Computer Architecture (ATCA) standard, includes reconfigurable digitizer modules with embedded field-programmable gate array (FPGA) devices capable of acquiring and simultaneously processing data in real-time from the 19 detectors. A suitable algorithm was developed and implemented in the FPGAs, which are able to deliver the corresponding energy of the acquired pulses. The processed data is sent periodically, during the discharge, through the JET real-time network and stored in the JET scientific databases at the end of the pulse. The interface between the ATCA digitizers, the JET control and data acquisition system (CODAS), and the JET real-time network is provided by the Multithreaded Application Real-Time executor (MARTe). The work developed allowed attaining two of the major milestones required by next fusion devices: the ability to process and simultaneously supply high volume data rates in real-time.

  16. Beneficial effects of calcitriol on hypertension, glucose intolerance, impairment of endothelium-dependent vascular relaxation, and visceral adiposity in fructose-fed hypertensive rats.

    PubMed

    Chou, Chu-Lin; Pang, Cheng-Yoong; Lee, Tony J F; Fang, Te-Chao

    2015-01-01

    Besides regulating calcium homeostasis, the effects of vitamin D on vascular tone and metabolic disturbances remain scarce in the literature despite an increase intake with high-fructose corn syrup worldwide. We investigated the effects of calcitriol, an active form of vitamin D, on vascular relaxation, glucose tolerance, and visceral fat pads in fructose-fed rats. Male Wistar-Kyoto rats were divided into 4 groups (n = 6 per group). Group Con: standard chow diet for 8 weeks; Group Fru: high-fructose diet (60% fructose) for 8 weeks; Group Fru-HVD: high-fructose diet as Group Fru, high-dose calcitriol treatment (20 ng / 100 g body weight per day) 4 weeks after the beginning of fructose feeding; and Group Fru-LVD: high-fructose diet as Group Fru, low-dose calcitriol treatment (10 ng / 100 g body weight per day) 4 weeks after the beginning of fructose feeding. Systolic blood pressure was measured twice a week by the tail-cuff method. Blood was examined for serum ionized calcium, phosphate, creatinine, glucose, triglycerides, and total cholesterol. Intra-peritoneal glucose intolerance test, aortic vascular reactivity, the weight of visceral fat pads, adipose size, and adipose angiotensin II levels were analyzed at the end of the study. The results showed that the fructose-fed rats significantly developed hypertension, impaired glucose tolerance, heavier weight and larger adipose size of visceral fat pads, and raised adipose angiotensin II expressions compared with the control rats. High- and low-dose calcitriol reduced modestly systolic blood pressure, increased endothelium-dependent aortic relaxation, ameliorated glucose intolerance, reduced the weight and adipose size of visceral fat pads, and lowered adipose angiotensin II expressions in the fructose-fed rats. However, high-dose calcitriol treatment mildly increased serum ionized calcium levels (1.44 ± 0.05 mmol/L). These results suggest a protective role of calcitriol treatment on endothelial function, glucose tolerance, and visceral adiposity in fructose-fed rats.

  17. Exercise performed immediately after fructose ingestion enhances fructose oxidation and suppresses fructose storage.

    PubMed

    Egli, Léonie; Lecoultre, Virgile; Cros, Jérémy; Rosset, Robin; Marques, Anne-Sophie; Schneiter, Philippe; Hodson, Leanne; Gabert, Laure; Laville, Martine; Tappy, Luc

    2016-02-01

    Exercise prevents the adverse effects of a high-fructose diet through mechanisms that remain unknown. We assessed the hypothesis that exercise prevents fructose-induced increases in very-low-density lipoprotein (VLDL) triglycerides by decreasing the fructose conversion into glucose and VLDL-triglyceride and fructose carbon storage into hepatic glycogen and lipids. Eight healthy men were studied on 3 occasions after 4 d consuming a weight-maintenance, high-fructose diet. On the fifth day, the men ingested an oral (13)C-labeled fructose load (0.75 g/kg), and their total fructose oxidation ((13)CO2 production), fructose storage (fructose ingestion minus (13)C-fructose oxidation), fructose conversion into blood (13)C glucose (gluconeogenesis from fructose), blood VLDL-(13)C palmitate (a marker of hepatic de novo lipogenesis), and lactate concentrations were monitored over 7 postprandial h. On one occasion, participants remained lying down throughout the experiment [fructose treatment alone with no exercise condition (NoEx)], and on the other 2 occasions, they performed a 60-min exercise either 75 min before fructose ingestion [exercise, then fructose condition (ExFru)] or 90 min after fructose ingestion [fructose, then exercise condition (FruEx)]. Fructose oxidation was significantly (P < 0.001) higher in the FruEx (80% ± 3% of ingested fructose) than in the ExFru (46% ± 1%) and NoEx (49% ± 1%). Consequently, fructose storage was lower in the FruEx than in the other 2 conditions (P < 0.001). Fructose conversion into blood (13)C glucose, VLDL-(13)C palmitate, and postprandial plasma lactate concentrations was not significantly different between conditions. Compared with sedentary conditions, exercise performed immediately after fructose ingestion increases fructose oxidation and decreases fructose storage. In contrast, exercise performed before fructose ingestion does not significantly alter fructose oxidation and storage. In both conditions, exercise did not abolish fructose conversion into glucose or its incorporation into VLDL triglycerides. This trial was registered at clinicaltrials.gov as NCT01866215. © 2016 American Society for Nutrition.

  18. Overexpression of ubiquitous 6-phosphofructo-2-kinase in the liver of transgenic mice results in weight gain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duran, Joan; Navarro-Sabate, Aurea; Pujol, Anna

    2008-01-11

    Fructose 2,6-bisphosphate (Fru-2,6-P{sub 2}) is an important metabolite that controls glycolytic and gluconeogenic pathways in several cell types. Its synthesis and degradation are catalyzed by the bifunctional enzyme 6-phosphofructo-2-kinase/fructose 2,6-bisphosphatase (PFK-2). Four genes, designated Pfkfb1-4, codify the different PFK-2 isozymes. The Pfkfb3 gene product, ubiquitous PFK-2 (uPFK-2), has the highest kinase/bisphosphatase activity ratio and is associated with proliferation and tumor metabolism. A transgenic mouse model that overexpresses uPFK-2 under the control of the phosphoenolpyruvate carboxykinase promoter was designed to promote sustained and elevated Fru-2,6-P{sub 2} levels in the liver. Our results demonstrate that in diet-induced obesity, high Fru-2,6-P{sub 2} levelsmore » in transgenic livers caused changes in hepatic gene expression profiles for key gluconeogenic and lipogenic enzymes, as well as an accumulation of lipids in periportal cells, and weight gain.« less

  19. 32 GHz Celestial Reference Frame Survey for Dec < -45 deg.

    NASA Astrophysics Data System (ADS)

    Horiuchi, Shinji; Phillips, Chris; Stevens, Jamie; Jacobs, Christopher; Sotuela, Ioana; Garcia miro, Cristina

    2013-04-01

    (We resubmit this proposal to extend from the previous semester. The 24 hour blocks for ATCA and Mopra were granted in May 2012 but canceled because fringe test before the scheduled experiment failed although fringes were detected between Mopra and Tidbinbilla. As it turned out ATCA had an issue with frequency standard, which has now been resolved.) We propose to conduct a LBA survey of compact radio sources at 32 GHz near the south pole region. This is the first attempt to fill the gap in the existing 32 GHz catalogue establish by NASA Deep Space Network toward completing the full sky celestial reference frame at 32 GHz. The catalogue will be used for future spacecraft navigation by NASA and other space agencies as well as for radio astronomical observations with southern radio telescope arrays such as ATCA and LBA.

  20. ATCA radio detection of the new X-ray transient MAXI J1813-095 as a candidate radio-quiet black hole X-ray binary

    NASA Astrophysics Data System (ADS)

    Russell, T. D.; Miller-Jones, J. C. A.; Sivakoff, G. R.; Tetarenko, A. J.; JACPOT XRB Collaboration

    2018-02-01

    We observed the new X-ray transient MAXI J1813-095 (ATels #11323, #11326, #11332) with the Australia Telescope Compact Array (ATCA) between 2018-02-22 20:52 UT and 2018-02-23 02:59 UT. Our observations were taken simultaneously at 5.5 and 9 GHz, with a bandwidth of 2 GHz at each frequency.

  1. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  2. 32 GHz Celestial Reference Frame Survey for Dec < -45 deg.

    NASA Astrophysics Data System (ADS)

    Horiuchi, Shinji; Phillips, Chris; Stevens, Jamie; Jacobs, Christopher; Sotuela, Ioana; Garcia miro, Cristina

    2014-04-01

    (We resubmit this proposal to extend from the previous semester. The 24 hour blocks for ATCA and Mopra were granted in May 2012 but canceled because fringe test before the scheduled experiment failed although fringes were detected between Mopra and Tidbinbilla. During the last scheduled LBA session for this project we discovered ATCA/Mopra had an issue with frequency standard, which has now been resolved.) We propose to conduct a LBA survey of compact radio sources at 32 GHz near the south pole region. This is the first attempt to fill the gap in the existing 32 GHz catalogue establish by NASA Deep Space Network toward completing the full sky celestial reference frame at 32 GHz. The catalogue will be used for future spacecraft navigation by NASA and other space agencies as well as for radio astronomical observations with southern radio telescope arrays such as ATCA and LBA.

  3. The Australia Telescope search for cosmic microwave background anisotropy

    NASA Astrophysics Data System (ADS)

    Subrahmanyan, Ravi; Kesteven, Michael J.; Ekers, Ronald D.; Sinclair, Malcolm; Silk, Joseph

    1998-08-01

    In an attempt to detect cosmic microwave background (CMB) anisotropy on arcmin scales, we have made an 8.7-GHz image of a sky region with a resolution of 2 arcmin and high surface brightness sensitivity using the Australia Telescope Compact Array (ATCA) in an ultracompact configuration. The foreground discrete-source confusion was estimated from observations with higher resolution at the same frequency and in a scaled array at a lower frequency. Following the subtraction of the foreground confusion, the field shows no features in excess of the instrument noise. This limits the CMB anisotropy flat-band power to Q_flat<23.6muK with 95 per cent confidence; the ATCA filter function (which is available at the website www.atnf.csiro.au/Research/cmbr/cmbr_atca.html) F_l in multipole l-space peaks at l_eff=4700 and has half-maximum values at l=3350 and 6050.

  4. A new ATLAS muon CSC readout system with system on chip technology on ATCA platform

    DOE PAGES

    Claus, R.

    2015-10-23

    The ATLAS muon Cathode Strip Chamber (CSC) back-end readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfiguration Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the ATCA platform. The RCE design is based on the new System on Chip Xilinx Zynq series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQmore » building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the Zynq for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chambers to be processed by 6 COBs in one ATCA shelf through software waveform feature extraction to output 32 S-links. Furthermore, the full system was installed in Sept. 2014. We will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning towards LHC Run 2.« less

  5. A new ATLAS muon CSC readout system with system on chip technology on ATCA platform

    NASA Astrophysics Data System (ADS)

    Claus, R.; ATLAS Collaboration

    2016-07-01

    The ATLAS muon Cathode Strip Chamber (CSC) back-end readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfiguration Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the ATCA platform. The RCE design is based on the new System on Chip Xilinx Zynq series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the Zynq for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chambers to be processed by 6 COBs in one ATCA shelf through software waveform feature extraction to output 32 S-links. The full system was installed in Sept. 2014. We will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning towards LHC Run 2.

  6. A new ATLAS muon CSC readout system with system on chip technology on ATCA platform

    NASA Astrophysics Data System (ADS)

    Bartoldus, R.; Claus, R.; Garelli, N.; Herbst, R. T.; Huffer, M.; Iakovidis, G.; Iordanidou, K.; Kwan, K.; Kocian, M.; Lankford, A. J.; Moschovakos, P.; Nelson, A.; Ntekas, K.; Ruckman, L.; Russell, J.; Schernau, M.; Schlenker, S.; Su, D.; Valderanis, C.; Wittgen, M.; Yildiz, S. C.

    2016-01-01

    The ATLAS muon Cathode Strip Chamber (CSC) backend readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run-2 luminosity. The readout design is based on the Reconfigurable Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the Advanced Telecommunication Computing Architecture (ATCA) platform. The RCE design is based on the new System on Chip XILINX ZYNQ series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources. Together with auxiliary memories, all these components form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the ZYNQ for high speed input and output fiberoptic links and TTC allowed the full system of 320 input links from the 32 chambers to be processed by 6 COBs in one ATCA shelf. The full system was installed in September 2014. We will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning for LHC Run 2.

  7. A new ATLAS muon CSC readout system with system on chip technology on ATCA platform

    DOE PAGES

    Bartoldus, R.; Claus, R.; Garelli, N.; ...

    2016-01-25

    The ATLAS muon Cathode Strip Chamber (CSC) backend readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run-2 luminosity. The readout design is based on the Reconfigurable Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the Advanced Telecommunication Computing Architecture (ATCA) platform. The RCE design is based on the new System on Chip XILINX ZYNQ series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources. Together with auxiliary memories, all ofmore » these components form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the ZYNQ for high speed input and output fiberoptic links and TTC allowed the full system of 320 input links from the 32 chambers to be processed by 6 COBs in one ATCA shelf. The full system was installed in September 2014. In conclusion, we will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning for LHC Run 2.« less

  8. Cyanide Toxicokinetics: The Behavior of Cyanide, Thiocyanate and 2-Amino-2-Thiazoline-4-Carboxylic Acid in Multiple Animal Models

    PubMed Central

    Bhandari, Raj K.; Oda, Robert P.; Petrikovics, Ilona; Thompson, David E.; Brenner, Matthew; Mahon, Sari B.; Bebarta, Vikhyat S.; Rockwood, Gary A.; Logue, Brian A.

    2014-01-01

    Cyanide causes toxic effects by inhibiting cytochrome c oxidase, resulting in cellular hypoxia and cytotoxic anoxia, and can eventually lead to death. Cyanide exposure can be verified by direct analysis of cyanide concentrations or analyzing its metabolites, including thiocyanate (SCN−) and 2-amino-2-thiazoline-4-carboxylic acid (ATCA) in blood. To determine the behavior of these markers following cyanide exposure, a toxicokinetics study was performed in three animal models: (i) rats (250–300 g), (ii) rabbits (3.5–4.2 kg) and (iii) swine (47–54 kg). Cyanide reached a maximum in blood and declined rapidly in each animal model as it was absorbed, distributed, metabolized and eliminated. Thiocyanate concentrations rose more slowly as cyanide was enzymatically converted to SCN−. Concentrations of ATCA did not rise significantly above the baseline in the rat model, but rose quickly in rabbits (up to a 40-fold increase) and swine (up to a 3-fold increase) and then fell rapidly, generally following the relative behavior of cyanide. Rats were administered cyanide subcutaneously and the apparent half-life (t1/2) was determined to be 1,510 min. Rabbits were administered cyanide intravenously and the t1/2 was determined to be 177 min. Swine were administered cyanide intravenously and the t1/2 was determined to be 26.9 min. The SCN− t1/2 in rats was 3,010 min, but was not calculated in rabbits and swine because SCN− concentrations did not reach a maximum. The t1/2 of ATCA was 40.7 and 13.9 min in rabbits and swine, respectively, while it could not be determined in rats with confidence. The current study suggests that cyanide exposure may be verified shortly after exposure by determining significantly elevated cyanide and SCN− in each animal model and ATCA may be used when the ATCA detoxification pathway is significant. PMID:24711295

  9. Cyanide toxicokinetics: the behavior of cyanide, thiocyanate and 2-amino-2-thiazoline-4-carboxylic acid in multiple animal models.

    PubMed

    Bhandari, Raj K; Oda, Robert P; Petrikovics, Ilona; Thompson, David E; Brenner, Matthew; Mahon, Sari B; Bebarta, Vikhyat S; Rockwood, Gary A; Logue, Brian A

    2014-05-01

    Cyanide causes toxic effects by inhibiting cytochrome c oxidase, resulting in cellular hypoxia and cytotoxic anoxia, and can eventually lead to death. Cyanide exposure can be verified by direct analysis of cyanide concentrations or analyzing its metabolites, including thiocyanate (SCN(-)) and 2-amino-2-thiazoline-4-carboxylic acid (ATCA) in blood. To determine the behavior of these markers following cyanide exposure, a toxicokinetics study was performed in three animal models: (i) rats (250-300 g), (ii) rabbits (3.5-4.2 kg) and (iii) swine (47-54 kg). Cyanide reached a maximum in blood and declined rapidly in each animal model as it was absorbed, distributed, metabolized and eliminated. Thiocyanate concentrations rose more slowly as cyanide was enzymatically converted to SCN(-). Concentrations of ATCA did not rise significantly above the baseline in the rat model, but rose quickly in rabbits (up to a 40-fold increase) and swine (up to a 3-fold increase) and then fell rapidly, generally following the relative behavior of cyanide. Rats were administered cyanide subcutaneously and the apparent half-life (t1/2) was determined to be 1,510 min. Rabbits were administered cyanide intravenously and the t1/2 was determined to be 177 min. Swine were administered cyanide intravenously and the t1/2 was determined to be 26.9 min. The SCN(-) t1/2 in rats was 3,010 min, but was not calculated in rabbits and swine because SCN(-) concentrations did not reach a maximum. The t1/2 of ATCA was 40.7 and 13.9 min in rabbits and swine, respectively, while it could not be determined in rats with confidence. The current study suggests that cyanide exposure may be verified shortly after exposure by determining significantly elevated cyanide and SCN(-) in each animal model and ATCA may be used when the ATCA detoxification pathway is significant.

  10. VizieR Online Data Catalog: Detected sources in the region of Magellanic Stream (For+, 2014)

    NASA Astrophysics Data System (ADS)

    For, B.-Q.; Staveley-Smith, L.; Matthews, D.; McClure-Griffiths, N. M.

    2017-04-01

    The ATCA high-resolution MS survey covers a 500 deg2 field Magellanic Stream (here after MS) using the H75 configuration of the ATCA. MS I to MS IV, part of the SMC, and the Interface Region (IFR) are covered in this survey. The observations were carried out over a period from 2005 to 2006, which resulted in ~180 hr of total observing time. The entire area was divided into 33 regions with 154 pointing centers per region, resulting in 5082 pointing centers. Each pointing center was separated by 20', arranged in a hexagonal grid, observed for 20 s, and revisited six times during an average of 10 hours of observation. The resulting ATCA data have an angular resolution of 413''x330'', a brightness sensitivity of 210 mK and a velocity resolution of 1.65 km/s after Hanning smoothing. The survey covers the local standard of rest velocity (VLSR) between -315 and +393 km/s. (1 data file).

  11. Comparison of cyanide exposure markers in the biofluids of smokers and non-smokers.

    PubMed

    Vinnakota, Chakravarthy V; Peetha, Naga S; Perrizo, Mitch G; Ferris, David G; Oda, Robert P; Rockwood, Gary A; Logue, Brian A

    2012-11-01

    Cyanide is highly toxic and is present in many foods, combustion products (e.g. cigarette smoke), industrial processes, and has been used as a terrorist weapon. In this study, cyanide and its major metabolites, thiocyanate and 2-amino-2-thiazoline-4-carboxylic acid (ATCA), were analyzed from various human biofluids of smokers (low-level chronic cyanide exposure group) and non-smokers to gain insight into the relationship of these biomarkers to cyanide exposure. The concentrations of each biomarker tested were elevated for smokers in each biofluid. Significant differences (p < 0.05) were found for thiocyanate in plasma and urine, and ATCA showed significant differences in plasma and saliva. Additionally, biomarker concentration ratios, correlations between markers of cyanide exposure, and other statistical methods were performed to better understand the relationship between cyanide and its metabolites. Of the markers studied, the results indicate plasma ATCA, in particular, showed excellent promise as a biomarker for chronic low-level cyanide exposure.

  12. Structural analysis of fructans from Agave americana grown in South Africa for spirit production.

    PubMed

    Ravenscroft, Neil; Cescutti, Paola; Hearshaw, Meredith A; Ramsout, Ronica; Rizzo, Roberto; Timme, Elizabeth M

    2009-05-27

    Fructans isolated from Agave americana grown in South Africa are currently used for spirit production. Structural studies on water-soluble fructans were performed to facilitate the development of other applications including its use as a prebiotic. Acid hydrolysis followed by HPAEC-PAD analysis confirmed that the fructan was composed of glucose and fructose, and size analysis by HPAEC-PAD and size exclusion chromatography indicated that the saccharides have a DP range from 6 to 50. An average DP of 14 was estimated by (1)H NMR analysis. Linkage analysis and ESI-MS studies suggest that A. americana has a neofructan structure consisting of a central sucrose to which (2 → 1)- and (2 → 6)-linked β-D-Fruf chains are attached. The (2 → 1)-linked units extend from C-1 of Fru and C-6 of glucose, whereas the (2 → 6)-linked β-D-Fruf units are attached to C-6 of the central Fru. This structure accounts for the presence of equimolar amounts of 1,6-linked Glu and 1,2,6-linked Fru found in linkage analysis and the multiplicity of the NMR signals observed. Detailed ESI-MS studies were performed on fructan fractions: native, periodate oxidized/reduced, and permethylated oligomers. These derivatizations introduced mass differences between Glc and Fru following oxidation and between 1,2-, 1,6-, 2,6-, and 1,2,6-linked units after methylation. Thus, ESI-MS showed the presence of a single Glc per fructan chain and that it is predominantly internal, rather than terminal as found in inulin. These structural features were confirmed by the use of 1D and 2D NMR experiments.

  13. Evidence for view-invariant face recognition units in unfamiliar face learning.

    PubMed

    Etchells, David B; Brooks, Joseph L; Johnston, Robert A

    2017-05-01

    Many models of face recognition incorporate the idea of a face recognition unit (FRU), an abstracted representation formed from each experience of a face which aids recognition under novel viewing conditions. Some previous studies have failed to find evidence of this FRU representation. Here, we report three experiments which investigated this theoretical construct by modifying the face learning procedure from that in previous work. During learning, one or two views of previously unfamiliar faces were shown to participants in a serial matching task. Later, participants attempted to recognize both seen and novel views of the learned faces (recognition phase). Experiment 1 tested participants' recognition of a novel view, a day after learning. Experiment 2 was identical, but tested participants on the same day as learning. Experiment 3 repeated Experiment 1, but tested participants on a novel view that was outside the rotation of those views learned. Results revealed a significant advantage, across all experiments, for recognizing a novel view when two views had been learned compared to single view learning. The observed view invariance supports the notion that an FRU representation is established during multi-view face learning under particular learning conditions.

  14. Genetic and neuronal mechanisms governing the sex-specific interaction between sleep and sexual behaviors in Drosophila.

    PubMed

    Chen, Dandan; Sitaraman, Divya; Chen, Nan; Jin, Xin; Han, Caihong; Chen, Jie; Sun, Mengshi; Baker, Bruce S; Nitabach, Michael N; Pan, Yufeng

    2017-07-28

    Animals execute one particular behavior among many others in a context-dependent manner, yet the mechanisms underlying such behavioral choice remain poorly understood. Here we studied how two fundamental behaviors, sex and sleep, interact at genetic and neuronal levels in Drosophila. We show that an increased need for sleep inhibits male sexual behavior by decreasing the activity of the male-specific P1 neurons that coexpress the sex determination genes fru M and dsx, but does not affect female sexual behavior. Further, we delineate a sex-specific neuronal circuit wherein the P1 neurons encoding increased courtship drive suppressed male sleep by forming mutually excitatory connections with the fru M -positive sleep-controlling DN1 neurons. In addition, we find that FRU M regulates male courtship and sleep through distinct neural substrates. These studies reveal the genetic and neuronal basis underlying the sex-specific interaction between sleep and sexual behaviors in Drosophila, and provide insights into how competing behaviors are co-regulated.Genes and circuits involved in sleep and sexual arousal have been extensively studied in Drosophila. Here the authors identify the sex determination genes fruitless and doublesex, and a sex-specific P1-DN1 neuronal feedback that governs the interaction between these competing behaviors.

  15. Hexose Transport in Growing Petunia Pollen Tubes and Characterization of a Pollen-Specific, Putative Monosaccharide Transporter1

    PubMed Central

    Ylstra, Bauke; Garrido, Dolores; Busscher, Jacqueline; van Tunen, Arjen J.

    1998-01-01

    We investigated the molecular and physiological processes of sugar uptake and metabolism during pollen tube growth and plant fertilization. In vitro germination assays showed that petunia (Petunia hybrida) pollen can germinate and grow not only in medium containing sucrose (Suc) as a carbon source, but also in medium containing the monosaccharides glucose (Glc) or fructose (Fru). Furthermore, high-performance liquid chromatography analysis demonstrated a rapid and complete conversion of Suc into equimolar amounts of Glc and Fru when pollen was cultured in a medium containing 2% Suc. This indicates the presence of wall-bound invertase activity and uptake of sugars in the form of monosaccharides by the growing pollen tube. A cDNA designated pmt1 (petunia monosaccharide transporter 1), which is highly homologous to plant monosaccharide transporters, was isolated from petunia. Pmt1 belongs to a small gene family and is expressed specifically in the male gametophyte, but not in any other vegetative or floral tissues. Pmt1 is activated after the first pollen mitosis, and high levels of mRNA accumulate in mature and germinating pollen. A model describing the transport of sugars to the style, the conversion of Suc into Glc and Fru, and the active uptake by a monosaccharide transporter into the pollen tube is presented. PMID:9733549

  16. Tectonic evolution of the Fru\\vska Gora (NW Serbia) and implications for the late stage inversion of the Pannonian Basin

    NASA Astrophysics Data System (ADS)

    Novčić, Novak; Toljić, Marinko; Stojadinović, Uroš; Matenco, Liviu

    2017-04-01

    Indentation of Adria microplate during latest Miocene to Quaternary times created contraction and transcurrent movements distributed in the Dinarides Mountains and along its margin with the adjacent Pannonian Basin. Fru\\vska Gora of northern Serbia is one of the few areas along the southern margin of the Pannonian Basin where the kinematic effects of this late-stage inversion can be studied. These mountains are located along the Sava-Vardar Suture Zone as an isolated inselberg surrounded by Neogene deposits of the Pannonian Basin, exposing metamorphic rocks, Mesozoic ophiolites and sediments belonging to the Dinarides units. Our field kinematic study demonstrate that deformation structures are related to several Oligocene - Miocene extensional and latest Miocene - Quaternary contractional deformation events. These events took place during the differential rotational stages experienced by Fru\\vska Gora. This has created a gradual change in strike from N-S to E-W of three successive normal faulting episodes (Oligocene-Early Miocene, Early Miocene and Middle-Late Miocene), subsequently inverted by contractional deformation. This latter deformation took place during the continuous latest Miocene - Quaternary Adria indentation and was accompanied by yet another 40 degrees counter clockwise rotation of the entire Fru\\vska Gora. Almost all resulting contractional structures reactivate the pre-existing Oligocene - Miocene normal faults. This is reflected in the present-day morphology of Fruska Gora that has a large-scale flower-type of structural geometry formed during dextral transpression, as demonstrated by field kinematics and seismic interpretations. This overall geometry is significantly different when compared with other areas situated more westwards in a similar structural position in the Dinariders at their contact with the Pannonian Basin, such as Medvednica Mountains or Sava-Drava transpressional systems. The variation in offsets along the strike of the orogen demonstrate that the indentation into the Pannonian basin significantly decrease eastwards towards Fruska Gora, likely accommodating a large-scale variation in indentation mechanics across and along the Dinarides.

  17. A Full Mesh ATCA-based General Purpose Data Processing Board (Pulsar II)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ajuha, S.

    The Pulsar II is a custom ATCA full mesh enabled FPGA-based processor board which has been designed with the goal of creating a scalable architecture abundant in flexible, non-blocking, high bandwidth interconnections. The design has been motivated by silicon-based tracking trigger needs for LHC experiments. In this technical memo we describe the Pulsar II hardware and its performance, such as the performance test results with full mesh backplanes from different vendors, how the backplane is used for the development of low-latency time-multiplexed data transfer schemes and how the inter-shelf and intra-shelf synchronization works.

  18. Nonlinear and progressive failure aspects of transport composite fuselage damage tolerance

    NASA Technical Reports Server (NTRS)

    Walker, Tom; Ilcewicz, L.; Murphy, Dan; Dopker, Bernhard

    1993-01-01

    The purpose is to provide an end-user's perspective on the state of the art in life prediction and failure analysis by focusing on subsonic transport fuselage issues being addressed in the NASA/Boeing Advanced Technology Composite Aircraft Structure (ATCAS) contract and a related task-order contract. First, some discrepancies between the ATCAS tension-fracture test database and classical prediction methods is discussed, followed by an overview of material modeling work aimed at explaining some of these discrepancies. Finally, analysis efforts associated with a pressure-box test fixture are addressed, as an illustration of modeling complexities required to model and interpret tests.

  19. The impact of ions on allosteric functions in human liver pyruvate kinase

    PubMed Central

    Alontaga, Aileen Y.

    2010-01-01

    Experimental designs used to monitor the magnitude of an allosteric response can greatly influence observed values. We report here the impact of buffer, monovalent cation, divalent cation and anion on the magnitude of the allosteric regulation of the affinity of human liver pyruvate kinase (hL-PYK) for substrate, phosphoenolpyruvate (PEP). The magnitudes of the allosteric activation by fructose-1,6-bisphosphate (Fru-1,6-BP) and the allosteric inhibition by alanine are independent of most, but not all buffers tested. However, these magnitudes are dependent on whether Mg2+ or Mn2+ is included as the divalent cation. In the presence of Mn2+, any change in Kapp-PEP caused by Fru-1,6-BP is minimal. hL-PYK activity does not appear to require monovalent cation. Monovalent cation binding in the active site impacts PEP affinity with minimum influence on the magnitude of allosteric coupling. However, Na+ and Li+ reduce the magnitude of the allosteric response to Fru-1,6-BP, likely due to mechanisms outside of the active site. Which anion is used to maintain a constant monovalent cation concentration also influences the magnitude of the allosteric response. The value of determining the impact of ions on allosteric function can be appreciated by considering that representative structures used in comparative studies have often been determined using protein crystals grown in diverse buffer and salt conditions. PMID:21609859

  20. Renin inhibition improves metabolic syndrome, and reduces angiotensin II levels and oxidative stress in visceral fat tissues in fructose-fed rats

    PubMed Central

    Chen, Jin-Shuen

    2017-01-01

    Renin–angiotensin system in visceral fat plays a crucial role in the pathogenesis of metabolic syndrome in fructose-fed rats. However, the effects of renin inhibition on visceral adiposity in metabolic syndrome are not fully investigated. We investigated the effects of renin inhibition on visceral adiposity in fructose-fed rats. Male Wistar–Kyoto rats were divided into 4 groups for 8-week experiments: Group Con (standard chow diet), Group Fru (high-fructose diet; 60% fructose), Group FruA (high-fructose diet and concurrent aliskiren treatment; 100 mg/kg body weight [BW] per day), and Group FruB (high-fructose diet and subsequent, i.e. 4 weeks after initiating high-fructose feeding, aliskiren treatment; 100 mg/kg BW per day). The high-fructose diet induced metabolic syndrome, increased visceral fat weights and adipocyte sizes, and augmented angiotensin II (Ang II), NADPH oxidase (NOX) isoforms expressions, oxidative stress, and dysregulated production of adipocytokines from visceral adipose tissues. Concurrent and subsequent aliskiren administration ameliorated metabolic syndrome, dysregulated adipocytokines, and visceral adiposity in high fructose-fed hypertensive rats, and was associated with reducing Ang II levels, NOX isoforms expressions and oxidative stress in visceral fat tissues. Therefore, this study demonstrates renin inhibition could improve metabolic syndrome, and reduce Ang II levels and oxidative stress in visceral fat tissue in fructose-fed rats, and suggests that visceral adipose Ang II plays a crucial role in the pathogenesis of metabolic syndrome in fructose-fed rats. PMID:28700686

  1. Renin inhibition improves metabolic syndrome, and reduces angiotensin II levels and oxidative stress in visceral fat tissues in fructose-fed rats.

    PubMed

    Chou, Chu-Lin; Lin, Heng; Chen, Jin-Shuen; Fang, Te-Chao

    2017-01-01

    Renin-angiotensin system in visceral fat plays a crucial role in the pathogenesis of metabolic syndrome in fructose-fed rats. However, the effects of renin inhibition on visceral adiposity in metabolic syndrome are not fully investigated. We investigated the effects of renin inhibition on visceral adiposity in fructose-fed rats. Male Wistar-Kyoto rats were divided into 4 groups for 8-week experiments: Group Con (standard chow diet), Group Fru (high-fructose diet; 60% fructose), Group FruA (high-fructose diet and concurrent aliskiren treatment; 100 mg/kg body weight [BW] per day), and Group FruB (high-fructose diet and subsequent, i.e. 4 weeks after initiating high-fructose feeding, aliskiren treatment; 100 mg/kg BW per day). The high-fructose diet induced metabolic syndrome, increased visceral fat weights and adipocyte sizes, and augmented angiotensin II (Ang II), NADPH oxidase (NOX) isoforms expressions, oxidative stress, and dysregulated production of adipocytokines from visceral adipose tissues. Concurrent and subsequent aliskiren administration ameliorated metabolic syndrome, dysregulated adipocytokines, and visceral adiposity in high fructose-fed hypertensive rats, and was associated with reducing Ang II levels, NOX isoforms expressions and oxidative stress in visceral fat tissues. Therefore, this study demonstrates renin inhibition could improve metabolic syndrome, and reduce Ang II levels and oxidative stress in visceral fat tissue in fructose-fed rats, and suggests that visceral adipose Ang II plays a crucial role in the pathogenesis of metabolic syndrome in fructose-fed rats.

  2. Group Cohesiveness, Deviation, Stress, and Conformity

    DTIC Science & Technology

    1993-08-11

    Cola number of cups, __ Chocolate, cocoa, wine, beer/alcohol, decaffeinated coffee. Breads containing raisins, prunes, orange peel , banana , or...pudding, mince pie. Banana , avocado, pineapple, canned figs, raisins, plums and prunes. Oranges, orange juice, fru~ cocktail with pineapple. Tomato

  3. Control of Sexual Differentiation and Behavior by the doublesex gene in Drosophila melanogaster

    PubMed Central

    Rideout, Elizabeth J.; Dornan, Anthony J.; Neville, Megan C.; Eadie, Suzanne; Goodwin, Stephen F.

    2010-01-01

    Doublesex proteins, part of the structurally and functionally conserved Dmrt gene family, play essential roles in sex determination throughout the animal kingdom. We targeted the insertion of GAL4 into the doublesex (dsx) locus of Drosophila melanogaster, allowing visualization and manipulation of dsx cells in various tissues. In the nervous system, significant differences between the sexes were detected in dsx neuronal numbers, axonal projections, and synaptic density. We show that dsx is required for the development of male-specific neurons that co-express fruitless (fru), a key regulator of male sexual behavior. We propose that both dsx and fru act together to form the neuronal framework necessary for male sexual behavior. Significantly, we show that disrupting dsx neuronal function has profound effects on male sexual behavior. Furthermore, we demonstrate a role for dsx neurons in pre- through to post-copulatory female reproductive behaviors. PMID:20305646

  4. A Novel Gene Controlling the Timing of Courtship Initiation in Drosophila melanogaster

    PubMed Central

    Luu, Peter; Zaki, Sadaf A.; Tran, David H.; French, Rachael L.

    2016-01-01

    Over the past 35 years, developmental geneticists have made impressive progress toward an understanding of how genes specify morphology and function, particularly as they relate to the specification of each physical component of an organism. In the last 20 years, male courtship behavior in Drosophila melanogaster has emerged as a robust model system for the study of genetic specification of behavior. Courtship behavior is both complex and innate, and a single gene, fruitless (fru), is both necessary and sufficient for all aspects of the courtship ritual. Typically, loss of male-specific Fruitless protein function results in male flies that perform the courtship ritual incorrectly, slowly, or not at all. Here we describe a novel requirement for fru: we have identified a group of cells in which male Fru proteins are required to reduce the speed of courtship initiation. In addition, we have identified a gene, Trapped in endoderm 1 (Tre1), which is required in these cells for normal courtship and mating behavior. Tre1 encodes a G-protein-coupled receptor required for establishment of cell polarity and cell migration and has previously not been shown to be involved in courtship behavior. We describe the results of feminization of the Tre1-expressing neurons, as well as the effects on courtship behavior of mutation of Tre1. In addition, we show that Tre1 is expressed in a sexually dimorphic pattern in the central and peripheral nervous systems and investigate the role of the Tre1 cells in mate identification. PMID:26721856

  5. 50 CFR 635.1 - Purpose and scope.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... sharks, and Atlantic swordfish under the authority of the Magnuson-Stevens Act and ATCA. They implement... shark regulations govern conservation and management of sharks in the management unit, under the...

  6. 50 CFR 635.1 - Purpose and scope.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... sharks, and Atlantic swordfish under the authority of the Magnuson-Stevens Act and ATCA. They implement... shark regulations govern conservation and management of sharks in the management unit, under the...

  7. 50 CFR 635.1 - Purpose and scope.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... sharks, and Atlantic swordfish under the authority of the Magnuson-Stevens Act and ATCA. They implement... shark regulations govern conservation and management of sharks in the management unit, under the...

  8. 50 CFR 635.1 - Purpose and scope.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... sharks, and Atlantic swordfish under the authority of the Magnuson-Stevens Act and ATCA. They implement... shark regulations govern conservation and management of sharks in the management unit, under the...

  9. Geodiversity "Engraved

    NASA Astrophysics Data System (ADS)

    Vujičić, M. D.; Vasiljević, Dj. A.; Marković, S. B.; Lukić, T.; Basarin, B.

    2012-04-01

    Geoheritage is not merely a part of Earth's history; rather that it is also important part of the history of mankind. Geological features and landscape, as components of human surroundings, have strongly influenced our society from its beginnings - first cave-dwellers to modern-day civilization. It has also had great influence on human tradition, culture and religion. This paper will discuss the role of geodiversity as construction material for cultural and historical heritage with the case of possible connection of these natural and anthropogenic resources through successful and sustainable geotourism planning. Case study of Fru\\vska Gora Mountain, as potential destination with significant anthropogenic and natural values, will demonstrate the main idea of this research. Fru\\vska Gora Mountain is situated at the confluence of the Danube and Sava Rivers, in northern Serbia. It was proclaimed a National Park in 1960 with 25,525 ha of protected area due to its rich, rare and endangered biodiversity. Additionally, within the Park and wider area of Fru\\vska Gora, there are numerous historical and cultural monuments with almost 20 orthodox monasteries, built in 15th and 16th century and hidden in the woods, which earned this destination the epithet "the Holy Mountain" apropos Serbian Atos. Besides biodiversity, Fru\\vska Gora Mountain has rich geomorphologic significance, geological and pedological diversity with relatively small region that reflects very complicated geological evolution which formed a unique tectonic, lithological and stratigraphic mosaic. Numerous valuable and rare geosites makes this mountain a future geopark destination. As geotourism is relatively new trend and still unrecognised in Serbia, thus it is evidently urgent to inform visitors of other (cultural, historical, natural) sites about the existence of attractive geosites. Authors conducted research in order to identify construction material of certain monasteries and established that the most of it is exploited from quarries and pits in vicinity. For example, some of them were extracted from Rakovac limestone quarry or brickyards with significant loess and loess like sediments. All these localities are planned to be included in geo-trails of future geopark. The idea is to, beside interpretative panels, place information on cultural and historical heritage that was constructed from this geo-material. The likewise process would be provided through all human-made sites where panels would explain and promote geosites from where the material was brought. This would certainly bring mutual benefits and promotion that is in core of the initial geopark philosophy.

  10. HI properties and star formation history of a fly-by pair of blue compact dwarf galaxies

    NASA Astrophysics Data System (ADS)

    Kim, Jinhyub; Chung, Aeree; Wong, O. Ivy; Lee, Bumhyun; Sung, Eon-Chang; Staveley-Smith, Lister

    2017-09-01

    A fly-by interaction has been suggested to be one of the major explanations for enhanced star formation in blue compact dwarf (BCD) galaxies, yet no direct evidence for this scenario has been found to date. In the Hi Parkes all-sky survey (HIPASS), ESO 435-IG 020 and ESO 435-G 016, a BCD pair were found in a common, extended gas envelope of atomic hydrogen, providing an ideal case to test the hypothesis that the starburst in BCDs can be indeed triggered by a fly-by interaction. Using high-resolution data from the Australia Telescope Compact Array (ATCA), we investigated Hi properties and the spectral energy distribution (SED) of the BCD pair to study their interaction and star formation histories. The high-resolution Hi data of both BCDs reveal a number of peculiarities, which are suggestive of tidal perturbation. Meanwhile, 40% of the HIPASS flux is not accounted for in the ATCA observations with no Hi gas bridge found between the two BCDs. Intriguingly, in the residual of the HIPASS and the ATCA data, 10% of the missing flux appears to be located between the two BCDs. While the SED-based age of the most dominant young stellar population is old enough to have originated from the interaction with any neighbors (including the other of the two BCDs), the most recent star formation activity traced by strong Hα emission in ESO 435-IG 020 and the shear motion of gas in ESO 435-G 016, suggest a more recent or current tidal interaction. Based on these and the residual emission between the HIPASS and the ATCA data, we propose an interaction between the two BCDs as the origin of their recently enhanced star formation activity. The shear motion on the gas disk, potentially with re-accretion of the stripped gas, could be responsible for the active star formation in this BCD pair. The reduced datacube (FITS file) is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/605/A54

  11. Chandra Takes on Heavy Jets and Massive Winds in 4U 1630-47

    NASA Astrophysics Data System (ADS)

    Neilsen, Joey

    2014-11-01

    Recently, Díaz Trigo et al. reported the discovery of relativistic baryons in a jet in XMM/ATCA observations of the 2012 outburst of the black hole 4U 1630-47. We present a search for a similarly massive jet earlier in the same outburst using high-resolution X-ray spectra from the Chandra HETGS. Despite a detection of radio emission with ATCA, we find no evidence of a heavy jet in the X-ray spectrum, with tight upper limits on the relativistic emission lines seen by Díaz Trigo eight months later. Instead, we find deep absorption lines from a massive, highly ionized disk wind, whose properties can be probed with detailed photoionization models. We explore several scenarios to explain the two modes of massive outflow in this remarkable black hole system.

  12. Genetic analysis of fructan-hyperproducing strains of Streptococcus mutans.

    PubMed Central

    Kiska, D L; Macrina, F L

    1994-01-01

    Fructan polymer, synthesized from sucrose by the extracellular fructosyltransferase of Streptococcus mutans, is thought to contribute to the progression of dental caries. It may serve as an extracellular storage polysaccharide facilitating survival and acid production. It may also have a role in adherence or accumulation of bacterial cells on the tooth surface. A number of clinical isolates of S. mutans which produce large, mucoid colonies on sucrose-containing agar as a result of increased production of fructan have been discovered. By using eight independent isolates, we sought to determine if such fructan-hyperproducing strains represented a genetically homogeneous group of organisms. Restriction fragment patterns of total cellular DNA were examined by using pulsed-field and conventional gel electrophoresis. Four genetic types which appeared to correlate with the serotype of the organism and the geographic site of isolation were evident. Southern blot analysis of several genetic loci for extracellular enzymes revealed some minor differences between the strains, but the basic genomic organizations of these loci were similar. To evaluate whether the excess fructan produced by these strains enhanced the virulence of these organisms in the oral cavity, it was of interest to create mutants deficient in fructosidase (FruA), the extracellular enzyme which degrades this polymer. The fruA gene was inactivated by allelic exchange in two fructan-hyperproducing strains as well as in S. mutans GS5, a strain which does not hyperproduce fructan. All of the fruA mutant strains were devoid of fructan hydrolase activity when levan was used as a substrate. However, the fructan-hyperproducing strains retained the ability to hydrolyze inulin, suggesting the presence of a second fructosidase with specificity for inulin in these strains. Images PMID:7911782

  13. Multiple Roles of Soluble Sugars in the Establishment of Gunnera-Nostoc Endosymbiosis1[OA

    PubMed Central

    Khamar, Hima J.; Breathwaite, Erick K.; Prasse, Christine E.; Fraley, Elizabeth R.; Secor, Craig R.; Chibane, Fairouz L.; Elhai, Jeff; Chiu, Wan-Ling

    2010-01-01

    Gunnera plants have the unique ability to form endosymbioses with N2-fixing cyanobacteria, primarily Nostoc. Cyanobacteria enter Gunnera through transiently active mucilage-secreting glands on stems. We took advantage of the nitrogen (N)-limitation-induced gland development in Gunnera manicata to identify factors that may enable plant tissue to attract and maintain cyanobacteria colonies. Cortical cells in stems of N-stressed Gunnera plants were found to accumulate a copious amount of starch, while starch in the neighboring mature glands was nearly undetectable. Instead, mature glands accumulated millimolar concentrations of glucose (Glc) and fructose (Fru). Successful colonization by Nostoc drastically reduced sugar accumulation in the surrounding tissue. Consistent with the abundance of Glc and Fru in the gland prior to Nostoc colonization, genes encoding key enzymes for sucrose and starch hydrolysis (e.g. cell wall invertase, α-amylase, and starch phosphorylase) were expressed at higher levels in stem segments with glands than those without. In contrast, soluble sugars were barely detectable in mucilage freshly secreted from glands. Different sugars affected Nostoc’s ability to differentiate motile hormogonia in a manner consistent with their locations. Galactose and arabinose, the predominant constituents of polysaccharides in the mucilage, had little or no inhibitory effect on hormogonia differentiation. On the other hand, soluble sugars that accumulated in gland tissue, namely sucrose, Glc, and Fru, inhibited hormogonia differentiation and enhanced vegetative growth. Results from this study suggest that, in an N-limited environment, mature Gunnera stem glands may employ different soluble sugars to attract Nostoc and, once the cyanobacteria are internalized, to maintain them in the N2-fixing vegetative state. PMID:20833727

  14. Trehalose prevents adipocyte hypertrophy and mitigates insulin resistance.

    PubMed

    Arai, Chikako; Arai, Norie; Mizote, Akiko; Kohno, Keizo; Iwaki, Kanso; Hanaya, Toshiharu; Arai, Shigeyuki; Ushio, Simpei; Fukuda, Shigeharu

    2010-12-01

    Trehalose has been shown to evoke lower insulin secretion than glucose in oral saccharide tolerance tests in humans. Given this hypoinsulinemic effect of trehalose, we hypothesized that trehalose suppresses adipocyte hypertrophy by reducing storage of triglyceride and mitigates insulin resistance in mice fed a high-fat diet (HFD). Mice were fed an HFD and given drinking water containing 2.5% saccharide (glucose [Glc], trehalose [Tre], maltose [Mal], high-fructose corn syrup, or fructose [Fru]) ad libitum. After 7 weeks of HFD and saccharide intake, fasting serum insulin levels in the Tre/HFD group were significantly lower than in the Mal/HFD and Glc/HFD groups (P < .05). Furthermore, the Tre/HFD group showed a significantly suppressed elevation of homeostasis model assessment-insulin resistance compared with the Mal/HFD group (P < .05) and showed a trend toward lower homeostasis model assessment-insulin resistance than the Glc/HFD group. After 8 weeks of feeding, mesenteric adipocyte size in the Tre/HFD group showed significantly less hypertrophy than the Glc/HFD, Mal/HFD, high-fructose corn syrup/HFD, or Fru/HFD group. Analysis of gene expression in mesenteric adipocytes showed that no statistically significant difference in the expression of monocyte chemoattractant protein-1 (MCP-1) messenger RNA (mRNA) was observed between the Tre/HFD group and the distilled water/standard diet group, whereas a significant increase in the MCP-1 mRNA expression was observed in the Glc/HFD, Mal/HFD, Fru/HFD, and distilled water/HFD groups. Thus, our data indicate that trehalose prevents adipocyte hypertrophy and mitigates insulin resistance in HFD-fed mice by reducing insulin secretion and down-regulating mRNA expression of MCP-1. These findings further suggest that trehalose is a functional saccharide that mitigates insulin resistance. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. Female-biased dimorphism underlies a female-specific role for post-embryonic Ilp7 neurons in Drosophila fertility

    PubMed Central

    Castellanos, Monica C.; Tang, Jonathan C. Y.; Allan, Douglas W.

    2013-01-01

    In Drosophila melanogaster, much of our understanding of sexually dimorphic neuronal development and function comes from the study of male behavior, leaving female behavior less well understood. Here, we identify a post-embryonic population of Insulin-like peptide 7 (Ilp7)-expressing neurons in the posterior ventral nerve cord that innervate the reproductive tracts and exhibit a female bias in their function. They form two distinct dorsal and ventral subsets in females, but only a single dorsal subset in males, signifying a rare example of a female-specific neuronal subset. Female post-embryonic Ilp7 neurons are glutamatergic motoneurons innervating the oviduct and are required for female fertility. In males, they are serotonergic/glutamatergic neuromodulatory neurons innervating the seminal vesicle but are not required for male fertility. In both sexes, these neurons express the sex-differentially spliced fruitless-P1 transcript but not doublesex. The male fruitless-P1 isoform (fruM) was necessary and sufficient for serotonin expression in the shared dorsal Ilp7 subset, but although it was necessary for eliminating female-specific Ilp7 neurons in males, it was not sufficient for their elimination in females. By contrast, sex-specific RNA-splicing by female-specific transformer is necessary for female-type Ilp7 neurons in females and is sufficient for their induction in males. Thus, the emergence of female-biased post-embryonic Ilp7 neurons is mediated in a subset-specific manner by a tra- and fru-dependent mechanism in the shared dorsal subset, and a tra-dependent, fru-independent mechanism in the female-specific subset. These studies provide an important counterpoint to studies of the development and function of male-biased neuronal dimorphism in Drosophila. PMID:23981656

  16. Fructose and Sucrose Intake Increase Exogenous Carbohydrate Oxidation during Exercise

    PubMed Central

    Trommelen, Jorn; Fuchs, Cas J.; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E.; Cermak, Naomi M.; van Loon, Luc J. C.

    2017-01-01

    Peak exogenous carbohydrate oxidation rates typically reach ~1 g·min−1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL·kg−1·min−1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g·min−1 of glucose (GLU), 1.2 g·min−1 glucose + 0.6 g·min−1 fructose (GLU + FRU), 0.6 g·min−1 glucose + 1.2 g·min−1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g·min−1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g·min−1: p < 0.05). In line, exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g·min−1, respectively, p < 0.05). We conclude that fructose co-ingestion (0.6 g·min−1) with glucose (1.2 g·min−1) provided either as a monosaccharide or as sucrose strongly increases exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. PMID:28230742

  17. Fructose and Sucrose Intake Increase Exogenous  Carbohydrate Oxidation during Exercise.

    PubMed

    Trommelen, Jorn; Fuchs, Cas J; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E; Cermak, Naomi M; van Loon, Luc J C

    2017-02-20

    Peak exogenous carbohydrate oxidation rates typically reach ~1 g∙min-1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL∙kg-1∙min-1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g∙min-1 of glucose (GLU), 1.2 g∙min-1 glucose + 0.6 g∙min-1 fructose (GLU + FRU), 0.6 g∙min-1 glucose + 1.2 g∙min-1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g∙min-1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g∙min-1: p < 0.05). In line, exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g∙min-1, respectively, p < 0.05). We conclude that fructose co-ingestion (0.6 g∙min-1) with glucose (1.2 g∙min-1) provided either as a monosaccharide or as sucrose strongly increases exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists.

  18. Properties of Fructan:Fructan 1-Fructosyltransferases from Chicory and Globe Thistle, Two Asteracean Plants Storing Greatly Different Types of Inulin1

    PubMed Central

    Vergauwen, Rudy; Van Laere, André; Van den Ende, Wim

    2003-01-01

    Remarkably, within the Asteraceae, a species-specific fructan pattern can be observed. Some species such as artichoke (Cynara scolymus) and globe thistle (Echinops ritro) store fructans with a considerably higher degree of polymerization than the one observed in chicory (Cichorium intybus) and Jerusalem artichoke (Helianthus tuberosus). Fructan:fructan 1-fructosyltransferase (1-FFT) is the enzyme responsible for chain elongation of inulin-type fructans. 1-FFTs were purified from chicory and globe thistle. A comparison revealed that chicory 1-FFT has a high affinity for sucrose (Suc), fructose (Fru), and 1-kestose as acceptor substrate. This makes redistribution of Fru moieties from large to small fructans very likely during the period of active fructan synthesis in the root when import and concentration of Suc can be expected to be high. In globe thistle, this problem is avoided by the very low affinity of 1-FFT for Suc, Fru, and 1-kestose and the higher affinity for inulin as acceptor substrate. Therefore, the 1-kestose formed by Suc:Suc 1-fructosyltransferase is preferentially used for elongation of inulin molecules, explaining why inulins with a much higher degree of polymerization accumulate in roots of globe thistle. Inulin patterns obtained in vitro from 1-kestose and the purified 1-FFTs from both species closely resemble the in vivo inulin patterns. Therefore, we conclude that the species-specific fructan pattern within the Asteraceae can be explained by the different characteristics of their respective 1-FFTs. Although 1-FFT and bacterial levansucrases clearly differ in their ability to use Suc as a donor substrate, a kinetic analysis suggests that 1-FFT also works via a ping-pong mechanism. PMID:12970504

  19. d-Fructose Modification Enhanced Internalization of Mixed Micelles in Breast Cancer Cells via GLUT5 Transporters.

    PubMed

    Zhou, Xu; Qin, Xianyan; Gong, Tao; Zhang, Zhi-Rong; Fu, Yao

    2017-07-01

    d-Fructose modified poly(ε-caprolactone)-polyethylene glycol (PCL-PEG-Fru) diblock amphiphile is synthesized via Cu(I)-catalyzed click chemistry, which self-assembles with D-α-tocopheryl polyethylene glycol 1000 succinate (TPGS) into PCL-PEG-Fru/TPGS mixed micelles (PPF MM). It has been proven that glucose transporter (GLUT)5 is overexpressed in MCF-7 cells other than L929 cells. In this study, PPF MM exhibit a significantly higher uptake efficiency than fructose-free PCL-PEG-N 3 /TPGS mixed micelles in both 2D MCF-7 cells and 3D tumor spheroids. Also, the presence of free d-fructose competitively inhibits the internalization of PPF MM in MCF-7 cells other than L929 cells. PPF MM show selective tumor accumulation in MCF-7 breast tumor bearing mice xenografts. Taken together, PPF MM represent a promising nanoscale carrier system to achieve GLUT5-mediated cell specific delivery in cancer therapy. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Identifying bioindicators across trait-taxon space for assessing water quality in marine environments.

    PubMed

    Xu, Guangjian; Zhong, Xiaoxiao; Al, Mamun Abdullah; Warren, Alan; Xu, Henglong

    2018-06-01

    The response units of protozoan communities, based on a community-weighted mean (CWM) dataset across trait-taxon space, were investigated in order to determine their utility as bioindicators of marine water quality. From a total of 17 functional categories of seven biological traits, three functional response units (FRUs) were identified at correlation levels of >0.75. FRUs 1 and 3 generally dominated the communities in more polluted areas during warm seasons, while FRU2 appeared to prefer less polluted waters and dominated the communities in spring and winter. Correlation analysis demonstrated that the CWM values of FRUs 1 and 3 were significantly positively correlated to the concentrations of chemical oxygen demand (COD), whereas those of FRU2 were negatively correlated to COD. Across taxon-function space, 16 species were identified as potential bioindicators of water quality. These results suggest that redundancy analysis across trait-taxon space is a useful tool for identifying indicators of environmental quality. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Analysis of bokbunja products show they contain Rubus occidentalis L. fruit

    USDA-ARS?s Scientific Manuscript database

    This is the first report of species adulteration in a collection of commercially available bokbunja (Rubus coreanus Miquel) products sold in Korea and the US (all originated from Korea). Seventeen bokbunja products were obtained for examination, though twelve samples contained R. occidentalis L. fru...

  2. Postexercise repletion of muscle energy stores with fructose or glucose in mixed meals.

    PubMed

    Rosset, Robin; Lecoultre, Virgile; Egli, Léonie; Cros, Jérémy; Dokumaci, Ayse Sila; Zwygart, Karin; Boesch, Chris; Kreis, Roland; Schneiter, Philippe; Tappy, Luc

    2017-03-01

    Background: Postexercise nutrition is paramount to the restoration of muscle energy stores by providing carbohydrate and fat as precursors of glycogen and intramyocellular lipid (IMCL) synthesis. Compared with glucose, fructose ingestion results in lower postprandial glucose and higher lactate and triglyceride concentrations. We hypothesized that these differences in substrate concentration would be associated with a different partition of energy stored as IMCLs or glycogen postexercise. Objective: The purpose of this study was to compare the effect of isocaloric liquid mixed meals containing fat, protein, and either fructose or glucose on the repletion of muscle energy stores over 24 h after a strenuous exercise session. Design: Eight male endurance athletes (mean ± SEM age: 29 ± 2 y; peak oxygen consumption: 66.8 ± 1.3 mL · kg -1 · min -1 ) were studied twice. On each occasion, muscle energy stores were first lowered by a combination of a 3-d controlled diet and prolonged exercise. After assessment of glycogen and IMCL concentrations in vastus muscles, subjects rested for 24 h and ingested mixed meals providing fat and protein together with 4.4 g/kg fructose (the fructose condition; FRU) or glucose (the glucose condition; GLU). Postprandial metabolism was assessed over 6 h, and glycogen and IMCL concentrations were measured again after 24 h. Finally, energy metabolism was evaluated during a subsequent exercise session. Results: FRU and GLU resulted in similar IMCL [+2.4 ± 0.4 compared with +2.0 ± 0.6 mmol · kg -1 wet weight · d -1 ; time × condition (mixed-model analysis): P = 0.45] and muscle glycogen (+10.9 ± 0.9 compared with +12.3 ± 1.9 mmol · kg -1 wet weight · d -1 ; time × condition: P = 0.45) repletion. Fructose consumption in FRU increased postprandial net carbohydrate oxidation and decreased net carbohydrate storage (estimating total, muscle, and liver glycogen synthesis) compared with GLU (+117 ± 9 compared with +135 ± 9 g/6 h, respectively; P < 0.01). Compared with GLU, FRU also resulted in lower plasma glucose concentrations and decreased exercise performance the next day. Conclusions: Mixed meals containing fat, protein, and either fructose or glucose elicit similar repletion of IMCLs and muscle glycogen. Under such conditions, fructose lowers whole-body glycogen synthesis and impairs subsequent exercise performance, presumably because of lower hepatic glycogen stores. This trial was registered at clinicaltrials.gov as NCT01866215. © 2017 American Society for Nutrition.

  3. Role of Akt/PKB and PFKFB isoenzymes in the control of glycolysis, cell proliferation and protein synthesis in mitogen-stimulated thymocytes.

    PubMed

    Houddane, Amina; Bultot, Laurent; Novellasdemunt, Laura; Johanns, Manuel; Gueuning, Marie-Agnès; Vertommen, Didier; Coulie, Pierre G; Bartrons, Ramon; Hue, Louis; Rider, Mark H

    2017-06-01

    Proliferating cells depend on glycolysis mainly to supply precursors for macromolecular synthesis. Fructose 2,6-bisphosphate (Fru-2,6-P 2 ) is the most potent positive allosteric effector of 6-phosphofructo-1-kinase (PFK-1), and hence of glycolysis. Mitogen stimulation of rat thymocytes with concanavalin A (ConA) led to time-dependent increases in lactate accumulation (6-fold), Fru-2,6-P 2 content (4-fold), 6-phosphofructo-2-kinase (PFK-2)/fructose-2,6-bisphosphatase isoenzyme 3 and 4 (PFKFB3 and PFKFB4) protein levels (~2-fold and ~15-fold, respectively) and rates of cell proliferation (~40-fold) and protein synthesis (10-fold) after 68h of incubation compared with resting cells. After 54h of ConA stimulation, PFKFB3 mRNA levels were 45-fold higher than those of PFKFB4 mRNA. Although PFKFB3 could be phosphorylated at Ser461 by protein kinase B (PKB) in vitro leading to PFK-2 activation, PFKFB3 Ser461 phosphorylation was barely detectable in resting cells and only increased slightly in ConA-stimulated cells. On the other hand, PFKFB3 and PFKFB4 mRNA levels were decreased (90% and 70%, respectively) by exposure of ConA-stimulated cells to low doses of PKB inhibitor (MK-2206), suggesting control of expression of the two PFKFB isoenzymes by PKB. Incubation of thymocytes with ConA resulted in increased expression and phosphorylation of the translation factors eukaryotic initiation factor-4E-binding protein-1 (4E-BP1) and ribosomal protein S6 (rpS6). Treatment of ConA-stimulated thymocytes with PFK-2 inhibitor (3PO) or MK-2206 led to significant decreases in Fru-2,6-P 2 content, medium lactate accumulation and rates of cell proliferation and protein synthesis. These data were confirmed by using siRNA knockdown of PFKFB3, PFKFB4 and PKB α/β in the more easily transfectable Jurkat E6-1 cell line. The findings suggest that increased PFKFB3 and PFKFB4 expression, but not increased PFKFB3 Ser461 phosphorylation, plays a role in increasing glycolysis in mitogen-stimulated thymocytes and implicate PKB in the upregulation of PFKFB3 and PFKFB4. The results also support a role for Fru-2,6-P 2 in coupling glycolysis to cell proliferation and protein synthesis in this model. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. VizieR Online Data Catalog: 2FGL sources observed between 5-9GHz (Schinzel+, 2015)

    NASA Astrophysics Data System (ADS)

    Schinzel, F. K.; Petrov, L.; Taylor, G. B.; Mahony, E. K.; Edwards, P. G.; Kovalev, Yu. Y.

    2015-04-01

    A list of 216 target fields were observed with the Very Large Array (VLA). The instantaneous bandwidth was split into two parts, with one half centered at 5.0GHz (4.5-5.5GHz) and the other centered at 7.3GHz (6.8-7.8GHz); on 2012 October 26 and 2012 November 3. See section 2.1 During the first campaign with the Australia Telescope Compact Array (ATCA), from 2012 September 19-20, we observed 411 2FGL unassociated sources in a decl. range of [-90°, +10°] at 5.5 and 9GHz. The details of that observing campaign and results have been reported by Petrov et al. (2013, J/MNRAS/432/1294). We detected a total of 424 point sources. In a second ATCA campaign on 2013 September 25-28, we re-observed sources that were detected at 5GHz, but were not detected at 9GHz. See section 2.2. Follow-up observations of 149 targets selected from the VLA and ATCA survey above -30° decl. were conducted with the Very Long Baseline Array (VLBA) between 2013 Feb-Aug (VCS7 project; 4.128-4.608 and 7.392-7.872GHz simultaneously) and in 2013 Jun-Dec (campaign S5272; 7.392-7.872GHz only). See section 2.3. For sources with decl. below -30° we added 21 objects to the on-going LCS campaign (Petrov et al. 2011, J/MNRAS/414/2528) in 2013 Mar-2013 Jun at 8.200-8.520GHz. See section 2.4. (7 data files).

  5. New ATCA, ALMA and VISIR observations of the candidate LBV SK -67 266 (S61): the nebular mass from modelling 3D density distributions

    NASA Astrophysics Data System (ADS)

    Agliozzo, C.; Nikutta, R.; Pignata, G.; Phillips, N. M.; Ingallinera, A.; Buemi, C.; Umana, G.; Leto, P.; Trigilio, C.; Noriega-Crespo, A.; Paladini, R.; Bufano, F.; Cavallaro, F.

    2017-04-01

    We present new observations of the nebula around the Magellanic candidate Luminous Blue Variable S61. These comprise high-resolution data acquired with the Australia Telescope Compact Array (ATCA), the Atacama Large Millimetre/Submillimetre Array (ALMA), and the VLT Imager and Spectrometer for mid Infrared (VISIR) at the Very Large Telescope. The nebula was detected only in the radio, up to 17 GHz. The 17 GHz ATCA map, with 0.8 arcsec resolution, allowed a morphological comparison with the Hα Hubble Space Telescope image. The radio nebula resembles a spherical shell, as in the optical. The spectral index map indicates that the radio emission is due to free-free transitions in the ionized, optically thin gas, but there are hints of inhomogeneities. We present our new public code RHOCUBE to model 3D density distributions and determine via Bayesian inference the nebula's geometric parameters. We applied the code to model the electron density distribution in the S61 nebula. We found that different distributions fit the data, but all of them converge to the same ionized mass, ˜ 0.1 M⊙, which is an order of magnitude smaller than previous estimates. We show how the nebula models can be used to derive the mass-loss history with high-temporal resolution. The nebula was probably formed through stellar winds, rather than eruptions. From the ALMA and VISIR non-detections, plus the derived extinction map, we deduce that the infrared emission observed by space telescopes must arise from extended, diffuse dust within the ionized region.

  6. U.S. EPA, Pesticide Product Label, SEVIN 5% DUST, 11/19/1981

    EPA Pesticide Factsheets

    2011-04-21

    ... "e;;t~~i~:i'·:,~r:.;~. eT~;:': i:, .O~~~:~J It;;;'"lh~''I~;.rP:~,~: t;~~ ';JI.~~ n>nl~ .nd "',"'nlll frU'1 m"lh KPI>I .. d( 1',",41 r.11 and .""rv II) to 14 ...

  7. Seedling vigor in Beta vulgaris: The artistry of germination

    USDA-ARS?s Scientific Manuscript database

    Emergence and stand establishment through the first 10 weeks after planting continue to be primary concerns of sugar beet growers. Our goal is to understand the genes and genetics of seedling vigor in order to overcome beet’s inherent disadvantages of small seed size and encapsulation in a corky fru...

  8. 50 CFR 600.15 - Other acronyms.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION... management terms. (1) ABC—acceptable biological catch (2) ATCA-Atlantic Tunas Convention Act (3) BFT... advisory committee (11) FMP—fishery management plan (12) ICCAT means the International Commission for the...

  9. Freudian Notion of Psychoanalysis: Its Implications in Contemporary Teaching Practices

    ERIC Educational Resources Information Center

    Awan, Muhammad Afzal

    2017-01-01

    The author has engaged in a critical review of Frued's notion of psychoanalysis and its vitality in teaching. Illustrating from Freud's own assertions and through the interpretations of the later critics, the author has pointed out certain noticeable pitfalls and, or incapacities of contemporary teaching practices. The forces of aggression and sex…

  10. Genetic and biochemical bases of superficial scald storage disorder in apple and pear fruits

    USDA-ARS?s Scientific Manuscript database

    Superficial scald is a physiological storage disorder affecting apple and pear fruits. The disorder develops during cold storage and intensifies after removal to market temperatures. Scald symptoms result from necrosis of a few hypodermal cell layers and manifest as brown or black patches on the fru...

  11. Design of the SLAC RCE Platform: A General Purpose ATCA Based Data Acquisition System

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herbst, R.; Claus, R.; Freytag, M.

    2015-01-23

    The SLAC RCE platform is a general purpose clustered data acquisition system implemented on a custom ATCA compliant blade, called the Cluster On Board (COB). The core of the system is the Reconfigurable Cluster Element (RCE), which is a system-on-chip design based upon the Xilinx Zynq family of FPGAs, mounted on custom COB daughter-boards. The Zynq architecture couples a dual core ARM Cortex A9 based processor with a high performance 28nm FPGA. The RCE has 12 external general purpose bi-directional high speed links, each supporting serial rates of up to 12Gbps. 8 RCE nodes are included on a COB, eachmore » with a 10Gbps connection to an on-board 24-port Ethernet switch integrated circuit. The COB is designed to be used with a standard full-mesh ATCA backplane allowing multiple RCE nodes to be tightly interconnected with minimal interconnect latency. Multiple shelves can be clustered using the front panel 10-gbps connections. The COB also supports local and inter-blade timing and trigger distribution. An experiment specific Rear Transition Module adapts the 96 high speed serial links to specific experiments and allows an experiment-specific timing and busy feedback connection. This coupling of processors with a high performance FPGA fabric in a low latency, multiple node cluster allows high speed data processing that can be easily adapted to any physics experiment. RTEMS and Linux are both ported to the module. The RCE has been used or is the baseline for several current and proposed experiments (LCLS, HPS, LSST, ATLAS-CSC, LBNE, DarkSide, ILC-SiD, etc).« less

  12. Prototype Control System for Compensation of Superconducting Cavities Detuning Using Piezoelectric Actuators

    NASA Astrophysics Data System (ADS)

    Przygoda, K.; Piotrowski, A.; Jablonski, G.; Makowski, D.; Pozniak, T.; Napieralski, A.

    2009-08-01

    Pulsed operation of high gradient superconducting radio frequency (SCRF) cavities results in dynamic Lorentz force detuning (LFD) approaching or exceeding the bandwidth of the cavity of order of a few hundreds of Hz. The resulting modulation of the resonance frequency of the cavity is leading to a perturbation of the amplitude and phase of the accelerating field, which can be controlled only at the expense of RF power. Presently, at various labs, a piezoelectric fast tuner based on an active compensation scheme for the resonance frequency control of the cavity is under study. The tests already performed in the Free Electron Laser in Hamburg (FLASH), proved the possibility of Lorentz force detuning compensation by the means of the piezo element excited with the single period of sine wave prior to the RF pulse. The X-Ray Free Electron Laser (X-FEL) accelerator, which is now under development in Deutsche Elektronen-Synchrotron (DESY), will consists of around 800 cavities with a fast tuner fixture including the actuator/sensor configuration. Therefore, it is necessary to design a distributed control system which would be able to supervise around 25 RF stations, each one comprised of 32 cavities. The Advanced Telecomunications Computing Architecture (ATCA) was chosen to design, develop, and build a Low Level Radio Frequency (LLRF) controller for X-FEL. The prototype control system for Lorentz force detuning compensation was designed and developed. The control applications applied in the system were fitted to the main framework of interfaces and communication protocols proposed for the ATCA-based LLRF control system. The paper presents the general view of a designed control system and shows the first experimental results from the tests carried out in FLASH facility. Moreover, the possibilities for integration of the piezo control system to the ATCA standards are discussed.

  13. 50 CFR 300.180 - Purpose and scope.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    .... The regulations in this subpart are issued under the authority of the Atlantic Tunas Convention Act of 1975 (ATCA), Tuna Conventions Act of 1950, and Magnuson-Stevens Act. The regulations implement the recommendations of the International Commission for the Conservation of Atlantic Tunas (ICCAT) for the...

  14. 50 CFR 300.180 - Purpose and scope.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    .... The regulations in this subpart are issued under the authority of the Atlantic Tunas Convention Act of 1975 (ATCA), Tuna Conventions Act of 1950, and Magnuson-Stevens Act. The regulations implement the recommendations of the International Commission for the Conservation of Atlantic Tunas (ICCAT) for the...

  15. The Southern HII Region Discovery Survey

    NASA Astrophysics Data System (ADS)

    Wenger, Trey; Miller Dickey, John; Jordan, Christopher; Bania, Thomas M.; Balser, Dana S.; Dawson, Joanne; Anderson, Loren D.; Armentrout, William P.; McClure-Griffiths, Naomi

    2016-01-01

    HII regions are zones of ionized gas surrounding recently formed high-mass (OB-type) stars. They are among the brightest objects in the sky at radio wavelengths. HII regions provide a useful tool in constraining the Galactic morphological structure, chemical structure, and star formation rate. We describe the Southern HII Region Discovery Survey (SHRDS), an Australia Telescope Compact Array (ATCA) survey that discovered ~80 new HII regions (so far) in the Galactic longitude range 230 degrees to 360 degrees. This project is an extension of the Green Bank Telescope HII Region Discovery Survey (GBT HRDS), Arecibo HRDS, and GBT Widefield Infrared Survey Explorer (WISE) HRDS, which together discovered ~800 new HII regions in the Galactic longitude range -20 degrees to 270 degrees. Similar to those surveys, candidate HII regions were chosen from 20 micron emission (from WISE) coincident with 10 micron (WISE) and 20 cm (SGPS) emission. By using the ATCA to detect radio continuum and radio recombination line emission from a subset of these candidates, we have added to the population of known Galactic HII regions.

  16. Purification, Cloning, Characterization, and N-Glycosylation Analysis of a Novel β-Fructosidase from Aspergillus oryzae FS4 Synthesizing Levan- and Neolevan-Type Fructooligosaccharides

    PubMed Central

    Lu, Lili; Jin, Lan; Liu, Jiawei; Song, Deyong; Guo, Zhongwu; Xiao, Min

    2014-01-01

    β-Fructosidases are a widespread group of enzymes that catalyze the hydrolysis of terminal fructosyl units from various substrates. These enzymes also exhibit transglycosylation activity when they function with high concentrations of sucrose, which is used to synthesize fructooligosaccharides (FOS) in the food industry. A β-fructosidase (BfrA) with high transglycosylation activity was purified from Aspergillus oryzae FS4 as a monomeric glycoprotein. Compared with the most extensively studied Aspergillus spp. fructosidases that synthesize inulin-type β-(2-1)-linked FOS, BfrA has unique transfructosylating property of synthesizing levan- and neolevan-type β-(2-6)-linked FOS. The coding sequence (bfrAFS4, 1.86 kb) of BfrA was amplified and expressed in Escherichia coli and Pichia pastoris. Both native and recombinant proteins showed transfructosylation and hydrolyzation activities with broad substrate specificity. These proteins could hydrolyze the following linkages: Glc α-1, 2-β Fru; Glc α-1, 3-α Fru; and Glc α-1, 5-β Fru. Compared with the unglycosylated E. coli-expressed BfrA (E.BfrA), the N-glycosylated native (N.BfrA) and the P. pastoris-expressed BfrA (P.BfrA) were highly stable at a wide pH range (pH 4 to 11), and significantly more thermostable at temperatures up to 50°C with a maximum activity at 55°C. Using sucrose as substrate, the Km and kcat values for total activity were 37.19±5.28 mM and 1.0016±0.039×104 s−1 for N.BfrA. Moreover, 10 of 13 putative N-glycosylation sites were glycosylated on N.BfrA, and N-glycosylation was essential for enzyme thermal stability and optima activity. Thus, BfrA has demonstrated as a well-characterized A. oryzae fructosidase with unique transfructosylating capability of synthesizing levan- and neolevan-type FOS. PMID:25501957

  17. Biosynthesis of l-Sorbose and l-Psicose Based on C—C Bond Formation Catalyzed by Aldolases in an Engineered Corynebacterium glutamicum Strain

    PubMed Central

    Yang, Jiangang; Li, Jitao; Men, Yan; Zhu, Yueming; Zhang, Ying; Ma, Yanhe

    2015-01-01

    The property of loose stereochemical control at aldol products from aldolases helped to synthesize multiple polyhydroxylated compounds with nonnatural stereoconfiguration. In this study, we discovered for the first time that some fructose 1,6-diphosphate aldolases (FruA) and tagatose 1,6-diphosphate (TagA) aldolases lost their strict stereoselectivity when using l-glyceraldehyde and synthesized not only l-sorbose but also a high proportion of l-psicose. Among the aldolases tested, TagA from Bacillus licheniformis (BGatY) showed the highest enzyme activity with l-glyceraldehyde. Subsequently, a “one-pot” reaction based on BGatY and fructose-1-phosphatase (YqaB) generated 378 mg/liter l-psicose and 199 mg/liter l-sorbose from dihydroxyacetone-phosphate (DHAP) and l-glyceraldehyde. Because of the high cost and instability of DHAP, a microbial fermentation strategy was used further to produce l-sorbose/l-psicose from glucose and l-glyceraldehyde, in which DHAP was obtained from glucose through the glycolytic pathway, and some recombination pathways based on FruA or TagA and YqaB were constructed in Escherichia coli and Corynebacterium glutamicum strains. After evaluation of different host cells and combinations of FruA or TagA with YqaB and optimization of gene expression, recombinant C. glutamicum strain WT(pXFTY) was selected and produced 2.53 g/liter total ketoses, with a yield of 0.50 g/g l-glyceraldehyde. Moreover, deletion of gene cgl0331, encoding the Zn-dependent alcohol dehydrogenase in C. glutamicum, was confirmed for the first time to significantly decrease conversion of l-glyceraldehyde to glycerol and to increase yield of target products. Finally, fed-batch culture of strain SY14(pXFTY) produced 3.5 g/liter l-sorbose and 2.3 g/liter l-psicose, with a yield of 0.61 g/g l-glyceraldehyde. This microbial fermentation strategy also could be applied to efficiently synthesize other l-sugars. PMID:25888171

  18. 50 CFR 300.180 - Purpose and scope.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... Purpose and scope. The regulations in this subpart are issued under the authority of the Atlantic Tunas Convention Act of 1975 (ATCA), Tuna Conventions Act of 1950, and Magnuson-Stevens Act. The regulations implement the recommendations of the International Commission for the Conservation of Atlantic Tunas (ICCAT...

  19. 50 CFR 300.180 - Purpose and scope.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... Purpose and scope. The regulations in this subpart are issued under the authority of the Atlantic Tunas Convention Act of 1975 (ATCA), Tuna Conventions Act of 1950, and Magnuson-Stevens Act. The regulations implement the recommendations of the International Commission for the Conservation of Atlantic Tunas (ICCAT...

  20. 50 CFR 300.180 - Purpose and scope.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Purpose and scope. The regulations in this subpart are issued under the authority of the Atlantic Tunas Convention Act of 1975 (ATCA), Tuna Conventions Act of 1950, and Magnuson-Stevens Act. The regulations implement the recommendations of the International Commission for the Conservation of Atlantic Tunas (ICCAT...

  1. 50 CFR 635.1 - Purpose and scope.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ..., DEPARTMENT OF COMMERCE ATLANTIC HIGHLY MIGRATORY SPECIES General § 635.1 Purpose and scope. (a) The regulations in this part govern the conservation and management of Atlantic tunas, Atlantic billfish, Atlantic sharks, and Atlantic swordfish under the authority of the Magnuson-Stevens Act and ATCA. They implement...

  2. Real-time plasma control based on the ISTTOK tomography diagnostica)

    NASA Astrophysics Data System (ADS)

    Carvalho, P. J.; Carvalho, B. B.; Neto, A.; Coelho, R.; Fernandes, H.; Sousa, J.; Varandas, C.; Chávez-Alarcón, E.; Herrera-Velázquez, J. J. E.

    2008-10-01

    The presently available processing power in generic processing units (GPUs) combined with state-of-the-art programmable logic devices benefits the implementation of complex, real-time driven, data processing algorithms for plasma diagnostics. A tomographic reconstruction diagnostic has been developed for the ISTTOK tokamak, based on three linear pinhole cameras each with ten lines of sight. The plasma emissivity in a poloidal cross section is computed locally on a submillisecond time scale, using a Fourier-Bessel algorithm, allowing the use of the output signals for active plasma position control. The data acquisition and reconstruction (DAR) system is based on ATCA technology and consists of one acquisition board with integrated field programmable gate array (FPGA) capabilities and a dual-core Pentium module running real-time application interface (RTAI) Linux. In this paper, the DAR real-time firmware/software implementation is presented, based on (i) front-end digital processing in the FPGA; (ii) a device driver specially developed for the board which enables streaming data acquisition to the host GPU; and (iii) a fast reconstruction algorithm running in Linux RTAI. This system behaves as a module of the central ISTTOK control and data acquisition system (FIRESIGNAL). Preliminary results of the above experimental setup are presented and a performance benchmarking against the magnetic coil diagnostic is shown.

  3. 77 FR 69593 - Atlantic Highly Migratory Species; Exempted Fishing, Scientific Research, Display, and Chartering...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-20

    ... platforms while conducting the specified research. As an example, NMFS has considered the recreational and... research and is therefore exempt from regulation. Examples of research conducted under LOAs include tagging... life history studies. Scientific research is not exempt from regulation under ATCA. NMFS issues SRPs...

  4. 78 FR 69823 - Atlantic Highly Migratory Species; Exempted Fishing, Scientific Research, Display, and Chartering...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-21

    ... the specified research. For example, in the past, NMFS has determined that commercial pelagic longline... activity meets the definition of research. Examples of research conducted under LOAs include tagging and... studies. Scientific research is not exempt from regulation under ATCA. NMFS issues SRPs which authorize...

  5. Radio re-brightening of MAXI J1535-571 as it transitions back towards the hard state

    NASA Astrophysics Data System (ADS)

    Russell, T. D.; Altamirano, D.; Tetarenko, A. J.; Sivakoff, G. R.; Neilsen, J.; Miller-Jones, J. C. A.; van den Eijnden, J.; Jacpot Xrb Collaboration

    2017-10-01

    As part of an ongoing Australia Telescope Compact Array (ATCA) campaign monitoring the current outburst of MAXI J1535-571, we observed the source on 2017 October 25 between 06:09 UT and 09:24 UT (MJD 58051.32 +/- 0.07).

  6. 77 FR 44161 - Atlantic Highly Migratory Species; 2012 Atlantic Bluefin Tuna Quota Specifications

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-27

    ... Convention Act (ATCA), and to achieve domestic management objectives under the Magnuson-Stevens Fishery Conservation and Management Act (Magnuson-Stevens Act). DATES: Effective August 27, 2012 through December 31... Review, and Final Regulatory Flexibility Analysis, as well as others, such as the Fishery Management...

  7. Sugar-sweetened beverage intake associations with fasting glucose and insulin concentrations are not modified by selected genetic variants in a ChREBP-FGF21 pathway: A meta-analysis

    USDA-ARS?s Scientific Manuscript database

    Sugar-sweetened beverages (SSBs) are a major dietary contributor to fructose intake. A molecular pathway involving the carbohydrate responsive element-binding protein (ChREBP) and the metabolic hormone fibroblast growth factor 21 (FGF21) may influence sugar metabolism and, thereby, contribute to fru...

  8. Modelling of carrying capacity in National Park - Fru\\vska Gora (Serbia) case study

    NASA Astrophysics Data System (ADS)

    Vujko, Aleksandra; Plavša, Jovan; Petrović, Marko D.; Radovanović, Milan; Gajić, Tamara

    2017-03-01

    Negative effects of tourism development in a destination are usually the consequence of the high concentration of tourists, accommodation facilities and the activities that are practiced in a relatively restricted area. One of the most important measures to protect the areas is to calculate the maximum number of tourists that can simultaneously reside in a region, i.e. the determination of the carrying capacity. This paper outlines a method for determining carrying capacity based on zoning of environmental resources and zoning within a region. The paper argues for a return to the idea of identifying maximum appropriate number of users. The main hypothesis of the paper is based on the statement that the development of tourism in Fru\\vska Gora (Mountain) National Park in Northern Serbia must be in accordance with the basic principles of sustainability, including the determination of carrying capacity. The main research goal was to show the opinion of local residents about the uncontrolled development of tourism, and to determine the carrying capacity in four sports and recreational zones of the mountain. The carrying capacity of the area is calculated by Lavery and Stanev formulas.

  9. The peculiar cluster MACS J0417.5-1154 in the C and X-bands

    NASA Astrophysics Data System (ADS)

    Sandhu, Pritpal; Malu, Siddharth; Raja, Ramij; Datta, Abhirup

    2018-06-01

    We present 5.5 and 9.0 GHz Australia Telescope Compact Array (ATCA) observations of the cluster MACSJ0417.5-1154, one of the most massive galaxy clusters and one of the brightest in X-ray in the Massive Cluster Survey (MACS). We estimate diffuse emission at 5.5 and 9.0 GHz from our ATCA observations, and compare the results with the 235 MHz and 610 MHz GMRT observations and 1575 MHz VLA observations. We also estimate the diffuse emission at low frequencies from existing GLEAM survey data (using the MWA telescope (http://www.mwatelescope.org)), and find that the steepening reported in earlier studies may have been an artefact of underestimates of diffuse emission at low frequencies. High-frequency radio observations of galaxy cluster mergers therefore provide an important complement to low-frequency observations, not only for a probing the `on' and `off' state of radio halos in these mergers, but also to constrain energetics of cluster mergers. We comment on the future directions that further studies of this cluster can take.

  10. Design and implementation of ATCA-based 100Gbps DP-QPSK optical signal test instrument

    NASA Astrophysics Data System (ADS)

    Su, Shaojing; Qin, Jiangyi; Huang, Zhiping; Liu, Chenwu

    2014-11-01

    In order to achieve the receiving task of 100Gbps Dual Polarization-Quadrature Phase Shift Keying (DP-QPSK) optical signal acquisition instrument, improve acquisition performance of the instrument, this paper has deeply researched DP-QPSK modulation principles, demodulation techniques and the key technologies of optical signal acquisition. The theories of DP-QPSK optical signal transmission are researched. The DP-QPSK optical signal transmission model is deduced. And the clock and data recovery in high-speed data acquisition and offset correction of multi-channel data are researched. By reasonable hardware circuit design and software system construction, the utilization of high performance Advanced Telecom Computing Architecture (ATCA), this paper proposes a 100Gbps DP-QPSK optical signal acquisition instrument which is based on ATCA. The implementations of key modules are presented by comparison and argumentation. According to the modularization idea, the instrument can be divided into eight modules. Each module performs the following functions. (1) DP-QPSK coherent detection demodulation module; (2) deceleration module; (3) FPGA (Field Programmable Gate Array); (4) storage module; (5) data transmission module; (6) clock module; (7) power module; (8) JTAG debugging, configuration module; What is more, this paper has put forward two solutions to test optical signal acquisition instrument performance. The first scenario is based on a standard STM-256 optical signal format and exploits the SignalTap of QuartusII software to monitor the optical signal data. Another scenario is to use a pseudo-random signal series to generate data, acquisition module acquires a certain amount of data signals, and then the signals are transferred to a computer by the Gigabit Ethernet to analyze. Two testing results show that the bit error rate of optical signal acquisition instrument is low. And the instrument fully meets the requirements of signal receiving system. At the same time this design has an important significance in practical applications.

  11. Assessment of the Concentrations of Various Advanced Glycation End-Products in Beverages and Foods That Are Commonly Consumed in Japan

    PubMed Central

    Takeuchi, Masayoshi; Takino, Jun-ichi; Furuno, Satomi; Shirai, Hikari; Kawakami, Mihoko; Muramatsu, Michiru; Kobayashi, Yuka; Yamagishi, Sho-ichi

    2015-01-01

    Dietary consumption has recently been identified as a major environmental source of pro-inflammatory advanced glycation end-products (AGEs) in humans. It is disputed whether dietary AGEs represent a risk to human health. Nε-(carboxymethyl)lysine (CML), a representative AGE compound found in food, has been suggested to make a significant contribution to circulating CML levels. However, recent studies have found that the dietary intake of AGEs is not associated with plasma CML concentrations. We have shown that the serum levels of glyceraldehyde-derived AGEs (Glycer-AGEs), but not hemoglobin A1c, glucose-derived AGEs (Glu-AGEs), or CML, could be used as biomarkers for predicting the progression of atherosclerosis and future cardiovascular events. We also detected the production/accumulation of Glycer-AGEs in normal rats administered Glu-AGE-rich beverages. Therefore, we assessed the concentrations of various AGEs in a total of 1,650 beverages and foods that are commonly consumed in Japan. The concentrations of four kinds of AGEs (Glu-AGEs, fructose-derived AGEs (Fru-AGEs), CML, and Glycer-AGEs) were measured with competitive enzyme-linked immunosorbent assays involving immunoaffinity-purified specific antibodies. The results of the latter assays indicated that Glu-AGEs and Fru-AGEs (especially Glu-AGEs), but not CML or Glycer-AGEs, are present at appreciable levels in beverages and foods that are commonly consumed by Japanese. Glu-AGEs, Fru-AGEs, CML, and Glycer-AGEs exhibited concentrations of ≥85%, 2–12%, <3%, and trace amounts in the examined beverages and ≥82%, 5–15%, <3%, and trace amounts in the tested foods, respectively. The results of the present study indicate that some lactic acid bacteria beverages, carbonated drinks, sugar-sweetened fruit drinks, sports drinks, mixed fruit juices, confectionery (snacks), dried fruits, cakes, cereals, and prepared foods contain markedly higher Glu-AGE levels than other classes of beverages and foods. We provide useful data on the concentrations of various AGEs, especially Glu-AGEs, in commonly consumed beverages and foods. PMID:25730321

  12. 78 FR 20258 - Atlantic Highly Migratory Species; Atlantic Bluefin Tuna Fisheries

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-04

    ... landings data. The adjusted limit for HMS Charter/Headboat vessels is one school BFT and one large school... regulations. NMFS is required under ATCA and the Magnuson-Stevens Act to provide U.S. fishing vessels with a... default Angling category daily retention limit of one school, large school, or small medium BFT (measuring...

  13. 76 FR 56120 - Atlantic Highly Migratory Species; North and South Atlantic Swordfish Quotas

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-12

    ... Contracting Parties. Contracting Parties may restrict fishermen to a minimum size of 25 kg live weight OR 125... restrict fishermen to a minimum size of 15 kg live weight OR 119 cm LJFL with no tolerance. In 2009, NMFS... quota, among other things. Per the ATCA, the United States is obligated to implement ICCAT-approved...

  14. Characterization of a restriction-modification system of the thermotolerant methylotroph Bacillus methanolicus.

    PubMed Central

    Cue, D; Lam, H; Hanson, R S; Flickinger, M C

    1996-01-01

    We report the isolation of a restriction endonuclease, BmeTI, an isoschizomer of BclI, that recognizes the DNA sequence 5' TGATCA 3'. We also report that BmeTI sites are modified to TGm6ATCA. These findings provide the basis for devising strategies to prevent BmeTI restriction of any DNA introduced into Bacillus methanolicus. PMID:8975604

  15. Cost model relationships between textile manufacturing processes and design details for transport fuselage elements

    NASA Technical Reports Server (NTRS)

    Metschan, Stephen L.; Wilden, Kurtis S.; Sharpless, Garrett C.; Andelman, Rich M.

    1993-01-01

    Textile manufacturing processes offer potential cost and weight advantages over traditional composite materials and processes for transport fuselage elements. In the current study, design cost modeling relationships between textile processes and element design details were developed. Such relationships are expected to help future aircraft designers to make timely decisions on the effect of design details and overall configurations on textile fabrication costs. The fundamental advantage of a design cost model is to insure that the element design is cost effective for the intended process. Trade studies on the effects of processing parameters also help to optimize the manufacturing steps for a particular structural element. Two methods of analyzing design detail/process cost relationships developed for the design cost model were pursued in the current study. The first makes use of existing databases and alternative cost modeling methods (e.g. detailed estimating). The second compares design cost model predictions with data collected during the fabrication of seven foot circumferential frames for ATCAS crown test panels. The process used in this case involves 2D dry braiding and resin transfer molding of curved 'J' cross section frame members having design details characteristic of the baseline ATCAS crown design.

  16. THE AUSTRALIA TELESCOPE COMPACT ARRAY H I SURVEY OF THE GALACTIC CENTER

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McClure-Griffiths, N. M.; Green, J. A.; Dickey, J. M.

    2012-03-01

    We present a survey of atomic hydrogen (H I) emission in the direction of the Galactic Center (GC) conducted with the CSIRO Australia Telescope Compact Array (ATCA). The survey covers the area -5 Degree-Sign {<=} l {<=} +5 Degree-Sign , -5 Degree-Sign {<=} b {<=} +5 Degree-Sign over the velocity range -309 km s{sup -1} {<=} v{sub LSR} {<=} 349 km s{sup -1} with a velocity resolution of 1 km s{sup -1}. The ATCA data are supplemented with data from the Parkes Radio Telescope for sensitivity to all angular scales larger than the 145'' angular resolution of the survey. Themore » mean rms brightness temperature across the field is 0.7 K, except near (l, b) = 0 Degree-Sign , 0 Degree-Sign where it increases to {approx}2 K. This survey complements the Southern Galactic Plane Survey to complete the continuous coverage of the inner Galactic plane in H I at {approx}2' resolution. Here, we describe the observations and analysis of this GC survey and present the final data product. Features such as Bania's Clump 2, the far 3 kpc arm, and small high-velocity clumps are briefly described.« less

  17. ATCA follow-up of blazar candidates in the H-ATLAS fields

    NASA Astrophysics Data System (ADS)

    Massardi, Marcella; Ricci, Roberto; de Zotti, Gianfranco; White, Glenn; Michalowski, Michal; Ivison, Rob; Baes, Maarten; Lapi, Andrea; Temi, Pasquale; Lopez-Caniego, Marcos; Herranz, Diego; Seymour, Nick; Gonzalez-Nuevo, Joaquin; Bonavera, Laura; Negrello, Mattia

    2012-04-01

    The Herschel-ATLAS (H-ATLAS) survey that is covering 550 sq.deg. in 5 bands from 100 to 500 micron, allows for the first time a flux limited selection of blazars at sub-mm wavelengths. This wavelength range is particularly interesting because it is where the most luminous blazars are expected to show the synchrotron peak. The peak frequency and luminosity carry key information on the blazar physics. However, blazars constitute a tiny fraction of H-ATLAS sources and therefore picking them up isn't easy. A criterion to efficiently select candidate blazars exploiting the roughly flat blazar continuum spectrum from radio to sub-mm wavelengths has been devised by Lopez-Caniego et al. (in prep.). Multifrequency radio follow-up is however a necessary step to assess the nature of candidates. We propose to complete the validation of candidates in the H-ATLAS equatorial fields (partly done during few hours of ATCA DDT allocated time and with Medicina radiotelescope observations) and to extend the investigation to the Southern (SGP) fields reconstructing the blazars SED between 1.1 and 40 GHz. This will provide the first statistically significant blazar sample selected at sub-mm wavelengths.

  18. Evolution of the Alpine Tethys (Sava) suture zone in Fruška Gora Mountains (N Serbia): from orogenic building to tectonic omissions

    NASA Astrophysics Data System (ADS)

    Toljić, Marinko; Matenco, Liviu; ĐErić, Nevenka; Milivojević, Jelena; Gerzina, Nataša.; Stojadinović, Uros

    2010-05-01

    The Fru\\vska Gora Mountains in northern Serbia offers an unique opportunity to study the Cretaceous-Eocene evolution of the NE part of the Dinarides, which is largely covered elsewhere beneath the thick Miocene sediments of the Pannonian basin, deposited during the back-arc collapse associated with the subduction and roll-back recorded in the external Carpathians. The structural grain of the Fru\\vska Gora Mountains is the one of a large scale antiform, exposing a complex puzzle of highly deformed metamorphic rocks in its centre and Triassic-Miocene sequence of non-metamorphosed sediments, ophiolites and volcanics along its flanks. The metamorphic rocks were the target of structural investigations coupled with paleontological dating (conodonts, palynomorphs and radiolarians) in an effort to unravel the geodynamic evolution of an area thought to be located near the suture zone between the Tisza upper plate and the Adriatic lower plate, i.e. the Sava subduction zone of the Dinarides (e.g., Pamic, 2002; Schmid et al., 2008). The existence of this subduction zone was previously inferred here by local observations, such as metamorphosed Mesozoic sediments containing Middle Triassic conodonts (Đurđanović, 1971) or Early Cretaceous blue schists metamorphism (123±5 Ma, Milovanović et al., 1995). The metamorphic sequence is characterized by a Paleozoic age meta-sedimentary basement which contains palynomorphs of Upper Paleozoic - Carboniferous age and a meta-sedimentary and meta-volcanic sequence which contain a succession of contrasting metamorphosed lithologies such sandstones, black limestones, shallow water white limestones, basic volcanic sequences, deep nodular limestiones, radiolarites, meta-ophiolites and turbiditic sequences. The lower part of the sequence is contrastingly similar with the Triassic cover of the Drina-Ivanijca thrust sheet and its metamorphosed equivalent observed in the Kopaonik and Studenica series (Schefer et al., in press). This observation is supported by the newly found micro-fauna of Upper Triassic in age in the meta-sandstones associated with meta-volcanics on the SW slopes of the mountain. The upper part of the sequence display metamorphosed "flysh"-type of sequences and meta-basalts. In these deposits, slightly metamorphosed siliciclastics (lithic sandstones with volcanic-derived clasts) previously interpreted as Upper Jurassic mélange have proved to contain Upper Cretaceous palynomorphs. Among the rocks exposed in the metamorphic core of the mountains, the SW slope of Fru\\vska Gora offers the optimal locality for the study of the kinematic evolution. Here, four phases of folding have been mapped, being associated mainly with large-scale regional contraction. The first phase is characterized by isoclinal folding, with reconstructed SW vergence. The second generation of E-W oriented and coaxial folds is asymmetric and is up to metres in size, displaying a south vergence and has largely refolded the previous generation. The third event was responsible for the formation of upright folds, yet again E-W oriented, re-folding earlier structures. The first two phases of folding are associated with metamorphic conditions, while the third was apparently near the transition with the brittle domain. The relationship with a fourth folding event observed also in the non-metamorphosed clastic-carbonate rocks is rather uncertain, but is apparently associated with the present day antiformal structure of the Fuska Gora Mountains. Interestingly, the metamorphosed Triassic and Upper Cretaceous carbonatic-clastic sequence in the core of the antiform is in structural contact along the antiformal flanks with Lower-Middle Triassic and Upper Cretaceous-Paleogene sediments which display the same facies, but these are not metamorphosed. This demonstrates a large scale tectonic omission along the flanks of the Fru\\vska Gora antiform, 9-10km of rocks being removed by what we speculatively define as an extensional detachment exhuming the metamorphic core. This detachment has been subsequently folded into the present-day antiformal geometry of the Fru\\vska Gora Mountains. These findings demonstrate that the metamorphic and non-metamorphic Upper Cretaceous - Paleogene clastic-carbonate sediments belongs to the main Alpine Tethys (Sava) subduction zone of the Dinarides. The Paleozoic-Triassic metamorphic and non-metamorphic rocks belong to the distal Adriatic lower plate, or more precisely to the Jadar-Kopaonik composite thrust sheet (Schmid et al., 2008), while the layer of serpentinized peridotite found at their contact most probably belongs to the Western Vardar ophiolites obducted over the Adriatic plate during Late Jurassic - Earliest Cretaceous. The distal Jadar-Kopaonik composite unit was partly affected by strong contractional deformation and a Late Eocene greenschist facies metamorphism during the main phase of subduction and collision, similarly to what has been observed elsewhere in the Dinarides (Pamić, 2002; Schefer et al., in press). A Miocene phase of core-complex formation was responsible for the large tectonic omission observed, being probably followed by the formation of a wide open antiformal structure during the Pliocene-Quaternary inversion of the Pannonian basin.

  19. Effect of the gene transformer of Anastrepha on the somatic sexual development of Drosophila.

    PubMed

    Ruiz, María-Fernanda; Sánchez, Lucas

    2010-01-01

    The gene transformer (tra) is the key regulatory memory device for sex determination in tephritid insects. The present manuscript addressed the question about the functional conservation of the tephritid Anastrepha Transformer protein to direct somatic sexual development in Drosophila (Drosophilidae). The transformer cDNA of Anastrepha encoding the putative full-length Tra protein was cloned in pUAST and introduced into Drosophila melanogaster. To express this protein, the GAL4-UAS system was used. The Anastrepha Tra protein induced the female-specific splicing of both dsx and fru pre-mRNAs in Drosophila XY male flies, so that these became transformed into females, though this transformation was incomplete (the sexually dimorphic foreleg basitarsus and the external terminalia were monitored). It was found that the degree of female transformation directly depended on the dose of Anastrepha tra and Drosophila transformer-2 (tra-2) genes, and that the Anastrepha Tra-Drosophila Tra2 complex is not as efficient as the Drosophila Tra-Tra2 complex at inducing the female-specific splicing of Drosophila dsx pre-mRNA. This can explain why the Anastrepha Tra protein cannot fully substitute for the endogenous Drosophila Tra protein.

  20. Intake of high fructose corn syrup sweetened soft drinks is associated with prevalent chronic bronchitis in U.S. Adults, ages 20-55 y.

    PubMed

    DeChristopher, Luanne Robalo; Uribarri, Jaime; Tucker, Katherine L

    2015-10-16

    High fructose corn syrup (HFCS) sweetened soft drink intake has been linked with asthma in US high-schoolers. Intake of beverages with excess free fructose (EFF), including apple juice, and HFCS sweetened fruit drinks and soft drinks, has been associated with asthma in children. One hypothesis for this association is that underlying fructose malabsorption and fructose reactivity in the GI may contribute to in situ formation of enFruAGEs. EnFruAGEs may be an overlooked source of advanced glycation end-products (AGE) that contribute to lung disease. AGE/ RAGEs are elevated in COPD lungs. EFF intake has increased in recent decades, and intakes may exceed dosages associated with adult fructose malabsorption in subsets of the population. Intestinal dysfunction has been shown to be elevated in COPD patients. The objective of this study was to investigate the association between HFCS sweetened soft drink intake and chronic bronchitis (CB), a common manifestation of COPD, in adults. In this cross sectional analysis, the outcome variable was self-reported existing chronic bronchitis or history of CB. Exposure variable was non-diet soda. Rao Scott Ҳ(2) was used for prevalence differences and logistic regression for associations, adjusted for age, sex, race-ethnicity, BMI, smoking, exposure to in-home smoking, pre-diabetes, diabetes, SES, total energy and total fruits and beverages consumption. Data are from the National Health and Nutrition Examination Survey 2003-2006. 2801 adults aged 20-55 y. There was a statistically significant correlation between intake of non-diet soft drinks and greater prevalence and odds of chronic bronchitis (p < 0.05). Independent of all covariates, intake of non-diet soda ≥5 times a week (vs. non/low non-diet soda) was associated with nearly twice the likelihood of having chronic bronchitis (OR = 1.80; p = 0.047; 95% CI 1.01-3.20). HFCS sweetened soft drink intake is correlated with chronic bronchitis in US adults aged 20-55 y, after adjusting for covariates, including smoking. Results support the hypothesis that underlying fructose malabsorption and fructose reactivity in the GI may contribute to chronic bronchitis, perhaps through in situ formation of enFruAGEs, which may contribute to lung disease. Longitudinal and biochemical research is needed to confirm and clarify the mechanisms involved.

  1. Numerical investigation of split flows by gravity currents into two-layered stratified water bodies

    NASA Astrophysics Data System (ADS)

    Cortés, A.; Wells, M. G.; Fringer, O. B.; Arthur, R. S.; Rueda, F. J.

    2015-07-01

    The behavior of a two-dimensional (2-D) gravity current impinging upon a density step in a two-layered stratified basin is analyzed using a high-resolution Reynolds-Averaged Navier-Stokes model. The gravity current splits at the density step, and the portion of the buoyancy flux becoming an interflow is largely controlled by the vertical distribution of velocity and density within the gravity current and the magnitude of the density step between the two ambient layers. This is in agreement with recent laboratory observations. The strongest changes in the ambient density profiles occur as a result of the impingement of supercritical currents with strong density contrasts, for which a large portion of the gravity current detaches from the bottom and becomes an interflow. We characterize the current partition process in the simulated experiments using the densimetric Froude number of the current (Fr) across the density step (upstream and downstream). When underflows are formed, more supercritical currents are observed downstream of the density step compared to upstream (Fru < Frd), and thus, stronger mixing of the current with the ambient water downstream. However, when split flows and interflows are formed, smaller Fr values are identified after the current crosses the density step (Fru > Frd), which indicates lower mixing between the current and ambient water after the impingement due to the significant stripping of interfacial material at the density step.

  2. Observing the Birth and evolution of Galaxies - the ATCA-AKARI-ASTE/AzTEC deep South Ecliptic Pole Field

    NASA Astrophysics Data System (ADS)

    White, Glenn; Kohno, Kotaro; Matsuhara, Hideo; Matsuura, Shuji; Hanami, Hitoshi; Lee, Hyung Mok; Pearson, Chris; Takagi, Toshi; Serjeant, Stephen; Jeong, Woongseob; Oyabu, Shinki; Shirahata, Mai; Nakanishi, Kouichiro; Figueredo, Elysandra; Etxaluze, Mireya

    2007-04-01

    We propose deep 20 cm observations supporting the AKARI (3-160 micron)/ASTE/AzTEC (1.1 mm) SEP ultra deep ('Oyabu Field') survey of an extremely low cirrus region at the South Ecliptic Pole. Our combined IR/mm/Radio survey addresses the questions: How do protogalaxies and protospheroids form and evolve? How do AGN link with ULIRGs in their birth and evolution? What is the nature of the mm/submm extragalactic source population? We will address these by sampling the star formation history in the early universe to at least z~2. Compared to other Deep Surveys, a) AKARI multi-band IR measurements allow precision photo-z estimates of optically obscured objects, b) our multi-waveband contiguous area will mitigate effects of cosmic variance, c) the low cirrus noise at the SEP (< 0.08 MJy/sr) rivals that of the Lockman Hole "Astronomy's other ultra-deep 'cosmological window'", and d) our coverage of four FIR bands will characterise the far-IR dust emission hump of our starburst galaxies better than SPITZER's two MIPS bands allow. The ATCA data are crucial to galaxy identification, and determining the star formation rates and intrinsic luminosities through this unique Southern cosmological window.

  3. On the radio properties of the intermediate-mass black hole candidate ESO 243-49 HLX-1

    NASA Astrophysics Data System (ADS)

    Cseh, D.; Webb, N. A.; Godet, O.; Barret, D.; Corbel, S.; Coriat, M.; Falcke, H.; Farrell, S. A.; Körding, E.; Lenc, E.; Wrobel, J. M.

    2015-02-01

    We present follow-up radio observations of ESO 243-49 HLX-1 from 2012 using the Australia Telescope Compact Array (ATCA) and the Karl G. Jansky Very Large Array (VLA). We report the detection of radio emission at the location of HLX-1 during its hard X-ray state using the ATCA. Assuming that the `Fundamental Plane' of accreting black holes is applicable, we provide an independent estimate of the black hole mass of M_{BH}≤ 2.8^{+7.5}_{-2.1} × 106 M⊙ at 90 per cent confidence. However, we argue that the detected radio emission is likely to be Doppler-boosted and our mass estimate is an upper limit. We discuss other possible origins of the radio emission such as being due to a radio nebula, star formation, or later interaction of the flares with the large-scale environment. None of these were found adequate. The VLA observations were carried out during the X-ray outburst. However, no new radio flare was detected, possibly due to a sparse time sampling. The deepest, combined VLA data suggest a variable radio source and we briefly discuss the properties of the previously detected flares and compare them with microquasars and active galactic nuclei.

  4. VizieR Online Data Catalog: Southern H II Region Discovery Survey: pilot survey (Brown+, 2017)

    NASA Astrophysics Data System (ADS)

    Brown, C.; Jordan, C.; Dickey, J. M.; Anderson, L. D.; Armentrout, W. P.; Balser, D. S.; Bania, T. M.; Dawson, J. R.; Mc Clure-Griffiths, N. M.; Wenger, T. V.

    2018-05-01

    The Southern H II Region Discovery Survey (SHRDS) is a multi-year project using the Australia Telescope Compact Array (ATCA) to complement the GBT and Arecibo HRDS by extending the survey area into the southern sky (δ<-45°). This area includes the Southern end of the Galactic Bar, the Near and Far 3 kpc Arms, the Norma/Cygnus Arm, the Scutum/Crux Arm, the Sagitttarius/Carina Arm, and outside the solar circle, the Perseus Arm, and the Outer Arm. All pilot SHRDS observations used the ATCA in the five antenna H75 array configuration, giving a nominal maximum baseline of 75 m and a beam size of FWHM ~65" at 7.8 GHz depending on the declination and hour angles of the observations. The SHRDS pilot observations were done in two sessions. Epoch I, observed 2013 June 30, focused on candidates that were expected to show bright radio recombination line (RRL) detections, which they did. Epoch II, observed 2014 June 26 and 27, used a list of candidates with expected flux densities typical of the SHRDS catalog as a whole. The two epochs also used different longitude ranges in order to generate samples of H II regions with different Galactic radii. (3 data files).

  5. Effects of grazing on leaf area index, fractional cover and evapotranspiration by a desert phreatophyte community at a former uranium mill site on the Colorado Plateau

    USGS Publications Warehouse

    Bresloff, Cynthia J.; Nguyen, Uyen; Glenn, Edward P.; Waugh, Jody; Nagler, Pamela L.

    2013-01-01

    This study employed ground and remote sensing methods to monitor the effects of grazing on leaf area index (LAI), fractional cover (fc) and evapotranspiration (ET) of a desert phreatophyte community over an 11 year period at a former uranium mill site on the Colorado Plateau, U.S. Nitrate, ammonium and sulfate are migrating away from the mill site in a shallow alluvial aquifer. The phreatophyte community, consisting of Atriplex canescens (ATCA) and Sarcobatus vermiculatus (SAVE) shrubs, intercepts groundwater and could potentially slow the movement of the contaminant plume through evapotranspiration (ET). However, the site has been heavily grazed by livestock, reducing plant cover and LAI. We used livestock exclosures and revegetation plots to determine the effects of grazing on LAI, fc and ET, then projected the findings over the whole site using multi-platform remote sensing methods. We show that ET is approximately equal to annual precipitation at the site, but when ATCA and SAVE are protected from grazing they can develop high fc and LAI values, and ET can exceed annual precipitation, with the excess coming from groundwater discharge. Therefore, control of grazing could be an effective method to slow migration of contaminants at this and similar sites in the western U.S.

  6. Medic - Chest Pain: A Decision Support Program for the Management of Acute Chest Pain (User’s Manual)

    DTIC Science & Technology

    1989-10-05

    musculoskeletal chest pain; b) pleurisy ; c) pulmonary erbolus; d) mediastinal emphysema a) Musculoskeletal chest pain and the pain of costochondritis denote muscle...includes mild A-22 analgesics/anti-inflammatory drugs, heat therapy, and rest. b) Pleurisy denotes inflammation of the pleura. It may be seen in the...setting of bronchitis or pneumonia. The symptoms of both assist in differentiating pleurisy fru pneumothorax. In the absence of signs of pneumonia or

  7. Insurgent Safe Havens: Can We Win the Fight?

    DTIC Science & Technology

    2011-03-08

    N/A. 14. ABSTRACT Theorists of Guerilla Warfare like Mao Tse -tung, T.E. Lawrence, and Che Guevara suggest some form of sanctuary is necessary for... Tse -tung, T.E. Lawrence, and Che Guevara suggest some form of sanctuary is necessary for any insurgency to be successful; history shows this to be...wru·fru·e, T.E. Lawrence, Mao Tse -tung and Che Guevara recdgnized the need for sanctuaries as a critical element of their insurgent campaigns; each

  8. Radio constraints on the mass-loss rate of the Type Ia SN 2018gv

    NASA Astrophysics Data System (ADS)

    Ryder, S. D.; Lundqvist, P.; Perez-Torres, M. A.; Kundu, E.; Kool, E. C.; Bjornsson, C.-I.; Fransson, C.

    2018-01-01

    The young Type Ia SN 2018gv (ATel #11175, #11177) in the galaxy NGC 2525 has been observed with the Australia Telescope Compact Array (ATCA) at 5.5 and 9.0 GHz on 2018 Jan 18.6 UT. No radio emission was detected at the reported location, to a 3-sigma upper limit of 120 microJy/beam (5.5 GHz) and 30 microJy/beam (9.0 GHz).

  9. Radio Observations of Nova Muscae 2018 and Nova Carinae 2018 (ASASSN-18fv)

    NASA Astrophysics Data System (ADS)

    Ryder, S. D.; Kool, E. C.; Chomiuk, L.

    2018-04-01

    The two optically-bright Galactic novae in Musca (CBET #4473, ATel #11183, #11201, #11212, #11296) and in Carina (ATel #11454, #11456, #11457, #11460, #11468) were observed at radio wavelengths using the Australia Telescope Compact Array (ATCA) on 2018 Apr 3.3 UT. Nova Muscae 2018 has faded by a factor of 3 at 9.0 and 5.5 GHz since peaking at > 30 mJy/bm in mid-March.

  10. The novel gene tank, a tumor suppressor homolog, regulates ethanol sensitivity in Drosophila.

    PubMed

    Devineni, Anita V; Eddison, Mark; Heberlein, Ulrike

    2013-05-08

    In both mammalian and insect models of ethanol intoxication, high doses of ethanol induce motor impairment and eventually sedation. Sensitivity to the sedative effects of ethanol is inversely correlated with risk for alcoholism. However, the genes regulating ethanol sensitivity are largely unknown. Based on a previous genetic screen in Drosophila for ethanol sedation mutants, we identified a novel gene, tank (CG15626), the homolog of the mammalian tumor suppressor EI24/PIG8, which has a strong role in regulating ethanol sedation sensitivity. Genetic and behavioral analyses revealed that tank acts in the adult nervous system to promote ethanol sensitivity. We localized the function of tank in regulating ethanol sensitivity to neurons within the pars intercerebralis that have not been implicated previously in ethanol responses. We show that acutely manipulating the activity of all tank-expressing neurons, or of pars intercerebralis neurons in particular, alters ethanol sensitivity in a sexually dimorphic manner, since neuronal activation enhanced ethanol sedation in males, but not females. Finally, we provide anatomical evidence that tank-expressing neurons form likely synaptic connections with neurons expressing the neural sex determination factor fruitless (fru), which have been implicated recently in the regulation of ethanol sensitivity. We suggest that a functional interaction with fru neurons, many of which are sexually dimorphic, may account for the sex-specific effect induced by activating tank neurons. Overall, we have characterized a novel gene and corresponding set of neurons that regulate ethanol sensitivity in Drosophila.

  11. Thermal and rheological properties of a family of botryosphaerans produced by Botryosphaeria rhodina MAMB-05.

    PubMed

    Fonseca, Paulo R M S; Dekker, Robert F H; Barbosa, Aneli M; Silveira, Joana L M; Vasconcelos, Ana F D; Monteiro, Nilson K; Aranda-Selverio, Gabriel; da Silva, Maria de Lourdes Corradi

    2011-09-02

    Differential scanning calorimetry (DSC), thermogravimetry (TG) and Fourier-transform infra-red spectroscopy (FT-IR) analyses were performed to investigate changes in the physico-chemical properties of botryosphaerans, a family of exopolysaccharides (EPS) produced by the fungus Botryosphaeria rhodina MAMB-05 grown on glucose (EPS(GLC)), sucrose (EPS(SUC)) and fructose (EPS(FRU)). A slight endothermic transition and small mass loss attributable to the removal of water of hydration were observed in the DSC and TG analyses, respectively, for the three EPS samples. The FT-IR spectra confirmed no structural changes occurred during thermal treatment. Viscometry was utilized to obtain information on the rheological behaviour of the EPS in aqueous solutions. The Power Law and Cross Equations determined the natural pseudoplastic characteristics of the EPS. Comparatively, results obtained for EPS produced when B. rhodina MAMB-05 was grown on each of the three carbohydrate sources demonstrated similar apparent viscosity values for EPS(GLC) and EPS(SUC), while EPS(FRU) displayed the lowest apparent viscosity of the three botryosphaerans, suggesting a higher degree of ramification and lower Mw. EPS(GLC) and EPS(SUC) possessed similar degrees of ramification. The slight differences found in their viscosities can be explained by the differences in the type of branching among the three botryosphaerans, thus varying the strength of intermolecular interactions and consequently, consistency and viscosity. The physico-chemical studies of botryosphaerans represent the originality of this work, and the knowledge of these properties is an important criterion for potential applications.

  12. Synthesis and Physicochemical Characterization of D-Tagatose-1-phosphate: The Substrate of the Tagatose-1-Phosphate Kinase TagK in the PTS-mediated D-Tagatose Catabolic Pathway of Bacillus licheniformis

    PubMed Central

    Van der Heiden, Edwige; Delmarcelle, Michaël; Simon, Patricia; Counson, Melody; Galleni, Moreno; Freedberg, Darón I.; Thompson, John; Joris, Bernard; Battistel, Marcos D.

    2015-01-01

    We report the first enzymatic synthesis of D-tagatose-1-phosphate (Tag-1P) by the multi-component PEP-dependent:tag-PTS present in tagatose-grown cells of Klebsiella pneumoniae. Physicochemical characterization by 31P and 1H NMR spectroscopy reveals that, in solution, this derivative is primarily in the pyranose form. Tag-1P was used to characterize the putative tagatose-1-phosphate kinase (TagK) of the Bacillus licheniformis PTS-mediated D-Tagatose catabolic Pathway (Bli-TagP). For this purpose, a soluble protein fusion was obtained with the 6 His-tagged trigger factor (TFHis6) of Escherichia coli. The active fusion enzyme was named TagK-TFHis6. Tag-1P and D-fructose-1-phosphate (Fru-1P) are substrates for the TagK-TFHis6 enzyme, whereas the isomeric derivatives D-tagatose-6-phosphate (Tag-6P) and D-fructose-6-phosphate (Fru-6P) are inhibitors. Studies of catalytic efficiency (kcat/Km) reveal that the enzyme specificity is markedly in favor of Tag-1P as substrate. Importantly, we show in vivo that the transfer of the phosphate moiety from PEP to the B. licheniformis tagatose-specific enzyme II (EIITag) in E.coli is inefficient. The capability of the PTS general cytoplasmic components of B. subtilis, HPr and EI, to restore the phosphate transfer is demonstrated. PMID:26159072

  13. Chemical properties and reactive oxygen and nitrogen species quenching activities of dry sugar-amino acid maillard reaction mixtures exposed to baking temperatures.

    PubMed

    Chen, Xiu-Min; Liang, Ningjian; Kitts, David D

    2015-10-01

    Maillard reaction products (MRPs) derived from 10 different, dry sugar-amino acid reaction model systems were examined for changes in color index (E), sugar loss, and formation of α-dicarbonyl compounds; the changes were correlated with relative activities to quench both reactive oxygen (ROS) and reactive nitrogen (RNS) species. Reducing sugars, xylose, ribose, fructose, glucose, and non-reducing sucrose were reacted with glycine (Xyl-Gly, Rib-Gly, Fru-Gly, Glc-Gly, and Suc-Gly), or lysine (Xyl-Lys, Rib-Lys, Fru-Lys, Glc-Lys, and Suc-Lys), respectively, at temperatures of 150°C and 180°C for time periods ranging from 5 to 60min. ROS quenching capacity was negatively correlated with color index (E) (r=-0.604, P<0.001), and positively correlated with sugar loss (r=0.567, P<0.001). MRPs also exhibited activity to quench RNS as assessed by nitric oxide (NO) inhibition in differentiated Caco-2 cells that were induced with interferon-γ (IFN-γ) and phorbol ester (PMA) cocktail. We also showed a correlation between RNS and color index, sugar loss, and ROS quenching activities for MR mixtures that were heated for a short time (e.g. 10min) at 150°C. MRP quenching of ROS was largely influenced by sugar type, whereas, RNS quenching was dependent more so on the interaction between reactants and reaction conditions used to generate MRPs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. The Novel Gene tank, a Tumor Suppressor Homolog, Regulates Ethanol Sensitivity in Drosophila

    PubMed Central

    Eddison, Mark; Heberlein, Ulrike

    2013-01-01

    In both mammalian and insect models of ethanol intoxication, high doses of ethanol induce motor impairment and eventually sedation. Sensitivity to the sedative effects of ethanol is inversely correlated with risk for alcoholism. However, the genes regulating ethanol sensitivity are largely unknown. Based on a previous genetic screen in Drosophila for ethanol sedation mutants, we identified a novel gene, tank (CG15626), the homolog of the mammalian tumor suppressor EI24/PIG8, which has a strong role in regulating ethanol sedation sensitivity. Genetic and behavioral analyses revealed that tank acts in the adult nervous system to promote ethanol sensitivity. We localized the function of tank in regulating ethanol sensitivity to neurons within the pars intercerebralis that have not been implicated previously in ethanol responses. We show that acutely manipulating the activity of all tank-expressing neurons, or of pars intercerebralis neurons in particular, alters ethanol sensitivity in a sexually dimorphic manner, since neuronal activation enhanced ethanol sedation in males, but not females. Finally, we provide anatomical evidence that tank-expressing neurons form likely synaptic connections with neurons expressing the neural sex determination factor fruitless (fru), which have been implicated recently in the regulation of ethanol sensitivity. We suggest that a functional interaction with fru neurons, many of which are sexually dimorphic, may account for the sex-specific effect induced by activating tank neurons. Overall, we have characterized a novel gene and corresponding set of neurons that regulate ethanol sensitivity in Drosophila. PMID:23658154

  15. The Discovery Outburst of the X-Ray Transient IGR J17497-2821 Observed with RXTE and ATCA

    NASA Technical Reports Server (NTRS)

    Rodriquez, Jerome; Bel, Marion Cadolle; Tomsick, John A.; Corbel, Stephane; Brocksopp, Catherine; Paizis, Ada; Shaw, Simon E.; Bodaghee, Arash

    2007-01-01

    We report the results of a series of RXTE and ATCA observations of the recently discovered X-ray transient IGR J17497-2821. Our 3-200 keV PCA+HEXTE spectral analysis shows very little variations over a period of approx.10 days around the maximum of the outburst. IGR J17497-2821 is found in a typical low-hard state (LHS) of X-ray binaries (XRBs), well represented by an absorbed Comptonized spectrum with an iron edge at about 7 keV. The high value of the absorption (approx.4 x 10(exp 22/sq cm suggests that the source is located at a large distance, either close to the Galactic center or beyond. The timing analysis shows no particular features, while the shape of the power density spectra is also typical of the LHS of XRBs, with apprrox.36% rms variability. No radio counterpart is found down to a limit of 0.21 mJy at 4.80 and 8.64 GHz. Although the position of IGR J17497-2821 in the radio to X-ray flux diagram is well below the correlation usually observed in the LHS of black holes, the comparison of its X-ray properties with those of other sources leads us to suggest that it is a black hole candidate.

  16. Effects of grazing on leaf area index, fractional cover and evapotranspiration by a desert phreatophyte community at a former uranium mill site on the Colorado Plateau.

    PubMed

    Bresloff, Cynthia J; Nguyen, Uyen; Glenn, Edward P; Waugh, Jody; Nagler, Pamela L

    2013-01-15

    This study employed ground and remote sensing methods to monitor the effects of grazing on leaf area index (LAI), fractional cover (f(c)) and evapotranspiration (ET) of a desert phreatophyte community over an 11 year period at a former uranium mill site on the Colorado Plateau, U.S. Nitrate, ammonium and sulfate are migrating away from the mill site in a shallow alluvial aquifer. The phreatophyte community, consisting of Atriplex canescens (ATCA) and Sarcobatus vermiculatus (SAVE) shrubs, intercepts groundwater and could potentially slow the movement of the contaminant plume through evapotranspiration (ET). However, the site has been heavily grazed by livestock, reducing plant cover and LAI. We used livestock exclosures and revegetation plots to determine the effects of grazing on LAI, f(c) and ET, then projected the findings over the whole site using multi-platform remote sensing methods. We show that ET is approximately equal to annual precipitation at the site, but when ATCA and SAVE are protected from grazing they can develop high f(c) and LAI values, and ET can exceed annual precipitation, with the excess coming from groundwater discharge. Therefore, control of grazing could be an effective method to slow migration of contaminants at this and similar sites in the western U.S. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Exploring the multifaceted circumstellar environment of the luminous blue variable HR Carinae

    NASA Astrophysics Data System (ADS)

    Buemi, C. S.; Trigilio, C.; Leto, P.; Umana, G.; Ingallinera, A.; Cavallaro, F.; Cerrigone, L.; Agliozzo, C.; Bufano, F.; Riggi, S.; Molinari, S.; Schillirò, F.

    2017-03-01

    We present a multiwavelength study of the Galactic luminous blue variable HR Carinae, based on new high-resolution mid-infrared (IR) and radio images obtained with the Very Large Telescope (VLT) and the Australia Telescope Compact Array (ATCA), which have been complemented by far-infrared Herschel-Photodetector Array Camera and Spectrometer (PACS) observations and ATCA archive data. The Herschel images reveal the large-scale distribution of the dusty emitting nebula, which extends mainly to the north-east direction, up to 70 arcsec from the central star, and is oriented along the direction of the space motion of the star. In the mid-infrared images, the brightness distribution is characterized by two arc-shaped structures, tracing an inner envelope surrounding the central star more closely. At radio wavelengths, the ionized gas emission lies on the opposite side of the cold dust with respect to the position of the star, as if the ionized front were confined by the surrounding medium in the north-south direction. Comparison with previous data indicates significant changes in the radio nebula morphology and in the mass-loss rate from the central star, which has increased from 6.1 × 10-6 M⊙ yr-1 in 1994-1995 to 1.17 × 10-5 M⊙ yr-1 in 2014. We investigate possible scenarios that could have generated the complex circumstellar environment revealed by our multiwavelength data.

  18. ACCURATE OH MASER POSITIONS FROM THE SPLASH PILOT REGION

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qiao, Hai-Hua; Shen, Zhi-Qiang; Walsh, Andrew J.

    2016-12-01

    We report on high spatial resolution observations, using the Australia Telescope Compact Array (ATCA), of ground-state OH masers. These observations were carried out toward 196 pointing centers previously identified in the Southern Parkes Large-Area Survey in Hydroxyl (SPLASH) pilot region, between Galactic longitudes of 334° and 344° and Galactic latitudes of −2° and +2°. Supplementing our data with data from the MAGMO (Mapping the Galactic Magnetic field through OH masers) survey, we find maser emission toward 175 of the 196 target fields. We conclude that about half of the 21 nondetections were due to intrinsic variability. Due to the superiormore » sensitivity of the followup ATCA observations, and the ability to resolve nearby sources into separate sites, we have identified 215 OH maser sites toward the 175 fields with detections. Among these 215 OH maser sites, 111 are new detections. After comparing the positions of these 215 maser sites to the literature, we identify 122 (57%) sites associated with evolved stars (one of which is a planetary nebula), 64 (30%) with star formation, two sites with supernova remnants, and 27 (13%) of unknown origin. The infrared colors of evolved star sites with symmetric maser profiles tend to be redder than those of evolved star sites with asymmetric maser profiles, which may indicate that symmetric sources are generally at an earlier evolutionary stage.« less

  19. Remote access and operation of telescopes by the scientific users

    NASA Astrophysics Data System (ADS)

    Edwards, P. G.; Amy, S.; Brodrick, D.; Carretti, E.; Hoyle, S.; Indermuehle, B.; McConnell, D.; Mader, S.; Mirtschin, P.; Preisig, B.; Smith, M.; Stevens, J.; Wark, R.; Wieringa, M.; Wu, X.

    2014-08-01

    The Australia Telescope National Facility operates three radio telescopes: the Parkes 64m Telescope, the Australia Telescope Compact Array (ATCA), and the Mopra 22m Telescope. Scientific operation of all these is conducted by members of the investigating teams rather than by professional operators. All three can now be accessed and controlled from any location served by the internet, the telescopes themselves being unattended for part or all of the time. Here we describe the rationale, advantages, and means of implementing this operational model.

  20. VizieR Online Data Catalog: Broadband polarisation of radio AGN (O'Sullivan+, 2017)

    NASA Astrophysics Data System (ADS)

    O'Sullivan, S. P.; Purcell, C. R.; Anderson, C. S.; Farnes, J. S.; Sun, X. H.; Gaensler, B. M.

    2017-08-01

    Linear polarisation data as a function of wavelength-squared for 100 extragalactic radio sources, selected to be highly polarised at 1.4GHz. The data presented here were obtained using the Australia Telescope Compact Array (ATCA) over 1.1-3.1GHz (16cm) with 1MHz spectral resolution between 2014 April 19-28. The integrated emission from each source, imaged at 10 MHz intervals, is presented below. See Section 2 for details. (2 data files).

  1. Pleiotropy and its dissection through a metabolic gene Miniature1 (Mn1) that encodes a cell wall invertase in developing seeds of maize.

    PubMed

    Chourey, Prem S; Li, Qin-Bao; Cevallos-Cevallos, Juan

    2012-03-01

    The Mn1-encoded endosperm-specific cell wall invertase is a major determinant of sink strength of developing seeds through its control of both sink size, cell number and cell size, and sink activity via sucrose hydrolysis and release of hexoses essential for energy and signaling functions. Consequently, loss-of-function mutations of the gene lead to the mn1 seed phenotype that shows ∼70% reduction in seed mass at maturity and several pleiotropic changes. A comparative analysis of endosperm and embryo mass in the Mn1 and mn1 genotypes showed here significant reductions of both tissues in the mn1 starting with early stages of development. Clearly, embryo development was endosperm-dependent. To gain a mechanistic understanding of the changes, sugar levels were measured in both endosperm and embryo samples. Changes in the levels of all sugars tested, glc, fru, suc, and sorbitol, were mainly observed in the endosperm. Greatly reduced fru levels in the mutant led to RNA level expression analyses by q-PCR of several genes that encode sucrose and fructose metabolizing enzymes. The mn1 endosperm showed reductions in gene expression, ranging from ∼70% to 99% of the Mn1 samples, for both suc-starch and suc--energy pathways, suggesting an in vivo metabolic coordinated regulation due to the hexose-deficiency. Together, these data provide evidence of the Mn1-dependent interconnected network of several pathways as a possible basis for pleiotropic changes in seed development. Published by Elsevier Ireland Ltd.

  2. Activation of Escherichia coli antiterminator BglG requires its phosphorylation

    PubMed Central

    Rothe, Fabian M.; Bahr, Thomas; Stülke, Jörg; Rak, Bodo; Görke, Boris

    2012-01-01

    Transcriptional antiterminator proteins of the BglG family control the expression of enzyme II (EII) carbohydrate transporters of the bacterial phosphotransferase system (PTS). In the PTS, phosphoryl groups are transferred from phosphoenolpyruvate (PEP) via the phosphotransferases enzyme I (EI) and HPr to the EIIs, which phosphorylate their substrates during transport. Activity of the antiterminators is negatively controlled by reversible phosphorylation catalyzed by the cognate EIIs in response to substrate availability and positively controlled by the PTS. For the Escherichia coli BglG antiterminator, two different mechanisms for activation by the PTS were proposed. According to the first model, BglG is activated by HPr-catalyzed phosphorylation at a site distinct from the EII-dependent phosphorylation site. According to the second model, BglG is not activated by phosphorylation, but solely through interaction with EI and HPr, which are localized at the cell pole. Subsequently BglG is released from the cell pole to the cytoplasm as an active dimer. Here we addressed this discrepancy and found that activation of BglG requires phosphorylatable HPr or the HPr homolog FruB in vivo. Further, we uniquely demonstrate that purified BglG protein becomes phosphorylated by FruB as well as by HPr in vitro. Histidine residue 208 in BglG is essential for this phosphorylation. These data suggest that BglG is in fact activated by phosphorylation and that there is no principal difference between the PTS-exerted mechanisms controlling the activities of BglG family proteins in Gram-positive and Gram-negative bacteria. PMID:22984181

  3. Operation STEADFAST Phased Implementation Plan. Revised

    DTIC Science & Technology

    1973-02-28

    i i <M• ~ · 1 fruL 𔃻 . roj rOJ<s: ~lo •’!"Cl ~ { : [ [ rt-t-t::t:±±:±:::t~!!:±:: ( HijO 1 JuL 7~ • TO~ 1ə fm<, Ml l I : ! i i...significant impact on the reorganization process. ~)PN STEADFAST FORM NO. 2 (OT) ’ --raa &rFI~~ Uii uNLY Un r · • ·. JP.11 TRADOC Ia FORSCOM 0...by a division staff element to accom- plish it:s mj.ssion or whose slippage would cause UN CLASS! FlED FUNCTIONS TO ~E TRANSFERRED TO: (NO!El

  4. VizieR Online Data Catalog: 8 Fermi GRB afterglows follow-up (Singer+, 2015)

    NASA Astrophysics Data System (ADS)

    Singer, L. P.; Kasliwal, M. M.; Cenko, S. B.; Perley, D. A.; Anderson, G. E.; Anupama, G. C.; Arcavi, I.; Bhalerao, V.; Bue, B. D.; Cao, Y.; Connaughton, V.; Corsi, A.; Cucchiara, A.; Fender, R. P.; Fox, D. B.; Gehrels, N.; Goldstein, A.; Gorosabel, J.; Horesh, A.; Hurley, K.; Johansson, J.; Kann, D. A.; Kouveliotou, C.; Huang, K.; Kulkarni, S. R.; Masci, F.; Nugent, P.; Rau, A.; Rebbapragada, U. D.; Staley, T. D.; Svinkin, D.; Thone, C. C.; de Ugarte Postigo, A.; Urata, Y.; Weinstein, A.

    2015-10-01

    In this work, we present the GBM-iPTF (intermediate Palomar Transient Factory) afterglows from the first 13 months of this project. Follow-up observations include R-band photometry from the P48, multicolor photometry from the P60, spectroscopy (acquired with the P200, Keck, Gemini, APO, Magellan, Very Large Telescope (VLT), and GTC), and radio observations with the Very Large Array (VLA), the Combined Array for Research in Millimeter-wave Astronomy (CARMA), the Australia Telescope Compact Array (ATCA), and the Arcminute Microkelvin Imager (AMI). (3 data files).

  5. The Genome-Based Metabolic Systems Engineering to Boost Levan Production in a Halophilic Bacterial Model.

    PubMed

    Aydin, Busra; Ozer, Tugba; Oner, Ebru Toksoy; Arga, Kazim Yalcin

    2018-03-01

    Metabolic systems engineering is being used to redirect microbial metabolism for the overproduction of chemicals of interest with the aim of transforming microbial hosts into cellular factories. In this study, a genome-based metabolic systems engineering approach was designed and performed to improve biopolymer biosynthesis capability of a moderately halophilic bacterium Halomonas smyrnensis AAD6 T producing levan, which is a fructose homopolymer with many potential uses in various industries and medicine. For this purpose, the genome-scale metabolic model for AAD6 T was used to characterize the metabolic resource allocation, specifically to design metabolic engineering strategies for engineered bacteria with enhanced levan production capability. Simulations were performed in silico to determine optimal gene knockout strategies to develop new strains with enhanced levan production capability. The majority of the gene knockout strategies emphasized the vital role of the fructose uptake mechanism, and pointed out the fructose-specific phosphotransferase system (PTS fru ) as the most promising target for further metabolic engineering studies. Therefore, the PTS fru of AAD6 T was restructured with insertional mutagenesis and triparental mating techniques to construct a novel, engineered H. smyrnensis strain, BMA14. Fermentation experiments were carried out to demonstrate the high efficiency of the mutant strain BMA14 in terms of final levan concentration, sucrose consumption rate, and sucrose conversion efficiency, when compared to the AAD6 T . The genome-based metabolic systems engineering approach presented in this study might be considered an efficient framework to redirect microbial metabolism for the overproduction of chemicals of interest, and the novel strain BMA14 might be considered a potential microbial cell factory for further studies aimed to design levan production processes with lower production costs.

  6. The Wright stuff: reimagining path analysis reveals novel components of the sex determination hierarchy in Drosophila melanogaster.

    PubMed

    Fear, Justin M; Arbeitman, Michelle N; Salomon, Matthew P; Dalton, Justin E; Tower, John; Nuzhdin, Sergey V; McIntyre, Lauren M

    2015-09-04

    The Drosophila sex determination hierarchy is a classic example of a transcriptional regulatory hierarchy, with sex-specific isoforms regulating morphology and behavior. We use a structural equation modeling approach, leveraging natural genetic variation from two studies on Drosophila female head tissues--DSPR collection (596 F1-hybrids from crosses between DSPR sub-populations) and CEGS population (75 F1-hybrids from crosses between DGRP/Winters lines to a reference strain w1118)--to expand understanding of the sex hierarchy gene regulatory network (GRN). This approach is completely generalizable to any natural population, including humans. We expanded the sex hierarchy GRN adding novel links among genes, including a link from fruitless (fru) to Sex-lethal (Sxl) identified in both populations. This link is further supported by the presence of fru binding sites in the Sxl locus. 754 candidate genes were added to the pathway, including the splicing factors male-specific lethal 2 and Rm62 as downstream targets of Sxl which are well-supported links in males. Independent studies of doublesex and transformer mutants support many additions, including evidence for a link between the sex hierarchy and metabolism, via Insulin-like receptor. The genes added in the CEGS population were enriched for genes with sex-biased splicing and components of the spliceosome. A common goal of molecular biologists is to expand understanding about regulatory interactions among genes. Using natural alleles we can not only identify novel relationships, but using supervised approaches can order genes into a regulatory hierarchy. Combining these results with independent large effect mutation studies, allows clear candidates for detailed molecular follow-up to emerge.

  7. Left ventricular volume estimation in cardiac three-dimensional ultrasound: a semiautomatic border detection approach.

    PubMed

    van Stralen, Marijn; Bosch, Johan G; Voormolen, Marco M; van Burken, Gerard; Krenning, Boudewijn J; van Geuns, Robert-Jan M; Lancée, Charles T; de Jong, Nico; Reiber, Johan H C

    2005-10-01

    We propose a semiautomatic endocardial border detection method for three-dimensional (3D) time series of cardiac ultrasound (US) data based on pattern matching and dynamic programming, operating on two-dimensional (2D) slices of the 3D plus time data, for the estimation of full cycle left ventricular volume, with minimal user interaction. The presented method is generally applicable to 3D US data and evaluated on data acquired with the Fast Rotating Ultrasound (FRU-) Transducer, developed by Erasmus Medical Center (Rotterdam, the Netherlands), a conventional phased-array transducer, rotating at very high speed around its image axis. The detection is based on endocardial edge pattern matching using dynamic programming, which is constrained by a 3D plus time shape model. It is applied to an automatically selected subset of 2D images of the original data set, for typically 10 equidistant rotation angles and 16 cardiac phases (160 images). Initialization requires the drawing of four contours per patient manually. We evaluated this method on 14 patients against MRI end-diastole and end-systole volumes. Initialization requires the drawing of four contours per patient manually. We evaluated this method on 14 patients against MRI end-diastolic (ED) and end-systolic (ES) volumes. The semiautomatic border detection approach shows good correlations with MRI ED/ES volumes (r = 0.938) and low interobserver variability (y = 1.005x - 16.7, r = 0.943) over full-cycle volume estimations. It shows a high consistency in tracking the user-defined initial borders over space and time. We show that the ease of the acquisition using the FRU-transducer and the semiautomatic endocardial border detection method together can provide a way to quickly estimate the left ventricular volume over the full cardiac cycle using little user interaction.

  8. Induction of steatohepatitis (NASH) with insulin resistance in wildtype B6 mice by a western-type diet containing soybean oil and cholesterol.

    PubMed

    Henkel, Janin; Coleman, Charles Dominic; Schraplau, Anne; Jӧhrens, Korinna; Weber, Daniela; Castro, José Pedro; Hugo, Martin; Schulz, Tim Julius; Krämer, Stephanie; Schürmann, Annette; Püschel, Gerhard Paul

    2017-03-21

    Non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH) are hepatic manifestations of the metabolic syndrome. Many currently used animal models of NAFLD/NASH lack clinical features of either NASH or metabolic syndrome such as hepatic inflammation and fibrosis (e.g. high-fat diets) or overweight and insulin resistance (e.g. methionine-choline-deficient diets) or they are based on monogenetic defects (e.g. ob/ob mice). In the current study, a western-type diet containing soybean oil with high n 6-PUFA and 0.75% cholesterol (SOD+Cho) induced steatosis, inflammation and fibrosis accompanied by hepatic lipid peroxidation and oxidative stress in livers of C57BL/6-mice which in addition showed increased weight gain and insulin resistance, thus displaying a phenotype closely resembling all clinical features of NASH in patients with metabolic syndrome. In striking contrast a soybean oil-containing western-type diet without cholesterol (SOD) induced only mild steatosis but neither hepatic inflammation nor fibrosis, weight gain or insulin resistance. Another high-fat diet mainly consisting of lard and supplemented with fructose in drinking water (LAD+Fru) resulted in more prominent weight gain, insulin resistance and hepatic steatosis than SOD+Cho but livers were devoid of inflammation and fibrosis. Although both LAD+Fru- and SOD+Cho-fed animals had high plasma cholesterol, liver cholesterol was elevated only in SOD+Cho animals. Cholesterol induced expression of chemotactic and inflammatory cytokines in cultured Kupffer cells and rendered hepatocytes more susceptible to apoptosis. Summarizing, dietary cholesterol in SOD+Cho diet may trigger hepatic inflammation and fibrosis. SOD+Cho-fed animals may be a useful disease model displaying many clinical features of patients with the metabolic syndrome and NASH.

  9. Concord and Niagara Grape Juice and Their Phenolics Modify Intestinal Glucose Transport in a Coupled in Vitro Digestion/Caco-2 Human Intestinal Model

    PubMed Central

    Moser, Sydney; Lim, Jongbin; Chegeni, Mohammad; Wightman, JoLynne D.; Hamaker, Bruce R.; Ferruzzi, Mario G.

    2016-01-01

    While the potential of dietary phenolics to mitigate glycemic response has been proposed, the translation of these effects to phenolic rich foods such as 100% grape juice (GJ) remains unclear. Initial in vitro screening of GJ phenolic extracts from American grape varieties (V. labrusca; Niagara and Concord) suggested limited inhibitory capacity for amylase and α-glucosidase (6.2%–11.5% inhibition; p < 0.05). Separately, all GJ extracts (10–100 µM total phenolics) did reduce intestinal trans-epithelial transport of deuterated glucose (d7-glu) and fructose (d7-fru) by Caco-2 monolayers in a dose-dependent fashion, with 60 min d7-glu/d7-fru transport reduced 10%–38% by GJ extracts compared to control. To expand on these findings by assessing the ability of 100% GJ to modify starch digestion and glucose transport from a model starch-rich meal, 100% Niagara and Concord GJ samples were combined with a starch rich model meal (1:1 and 1:2 wt:wt) and glucose release and transport were assessed in a coupled in vitro digestion/Caco-2 cell model. Digestive release of glucose from the starch model meal was decreased when digested in the presence of GJs (5.9%–15% relative to sugar matched control). Furthermore, transport of d7-glu was reduced 10%–38% by digesta containing bioaccessible phenolics from Concord and Niagara GJ compared to control. These data suggest that phenolics present in 100% GJ may alter absorption of monosaccharides naturally present in 100% GJ and may potentially alter glycemic response if consumed with a starch rich meal. PMID:27399765

  10. Characterization and manufacture of braided composites for large commercial aircraft structures

    NASA Technical Reports Server (NTRS)

    Fedro, Mark J.; Willden, Kurtis

    1992-01-01

    Braided composite materials, one of the advanced material forms which is under investigation in Boeing's ATCAS program, have been recognized as a potential cost-effective material form for fuselage structural elements. Consequently, there is a strong need for more knowledge in the design, manufacture, test, and analysis of textile structural composites. The overall objective of this work is to advance braided composite technology towards applications to a large commercial transport fuselage. This paper summarizes the mechanics of materials and manufacturing demonstration results which have been obtained in order to acquire an understanding of how braided composites can be applied to a commercial fuselage. Textile composites consisting of 1D, 2D triaxial, and 3D braid patterns with thermoplastic and two RTM resin systems were investigated. The structural performance of braided composites was evaluated through an extensive mechanical test program. Analytical methods were also developed and applied to predict the following: internal fiber architectures, stiffnesses, fiber stresses, failure mechanisms, notch effects, and the entire history of failure of the braided composites specimens. The applicability of braided composites to a commercial transport fuselage was further assessed through a manufacturing demonstration. Three foot fuselage circumferential hoop frames were manufactured to demonstrate the feasibility of consistently producing high quality braided/RTM composite primary structures. The manufacturing issues (tooling requirements, processing requirements, and process/quality control) addressed during the demonstration are summarized. The manufacturing demonstration in conjunction with the mechanical test results and developed analytical methods increased the confidence in the ATCAS approach to the design, manufacture, test, and analysis of braided composites.

  11. DISCOVERY OF NUCLEAR WATER MASER EMISSION IN CENTAURUS A

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ott, Juergen; Meier, David S.; Walter, Fabian

    2013-07-10

    We report the detection of a 22 GHz water maser line in the nearest (D {approx} 3.8 Mpc) radio galaxy Centaurus A (Cen A) using the Australia Telescope Compact Array (ATCA). The line is centered at a velocity of {approx}960 km s{sup -1}, which is redshifted by about 415 km s{sup -1} from the systemic velocity. Such an offset, as well as the width of {approx}120 km s{sup -1}, could be consistent with either a nuclear maser arising from an accretion disk of the central supermassive black hole (SMBH), or with a jet maser that is emitted from the materialmore » that is shocked near the base of the jet in Cen A. The best spatial resolution of our ATCA data constrains the origin of the maser feature within <3 pc of the SMBH. The maser exhibits an isotropic luminosity of {approx}1 L{sub Sun }, which classifies it as a kilomaser, and appears to be variable on timescales of months. A kilomaser can also be emitted by shocked gas in star-forming regions. Given the small projected distance from the core, the large offset from systemic velocity, and the smoothness of the line feature, we conclude that a jet maser line emitted by shocked gas around the base of the active galactic nucleus is the most likely explanation. For this scenario we can infer a minimum density of the radio jet of {approx}> 10 cm{sup -3}, which indicates substantial mass entrainment of surrounding gas into the propagating jet material.« less

  12. SPT0346-52: Negligible AGN Activity in a Compact, Hyper-starburst Galaxy at z = 5.7

    NASA Astrophysics Data System (ADS)

    Ma, Jingzhe; Gonzalez, Anthony. H.; Vieira, J. D.; Aravena, M.; Ashby, M. L. N.; Béthermin, M.; Bothwell, M. S.; Brandt, W. N.; de Breuck, C.; Carlstrom, J. E.; Chapman, S. C.; Gullberg, B.; Hezaveh, Y.; Litke, K.; Malkan, M.; Marrone, D. P.; McDonald, M.; Murphy, E. J.; Spilker, J. S.; Sreevani, J.; Stark, A. A.; Strandet, M.; Wang, S. X.

    2016-12-01

    We present Chandra ACIS-S and Australia Telescope Compact Array (ATCA) radio continuum observations of the strongly lensed dusty, star-forming galaxy SPT-S J034640-5204.9 (hereafter SPT0346-52) at z = 5.656. This galaxy has also been observed with ALMA, HST, Spitzer, Herschel, Atacama Pathfinder EXperiment, and the Very Large Telescope. Previous observations indicate that if the infrared (IR) emission is driven by star formation, then the inferred lensing-corrected star formation rate (SFR) (˜4500 M ⊙ yr-1) and SFR surface density ΣSFR (˜2000 M ⊙ yr-1 kpc-2) are both exceptionally high. It remained unclear from the previous data, however, whether a central active galactic nucleus (AGN) contributes appreciably to the IR luminosity. The Chandra upper limit shows that SPT0346-52 is consistent with being star formation dominated in the X-ray, and any AGN contribution to the IR emission is negligible. The ATCA radio continuum upper limits are also consistent with the FIR-to-radio correlation for star-forming galaxies with no indication of an additional AGN contribution. The observed prodigious intrinsic IR luminosity of (3.6 ± 0.3) × 1013 L ⊙ originates almost solely from vigorous star formation activity. With an intrinsic source size of 0.61 ± 0.03 kpc, SPT0346-52 is confirmed to have one of the highest ΣSFR of any known galaxy. This high ΣSFR, which approaches the Eddington limit for a radiation pressure supported starburst, may be explained by a combination of very high star formation efficiency and gas fraction.

  13. VizieR Online Data Catalog: Radio follow-up on 3FGL unassociated sources (Schinzel+, 2017)

    NASA Astrophysics Data System (ADS)

    Schinzel, F. K.; Petrov, L.; Taylor, G. B.; Edwards, P. G.

    2017-11-01

    The 3FGL catalog covers the entire sky, thus we performed follow-up observations at two radio interferometric arrays: The Australia Telescope Compact Array (ATCA) in the Southern Hemisphere for observing sources with declinations in the range [-90,+10] and the Jansky Very Large Array (VLA) in the Northern Hemisphere for observing sources with declinations [0,+90]. ATCA observations were made in three campaigns: A3 started on 2014 April 7 and lasted for 30hr, A4 started on 2014 September 23 and lasted for 66hr, and A5 started on 2015 April 4 and lasted for 8hr. Observations in all three campaigns were recorded simultaneously in two bands centered at 5.5 and 9.0GHz. A total of 322 unassociated 3FGL fields with decl. above 0° were selected for observations with NRAO's Jansky VLA in this campaign (V2). Additionally, we observed the location of 2FGL J0423.4+5612, for which no data were recorded in our previous VLA survey. We reanalyzed our previous campaign V1 (Schinzel+ 2015, J/ApJS/217/4). The observations were conducted using the C-Band receiver covering the frequency range 4-8GHz. The observing time of 10hr was split into five segments. The first four segments were observed between 2015 March 16 and 21 under time approved through the NASA Fermi Guest Investigator program; an additional hour to complete the program was observed on 2015 April 16. See section 2 for further details. (5 data files).

  14. The Remarkable Synchrotron Nebula Associated with PSR J1015-5719

    NASA Astrophysics Data System (ADS)

    Ng, Chi Yung; Bandiera, Rino; Hunstead, Richard; Johnston, Simon

    2017-08-01

    We report the discovery of a synchrotron nebula G283.1-0.59 associated with the young and energetic pulsar J1015-5719. Radio observations using the Molonglo Observatory Synthesis Telescope (MOST) and the Australia Telescope Compact Array (ATCA) at 36, 16, 6, and 3 cm reveal a complex morphology for the source. The pulsar is embedded in the "head" of the nebula with fan-shaped diffuse emission. This is connected to a circular bubble structure of 20" radius and followed by a collimated tail extending over 1'. Polarization measurements show a highly ordered magnetic field in the nebula. The intrinsic B-field wraps around the edge of the head and shows an azimuthal configuration near the pulsar, then switches direction quasi-periodically near the bubble and in the tail. Together with the flat radio spectrum observed, we suggest that this system is most plausibly a pulsar wind nebula (PWN), with the head as a bow shock that has a low Mach number and the bubble as a shell expanding in a dense environment, possibly due to flow instabilities. In addition, the bubble could act as a magnetic bottle trapping the relativistic particles. A comparison with other bow-shock PWNe with higher Mach numbers shows similar structure and B-field geometry, implying that pulsar velocity may not be the most critical factor in determining the properties of these systems.ATCA is part of the Australia Telescope National Facility which is funded by the Commonwealth of Australia for operation as a National Facility managed by CSIRO. MOST is operated by The University of Sydney with support from the Australian Research Council and the Science Foundation for Physics within the University of Sydney. This work is supported by an ECS grant under HKU 709713P.

  15. The Luminous Blue Variable RMC 127 as Seen with ALMA and ATCA

    NASA Astrophysics Data System (ADS)

    Agliozzo, C.; Trigilio, C.; Pignata, G.; Phillips, N. M.; Nikutta, R.; Leto, P.; Umana, G.; Ingallinera, A.; Buemi, C.; Bauer, F. E.; Paladini, R.; Noriega-Crespo, A.; Prieto, J. L.; Massardi, M.; Cerrigone, L.

    2017-06-01

    We present ALMA and ATCA observations of the luminous blue variable RMC 127. The radio maps show for the first time the core of the nebula and evidence that the nebula is strongly asymmetric with a Z-pattern shape. Hints of this morphology are also visible in the archival Hubble Space Telescope {{H}}α image, which overall resembles the radio emission. The emission mechanism in the outer nebula is optically thin free-free in the radio. At high frequencies, a component of point-source emission appears at the position of the star, up to the ALMA frequencies. The rising flux density distribution ({S}ν ˜ {ν }0.78+/- 0.05) of this object suggests thermal emission from the ionized stellar wind and indicates a departure from spherical symmetry with {n}e(r)\\propto {r}-2. We examine different scenarios to explain this excess of thermal emission from the wind and show that this can arise from a bipolar outflow, supporting the suggestion by other authors that the stellar wind of RMC 127 is aspherical. We fit the data with two collimated ionized wind models, and we find that the mass-loss rate can be a factor of two or more smaller than in the spherical case. We also fit the photometry obtained by IR space telescopes and deduce that the mid- to far-IR emission must arise from extended, cool (˜ 80 {{K}}) dust within the outer ionized nebula. Finally, we discuss two possible scenarios for the nebular morphology: the canonical single-star expanding shell geometry and a precessing jet model assuming the presence of a companion star.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ma, Jingzhe; Gonzalez, Anthony H.; Vieira, J. D.

    We present Chandra ACIS-S and Australia Telescope Compact Array (ATCA) radio continuum observations of the strongly lensed dusty, star-forming galaxy SPT-S J034640-5204.9 (hereafter SPT0346-52) at z = 5.656. This galaxy has also been observed with ALMA, HST , Spitzer , Herschel , Atacama Pathfinder EXperiment, and the Very Large Telescope. Previous observations indicate that if the infrared (IR) emission is driven by star formation, then the inferred lensing-corrected star formation rate (SFR) (∼4500 M {sub ☉} yr{sup −1}) and SFR surface density Σ{sub SFR} (∼2000 M {sub ☉} yr{sup −1} kpc{sup −2}) are both exceptionally high. It remained unclear frommore » the previous data, however, whether a central active galactic nucleus (AGN) contributes appreciably to the IR luminosity. The Chandra upper limit shows that SPT0346-52 is consistent with being star formation dominated in the X-ray, and any AGN contribution to the IR emission is negligible. The ATCA radio continuum upper limits are also consistent with the FIR-to-radio correlation for star-forming galaxies with no indication of an additional AGN contribution. The observed prodigious intrinsic IR luminosity of (3.6 ± 0.3) × 10{sup 13} L {sub ☉} originates almost solely from vigorous star formation activity. With an intrinsic source size of 0.61 ± 0.03 kpc, SPT0346-52 is confirmed to have one of the highest Σ{sub SFR} of any known galaxy. This high Σ{sub SFR}, which approaches the Eddington limit for a radiation pressure supported starburst, may be explained by a combination of very high star formation efficiency and gas fraction.« less

  17. The Vela Cloud: A Giant H I Anomaly in the NGC 3256 GROUP

    NASA Astrophysics Data System (ADS)

    English, Jayanne; Koribalski, B.; Bland-Hawthorn, J.; Freeman, K. C.; McCain, Claudia F.

    2010-01-01

    We present Australia Telescope Compact Array (ATCA) observations of a galaxy-sized intergalactic H I cloud ("the Vela Cloud") in the NGC 3256 galaxy group. The group contains the prominent merging galaxy NGC 3256, which is surrounded by a number of H I fragments, the tidally disturbed galaxy NGC 3263, and several other peculiar galaxies. The Vela Cloud, with an H I mass of 3-5 × 10^9 M_{⊙}, resides southeast of NGC 3256 and west of NGC 3263, within an area of 9' × 16' (100 kpc × 175 kpc for an adopted distance of 38 Mpc). In our ATCA data the Vela Cloud appears as three diffuse components and contains four density enhancements. The Vela Cloud's properties, together with its group environment, suggest that it has a tidal origin. Each density enhancement contains ˜ 10^{8} M_{⊙} of H I gas, which is sufficient material for the formation of globular cluster progenitors. However, if we represent the enhancements as Bonnor-Ebert spheres, then the pressure of the surrounding H I would need to increase by at least a factor of 9 in order to cause the collapse of an enhancement. Thus we do not expect them to form massive bound stellar systems like super star clusters or tidal dwarf galaxies. Since the H I density enhancements have some properties in common with high-velocity clouds, we explore whether they may evolve to be identified with these starless clouds instead. Original plate material is copyright © the Royal Observatory Edinburgh and the Anglo-Australian Observatory. The plates were processed into the present compressed digital form with their permission. The Digitized Sky Survey was produced at the Space Telescope Science Institute under US Government grant NAG W-2166.

  18. The correct estimate of the probability of false detection of the matched filter in weak-signal detection problems . II. Further results with application to a set of ALMA and ATCA data

    NASA Astrophysics Data System (ADS)

    Vio, R.; Vergès, C.; Andreani, P.

    2017-08-01

    The matched filter (MF) is one of the most popular and reliable techniques to the detect signals of known structure and amplitude smaller than the level of the contaminating noise. Under the assumption of stationary Gaussian noise, MF maximizes the probability of detection subject to a constant probability of false detection or false alarm (PFA). This property relies upon a priori knowledge of the position of the searched signals, which is usually not available. Recently, it has been shown that when applied in its standard form, MF may severely underestimate the PFA. As a consequence the statistical significance of features that belong to noise is overestimated and the resulting detections are actually spurious. For this reason, an alternative method of computing the PFA has been proposed that is based on the probability density function (PDF) of the peaks of an isotropic Gaussian random field. In this paper we further develop this method. In particular, we discuss the statistical meaning of the PFA and show that, although useful as a preliminary step in a detection procedure, it is not able to quantify the actual reliability of a specific detection. For this reason, a new quantity is introduced called the specific probability of false alarm (SPFA), which is able to carry out this computation. We show how this method works in targeted simulations and apply it to a few interferometric maps taken with the Atacama Large Millimeter/submillimeter Array (ALMA) and the Australia Telescope Compact Array (ATCA). We select a few potential new point sources and assign an accurate detection reliability to these sources.

  19. Local Group dSph radio survey with ATCA (I): observations and background sources

    NASA Astrophysics Data System (ADS)

    Regis, Marco; Richter, Laura; Colafrancesco, Sergio; Massardi, Marcella; de Blok, W. J. G.; Profumo, Stefano; Orford, Nicola

    2015-04-01

    Dwarf spheroidal (dSph) galaxies are key objects in near-field cosmology, especially in connection to the study of galaxy formation and evolution at small scales. In addition, dSphs are optimal targets to investigate the nature of dark matter. However, while we begin to have deep optical photometric observations of the stellar population in these objects, little is known so far about their diffuse emission at any observing frequency, and hence on thermal and non-thermal plasma possibly residing within dSphs. In this paper, we present deep radio observations of six local dSphs performed with the Australia Telescope Compact Array (ATCA) at 16 cm wavelength. We mosaicked a region of radius of about 1 deg around three `classical' dSphs, Carina, Fornax, and Sculptor, and of about half of degree around three `ultrafaint' dSphs, BootesII, Segue2, and Hercules. The rms noise level is below 0.05 mJy for all the maps. The restoring beams full width at half-maximum ranged from 4.2 arcsec × 2.5 arcsec to 30.0 arcsec × 2.1 arcsec in the most elongated case. A catalogue including the 1392 sources detected in the six dSph fields is reported. The main properties of the background sources are discussed, with positions and fluxes of brightest objects compared with the FIRST, NVSS, and SUMSS observations of the same fields. The observed population of radio emitters in these fields is dominated by synchrotron sources. We compute the associated source number counts at 2 GHz down to fluxes of 0.25 mJy, which prove to be in agreement with AGN count models.

  20. Local Group dSph radio survey with ATCA (III): constraints on particle dark matter

    NASA Astrophysics Data System (ADS)

    Regis, Marco; Colafrancesco, Sergio; Profumo, Stefano; de Blok, W. J. G.; Massardi, Marcella; Richter, Laura

    2014-10-01

    We performed a deep search for radio synchrotron emissions induced by weakly interacting massive particles (WIMPs) annihilation or decay in six dwarf spheroidal (dSph) galaxies of the Local Group. Observations were conducted with the Australia Telescope Compact Array (ATCA) at 16 cm wavelength, with an rms sensitivity better than 0.05 mJy/beam in each field. In this work, we first discuss the uncertainties associated with the modeling of the expected signal, such as the shape of the dark matter (DM) profile and the dSph magnetic properties. We then investigate the possibility that point-sources detected in the proximity of the dSph optical center might be due to the emission from a DM cuspy profile. No evidence for an extended emission over a size of few arcmin (which is the DM halo size) has been detected. We present the associated bounds on the WIMP parameter space for different annihilation/decay final states and for different astrophysical assumptions. If the confinement of electrons and positrons in the dSph is such that the majority of their power is radiated within the dSph region, we obtain constraints on the WIMP annihilation rate which are well below the thermal value for masses up to few TeV. On the other hand, for conservative assumptions on the dSph magnetic properties, the bounds can be dramatically relaxed. We show however that, within the next 10 years and regardless of the astrophysical assumptions, it will be possible to progressively close in on the full parameter space of WIMPs by searching for radio signals in dSphs with SKA and its precursors.

  1. The ATCA CABB Line Survey on Centaurus A: Properties of the Molecular Gas from the Dust Lanes to the Central Engine

    NASA Astrophysics Data System (ADS)

    Ott, Juergen; Henkel, Christian; Meier, David; Feain, Ilana; Martin-Pintado, Jesus; Israel, Frank; Impellizzeri, Caterina M. V.

    2011-04-01

    Centaurus A with its host NGC5128 is the most nearby radio galaxy. Its molecular spectrum exhibits three prominent features: a) gas that is located in the outer disk and dust lanes, b) absorption lines that are supposedly close to the central AGN, and c) gas in emission from the central nucleus. We propose to perform an extensive line survey toward CenA using the exciting new capabilities of CABB. Our multi-band line observations will allow us to derive the exact physical conditions of each component as well as the chemistry involved.

  2. Skyscrapers in the Desert: Observing Ongoing, Active Star Formation in the Low-Density Wing of the Small Magellanic Cloud

    NASA Astrophysics Data System (ADS)

    Fulmer, Leah M.; Gallagher, John S.; Hamann, Wolf-Rainer; Oskinova, Lida; Ramachandran, Varsha

    2018-01-01

    The low-density Wing of the Small Magellanic Cloud exhibits ongoing, active star formation despite a distinctive lack of dense ambient gas and dust, or resources from which to form stars. Our continued work in studying this region reveals that these paradoxical observations may be explained by a process of sequential star formation. We present photometric, clustering, and spatial analyses in support of this scenario, along with a proposed star formation history based on the following evidence: matches to isochrone models, stellar and ionized gas kinematics (VLT, SALT), and regional HI gas kinematics (ATCA, PKS).

  3. An Integrated Approach to Winds, Jets, and State Transitions

    NASA Astrophysics Data System (ADS)

    Neilsen, Joseph

    2017-09-01

    We propose a large multiwavelength campaign (120 ks Chandra HETGS, NuSTAR, INTEGRAL, JVLA/ATCA, Swift, XMM, Gemini) on a black hole transient to study the influence of ionized winds on relativistic jets and state transitions. With a reimagined observing strategy based on new results on integrated RMS variability and a decade of radio/X-ray monitoring, we will search for winds during and after the state transition to test their influence on and track their coevolution with the disk and the jet over the next 2-3 months. Our spectral and timing constraints will provide precise probes of the accretion geometry and accretion/ejection physics.

  4. Enhancing neonatal survival: what can we do today?

    PubMed

    Daga, S; Daga, A; Mhatre, S; Ghane, V

    2016-08-01

    Neonatal deaths account for 44% of the world's under-5 child mortality. Over half of all neonatal deaths globally occur in preterm babies. Therefore, improving care of a preterm baby is particularly important to reduce under-5 mortality. The objective of this study was to spell out components of care of preterm/low birth weight babies at first level health facility and at first referral unit (FRU) in low resource settings. We have analyzed weight-wise survivals at two hospitals attached to medical colleges, J.J. Hospital, Mumbai and General Hospital, Talegaon, and at Rural Hospital, Dahanu. There were three-tier interventions: (i) warmth+ feeding and antibiotics, (ii) improved care at birth plus increased oxygen availability and (iii) use of dopamine. J.J. Hospital went through all these stages one after another; General Hospital had all three going simultaneously. The Rural Hospital had a 1+2. During 1978 to 1984, J.J. Hospital saved 50 to 55% very low birth weight (VLBW) babies by providing warmth, feeding and antibiotics. This percentage increased to 56 to 58%, when adequate oxygen and good care at birth was available (1984 to 1989). For babies in the moderately low birth weight category (MLBW), 1500 to 2000 g at birth, the corresponding figures were 56 to 58% and 84 to 86%. The same interventions led to statistically significant decline in MLBW and VLBW categories at General Hospital, Talegaon (2010 to 2013). The Rural Hospital, Dahanu (1987 to 1992) achieved better survival rates in VLBW (61.5%) and MLBW (92.5%) categories with identical interventions and less staff. On the basis of our results, we suggest that in resource-limited settings, the first level health facility may be able to look after short-stay babies that weigh more than 1500 g and that have no respiratory distress. The FRU may look after MLBW babies, with or without respiratory distress, and VLBW babies without respiratory distress by giving special care.

  5. Masses and activity of AB Doradus B a/b. The age of the AB Dor quadruple system revisited

    NASA Astrophysics Data System (ADS)

    Wolter, U.; Czesla, S.; Fuhrmeister, B.; Robrade, J.; Engels, D.; Wieringa, M.; Schmitt, J. H. M. M.

    2014-10-01

    We present a multiwavelength study of the close binary AB Dor Ba/b (Rst137B). Our study comprises astrometric orbit measurements, optical spectroscopy, X-ray and radio observations. Using all available adaptive optics images of AB Dor B taken with VLT/NACO from 2004 to 2009, we tightly constrain its orbital period to 360.6 ± 1.5 days. We present the first orbital solution of Rst 137B and estimate the combined mass of AB Dor Ba+b as 0.69+0.02-0.24 M⊙, slightly exceeding previous estimates based on IR photometry. Our determined orbital inclination of Rst 137B is close to the axial inclination of AB Dor A inferred from Doppler imaging. Our VLT/UVES spectra yield high rotational velocities of ≥30 km s-1 for both components Ba and Bb, in accord with previous measurements, which corresponds to rotation periods significantly shorter than one day. Our combined spectral model, using PHOENIX spectra, yields an effective temperature of 3310 ± 50 K for the primary and approximately 60 K less for the secondary. The optical spectra presumably cover a chromospheric flare and show that at least one component of Rst 137B is significantly active. Activity and weak variations are also found in our simultaneous XMM-Newton observations, while our ATCA radio data yield constant fluxes at the level of previous measurements. Using evolutionary models, our newly determined stellar parameters confirm that the age of Rst 137B is between 50 and 100 Myr. Based on observations collected at the European Southern Observatory, Paranal, Chile, 383.D-1002(A) and the ESO Science Archive Facility. Using data obtained with XMM-Newton, an ESA science mission with instruments and contributions directly funded by ESA Member states and NASA. Using data obtained with the Australia Telescope Compact Array (ATCA) operated by the Commonwealth Scientific and Industrial Research Organisation (CSIRO).

  6. ATCA observations of the MACS-Planck Radio Halo Cluster Project. II. Radio observations of an intermediate redshift cluster sample

    NASA Astrophysics Data System (ADS)

    Martinez Aviles, G.; Johnston-Hollitt, M.; Ferrari, C.; Venturi, T.; Democles, J.; Dallacasa, D.; Cassano, R.; Brunetti, G.; Giacintucci, S.; Pratt, G. W.; Arnaud, M.; Aghanim, N.; Brown, S.; Douspis, M.; Hurier, J.; Intema, H. T.; Langer, M.; Macario, G.; Pointecouteau, E.

    2018-04-01

    Aim. A fraction of galaxy clusters host diffuse radio sources whose origins are investigated through multi-wavelength studies of cluster samples. We investigate the presence of diffuse radio emission in a sample of seven galaxy clusters in the largely unexplored intermediate redshift range (0.3 < z < 0.44). Methods: In search of diffuse emission, deep radio imaging of the clusters are presented from wide band (1.1-3.1 GHz), full resolution ( 5 arcsec) observations with the Australia Telescope Compact Array (ATCA). The visibilities were also imaged at lower resolution after point source modelling and subtraction and after a taper was applied to achieve better sensitivity to low surface brightness diffuse radio emission. In case of non-detection of diffuse sources, we set upper limits for the radio power of injected diffuse radio sources in the field of our observations. Furthermore, we discuss the dynamical state of the observed clusters based on an X-ray morphological analysis with XMM-Newton. Results: We detect a giant radio halo in PSZ2 G284.97-23.69 (z = 0.39) and a possible diffuse source in the nearly relaxed cluster PSZ2 G262.73-40.92 (z = 0.421). Our sample contains three highly disturbed massive clusters without clear traces of diffuse emission at the observed frequencies. We were able to inject modelled radio haloes with low values of total flux density to set upper detection limits; however, with our high-frequency observations we cannot exclude the presence of RH in these systems because of the sensitivity of our observations in combination with the high z of the observed clusters. The reduced images are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/611/A94

  7. Limited Surface Observations Climatic Summary (LISOCS), Murmansk, USSR. Parts A-F

    DTIC Science & Technology

    1988-06-01

    1 OPERATING LOCATION - A USAFETAC Air Weather Service (MAC) "LIMITED SURFACE OBSERVATIONS" , 3sP6FETAr CLIMATIC SUMMARY "LISOCS" MURMANSK USSR MSC ...3’ 7"󈧵 1 -𔄁 4p-5s UC S6 TLIAL PLAN (Dr ’ EES I I 0 INb N • . 1.. 9.2 7.9 .7 29.9 7.5 !NL 7 𔃾.6 3.. ’,2 17.1 66 . 2.3 3 .6 1.2 7.2 93 TC 7 . 1.3...CEIrATOLOSY R INCH PLPCENIAGE F TEE L UC -NCY Or OCCUPRC NCE (IF SUROFACE WI1ND UTPf C tION VERSUS WINE) lFEfE StEAFL T AC FRU4 POORLYOERY08AT31ON’ Alg

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Batista, Antonio J. N.; Santos, Bruno; Fernandes, Ana

    The data acquisition and control instrumentation cubicles room of the ITER tokamak will be irradiated with neutrons during the fusion reactor operation. A Virtex-6 FPGA from Xilinx (XC6VLX365T-1FFG1156C) is used on the ATCA-IO-PROCESSOR board, included in the ITER Catalog of I and C products - Fast Controllers. The Virtex-6 is a re-programmable logic device where the configuration is stored in Static RAM (SRAM), functional data stored in dedicated Block RAM (BRAM) and functional state logic in Flip-Flops. Single Event Upsets (SEU) due to the ionizing radiation of neutrons causes soft errors, unintended changes (bit-flips) to the values stored in statemore » elements of the FPGA. The SEU monitoring and soft errors repairing, when possible, were explored in this work. An FPGA built-in Soft Error Mitigation (SEM) controller detects and corrects soft errors in the FPGA configuration memory. Novel SEU sensors with Error Correction Code (ECC) detect and repair the BRAM memories. Proper management of SEU can increase reliability and availability of control instrumentation hardware for nuclear applications. The results of the tests performed using the SEM controller and the BRAM SEU sensors are presented for a Virtex-6 FPGA (XC6VLX240T-1FFG1156C) when irradiated with neutrons from the Portuguese Research Reactor (RPI), a 1 MW nuclear fission reactor operated by IST in the neighborhood of Lisbon. Results show that the proposed SEU mitigation technique is able to repair the majority of the detected SEU errors in the configuration and BRAM memories. (authors)« less

  9. VizieR Online Data Catalog: MALT-45, a 7mm survey of the southern Galaxy (Jordan+, 2015)

    NASA Astrophysics Data System (ADS)

    Jordan, C. H.; Walsh, A. J.; Lowe, V.; Voronkov, M. A.; Ellingsen, S. P.; Breen, S. L.; Purcell, C. R.; Barnes, P. J.; Burton, M. G.; Cunningham, M. R.; Hill, T.; Jackson, J. M.; Longmore, S. N.; Peretto, N.; Urquhart, J. S.

    2018-03-01

    MALT-45 is an untargeted Galactic plane survey for spectral lines which are commonly bright in star-forming regions at 45GHz (7mm waveband). We have so far observed 5 square degrees within the region bounded by 330°<=l<=335°, b=+/-0.5°. MALT-45 observations were conducted on the Australia Telescope Compact Array (ATCA), which provides 2x2048MHz broad-band continuum windows for observing. Section 1.1 discusses the primary lines surveyed, and their rest frequencies dictate the positions of the broad-band windows for MALT-45. Within the frequency ranges of the broad-band windows, we survey for 12 spectral lines. (2 data files).

  10. Deployable Air Beam Fender System (DAFS): Energy Absorption Performance Analysis

    DTIC Science & Technology

    2007-03-30

    impacts. The main energy-absorbing component of DAFS is the flexible cylindrical pressure vessel (figure 3), which is constructed of a woven, coated fabric...96Co60rfss ar Fiur 16.atca Normali"ed Volme Versusm Percen04-t DiamerlCmrsinCre o 5 2-Ft Dia 2- tFt -ia 4 ~6-ft Dia 0.75 47Il " - Ft13-4 iaa U +1.77 M...N .S.)2Is- Ol = X’Scot ,60O DLe4" e~~eoo Cnmlat~V~ aDxftcil Iffc /idaN 6-ft Die - 900 Bo 2-31S FtO ria LS135. 4- Dia60pi8fDa +oo 2:U13ý0 * X𔃼

  11. Substrate Specificity and Inhibitor Sensitivity of Plant UDP-Sugar Producing Pyrophosphorylases.

    PubMed

    Decker, Daniel; Kleczkowski, Leszek A

    2017-01-01

    UDP-sugars are essential precursors for glycosylation reactions producing cell wall polysaccharides, sucrose, glycoproteins, glycolipids, etc. Primary mechanisms of UDP sugar formation involve the action of at least three distinct pyrophosphorylases using UTP and sugar-1-P as substrates. Here, substrate specificities of barley and Arabidopsis (two isozymes) UDP-glucose pyrophosphorylases (UGPase), Arabidopsis UDP-sugar pyrophosphorylase (USPase) and Arabidopsis UDP- N -acetyl glucosamine pyrophosphorylase2 (UAGPase2) were investigated using a range of sugar-1-phosphates and nucleoside-triphosphates as substrates. Whereas all the enzymes preferentially used UTP as nucleotide donor, they differed in their specificity for sugar-1-P. UGPases had high activity with D-Glc-1-P, but could also react with Fru-1-P and Fru-2-P ( K m values over 10 mM). Contrary to an earlier report, their activity with Gal-1-P was extremely low. USPase reacted with a range of sugar-1-phosphates, including D-Glc-1-P, D-Gal-1-P, D-GalA-1-P ( K m of 1.3 mM), β-L-Ara-1-P and α-D-Fuc-1-P ( K m of 3.4 mM), but not β-L-Fuc-1-P. In contrast, UAGPase2 reacted only with D-GlcNAc-1-P, D-GalNAc-1-P ( K m of 1 mM) and, to some extent, D-Glc-1-P ( K m of 3.2 mM). Generally, different conformations/substituents at C2, C4, and C5 of the pyranose ring of a sugar were crucial determinants of substrate specificity of a given pyrophosphorylase. Homology models of UDP-sugar binding to UGPase, USPase and UAGPase2 revealed more common amino acids for UDP binding than for sugar binding, reflecting differences in substrate specificity of these proteins. UAGPase2 was inhibited by a salicylate derivative that was earlier shown to affect UGPase and USPase activities, consistent with a common structural architecture of the three pyrophosphorylases. The results are discussed with respect to the role of the pyrophosphorylases in sugar activation for glycosylated end-products.

  12. [False recognition of faces associated with fronto-temporal dementia with prosopagnosia].

    PubMed

    Verstichel, P

    2005-09-01

    The association of prosopagnosia and false recognition of faces is unusual and contributes to our understanding of the generation of facial familiarity. A 67-year-old man with a left prefrontal traumatic lesion, developed a temporal variety of fronto-temporal dementia (semantic dementia) with amyotrophic lateral sclerosis. Cerebral imagery demonstrated a bilateral, temporal anterior atrophy predominating in the right hemisphere. The main cognitive signs consisted in severe difficulties to recognize faces of familiar people (prosopagnosia), associated with systematic false recognition of unfamiliar people. Neuropsychological testing indicated that the prosopagnosia probably resulted from the association of an associative/mnemonic mechanism (inability to activate the Face Recognition Units (FRU) from the visual input) and a semantic mechanism (degradation of semantic/biographical information or deconnexion between FRU and this information). At the early stage of the disease, the patient could activate residual semantic information about individuals from their names, but after a 4-year course, he failed to do so. This worsening could be attributed to the extension of the degenerative lesions to the left temporal lobe. Familiar and unfamiliar faces triggered a marked feeling of knowing. False recognition concerned all the unfamiliar faces, and the patient claimed spontaneously that they corresponded to actors, but he could not provide any additional information about their specific identities. The coexistence of prosopagnosia and false recognition suggests the existence of different interconnected systems processing face recognition, one intended to identification of individuals, and the other producing the sense of familiarity. Dysfunctions at different stages of one or the other of these two processes could result in distortions in the feeling of knowing. From this case and others reported in literature, we propose to complete the classical model of face processing by adding a pathway linked to limbic system and frontal structures. This later pathway could normally emit signals for familiarity, essentially autonomic, in response to the familiar faces. These signals, primitively unconscious, secondly reach consciousness and are then integrated by a central supervisor system which evaluates and verifies identity-specific biographical information in order to make a decision about the sense of familiarity.

  13. Intake of high-fructose corn syrup sweetened soft drinks, fruit drinks and apple juice is associated with prevalent arthritis in US adults, aged 20-30 years.

    PubMed

    DeChristopher, L R; Uribarri, J; Tucker, K L

    2016-03-07

    There is a link between joint and gut inflammation of unknown etiology in arthritis. Existing research indicates that regular consumption of high-fructose corn syrup sweetened (HFCS) soft drinks, but not diet soft drinks, may be associated with increased risk of seropositive rheumatoid arthritis (RA) in women, independent of other dietary and lifestyle factors. One unexplored hypothesis for this association is that fructose malabsorption, due to regular consumption of excess free fructose (EFF) and HFCS, contributes to fructose reactivity in the gastrointestinal tract and intestinal in situ formation of enFruAGEs, which once absorbed, travel beyond the intestinal boundaries to other tissues and promote inflammation. In separate studies, the accumulation of advanced glycation end-products has been associated with joint inflammation in RA. Objective of this study was to assess the association between EFF beverages intake and non-age, non-wear and tear-associated arthritis in US young adults. In this cross sectional study of 1209 adults aged 20-30y, (Nutrition and Health Examination Surveys 2003-2006) exposure variables were high EFF beverages, including HFCS sweetened soft drinks, and any combination of HFCS sweetened soft drinks, fruit drinks (FD) and apple juice, referred to as tEFF. Analyses of diet soda and diet FD were included for comparison. The outcome was self-reported arthritis. Rao Scott Ҳ(2) was used for prevalence differences and logistic regression for associations, adjusted for confounders. Young adults consuming any combination of high EFF beverages (tEFF) ⩾5 times/week (but not diet soda) were three times as likely to have arthritis as non/low consumers (odds ratios=3.01; p⩽0.021; 95% confidence intervals=1.20-7.59), independent of all covariates, including physical activity, other dietary factors, blood glucose and smoking. EFF beverage intake is significantly associated with arthritis in US adults aged 20-30 years, possibly due to the intestinal in situ formation of enFruAGEs.

  14. Intake of high-fructose corn syrup sweetened soft drinks, fruit drinks and apple juice is associated with prevalent arthritis in US adults, aged 20–30 years

    PubMed Central

    DeChristopher, L R; Uribarri, J; Tucker, K L

    2016-01-01

    Objective: There is a link between joint and gut inflammation of unknown etiology in arthritis. Existing research indicates that regular consumption of high-fructose corn syrup sweetened (HFCS) soft drinks, but not diet soft drinks, may be associated with increased risk of seropositive rheumatoid arthritis (RA) in women, independent of other dietary and lifestyle factors. One unexplored hypothesis for this association is that fructose malabsorption, due to regular consumption of excess free fructose (EFF) and HFCS, contributes to fructose reactivity in the gastrointestinal tract and intestinal in situ formation of enFruAGEs, which once absorbed, travel beyond the intestinal boundaries to other tissues and promote inflammation. In separate studies, the accumulation of advanced glycation end-products has been associated with joint inflammation in RA. Objective of this study was to assess the association between EFF beverages intake and non-age, non-wear and tear-associated arthritis in US young adults. Methods: In this cross sectional study of 1209 adults aged 20–30y, (Nutrition and Health Examination Surveys 2003–2006) exposure variables were high EFF beverages, including HFCS sweetened soft drinks, and any combination of HFCS sweetened soft drinks, fruit drinks (FD) and apple juice, referred to as tEFF. Analyses of diet soda and diet FD were included for comparison. The outcome was self-reported arthritis. Rao Scott Ҳ2 was used for prevalence differences and logistic regression for associations, adjusted for confounders. Results: Young adults consuming any combination of high EFF beverages (tEFF) ⩾5 times/week (but not diet soda) were three times as likely to have arthritis as non/low consumers (odds ratios=3.01; p⩽0.021; 95% confidence intervals=1.20–7.59), independent of all covariates, including physical activity, other dietary factors, blood glucose and smoking. Conclusion: EFF beverage intake is significantly associated with arthritis in US adults aged 20–30 years, possibly due to the intestinal in situ formation of enFruAGEs. PMID:26950480

  15. Substrate Specificity and Inhibitor Sensitivity of Plant UDP-Sugar Producing Pyrophosphorylases

    PubMed Central

    Decker, Daniel; Kleczkowski, Leszek A.

    2017-01-01

    UDP-sugars are essential precursors for glycosylation reactions producing cell wall polysaccharides, sucrose, glycoproteins, glycolipids, etc. Primary mechanisms of UDP sugar formation involve the action of at least three distinct pyrophosphorylases using UTP and sugar-1-P as substrates. Here, substrate specificities of barley and Arabidopsis (two isozymes) UDP-glucose pyrophosphorylases (UGPase), Arabidopsis UDP-sugar pyrophosphorylase (USPase) and Arabidopsis UDP-N-acetyl glucosamine pyrophosphorylase2 (UAGPase2) were investigated using a range of sugar-1-phosphates and nucleoside-triphosphates as substrates. Whereas all the enzymes preferentially used UTP as nucleotide donor, they differed in their specificity for sugar-1-P. UGPases had high activity with D-Glc-1-P, but could also react with Fru-1-P and Fru-2-P (Km values over 10 mM). Contrary to an earlier report, their activity with Gal-1-P was extremely low. USPase reacted with a range of sugar-1-phosphates, including D-Glc-1-P, D-Gal-1-P, D-GalA-1-P (Km of 1.3 mM), β-L-Ara-1-P and α-D-Fuc-1-P (Km of 3.4 mM), but not β-L-Fuc-1-P. In contrast, UAGPase2 reacted only with D-GlcNAc-1-P, D-GalNAc-1-P (Km of 1 mM) and, to some extent, D-Glc-1-P (Km of 3.2 mM). Generally, different conformations/substituents at C2, C4, and C5 of the pyranose ring of a sugar were crucial determinants of substrate specificity of a given pyrophosphorylase. Homology models of UDP-sugar binding to UGPase, USPase and UAGPase2 revealed more common amino acids for UDP binding than for sugar binding, reflecting differences in substrate specificity of these proteins. UAGPase2 was inhibited by a salicylate derivative that was earlier shown to affect UGPase and USPase activities, consistent with a common structural architecture of the three pyrophosphorylases. The results are discussed with respect to the role of the pyrophosphorylases in sugar activation for glycosylated end-products. PMID:28970843

  16. Nonenzymatic modification of Ubiquitin under high-pressure and -temperature treatment: mass spectrometric studies.

    PubMed

    Kijewska, Monika; Radziszewska, Karolina; Kielmas, Martyna; Stefanowicz, Piotr; Szewczuk, Zbigniew

    2015-01-21

    The effect of high-pressure and/or high-temperature on the glycation of a model protein (ubiquitin) was investigated by mass spectrometry. This paper reports the impact of high pressure (up to 1200 MPa) on the modification of a ubiquitin using ESI-MS measurements. The application of glucose labeled with stable isotope allows a quantitative assessment of modification under the conditions of high-pressure (HPG) and high-temperature (HTG) glycation. A higher degree of modification was observed for the sample heated at 80 °C for 25 min under atmospheric pressure than for sample treated under high pressure. In samples treated at pressure below 400 MPa an insignificant increase of glycation level was observed, whereas high pressure (>600 MPa) has only a minor effect on the number of hexose moieties (Fru) attached to the lysine residue side chain.

  17. A Chandra Survey of high-redshift (0.7 < z < 0.8) clusters selected in the 100 deg^2 SPT-Pol Deep Field

    NASA Astrophysics Data System (ADS)

    Garmire, Gordon

    2016-09-01

    We propose to observe a complete sample of 10 galaxy clusters at 1e14 < M500 < 5e14 and 0.7 < z < 0.8. These systems were selected from the 100 deg^2 deep field of the SPT-Pol SZ survey. This survey are has significant complementary data, including uniform depth ATCA, Herschel, Spitzer, and DES imaging, enabling a wide variety of astrophysical and cosmological studies. This sample complements the successful SPT-XVP survey, which has a broad redshift range and a narrow mass range, by including clusters over a narrow redshift range and broad mass range. These systems are such low mass and high redshift that they will not be detected in the eRosita all-sky survey.

  18. Different evolutionary stages in massive star formation. Centimeter continuum and H2O maser emission with ATCA

    NASA Astrophysics Data System (ADS)

    Sánchez-Monge, Á.; Beltrán, M. T.; Cesaroni, R.; Fontani, F.; Brand, J.; Molinari, S.; Testi, L.; Burton, M.

    2013-02-01

    Aims: We present Australia Telescope Compact Array (ATCA) observations of the H2O maser line and radio continuum at 18.0 GHz and 22.8 GHz toward a sample of 192 massive star-forming regions containing several clumps already imaged at 1.2 mm. The main aim of this study is to investigate the water maser and centimeter continuum emission (that likely traces thermal free-free emission) in sources at different evolutionary stages, using evolutionary classifications previously published. Methods: We used the recently comissioned Compact Array Broadband Backend (CABB) at ATCA that obtains images with ~20'' resolution in the 1.3 cm continuum and H2O maser emission in all targets. For the evolutionary analysis of the sources we used millimeter continuum emission from the literature and the infrared emission from the MSX Point Source Catalog. Results: We detect centimeter continuum emission in 88% of the observed fields with a typical rms noise level of 0.45 mJy beam-1. Most of the fields show a single radio continuum source, while in 20% of them we identify multiple components. A total of 214 cm continuum sources have been identified, that likely trace optically thin H ii regions, with physical parameters typical of both extended and compact H ii regions. Water maser emission was detected in 41% of the regions, resulting in a total of 85 distinct components. The low angular (~20'') and spectral (~14 km s-1) resolutions do not allow a proper analysis of the water maser emission, but suffice to investigate its association with the continuum sources. We have also studied the detection rate of H ii regions in the two types of IRAS sources defined in the literature on the basis of the IRAS colors: High and Low. No significant differences are found, with high detection rates (>90%) for both High and Low sources. Conclusions: We classify the millimeter and infrared sources in our fields in three evolutionary stages following the scheme presented previously: (Type 1) millimeter-only sources, (Type 2) millimeter plus infrared sources, (Type 3) infrared-only sources. We find that H ii regions are mainly associated with Type 2 and Type 3 objects, confirming that these are more evolved than Type 1 sources. The H ii regions associated with Type 3 sources are slightly less dense and larger in size than those associated with Type 2 sources, as expected if the H ii region expands as it evolves, and Type 3 objects are older than Type 2 objects. The maser emission is mostly found to be associated with Type 1 and Type 2 sources, with a higher detection rate toward Type 2, consistent with the results of the literature. Finally, our results on H ii region and H2O maser association with different evolutionary types confirm the evolutionary classification proposed previously. Appendices are available in electronic form at http://www.aanda.orgTables 3-5, 7-9 are only, and Table 1 is also available at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/550/A21

  19. Ammonia as a Temperature Tracer in the Ultraluminous Galaxy Merger Arp 220

    NASA Astrophysics Data System (ADS)

    Ott, Jürgen; Henkel, Christian; Braatz, James A.; Weiß, Axel

    2011-12-01

    We present Australia Telescope Compact Array (ATCA) and Robert C. Byrd Green Bank Telescope (GBT) observations of ammonia (NH3) and the 1.2 cm radio continuum toward the ultraluminous infrared galaxy merger Arp 220. We detect the NH3(1,1), (2,2), (3,3), (4,4), (5,5), and (6,6) inversion lines in absorption against the unresolved, (62 ± 9) mJy continuum source at 1.2 cm. The peak apparent optical depths of the ammonia lines range from ~0.05 to 0.18. The absorption lines are well described by single-component Gaussians with central velocities in between the velocities of the eastern and western cores of Arp 220. Therefore, the ammonia likely traces gas that encompasses both cores. The absorption depth of the NH3(1,1) line is significantly shallower than expected based on the depths of the other transitions. The shallow (1,1) profile may be caused by contamination from emission by a hypothetical, cold (lsim 20 K) gas layer with an estimated column density of <~ 2 × 1014 cm-2. This layer would have to be located behind or away from the radio continuum sources to produce the contaminating emission. The widths of the ammonia absorption lines are ~120-430 km s-1, in agreement with those of other molecular tracers. We cannot confirm the extremely large line widths of up to ~1800 km s-1 previously reported for this galaxy. Using all of the ATCA detections except for the shallow (1,1) line, we determine a rotational temperature of (124 ± 19) K, corresponding to a kinetic temperature of T kin = (186 ± 55) K. Ammonia column densities depend on the excitation temperature. For excitation temperatures of 10 K and 50 K, we estimate N(NH3) = (1.7 ± 0.1) × 1016 cm-2 and (8.4 ± 0.5) × 1016 cm-2, respectively. The relation scales linearly for possible higher excitation temperatures. Our observations are consistent with an ortho-to-para-ammonia ratio of unity, implying that the ammonia formation temperature exceeds ~30 K. In the context of a model with a molecular ring that connects the two nuclei in Arp 220, we estimate the H2 gas density to be ~f -0.5 V × (1-4) × 103, where f V is the volume filling factor of the molecular gas. In addition to ammonia, our ATCA data show an absorption feature adjacent in frequency to the NH3(3,3) line. The line does not appear in the GBT spectrum. If we interpret the line to be from the OH 2Π3/2 J = 9/2 F = 4-4 transition, it would have a line width, systemic velocity, and apparent optical depth similar to what we detect in the ammonia lines. Comparing the new line to the previously detected 6 GHz OH 2Π3/2 J = 5/2 F = 2-2 transition, we determine a rotational OH temperature of ~245 K, about two times the rotational temperature of ammonia. If this association with OH is correct, it marks the first detection of the highly excited (~511 K above ground state) 2Π3/2 J = 9/2 F = 4-4 OH line in an extragalactic object.

  20. HDL Based FPGA Interface Library for Data Acquisition and Multipurpose Real Time Algorithms

    NASA Astrophysics Data System (ADS)

    Fernandes, Ana M.; Pereira, R. C.; Sousa, J.; Batista, A. J. N.; Combo, A.; Carvalho, B. B.; Correia, C. M. B. A.; Varandas, C. A. F.

    2011-08-01

    The inherent parallelism of the logic resources, the flexibility in its configuration and the performance at high processing frequencies makes the field programmable gate array (FPGA) the most suitable device to be used both for real time algorithm processing and data transfer in instrumentation modules. Moreover, the reconfigurability of these FPGA based modules enables exploiting different applications on the same module. When using a reconfigurable module for various applications, the availability of a common interface library for easier implementation of the algorithms on the FPGA leads to more efficient development. The FPGA configuration is usually specified in a hardware description language (HDL) or other higher level descriptive language. The critical paths, such as the management of internal hardware clocks that require deep knowledge of the module behavior shall be implemented in HDL to optimize the timing constraints. The common interface library should include these critical paths, freeing the application designer from hardware complexity and able to choose any of the available high-level abstraction languages for the algorithm implementation. With this purpose a modular Verilog code was developed for the Virtex 4 FPGA of the in-house Transient Recorder and Processor (TRP) hardware module, based on the Advanced Telecommunications Computing Architecture (ATCA), with eight channels sampling at up to 400 MSamples/s (MSPS). The TRP was designed to perform real time Pulse Height Analysis (PHA), Pulse Shape Discrimination (PSD) and Pile-Up Rejection (PUR) algorithms at a high count rate (few Mevent/s). A brief description of this modular code is presented and examples of its use as an interface with end user algorithms, including a PHA with PUR, are described.

  1. Radio and submillimetre observations of wind structure in zeta Puppis

    NASA Astrophysics Data System (ADS)

    Blomme, R.; van de Steene, G. C.; Prinja, R. K.; Runacres, M. C.; Clark, J. S.

    2003-09-01

    We present radio and submillimetre observations of the O4I(n)f star zeta Pup, and discuss structure in the outer region of its wind ( ~ 10-100 R_*). The properties of bremsstrahlung, the dominant emission process at these wavelengths, make it sensitive to structure and allow us to study how the amount of structure changes in the wind by comparing the fluxes at different wavelengths. Possible forms of structure at these distances include Corotating Interaction Regions (CIRs), stochastic clumping, a disk or a polar enhancement. As the CIRs are azimuthally asymmetric, they should result in variability at submillimetre or radio wavelengths. To look for this variability, we acquired 3.6 and 6 cm observations with the Australia Telescope Compact Array (ATCA), covering about two rotational periods of the star. We supplemented these with archive observations from the NRAO Very Large Array (VLA), which cover a much longer time scale. We did not find variability at more than the +/-20% level. The long integration time does allow an accurate determination of the fluxes at 3.6 and 6 cm. Converting these fluxes into a mass loss rate, we find dot {M} = 3.5 x 10-6 Msun/yr. This value confirms the significant discrepancy with the mass loss rate derived from the Hα profile, making zeta Pup an exception to the usually good agreement between the Hα and radio mass loss rates. To study the run of structure as a function of distance, we supplemented the ATCA data by observing zeta Pup at 850 mu m with the James Clerk Maxwell Telescope (JCMT) and at 20 cm with the VLA. A smooth wind model shows that the millimetre fluxes are too high compared to the radio fluxes. While recombination of helium in the outer wind cannot be discounted as an explanation, the wealth of evidence for structure strongly suggests this as the explanation for the discrepancy. Model calculations show that the structure needs to be present in the inner ~ 70 R_* of the wind, but that it decays significantly, or maybe even disappears, beyond that radius.

  2. Large-amplitude late-time radio variability in GRB 151027B

    NASA Astrophysics Data System (ADS)

    Greiner, J.; Bolmer, J.; Wieringa, M.; van der Horst, A. J.; Petry, D.; Schulze, S.; Knust, F.; de Bruyn, G.; Krühler, T.; Wiseman, P.; Klose, S.; Delvaux, C.; Graham, J. F.; Kann, D. A.; Moin, A.; Nicuesa-Guelbenzu, A.; Schady, P.; Schmidl, S.; Schweyer, T.; Tanga, M.; Tingay, S.; van Eerten, H.; Varela, K.

    2018-06-01

    Context. Deriving physical parameters from gamma-ray burst (GRB) afterglow observations remains a challenge, even 20 years after the discovery of afterglows. The main reason for the lack of progress is that the peak of the synchrotron emission is in the sub-mm range, thus requiring radio observations in conjunction with X-ray/optical/near-infrared data in order to measure the corresponding spectral slopes and consequently remove the ambiguity with respect to slow vs. fast cooling and the ordering of the characteristic frequencies. Aims: We have embarked on a multifrequency, multi-epoch observing campaign to obtain sufficient data for a given GRB that allows us to test the simplest version of the fireball afterglow model. Methods: We observed GRB 151027B, the 1000th Swift-detected GRB, with GROND in the optical-near-IR, ALMA in the sub-millimeter, ATCA in the radio band; we combined this with public Swift/XRT X-ray data. Results: While some observations at crucial times only return upper limits or surprising features, the fireball model is narrowly constrained by our data set, and allows us to draw a consistent picture with a fully determined parameter set. Surprisingly, we find rapid, large-amplitude flux density variations in the radio band which are extreme not only for GRBs, but generally for any radio source. We interpret them as scintillation effects, though their extreme nature requires the scattering screen to be at a much smaller distance than usually assumed, multiple screens, or a combination of the two. Conclusions: The data are consistent with the simplest fireball scenario for a blast wave moving into a constant-density medium, and slow-cooling electrons. All fireball parameters are constrained at or better than a factor of 2, except for the density and the fraction of the energy in the magnetic field which has a factor of 10 uncertainty in both directions. This paper makes use of the following data: ATCA: Proposal C2955 (PI: Greiner), ALMA: ADS/JAO.ALMA#2015.1.01558.T (PI: Schulze).

  3. Long-term monitoring of PKS0558­-504, a highly accreting AGN with a radio jet

    NASA Astrophysics Data System (ADS)

    Gliozzi, Mario

    Mario Gliozzi, mgliozzi@gmu.edu George Mason University, Fairfax, Virginia, United States The radio-loud Narrow-Line Seyfert 1 galaxy PKS 0558-504 is a highly variable, X-ray bright source with super-Eddington accretion rate and a powerful radio jet that does not dominate the emission beyond the radio band. Hence this source represents an ideal laboratory to study the link between accretion and ejection phenomena. Here we present the preliminary results from a 5-year monitoring campaign with RXTE as well as from a 1.5-year multi-wavelength campaign with Swift, complemented with radio observations from the ATCA and VLBI. We combine several pieces of information from different energy bands to shed some light on the energetics of accretion and ejection phenomena in this extreme black hole system.

  4. VLA Imaging of Protoplanetary Environments

    NASA Technical Reports Server (NTRS)

    Wilner, David J.

    2004-01-01

    We summarize the major accomplishments of our program to use high angular resolution observations at millimeter wavelengths to probe the structure of protoplanetary disks in nearby regions of star formation. The primary facilities used in this work were the Very Large Array (VLA) of the National Radio Astronomy Observatories (NRAO) located in New Mexico, and the recently upgraded Australia Telescope Compact Array (ATCA), located in Australia (to access sources in the far southern sky). We used these facilities to image thermal emission from dust particles in disks at long millimeter wavelengths, where the emission is optically thin and probes the full disk volume, including the inner regions of planet formation that remain opaque at shorter wavelengths. The best resolution obtained with the VLA is comparable to the size scales of the orbits of giant planets in our Solar System (< 10 AU).

  5. A Chandra Survey of low-mass clusters at 0.8 < z < 0.9 selected in the 100 deg^2 SPT-Pol Deep Field

    NASA Astrophysics Data System (ADS)

    Kraft, Ralph

    2016-09-01

    We propose to observe a complete sample of 4 galaxy clusters at 1e14 < M500 < 3e14 and 0.8 < z < 0.9. These systems were selected from the 100 deg^2 deep field of the SPT-Pol SZ survey. This survey are has significant complementary data, including uniform depth ATCA, Herschel, Spitzer, and DES imaging, enabling a wide variety of astrophysical and cosmological studies. This sample complements the successful SPT-XVP survey, which has a broad redshift range and a narrow mass range, by including clusters over a narrow redshift range and broad mass range. These systems are such low mass and high redshift that they will not be detected in the eRosita all-sky survey.

  6. A Chandra Survey of low-mass clusters at 0.7 < z < 0.8 selected in the 100 deg^2 SPT-Pol Deep Field

    NASA Astrophysics Data System (ADS)

    Kraft, Ralph

    2016-09-01

    We propose to observe a complete sample of 4 galaxy clusters at 1e14 < M500 < 3e14 and 0.7 < z < 0.8. These systems were selected from the 100 deg^2 deep field of the SPT-Pol SZ survey. This survey are has significant complementary data, including uniform depth ATCA, Herschel, Spitzer, and DES imaging, enabling a wide variety of astrophysical and cosmological studies. This sample complements the successful SPT-XVP survey, which has a broad redshift range and a narrow mass range, by including clusters over a narrow redshift range and broad mass range. These systems are such low mass and high redshift that they will not be detected in the eRosita all-sky survey.

  7. The Mysterious Rescue of adg1-1/tpt-2 – an Arabidopsis thaliana Double Mutant Impaired in Acclimation to High Light – by Exogenously Supplied Sugars

    PubMed Central

    Heinrichs, Luisa; Schmitz, Jessica; Flügge, Ulf-Ingo; Häusler, Rainer E.

    2012-01-01

    An Arabidopsis thaliana double mutant (adg1-1/tpt-2) defective in the day- and night-path of photoassimilate export from the chloroplast due to a knockout in the triose phosphate/phosphate translocator (TPT; tpt-2) and a lack of starch [mutation in ADP glucose pyrophosphorylase (AGPase); adg1-1] exhibits severe growth retardation, a decrease in the photosynthetic capacity, and a high chlorophyll fluorescence (HCF) phenotype under high light conditions. These phenotypes could be rescued when the plants were grown on sucrose (Suc) or glucose (Glc). Here we address the question whether Glc-sensing hexokinase1 (HXK1) defective in the Glc insensitive 2 (gin2-1) mutant is involved in the sugar-dependent rescue of adg1-1/tpt-2. Triple mutants defective in the TPT, AGPase, and HXK1 (adg1-1/tpt-2/gin2-1) were established as homozygous lines and grown together with Col-0 and Landsberg erecta (Ler) wild-type plants, gin2-1, the adg1-1/tpt-2 double mutant, and the adg1-1/tpt-2/gpt2-1 triple mutant [additionally defective in the glucose 6-phosphate/phosphate translocator 2 (GPT2)] on agar in the presence or absence of 50 mM of each Glc, Suc, or fructose (Fru). The growth phenotype of the double mutant and both triple mutants could be rescued to a similar extent only by Glc and Suc, but not by Fru. All three sugars were capable of rescuing the HCF and photosynthesis phenotype, irrespectively of the presence or absence of HXK1. Quantitative RT-PCR analyses of sugar-responsive genes revealed that plastidial HXK (pHXK) was up-regulated in adg1-1/tpt-2 plants grown on sugars, but showed no response in adg1-1/tpt-2/gin2-1. It appears likely that soluble sugars are directly taken up by the chloroplasts and enter further metabolism, which consumes ATP and NADPH from the photosynthetic light reaction and thereby rescues the photosynthesis phenotype of the double mutant. The implication of sugar turnover and probably signaling inside the chloroplasts for the concept of retrograde signaling is discussed. PMID:23233856

  8. Proper motion of the radio pulsar B1727-47 and its association with the supernova remnant RCW 114

    NASA Astrophysics Data System (ADS)

    Shternin, P. S.; Yu, M.; Kirichenko, A. Yu; Shibanov, Yu A.; Danilenko, A. A.; Voronkov, M. A.; Zyuzin, D. A.

    2017-12-01

    We report preliminary results of the analysis of the proper motion of the bright radio pulsar B1727-47. Using archival Parkes timing data, as well as original and archival ATCA interferometry observations, we, for the first time, constrain the pulsar proper motion at the level of 148±11 mas yr-1. The backward extrapolation of the proper motion vector to the pulsar birth epoch points at the center of the Galactic supernova remnant RCW 114 suggesting the genuine association between the two objects. We discuss the implications of the association and argue that the distance to the system is less than 1 kpc. This value is at least two times lower than the dispersion measure distance estimates. This suggests that the existing Galaxy electron density models are incomplete in the direction to the pulsar.

  9. Apocenter Glow in Eccentric Debris Disks: Implications for Fomalhaut and Epsilon Eridani

    NASA Technical Reports Server (NTRS)

    Pan, Margaret; Nesvold, Erika R.; Kuchner, Marc J.

    2016-01-01

    Debris disks often take the form of eccentric rings with azimuthal asymmetries in surface brightness. Such disks are often described as showing pericenter glow, an enhancement of the disk brightness in regions nearest the central star. At long wavelengths, however, the disk apocenters should appear brighter than their pericenters: in the long-wavelength limit, we find that the apocenter pericenter flux ratio scales as 1 + e for disk eccentricity e. We produce new models of this apocenter glow to explore its causes and wavelength dependence and study its potential as a probe of dust grain properties. Based on our models, we argue that several far-infrared and (sub)millimeter images of the Fomalhaut and Epsilon Eridani debris rings obtained with Herschel, JCMT, SHARC II, ALMA, and ATCA should be reinterpreted as suggestions or examples of apocenter glow. This reinterpretation yields new constraints on the disks dust grain properties and size distributions.

  10. VizieR Online Data Catalog: Local Group dSph radio survey with ATCA (Regis+, 2015)

    NASA Astrophysics Data System (ADS)

    Regis, M.; Richter, L.; Colafrancesco, S.; Massardi, M.; De Blok, W. J. G.; Profumo, S.; Orford, N.

    2015-09-01

    We present a catalogue of radio sources detected in the fields of six dwarf spheroidal galaxies of the Local Group, which are Carina, Fornax, Sculptor, BootesII, Segue2, and Hercules. Observations were performed during July/August 2011 with the six 22-m diameter Australia Telescope Compact Array antennae operating at 16cm wavelength. We mosaicked a region of radius of about one degree around the first three dwarfs, and of about half of degree around the last three dwarfs. The rms noise level is below 0.05mJy. The restoring beams FWHM ranged from 4.2x2.5-arcseconds to 30.0x2.1-arcseconds in the most elongated case. The catalogue includes different parameters describing 1835 entries which, in our classification, correspond to 1392 sources. See the publication for more details. (1 data file).

  11. Swift/BAT Detects Increase in Hard X-ray Emission from the Ultra-compact X-ray Binary 4U 1543-624

    NASA Astrophysics Data System (ADS)

    Ludlam, Renee; Miller, Jon M.; Miller-Jones, James; Reynolds, Mark

    2017-08-01

    The Swift/BAT detected an increase in hard X-ray emission (15-50 keV) coming from the ultra-compact X-ray binary 4U 1543-624 around 2017 August 9. The MAXI daily monitoring also shows a gradual increase in 2.0-20.0 keV X-ray intensity as of 2017 August 19. Swift/XRT ToO monitoring of the source was triggered and shows an increase in unabsorbed flux to 1.06E-9 ergs/cm2/s in the 0.3-10.0 keV energy band as of 2017 August 26. ATCA performed ToO observations for approximately 4 hours in the 5.5 GHz and 9.0 GHz bands while the antennas were in the 1.5A array configuration from 11:25-16:09 UTC on 2017 August 23. The source was not detected in either band.

  12. The energy spectrum and geometrical structure of Galactic turbulent magnetic field

    NASA Astrophysics Data System (ADS)

    Sun, Xiaohui; Gaensler, Bryan; Mcclure-Griffiths, Naomi; Purcell, Cormac; Hill, Alex; Burkhart, Blakesley; Lazarian, Alex

    2012-10-01

    The energy spectrum and geometrical structure of the turbulent magnetic field can offer a solid test of different theoretical models on the generation and evolution of Galactic magnetic fields. They are also pivotal to understanding the propagation of cosmic-ray particles. However, the energy spectrum has been difficult to determine and the geometrical structure has never been obtained so far, due to lack of proper methods and observations. We aim to infer these quantities by applying our newly developed techniques to polarisation images. These images are required to be observed with high angular resolution and broadband multi-channel polarimetry, which is possible only recently using the ATCA. As a pilot study, we plan to map the 2X2 degree high-latitude field centred at l=255.5 degree and b=-38 degree at 1.1-3.1 GHz in total intensity and polarisation.

  13. The energy spectrum and geometrical structure of Galactic turbulent magnetic field

    NASA Astrophysics Data System (ADS)

    Sun, Xiaohui; Gaensler, Bryan; Mcclure-Griffiths, Naomi; Purcell, Cormac; Hill, Alex; Burkhart, Blakesley; Lazarian, Alex

    2012-04-01

    The energy spectrum and geometrical structure of the turbulent magnetic field can offer a solid test of different theoretical models on the generation and evolution of Galactic magnetic fields. They are also pivotal to understanding the propagation of cosmic-ray particles. However, the energy spectrum has been difficult to determine and the geometrical structure has never been obtained so far, due to lack of proper methods and observations. We aim to infer these quantities by applying our newly developed techniques to polarisation images. These images are required to be observed with high angular resolution and broadband multi-channel polarimetry, which is possible only recently using the ATCA. As a pilot study, we plan to map the 2X2 degree high-latitude field centred at l=255.5 degree and b=-38 degree at 1.1-3.1 GHz in total intensity and polarisation.

  14. A Turnover in the Radio Light Curve of GW170817

    NASA Astrophysics Data System (ADS)

    Dobie, Dougal; Kaplan, David L.; Murphy, Tara; Lenc, Emil; Mooley, Kunal P.; Lynch, Christene; Corsi, Alessandra; Frail, Dale; Kasliwal, Mansi; Hallinan, Gregg

    2018-05-01

    We present 2–9 GHz radio observations of GW170817 covering the period 125–200 days post-merger, taken with the Australia Telescope Compact Array (ATCA) and the Karl G. Jansky Very Large Array (VLA). Our observations demonstrate that the radio afterglow peaked at 149 ± 2 days post-merger and is now declining in flux density. We see no evidence for evolution in the radio-only spectral index, which remains consistent with optically thin synchrotron emission connecting the radio, optical, and X-ray regimes. The peak implies a total energy in the synchrotron-emitting component of a few × 1050 erg. The temporal decay rate is most consistent with mildly or non-relativistic material and we do not see evidence for a very energetic off-axis jet, but we cannot distinguish between a lower-energy jet and more isotropic emission.

  15. A PCIe Gen3 based readout for the LHCb upgrade

    NASA Astrophysics Data System (ADS)

    Bellato, M.; Collazuol, G.; D'Antone, I.; Durante, P.; Galli, D.; Jost, B.; Lax, I.; Liu, G.; Marconi, U.; Neufeld, N.; Schwemmer, R.; Vagnoni, V.

    2014-06-01

    The architecture of the data acquisition system foreseen for the LHCb upgrade, to be installed by 2018, is devised to readout events trigger-less, synchronously with the LHC bunch crossing rate at 40 MHz. Within this approach the readout boards act as a bridge between the front-end electronics and the High Level Trigger (HLT) computing farm. The baseline design for the LHCb readout is an ATCA board requiring dedicated crates. A local area standard network protocol is implemented in the on-board FPGAs to read out the data. The alternative solution proposed here consists in building the readout boards as PCIe peripherals of the event-builder servers. The main architectural advantage is that protocol and link-technology of the event-builder can be left open until very late, to profit from the most cost-effective industry technology available at the time of the LHC LS2.

  16. The Parsec-Scale Morphology of Southern GPS Sources

    NASA Astrophysics Data System (ADS)

    Edwards, P. G.; Tingay, S. J.

    2016-12-01

    Multi-frequency, multi-epoch ATCA observations of a sample of AGN resulted in the identification of nine new candidate Giga-hertz Peaked Spectrum sources. Here, we present Long Baseline Array observations at 4.8 GHz of the four candidates with no previously published VLBI image, and consider these together with previously published VLBI images of the other five sources. We find core-jet or compact double morphologies dominate, with further observations required to distinguish between these two possibilities for some sources. One of the nine candidates, PKS 1831-711, displays appreciable variability, suggesting its GPS spectrum is more ephemeral in nature. We focus in particular on the apparent relationship between a narrow spectral width and `compact double' parsec-scale morphology, finding further examples, but also exceptions to this trend. An examination of the VLBI morphologies high-redshift (z > 3) sub-class of GPS sources suggests that core-jet morphologies predominate in this class.

  17. Lac-L-TTA, a novel lactose-based amino acid-sugar conjugate for anti-metastatic applications.

    PubMed

    Roviello, Giovanni N; Iannitti, Roberta; Palumbo, Rosanna; Simonyan, Hayarpi; Vicidomini, Caterina; Roviello, Valentina

    2017-08-01

    Here we describe the synthesis, chromatographic purification, MS and NMR characterization of a new lactosyl-derivative, i.e. a lactosyl thiophenyl-substituted triazolyl-thione L-alanine (Lac-L-TTA). This amino acid-sugar conjugate was prepared by solution synthesis in analogy to the natural fructosyl-amino acids. Furthermore, we investigated the inhibition of PC-3 prostate cancer cell colony formation by this lactose derivative in comparison with the less polar fructose-based derivative, Fru-L-TTA. This let us to compare the properties of the artificial derivative, object of the present work, with the monosaccharide-based counterpart and to obtain a preliminary information on the influence of polarity on such biological activity. A significantly higher anticancer effect of Lac-L-TTA with respect to the fructose analogue emerged from our study suggesting that the anti-metastatic potential of fructosyl-amino acids can be enhanced by increasing the polarity of the compounds, for example by introducing disaccharide moieties in place of fructose.

  18. An Icy Kuiper-Belt Around the Young Solar-Type Star HD 181327

    NASA Technical Reports Server (NTRS)

    Lebreton, J.; Augereau, J.-C.; Thi, W.-F.; Roberge, A.; Donaldson, J.; Schneider, G.; Maddison, S. T.; Menard, F.; Riviere-Marichalar, P.; Mathews, G. S.; hide

    2011-01-01

    HD 181327 is a young Main Sequence F5/F6 V star belonging to the Beta Pictoris moving group (age approx 12 Myr). It harbors an optically thin belt of circumstellar material at approx90 AU, presumed to result from collisions in a populat.ion of unseen planetesimals. Aims. We aim to study the dust properties in the belt in great details, and to constrain the gas-to-dust ratio. Methods. We obtained far-IR photometric observations of HD 181327 with the PACS instrument onboard the Herschel Space Observatory, complemented by new 3.2 nun observations carried with the ATCA array. The geometry of the belt is constrained with newly reduced HST /NICMOS scattered light images that break the degeneracy between the disk geometry and the dust properties. We then use the radiative transfer code GRaTer to compute a large grid of dust models, and we apply a Bayesian inference method to identify the grain models that best reproduce the SED. We attempt to detect the oxygen and ionized carbon fine-structure lines with Herschel/PACS spectroscopy, providing observables to our photochemical code ProDiMo. Results. The HST observations confirm that the dust is confined in a narrow belt. The continuum is detected with Herschel/PACS completing nicely the SED in the far-infrared. The disk is marginally resolved with both PACS and ATCA. A medium integration of the gas spectral lines only provides upper limits on the [OI] and [CII] line fluxes. We show that the HD 181327 dust disk consists of micron-sized grains of porous amorphous silicates and carbonaceous material surrounded by an import.ant layer of ice for a total dust mass of approx 0.05 stellar Mass. We discuss evidences that the grains consists of fluffy aggregates. The upper limits on the gas atomic lines do not provide unambiguous constraints: only if the PAH abundance is high, the gas mass must be lower than approx 17 Stellar Mass Conclusions. Despite the weak constraints on the gas disk, the age of HD 181327 and the properties of the dust disk suggest that it has passed the stage of gaseous planets formation. The dust reveals a population of icy planetesimals, similar to the primitive Edgeworth-Kuiper Belt, that may be a source for the future delivery of water and volatiles onto forming terrestrial planets.

  19. Intakes of apple juice, fruit drinks and soda are associated with prevalent asthma in US children aged 2-9 years.

    PubMed

    DeChristopher, Luanne Robalo; Uribarri, Jaime; Tucker, Katherine L

    2016-01-01

    High soft drink consumption has been linked with asthma. Anecdotal evidence links high-fructose corn syrup with asthma. The receptor of advanced glycation end products (RAGE) has emerged as a mediator of asthma. The objectives of the present study were to: (i) assess the correlation between intake of beverages containing excess free fructose (EFF beverages) and asthma in children; and (ii) epidemiologically test the mechanistic hypothesis that intake of high EFF beverages, such as apple juice or beverages sweetened with high-fructose corn syrup, is associated with increased risk of asthma. This hypothesis is based on the possible effect of increases in the in situ intestinal formation of advanced glycation end products (enFruAGE) with EFF, which may be absorbed and play a role in RAGE-mediated asthma. We examined cross-sectional associations between beverage intake and self-reported current or history of asthma. Exposure variables were EFF beverages, including apple juice (AJ), non-diet soft drinks (ndSD) and fruit drinks (FD). Orange juice (OJ), not an EFF beverage, was included as a comparison. Rao-Scott χ(2) analysis was used for prevalence differences and logistic regression for associations, adjusted for age, sex, race/ethnicity, BMI and total energy intake. Data are from the National Health and Nutrition Examination Survey 2003-2006, a nationally representative survey. US children (n 1961) aged 2-9 years with complete responses on the dietary frequency questionnaire. Intakes of EFF beverages were significantly associated with asthma in 2-9-year-olds. Adjusted odds of asthma in children consuming EFF beverages ≥5 times/week was more than five times that in children consuming these beverages ≤1 time/month (OR=5·29, P=0·012). Children consuming AJ ≥5 times/week v. ≤1 time/month, adjusted for the other beverages, were more than twice as likely to have asthma (OR=2·43, P=0·035). In contrast, there was a tendency for OJ to be protective. These results support the hypothesis that intake of high EFF beverages, including AJ and beverages sweetened with high-fructose corn syrup, is associated with asthma in children aged 2-9 years. Results support the mechanistic hypothesis that enFruAGE may be an overlooked contributor to asthma in children. Longitudinal studies are needed to provide evidence of causal association.

  20. A Genetic System for the Thermophilic Acetogenic Bacterium Thermoanaerobacter kivui.

    PubMed

    Basen, Mirko; Geiger, Irina; Henke, Laura; Müller, Volker

    2018-02-01

    Thermoanaerobacter kivui is one of the very few thermophilic acetogenic microorganisms. It grows optimally at 66°C on sugars but also lithotrophically with H 2 + CO 2 or with CO, producing acetate as the major product. While a genome-derived model of acetogenesis has been developed, only a few physiological or biochemical experiments regarding the function of important enzymes in carbon and energy metabolism have been carried out. To address this issue, we developed a method for targeted markerless gene deletions and for integration of genes into the genome of T. kivui The strain naturally took up plasmid DNA in the exponential growth phase, with a transformation frequency of up to 3.9 × 10 -6 A nonreplicating plasmid and selection with 5-fluoroorotate was used to delete the gene encoding the orotate phosphoribosyltransferase ( pyrE ), resulting in a Δ pyrE uracil-auxotrophic strain, TKV002. Reintroduction of pyrE on a plasmid or insertion of pyrE into different loci within the genome restored growth without uracil. We subsequently studied fructose metabolism in T. kivui The gene fruK (TKV_c23150) encoding 1-phosphofructosekinase (1-PFK) was deleted, using pyrE as a selective marker via two single homologous recombination events. The resulting Δ fruK strain, TKV003, did not grow on fructose; however, growth on glucose (or on mannose) was unaffected. The combination of pyrE as a selective marker and the natural competence of the strain for DNA uptake will be the basis for future studies on CO 2 reduction and energy conservation and their regulation in this thermophilic acetogenic bacterium. IMPORTANCE Acetogenic bacteria are currently the focus of research toward biotechnological applications due to their potential for de novo synthesis of carbon compounds such as acetate, butyrate, or ethanol from H 2 + CO 2 or from synthesis gas. Based on available genome sequences and on biochemical experiments, acetogens differ in their energy metabolism. Thus, there is an urgent need to understand the carbon and electron flows through the Wood-Ljungdahl pathway and their links to energy conservation, which requires genetic manipulations such as deletion or overexpression of genes encoding putative key enzymes. Unfortunately, genetic systems have been reported for only a few acetogenic bacteria. Here, we demonstrate proof of concept for the genetic modification of the thermophilic acetogenic species Thermoanaerobacter kivui The genetic system will be used to study genes involved in biosynthesis and energy metabolism, and may further be applied to metabolically engineer T. kivui to produce fuels and chemicals. Copyright © 2018 American Society for Microbiology.

  1. VizieR Online Data Catalog: LMC and Cen A 1.3-10GHz polarization behavior (Anderson+, 2016)

    NASA Astrophysics Data System (ADS)

    Anderson, C. S.; Gaensler, B. M.; Feain, I. J.

    2016-08-01

    The targets for our study were selected from among two archival polarization data sets, which were observed and processed by several independent groups. i.e. LMC observations spanning from 1994 Oct to 1996 Jan in 1.328-1.432GHz band; Cen A observations spanning from 2006 Dec to 2008 Feb in 1.296-1.480GHz band. We observed the 40 sample sources using the Australia Telescope Compact Array (ATCA) over 1.1-3.1GHz (16cm), 4.5-6.5GHz (6cm), and 8.0-10.0GHz (3cm) in full polarization with a nominal 1MHz channel resolution between 2012 Feb 10-12 and 2012 Aug 17-19. We imaged each source in Stokes I, Q, and U at 20MHz intervals through the 16 and 6cm bands, and at a substantially coarser resolution of 200MHz in the 3cm band. See sections 2 and 3 for further explanations. (2 data files).

  2. Global cost and weight evaluation of fuselage keel design concepts

    NASA Technical Reports Server (NTRS)

    Flynn, B. W.; Morris, M. R.; Metschan, S. L.; Swanson, G. D.; Smith, P. J.; Griess, K. H.; Schramm, M. R.; Humphrey, R. J.

    1993-01-01

    The Boeing program entitled Advanced Technology Composite Aircraft Structure (ATCAS) is focused on the application of affordable composite technology to pressurized fuselage structure of future aircraft. As part of this effort, a design study was conducted on the keel section of the aft fuselage. A design build team (DBT) approach was used to identify and evaluate several design concepts which incorporated different material systems, fabrication processes, structural configurations, and subassembly details. The design concepts were developed in sufficient detail to accurately assess their potential for cost and weight savings as compared with a metal baseline representing current wide body technology. The cost and weight results, along with an appraisal of performance and producibility risks, are used to identify a globally optimized keel design; one which offers the most promising cost and weight advantages over metal construction. Lastly, an assessment is given of the potential for further cost and weight reductions of the selected keel design during local optimization.

  3. The ATCA CABB Line Survey on Centaurus A: Properties of the Molecular Gas from the Dust Lanes to the Central Engine

    NASA Astrophysics Data System (ADS)

    Ott, Juergen; Koribalski, Baerbel; Henkel, Christian; Edwards, Philip; Norris, Ray; Meier, David; Feain, Ilana; Curran, Steve; Martin-Pintado, Jesus; Beelen, Alexandre; Aalto, Susanne; Combes, Francoise; Israel, Frank; Muller, Sebastien; Espada, Daniel; Guelin, Michel; Black, John Harry; V-Trung, Dinh; Impellizzeri, Caterina M. V.; Persson, Carina

    2011-10-01

    Centaurus A with its host NGC5128 is the most nearby radio galaxy. Its molecular spectrum exhibits three prominent features: a) gas that is located in the outer disk and dust lanes, b) absorption lines that are supposedly close to the central AGN, and c) gas in emission from the nucleus. We propose to perform an extensive line survey toward CenA using the exciting new capabilities of CABB. The broad basebands and narrow zoom bands of CABB are ideal to capture the full breath of the CenA spectral features. Our multi-band line observations will allow us to derive the exact physical conditions of each component as well as the chemistry involved. We will therefore obtain a comprehensive view of the physics imprinted on the molecular spectrum of a radio galaxy and its host, reaching from the central supermassive black hole, through the accretion region and the inner disk to the outer dust lanes.

  4. The search for molecular gas in the most distant submillimetre galaxy at z=4.76

    NASA Astrophysics Data System (ADS)

    Coppin, Kristen; Weiss, Axel; De Breuck, Carlos; Walter, Fabian; Edge, Alastair; Kovacs, Attila; Ivison, Rob; Huynh, Minh; Smail, Ian; Schinnerer, Eva; Greve, Thomas; Wardlow, Julie

    2009-07-01

    We propose to use ATCA to measure the CO(2-1) and CO(5-4) emission in the highest redshift submm-selected galaxy (SMG) known: LESS J033229 at z=4.76. These observations will measure the gas mass and dynamics of this far-infrared luminous galaxy at a time when the Universe was only 1 Gyr old. In conjunction with similar observations of three z~4-4.5 SMG, these observations will constrain the potential evolution of the star formation and dynamical mass of these high redshift, but relatively typical, young galaxies and their potential role as the precursor population to the red-and-dead galaxies seen at z~3, as well as allowing us to contrast the physical state of the gas reservoirs in these early galaxies with the well-studied and more numerous SMG population at z~2. These observations will provide a sneak-preview of the science which ALMA will provide on the formation of the earliest massive galaxies in the Universe.

  5. A non cool-core 4.6-keV cluster around the bright nearby radio galaxy PKS B1416-493

    NASA Astrophysics Data System (ADS)

    Worrall, D. M.; Birkinshaw, M.

    2017-05-01

    We present new X-ray (Chandra) and radio (ATCA) observations of the z = 0.09 radio galaxy PKS B1416-493, a member of the southern equivalent of the 3CRR sample. We find the source to be embedded in a previously unrecognized bright kT = 4.6-keV non cool-core cluster. The discovery of new clusters of such high temperature and luminosity within z = 0.1 is rare. The radio source was chosen for observation based on its intermediate FR I/II morphology. We identify a cavity coincident with the northeast lobe, and excess counts associated with the southwest lobe that we interpret as inverse-Compton X-ray emission. The jet power, at 5.3 × 1044 erg s-1, when weighted by radio source density, supports suggestions that radio sources of intermediate morphology and radio power may dominate radio-galaxy heating in the local Universe.

  6. Transport of Stachyose and Sucrose by Vacuoles of Japanese Artichoke (Stachys sieboldii) Tubers 1

    PubMed Central

    Keller, Felix

    1992-01-01

    Vacuoles are the stores for large amounts of stachyose [αgal (1,6) αgal (1,6) αglc (1,2) βfru] in tubers of Japanese artichoke (Stachys sieboldii). The uptake of stachyose by these vacuoles was examined and compared with that of sucrose. The uptake mechanisms of both sugars were quite similar. The kinetics showed a single saturable response to increasing external concentrations of 14C-sugars with similar apparent Km values of about 50 and 30 millimolar for stachyose and sucrose, respectively. The uptake rates, however, were always higher for stachyose than for sucrose. Stachyose and sucrose uptake was inhibited by fructose and raffinose, and, reciprocally, by sucrose and stachyose, but not by glucose or galactose. The main structural feature common to all sugars recognized by the uptake systems seems to be a terminal fructosyl residue. The uptake of both sugars was stimulated by Mg-ATP and inorganic pyrophosphate, suggesting a proton-sugar antiport system. The possibility that stachyose and sucrose might be transported by the same carrier is discussed. PMID:16668659

  7. Evaluation of synthase and hemisynthase activities of glucosamine-6-phosphate synthase by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe

    2014-08-01

    Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Octopamine Neuromodulation Regulates Gr32a-Linked Aggression and Courtship Pathways in Drosophila Males

    PubMed Central

    Andrews, Jonathan C.; Fernández, María Paz; Yu, Qin; Leary, Greg P.; Leung, Adelaine K. W.; Kavanaugh, Michael P.; Kravitz, Edward A.; Certel, Sarah J.

    2014-01-01

    Chemosensory pheromonal information regulates aggression and reproduction in many species, but how pheromonal signals are transduced to reliably produce behavior is not well understood. Here we demonstrate that the pheromonal signals detected by Gr32a-expressing chemosensory neurons to enhance male aggression are filtered through octopamine (OA, invertebrate equivalent of norepinephrine) neurons. Using behavioral assays, we find males lacking both octopamine and Gr32a gustatory receptors exhibit parallel delays in the onset of aggression and reductions in aggression. Physiological and anatomical experiments identify Gr32a to octopamine neuron synaptic and functional connections in the suboesophageal ganglion. Refining the Gr32a-expressing population indicates that mouth Gr32a neurons promote male aggression and form synaptic contacts with OA neurons. By restricting the monoamine neuron target population, we show that three previously identified OA-FruM neurons involved in behavioral choice are among the Gr32a-OA connections. Our findings demonstrate that octopaminergic neuromodulatory neurons function as early as a second-order step in this chemosensory-driven male social behavior pathway. PMID:24852170

  9. Visually induced initiation of Drosophila innate courtship-like following pursuit is mediated by central excitatory state.

    PubMed

    Kohatsu, Soh; Yamamoto, Daisuke

    2015-03-06

    The courtship ritual of male Drosophila represents an innate behaviour that is initiated by female-derived sensory stimuli. Here we report that moving light spots can induce courtship-like following pursuit in tethered wild-type male flies provided the fly is primed by optogenetic stimulation of specific dsx-expressing neuronal clusters in the lateral protocerebrum (LPR). Namely, stimulation of the pC1 neuronal cluster initiates unilateral wing extension and vibration of both sides, whereas stimulation of the pC2l cluster initiates only contralateral wing displays. In addition, stimulation of pC2l but not pC1 neurons induced abdominal bending and proboscis extension. Ca(2+) imaging of the pC1 cluster revealed periodic Ca(2+) rises, each corresponding to a turn of the male fly during courtship. In contrast, group-reared fru mutant males exhibit light spot-induced courtship pursuit without optogenetic priming. Ca(2+) imaging revealed enhanced responses of LPR neurons to visual stimuli in the mutants, suggesting a neural correlate of the light spot-induced courtship behaviour.

  10. Antitumor effects and immune regulation activities of a purified polysaccharide extracted from Juglan regia.

    PubMed

    Ruijun, Wang; Shi, Wang; Yijun, Xia; Mengwuliji, Tu; Lijuan, Zhang; Yumin, Wang

    2015-01-01

    A water-soluble polysaccharide, named as JRP1, was extracted and fractioned from the epicarp of immature fruit of Juglans mandshurica Maxim. The determination of the monosaccharide composition in JRP1 with gas chromatography (GC) showed that JRP1 was composed of Gal (43.1%), Glu (23.6%), Ara (16.2%), Rha (9.8%) and Fru (7.3%). The results in vitro showed that 25, 50 and 100 μg/mL of JRP1 could present a significant inhibition on the growth of S180 cells, and furthermore, a significant improvement on the proliferation ability of lymphocytes and the phagocytic activity of macrophages. The results in vivo showed that compared with those in the control group, the inhibition rates of different doses of JRP1 on S180 cells in the tumor-bearing mice were 35.3%, 40.6% and 48.1%, respectively, and serum immune cytokine levels such as IL-2, TNF-α and IFN-γ were significantly improved. Our results confirm that JRP1 has the activities of effective antitumor and immunomodulatory function. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. An Icy Kuiper Belt Around the Young Solar-type Star HD 181327

    NASA Technical Reports Server (NTRS)

    Lebreton, J.; Augereau, J.-C.; Thi, W.-F.; Roberge, A.; Donaldson, J; Schneider, G.; Maddison, S. T.; Menard, F.; Riviere-Marichalar, P.; Matthews, G. S.; hide

    2012-01-01

    Context. HD 181327 is a young main sequence F5/F6 V star belonging to the Beta Pictoris moving group (age approx.. 12 Myr). It harbors an optically thin belt of circumstellar material at radius approx.. 90 AU, presumed to result from collisions in a population of unseen planetesimals. Aims. We aim to study the dust properties in the belt in details, and to constrain the gas-to-dust ratio. Methods. We obtained far-infrared photometric observations of HD 181327 with the PACS instrument onboard the Herschel Space Observatory, complemented by new 3.2 mm observations carried with the ATCA array. The geometry of the belt is constrained with newly reduced HST/NICMOS scattered light images that allow the degeneracy between the disk geometry and the dust properties to be broken. We then use the radiative transfer code GRaTeR to compute a large grid of models, and we identify the grain models that best reproduce the spectral energy distribution (SED) through a Bayesian analysis. We attempt to detect the oxygen and ionized carbon fine-structure lines with Herschel/PACS spectroscopy, providing observables to our photochemical code ProDiMo. Results. The HST observations confirm that the dust is confined in a narrow belt. The continuum is detected with Herschel/PACS completing nicely the SED in the far-infrared. The disk is marginally resolved with both PACS and ATCA. A medium integration of the gas spectral lines only provides upper limits on the [OI] and [CII] line fluxes.We show that the HD 181327 dust disk consists of micron-sized grains of porous amorphous silicates and carbonaceous material surrounded by an important layer of ice, for a total dust mass of approx.. 0.05 Solar Mass (in grains up to 1 mm). We discuss evidences that the grains consists of fluffy aggregates. The upper limits on the gas atomic lines do not provide unambiguous constraints: only if the PAH abundance is high, the gas mass must be lower than approx. 17 Solar Mass. Conclusions. Despite the weak constraints on the gas disk, the age of HD 181327 and the properties of the dust disk suggest that it has passed the stage of gaseous planets formation. The dust reveals a population of icy planetesimals, similar to the primitive Edgeworth-Kuiper belt, that may be a source for the future delivery of water and volatiles onto forming terrestrial planets.

  12. Hi Image Synthesis of Southern Compact Groups

    NASA Astrophysics Data System (ADS)

    Babic, B.; Price, R. M.; Jones, K.

    Four southern compact groups, the Hickson Compact Groups HCG 22 and HCG 26 (Hickson 1982), and the groups AM 1238 - 396 and ESO 410-G(024 - 026) have been imaged in Hi, along with 12 cm continuum using the Australia Telescope Compact Array (ATCA). The initial findings for the latter two groups are presented here. While ESO 410-G is not in fact a physical group, due to the discordant redshifts amongst the members, it is however presented here. Overall for all the groups we find no other sources of Hi in the field that might indicate that these are part of a larger loose group structure. This is not always the case, as with HCG 23 (Williams 1995) and HCG 95 (Hutchmeier 1999), both of whom find additional Hi sources within the primary beam accordant with the compact group's velocity. The Hi is also clearly associated with each of the individual member galaxies in all cases, except for HCG 26, which envelopes the whole group as was also shown by Williams and van Gorkom (Williams 1995).

  13. Radio Observations of Elongated Pulsar Wind Nebulae

    NASA Astrophysics Data System (ADS)

    Ng, Stephen C.-Y.

    2015-08-01

    The majority of pulsars' rotational energy is carried away by relativistic winds, which are energetic particles accelerated in the magnetosphere. The confinement of the winds by the ambient medium result in synchrotron bubbles with broad-band emission, which are commonly referred to as pulsar wind nebulae (PWNe). Due to long synchrotron cooling time, a radio PWN reflects the integrated history of the system, complementing information obtained from the X-ray and higher energy bands. In addition, radio polarization measurements can offer a powerful probe of the PWN magnetic field structure. Altogether these can reveal the physical conditions and evolutionary history of a system.I report on preliminary results from high-resolution radio observations of PWNe associated with G327.1-1.1, PSRs J1015-5719, B1509-58, and J1549-4848 taken with the Australia Telescope Compact Array (ATCA). Their magnetic field structure and multiwavelength comparison with other observations are discussed.This work is supported by a ECS grant of the Hong Kong Government under HKU 709713P. The Australia Telescope is funded by the Commonwealth of Australia for operation as a National Facility managed by CSIRO.

  14. VizieR Online Data Catalog: Spectropolarimetric survey of radio sources (Anderson+, 2015)

    NASA Astrophysics Data System (ADS)

    Anderson, C. S.; Gaensler, B. M.; Feain, I. J.; Franzen, T. M. O.

    2017-10-01

    We obtained mosaicked observations of a 30 deg2 region of sky the CABB correlator on the Australia Telescope Compact Array (ATCA; Wilson et al. 2011MNRAS.416..832W). Our observations were performed using the "CFB 1M" mode, which generates all polarization products from 1.1 to 3.1 GHz with 1 MHz channel widths. The mosaic consisted of 342 pointings laid out in a hexagonal grid. This grid spanned 7.5° in RA and 5.5° in DE and was centered on RA=03h29m40s and DE=-36°16'30" (J2000) in Fornax. The angular separation of the mosaic pointings was 0.323° and therefore spatially Nyquist-sampled at 1.4 GHz. To obtain adequate uv coverage, we broke the full mosaic up into seven submosaics and observed each submosaic on consecutive days. We completed the full seven-day observing run twice-once in each of the 1.5B and 750B array configurations, from 2011 May 5-11 and 2011 June 10-16, respectively. (1 data file).

  15. La Freccia Rossa: An IR-dark cloud hosting the Milky Way intermediate-mass black hole candidate

    NASA Astrophysics Data System (ADS)

    Ravi, Vikram; Vedantham, Harish; Phinney, E. Sterl

    2018-05-01

    The dynamics of the high-velocity compact molecular cloud CO-0.40-0.22 have been interpreted as evidence for a ˜105M⊙ black hole within 60 pc of Sgr A*. Recently, Oka et al. have identified a compact millimetre-continuum source, CO-0.40-0.22*, with this candidate black hole. Here we present a collation of radio and infrared data at this location. ATCA constraints on the radio spectrum, and the detection of a mid-infrared counterpart, are in tension with an Sgr A*-like model for CO-0.40-0.22* despite the comparable bolometric to Eddington luminosity ratios under the IMBH interpretation. A protostellar-disk scenario is, however, tenable. CO-0.40-0.22(*) is positionally coincident with an arrowhead-shaped infrared-dark cloud (which we call the Freccia Rossa). If the VLSR ≈ 70 km s-1 systemic velocity of CO-0.40-0.22 is common to the entire Freccia Rossa system, we hypothesise that it is the remnant of a high-velocity cloud that has plunged into the Milky Way from the Galactic halo.

  16. A search for AGN activity in Infrared-Faint Radio Sources (IFRS)

    NASA Astrophysics Data System (ADS)

    Lenc, Emil; Middelberg, Enno; Norris, Ray; Mao, Minnie

    2009-04-01

    We propose to observe a large sample of radio sources from the ATLAS (Australia Telescope Large Area Survey) source catalogue with the LBA, to determine their compactness. The sample consists of 36 sources with no counterpart in the co-located SWIRE survey (3.6 um to 160 um), carried out with the Spitzer Space Telescope. This rare class of sources, dubber Infrared-Faint Radio Sources (IFRS), is inconsistent with current galaxy evolution models. VLBI observations are an essential way to obtain further clues on what these objects are and why they are hidden from infrared observations. We will measure the flux densities on long baselines to determine their compactness. Only five IFRS have been previously targeted with VLBI observations (resulting in two detections). We propose using single baseline (Parkes-ATCA) eVLBI observations with the LBA at 1 Gbps to maximise sensitivity. With the observations proposed here we will increase the number of VLBI-observed IFRS from 5 to 36, allowing us to draw statistical conclusions about this intriguing new class of objects.

  17. A search for AGN activity in Infrared-Faint Radio Sources (IFRS)

    NASA Astrophysics Data System (ADS)

    Lenc, Emil; Middelberg, Enno; Norris, Ray; Mao, Minnie

    2010-04-01

    We propose to observe a large sample of radio sources from the ATLAS (Australia Telescope Large Area Survey) source catalogue with the LBA, to determine their compactness. The sample consists of 36 sources with no counterpart in the co-located SWIRE survey (3.6 um to 160 um), carried out with the Spitzer Space Telescope. This rare class of sources, dubber Infrared-Faint Radio Sources (IFRS), is inconsistent with current galaxy evolution models. VLBI observations are an essential way to obtain further clues on what these objects are and why they are hidden from infrared observations. We will measure the flux densities on long baselines to determine their compactness. Only five IFRS have been previously targeted with VLBI observations (resulting in two detections). We propose using single baseline (Parkes-ATCA) eVLBI observations with the LBA at 1 Gbps to maximise sensitivity. With the observations proposed here we will increase the number of VLBI-observed IFRS from 5 to 36, allowing us to draw statistical conclusions about this intriguing new class of objects.

  18. Radio and X-Ray Observations of the 1998 Outburst of the Recurrent X-Ray Transient 4U 1630-47

    NASA Technical Reports Server (NTRS)

    Hjellming, R. M.; Rupen, M.; Mioduszewski, A. J.; Kuulkers, E.; McCollough, M. L.; Harmon, B. Alan; Buxton, M.; Sood, R.; Tzioumis, A.

    1998-01-01

    We report radio (VLA and ATCA), soft X-ray (RXTE ASM), and hard X-ray (CGRO BATSE) observations of a 1998 outburst in the recurring X-ray transient 4U 1630-47 where radio emission was detected for the first time. The radio observations identify the position of 4U 1630-47 to within 1". Because the radio emission is optically thin with a spectral index of approximately -0.6 during the rise and approximately -1 during the peak and decay of the initial radio event, the emission is probably coming from an optically thin radio jet ejected over a period of time. The 20-100 keV emission first appeared 1998 January 28 (MJD 50841), the 2-12 keV emission first appeared February 3 (MJD 50847), and the first radio emission was detected February 12.6 (MJD 50856.6). The rise of the radio emission probably began about February 7 (MJD 50851) when the X-rays were in a very hard, fluctuating hardness state, just before changing to a softer, more stable hardness state.

  19. The Local Volume HI Survey (LVHIS)

    NASA Astrophysics Data System (ADS)

    Koribalski, Bärbel S.; Wang, Jing; Kamphuis, P.; Westmeier, T.; Staveley-Smith, L.; Oh, S.; López-Sánchez, Á. R.; Wong, O. I.; Ott, J.; de Blok, W. J. G.; Shao, L.

    2018-02-01

    The `Local Volume HI Survey' (LVHIS) comprises deep H I spectral line and 20-cm radio continuum observations of 82 nearby, gas-rich galaxies, supplemented by multi-wavelength images. Our sample consists of all galaxies with Local Group velocities vLG <550 km s-1 or distances D < 10 Mpc that are detected in the H I Parkes All Sky Survey (HIPASS). Using full synthesis observations in at least three configurations of the Australia Telescope Compact Array (ATCA), we obtain detailed H I maps for a complete sample of gas-rich galaxies with δ ≲ -30°. Here we present a comprehensive LVHIS galaxy atlas, including the overall gas distribution, mean velocity field, velocity dispersion and position-velocity diagrams, together with a homogeneous set of measured and derived galaxy properties. Our primary goal is to investigate the H I morphologies, kinematics and environment at high resolution and sensitivity. LVHIS galaxies represent a wide range of morphologies and sizes; our measured H I masses range from ˜107 to 1010 M⊙, based on independent distance estimates. The LVHIS galaxy atlas (incl. FITS files) is available on-line.

  20. Advanced Technology Composite Fuselage: Program Overview

    NASA Technical Reports Server (NTRS)

    Ilcewicz, L. B.; Smith, P. J.; Hanson, C. T.; Walker, T. H.; Metschan, S. L.; Mabson, G. E.; Wilden, K. S.; Flynn, B. W.; Scholz, D. B.; Polland, D. R.; hide

    1997-01-01

    The Advanced Technology Composite Aircraft Structures (ATCAS) program has studied transport fuselage structure with a large potential reduction in the total direct operating costs for wide-body commercial transports. The baseline fuselage section was divided into four 'quadrants', crown, keel, and sides, gaining the manufacturing cost advantage possible with larger panels. Key processes found to have savings potential include (1) skins laminated by automatic fiber placement, (2) braided frames using resin transfer molding, and (3) panel bond technology that minimized mechanical fastening. The cost and weight of the baseline fuselage barrel was updated to complete Phase B of the program. An assessment of the former, which included labor, material, and tooling costs, was performed with the help of design cost models. Crown, keel, and side quadrant cost distributions illustrate the importance of panel design configuration, area, and other structural details. Composite sandwich panel designs were found to have the greatest cost savings potential for most quadrants. Key technical findings are summarized as an introduction to the other contractor reports documenting Phase A and B work completed in functional areas. The current program status in resolving critical technical issues is also highlighted.

  1. Influence of a rare sugar, d-Psicose, on the physicochemical and functional properties of an aerated food system containing egg albumen.

    PubMed

    Sun, Yuanxia; Hayakawa, Shigeru; Ogawa, Masahiro; Fukada, Kazuhiro; Izumori, Ken

    2008-06-25

    d-Psicose (Psi) might be an ideal sucrose (Suc) substitute for food products due to its sweet taste, easy processing, and functional properties (noncaloric and low glycemic response). In the present study, the effects of Psi on foaming properties of egg white (EW) protein and the quality of butter cookies were analyzed to find a better use of Psi in aerated food systems. The results showed that Psi could improve the foaming properties of EW protein with increasing whipping time in comparison to Suc and d-fructose (Fru). The addition of Psi to butter cookies, as partial replacement of Suc, had no influence on the cook loss while significantly contributing to a color change of the cookie crust through a nonenzymatic browning reaction. Furthermore, Psi-containing cookies possessed the highest antioxidant capacity in all tested cookies using two assays of radical scavenging activity and ferric reducing power. It was found that there was a close correlation between the crust color and the antioxidant activity of the cookie. The results suggest that the addition of Psi enhanced the browning reaction during cookie processing and, consequently, produced a strong antioxidant activity.

  2. Association of catechol-O-methyltransferase genetic variants with outcome in patients undergoing surgical treatment for lumbar degenerative disc disease.

    PubMed

    Dai, Feng; Belfer, Inna; Schwartz, Carolyn E; Banco, Robert; Martha, Julia F; Tighioughart, Hocine; Tromanhauser, Scott G; Jenis, Louis G; Kim, David H

    2010-11-01

    Surgical treatment for lumbar degenerative disc disease (DDD) has been associated with highly variable results in terms of postoperative pain relief and functional improvement. Many experts believe that DDD should be considered a chronic pain disorder as opposed to a degenerative disease. Genetic variation of the catechol-O-methyltransferase (COMT) gene has been associated with variation in human pain sensitivity and response to analgesics in previous studies. To determine whether genetic variation of COMT is associated with clinical outcome after surgical treatment for DDD. Prospective genetic association study. Sixty-nine patients undergoing surgical treatment for lumbar DDD. Diagnosis was based on documentation of chronic disabling low back pain (LBP) present for a minimum of 6 months and unresponsive to supervised nonoperative treatment, including activity modification, medication, physical therapy, and/or injection therapy. Plain radiographs and magnetic resonance imaging revealed intervertebral disc desiccation, tears, and/or collapse without focal herniation, nerve root compression, stenosis, spondylolisthesis, spondylolysis, or alternative diagnoses. Oswestry Disability Index (ODI) and visual analog score (VAS) for LBP. Surgical treatment included 65 instrumented fusions and four disc arthroplasty procedures. All patients completed preoperative and 1-year postoperative ODI questionnaires. DNA was extracted from a sample of venous blood, and genotype analysis was performed for five common COMT single nucleotide polymorphisms (SNPs). Potential genetic association between these COMT SNPs and the primary outcome variable, 1-year change in ODI, was investigated using both single-marker and haplotype association analyses. Association with VAS scores for LBP was analyzed as a secondary outcome variable. Single-marker analysis revealed that the COMT SNP rs4633 was significantly associated with greater improvement in ODI score 1 year after surgery (p=.03), with individuals homozygous for the less common "T" allele demonstrating the largest improvement in ODI. Haplotype analysis of four COMT SNPs, rs6269, rs4633, rs4818, and rs4680, also identified a common haplotype "ATCA" (haplotype frequency of 39.3% in the study population) associated with greater improvement in ODI (p=.046). The greatest mean improvement in ODI was observed in patients homozygous for the "ATCA"COMT haplotype. A nonsignificant trend was observed between SNP rs4633 and greater improvement in VAS score for LBP. This is the first study to report an association between surgical treatment success in DDD patients and genetic variation in the putative pain sensitivity gene COMT. These findings require replication in other DDD populations but suggest that genetic testing for pain-relevant genetic markers such as COMT may provide useful clinical information in terms of predicting outcome after surgery for patients diagnosed with DDD. Copyright © 2010 Elsevier Inc. All rights reserved.

  3. VizieR Online Data Catalog: Galaxy clusters: radio halos, relics and parameters (Yuan+, 2015)

    NASA Astrophysics Data System (ADS)

    Yuan, Z. S.; Han, J. L.; Wen, Z. L.

    2017-10-01

    A large number of radio halos, relics, and mini-halos have been discovered and measured in recent decades through observations with VLA (e.g., Giovannini & Feretti 2000NewA....5..335G; van Weeren et al. 2011A&A...533A..35V), GMRT (e.g., Venturi et al. 2007A&A...463..937V; Kale et al. 2015A&A...579A..92K), WSRT (e.g., van Weeren et al. 2010Sci...330..347V; Trasatti et al. 2015A&A...575A..45T), and also ATCA (e.g., Shimwell et al. 2014MNRAS.440.2901S, 2015MNRAS.449.1486S). We have checked the radio images of radio halos, relics, and mini-halos in the literature and collected in Table 1 the radio flux Sν at frequencies within a few per cent around 1.4 GHz, 610 MHz, and 325 MHz; we have interpolated the flux at an intermediate frequency if measurements are available at higher and lower frequencies. To establish reliable scaling relations, we include only the very firm detection of diffuse radio emission in galaxy clusters, and omit questionable detections or flux estimates due to problematic point-source subtraction. (3 data files).

  4. Galactic Black Holes in the Hard State: A Multi-Wavelength View of Accretion and Ejection

    NASA Technical Reports Server (NTRS)

    Kalemci; Tomsick, John A.; Migliari; Corbel; Markoff

    2010-01-01

    The canonical hard state is associated with emission from all three fundamental accretion components: the accretion disk, the hot accretion disk corona and the jet. On top of these, the hard state also hosts very rich temporal variability properties (low frequency QPOs in the PDS, time lags, long time scale evolution). Our group has been working on the major questions of the hard state both observationally (with mult i-wavelength campaigns using RXTE, Swift, Suzaku, Spitzer, VLA, ATCA, SMARTS) and theoretically (through jet models that can fit entire SEDs). Through spectral and temporal analysis we seek to determine the geometry of accretion components, and relate the geometry to the formation and emission from a jet. In this presentation I will review the recent contributions of our group to the field, including the Swift results on the disk geometry at low accretion rates, the jet model fits to the hard state SEDs (including Spitzer data) of GRO J1655-40, and the final results on the evolution of spectral (including X-ray, radio and infrared) and temporal properties of elected black holes in the hard states. I will also talk about impact of ASTROSAT to the science objective of our group.

  5. Too Cool for Stellar Rules: A Bayesian Exploration of Trends in Ultracool Magnetism

    NASA Astrophysics Data System (ADS)

    Cruz, Kelle L.; Schwab, Ellianna; Williams, Peter K. G.; Hogg, David W.; Rodriguez, David R.; BDNYC

    2017-01-01

    Ultracool dwarfs, the lowest mass red dwarfs and brown dwarfs (spectral types M7-Y9), are fully convective objects with electrically neutral atmospheres due to their extremely cool temperatures (500-3000 K). Radio observations of ultracool dwarfs indicate the presence of magnetic field strengths on the order of ~kG, however the dynamo driving these fields is not fully understood. To better understand ultracool dwarf magnetic behavior, we analyze photometric radio detections of 196 dwarfs (spectral types M7-T8), observed in the 4.5-8.5 GHz range on the Karl G. Jansky Very Large Array (VLA) and the Australia Telescope Compact Array (ATCA). The measurements in our sample are mostly upper limits, along with a small percentage of confirmed detections. The detections have both large uncertainties and high intrinsic scatter. Using Bayesian analysis to fully take advantage of the information available in these inherently uncertain measurements, we search for trends in radio luminosity as a function of several fundamental parameters: spectral type, effective temperature, and rotation rate. In this poster, we present the preliminary results of our efforts to investigate the possibility of subpopulations with different magnetic characteristics using Gaussian mixture models.

  6. WISE J233237.05-505643.5: A Double-Peaked Broad-Lined AGN with Spiral-Shaped Radio Morphology

    NASA Technical Reports Server (NTRS)

    Tsai, Chao Wei; Jarrett, Thomas H.; Stern, Daniel; Emonts, Bjorn; Barrows, R. Scott; Assef, Roberto J.; Norris, Ray P.; Eisenhardt, Peter R. M.; Lonsdale, Carol; Blain, Andrew W.; hide

    2013-01-01

    We present radio continuum mapping, optical imaging and spectroscopy of the newly discovered double-peaked broad-lined AGN WISE J233237.05-505643.5 at redshift z = 0.3447. This source exhibits an FR-I and FR-II hybrid-morphology, characterized by bright core, jet, and Doppler-boosted lobe structures in ATCA continuum maps at 1.5, 5.6, and 9 GHz. Unlike most FR-II objects, W2332-5056 is hosted by a disk-like galaxy. The core has a projected 5" linear radio feature that is perpendicular to the curved primary jet, hinting at unusual and complex activity within the inner 25 kpc. The multi-epoch optical-near-IR photometric measurements indicate significant variability over a 3-20 year baseline from the AGN component. Gemini-South optical data shows an unusual double-peaked emission-line features: the centroids of the broad-lined components of H-alpha and H-beta are blueshifted with respect to the narrow lines and host galaxy by approximately 3800 km/s. We examine possible cases which involve single or double supermassive black holes in the system, and discuss required future investigations to disentangle the mystery nature of this system.

  7. High-Resolution Observations of a Binary Black Hole Candidate

    NASA Astrophysics Data System (ADS)

    Tsai, Chao-Wei; Phillips, Chris; Norris, Ray; Jarrett, Thomas; Emonts, Bjorn; Cluver, Michelle; Eisenhardt, Peter; Stern, Daniel; Assef, Roberto

    2012-10-01

    We propose a 12-hour 2.3 GHz continuum Long Baseline Array (LBA) observation of WISE J2332-5056, a newly discovered supermassive black hole (SMBH) merger candidate that is located in the nearby universe (z = 0.3447). Our recently acquired 9 GHz ATCA map shows unusual radio morphology: a one-sided, smaller (and likely younger) FR-I jet perpendicular to a larger, Doppler-boosted FR-II jet. Follow-up Gemini-S/GMOS spectroscopy of this WISE-selected radio galaxy reveals broad emission lines blue-shifted by > 3,500 km/s with respect to the narrow lines and host galaxy, hallmarks of a dual AGN system. Combined, the optical spectroscopy and radio morphology of this object are strongly suggestive of a black hole merger system. Even in the local universe these systems are extremely difficult to identify; yet the process of supermassive blackhole growth is vital toward understanding galaxy evolution from the early to the current universe. Moreover, nearby merging SMBHs may serve as outstanding targets for gravitational wave studies. The proposed high resolution LBA map, reaching 50 pc resolution at the source redshift will allow us to investigate the SMBH merger scenario hypothesis.

  8. VizieR Online Data Catalog: A deep Chandra ACIS survey of M83 (Long+, 2014)

    NASA Astrophysics Data System (ADS)

    Long, K. S.; Kuntz, K. D.; Blair, W. P.; Godfrey, L.; Plucinsky, P. P.; Soria, R.; Stockdale, C.; Winkler, P. F.

    2014-07-01

    X-ray observations of M83 were all carried out with Chandra/ACIS-S in the "very faint" mode and spaced over a period of one year from 2010 December to 2011 December. We included in our analysis earlier Chandra observations of M83 in 2000 and 2001 totaling 61ks obtained by G. Rieke (Prop ID. 1600489; ObsID 73) and by A. Prestwich (Prop ID. 267005758; ObsID 2064). To support and extend our X-ray study of M83, we have been carrying out a number of other studies of M83, including optical broadband and narrowband imaging with the IMACS camera on Magellan (Blair et al. 2012, Cat. J/ApJS/203/8), optical imaging with the Wide Field Camera 3 (WFC3) on the Hubble Space Telescope (HST; W. P. Blair PI, Prop. ID. 12513, Blair et al. 2014ApJ...788...55B), and radio imaging with the Jansky Very Large Array (JVLA; C. Stockdale PI, Prog. ID. 12A-335). Here we describe new 6 and 3cm radio imaging we have obtained from ATCA (Australia Telescope Compact Array) on 2011 April 28, 29, and 30 (table 2). (4 data files).

  9. LUNASKA experiments using the Australia Telescope Compact Array to search for ultrahigh energy neutrinos and develop technology for the lunar Cherenkov technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    James, C. W.; Protheroe, R. J.; Ekers, R. D.

    2010-02-15

    We describe the design, performance, sensitivity and results of our recent experiments using the Australia Telescope Compact Array (ATCA) for lunar Cherenkov observations with a very wide (600 MHz) bandwidth and nanosecond timing, including a limit on an isotropic neutrino flux. We also make a first estimate of the effects of small-scale surface roughness on the effective experimental aperture, finding that contrary to expectations, such roughness will act to increase the detectability of near-surface events over the neutrino energy-range at which our experiment is most sensitive (though distortions to the time-domain pulse profile may make identification more difficult). The aimmore » of our 'Lunar UHE Neutrino Astrophysics using the Square Kilometre Array' (LUNASKA) project is to develop the lunar Cherenkov technique of using terrestrial radio telescope arrays for ultrahigh energy (UHE) cosmic ray (CR) and neutrino detection, and, in particular, to prepare for using the Square Kilometre Array (SKA) and its path-finders such as the Australian SKA Pathfinder (ASKAP) and the Low Frequency Array (LOFAR) for lunar Cherenkov experiments.« less

  10. Herschel And Alma Observations Of The Ism In Massive High-Redshift Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Wu, John F.; Aguirre, Paula; Baker, Andrew J.; Devlin, Mark J.; Hilton, Matt; Hughes, John P.; Infante, Leopoldo; Lindner, Robert R.; Sifón, Cristóbal

    2017-06-01

    The Sunyaev-Zel'dovich effect (SZE) can be used to select samples of galaxy clusters that are essentially mass-limited out to arbitrarily high redshifts. I will present results from an investigation of the star formation properties of galaxies in four massive clusters, extending to z 1, which were selected on the basis of their SZE decrements in the Atacama Cosmology Telescope (ACT) survey. All four clusters have been imaged with Herschel/PACS (tracing star formation rate) and two with ALMA (tracing dust and cold gas mass); newly discovered ALMA CO(4-3) and [CI] line detections expand an already large sample of spectroscopically confirmed cluster members. Star formation rate appears to anti-correlate with environmental density, but this trend vanishes after controlling for stellar mass. Elevated star formation and higher CO excitation are seen in "El Gordo," a violent cluster merger, relative to a virialized cluster at a similar high (z 1) redshift. Also exploiting ATCA 2.1 GHz observations to identify radio-loud active galactic nuclei (AGN) in our sample, I will use these data to develop a coherent picture of how environment influences galaxies' ISM properties and evolution in the most massive clusters at early cosmic times.

  11. Advanced Technology Composite Fuselage-Structural Performance

    NASA Technical Reports Server (NTRS)

    Walker, T. H.; Minguet, P. J.; Flynn, B. W.; Carbery, D. J.; Swanson, G. D.; Ilcewicz, L. B.

    1997-01-01

    Boeing is studying the technologies associated with the application of composite materials to commercial transport fuselage structure under the NASA-sponsored contracts for Advanced Technology Composite Aircraft Structures (ATCAS) and Materials Development Omnibus Contract (MDOC). This report addresses the program activities related to structural performance of the selected concepts, including both the design development and subsequent detailed evaluation. Design criteria were developed to ensure compliance with regulatory requirements and typical company objectives. Accurate analysis methods were selected and/or developed where practical, and conservative approaches were used where significant approximations were necessary. Design sizing activities supported subsequent development by providing representative design configurations for structural evaluation and by identifying the critical performance issues. Significant program efforts were directed towards assessing structural performance predictive capability. The structural database collected to perform this assessment was intimately linked to the manufacturing scale-up activities to ensure inclusion of manufacturing-induced performance traits. Mechanical tests were conducted to support the development and critical evaluation of analysis methods addressing internal loads, stability, ultimate strength, attachment and splice strength, and damage tolerance. Unresolved aspects of these performance issues were identified as part of the assessments, providing direction for future development.

  12. Global Cost and Weight Evaluation of Fuselage Side Panel Design Concepts

    NASA Technical Reports Server (NTRS)

    Polland, D. R.; Finn, S. R.; Griess, K. H.; Hafenrichter, J. L.; Hanson, C. T.; Ilcewicz, L. B.; Metschan, S. L.; Scholz, D. B.; Smith, P. J.

    1997-01-01

    This report documents preliminary design trades conducted under NASA contracts NAS1 18889 (Advanced Technology Composite Aircraft Structures, ATCAS) and NAS1-19349 (Task 3, Pathfinder Shell Design) for a subsonic wide body commercial aircraft fuselage side panel section utilizing composite materials. Included in this effort were (1) development of two complete design concepts, (2) generation of cost and weight estimates, (3) identification of technical issues and potential design enhancements, and (4) selection of a single design to be further developed. The first design concept featured an open-section stringer stiffened skin configuration while the second was based on honeycomb core sandwich construction. The trade study cost and weight results were generated from comprehensive assessment of each structural component comprising the fuselage side panel section from detail fabrication through airplane final assembly. Results were obtained in three phases: (1) for the baseline designs, (2) after global optimization of the designs, and (3) the results anticipated after detailed design optimization. A critical assessment of both designs was performed to determine the risk associated with each concept, that is the relative probability of achieving the cost and weight projections. Seven critical technical issues were identified as the first step towards side panel detailed design optimization.

  13. MODELING THE AFTERGLOW OF THE POSSIBLE FERMI -GBM EVENT ASSOCIATED WITH GW150914

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morsony, Brian J.; Workman, Jared C.; Ryan, Dominic M., E-mail: morsony@astro.umd.edu

    2016-07-10

    We model the possible afterglow of the Fermi Gamma-ray Burst Monitor (GBM) event associated with LIGO detection GW150914, under the assumption that the gamma-rays are produced by a short GRB-like relativistic outflow. We model GW150914-GBM as both a weak, on-axis short GRB and normal short GRB seen far off-axis. Given the large uncertainty in the position of GW150914, we determine that the best chance of finding the afterglow is with ASKAP or possibly the Murchinson Widefield Array (MWA), with the flux from an off-axis short GRB reaching 0.2–4 mJy (0.12–16 mJy) at 150 MHz (863.5 MHz) by 1–12 months aftermore » the initial event. At low frequencies, the source would evolve from a hard to soft spectrum over several months. The radio afterglow would be detectable for several months to years after it peaks, meaning the afterglow may still be detectable and increasing in brightness NOW (2016 mid-July). With a localization from the MWA or ASKAP, the afterglow would be detectable at higher radio frequencies with the ATCA and in X-rays with Chandra or XMM .« less

  14. Brought in Dead: An Avoidable Delay in Maternal Deaths.

    PubMed

    Kumar, Aruna; Agrawal, Neha

    2016-10-01

    Maternal brought in dead are the patient who dies in the need of adequate medical care. These deaths are often not analyzed sincerely as they are not institutional deaths. Our aim is to find out actual life threatening cause of delay leading to death. Patients brought dead to casualty were seen by the doctors on duty in Department of Obstetrics and Gynaecology,Gandhi Medical College, Bhopal round the clock. Cause of death was analyzed by verbal autopsy of attendants and referral letter from the institute. In this analytical study a complete evaluation of brought deaths from January 2011 to Decmeber 2014 was done. A total of 64 brought in deaths were reported in this 4 year duration. Most common cause of death was postpartum hemorrhage (54.68 %) followed by hypertension (15.62 %) and the most common cause of delay was delay in getting adequate treatment (56.25 %). The brought in dead are the indicator of the three delays in getting health care. Challenges appear to be enormous to be tackled. Timely management proves to be critical in preventing maternal death. Thus it appears that community education about pregnancy and its complications, EmOC training at FRU and strict adherence to referral protocol may help us to reduce the brought dead burden.

  15. Two-Component Signal Transduction Systems That Regulate the Temporal and Spatial Expression of Myxococcus xanthus Sporulation Genes.

    PubMed

    Sarwar, Zaara; Garza, Anthony G

    2016-02-01

    When starved for nutrients, Myxococcus xanthus produces a biofilm that contains a mat of rod-shaped cells, known as peripheral rods, and aerial structures called fruiting bodies, which house thousands of dormant and stress-resistant spherical spores. Because rod-shaped cells differentiate into spherical, stress-resistant spores and spore differentiation occurs only in nascent fruiting bodies, many genes and multiple levels of regulation are required. Over the past 2 decades, many regulators of the temporal and spatial expression of M. xanthus sporulation genes have been uncovered. Of these sporulation gene regulators, two-component signal transduction circuits, which typically contain a histidine kinase sensor protein and a transcriptional regulator known as response regulator, are among the best characterized. In this review, we discuss prototypical two-component systems (Nla6S/Nla6 and Nla28S/Nla28) that regulate an early, preaggregation phase of sporulation gene expression during fruiting body development. We also discuss orphan response regulators (ActB and FruA) that regulate a later phase of sporulation gene expression, which begins during the aggregation stage of fruiting body development. In addition, we summarize the research on a complex two-component system (Esp) that is important for the spatial regulation of sporulation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Myxococcus xanthus Developmental Cell Fate Production: Heterogeneous Accumulation of Developmental Regulatory Proteins and Reexamination of the Role of MazF in Developmental Lysis

    PubMed Central

    Lee, Bongsoo; Holkenbrink, Carina; Treuner-Lange, Anke

    2012-01-01

    Myxococcus xanthus undergoes a starvation-induced multicellular developmental program during which cells partition into three known fates: (i) aggregation into fruiting bodies followed by differentiation into spores, (ii) lysis, or (iii) differentiation into nonaggregating persister-like cells, termed peripheral rods. As a first step to characterize cell fate segregation, we enumerated total, aggregating, and nonaggregating cells throughout the developmental program. We demonstrate that both cell lysis and cell aggregation begin with similar timing at approximately 24 h after induction of development. Examination of several known regulatory proteins in the separated aggregated and nonaggregated cell fractions revealed previously unknown heterogeneity in the accumulation patterns of proteins involved in type IV pilus (T4P)-mediated motility (PilC and PilA) and regulation of development (MrpC, FruA, and C-signal). As part of our characterization of the cell lysis fate, we set out to investigate the unorthodox MazF-MrpC toxin-antitoxin system which was previously proposed to induce programmed cell death (PCD). We demonstrate that deletion of mazF in two different wild-type M. xanthus laboratory strains does not significantly reduce developmental cell lysis, suggesting that MazF's role in promoting PCD is an adaption to the mutant background strain used previously. PMID:22493014

  17. Genome-wide Screening Identifies Phosphotransferase System Permease BepA to Be Involved in Enterococcus faecium Endocarditis and Biofilm Formation.

    PubMed

    Paganelli, Fernanda L; Huebner, Johannes; Singh, Kavindra V; Zhang, Xinglin; van Schaik, Willem; Wobser, Dominique; Braat, Johanna C; Murray, Barbara E; Bonten, Marc J M; Willems, Rob J L; Leavis, Helen L

    2016-07-15

    Enterococcus faecium is a common cause of nosocomial infections, of which infective endocarditis is associated with substantial mortality. In this study, we used a microarray-based transposon mapping (M-TraM) approach to evaluate a rat endocarditis model and identified a gene, originally annotated as "fruA" and renamed "bepA," putatively encoding a carbohydrate phosphotransferase system (PTS) permease (biofilm and endocarditis-associated permease A [BepA]), as important in infective endocarditis. This gene is highly enriched in E. faecium clinical isolates and absent in commensal isolates that are not associated with infection. Confirmation of the phenotype was established in a competition experiment of wild-type and a markerless bepA mutant in a rat endocarditis model. In addition, deletion of bepA impaired biofilm formation in vitro in the presence of 100% human serum and metabolism of β-methyl-D-glucoside. β-glucoside metabolism has been linked to the metabolism of glycosaminoglycans that are exposed on injured heart valves, where bacteria attach and form vegetations. Therefore, we propose that the PTS permease BepA is directly implicated in E. faecium pathogenesis. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  18. Effect of single alien chromosome from shallot (Allium cepa L. Aggregatum group) on carbohydrate production in leaf blade of bunching onion (A. fistulosum L.).

    PubMed

    Hang, Tran Thi Minh; Shigyo, Masayoshi; Yaguchi, Shigenori; Yamauchi, Naoki; Tashiro, Yosuke

    2004-12-01

    We used a complete set of Allium fistulosum - shallot (A. cepa Aggregatum group) monosomic addition lines (FF+1A - FF+8A) to identify shallot chromosomes affecting the production of sugars. In the alien addition lines grown over two years in an experimental field at Yamaguchi University (34 degrees N, 131 degrees E), shallot chromosomes 2A and 8A altered sugar contents in leaf-bunching onion (A. fistulosum). Except for FF+2A, every monosomic addition accumulated non-reducing sugars in winter leaf blades. FF+8A caused an increase in the amounts of non-reducing sugars in the winter. FF+2A hardly produced non-reducing sugar throughout the two-year study. These results indicated that genes related to non-reducing sugar metabolism are located on the 2A and 8A chromosomes. The results of regression analyses using 2002 data on A. fistulosum and the monosomic addition set revealed a correlation (r = 0.63 +/- 0.07; mean +/- SE., n = 9) between reducing sugar and monosaccharide (Glc+Fru) contents but no correlation between non-reducing sugar and sucrose contents. This result indicates the existence of other polysaccharides (e.g., scorodose) as non-reducing sugars in the leaf blade.

  19. Evaluation of the site specific protein glycation and antioxidant capacity of rare sugar-protein/peptide conjugates.

    PubMed

    Sun, Yuanxia; Hayakawa, Shigeru; Ogawa, Masahiro; Izumori, Ken

    2005-12-28

    Protein-sugar conjugates generated in nonenzymatic glycation of alpha-lactalbumin (LA) with rare sugars [D-allose (All) and D-psicose (Psi)] and alimentary sugars as controls [D-glucose (Glc) and D-fructose (Fru)] were qualitatively determined by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). Mass spectra revealed that the extent of glycation at lysine residues on LA with D-aldose molecules was very much higher than that of glycation with d-ketose molecules. To identify the specific site of glycation, the peptide mapping was established from protease V8 digestion, using a combination of computational cutting of proteins and MALDI-TOF-MS. As compared to peptide mapping, three and seven glycation sites were located in the primary structure of LA-ketose and LA-aldose conjugates, respectively. On the other hand, the antioxidant activities of protein-sugar conjugates and their peptic hydrolysates were investigated by 1,1-diphenyl-2-picrylhydrazyl radical scavenging method. The antioxidant activities of proteins/peptides glycated with rare sugars were significantly higher than those modified with the control sugars. The results indicated that the glycation degree and position were not markedly different between rare sugar and corresponding control sugar, but the antioxidant properties of protein and its hydrolysate were significantly enhanced by modifying with rare sugar.

  20. Recent advances in the synthesis of rare sugars using DHAP-dependent aldolases.

    PubMed

    Li, Aimin; Cai, Li; Chen, Zhou; Wang, Mayan; Wang, Ning; Nakanishi, Hideki; Gao, Xiao-Dong; Li, Zijie

    2017-11-27

    The occurrence rates of non-communicable diseases like obesity, diabetes and hyperlipidemia have increased remarkably due to excessive consumption of a high-energy diet. Rare sugars therefore have become increasingly attractive owing to their unique nutritional properties. In the past two decades, various rare sugars have been successfully prepared guided by the "Izumoring strategy". As a valuable complement to the Izumoring approach, the controllable dihydroxyacetone phosphate (DHAP)-dependent aldolases have generally predictable regio- and stereoselectivity, which makes them powerful tools in C-C bond construction and rare sugar production. However, the main disadvantage for this group of aldolases is their strict substrate specificity toward the donor molecule DHAP, a very expensive and relatively unstable compound. Among the current methods involving DHAP, the one that couples DHAP production from inexpensive starting materials (for instance, glycerol, DL-glycerol 3-phosphate, dihydroxyacetone, and glucose) with aldol condensation appears to be the most promising. This review thus focuses on recent advances in the application of L-rhamnulose-1-phosphate aldolase (RhaD), L-fuculose-1-phosphate aldolase (FucA), and D-fructose-1,6-bisphosphate aldolase (FruA) for rare sugar synthesis in vitro and in vivo, while illustrating strategies for supplying DHAP in efficient and economical ways. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Association Mapping of Main Tomato Fruit Sugars and Organic Acids

    PubMed Central

    Zhao, Jiantao; Xu, Yao; Ding, Qin; Huang, Xinli; Zhang, Yating; Zou, Zhirong; Li, Mingjun; Cui, Lu; Zhang, Jing

    2016-01-01

    Association mapping has been widely used to map the significant associated loci responsible for natural variation in complex traits and are valuable for crop improvement. Sugars and organic acids are the most important metabolites in tomato fruits. We used a collection of 174 tomato accessions composed of Solanum lycopersicum (123 accessions) and S. lycopersicum var cerasiforme (51 accessions) to detect significantly associated loci controlling the variation of main sugars and organic acids. The accessions were genotyped with 182 SSRs spreading over the tomato genome. Association mapping was conducted on the main sugars and organic acids detected by gas chromatography-mass spectrometer (GC-MS) over 2 years using the mixed linear model (MLM). We detected a total of 58 significantly associated loci (P < 0.001) for the 17 sugars and organic acids, including fructose, glucose, sucrose, citric acid, malic acid. These results not only co-localized with several reported QTLs, including fru9.1/PV, suc9.1/PV, ca2.1/HS, ca3.1/PV, ca4.1/PV, and ca8.1/PV, but also provided a list of candidate significantly associated loci to be functionally validated. These significantly associated loci could be used for deciphering the genetic architecture of tomato fruit sugars and organic acids and for tomato quality breeding. PMID:27617019

  2. Association Mapping of Main Tomato Fruit Sugars and Organic Acids.

    PubMed

    Zhao, Jiantao; Xu, Yao; Ding, Qin; Huang, Xinli; Zhang, Yating; Zou, Zhirong; Li, Mingjun; Cui, Lu; Zhang, Jing

    2016-01-01

    Association mapping has been widely used to map the significant associated loci responsible for natural variation in complex traits and are valuable for crop improvement. Sugars and organic acids are the most important metabolites in tomato fruits. We used a collection of 174 tomato accessions composed of Solanum lycopersicum (123 accessions) and S. lycopersicum var cerasiforme (51 accessions) to detect significantly associated loci controlling the variation of main sugars and organic acids. The accessions were genotyped with 182 SSRs spreading over the tomato genome. Association mapping was conducted on the main sugars and organic acids detected by gas chromatography-mass spectrometer (GC-MS) over 2 years using the mixed linear model (MLM). We detected a total of 58 significantly associated loci (P < 0.001) for the 17 sugars and organic acids, including fructose, glucose, sucrose, citric acid, malic acid. These results not only co-localized with several reported QTLs, including fru9.1/PV, suc9.1/PV, ca2.1/HS, ca3.1/PV, ca4.1/PV, and ca8.1/PV, but also provided a list of candidate significantly associated loci to be functionally validated. These significantly associated loci could be used for deciphering the genetic architecture of tomato fruit sugars and organic acids and for tomato quality breeding.

  3. Genetic Determinants of High-Level Oxacillin Resistance in Methicillin-Resistant Staphylococcus aureus.

    PubMed

    Pardos de la Gandara, Maria; Borges, Vitor; Chung, Marilyn; Milheiriço, Catarina; Gomes, João Paulo; de Lencastre, Herminia; Tomasz, Alexander

    2018-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) strains carry either a mecA - or a mecC -mediated mechanism of resistance to beta-lactam antibiotics, and the phenotypic expression of resistance shows extensive strain-to-strain variation. In recent communications, we identified the genetic determinants associated with the stringent stress response that play a major role in the antibiotic resistant phenotype of the historically earliest "archaic" clone of MRSA and in the mecC -carrying MRSA strain LGA251. Here, we sought to test whether or not the same genetic determinants also contribute to the resistant phenotype of highly and homogeneously resistant (H*R) derivatives of a major contemporary MRSA clone, USA300. We found that the resistance phenotype was linked to six genes ( fruB , gmk , hpt , purB , prsA , and relA ), which were most frequently targeted among the analyzed 20 H*R strains (one mutation per clone in 19 of the 20 H*R strains). Besides the strong parallels with our previous findings (five of the six genes matched), all but one of the repeatedly targeted genes were found to be linked to guanine metabolism, pointing to the key role that this pathway plays in defining the level of antibiotic resistance independent of the clonal type of MRSA. Copyright © 2018 American Society for Microbiology.

  4. The radio relics and halo of El Gordo, a massive z = 0.870 cluster merger

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindner, Robert R.; Baker, Andrew J.; Hughes, John P.

    We present 610 MHz and 2.1 GHz imaging of the massive Sunyaev-Zel'dovich Effect selected z = 0.870 cluster merger ACT-CL J0102–4915 ({sup E}l Gordo{sup )}, obtained with the Giant Metrewave Radio Telescope and the Australia Telescope Compact Array (ATCA), respectively. We detect two complexes of radio relics separated by 3.'4 (1.6 Mpc) along the system's northwest-to-southeast collision axis that have high integrated polarization fractions (33%) and steep spectral indices (α between 1 and 2; S {sub ν}∝ν{sup –α}), consistent with creation via Fermi acceleration by shocks in the intracluster medium triggered by the cluster collision. From the spectral index ofmore » the relics, we compute a Mach number M=2.5{sub −0.3}{sup +0.7} and shock speed of 2500{sub −300}{sup +400} km s{sup −1}. With our wide-bandwidth, full-polarization ATCA data, we compute the Faraday depth φ across the northwest relic and find a range of values spanning Δφ = 30 rad m{sup –2}, with a mean value of (φ) = 11 rad m{sup –2} and standard deviation σ{sub φ} = 6 rad m{sup –2}. With the integrated line-of-sight gas density derived from new Chandra X-ray observations, our Faraday depth measurement implies B {sub ∥} ∼ 0.01 μG in the cluster outskirts. The extremely narrow shock widths in the relics (d {sub shock} ≤ 23 kpc), caused by the short synchrotron cooling timescale of relativistic electrons at z = 0.870, prevent us from placing a meaningful constraint on the magnetic field strength B using cooling time arguments. In addition to the relics, we detect a large (r {sub H} ≅ 1.1 Mpc radius), powerful (log (L {sub 1.4}/W Hz{sup –1}) = 25.66 ± 0.12) radio halo with a shape similar to El Gordo's 'bullet'-like X-ray morphology. The spatially resolved spectral-index map of the halo shows the synchrotron spectrum is flattest near the relics, along the system's collision axis, and in regions of high T {sub gas}, all locations associated with recent energy injection. The spatial and spectral correlation between the halo emission and cluster X-ray properties supports primary-electron processes like turbulent reacceleration as the halo production mechanism. The halo's integrated 610 MHz to 2.1 GHz spectral index is a relatively flat α = 1.2 ± 0.1, consistent with the cluster's high T {sub gas} in view of previously established global scaling relations. El Gordo is the highest-redshift cluster known to host a radio halo and/or radio relics, and provides new constraints on the non-thermal physics in clusters at z > 0.6.« less

  5. High-rate serial interconnections for embedded and distributed systems with power and resource constraints

    NASA Astrophysics Data System (ADS)

    Sheynin, Yuriy; Shutenko, Felix; Suvorova, Elena; Yablokov, Evgenej

    2008-04-01

    High rate interconnections are important subsystems in modern data processing and control systems of many classes. They are especially important in prospective embedded and on-board systems that used to be multicomponent systems with parallel or distributed architecture, [1]. Modular architecture systems of previous generations were based on parallel busses that were widely used and standardised: VME, PCI, CompactPCI, etc. Busses evolution went in improvement of bus protocol efficiency (burst transactions, split transactions, etc.) and increasing operation frequencies. However, due to multi-drop bus nature and multi-wire skew problems the parallel bussing speedup became more and more limited. For embedded and on-board systems additional reason for this trend was in weight, size and power constraints of an interconnection and its components. Parallel interfaces have become technologically more challenging as their respective clock frequencies have increased to keep pace with the bandwidth requirements of their attached storage devices. Since each interface uses a data clock to gate and validate the parallel data (which is normally 8 bits or 16 bits wide), the clock frequency need only be equivalent to the byte rate or word rate being transmitted. In other words, for a given transmission frequency, the wider the data bus, the slower the clock. As the clock frequency increases, more high frequency energy is available in each of the data lines, and a portion of this energy is dissipated in radiation. Each data line not only transmits this energy but also receives some from its neighbours. This form of mutual interference is commonly called "cross-talk," and the signal distortion it produces can become another major contributor to loss of data integrity unless compensated by appropriate cable designs. Other transmission problems such as frequency-dependent attenuation and signal reflections, while also applicable to serial interfaces, are more troublesome in parallel interfaces due to the number of additional cable conductors involved. In order to compensate for these drawbacks, higher quality cables, shorter cable runs and fewer devices on the bus have been the norm. Finally, the physical bulk of the parallel cables makes them more difficult to route inside an enclosure, hinders cooling airflow and is incompatible with the trend toward smaller form-factor devices. Parallel busses worked in systems during the past 20 years, but the accumulated problems dictate the need for change and the technology is available to spur the transition. The general trend in high-rate interconnections turned from parallel bussing to scalable interconnections with a network architecture and high-rate point-to-point links. Analysis showed that data links with serial information transfer could achieve higher throughput and efficiency and it was confirmed in various research and practical design. Serial interfaces offer an improvement over older parallel interfaces: better performance, better scalability, and also better reliability as the parallel interfaces are at their limits of speed with reliable data transfers and others. The trend was implemented in major standards' families evolution: e.g. from PCI/PCI-X parallel bussing to PCIExpress interconnection architecture with serial lines, from CompactPCI parallel bus to ATCA (Advanced Telecommunications Architecture) specification with serial links and network topologies of an interconnection, etc. In the article we consider a general set of characteristics and features of serial interconnections, give a brief overview of serial interconnections specifications. In more details we present the SpaceWire interconnection technology. Have been developed for space on-board systems applications the SpaceWire has important features and characteristics that make it a prospective interconnection for wide range of embedded systems.

  6. Advanced Technology Composite Fuselage - Repair and Damage Assessment Supporting Maintenance

    NASA Technical Reports Server (NTRS)

    Flynn, B. W.; Bodine, J. B.; Dopker, B.; Finn, S. R.; Griess, K. H.; Hanson, C. T.; Harris, C. G.; Nelson, K. M.; Walker, T. H.; Kennedy, T. C.; hide

    1997-01-01

    Under the NASA-sponsored contracts for Advanced Technology Composite Aircraft Structures (ATCAS) and Materials Development Omnibus Contract (MDOC), Boeing is studying the technologies associated with the application of composite materials to commercial transport fuselage structure. Included in the study is the incorporation of maintainability and repairability requirements of composite primary structure into the design. This contractor report describes activities performed to address maintenance issues in composite fuselage applications. A key aspect of the study was the development of a maintenance philosophy which included consideration of maintenance issues early in the design cycle, multiple repair options, and airline participation in design trades. Fuselage design evaluations considered trade-offs between structural weight, damage resistance/tolerance (repair frequency), and inspection burdens. Analysis methods were developed to assess structural residual strength in the presence of damage, and to evaluate repair design concepts. Repair designs were created with a focus on mechanically fastened concepts for skin/stringer structure and bonded concepts for sandwich structure. Both a large crown (skintstringer) and keel (sandwich) panel were repaired. A compression test of the keel panel indicated the demonstrated repairs recovered ultimate load capability. In conjunction with the design and manufacturing developments, inspection methods were investigated for their potential to evaluate damaged structure and verify the integrity of completed repairs.

  7. Advanced tow placement of composite fuselage structure

    NASA Technical Reports Server (NTRS)

    Anderson, Robert L.; Grant, Carroll G.

    1992-01-01

    The Hercules NASA ACT program was established to demonstrate and validate the low cost potential of the automated tow placement process for fabrication of aircraft primary structures. The program is currently being conducted as a cooperative program in collaboration with the Boeing ATCAS Program. The Hercules advanced tow placement process has been in development since 1982 and was developed specifically for composite aircraft structures. The second generation machine, now in operation at Hercules, is a production-ready machine that uses a low cost prepreg tow material form to produce structures with laminate properties equivalent to prepreg tape layup. Current program activities are focused on demonstration of the automated tow placement process for fabrication of subsonic transport aircraft fuselage crown quadrants. We are working with Boeing Commercial Aircraft and Douglas Aircraft during this phase of the program. The Douglas demonstration panels has co-cured skin/stringers, and the Boeing demonstration panel is an intricately bonded part with co-cured skin/stringers and co-bonded frames. Other aircraft structures that were evaluated for the automated tow placement process include engine nacelle components, fuselage pressure bulkheads, and fuselage tail cones. Because of the cylindrical shape of these structures, multiple parts can be fabricated on one two placement tool, thus reducing the cost per pound of the finished part.

  8. Advanced Technology Composite Fuselage - Materials and Processes

    NASA Technical Reports Server (NTRS)

    Scholz, D. B.; Dost, E. F.; Flynn, B. W.; Ilcewicz, L. B.; Nelson, K. M.; Sawicki, A. J.; Walker, T. H.; Lakes, R. S.

    1997-01-01

    The goal of Boeing's Advanced Technology Composite Aircraft Structures (ATCAS) program was to develop the technology required for cost and weight efficient use of composite materials in transport fuselage structure. This contractor report describes results of material and process selection, development, and characterization activities. Carbon fiber reinforced epoxy was chosen for fuselage skins and stiffening elements and for passenger and cargo floor structures. The automated fiber placement (AFP) process was selected for fabrication of monolithic and sandwich skin panels. Circumferential frames and window frames were braided and resin transfer molded (RTM'd). Pultrusion was selected for fabrication of floor beams and constant section stiffening elements. Drape forming was chosen for stringers and other stiffening elements. Significant development efforts were expended on the AFP, braiding, and RTM processes. Sandwich core materials and core edge close-out design concepts were evaluated. Autoclave cure processes were developed for stiffened skin and sandwich structures. The stiffness, strength, notch sensitivity, and bearing/bypass properties of fiber-placed skin materials and braided/RTM'd circumferential frame materials were characterized. The strength and durability of cocured and cobonded joints were evaluated. Impact damage resistance of stiffened skin and sandwich structures typical of fuselage panels was investigated. Fluid penetration and migration mechanisms for sandwich panels were studied.

  9. The Belle II Pixel Detector Data Acquisition and Background Suppression System

    NASA Astrophysics Data System (ADS)

    Lautenbach, K.; Deschamps, B.; Dingfelder, J.; Getzkow, D.; Geßler, T.; Konorov, I.; Kühn, W.; Lange, S.; Levit, D.; Liu, Z.-A.; Marinas, C.; Münchow, D.; Rabusov, A.; Reiter, S.; Spruck, B.; Wessel, C.; Zhao, J.

    2017-06-01

    The Belle II experiment at the future SuperKEKB collider in Tsukuba, Japan, features a design luminosity of 8 · 1035 cm-2s-1, which is a factor of 40 larger than that of its predecessor Belle. The pixel detector (PXD) with about 8 million pixels is based on the DEPFET technology and will improve the vertex resolution in beam direction by a factor of 2. With an estimated trigger rate of 30 kHz, the PXD is expected to generate a data rate of 20 GBytes/s, which is about 10 times larger than the amount of data generated by all other Belle II subdetectors. Due to the large beam-related background, the PXD requires a data acquisition system with high-bandwidth data links and realtime background reduction by a factor of 30. To achieve this, the Belle II pixel DAQ uses an FPGA-based computing platform with high speed serial links implemented in the ATCA (Advanced Telecommunications Computing Architecture) standard. The architecture and performance of the data acquisition system and data reduction of the PXD will be presented. In April 2016 and February 2017 a prototype PXD-DAQ system operated in a test beam campaign delivered data with the whole readout chain under realistic high rate conditions. Final results from the beam test will be presented.

  10. Direct Evidence for Maser Emission from the 36.2 GHz Class I Transition of Methanol in NGC253

    NASA Astrophysics Data System (ADS)

    Chen, Xi; Ellingsen, Simon P.; Shen, Zhi-Qiang; McCarthy, Tiege P.; Zhong, Wei-Ye; Deng, Hui

    2018-04-01

    Observations made with the Jansky Very large Array (JVLA) at an angular resolution of ∼0.″1 have detected class I methanol maser emission from the 36.2 GHz transition toward the starburst galaxy NGC 253. The methanol emission is detected toward four sites which lie within the regions of extended methanol emission detected in previous lower angular resolution (a few arcseconds) observations. The peak flux densities of the detected compact components are in the range 3–9 mJy beam‑1. Combining the JVLA data with single-dish observations from the Shanghai Tianma Radio Telescope (TMRT) and previous interferometric observations with the Australia Telescope Compact Array (ATCA), we show that the 36.2 GHz class I methanol emission consists of both extended and compact structures, with typical scales of ∼6″ (0.1 kpc) and ∼0.″05 (1 pc), respectively. The strongest components have a brightness temperature of >103 K, much higher than the maximum kinetic temperature (∼100 K) of the thermal methanol emission from NGC 253. Therefore, these observations conclusively demonstrate for the first time the presence of maser emission from a class I methanol transition in an external galaxy.

  11. Development and test of the DAQ system for a Micromegas prototype to be installed in the ATLAS experiment

    NASA Astrophysics Data System (ADS)

    Bianco, M.; Martoiu, S.; Sidiropoulou, O.; Zibell, A.

    2015-12-01

    A Micromegas (MM) quadruplet prototype with an active area of 0.5 m2 that adopts the general design foreseen for the upgrade of the innermost forward muon tracking systems (Small Wheels) of the ATLAS detector in 2018-2019, has been built at CERN and is going to be tested in the ATLAS cavern environment during the LHC RUN-II period 2015-2017. The integration of this prototype detector into the ATLAS data acquisition system using custom ATCA equipment is presented. An ATLAS compatible Read Out Driver (ROD) based on the Scalable Readout System (SRS), the Scalable Readout Unit (SRU), will be used in order to transmit the data after generating valid event fragments to the high-level Read Out System (ROS). The SRU will be synchronized with the LHC bunch crossing clock (40.08 MHz) and will receive the Level-1 trigger signals from the Central Trigger Processor (CTP) through the TTCrx receiver ASIC. The configuration of the system will be driven directly from the ATLAS Run Control System. By using the ATLAS TDAQ Software, a dedicated Micromegas segment has been implemented, in order to include the detector inside the main ATLAS DAQ partition. A full set of tests, on the hardware and software aspects, is presented.

  12. Magnetic field analysis of the bow and terminal shock of the SS 433 jet

    NASA Astrophysics Data System (ADS)

    Sakemi, Haruka; Machida, Mami; Akahori, Takuya; Nakanishi, Hiroyuki; Akamatsu, Hiroki; Kurahara, Kohei; Farnes, Jamie

    2018-03-01

    We report a polarization analysis of the eastern region of W 50, observed with the Australia Telescope Compact Array (ATCA) at 1.4-3.0 GHz. In order to study the physical structures in the region where the SS 433 jet and W 50 interact, we obtain an intrinsic magnetic field vector map of that region. We find that the orientation of the intrinsic magnetic field vectors are aligned along the total intensity structures, and that there are characteristic, separate structures related to the jet, the bow shock, and the terminal shock. The Faraday rotation measures (RMs), and the results of Faraday tomography suggest that a high-intensity, filamentary structure in the north-south direction of the eastern-edge region can be separated into at least two parts to the north and south. The results of Faraday tomography also show that there are multiple components along the line of sight and/or within the beam area. In addition, we analyze the X-ray ring-like structure observed with XMM-Newton. While the possibility still remains that this X-ray ring is "real", it seems that the structure is not ring-like at radio wavelengths. Finally, we suggest that the structure is a part of the helical structure that coils the eastern ear of W 50.

  13. Lactose metabolism by Staphylococcus aureus: characterization of lacABCD, the structural genes of the tagatose 6-phosphate pathway.

    PubMed Central

    Rosey, E L; Oskouian, B; Stewart, G C

    1991-01-01

    The nucleotide and deduced amino acid sequences of the lacA and lacB genes of the Staphylococcus aureus lactose operon (lacABCDFEG) are presented. The primary translation products are polypeptides of 142 (Mr = 15,425) and 171 (Mr = 18,953) amino acids, respectively. The lacABCD loci were shown to encode enzymes of the tagatose 6-phosphate pathway through both in vitro studies and complementation analysis in Escherichia coli. A serum aldolase assay, modified to allow detection of the tagatose 6-phosphate pathway enzymes utilizing galactose 6-phosphate or fructose phosphate analogs as substrate, is described. Expression of both lacA and lacB was required for galactose 6-phosphate isomerase activity. LacC (34 kDa) demonstrated tagatose 6-phosphate kinase activity and was found to share significant homology with LacC from Lactococcus lactis and with both the minor 6-phosphofructokinase (PfkB) and 1-phosphofructokinase (FruK) from E. coli. Detection of tagatose 1,6-bisphosphate aldolase activity was dependent on expression of the 36-kDa protein specified by lacD. The LacD protein is highly homologous with LacD of L. lactis. Thus, the lacABCD genes comprise the tagatose 6-phosphate pathway and are cotranscribed with genes lacFEG, which specify proteins for transport and cleavage of lactose in S. aureus. PMID:1655695

  14. Geofilum rubicundum gen. nov., sp. nov., isolated from deep subseafloor sediment.

    PubMed

    Miyazaki, Masayuki; Koide, Osamu; Kobayashi, Tohru; Mori, Kozue; Shimamura, Shigeru; Nunoura, Takuro; Imachi, Hiroyuki; Inagaki, Fumio; Nagahama, Takahiko; Nogi, Yuichi; Deguchi, Shigeru; Takai, Ken

    2012-05-01

    A novel, facultatively anaerobic bacterium (strain JAM-BA0501(T)) was isolated from a deep subseafloor sediment sample at a depth of 247 m below seafloor off the Shimokita Peninsula of Japan in the north-western Pacific Ocean (Site C9001, 1180 m water depth). Cells of strain JAM-BA0501(T) were gram-negative, filamentous, non-spore-forming and motile on solid medium by gliding. Phylogenetic analysis based on the 16S rRNA gene sequence of strain JAM-BA0501(T) indicated a distant relationship to strains representing genera within the order Bacteroidales, such as Alkaliflexus imshenetskii Z-7010(T) (91.1 % similarity), Marinilabilia salmonicolor ATCC 19041(T) (86.2 %) and Anaerophaga thermohalophila Fru22(T) (89.3 %). The new isolate produced isoprenoid quinones with menaquinone MK-7 as the major component, and the predominant fatty acids were iso-C(15 : 0) and anteiso-C(15 : 0). The DNA G+C content of the isolate was 42.9 mol%. Based on its taxonomic distinctiveness, strain JAM-BA0501(T) is considered to represent a novel species of a new genus within the family Marinilabiliaceae, for which the name Geofilum rubicundum gen. nov., sp. nov. is proposed. The type strain of Geofilum rubicundum is JAM-BA0501(T) ( = JCM 15548(T)  = NCIMB 14482(T)).

  15. Broadband Observations and Modeling of the Shell-Type Supernova Remnant G347.3-0.5

    NASA Technical Reports Server (NTRS)

    Ellison, Donald C.; Slane, Patrick O.; Gaensler, Bryan M.

    2002-01-01

    The supernova remnant G347.3-0.5 emits a featureless power law in X-rays, thought to indicate shock acceleration of electrons to high energies. We here produce a broadband spectrum of the bright northwest limb of this source by combining radio observations from the Australia Telescope Compact Array (ATCA), X-ray observations from the Advanced Satellite for Cosmology and Astrophysics (ASCA), and TeV gamma-ray observations from the CANGAROO imaging Cerenkov telescope. We assume that this emission is produced by an electron population generated by diffusive shock acceleration at the remnant forward shock. The nonlinear aspects of the particle acceleration force a connection between the widely different wavelength bands and between the electrons and the unseen ions, presumably accelerated simultaneously with the electrons. This allows us to infer the relativistic proton spectrum and estimate ambient parameters such as the supernova explosion energy, magnetic field, matter density in the emission region, and efficiency of the shock acceleration process. We find convincing evidence that the shock acceleration is efficient, placing greater than 25% of the shock kinetic energy flux into relativistic ions. Despite this high efficiency, the maximum electron and proton energies, while depending somewhat on assumptions for the compression of the magnetic field in the shock, are well below the observed 'knee' at 10(exp 15) eV in the Galactic cosmic-ray spectrum.

  16. PKS 1954-388: RadioAstron Detection on 80,000 km Baselines and Multiwavelength Observations

    NASA Astrophysics Data System (ADS)

    Edwards, P. G.; Kovalev, Y. Y.; Ojha, R.; An, H.; Bignall, H.; Carpenter, B.; Hovatta, T.; Stevens, J.; Voytsik, P.; Andrianov, A. S.; Dutka, M.; Hase, H.; Horiuchi, S.; Jauncey, D. L.; Kadler, M.; Lisakov, M.; Lovell, J. E. J.; McCallum, J.; Müller, C.; Phillips, C.; Plötz, C.; Quick, J.; Reynolds, C.; Schulz, R.; Sokolovsky, K. V.; Tzioumis, A. K.; Zuga, V.

    2017-04-01

    We present results from a multiwavelength study of the blazar PKS 1954-388 at radio, UV, X-ray, and gamma-ray energies. A RadioAstron observation at 1.66 GHz in June 2012 resulted in the detection of interferometric fringes on baselines of 6.2 Earth-diameters. This suggests a source frame brightness temperature of greater than 2 × 1012 K, well in excess of both equipartition and inverse Compton limits and implying the existence of Doppler boosting in the core. An 8.4-GHz TANAMI VLBI image, made less than a month after the RadioAstron observations, is consistent with a previously reported superluminal motion for a jet component. Flux density monitoring with the Australia Telescope Compact Array confirms previous evidence for long-term variability that increases with observing frequency. A search for more rapid variability revealed no evidence for significant day-scale flux density variation. The ATCA light-curve reveals a strong radio flare beginning in late 2013, which peaks higher, and earlier, at higher frequencies. Comparison with the Fermi gamma-ray light-curve indicates this followed 9 months after the start of a prolonged gamma-ray high-state-a radio lag comparable to that seen in other blazars. The multiwavelength data are combined to derive a Spectral Energy Distribution, which is fitted by a one-zone synchrotron-self-Compton (SSC) model with the addition of external Compton (EC) emission.

  17. Automated detection of extended sources in radio maps: progress from the SCORPIO survey

    NASA Astrophysics Data System (ADS)

    Riggi, S.; Ingallinera, A.; Leto, P.; Cavallaro, F.; Bufano, F.; Schillirò, F.; Trigilio, C.; Umana, G.; Buemi, C. S.; Norris, R. P.

    2016-08-01

    Automated source extraction and parametrization represents a crucial challenge for the next-generation radio interferometer surveys, such as those performed with the Square Kilometre Array (SKA) and its precursors. In this paper, we present a new algorithm, called CAESAR (Compact And Extended Source Automated Recognition), to detect and parametrize extended sources in radio interferometric maps. It is based on a pre-filtering stage, allowing image denoising, compact source suppression and enhancement of diffuse emission, followed by an adaptive superpixel clustering stage for final source segmentation. A parametrization stage provides source flux information and a wide range of morphology estimators for post-processing analysis. We developed CAESAR in a modular software library, also including different methods for local background estimation and image filtering, along with alternative algorithms for both compact and diffuse source extraction. The method was applied to real radio continuum data collected at the Australian Telescope Compact Array (ATCA) within the SCORPIO project, a pathfinder of the Evolutionary Map of the Universe (EMU) survey at the Australian Square Kilometre Array Pathfinder (ASKAP). The source reconstruction capabilities were studied over different test fields in the presence of compact sources, imaging artefacts and diffuse emission from the Galactic plane and compared with existing algorithms. When compared to a human-driven analysis, the designed algorithm was found capable of detecting known target sources and regions of diffuse emission, outperforming alternative approaches over the considered fields.

  18. Digital Front End for Wide-Band VLBI Science Receiver

    NASA Technical Reports Server (NTRS)

    Jongeling, Andre; Sigman, Elliott; Navarro, Robert; Goodhart, Charles; Rogstad, Steve; Chandra, Kumar; Finley, Sue; Trinh, Joseph; Soriano, Melissa; White, Les; hide

    2006-01-01

    An upgrade to the very-long-baseline-interferometry (VLBI) science receiver (VSR) a radio receiver used in NASA's Deep Space Network (DSN) is currently being implemented. The current VSR samples standard DSN intermediate- frequency (IF) signals at 256 MHz and after digital down-conversion records data from up to four 16-MHz baseband channels. Currently, IF signals are limited to the 265-to-375-MHz range, and recording rates are limited to less than 80 Mbps. The new digital front end, denoted the Wideband VSR, provides improvements to enable the receiver to process wider bandwidth signals and accommodate more data channels for recording. The Wideband VSR utilizes state-of-the-art commercial analog-to-digital converter and field-programmable gate array (FPGA) integrated circuits, and fiber-optic connections in a custom architecture. It accepts IF signals from 100 to 600 MHz, sampling the signal at 1.28 GHz. The sample data are sent to a digital processing module, using a fiber-optic link for isolation. The digital processing module includes boards designed around an Advanced Telecom Computing Architecture (ATCA) industry-standard backplane. Digital signal processing implemented in FPGAs down-convert the data signals in up to 16 baseband channels with programmable bandwidths from 1 kHz to 16 MHz. Baseband samples are transmitted to a computer via multiple Ethernet connections allowing recording to disk at rates of up to 1 Gbps.

  19. VizieR Online Data Catalog: Chemical properties of red MSX sources (RMSs) (Yu+, 2016)

    NASA Astrophysics Data System (ADS)

    Yu, N.; Xu, J.

    2017-05-01

    Our molecular line data come from the Millimetre Astronomy Legacy Team Survey at 90GHz (MALT90) (e.g., Foster+ 2011, J/ApJS/197/25; Jackson+ 2013PASA...30...57J). This project is performed with Mopra, a 22m single-dish radio telescope located near Coonabarabran in New South Wales, Australia. The angular resolution of Mopra is 38", with a beam efficiency between 0.49 at 86GHz and 0.42 at 115GHz. The pointing accuracy of the main MALT90 maps is about 8", and the absolute flux uncertainty is in the range of 10%-17% depending on the transition in question. The target clumps of this survey are selected from the 870um Atacama Pathfinder Experiment (APEX) Telescope Large Area Survey of the Galaxy (ATLASGAL; Schuller+ 2009A&A...504..415S; Contreras+ 2013, J/A+A/549/A45; superseded by J/A+A/568/A41). Using Australia Telescope Compact Array (ATCA), Urquhart+ (2007, J/A+A/461/11) observed radio emissions of 826 Red Midcourse Space Experiment (MSX) Sources (RMSs) in the southern sky. We also have checked our sources with the data taken from the Sydney University Molonglo Sky Survey (SUMSS) carried out at 843MHz with the Molonglo Observatory Synthesis Telescope (MOST; Mauch+ 2003, VIII/81). See section 2 for further explanations. (5 data files).

  20. Quantification of sugars and sugar phosphates in Arabidopsis thaliana tissues using porous graphitic carbon liquid chromatography-electrospray ionization mass spectrometry.

    PubMed

    Antonio, Carla; Larson, Tony; Gilday, Alison; Graham, Ian; Bergström, Ed; Thomas-Oates, Jane

    2007-11-23

    This work reports the development and optimisation of a negative ion mode on-line LC-ESI-MS/MS method for the sensitive targeted analysis of the key glycolytic intermediates, sugars and sugar phosphates from plants, using a porous graphitic carbon (PGC) stationary phase and an MS compatible mobile phase. Using this newly developed method, separation and detection of a solution of standard compounds is achieved in less than 20min. Target metabolite compounds were identified in plant extracts from their characteristic retention times, and product ion spectra. This on-line PGC-ESI-MS/MS method shows good linearity over the concentration range 0-100microM, selectivity, short analysis time, and limits of detection of 0.1microM for disaccharides trehalose (Tre), sucrose (Suc), and maltose, and 1.5microM for hexose phosphates fructose-6-phosphate (Fru6P), glucose-1-phosphate (Glc1P), and glucose-6-phosphate (Glc6P), and phosphoenolpyruvate (PEP). This paper describes details of our method and its application to the simultaneous quantitative analysis of soluble sugars and sugar phosphates from Arabidopsis thaliana tissues. We have demonstrated the utility of our method for the analysis of biological samples by applying it to the simultaneous quantitation of changes in soluble sugars and sugar phosphates in A. thaliana Columbia-0 (Col-0) and its starchless phosphoglucomutase (pgm) mutant over a 12-h light/12-h dark growth cycle.

  1. Structural and functional characterization of the LldR from Corynebacterium glutamicum: a transcriptional repressor involved in l-lactate and sugar utilization

    PubMed Central

    Gao, Yong-Gui; Suzuki, Hiroaki; Itou, Hiroshi; Zhou, Yong; Tanaka, Yoshikazu; Wachi, Masaaki; Watanabe, Nobuhisa; Tanaka, Isao; Yao, Min

    2008-01-01

    LldR (CGL2915) from Corynebacterium glutamicum is a transcription factor belonging to the GntR family, which is typically involved in the regulation of oxidized substrates associated with amino acid metabolism. In the present study, the crystal structure of LldR was determined at 2.05-Å resolution. The structure consists of N- and C-domains similar to those of FadR, but with distinct domain orientations. LldR and FadR dimers achieve similar structures by domain swapping, which was first observed in dimeric assembly of transcription factors. A structural feature of Zn2+ binding in the regulatory domain was also observed, as a difference from the FadR subfamily. DNA microarray and DNase I footprint analyses suggested that LldR acts as a repressor regulating cgl2917-lldD and cgl1934-fruK-ptsF operons, which are indispensable for l-lactate and fructose/sucrose utilization, respectively. Furthermore, the stoichiometries and affinities of LldR and DNAs were determined by isothermal titration calorimetry measurements. The transcriptional start site and repression of LldR on the cgl2917-lldD operon were analysed by primer extension assay. Mutation experiments showed that residues Lys4, Arg32, Arg42 and Gly63 are crucial for DNA binding. The location of the putative ligand binding cavity and the regulatory mechanism of LldR on its affinity for DNA were proposed. PMID:18988622

  2. CHRONICLE OF THE "ANGLO-YUGOSLAV CHILDREN'S HOSPITAL" IN SREMSKA KAMENICA.

    PubMed

    Dobanovački, Dušanka; Mikić, Želimir; Vučković, Nada

    2015-01-01

    As a peacetime work of Katherine S. Macphail (Glasgow, 1887- St.Andrews, 1974) MB ChB (Bachelor of Medicine and Surgery), the Anglo-Serbian Children's Hospital in Belgrade was established after World War I, and the English-Yugoslav Children's Hospital for Treatment of Osteoarticular Tuberculosis was founded in Sremska Kamenica in 1934. Situated on the Fruška Gora slope, the hospital-sanatorium was a well-equipped medical institution with an operating theatre and x-ray machine providing very advanced therapy, comparable to those in Switzerland and England: aero and heliotherapy, good quality nourishment, etc. In addition, school lessons were organized as well as several types of handwork as the work-therapy. It was a privately owned hospital but almost all the children were treated free of cost. The age for admission was up to 14. During the period from 1934 to 1937, around 458 children underwent hospital treatment, most of them with successful results. During the war years the Sanatorium was closed but after the war it was reactivated. In 1948 by the act of final nationalization of all medical institutions in the communist Yugoslavia, the hospital was transformed into a ward of orthopedic surgery under the supervision of the referent departments in Belgrade and Novi Sad. Today, hospital is out of work and deprived of its humanitarian mission. The building is neglected and in ruins although it has been proclaimed the national treasure by the Regional Institute for Protection of Monuments of Culture.

  3. Study of MicroRNAs Related to the Liver Regeneration of the Whitespotted Bamboo Shark, Chiloscyllium plagiosum

    PubMed Central

    Lu, Conger; Nie, Zuoming; Chen, Jian; Zhang, Wenping; Ren, Xiaoyuan; Yu, Wei; Liu, Lili; Jiang, Caiying; Zhang, Yaozhou; Guo, Jiangfeng; Wu, Wutong; Shu, Jianhong; Lv, Zhengbing

    2013-01-01

    To understand the mechanisms of liver regeneration better to promote research examining liver diseases and marine biology, normal and regenerative liver tissues of Chiloscyllium plagiosum were harvested 0 h and 24 h after partial hepatectomy (PH) and used to isolate small RNAs for miRNA sequencing. In total, 91 known miRNAs and 166 putative candidate (PC) miRNAs were identified for the first time in Chiloscyllium plagiosum. Through target prediction and GO analysis, 46 of 91 known miRNAs were screened specially for cellular proliferation and growth. Differential expression levels of three miRNAs (xtr-miR-125b, fru-miR-204, and hsa-miR-142-3p_R-1) related to cellular proliferation and apoptosis were measured in normal and regenerating liver tissues at 0 h, 6 h, 12 h, and 24 h using real-time PCR. The expression of these miRNAs showed a rising trend in regenerative liver tissues at 6 h and 12 h but exhibited a downward trend compared to normal levels at 24 h. Differentially expressed genes were screened in normal and regenerating liver tissues at 24 h by DDRT-PCR, and ten sequences were identified. This study provided information regarding the function of genes related to liver regeneration, deepened the understanding of mechanisms of liver regeneration, and resulted in the addition of a significant number of novel miRNAs sequences to GenBank. PMID:24151623

  4. Enhanced seed oil production in canola by conditional expression of Brassica napus LEAFY COTYLEDON1 and LEC1-LIKE in developing seeds.

    PubMed

    Tan, Helin; Yang, Xiaohui; Zhang, Fengxia; Zheng, Xiu; Qu, Cunmin; Mu, Jinye; Fu, Fuyou; Li, Jiana; Guan, Rongzhan; Zhang, Hongsheng; Wang, Guodong; Zuo, Jianru

    2011-07-01

    The seed oil content in oilseed crops is a major selection trait to breeders. In Arabidopsis (Arabidopsis thaliana), LEAFY COTYLEDON1 (LEC1) and LEC1-LIKE (L1L) are key regulators of fatty acid biosynthesis. Overexpression of AtLEC1 and its orthologs in canola (Brassica napus), BnLEC1 and BnL1L, causes an increased fatty acid level in transgenic Arabidopsis plants, which, however, also show severe developmental abnormalities. Here, we use truncated napin A promoters, which retain the seed-specific expression pattern but with a reduced expression level, to drive the expression of BnLEC1 and BnL1L in transgenic canola. Conditional expression of BnLEC1 and BnL1L increases the seed oil content by 2% to 20% and has no detrimental effects on major agronomic traits. In the transgenic canola, expression of a subset of genes involved in fatty acid biosynthesis and glycolysis is up-regulated in developing seeds. Moreover, the BnLEC1 transgene enhances the expression of several genes involved in Suc synthesis and transport in developing seeds and the silique wall. Consistently, the accumulation of Suc and Fru is increased in developing seeds of the transgenic rapeseed, suggesting the increased carbon flux to fatty acid biosynthesis. These results demonstrate that BnLEC1 and BnL1L are reliable targets for genetic improvement of rapeseed in seed oil production.

  5. PKS 1954–388: RadioAstron detection on 80,000 km baselines and multiwavelength observations

    DOE PAGES

    Edwards, P. G.; Kovalev, Y. Y.; Ojha, R.; ...

    2017-04-26

    Here, we present results from a multiwavelength study of the blazar PKS 1954–388 at radio, UV, X-ray, and gamma-ray energies. A RadioAstron observation at 1.66 GHz in June 2012 resulted in the detection of interferometric fringes on baselines of 6.2 Earth-diameters. This suggests a source frame brightness temperature of greater than 2 × 10 12 K, well in excess of both equipartition and inverse Compton limits and implying the existence of Doppler boosting in the core. An 8.4-GHz TANAMI VLBI image, made less than a month after the RadioAstron observations, is consistent with a previously reported superluminal motion for amore » jet component. Flux density monitoring with the Australia Telescope Compact Array confirms previous evidence for long-term variability that increases with observing frequency. A search for more rapid variability revealed no evidence for significant day-scale flux density variation. The ATCA light-curve reveals a strong radio flare beginning in late 2013, which peaks higher, and earlier, at higher frequencies. Comparison with the Fermi gamma-ray light-curve indicates this followed ~ 9 months after the start of a prolonged gamma-ray high-state—a radio lag comparable to that seen in other blazars. The multiwavelength data are combined to derive a Spectral Energy Distribution, which is fitted by a one-zone synchrotron-self-Compton (SSC) model with the addition of external Compton (EC) emission.« less

  6. The COMPASS Tokamak Plasma Control Software Performance

    NASA Astrophysics Data System (ADS)

    Valcarcel, Daniel F.; Neto, André; Carvalho, Ivo S.; Carvalho, Bernardo B.; Fernandes, Horácio; Sousa, Jorge; Janky, Filip; Havlicek, Josef; Beno, Radek; Horacek, Jan; Hron, Martin; Panek, Radomir

    2011-08-01

    The COMPASS tokamak has began operation at the IPP Prague in December 2008. A new control system has been built using an ATCA-based real-time system developed at IST Lisbon. The control software is implemented on top of the MARTe real-time framework attaining control cycles as short as 50 μs, with a jitter of less than 1 μs. The controlled parameters, important for the plasma performance, are the plasma current, position of the plasma current center, boundary shape and horizontal and vertical velocities. These are divided in two control cycles: slow at 500 μs and fast at 50 μs. The project has two phases. First, the software implements a digital controller, similar to the analog one used during the COMPASS-D operation in Culham. In the slow cycle, the plasma current and position are measured and controlled with PID and feedforward controllers, respectively, the shaping magnetic field is preprogrammed. The vertical instability and horizontal equilibrium are controlled with the faster 50-μs cycle PID controllers. The second phase will implement a plasma-shape reconstruction algorithm and controller, aiming at optimized plasma performance. The system was designed to be as modular as possible by breaking the functional requirements of the control system into several independent and specialized modules. This splitting enabled tuning the execution of each system part and to use the modules in a variety of applications with different time constraints. This paper presents the design and overall performance of the COMPASS control software.

  7. The relationship between Class I and Class II methanol masers at high angular resolution

    NASA Astrophysics Data System (ADS)

    McCarthy, T. P.; Ellingsen, S. P.; Voronkov, M. A.; Cimò, G.

    2018-06-01

    We have used the Australia Telescope Compact Array (ATCA) to make the first high-resolution observations of a large sample of class I methanol masers in the 95-GHz (80-71A+) transition. The target sources consist of a statistically complete sample of 6.7-GHz class II methanol masers with an associated 95-GHz class I methanol maser, enabling a detailed study of the relationship between the two methanol maser classes at arcsecond angular resolution. These sources have been previously observed at high resolution in the 36- and 44-GHz transitions, allowing comparison between all three class I maser transitions. In total, 172 95-GHz maser components were detected across the 32 target sources. We find that at high resolution, when considering matched maser components, a 3:1 flux density ratio is observed between the 95- and 44-GHz components, consistent with a number of previous lower angular resolution studies. The 95-GHz maser components appear to be preferentially located closer to the driving sources and this may indicate that this transition is more strongly inverted nearby to background continuum sources. We do not observe an elevated association rate between 95-GHz maser emission and more evolved sources, as indicated by the presence of 12.2-GHz class II masers. We find that in the majority of cases where both class I and class II methanol emission is observed, some component of the class I emission is associated with a likely outflow candidate.

  8. The Infrared-Radio Correlation of Dusty Star Forming Galaxies at High Redshift

    NASA Astrophysics Data System (ADS)

    Lower, Sidney; Vieira, Joaquin Daniel; Jarugula, Sreevani

    2018-01-01

    Far-infrared (FIR) and radio continuum emission in galaxies are related by a common origin: massive stars and the processes triggered during their birth, lifetime, and death. FIR emission is produced by cool dust, heated by the absorption of UV emission from massive stars, which is then re-emitted in the FIR. Thermal free-free radiation emitted from HII regions dominates the spectral energy density (SED) of galaxies at roughly 30 GHz, while non-thermal synchrotron radiation dominates at lower frequencies. At low redshift, the infrared radio correlation (IRC, or qIR) holds as a tight empirical relation for many star forming galaxy types, but until recently, there has not been sensitive enough radio observations to extend this relation to higher redshifts. Many selection biases cloud the results of these analyses, leaving the evolution of the IRC with redshift ambiguous. In this poster, I present CIGALE fitted spectral energy distributions (SEDs) for 24 gravitationally-lensed sources selected in the mm-wave from the South Pole Telescope (SPT) survey. I fit the IRC from infrared and submillimeter fluxes obtained with Herschel, Atacama Pathfinder Experiment (APEX), and SPT and radio fluxes obtained with ATCA at 2.1, 5.5, 9, and 30 GHz. This sample of SPT sources has a spectroscopic redshift range of 2.1

  9. Galactic Starburst NGC 3603 from X-Rays to Radio

    NASA Technical Reports Server (NTRS)

    Moffat, A. F. J.; Corcoran, M. F.; Stevens, I. R.; Skalkowski, G.; Marchenko, S. V.; Muecke, A.; Ptak, A.; Koribalski, B. S.; Brenneman, L.; Mushotzky, R.; hide

    2002-01-01

    NGC 3603 is the most massive and luminous visible starburst region in the Galaxy. We present the first Chandra/ACIS-I X-ray image and spectra of this dense, exotic object, accompanied by deep cm-wavelength ATCA radio image at similar or less than 1 inch spatial resolution, and HST/ground-based optical data. At the S/N greater than 3 level, Chandra detects several hundred X-ray point sources (compared to the 3 distinct sources seen by ROSAT). At least 40 of these sources are definitely associated with optically identified cluster O and WR type members, but most are not. A diffuse X-ray component is also seen out to approximately 2 feet (4 pc) form the center, probably arising mainly from the large number of merging/colliding hot stellar winds and/or numerous faint cluster sources. The point-source X-ray fluxes generally increase with increasing bolometric brightnesses of the member O/WR stars, but with very large scatter. Some exceptionally bright stellar X-ray sources may be colliding wind binaries. The radio image shows (1) two resolved sources, one definitely non-thermal, in the cluster core near where the X-ray/optically brightest stars with the strongest stellar winds are located, (2) emission from all three known proplyd-like objects (with thermal and non-thermal components, and (3) many thermal sources in the peripheral regions of triggered star-formation. Overall, NGC 3603 appears to be a somewhat younger and hotter, scaled-down version of typical starbursts found in other galaxies.

  10. 9500 Nights of Mid-Infrared Observations of SN 1987A: the birth of the remnant

    NASA Astrophysics Data System (ADS)

    Bouchet, Patrice; Danziger, John

    2014-01-01

    The one-in-a-life-time event Supernova SN 1987A, the brightest supernova seen since Kepler's in 1604, has given us a unique opportunity to study the mechanics of a supernova explosion and now to witness the birth of a supernova remnant. A violent encounter is underway between the fastest-moving debris and the circumstellar ring: shocks excite ``hotspots''. ATCA/ANTF, Gemini, VLT, HST, Spitzer, Chandra, and recently ALMA observations have been so far organized to help understanding the several emission mechanisms at work. In the mid-infrared SN 1987A has transformed from a SN with the bulk of its radiation from the ejecta to a SNR whose emission is dominated by the interaction of the blast wave with the surrounding interstellar medium, a process in which kinetic energy is converted into radiative energy. Currently this remnant emission is dominated by material in or near the inner equatorial ring (ER). We give here a brief history of our mid-infrared observations, and present our last data obtained with the SPITZER infrared satellite and the ESO VLT and Gemini telescopes: we show how together with Chandra observations, they contribute to the understanding of this fascinating object. We argue also that our imaging observations suggest that warm dust is still present in the ejecta, and we dispute the presence of huge amount of very cold dust in it, as it has been claimed on the basis of data obtained with the HERSCHELl satellite.

  11. Probing the Evolution of Massive Young Stellar Objects using Weak Class II 6.7GHz Methanol Maser Emission

    NASA Astrophysics Data System (ADS)

    Ludwig, Bethany Ann; Cunningham, Nichol

    2017-01-01

    We present results from an investigation of class II 6.7GHz methanol masers towards four Massive Young Stellar Objects (MYSOs). The sources, selected from the Red MSX Source (RMS) Survey (Lumsden et al. 2013), were previously understood to be non-detections for class II methanol maser emission in the methanol multi-beam (MMB) Survey (Caswell et al. 2010.) Class II methanol masers are a well-known sign post of massive star forming regions and may be utilized to probe their relatively poorly understood formation. It is possible that these non-detections are simply weak masers that are potentially associated with a younger evolutionary phase of MYSOs as hypothesized by Olmi et al. (2014). The sources were chosen to sample various stages of evolution, having similar 21 to 8 micron flux ratios and bolometric luminosities as other MYSOs with previous class II methanol maser detections. We observed all 4 MYSOs with ATCA (~2" resolution) at 10 times deeper sensitivity than previously obtained with the MMB survey and have a spectral resolution of 0.087kms^-1 . The raw data is reduced using the program Miriad (Sault, R. J., et al., 1995) and deconvolutioned using the program CASA (McMullin, J. P., et al. 2007.) We determine one of the four observed MYSOs is harboring a weak class II methanol maser. We discuss the possibility of sensitivity limitations on the remaining sources as well as environmental and evolutionary differences between the sources.

  12. Arm anthropometry indices in Turkish children and adolescents: changes over a three-year period.

    PubMed

    Çiçek, Betül; Öztürk, Ahmet; Mazıcıoğlu, Mustafa Mümtaz; Kurtoğlu, Selim

    2014-12-01

    Time-related changes and comparisons for mid-upper arm circumference (MUAC), triceps skinfold thickness (TSF), arm fat area (AFA) are lacking for Turkish children and adolescents. To determine the arm anthropometry indices (MUAC, TSF, AFA) in children and adolescents and to also assess the changes in these indices over a 3-year time period. The data of the Anthropometry of Turkish Children Aged 0-6 Years (ATCA-06) study and the Second Study of Determination of the Anthropometric Measurements of Turkish Children and Adolescents (DAMTCA-II) were used to calculate the arm anthropometry percentiles in a total group of 6982 children and adolescents aged 28 days to 17 years. The 3rd-97th percentiles were computed by the LMS method. In girls, 50th percentile MUAC values linearly increased with age. In boys, 50th percentile TSF values linearly increased until 10 years of age and decreased after age 11 years, while in girls, TSF values increased linearly with age. 50th percentile values for AFA showed a linear increase in both genders with age. Significant differences were found between the 5th, 50th and 95th percentile values for MUAC and AFA obtained in the two studies (DAMTCA-II and DAMTCA-I) in both boys and girls. The prominent finding was the significant and alarming increase in arm anthropometry indices in both genders within as short period of time as three years.

  13. Sexual dimorphism of sleep regulated by juvenile hormone signaling in Drosophila

    PubMed Central

    Zhang, Enyan; Du, Juan; Liu, Suning; Price, Jeffrey

    2018-01-01

    Sexually dimorphic phenotypes are a universal phenomenon in animals. In the model animal fruit fly Drosophila, males and females exhibit long- and short-sleep phenotypes, respectively. However, the mechanism is still a mystery. In this study, we showed that juvenile hormone (JH) is involved in regulation of sexually dimorphic sleep in Drosophila, in which gain of JH function enlarges differences of the dimorphic sleep phenotype with higher sleep in males and lower sleep in females, while loss of JH function blurs these differences and results in feminization of male sleep and masculinization of female sleep. Further studies indicate that germ cell-expressed (GCE), one of the JH receptors, mediates the response in the JH pathway because the sexually dimorphic sleep phenotypes cannot be rescued by JH hormone in a gce deletion mutant. The JH-GCE regulated sleep dimorphism is generated through the sex differentiation-related genes -fruitless (fru) and doublesex (dsx) in males and sex-lethal (sxl), transformer (tra) and doublesex (dsx) in females. These are the “switch” genes that separately control the sleep pattern in males and females. Moreover, analysis of sleep deprivation and circadian behaviors showed that the sexually dimorphic sleep induced by JH signals is a change of sleep drive and independent of the circadian clock. Furthermore, we found that JH seems to also play an unanticipated role in antagonism of an aging-induced sleep decrease in male flies. Taken together, these results indicate that the JH signal pathway is critical for maintenance of sexually dimorphic sleep by regulating sex-relevant genes. PMID:29617359

  14. Gravity-stimulated changes in auxin and invertase gene expression in maize pulvinal cells

    NASA Technical Reports Server (NTRS)

    Long, Joanne C.; Zhao, Wei; Rashotte, Aaron M.; Muday, Gloria K.; Huber, Steven C.; Brown, C. S. (Principal Investigator)

    2002-01-01

    Maize (Zea mays) stem gravitropism involves differential elongation of cells within a highly specialized region, the stem internodal pulvinus. In the present study, we investigated factors that control gravitropic responses in this system. In the graviresponding pulvinus, hexose sugars (D-Glc and D-Fru) accumulated asymmetrically across the pulvinus. This correlated well with an asymmetric increase in acid invertase activity across the pulvinus. Northern analyses revealed asymmetric induction of one maize acid invertase gene, Ivr2, consistent with transcriptional regulation by gravistimulation. Several lines of evidence indicated that auxin redistribution, as a result of polar auxin transport, is necessary for gravity-stimulated Ivr2 transcript accumulation and differential cell elongation across the maize pulvinus. First, the auxin transport inhibitor, N-1-naphthylphthalamic acid, inhibited gravistimulated curvature and Ivr2 transcript accumulation. Second, a transient gradient of free indole-3-acetic acid (IAA) across the pulvinus was apparent shortly after initiation of gravistimulation. This temporarily free IAA gradient appears to be important for differential cell elongation and Ivr2 transcript accumulation. This is based on the observation that N-1-naphthylphthalamic acid will not inhibit gravitropic responses when applied to pulvinus tissue after the free IAA gradient peak has occurred. Third, IAA alone can stimulate Ivr2 transcript accumulation in non-gravistimulated pulvini. The gravity- and IAA-stimulated increase in Ivr2 transcripts was sensitive to the protein synthesis inhibitor, cycloheximide. Based on these results, a two-phase model describing possible relationships between gravitropic curvature, IAA redistribution, and Ivr2 expression is presented.

  15. Protective effect of Clerodendron glandulosum extract against experimentally induced metabolic syndrome in rats.

    PubMed

    Jadeja, Ravirajsinh N; Thounaojam, Menaka C; Ansarullah; Patel, Vaibhav B; Devkar, Ranjitsinh V; Ramachandran, A V

    2010-12-01

    Metabolic syndrome (MetS) has become one of the major health burdens worldwide. To date, no single pharmacological agent has been developed to correct metabolic abnormalities associated with MetS. Use of indigenous medicinal plants as alternative medicines against MetS could be beneficial due to multiple therapeutic usage, easy availability, and relatively few side effects. To investigate the protective effect of Clerodendron glandulosum Coleb. (Verbenaceae) aqueous leaf extract (CgE) against experimentally induced MetS in rats. Changes in body weight, food and fluid intake, plasma glucose, insulin, fasting insulin resistance index (FIRI), plasma total lipid profile, free fatty acids (FFA), oral glucose tolerance test (OGTT), blood pressure and vascular reactivity have been investigated in various experimental groups. Fructose+CgE groups recorded significant decrement (P <0.05) in plasma glucose, insulin, FIRI, total cholesterol, triglycerides, LDL, VLDL and FFA, whereas plasma HDL level was significantly increased (P <0.05) along with an efficient clearance of glucose during OGTT and lowered area under curve values. FRU+CgE groups also showed significantly decreased (P <0.05) mean arterial blood pressure along with decreased vasoconstriction and increased vasorelaxation in response to administration of various pharmacological agents. These results were comparable with metformin treated rats. C. glandulosum leaf extract ameliorates experimentally induced MetS by improving dyslipidemia and insulin resistance. This study provides the first pharmacological evidence for the protective role of C. glandulosum leaves against experimentally induced MetS. Thus, therapeutic use of C. glandulosum in controlling MetS is indicated.

  16. Photosynthesis and antioxidant defense system of Gynura Bicolor DC grown at different elevated CO2 levels

    NASA Astrophysics Data System (ADS)

    Wang, Minjuan; Liu, Hong; Fu, Yuming

    Atmospheric carbon dioxide concentration [CO _{2}] will increase in the future and will affect global climate and ecosystem productivity. However, this is not clearly an area that requires further study on the most appropriate [CO _{2}] selection for plant growth and quality in a closed, controlled environment. The aim of this study was to determine the variation of photosynthetic characteristics and antioxidant status under five CO _{2} concentration (400, 800, 1200, 2000 and 3000 umol mol (-1) ) on the leaf of Gynura bicolor DC. Here the results show that net photosynthetic rate(Pn), Chl content, edible biomass(EB), leaf blade width(LBW), root weight(RW), fructose(Fru) and sucrose(Suc) of Gynura bicolor DC increased under elevated [CO _{2}] of 800 umol mol (-1) , 1200 umol mol (-1) and 2000 umol mol (-1) . On the contrary, photosynthesis and biomass production declined significantly at 3000 umol mol (-1) CO _{2}, While Lipid peroxidation (LPO), malondialdehyde (MDA) and hydrogen peroxide (H _{2}O _{2}) achieved the highest levels. Furthermore, the contents of glutathione (GSH), vitamin C (VC), and vitamin E (VE), and total antioxidant capacity (T-AOC), the activity of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) reached the highest level at 2000 umol mol ({-1) }CO _{2}. Results imply that a significant increase in growth and antioxidant defense system of Gynura bicolor DC occurred under 800-2000 umol mol (-1) of CO _{2} concentration provided a theoretical basis for the application for plants selection in Bioregeneration Life Support System (BLSS) and a closed controlled environment.

  17. Autoinducer 2 activity in Escherichia coli culture supernatants can be actively reduced despite maintenance of an active synthase, LuxS.

    PubMed

    Hardie, Kim R; Cooksley, Clare; Green, Andrew D; Winzer, Klaus

    2003-03-01

    Production of the signalling molecule (autoinducer-2) synthesized by LuxS has been proposed to be pivotal to a universal mechanism of inter-species bacterial cell-cell communication (quorum sensing); however recently the function of LuxS has been noted to be integral to central metabolism since it contributes to the activated methyl cycle. This paper shows that when Helicobacter pylori LuxS is overproduced in Escherichia coli, it forms cross-linkable multimers. These multimers persist at comparable levels after 24 h of growth if glucose is omitted from the growth medium; however, the levels of extracellular autoinducer-2 decline (Glucose Retention of AI-2 Levels: GRAIL). Glycerol, maltose, galactose, ribose and L-arabinose could substitute for glucose, but lactose, D-arabinose, acetate, citrate and pyruvate could not. Mutations in (i). metabolic pathways (glycolytic enzymes eno, pgk, pgm; galactose epimerase; the Pta-AckA pathway), (ii). sugar transport (pts components, rbs operon, mgl, trg), and (iii). regulators involved in conventional catabolic repression (crp, cya), cAMP-independent catabolite repression (creC, fruR, rpoS,) the stringent response (relA, spoT) and the global carbon storage regulator (csrA) did not prevent GRAIL. Although the basis of GRAIL remains uncertain, it is clear that the mechanism is distinct from conventional catabolite repression. Moreover, GRAIL is not due to inactivation of the enzymic activity of LuxS, since in E. coli, LuxS contained within stationary-phase cells grown in the absence of glucose maintains its activity in vitro.

  18. Fructose 1-Phosphate Is the Preferred Effector of the Metabolic Regulator Cra of Pseudomonas putida*

    PubMed Central

    Chavarría, Max; Santiago, César; Platero, Raúl; Krell, Tino; Casasnovas, José M.; de Lorenzo, Víctor

    2011-01-01

    The catabolite repressor/activator (Cra) protein is a global sensor and regulator of carbon fluxes through the central metabolic pathways of Gram-negative bacteria. To examine the nature of the effector (or effectors) that signal such fluxes to the protein of Pseudomonas putida, the Cra factor of this soil microorganism has been purified and characterized and its three-dimensional structure determined. Analytical ultracentrifugation, gel filtration, and mobility shift assays showed that the effector-free Cra is a dimer that binds an operator DNA sequence in the promoter region of the fruBKA cluster. Furthermore, fructose 1-phosphate (F1P) was found to most efficiently dissociate the Cra-DNA complex. Thermodynamic parameters of the F1P-Cra-DNA interaction calculated by isothermal titration calorimetry revealed that the factor associates tightly to the DNA sequence 5′-TTAAACGTTTCA-3′ (KD = 26.3 ± 3.1 nm) and that F1P binds the protein with an apparent stoichiometry of 1.06 ± 0.06 molecules per Cra monomer and a KD of 209 ± 20 nm. Other possible effectors, like fructose 1,6-bisphosphate, did not display a significant affinity for the regulator under the assay conditions. Moreover, the structure of Cra and its co-crystal with F1P at a 2-Å resolution revealed that F1P fits optimally the geometry of the effector pocket. Our results thus single out F1P as the preferred metabolic effector of the Cra protein of P. putida. PMID:21239488

  19. Relationships of Leaf Net Photosynthesis, Stomatal Conductance, and Mesophyll Conductance to Primary Metabolism: A Multispecies Meta-Analysis Approach1

    PubMed Central

    Gago, Jorge; Daloso, Danilo de Menezes; Flexas, Jaume; Fernie, Alisdair Robert

    2016-01-01

    Plant metabolism drives plant development and plant-environment responses, and data readouts from this cellular level could provide insights in the underlying molecular processes. Existing studies have already related key in vivo leaf gas-exchange parameters with structural traits and nutrient components across multiple species. However, insights in the relationships of leaf gas-exchange with leaf primary metabolism are still limited. We investigated these relationships through a multispecies meta-analysis approach based on data sets from 17 published studies describing net photosynthesis (A) and stomatal (gs) and mesophyll (gm) conductances, alongside the 53 data profiles from primary metabolism of 14 species grown in different experiments. Modeling results highlighted the conserved patterns between the different species. Consideration of species-specific effects increased the explanatory power of the models for some metabolites, including Glc-6-P, Fru-6-P, malate, fumarate, Xyl, and ribose. Significant relationships of A with sugars and phosphorylated intermediates were observed. While gs was related to sugars, organic acids, myo-inositol, and shikimate, gm showed a more complex pattern in comparison to the two other traits. Some metabolites, such as malate and Man, appeared in the models for both conductances, suggesting a metabolic coregulation between gs and gm. The resulting statistical models provide the first hints for coregulation patterns involving primary metabolism plus leaf water and carbon balances that are conserved across plant species, as well as species-specific trends that can be used to determine new biotechnological targets for crop improvement. PMID:26977088

  20. Calibrating the HISA temperature: Measuring the temperature of the Riegel-Crutcher cloud

    NASA Astrophysics Data System (ADS)

    Dénes, H.; McClure-Griffiths, N. M.; Dickey, J. M.; Dawson, J. R.; Murray, C. E.

    2018-06-01

    H I self absorption (HISA) clouds are clumps of cold neutral hydrogen (H I) visible in front of warm background gas, which makes them ideal places to study the properties of the cold atomic component of the interstellar medium (ISM). The Riegel-Crutcher (R-C) cloud is the most striking HISA feature in the Galaxy. It is one of the closest HISA clouds to us and is located in the direction of the Galactic Centre, which provides a bright background. High-resolution interferometric measurements have revealed the filamentary structure of this cloud, however it is difficult to accurately determine the temperature and the density of the gas without optical depth measurements. In this paper we present new H I absorption observations with the Australia Telescope Compact Array (ATCA) against 46 continuum sources behind the Riegel-Crutcher cloud to directly measure the optical depth of the cloud. We decompose the complex H I absorption spectra into Gaussian components using an automated machine learning algorithm. We find 300 Gaussian components, from which 67 are associated with the R-C cloud (0 < vLSR < 10 km s-1, FWHM <10 km s-1). Combining the new H I absorption data with H I emission data from previous surveys we calculate the spin temperature and find it to be between 20 and 80 K. Our measurements uncover a temperature gradient across the cloud with spin temperatures decreasing towards positive Galactic latitudes. We also find three new OH absorption lines associated with the cloud, which support the presence of molecular gas.

  1. ATCA 16 cm observation of CIZA J1358.9-4750: Implication of merger stage and constraint on non-thermal properties

    NASA Astrophysics Data System (ADS)

    Akahori, Takuya; Kato, Yuichi; Nakazawa, Kazuhiro; Ozawa, Takeaki; Gu, Liyi; Takizawa, Motokazu; Fujita, Yutaka; Nakanishi, Hiroyuki; Okabe, Nobuhiro; Makishima, Kazuo

    2018-06-01

    We report the Australia Telescope Compact Array 16 cm observation of CIZA J1358.9-4750. Recent X-ray studies imply that this galaxy cluster is composed of merging, binary clusters. Using the EW367 configuration, we found no significant diffuse radio emission in and around the cluster. An upper limit of the total radio power at 1.4 GHz is ˜1.1 × 1022 W Hz-1 in 30 square arcminutes, which is a typical size for radio relics. It is known that an empirical relation holds between the total radio power and X-ray luminosity of the host cluster. The upper limit is about one order of magnitude lower than the power expected from the relation. Very young (˜70 Myr) shocks with low Mach numbers (˜1.3), which are often seen at an early stage of merger simulations, are suggested by the previous X-ray observation. The shocks may generate cosmic-ray electrons with a steep energy spectrum, which is consistent with non-detection of bright (>1023 W Hz-1) relic in this 16 cm band observation. Based on the assumption of energy equipartition, the upper limit gives a magnetic field strength of below 0.68f(Dlos/1 Mpc)-1(γmin/200)-1 μG, where f is the cosmic-ray total energy density over the cosmic-ray electron energy density, Dlos is the depth of the shock wave along the sightline, and γmin is the lower cutoff Lorentz factor of the cosmic-ray electron energy spectrum.

  2. Millimeter Studies of Nearby Debris Disks

    NASA Astrophysics Data System (ADS)

    MacGregor, Meredith A.

    2017-01-01

    At least 20% of nearby main sequence stars are known to be surrounded by disks of dusty material resulting from the collisional erosion of planetesimals, larger bodies similar to asteroids and comets in our own Solar System. Since the dust-producing planetesimals are expected to persist in stable regions like belts and resonances, the locations, morphologies, and physical properties of dust in these ‘debris disks’ provide probes of planet formation and subsequent dynamical evolution. Observations at millimeter wavelengths are especially critical to our understanding of these systems, since the large grains that dominate emission at these long wavelengths do not travel far from their origin and therefore reliably trace the underlying planetesimal distribution. The newly upgraded capabilities of millimeter interferometers like ALMA are providing us with the opportunity to image these disks with unprecedented sensitivity and resolution. In this dissertation talk, I will present my ongoing work, which uses observations of the angularly resolved brightness distribution and the spectral dependence of the flux density to constrain both the structure and grain size distribution of a sample of nearby debris disks. I will present constraints on the position, width, surface density gradient, and any asymmetric structure of several debris disks (including Epsilon Eridani, Tau Ceti, and Fomalhaut) determined from ALMA and SMA observations. In addition, I will present the results of a survey using the VLA and ATCA to measure the long wavelength spectral index and thus the grain size distribution of fifteen debris disks. Together these results provide a foundation to investigate the dynamical evolution of planetary systems through multi-wavelength observations of debris disks.

  3. Establishing a comprehensive genetic diagnosis strategy for hemophilia B and its application in Chinese population.

    PubMed

    Lin, X Y; Wang, J; Xiao, X; Xu, Y W; Yan, Q J; Jiang, W Y

    2018-04-01

    To reduce the incidence of hemophilia B (HB) which with no complete cure currently, prenatal diagnosis and preimplantation genetic diagnosis (PGD) are effective and feasible means. However, previous studies about genetic diagnosis in HB mostly just focused on the detection of patients and carriers. Here, we established a comprehensive genetic diagnosis strategy for HB and worked it out in Chinese population. The strategy includes the detection of patients and carriers, prenatal diagnosis, and PGD. Seven unrelated HB families from Chinese population involved in this study. Firstly, probands and available members were carried out coagulation laboratory assays, and the clinical information has been recorded. Secondly, we used DNA direct sequencing to screen the whole FIX gene of them. The pathogenicity of novel mutations was verified according to 2015 ACMG-AM guidelines. For prenatal diagnosis, a mix of DNA direct sequencing and STR linkage analysis was employed. To explore a better PGD protocol, Karyomapping was first applied in PGD of HB, comparing with conventional PCR-based methods. Six different pathogenic mutations including 1 novel duplication (c.660_661dup ATCA) were identified. The results of prenatal diagnosis were consistent with birth outcomes. In the PGD case, 4 of 11 embryos were confirmed to be normal and one of them was transferred and led to a healthy birth. The established genetic diagnosis strategy for HB in our study was comprehensive and well applied in clinic practice. Besides, we recommended that DNA direct sequencing combined with Karyomapping was a better PGD protocol. © 2017 John Wiley & Sons Ltd.

  4. Local Group dSph radio survey with ATCA - II. Non-thermal diffuse emission

    NASA Astrophysics Data System (ADS)

    Regis, Marco; Richter, Laura; Colafrancesco, Sergio; Profumo, Stefano; de Blok, W. J. G.; Massardi, Marcella

    2015-04-01

    Our closest neighbours, the Local Group dwarf spheroidal (dSph) galaxies, are extremely quiescent and dim objects, where thermal and non-thermal diffuse emissions lack, so far, of detection. In order to possibly study the dSph interstellar medium, deep observations are required. They could reveal non-thermal emissions associated with the very low level of star formation, or to particle dark matter annihilating or decaying in the dSph halo. In this work, we employ radio observations of six dSphs, conducted with the Australia Telescope Compact Array in the frequency band 1.1-3.1 GHz, to test the presence of a diffuse component over typical scales of few arcmin and at an rms sensitivity below 0.05 mJy beam-1. We observed the dSph fields with both a compact array and long baselines. Short spacings led to a synthesized beam of about 1 arcmin and were used for the extended emission search. The high-resolution data mapped background sources, which in turn were subtracted in the short-baseline maps, to reduce their confusion limit. We found no significant detection of a diffuse radio continuum component. After a detailed discussion on the modelling of the cosmic ray (CR) electron distribution and on the dSph magnetic properties, we present bounds on several physical quantities related to the dSphs, such that the total radio flux, the angular shape of the radio emissivity, the equipartition magnetic field, and the injection and equilibrium distributions of CR electrons. Finally, we discuss the connection to far-infrared and X-ray observations.

  5. LMC X-1: A New Spectral Analysis of the O-star in the Binary and Surrounding Nebula

    NASA Astrophysics Data System (ADS)

    Hyde, E. A.; Russell, D. M.; Ritter, A.; Filipović, M. D.; Kaper, L.; Grieve, K.; O'Brien, A. N.

    2017-09-01

    We provide new observations of the LMC X-1 O star and its extended nebula structure using spectroscopic data from VLT/UVES as well as Hα imaging from the Wide Field Imager on the Max Planck Gesellschaft/European Southern Observatory 2.2 m telescope and ATCA imaging of the 2.1 GHz radio continuum. This nebula is one of the few known to be energized by an X-ray binary. We use a new spectrum extraction technique that is superior to other methods used to obtain both radial velocities and fluxes. This provides an updated spatial velocity of ≃ 21.0 +/- 4.8 km s-1 for the O star. The slit encompasses both the photo-ionized and shock-ionized regions of the nebula. The imaging shows a clear arc-like structure reminiscent of a wind bow shock in between the ionization cone and shock-ionized nebula. The observed structure can be fit well by the parabolic shape of a wind bow shock. If an interpretation of a wind bow shock system is valid, we investigate the N159-O1 star cluster as a potential parent of the system, suggesting a progenitor mass of ˜60 M ⊙ for the black hole. We further note that the radio emission could be non-thermal emission from the wind bow shock, or synchrotron emission associated with the jet-inflated nebula. For both wind- and jet-powered origins, this would represent one of the first radio detections of such a structure.

  6. An Adaptive Low-Cost GNSS/MEMS-IMU Tightly-Coupled Integration System with Aiding Measurement in a GNSS Signal-Challenged Environment

    PubMed Central

    Zhou, Qifan; Zhang, Hai; Li, You; Li, Zheng

    2015-01-01

    The main aim of this paper is to develop a low-cost GNSS/MEMS-IMU tightly-coupled integration system with aiding information that can provide reliable position solutions when the GNSS signal is challenged such that less than four satellites are visible in a harsh environment. To achieve this goal, we introduce an adaptive tightly-coupled integration system with height and heading aiding (ATCA). This approach adopts a novel redundant measurement noise estimation method for an adaptive Kalman filter application and also augments external measurements in the filter to aid the position solutions, as well as uses different filters to deal with various situations. On the one hand, the adaptive Kalman filter makes use of the redundant measurement system’s difference sequence to estimate and tune noise variance instead of employing a traditional innovation sequence to avoid coupling with the state vector error. On the other hand, this method uses the external height and heading angle as auxiliary references and establishes a model for the measurement equation in the filter. In the meantime, it also changes the effective filter online based on the number of tracked satellites. These measures have increasingly enhanced the position constraints and the system observability, improved the computational efficiency and have led to a good result. Both simulated and practical experiments have been carried out, and the results demonstrate that the proposed method is effective at limiting the system errors when there are less than four visible satellites, providing a satisfactory navigation solution. PMID:26393605

  7. An Adaptive Low-Cost GNSS/MEMS-IMU Tightly-Coupled Integration System with Aiding Measurement in a GNSS Signal-Challenged Environment.

    PubMed

    Zhou, Qifan; Zhang, Hai; Li, You; Li, Zheng

    2015-09-18

    The main aim of this paper is to develop a low-cost GNSS/MEMS-IMU tightly-coupled integration system with aiding information that can provide reliable position solutions when the GNSS signal is challenged such that less than four satellites are visible in a harsh environment. To achieve this goal, we introduce an adaptive tightly-coupled integration system with height and heading aiding (ATCA). This approach adopts a novel redundant measurement noise estimation method for an adaptive Kalman filter application and also augments external measurements in the filter to aid the position solutions, as well as uses different filters to deal with various situations. On the one hand, the adaptive Kalman filter makes use of the redundant measurement system's difference sequence to estimate and tune noise variance instead of employing a traditional innovation sequence to avoid coupling with the state vector error. On the other hand, this method uses the external height and heading angle as auxiliary references and establishes a model for the measurement equation in the filter. In the meantime, it also changes the effective filter online based on the number of tracked satellites. These measures have increasingly enhanced the position constraints and the system observability, improved the computational efficiency and have led to a good result. Both simulated and practical experiments have been carried out, and the results demonstrate that the proposed method is effective at limiting the system errors when there are less than four visible satellites, providing a satisfactory navigation solution.

  8. Sequencing the Earliest Stages of Active Galactic Nuclei Development Using The Youngest Radio Sources

    NASA Astrophysics Data System (ADS)

    Collier, Jordan; Filipovic, Miroslav; Norris, Ray; Chow, Kate; Huynh, Minh; Banfield, Julie; Tothill, Nick; Sirothia, Sandeep Kumar; Shabala, Stanislav

    2014-04-01

    This proposal is a continuation of an extensive project (the core of Collier's PhD) to explore the earliest stages of AGN formation, using Gigahertz-Peaked Spectrum (GPS) and Compact Steep Spectrum (CSS) sources. Both are widely believed to represent the earliest stages of radio-loud AGN evolution, with GPS sources preceding CSS sources. In this project, we plan to (a) test this hypothesis, (b) place GPS and CSS sources into an evolutionary sequence with a number of other young AGN candidates, and (c) search for evidence of the evolving accretion mode. We will do this using high-resolution radio observations, with a number of other multiwavelength age indicators, of a carefully selected complete faint sample of 80 GPS/CSS sources. Analysis of the C2730 ELAIS-S1 data shows that we have so far met our goals, resolving the jets of 10/49 sources, and measuring accurate spectral indices from 0.843-10 GHz. This particular proposal is to almost triple the sample size by observing an additional 80 GPS/CSS sources in the Chandra Deep Field South (arguably the best-studied field) and allow a turnover frequency - linear size relation to be derived at >10-sigma. Sources found to be unresolved in our final sample will subsequently be observed with VLBI. Comparing those sources resolved with ATCA to the more compact sources resolved with VLBI will give a distribution of source sizes, helping to answer the question of whether all GPS/CSS sources grow to larger sizes.

  9. A dearth of OH/IR stars in the Small Magellanic Cloud

    NASA Astrophysics Data System (ADS)

    Goldman, Steven R.; van Loon, Jacco Th.; Gómez, José F.; Green, James A.; Zijlstra, Albert A.; Nanni, Ambra; Imai, Hiroshi; Whitelock, Patricia A.; Groenewegen, Martin A. T.; Oliveira, Joana M.

    2018-01-01

    We present the results of targeted observations and a survey of 1612-, 1665- and 1667-MHz circumstellar OH maser emission from asymptotic giant branch (AGB) stars and red supergiants (RSGs) in the Small Magellanic Cloud (SMC), using the Parkes and Australia Telescope Compact Array (ATCA) radio telescopes. No clear OH maser emission has been detected in any of our observations targeting luminous, long-period, large-amplitude variable stars, which have been confirmed spectroscopically and photometrically to be mid- to late-M spectral type. These observations have probed 3-4 times deeper than any OH maser survey in the SMC. Using a bootstrapping method with Large Magellanic Cloud (LMC) and Galactic OH/IR star samples and our SMC observation upper limits, we have calculated the likelihood of not detecting maser emission in any of the two sources considered to be the top maser candidates to be less than 0.05 per cent, assuming a similar pumping mechanism as the LMC and Galactic OH/IR sources. We have performed a population comparison of the Magellanic Clouds and used Spitzer IRAC and MIPS photometry to confirm that we have observed all high luminosity SMC sources that are expected to exhibit maser emission. We suspect that, compared to the OH/IR stars in the Galaxy and LMC, the reduction in metallicity may curtail the dusty wind phase at the end of the evolution of the most massive cool stars. We also suspect that the conditions in the circumstellar envelope change beyond a simple scaling of abundances and wind speed with metallicity.

  10. Deep Chandra observations of Pictor A

    NASA Astrophysics Data System (ADS)

    Hardcastle, M. J.; Lenc, E.; Birkinshaw, M.; Croston, J. H.; Goodger, J. L.; Marshall, H. L.; Perlman, E. S.; Siemiginowska, A.; Stawarz, Ł.; Worrall, D. M.

    2016-02-01

    We report on deep Chandra observations of the nearby broad-line radio galaxy Pictor A, which we combine with new Australia Telescope Compact Array (ATCA) observations. The new X-ray data have a factor of 4 more exposure than observations previously presented and span a 15 yr time baseline, allowing a detailed study of the spatial, temporal and spectral properties of the AGN, jet, hotspot and lobes. We present evidence for further time variation of the jet, though the flare that we reported in previous work remains the most significantly detected time-varying feature. We also confirm previous tentative evidence for a faint counterjet. Based on the radio through X-ray spectrum of the jet and its detailed spatial structure, and on the properties of the counterjet, we argue that inverse-Compton models can be conclusively rejected, and propose that the X-ray emission from the jet is synchrotron emission from particles accelerated in the boundary layer of a relativistic jet. For the first time, we find evidence that the bright western hotspot is also time-varying in X-rays, and we connect this to the small-scale structure in the hotspot seen in high-resolution radio observations. The new data allow us to confirm that the spectrum of the lobes is in good agreement with the predictions of an inverse-Compton model and we show that the data favour models in which the filaments seen in the radio images are predominantly the result of spatial variation of magnetic fields in the presence of a relatively uniform electron distribution.

  11. Fructose intake exacerbates the contractile response elicited by norepinephrine in mesenteric vascular bed of rats via increased endothelial prostanoids.

    PubMed

    Sousa, Glauciene J; Oliveira, Phablo Wendell C; Nogueira, Breno V; Melo, Antônio F; Faria, Thaís de Oliveira; Meira, Eduardo Frizera; Mill, José G; Bissoli, Nazaré S; Baldo, Marcelo P

    2017-10-01

    Chronic fructose intake induces major cardiovascular and metabolic disturbances and is associated with the development of hypertension due to changes in vascular function. We hypothesized that high fructose intake for 6 weeks would cause metabolic syndrome and lead to initial vascular dysfunction. Male Wistar rats were assigned to receive fructose (FRU, 10%) or drinking water (CON) for 6 weeks. Systolic blood pressure was evaluated by tail plethysmography. Fasting glucose, insulin and glucose tolerance were measured at the end of the follow-up. Mesenteric vascular bed reactivity was tested before and after pharmacological blockade. Western blot analysis was performed for iNOS, eNOS, Nox2 and COX-2. DHE staining was used for vascular superoxide anion detection. Vessel structure was evaluated by optical and electronic microscopy. Fructose intake did not alter blood pressure, but did increase visceral fat deposition and fasting glucose as well as impair insulin and glucose tolerance. Fructose increased NE-induced vasoconstriction compared with CON, and this difference was abrogated by indomethacin perfusion as well as endothelium removal. ACh-induced relaxation was preserved, and the NO modulation tested after L-NAME perfusion was similar between groups. SNP-induced relaxation was not altered. Inducible NOS was increased; however, there were no changes in eNOS, Nox2 or COX-2 protein expression. Basal or stimulated superoxide anion production was not changed by fructose intake. In conclusion, high fructose intake increased NE-induced vasoconstriction through the endothelial prostanoids even in the presence of a preserved endothelium-mediated relaxation. No major changes in vessel structure were detected. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    den Hollander, J.A.; Ugurbil, K.; Brown, T.R.

    Glucose metabolism was followed in suspensions of Saccharomyces cerevisiae by using 13C NMR and 14C radioactive labeling techniques and by Warburg manometer experiments. These experiments were performed for cells grown with various carbon sources in the growth medium, so as to evaluate the effect of catabolite repression. The rate of glucose utilization was most conveniently determined by the 13C NMR experiments, which measured the concentration of (1-13C)glucose, whereas the distribution of end products was determined from the 13C and the 14C experiments. By combining these measurements the flows into the various pathways that contribute to glucose catabolism were estimated, andmore » the effect of oxygen upon glucose catabolism was evaluated. From these measurements, the Pasteur quotient (PQ) for glucose catabolism was calculated to be 2.95 for acetate-grown cells and 1.89 for cells grown on glucose into saturation. The Warburg experiments provided an independent estimate of glucose catabolism. The PQ estimated from Warburg experiments was 2.9 for acetate-grown cells in excellent agreement with the labeled carbon experiments and 4.6 for cells grown into saturation, which did not agree. Possible explanations of these differences are discussed. From these data an estimate is obtained of the net flow through the Embden-Meyerhof-Parnas pathway. The backward flow through fructose-1,6-bisphosphatase (Fru-1,6-P2-ase) was calculated from the scrambling of the 13C label of (1-13C)glucose into the C1 and C6 positions of trehalose. Combining these data allowed us to calculate the net flux through phosphofructokinase (PFK). For acetate-grown cells we found that the relative flow through PFK is a factor of 1.7 faster anaerobically than aerobically.« less

  13. Sucrose biosynthesis in a prokaryotic organism: Presence of two sucrose-phosphate synthases in Anabaena with remarkable differences compared with the plant enzymes

    PubMed Central

    Porchia, Andrea C.; Salerno, Graciela L.

    1996-01-01

    Biosynthesis of sucrose-6-P catalyzed by sucrose-phosphate synthase (SPS), and the presence of sucrose-phosphate phosphatase (SPP) leading to the formation of sucrose, have both been ascertained in a prokaryotic organism: Anabaena 7119, a filamentous heterocystic cyanobacterium. Two SPS activities (SPS-I and SPS-II) were isolated by ion-exchange chromatography and partially purified. Four remarkable differences between SPSs from Anabaena and those from higher plants were shown: substrate specificity, effect of divalent cations, native molecular mass, and oligomeric composition. Both SPS-I and SPS-II accept Fru-6-P (Km for SPS-I = 0.8 ± 0.1 mM; Km for SPS-II = 0.7 ± 0.1 mM) and UDP-Glc as substrates (Km for SPS-I = 1.3 ± 0.4 mM; Km for SPS-II = 4.6 ± 0.4 mM), but unlike higher plant enzymes, they are not specific for UDP-Glc. GDP-Glc and TDP-Glc are also SPS-I substrates (Km for GDP-Glc = 1.2 ± 0.2 mM and Km for TDP-Glc = 4.0 ± 0.4 mM), and ADP-Glc is used by SPS-II (Km for ADP-Glc = 5.7 ± 0.7 mM). SPS-I has an absolute dependence toward divalent metal ions (Mg2+ or Mn2+) for catalytic activity, not found in plants. A strikingly smaller native molecular mass (between 45 and 47 kDa) was determined by gel filtration for both SPSs, which, when submitted to SDS/PAGE, showed a monomeric composition. Cyanobacteria are, as far as the authors know, the most primitive organisms that are able to biosynthesize sucrose as higher plants do. PMID:8942980

  14. Fatty Acid Oxidation Is Required for Myxococcus xanthus Development.

    PubMed

    Bullock, Hannah A; Shen, Huifeng; Boynton, Tye O; Shimkets, Lawrence J

    2018-05-15

    Myxococcus xanthus cells produce lipid bodies containing triacylglycerides during fruiting body development. Fatty acid β-oxidation is the most energy-efficient pathway for lipid body catabolism. In this study, we used mutants in fadJ (MXAN_5371 and MXAN_6987) and fadI (MXAN_5372) homologs to examine whether β-oxidation serves an essential developmental function. These mutants contained more lipid bodies than the wild-type strain DK1622 and 2-fold more flavin adenine dinucleotide (FAD), consistent with the reduced consumption of fatty acids by β-oxidation. The β-oxidation pathway mutants exhibited differences in fruiting body morphogenesis and produced spores with thinner coats and a greater susceptibility to thermal stress and UV radiation. The MXAN_5372/5371 operon is upregulated in sporulating cells, and its expression could not be detected in csgA , fruA , or mrpC mutants. Lipid bodies were found to persist in mature spores of DK1622 and wild strain DK851, suggesting that the roles of lipid bodies and β-oxidation may extend to spore germination. IMPORTANCE Lipid bodies act as a reserve of triacylglycerides for use when other sources of carbon and energy become scarce. β-Oxidation is essential for the efficient metabolism of fatty acids associated with triacylglycerides. Indeed, the disruption of genes in this pathway has been associated with severe disorders in animals and plants. Myxococcus xanthus , a model organism for the study of development, is ideal for investigating the complex effects of altered lipid metabolism on cell physiology. Here, we show that β-oxidation is used to consume fatty acids associated with lipid bodies and that the disruption of the β-oxidation pathway is detrimental to multicellular morphogenesis and spore formation. Copyright © 2018 American Society for Microbiology.

  15. Fresh from the Ornamental Garden: Hips of Selected Rose Cultivars Rich in Phytonutrients.

    PubMed

    Cunja, Vlasta; Mikulic-Petkovsek, Maja; Weber, Nika; Jakopic, Jerneja; Zupan, Anka; Veberic, Robert; Stampar, Franci; Schmitzer, Valentina

    2016-02-01

    Morphological parameters (size, weight, color), the content of sugars, organic acids, lycopene, β-carotene, and phenolics were determined in hips of Rosa canina (RCA), Rosa sweginzowii (RSW), Rosa rugosa (RUG), and selected ornamental Rosa cultivars Fru Dagmar Hastrup (FDH), Repandia (REP), Veilchenblau (RVB), Aloha (RAL), Bonica (BON), and Golden Gate (RGG). Although traditionally used RCA hips contained the highest amount of cyanidin-3-glucoside (83 μg/g DW) and were the reddest (h° = 17.5), they did not stand out in other analyzed parameters. RGG climber had the biggest hips (8.86 g), which also contained highest sugar levels (50.9 g/100 g DW). RAL stood out as the cultivar rich in organic acids (33.9 g/100 g DW), mainly because of high quinic acid content (17.6 g/100g DW). FDH and RSW hips were characterized by particularly high ascorbic acid levels (4325 mg/100 g DW and 4711 mg/100 g DW). Other ornamental cultivars contained low amounts of ascorbic acid compared to the analyzed species. The phenolic profile was species/cultivars-specific. The greatest diversity of phenolic compounds was detected in RUG and FDH hips (55 and 54 different tentatively identified compounds with HPLC/MS). Flavanols represented the main phenolic class in most of the investigated species/cultivars and RGG hips contained the highest amount of catechin and proanthocyandin derivatives (15855 μg/g DW). Altogether RAL hips contained the highest quantity of phenolics (44746 μg/g DW) mainly due to high levels of hydrolysable tannins compared to other species/cultivars. Although small, hips of BON and REP were most abundant regarding β-carotene and lycopene content, respectively. © 2016 Institute of Food Technologists®

  16. A constitutive pan-hexose permease for the Plasmodium life cycle and transgenic models for screening of antimalarial sugar analogs.

    PubMed

    Blume, Martin; Hliscs, Marion; Rodriguez-Contreras, Dayana; Sanchez, Marco; Landfear, Scott; Lucius, Richard; Matuschewski, Kai; Gupta, Nishith

    2011-04-01

    Glucose is considered essential for erythrocytic stages of the malaria parasite, Plasmodium falciparum. Importance of sugar and its permease for hepatic and sexual stages of Plasmodium, however, remains elusive. Moreover, increasing global resistance to current antimalarials necessitates the search for novel drugs. Here, we reveal that hexose transporter 1 (HT1) of Plasmodium berghei can transport glucose (K(m)~87 μM), mannose (K(i)~93 μM), fructose (K(i)~0.54 mM), and galactose (K(i)~5 mM) in Leishmania mexicana mutant and Xenopus laevis; and, therefore, is functionally equivalent to HT1 of P. falciparum (Glc, K(m)~175 μM; Man, K(i)~276 μM; Fru, K(i)~1.25 mM; Gal, K(i)~5.86 mM). Notably, a glucose analog, C3361, attenuated hepatic (IC(50)~15 μM) and ookinete development of P. berghei. The PbHT1 could be ablated during intraerythrocytic stages only by concurrent complementation with PbHT1-HA or PfHT1. Together; these results signify that PbHT1 and glucose are required for the entire life cycle of P. berghei. Accordingly, PbHT1 is expressed in the plasma membrane during all parasite stages. To permit a high-throughput screening of PfHT1 inhibitors and their subsequent in vivo assessment, we have generated Saccharomyces cerevisiae mutant expressing codon-optimized PfHT1, and a PfHT1-dependent Δpbht1 parasite strain. This work provides a platform to facilitate the development of drugs against malaria, and it suggests a disease-control aspect by reducing parasite transmission.

  17. Discovery of Salmonella Virulence Factors Translocated via Outer Membrane Vesicles to Murine Macrophages.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoon, Hyunjin; Ansong, Charles; Adkins, Joshua N.

    We have previously shown that the regulators SpvR, FruR, IHF, PhoP/PhoQ, SsrA/SsrB, SlyA, Hnr, RpoE, SmpB, CsrA, RpoS, Crp, OmpR/EnvZ, and Hfq are essential for Salmonella Typhimurium virulence in mice. Here we use quantitative LC-MS-based proteomics profiling of in-frame deletion mutants of these 14 regulators to identify proteins that are coordinately regulated by these virulence regulators and are thus presumably novel factors contributing to Salmonella pathogenesis. Putative candidate proteins from proteomics analysis were determined, which exhibited similar abundance profiles to those of Salmonella pathogenicity island (SPI)-2 type III secretion system (TTSS) proteins. A subset of 5 proteins including STM0082, STM1548,more » PdgL, STM1633, and STM3595 was selected for further analysis. All 5 proteins were expressed inside macrophage cells and STM0082 (SrfN) was secreted into host cytoplasm. Furthermore, deletion of STM0082 attenuated virulence in mice when administered intraperitoneally as determined by competitive index. srfN transcription was positively regulated by SsrAB, however, secretion was independent of SPI-2 TTSS as well as SPI-1 TTSS and flagella. Proteins including PagK and STM2585A, which are positively regulated by PhoP/PhoQ, have sec signal peptides as predicted for SrfN and were secreted into macrophage cytoplasm regardless of SPI-2 TTSS. Isolation of outer membrane vesicles (OMVs) revealed the presence of SrfN, PagK, and STM2585A inside vesicle compartments. This result is the first case showing delivery of virulence effectors via OMVs in S. Typhimurium. Moreover, Hfq regulation of SrfN translation suggests that small non-coding RNAs may be responsible for regulating effector protein expression.« less

  18. The Implementation of Managed Entry Agreements in Central and Eastern Europe: Findings and Implications.

    PubMed

    Ferrario, Alessandra; Arāja, Diāna; Bochenek, Tomasz; Čatić, Tarik; Dankó, Dávid; Dimitrova, Maria; Fürst, Jurij; Greičiūtė-Kuprijanov, Ieva; Hoxha, Iris; Jakupi, Arianit; Laidmäe, Erki; Löblová, Olga; Mardare, Ileana; Markovic-Pekovic, Vanda; Meshkov, Dmitry; Novakovic, Tanja; Petrova, Guenka; Pomorski, Maciej; Tomek, Dominik; Voncina, Luka; Haycox, Alan; Kanavos, Panos; Vella Bonanno, Patricia; Godman, Brian

    2017-12-01

    Managed entry agreements (MEAs) are a set of instruments to facilitate access to new medicines. This study surveyed the implementation of MEAs in Central and Eastern Europe (CEE) where limited comparative information is currently available. We conducted a survey on the implementation of MEAs in CEE between January and March 2017. Sixteen countries participated in this study. Across five countries with available data on the number of different MEA instruments implemented, the most common MEAs implemented were confidential discounts (n = 495, 73%), followed by paybacks (n = 92, 14%), price-volume agreements (n = 37, 5%), free doses (n = 25, 4%), bundle and other agreements (n = 19, 3%), and payment by result (n = 10, >1%). Across seven countries with data on MEAs by therapeutic group, the highest number of brand names associated with one or more MEA instruments belonged to the Anatomical Therapeutic Chemical (ATC)-L group, antineoplastic and immunomodulating agents (n = 201, 31%). The second most frequent therapeutic group for MEA implementation was ATC-A, alimentary tract and metabolism (n = 87, 13%), followed by medicines for neurological conditions (n = 83, 13%). Experience in implementing MEAs varied substantially across the region and there is considerable scope for greater transparency, sharing experiences and mutual learning. European citizens, authorities and industry should ask themselves whether, within publicly funded health systems, confidential discounts can still be tolerated, particularly when it is not clear which country and party they are really benefiting. Furthermore, if MEAs are to improve access, countries should establish clear objectives for their implementation and a monitoring framework to measure their performance, as well as the burden of implementation.

  19. ALMA OBSERVATIONS OF THE COLDEST PLACE IN THE UNIVERSE: THE BOOMERANG NEBULA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sahai, R.; Vlemmings, W. H. T.; Huggins, P. J.

    The Boomerang Nebula is the coldest known object in the universe, and an extreme member of the class of pre-planetary nebulae, objects which represent a short-lived transitional phase between the asymptotic giant branch and planetary nebula evolutionary stages. Previous single-dish CO (J = 1-0) observations (with a 45'' beam) showed that the high-speed outflow in this object has cooled to a temperature significantly below the temperature of the cosmic background radiation. Here we report the first observations of the Boomerang Nebula with ALMA in the CO J = 2-1 and J = 1-0 lines to resolve the structure of thismore » ultra-cold nebula. We find a central hourglass-shaped nebula surrounded by a patchy, but roughly round, cold high-velocity outflow. We compare the ALMA data with visible-light images obtained with the Hubble Space Telescope and confirm that the limb-brightened bipolar lobes seen in these data represent hollow cavities with dense walls of molecular gas and dust producing both the molecular-emission-line and scattered-light structures seen at millimeter and visible wavelengths. The large diffuse biconical shape of the nebula seen in the visible wavelength range is likely due to preferential illumination of the cold, high-velocity outflow. We find a compact source of millimeter-wave continuum in the nebular waist—these data, together with sensitive upper limits on the radio continuum using observations with ATCA, indicate the presence of a substantial mass of very large (millimeter-sized) grains in the waist of the nebula. Another unanticipated result is the detection of CO emission regions beyond the ultra-cold region which indicate the re-warming of the cold gas, most likely due to photoelectric grain heating.« less

  20. Photonics applications and web engineering: WILGA Winter 2016

    NASA Astrophysics Data System (ADS)

    Romaniuk, Ryszard S.

    2016-09-01

    Since twenty years, young researchers form the Institute of Electronic Systems, Warsaw University of Technology, organize two times a year, under only a marginal supervision of the senior faculty members, under the patronage of WEiTI PW, KEiT PAN, SPIE, IEEE, PKOpto SEP and PSF, the WILGA Symposium on advanced, integrated functional electronic, photonic and mechatronic systems [1-5]. All aspects are considered like: research and development, theory and design, technology - material and construction, software and hardware, commissioning and tests, as well as pilot and practical applications. The applications concern mostly, which turned after several years to be a proud specialization of the WILGA Symposium, Internet engineering, high energy physics experiments, new power industry including fusion, nuclear industry, space and satellite technologies, telecommunications, smart municipal environment, as well as biology and medicine [6-8]. XXXVIIth WILGA Symposium was held on 29-31 January 2016 and gathered a few tens of young researchers active in the mentioned research areas. There were presented a few tens of technical papers which will be published in Proc.SPIE together with the accepted articles from the Summer Edition of the WILGA Symposium scheduled for 29.05-06.06.2016. This article is a digest of chosen presentations from WILGA Symposium 2016 Winter Edition. The survey is narrowed to a few chosen and main topical tracks, like electronics and photonics design using industrial standards like ATCA/MTCA, also particular designs of functional systems using this series of industrial standards. The paper, summarizing traditionally since many years the accomplished WILGA Symposium organized by young researchers from Warsaw University of Technology, is also the following part of a cycle of papers concerning their participation in design of new generations of electronic systems used in discovery experiments in Poland and in leading research laboratories of the world.

  1. Network analysis of global tobacco control collaboration: data from the World Conference on Tobacco or Health (WCTOH).

    PubMed

    Leischow, Scott J; Okamoto, Janet; McIntosh, Scott; Ossip, Deborah J; Lando, Harry A

    2017-04-20

    The World Conference on Tobacco or Health (WCTOH) is held every three years to foster communication and collaboration on global tobacco control. Very little is known about the nature of interactions between WCTOH attendees and their linkages to tobacco control organizations, so knowing this information could help improve tobacco control efforts. At the 2015 WCTOH, we implemented an online survey to assess barriers to global tobacco control activities, which information sources they use for tobacco control information, and with whom they interact regarding tobacco control. A total of 169 respondents completed the survey, with responses from all six World Health Organization (WHO) regions. Respondents worked in all areas of tobacco control; the most common were research (29.2%) and patient care/treatment (23.3%). The top barriers faced regarding tobacco control activities were: funding is weak (56.8%), government commitment (45.0%), tobacco industry interference (43.8%), and lack of coordination (34.3%). The network analysis identified Framework Convention Alliance (FCA) and Society for Research on Nicotine and Tobacco (SRNT) as the two most prominent groups that people belonged to and where they went to exchange information and best practices. Important regional and country specific groups also appear to be growing, such as the African Tobacco Control Alliance (ATCA) and the Argentinian Association of Tabacology (ASAT). Mapping and better understanding the global tobacco control network is important for informing knowledge exchange and best practices, particularly as increasing attention is being focused on global tobacco control efforts in low- and middle-income countries in particular. The present study demonstrates that even a subsample of the WCTOH shows considerable collaboration. The full WCTOH network should be mapped in order to foster greater collaboration that has the the potential to improve global tobacco control efforts.

  2. Standardized Solution for Management Controller for MTCA.4

    NASA Astrophysics Data System (ADS)

    Makowski, D.; Fenner, M.; Ludwig, F.; Mavrič, U.; Mielczarek, A.; Napieralski, A.; Perek, P.; Schlarb, H.

    2015-06-01

    The Micro Telecommunications Computing Architecture (MTCA) standard is a modern platform that is gaining popularity in the area of High Energy Physics (HEP) experiments. The standard provides extensive management, monitoring and diagnostics functionalities. The hardware control and monitoring is based on the Intelligent Platform Management Interface (IPMI), that was initially developed for supervision of complex computers operation. The original IPMI specification was extended to support functions required by the MTCA specification. The Module Management Controller (MMC) is required on each Advanced Mezzanine Card (AMC) installed in MTCA chassis. The Rear Transition Modules (RTMs) have to be equipped with RTM Management Controllers (RMCs) which is required by the MTCA.4 subsidiary specification. The commercially available implementations of MMC and RMC are expensive and do not provide the complete functionality that is required by specific HEP applications. Therefore, many research centers and commercial companies work on their own implementation of AMC and RTM controllers. The available implementations suffer because of lack of common approach and interoperability problems. Since both Lodz University of Technology (TUL) and Deutsches Elektronen-Synchrotron (DESY) have long-term experience in developing ATCA and MTCA hardware, the authors decided to develop a unified solution of management controller fully compliant with AMC and MTCA.4 standards. The MMC v1.00 solution is dedicated for management of AMC and RTM modules. The MMC v1.00 is based on Atmel ATxmega MCUs and can be fully customized by the user or used as a drop-in-module without any modifications. The paper discusses the functionality of the MMC v1.00 solution. The implementation was verified with developed evaluation kits for AMC and RTM cards.

  3. ALMA Observations of the Coldest Place in the Universe: The Boomerang Nebula

    NASA Astrophysics Data System (ADS)

    Sahai, R.; Vlemmings, W. H. T.; Huggins, P. J.; Nyman, L.-Å.; Gonidakis, I.

    2013-11-01

    The Boomerang Nebula is the coldest known object in the universe, and an extreme member of the class of pre-planetary nebulae, objects which represent a short-lived transitional phase between the asymptotic giant branch and planetary nebula evolutionary stages. Previous single-dish CO (J = 1-0) observations (with a 45'' beam) showed that the high-speed outflow in this object has cooled to a temperature significantly below the temperature of the cosmic background radiation. Here we report the first observations of the Boomerang Nebula with ALMA in the CO J = 2-1 and J = 1-0 lines to resolve the structure of this ultra-cold nebula. We find a central hourglass-shaped nebula surrounded by a patchy, but roughly round, cold high-velocity outflow. We compare the ALMA data with visible-light images obtained with the Hubble Space Telescope and confirm that the limb-brightened bipolar lobes seen in these data represent hollow cavities with dense walls of molecular gas and dust producing both the molecular-emission-line and scattered-light structures seen at millimeter and visible wavelengths. The large diffuse biconical shape of the nebula seen in the visible wavelength range is likely due to preferential illumination of the cold, high-velocity outflow. We find a compact source of millimeter-wave continuum in the nebular waist—these data, together with sensitive upper limits on the radio continuum using observations with ATCA, indicate the presence of a substantial mass of very large (millimeter-sized) grains in the waist of the nebula. Another unanticipated result is the detection of CO emission regions beyond the ultra-cold region which indicate the re-warming of the cold gas, most likely due to photoelectric grain heating.

  4. An Extreme Protocluster of Luminous Dusty Starbursts in the Early Universe

    NASA Astrophysics Data System (ADS)

    Oteo, I.; Ivison, R. J.; Dunne, L.; Manilla-Robles, A.; Maddox, S.; Lewis, A. J. R.; de Zotti, G.; Bremer, M.; Clements, D. L.; Cooray, A.; Dannerbauer, H.; Eales, S.; Greenslade, J.; Omont, A.; Perez–Fournón, I.; Riechers, D.; Scott, D.; van der Werf, P.; Weiss, A.; Zhang, Z.-Y.

    2018-03-01

    We report the identification of an extreme protocluster of galaxies in the early universe whose core (nicknamed Distant Red Core, DRC, because of its very red color in Herschel SPIRE bands) is formed by at least 10 dusty star-forming galaxies (DSFGs), spectroscopically confirmed to lie at {z}spec}=4.002 via detection of [C I](1–0), 12CO(6–5), 12CO(4–3), 12CO(2–1), and {{{H}}}2{{O}}({2}11{--}{2}02) emission lines with ALMA and ATCA. These DSFGs are distributed over a 260 {kpc}× 310 {kpc} region and have a collective obscured star formation rate (SFR) of ∼ 6500 {M}ȯ {yr}}-1, considerably higher than those seen before in any protocluster at z≳ 4. Most of the star formation is taking place in luminous DSFGs since no Lyα emitters are detected in the protocluster core, apart from a Lyα blob located next to one of the DRC components, extending over 60 {kpc}. The total obscured SFR of the protocluster could rise to {SFR}∼ {{14,400}} {M}ȯ {yr}}-1 if all the members of an overdensity of bright DSFGs discovered around DRC in a wide-field Large APEX BOlometer CAmera 870 μm image are part of the same structure. [C I](1–0) emission reveals that DRC has a total molecular gas mass of at least {M}{{{H}}2}∼ 6.6× {10}11 {M}ȯ , and its total halo mass could be as high as ∼ 4.4× {10}13 {M}ȯ , indicating that it is the likely progenitor of a cluster at least as massive as Coma at z = 0.

  5. THE RADIO/GAMMA-RAY CONNECTION IN ACTIVE GALACTIC NUCLEI IN THE ERA OF THE FERMI LARGE AREA TELESCOPE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ackermann, M.; Ajello, M.; Allafort, A.

    We present a detailed statistical analysis of the correlation between radio and gamma-ray emission of the active galactic nuclei (AGNs) detected by Fermi during its first year of operation, with the largest data sets ever used for this purpose. We use both archival interferometric 8.4 GHz data (from the Very Large Array and ATCA, for the full sample of 599 sources) and concurrent single-dish 15 GHz measurements from the Owens Valley Radio Observatory (OVRO, for a sub sample of 199 objects). Our unprecedentedly large sample permits us to assess with high accuracy the statistical significance of the correlation, using amore » surrogate data method designed to simultaneously account for common-distance bias and the effect of a limited dynamical range in the observed quantities. We find that the statistical significance of a positive correlation between the centimeter radio and the broadband (E > 100 MeV) gamma-ray energy flux is very high for the whole AGN sample, with a probability of <10{sup -7} for the correlation appearing by chance. Using the OVRO data, we find that concurrent data improve the significance of the correlation from 1.6 x 10{sup -6} to 9.0 x 10{sup -8}. Our large sample size allows us to study the dependence of correlation strength and significance on specific source types and gamma-ray energy band. We find that the correlation is very significant (chance probability < 10{sup -7}) for both flat spectrum radio quasars and BL Lac objects separately; a dependence of the correlation strength on the considered gamma-ray energy band is also present, but additional data will be necessary to constrain its significance.« less

  6. The radio/gamma-ray connection in active galactic nuclei in the era of the Fermi Large Area Telescope

    DOE PAGES

    Ackermann, M.; Ajello, M.; Allafort, A.; ...

    2011-10-12

    We present a detailed statistical analysis of the correlation between radio and gamma-ray emission of the active galactic nuclei (AGNs) detected by Fermi during its first year of operation, with the largest data sets ever used for this purpose. We use both archival interferometric 8.4 GHz data (from the Very Large Array and ATCA, for the full sample of 599 sources) and concurrent single-dish 15 GHz measurements from the Owens Valley Radio Observatory (OVRO, for a sub sample of 199 objects). Our unprecedentedly large sample permits us to assess with high accuracy the statistical significance of the correlation, using amore » surrogate data method designed to simultaneously account for common-distance bias and the effect of a limited dynamical range in the observed quantities. We find that the statistical significance of a positive correlation between the centimeter radio and the broadband (E > 100 MeV) gamma-ray energy flux is very high for the whole AGN sample, with a probability of <10 –7 for the correlation appearing by chance. Using the OVRO data, we find that concurrent data improve the significance of the correlation from 1.6 × 10 –6 to 9.0 × 10 –8. Our large sample size allows us to study the dependence of correlation strength and significance on specific source types and gamma-ray energy band. As a result, we find that the correlation is very significant (chance probability < 10 –7) for both flat spectrum radio quasars and BL Lac objects separately; a dependence of the correlation strength on the considered gamma-ray energy band is also present, but additional data will be necessary to constrain its significance.« less

  7. The Radio/Gamma-Ray Connection in Active Galactic Nuclei in the Era of the Fermi Large Area Telescope

    NASA Technical Reports Server (NTRS)

    Ackermann, M.; Ajello, M.; Allafort, A.; Angelakis, E.; Axelsson, M.; Baldini, L.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Bellazzini, R.; hide

    2011-01-01

    We present a detailed statistical analysis of the correlation between radio and gamma-ray emission of the active galactic nuclei (AGNs) detected by Fermi during its first year of operation, with the largest data sets ever used for this purpose.We use both archival interferometric 8.4 GHz data (from the Very Large Array and ATCA, for the full sample of 599 sources) and concurrent single-dish 15 GHz measurements from the OwensValley RadioObservatory (OVRO, for a sub sample of 199 objects). Our unprecedentedly large sample permits us to assess with high accuracy the statistical significance of the correlation, using a surrogate data method designed to simultaneously account for common-distance bias and the effect of a limited dynamical range in the observed quantities. We find that the statistical significance of a positive correlation between the centimeter radio and the broadband (E > 100 MeV) gamma-ray energy flux is very high for the whole AGN sample, with a probability of <10(exp -7) for the correlation appearing by chance. Using the OVRO data, we find that concurrent data improve the significance of the correlation from 1.6 10(exp -6) to 9.0 10(exp -8). Our large sample size allows us to study the dependence of correlation strength and significance on specific source types and gamma-ray energy band. We find that the correlation is very significant (chance probability < 10(exp -7)) for both flat spectrum radio quasars and BL Lac objects separately; a dependence of the correlation strength on the considered gamma-ray energy band is also present, but additional data will be necessary to constrain its significance.

  8. Maternal provision of transformer-2 is required for female development and embryo viability in the wasp Nasonia vitripennis.

    PubMed

    Geuverink, Elzemiek; Rensink, Anna H; Rondeel, Inge; Beukeboom, Leo W; van de Zande, Louis; Verhulst, Eveline C

    2017-11-01

    In insect sex determination a primary signal starts the genetic sex determination cascade that, in most insect orders, is subsequently transduced down the cascade by a transformer (tra) ortholog. Only a female-specifically spliced tra mRNA yields a functional TRA-protein that forms a complex with TRA2, encoded by a transformer-2 (tra2) ortholog, to act as a sex specific splicing regulator of the downstream transcription factors doublesex (dsx) and fruitless (fru). Here, we identify the tra2 ortholog of the haplodiploid parasitoid wasp N. vitripennis (Nv-tra2) and confirm its function in N. vitripennis sex determination. Knock down of Nv-tra2 by parental RNA interference (pRNAi) results in complete sex reversal of diploid offspring from female to male, indicating the requirement of Nv-tra2 for female sex determination. As Nv-tra2 pRNAi leads to frequent lethality in early developmental stages, maternal provision of Nv-tra2 transcripts is apparently also required for another, non-sex determining function during embryogenesis. In addition, lethality following Nv-tra2 pRNAi appears more pronounced in diploid than in haploid offspring. This diploid lethal effect was also observed following Nv-tra pRNAi, which served as a positive control in our experiments. As diploid embryos from fertilized eggs have a paternal chromosome set in addition to the maternal one, this suggests that either the presence of this paternal chromosome set or the dosage effect resulting from the diploid state is incompatible with the induced male development in N. vitripennis caused by either Nv-tra2 or Nv-tra pRNAi. The role of Nv-tra2 in activating the female sex determination pathway yields more insight into the sex determination mechanism of Nasonia. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Stannous Fluoride Effects on Gene Expression of Streptococcus mutans and Actinomyces viscosus.

    PubMed

    Shi, Y; Li, R; White, D J; Biesbrock, A R

    2018-02-01

    A genome-wide transcriptional analysis was performed to elucidate the bacterial cellular response of Streptococcus mutans and Actinomyces viscosus to NaF and SnF 2 . The minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) of SnF 2 were predetermined before microarray study. Gene expression profiling microarray experiments were carried out in the absence (control) and presence (experimental) of 10 ppm and 100 ppm Sn 2+ (in the form of SnF 2 ) and fluoride controls for 10-min exposures (4 biological replicates/treatment). These Sn 2+ levels and treatment time were chosen because they have been shown to slow bacterial growth of S. mutans (10 ppm) and A. viscosus (100 ppm) without affecting cell viability. All data generated by microarray experiments were analyzed with bioinformatics tools by applying the following criteria: 1) a q value should be ≤0.05, and 2) an absolute fold change in transcript level should be ≥1.5. Microarray results showed SnF 2 significantly inhibited several genes encoding enzymes of the galactose pathway upon a 10-min exposure versus a negative control: lacA and lacB (A and B subunits of the galactose-6-P isomerase), lacC (tagatose-6-P kinase), lacD (tagatose-1,6-bP adolase), galK (galactokinase), galT (galactose-1-phosphate uridylyltransferase), and galE (UDP-glucose 4-epimerase). A gene fruK encoding fructose-1-phosphate kinase in the fructose pathway was also significantly inhibited. Several genes encoding fructose/mannose-specific enzyme IIABC components in the phosphotransferase system (PTS) were also downregulated, as was ldh encoding lactate dehydrogenase, a key enzyme involved in lactic acid synthesis. SnF 2 downregulated the transcription of most key enzyme genes involved in the galactose pathway and also suppressed several key genes involved in the PTS, which transports sugars into the cell in the first step of glycolysis.

  10. Manninotriose is a major carbohydrate in red deadnettle (Lamium purpureum, Lamiaceae)

    PubMed Central

    dos Santos, Raquel; Vergauwen, Rudy; Pacolet, Pieter; Lescrinier, Eveline; Van den Ende, Wim

    2013-01-01

    Background and Aims There is a great need to search for natural compounds with superior prebiotic, antioxidant and immunostimulatory properties for use in (food) applications. Raffinose family oligosaccharides (RFOs) show such properties. Moreover, they contribute to stress tolerance in plants, acting as putative membrane stabilizers, antioxidants and signalling agents. Methods A large-scale soluble carbohydrate screening was performed within the plant kingdom. An unknown compound accumulated to a high extent in early-spring red deadnettle (Lamium purpureum) but not in other RFO plants. The compound was purified and its structure was unravelled with NMR. Organs and organ parts of red deadnettle were carefully dissected and analysed for soluble sugars. Phloem sap content was analysed by a common EDTA-based method. Key Results Early-spring red deadnettle stems and roots accumulate high concentrations of the reducing trisaccharide manninotriose (Galα1,6Galα1,6Glc), a derivative of the non-reducing RFO stachyose (Galα1,6Galα1,6Glcα1,2βFru). Detailed soluble carbohydrate analyses on dissected stem and leaf sections, together with phloem sap analyses, strongly suggest that stachyose is the main transport compound, but extensive hydrolysis of stachyose to manninotriose seems to occur along the transport path. Based on the specificities of the observed carbohydrate dynamics, the putative physiological roles of manninotriose in red deadnettle are discussed. Conclusions It is demonstrated for the first time that manninotriose is a novel and important player in the RFO metabolism of red dead deadnettle. It is proposed that manninotriose represents a temporary storage carbohydrate in early-spring deadnettle, at the same time perhaps functioning as a membrane protector and/or as an antioxidant in the vicinity of membranes, as recently suggested for other RFOs and fructans. This novel finding urges further research on this peculiar carbohydrate on a broader array of RFO accumulators. PMID:23264235

  11. PKS 2123-463: A Confirmed Gamma-ray Blazar at High Redshift

    NASA Technical Reports Server (NTRS)

    DAmmando, F.; Rau, A.; Schady, P.; Finke, J.; Orienti, M.; Greiner, J.; Kann, D. A.; Ojha, R.; Foley, A. R.; Stevens, J.; hide

    2012-01-01

    The flat spectrum radio quasar (FSRQ) PKS 2123-463 was associated in the First Fermi-LAT source catalog with the gamma-ray source 1FGL J2126.1-4603, but when considering the full first two years of Fermi observations, no gamma-ray source at a position consistent with this FSRQ was detected, and thus PKS 2123-463 was not reported in the Second Fermi-LAT source catalog. On 2011 December 14 a gamma-ray source positionally consistent with PKS 2123-463 was detected in flaring activity by Fermi-LAT. This activity triggered radio-to-X-ray observations by the Swift, GROND, ATCA, Ceduna, and KAT-7 observatories. Results of the localization of the gamma-ray source over 41 months of Fermi-LAT operation are reported here in conjunction with the results of the analysis of radio, optical, UV and X-ray data collected soon after the gamma-ray flare. The strict spatial association with the lower energy counterpart together with a simultaneous increase of the activity in optical, UV, X-ray and gamma-ray bands led to a firm identification of the gamma-ray source with PKS 2123-463. A new photometric redshift has been estimated as z = 1.46 +/- 0.05 using GROND and Swift/UVOT observations, in rough agreement with the disputed spectroscopic redshift of z = 1.67. We fit the broadband spectral energy distribution with a synchrotron/external Compton model. We find that a thermal disk component is necessary to explain the optical/UV emis- sion detected by Swift/UVOT. This disk has a luminosity of 1.8x1046 erg s-1, and a fit to the disk emission assuming a Schwarzschild (i.e., nonrotating) black hole gives a mass of 2 x 109 M(solar mass). This is the first black hole mass estimate for this source.

  12. ATCA survey of ammonia in the galactic center: The temperatures of dense gas clumps between Sgr A* and Sgr B2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ott, Jürgen; Weiß, Axel; Henkel, Christian

    We present a large-scale, interferometric survey of ammonia (1, 1) and (2, 2) toward the Galactic center observed with the Australia Telescope Compact Array. The survey covers Δℓ ∼ 1° (∼150 pc at an assumed distance of 8.5 kpc) and Δb ∼ 0.°2 (∼30 pc) which spans the region between the supermassive black hole Sgr A* and the massive star forming region Sgr B2. The resolution is ∼20'' (∼0.8 pc) and emission at scales ≳ 2' (≳ 3.2 pc) is filtered out due to missing interferometric short spacings. Consequently, the data represent the denser, compact clouds and disregards the large-scale,more » diffuse gas. Many of the clumps align with the 100 pc dust ring and mostly anti-correlate with 1.2 cm continuum emission. We present a kinetic temperature map of the dense gas. The temperature distribution peaks at ∼38 K with a width at half maximum between 18 K and 61 K (measurements sensitive within T {sub kin} ∼ 10-80 K). Larger clumps are on average warmer than smaller clumps which suggests internal heating sources. Our observations indicate that the circumnuclear disk ∼1.5 pc around Sgr A* is supplied with gas from the 20 km s{sup –1} molecular cloud. This gas is substantially cooler than gas ∼3-15 pc away from Sgr A*. We find a strong temperature gradient across Sgr B2. Ammonia column densities correlate well with SCUBA 850 μm fluxes, but the relation is shifted from the origin, which may indicate a requirement for a minimum amount of dust to form and shield ammonia. Around the Arches and Quintuplet clusters we find shell morphologies with UV-influenced gas in their centers, followed by ammonia and radio continuum layers.« less

  13. NGC 3503 and its molecular environment

    NASA Astrophysics Data System (ADS)

    Duronea, N. U.; Vasquez, J.; Cappa, C. E.; Corti, M.; Arnal, E. M.

    2012-01-01

    Aims: We present a study of the molecular gas and interstellar dust distribution in the environs of the Hii region NGC 3503 associated with the open cluster Pis 17 with the aim of investigating the spatial distribution of the molecular gas linked to the nebula and achieving a better understanding of the interaction of the nebula and Pis 17 with their molecular environment. Methods: We based our study on 12CO(1-0) observations of a region of ~0.6° in size obtained with the 4-m NANTEN telescope, unpublished radio continuum data at 4800 and 8640 MHz obtained with the ATCA telescope, radio continuum data at 843 MHz obtained from SUMSS, and available IRAS, MSX, IRAC-GLIMPSE, and MIPSGAL images. Results: We found a molecular cloud (Component 1) having a mean velocity of -24.7 km s-1 ,compatible with the velocity of the ionized gas, which is associated with the nebula and its surroundings. Adopting a distance of 2.9 ± 0.4 kpc, the total molecular mass yields (7.6 ± 2.1) × 103M⊙ and density yields 400 ± 240 cm-3. The radio continuum data confirm the existence of an electron density gradient in NGC 3503. The IR emission shows a PDR bordering the higher density regions of the nebula. The spatial distribution of the CO emission shows that the nebula coincides with a molecular clump, and the strongest CO emission peak is located close to the higher electron density region. The more negative velocities of the molecular gas (about -27 km s-1), are coincident with NGC 3503. Candidate young stellar objects (YSOs) were detected toward the Hii region, suggesting that embedded star formation may be occurring in the neighborhood of the nebula. The clear electron density gradient, along with the spatial distribution of the molecular gas and PAHs in the region indicates that NGC 3503 is a blister-type Hii region that has probably undergone a champagne phase.

  14. The Gamma-Ray Emitting Radio-Loud Narrow-Line Seyfert 1 Galaxy PKS 2004-447 II. The Radio View

    NASA Technical Reports Server (NTRS)

    Schulz, R.; Kreikenbohm, A.; Kadler, M.; Ojha, R.; Ros, E.; Stevens, J.; Edwards, P. G.; Carpenter, B.; Elsaesser, D.; Gehrels, N.; hide

    2016-01-01

    Context. gamma-ray-detected radio-loud narrow-line Seyfert 1 (gamma-NLS1) galaxies constitute a small but interesting sample of the gamma-ray-loud AGN. The radio-loudest gamma-NLS1 known, PKS2004447, is located in the southern hemisphere and is monitored in the radio regime by the multiwavelength monitoring programme TANAMI. Aims. We aim for the first detailed study of the radio morphology and long-term radio spectral evolution of PKS2004447, which are essential for understanding the diversity of the radio properties of gamma-NLS1s. Methods. The TANAMI VLBI monitoring program uses the Australian Long Baseline Array (LBA) and telescopes in Antarctica, Chile, New Zealand, and South Africa to monitor the jets of radio-loud active galaxies in the southern hemisphere. Lower resolution radio flux density measurements at multiple radio frequencies over four years of observations were obtained with the Australia Telescope Compact Array (ATCA). Results. The TANAMI VLBI image at 8.4GHz shows an extended one-sided jet with a dominant compact VLBI core. Its brightness temperature is consistent with equipartition, but it is an order of magnitude below other gamma-NLS1s with the sample value varying over two orders of magnitude. We find a compact morphology with a projected large-scale size 11 kpc and a persistent steep radio spectrum with moderate flux-density variability. Conclusions. PKS2004447 appears to be a unique member of the gamma-NLS1 sample. It exhibits blazar-like features, such as a flat featureless X-ray spectrum and a core-dominated, one-sided parsec-scale jet with indications for relativistic beaming. However, the data also reveal properties atypical for blazars, such as a radio spectrum and large-scale size consistent with compact-steep-spectrum (CSS) objects, which are usually associated with young radio sources. These characteristics are unique among all gamma-NLS1s and extremely rare among gamma-ray-loud AGN.

  15. A study of the cool gas in the Large Magellanic Cloud. I. Properties of the cool atomic phase - a third H i absorption survey

    NASA Astrophysics Data System (ADS)

    Marx-Zimmer, M.; Herbstmeier, U.; Dickey, J. M.; Zimmer, F.; Staveley-Smith, L.; Mebold, U.

    2000-02-01

    The cool atomic interstellar medium of the Large Magellanic Cloud (LMC) seems to be quite different from that in the Milky Way. In a series of three papers we study the properties of the cool atomic hydrogen in the LMC (Paper I), its relation to molecular clouds using SEST-CO-observations (Paper II) and the cooling mechanism of the atomic gas based on ISO-[\\CII]-investigations (Paper III). In this paper we present the results of a third 21 cm absorption line survey toward the LMC carried out with the Australia Telescope Compact Array (ATCA). 20 compact continuum sources, which are mainly in the direction of the supergiant shell LMC 4, toward the surroundings of 30 Doradus and toward the eastern steep \\HI\\ boundary, have been chosen from the 1.4 GHz snapshot continuum survey of Marx et al. We have identified 20 absorption features toward nine of the 20 sources. The properties of the cool \\HI\\ clouds are investigated and are compared for the different regions of the LMC taking the results of Dickey et al. (survey 2) into account. We find that the cool \\HI\\ gas in the LMC is either unusually abundant compared to the cool atomic phase of the Milky Way or the gas is clearly colder (\\Tc\\ ~ 30 K) than that in our Galaxy (\\Tc\\ ~ 60 K). The properties of atomic clouds toward 30 Doradus and LMC 4 suggest a higher cooling rate in these regions compared to other parts of the LMC, probably due to an enhanced pressure near the shock fronts of LMC 4 and 30 Doradus. The detected cool atomic gas toward the eastern steep \\HI\\ boundary might be the result of a high compression of gas at the leading edge. The Australia Telescope is funded by the Commonwealth of Australia for operation as a National Facility managed by CSIRO.

  16. 40-Gbps optical backbone network deep packet inspection based on FPGA

    NASA Astrophysics Data System (ADS)

    Zuo, Yuan; Huang, Zhiping; Su, Shaojing

    2014-11-01

    In the era of information, the big data, which contains huge information, brings about some problems, such as high speed transmission, storage and real-time analysis and process. As the important media for data transmission, the Internet is the significant part for big data processing research. With the large-scale usage of the Internet, the data streaming of network is increasing rapidly. The speed level in the main fiber optic communication of the present has reached 40Gbps, even 100Gbps, therefore data on the optical backbone network shows some features of massive data. Generally, data services are provided via IP packets on the optical backbone network, which is constituted with SDH (Synchronous Digital Hierarchy). Hence this method that IP packets are directly mapped into SDH payload is named POS (Packet over SDH) technology. Aiming at the problems of real time process of high speed massive data, this paper designs a process system platform based on ATCA for 40Gbps POS signal data stream recognition and packet content capture, which employs the FPGA as the CPU. This platform offers pre-processing of clustering algorithms, service traffic identification and data mining for the following big data storage and analysis with high efficiency. Also, the operational procedure is proposed in this paper. Four channels of 10Gbps POS signal decomposed by the analysis module, which chooses FPGA as the kernel, are inputted to the flow classification module and the pattern matching component based on TCAM. Based on the properties of the length of payload and net flows, buffer management is added to the platform to keep the key flow information. According to data stream analysis, DPI (deep packet inspection) and flow balance distribute, the signal is transmitted to the backend machine through the giga Ethernet ports on back board. Practice shows that the proposed platform is superior to the traditional applications based on ASIC and NP.

  17. Distribution of inhomogeneities in the interstellar plasma in the directions of three distant pulsars from observations with the RadioAstron ground-space interferometer

    NASA Astrophysics Data System (ADS)

    Popov, M. V.; Andrianov, A. S.; Bartel, N.; Gwinn, C.; Joshi, B. C.; Jauncey, D.; Kardashev, N. S.; Rudnitskii, A. G.; Smirnova, T. V.; Soglasnov, V. A.; Fadeev, E. N.; Shishov, V. I.

    2016-09-01

    The RadioAstron ground-space interferometer has been used to measure the angular sizes of the scattering disks of the three distant pulsars B1641-45, B1749-28, and B1933+16. The observations were carried out with the participation of the Westerbork Synthesis Radio Telescope; two 32-m telescopes at Torun, Poland and Svetloe, Russia (the latter being one antenna of the KVAZAR network); the Saint Croix VLBA antenna; the Arecibo radio telescope; the Parkes, Narrabri (ATCA), Mopra, Hobart, and Ceduna Australian radio telescopes; and the Hartebeesthoek radio telescope in South Africa. The full widths at half maximum of the scattering disks were 27 mas at 1668 MHz for B1641-45, 0.5 mas at 1668 MHz for B1749-28, and 12.3 at 316 MHz and 0.84 mas at 1668 MHz for B1933+16. The characteristic time scales for scatter-broadening of the pulses on inhomogeneities in the interstellar plasma τsc were also measured for these pulsars using various methods. Joint knowledge of the size of the scattering disk and the scatter-broadening time scale enables estimation of the distance to the effective scattering screen d. For B1641-45, d = 3.0 kpc for a distance to the pulsar D = 4.9 kpc, and for B1749-28, d = 0.95 kpc for D = 1.3 kpc. Observations of B1933+16 were carried out simultaneously at 316 and 1668 MHz. The positions of the screen derived using the measurements at the two frequencies agree: d 1 = 2.6 and d 2 = 2.7 kpc, for a distance to the pulsar of 3.7 kpc. Two screens were detected for this pulsar from an analysis of parabolic arcs in the secondary dynamic spectrum at 1668 MHz, at 1.3 and 3.1 kpc. The scattering screens for two of the pulsars are identified with real physical objects located along the lines of sight toward the pulsars: G339.1-04 (B1641-45) and G0.55-0.85 (B1749-28).

  18. The formation and evolution of high-redshift dusty galaxies

    NASA Astrophysics Data System (ADS)

    Ma, Jingzhe; Gonzalez, Anthony H.; Ge, Jian; Vieira, Joaquin D.; Prochaska, Jason X.; Spilker, Justin; Strandet, Maria; Ashby, Matthew; Noterdaeme, Pasquier; Lundgren, Britt; Zhao, Yinan; Ji, Tuo; Zhang, Shaohua; Caucal, Paul; SPT SMG Collaboration

    2017-01-01

    Star formation and chemical evolution are among the biggest questions in galaxy formation and evolution. High-redshift dusty galaxies are the best sites to investigate mass assembly and growth, star formation rates, star formation history, chemical enrichment, and physical conditions. My thesis is based on two populations of high-redshift dusty galaxies, submillimeter galaxies (SMGs) and quasar 2175 Å dust absorbers, which are selected by dust emission and dust absorption, respectively.For the SMG sample, I have worked on the gravitationally lensed dusty, star-forming galaxies (DSFGs) at 2.8 < z < 5.7, which were first discovered by the South Pole Telescope (SPT) and further confirmed by ALMA. My thesis is focused on the stellar masses and star formation rates of these objects by means of multi-wavelength spectral energy distribution (SED) modelling. The data include HST/WFC3, Spitzer/IRAC, Herschel/PACS, Herschel/SPIRE, APEX/Laboca and SPT. Compared to the star-forming main sequence (MS), these DSFGs have specific SFRs that lie above the MS, suggesting that we are witnessing ongoing strong starburst events that may be driven by major mergers. SPT0346-52 at z = 5.7, the most extraordinary source in the SPT survey for which we obtained Chandra X-ray and ATCA radio data, was confirmed to have the highest star formation surface density of any known galaxy at high-z.The other half of my thesis is focused on a new population of quasar absorption line systems, 2175 Å dust absorbers, which are excellent probes of gas and dust properties, chemical evolution and physical conditions in the absorbing galaxies. This sample was selected from the SDSS and BOSS surveys and followed up with the Echelle Spectrographs and Imager on the Keck-II telescope, the Red & Blue Channel Spectrograph on the Multiple Mirror Telescope, and the Ultraviolet and Visible Echelle Spectrograph onboard the Very Large Telescope. We found a correlation between the presence of the 2175 Å bump and other ingredients including high metallicity, high depletion level, overall low ionization state of gas, neutral carbon and molecules. I have also pushed forward this study by using HST IR grism to link the absorber and the host galaxy.

  19. SN 1987A after 18 Years: Mid-Infrared Gemini and Spitzer Observations of the Remnant

    NASA Astrophysics Data System (ADS)

    Bouchet, Patrice; Dwek, Eli; Danziger, John; Arendt, Richard G.; De Buizer, I. James M.; Park, Sangwook; Suntzeff, Nicholas B.; Kirshner, Robert P.; Challis, Peter

    2006-10-01

    Using the Gemini South 8 m telescope, we obtained high-resolution 11.7 and 18.3 μm mid-IR images of SN 1987A on day 6526 since the explosion. All the emission arises from the equatorial ring. Nearly contemporaneous spectra obtained at 5-38 μm with the Spitzer Space Telescope show that this is thermal emission from silicate dust that condensed out in the red giant wind of the progenitor star. The dust temperature is 166+18-12 K, and the emitting dust mass is 2.6+2.0-1.4×10-6 Msolar. Comparison of the Gemini 11.7 μm image with Chandra X-ray images, HST UV-optical images, and ATCA radio synchrotron images shows generally good correlation across all wavelengths. If the dust resides in the diffuse X-ray-emitting gas then it is collisionally heated. The IR emission can then be used to derive the plasma temperature and density, which were found to be in good agreement with those inferred from the X-rays. Alternatively, the dust could reside in the dense UV-optical knots and be heated by the radiative shocks that are propagating through the knots. In either case the dust-to-gas mass ratio in the CSM around the supernova is significantly lower than that in the general interstellar medium of the LMC, suggesting either a low condensation efficiency in the wind of the progenitor star or the efficient destruction of the dust by the SN blast wave. Overall, we are witnessing the interaction of the SN blast wave with its surrounding medium, creating an environment that is rapidly evolving at all wavelengths. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy (AURA), Inc., under cooperative agreement with the National Science Foundation (NSF) on behalf of the Gemini partnership: the NSF (United States), the Particle Physics and Astronomy research Council (United Kingdom), the National Research Council (Canada), CONICYT (Chile), the Australian Research Council (Australia), CNPq (Brazil), and CONICET (Argentina).

  20. PKS 2123-463: A Confirmed Gamma-ray Blazar at High Redshift

    NASA Technical Reports Server (NTRS)

    D'Ammando, F.; Rau, A.; Schady, P.; Finke, J.; Orienti, M.; Greiner, J.; Kann, D. A.; Ojha, R.; Foley, A. R.; Stevens, J.; hide

    2013-01-01

    The flat spectrum radio quasar (FSRQ) PKS 2123-463 was associated in the first Fermi- Large Area Telescope (LAT) source catalogue with the gamma-ray source 1FGL J2126.1-4603, but when considering the full first two years of Fermi observations, no gamma-ray source at a position consistent with this FSRQ was detected, and thus PKS 2123-463 was not reported in the second Fermi-LAT source catalogue. On 2011 December 14 a gamma-ray source positionally consistent with PKS 2123-463 was detected in flaring activity by Fermi-LAT. This activity triggered radio-to-X-ray observations by the Swift,Gamma-ray Optical/Near-Infrared Detector (GROND), Australia Telescope Compact Array (ATCA), Ceduna and Seven Dishes Karoo Array Telescope (KAT-7) observatories. Results of the localization of the gamma-ray source over 41 months of Fermi-LAT operation are reported here in conjunction with the results of the analysis of radio, optical, ultraviolet (UV) and X-ray data collected soon after the gamma-ray flare. The strict spatial association with the lower energy counterpart together with a simultaneous increase of the activity in optical, UV, X-ray and gamma-ray bands led to a firm identification of the gamma-ray source with PKS 2123-463. A new photometric redshift has been estimated as z = 1.46 plus or minus 0.05 using GROND and Swift Ultraviolet/Optical Telescope (UVOT) observations, in rough agreement with the disputed spectroscopic redshift of z = 1.67.We fit the broad-band spectral energy distribution with a synchrotron/external Compton model. We find that a thermal disc component is necessary to explain the optical/UV emission detected by Swift/UVOT. This disc has a luminosity of approximately 1.8 x 10(exp 46) erg s(exp -1), and a fit to the disc emission assuming a Schwarzschild (i.e. non-rotating) black hole gives a mass of approximately 2 x 10(exp 9) solar mass. This is the first black hole mass estimate for this source.

  1. The genes and enzymes for the catabolism of galactitol, D-tagatose, and related carbohydrates in Klebsiella oxytoca M5a1 and other enteric bacteria display convergent evolution.

    PubMed

    Shakeri-Garakani, A; Brinkkötter, A; Schmid, K; Turgut, S; Lengeler, J W

    2004-07-01

    Enteric bacteria (Enteriobacteriaceae) carry on their single chromosome about 4000 genes that all strains have in common (referred to here as "obligatory genes"), and up to 1300 "facultative" genes that vary from strain to strain and from species to species. In closely related species, obligatory and facultative genes are orthologous genes that are found at similar loci. We have analyzed a set of facultative genes involved in the degradation of the carbohydrates galactitol, D-tagatose, D-galactosamine and N-acetyl-galactosamine in various pathogenic and non-pathogenic strains of these bacteria. The four carbohydrates are transported into the cell by phosphotransferase (PTS) uptake systems, and are metabolized by closely related or even identical catabolic enzymes via pathways that share several intermediates. In about 60% of Escherichia coli strains the genes for galactitol degradation map to a gat operon at 46.8 min. In strains of Salmonella enterica, Klebsiella pneumoniae and K. oxytoca, the corresponding gat genes, although orthologous to their E. coli counterparts, are found at 70.7 min, clustered in a regulon together with three tag genes for the degradation of D-tagatose, an isomer of D-fructose. In contrast, in all the E. coli strains tested, this chromosomal site was found to be occupied by an aga/kba gene cluster for the degradation of D-galactosamine and N-acetyl-galactosamine. The aga/kba and the tag genes were paralogous either to the gat cluster or to the fru genes for degradation of D-fructose. Finally, in more then 90% of strains of both Klebsiella species, and in about 5% of the E. coli strains, two operons were found at 46.8 min that comprise paralogous genes for catabolism of the isomers D-arabinitol (genes atl or dal) and ribitol (genes rtl or rbt). In these strains gat genes were invariably absent from this location, and they were totally absent in S. enterica. These results strongly indicate that these various gene clusters and metabolic pathways have been subject to convergent evolution among the Enterobacteriaceae. This apparently involved recent horizontal gene transfer and recombination events, as indicated by major chromosomal rearrangements found in their immediate vicinity.

  2. Semiconductor-based, large-area, flexible, electronic devices

    DOEpatents

    Goyal, Amit [Knoxville, TN

    2011-03-15

    Novel articles and methods to fabricate the same resulting in flexible, large-area, triaxially textured, single-crystal or single-crystal-like, semiconductor-based, electronic devices are disclosed. Potential applications of resulting articles are in areas of photovoltaic devices, flat-panel displays, thermophotovoltaic devices, ferroelectric devices, light emitting diode devices, computer hard disc drive devices, magnetoresistance based devices, photoluminescence based devices, non-volatile memory devices, dielectric devices, thermoelectric devices and quantum dot laser devices.

  3. Semiconductor-based, large-area, flexible, electronic devices on {110}<100> oriented substrates

    DOEpatents

    Goyal, Amit

    2014-08-05

    Novel articles and methods to fabricate the same resulting in flexible, oriented, semiconductor-based, electronic devices on {110}<100> textured substrates are disclosed. Potential applications of resulting articles are in areas of photovoltaic devices, flat-panel displays, thermophotovoltaic devices, ferroelectric devices, light emitting diode devices, computer hard disc drive devices, magnetoresistance based devices, photoluminescence based devices, non-volatile memory devices, dielectric devices, thermoelectric devices and quantum dot laser devices.

  4. [100] or [110] aligned, semiconductor-based, large-area, flexible, electronic devices

    DOEpatents

    Goyal, Amit

    2015-03-24

    Novel articles and methods to fabricate the same resulting in flexible, large-area, [100] or [110] textured, semiconductor-based, electronic devices are disclosed. Potential applications of resulting articles are in areas of photovoltaic devices, flat-panel displays, thermophotovoltaic devices, ferroelectric devices, light emitting diode devices, computer hard disc drive devices, magnetoresistance based devices, photoluminescence based devices, non-volatile memory devices, dielectric devices, thermoelectric devices and quantum dot laser devices.

  5. {100}<100> or 45.degree.-rotated {100}<100>, semiconductor-based, large-area, flexible, electronic devices

    DOEpatents

    Goyal, Amit [Knoxville, TN

    2012-05-15

    Novel articles and methods to fabricate the same resulting in flexible, {100}<100> or 45.degree.-rotated {100}<100> oriented, semiconductor-based, electronic devices are disclosed. Potential applications of resulting articles are in areas of photovoltaic devices, flat-panel displays, thermophotovoltaic devices, ferroelectric devices, light emitting diode devices, computer hard disc drive devices, magnetoresistance based devices, photoluminescence based devices, non-volatile memory devices, dielectric devices, thermoelectric devices and quantum dot laser devices.

  6. 76 FR 45860 - In the Matter of Certain Electronic Devices, Including Wireless Communication Devices, Portable...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-01

    ..., Including Wireless Communication Devices, Portable Music and Data Processing Devices, and Tablet Computers... electronic devices, including wireless communication devices, portable music and data processing devices, and... electronic devices, including wireless communication devices, portable music and data processing devices, and...

  7. Millimeter Studies of Nearby Debris Disks

    NASA Astrophysics Data System (ADS)

    MacGregor, Meredith Ann

    2017-03-01

    At least 20% of nearby main sequence stars are known to be surrounded by disks of dusty material resulting from the collisional erosion of planetesimals, similar to asteroids and comets in our own Solar System. The material in these ‘debris disks’ is directly linked to the larger bodies, like planets, in the system through collisions and gravitational perturbations. Observations at millimeter wavelengths are especially critical to our understanding of these systems, since the large grains that dominate emission at these long wavelengths reliably trace the underlying planetesimal distribution. In this thesis, I have used state-of-the-art observations at millimeter wavelengths to address three related questions concerning debris disks and planetary system evolution: 1) How are wide-separation, substellar companions formed? 2) What is the physical nature of the collisional process in debris disks? And, 3) Can the structure and morphology of debris disks provide probes of planet formation and subsequent dynamical evolution? Using ALMA observations of GQ Lup, a pre-main sequence system with a wide-separation, substellar companion, I have placed constraints on the mass of a circumplanetary disk around the companion, informing formation scenarios for this and other similar systems (Chapter 2). I obtained observations of a sample of fifteen debris disks with both the VLA and ATCA at centimeter wavelengths, and robustly determined the millimeter spectral index of each disk and thus the slope of the grain size distribution, providing the first observational test of collision models of debris disks (Chapter 3). By applying an MCMC modeling framework to resolved millimeter observations with ALMA and SMA, I have placed the first constraints on the position, width, surface density gradient, and any asymmetric structure of the AU Mic, HD 15115, Epsilon Eridani, Tau Ceti, and Fomalhaut debris disks (Chapters 4–8). These observations of individual systems hint at trends in disk structure and dynamics, which can be explored further with a comparative study of a sample of the eight brightest debris disks around Sun-like stars within 20 pc (Chapter 9). This body of work has yielded the first resolved images of notable debris disks at millimeter wavelengths, and complements other ground- and space-based observations by providing constraints on these systems with uniquely high angular resolution and wavelength coverage. Together these results provide a foundation to investigate the dynamical evolution of planetary systems through multi-wavelength observations of debris disks.

  8. IKT 16: the first X-ray confirmed composite SNR in the SMC

    NASA Astrophysics Data System (ADS)

    Maitra, C.; Ballet, J.; Filipović, M. D.; Haberl, F.; Tiengo, A.; Grieve, K.; Roper, Q.

    2015-12-01

    Aims: IKT 16 is an X-ray and radio-faint supernova remnant (SNR) in the Small Magellanic Cloud (SMC). A detailed X-ray study of this SNR with XMM-Newton confirmed the presence of a hard X-ray source near its centre, indicating the detection of the first composite SNR in the SMC. With a dedicated Chandra observation we aim to resolve the point source and confirm its nature. We also acquire new ATCA observations of the source at 2.1 GHz with improved flux density estimates and resolution. Methods: We perform detailed spatial and spectral analysis of the source. With the highest resolution X-ray and radio image of the centre of the SNR available today, we resolve the source and confirm its pulsar wind nebula (PWN) nature. Further, we constrain the geometrical parameters of the PWN and perform spectral analysis for the point source and the PWN separately. We also test for the radial variations of the PWN spectrum and its possible east west asymmetry. Results: The X-ray source at the centre of IKT 16 can be resolved into a symmetrical elongated feature centring a point source, the putative pulsar. Spatial modelling indicates an extent of 5.2'' of the feature with its axis inclined at 82° east from north, aligned with a larger radio feature consisting of two lobes almost symmetrical about the X-ray source. The picture is consistent with a PWN which has not yet collided with the reverse shock. The point source is about three times brighter than the PWN and has a hard spectrum of spectral index 1.1 compared to a value 2.2 for the PWN. This points to the presence of a pulsar dominated by non-thermal emission. The expected Ė is ~1037 erg s-1 and spin period <100 ms. However, the presence of a compact nebula unresolved by Chandra at the distance of the SMC cannot completely be ruled out. The reduced images (FITS files) are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/584/A41

  9. Wireless device monitoring methods, wireless device monitoring systems, and articles of manufacture

    DOEpatents

    McCown, Steven H [Rigby, ID; Derr, Kurt W [Idaho Falls, ID; Rohde, Kenneth W [Idaho Falls, ID

    2012-05-08

    Wireless device monitoring methods, wireless device monitoring systems, and articles of manufacture are described. According to one embodiment, a wireless device monitoring method includes accessing device configuration information of a wireless device present at a secure area, wherein the device configuration information comprises information regarding a configuration of the wireless device, accessing stored information corresponding to the wireless device, wherein the stored information comprises information regarding the configuration of the wireless device, comparing the device configuration information with the stored information, and indicating the wireless device as one of authorized and unauthorized for presence at the secure area using the comparing.

  10. 16 CFR § 1507.9 - Toy smoke devices and flitter devices.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 2 2013-01-01 2013-01-01 false Toy smoke devices and flitter devices. Â... SUBSTANCES ACT REGULATIONS FIREWORKS DEVICES § 1507.9 Toy smoke devices and flitter devices. (a) Toy smoke... fuse and firstfire upon ignition) during normal operation. (b) Toy smoke devices and flitter devices...

  11. 16 CFR 1507.9 - Toy smoke devices and flitter devices.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 2 2011-01-01 2011-01-01 false Toy smoke devices and flitter devices. 1507... SUBSTANCES ACT REGULATIONS FIREWORKS DEVICES § 1507.9 Toy smoke devices and flitter devices. (a) Toy smoke... fuse and firstfire upon ignition) during normal operation. (b) Toy smoke devices and flitter devices...

  12. 16 CFR 1507.9 - Toy smoke devices and flitter devices.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 2 2014-01-01 2014-01-01 false Toy smoke devices and flitter devices. 1507... SUBSTANCES ACT REGULATIONS FIREWORKS DEVICES § 1507.9 Toy smoke devices and flitter devices. (a) Toy smoke... fuse and firstfire upon ignition) during normal operation. (b) Toy smoke devices and flitter devices...

  13. 16 CFR 1507.9 - Toy smoke devices and flitter devices.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 2 2012-01-01 2012-01-01 false Toy smoke devices and flitter devices. 1507... SUBSTANCES ACT REGULATIONS FIREWORKS DEVICES § 1507.9 Toy smoke devices and flitter devices. (a) Toy smoke... fuse and firstfire upon ignition) during normal operation. (b) Toy smoke devices and flitter devices...

  14. 77 FR 58576 - Certain Wireless Communication Devices, Portable Music and Data Processing Devices, Computers...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-21

    ... Devices, Portable Music and Data Processing Devices, Computers, and Components Thereof; Institution of... communication devices, portable music and data processing devices, computers, and components thereof by reason... certain wireless communication devices, portable music and data processing devices, computers, and...

  15. 78 FR 34669 - Certain Electronic Devices, Including Wireless Communication Devices, Portable Music and Data...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-10

    ..., Including Wireless Communication Devices, Portable Music and Data Processing Devices, and Tablet Computers... importing wireless communication devices, portable music and data processing devices, and tablet computers... certain electronic devices, including wireless communication devices, portable music and data processing...

  16. 21 CFR 882.1560 - Skin potential measurement device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Skin potential measurement device. 882.1560... (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1560 Skin potential measurement device. (a) Identification. A skin potential measurement device is a general diagnostic device...

  17. 21 CFR 882.1560 - Skin potential measurement device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Skin potential measurement device. 882.1560... (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1560 Skin potential measurement device. (a) Identification. A skin potential measurement device is a general diagnostic device...

  18. 21 CFR 882.1560 - Skin potential measurement device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Skin potential measurement device. 882.1560... (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1560 Skin potential measurement device. (a) Identification. A skin potential measurement device is a general diagnostic device...

  19. 21 CFR 882.1560 - Skin potential measurement device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Skin potential measurement device. 882.1560... (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1560 Skin potential measurement device. (a) Identification. A skin potential measurement device is a general diagnostic device...

  20. 21 CFR 872.2060 - Jaw tracking device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2060 Jaw tracking device. (a) Jaw tracking device... Controls Guidance Document: Dental Sonography and Jaw Tracking Devices.” [68 FR 67367, Dec. 2, 2003] ...

  1. 21 CFR 872.2050 - Dental sonography device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Dental sonography device. 872.2050 Section 872...) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2050 Dental sonography device. (a) Dental sonography device for monitoring—(1) Identification. A dental sonography device for monitoring is an...

  2. 21 CFR 872.2050 - Dental sonography device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Dental sonography device. 872.2050 Section 872...) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2050 Dental sonography device. (a) Dental sonography device for monitoring—(1) Identification. A dental sonography device for monitoring is an...

  3. 21 CFR 872.2050 - Dental sonography device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Dental sonography device. 872.2050 Section 872...) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2050 Dental sonography device. (a) Dental sonography device for monitoring—(1) Identification. A dental sonography device for monitoring is an...

  4. 21 CFR 872.2050 - Dental sonography device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Dental sonography device. 872.2050 Section 872...) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2050 Dental sonography device. (a) Dental sonography device for monitoring—(1) Identification. A dental sonography device for monitoring is an...

  5. 21 CFR 872.2050 - Dental sonography device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Dental sonography device. 872.2050 Section 872...) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2050 Dental sonography device. (a) Dental sonography device for monitoring—(1) Identification. A dental sonography device for monitoring is an...

  6. 21 CFR 872.6010 - Abrasive device and accessories.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Miscellaneous Devices § 872.6010 Abrasive device and accessories... crowns. The device is attached to a shank that is held by a handpiece. The device includes the abrasive...

  7. 21 CFR 872.6010 - Abrasive device and accessories.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Miscellaneous Devices § 872.6010 Abrasive device and accessories... crowns. The device is attached to a shank that is held by a handpiece. The device includes the abrasive...

  8. 21 CFR 872.6010 - Abrasive device and accessories.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Miscellaneous Devices § 872.6010 Abrasive device and accessories... crowns. The device is attached to a shank that is held by a handpiece. The device includes the abrasive...

  9. 21 CFR 872.6010 - Abrasive device and accessories.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Miscellaneous Devices § 872.6010 Abrasive device and accessories... crowns. The device is attached to a shank that is held by a handpiece. The device includes the abrasive...

  10. 21 CFR 872.6010 - Abrasive device and accessories.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Miscellaneous Devices § 872.6010 Abrasive device and accessories... crowns. The device is attached to a shank that is held by a handpiece. The device includes the abrasive...

  11. Processes for multi-layer devices utilizing layer transfer

    DOEpatents

    Nielson, Gregory N; Sanchez, Carlos Anthony; Tauke-Pedretti, Anna; Kim, Bongsang; Cederberg, Jeffrey; Okandan, Murat; Cruz-Campa, Jose Luis; Resnick, Paul J

    2015-02-03

    A method includes forming a release layer over a donor substrate. A plurality of devices made of a first semiconductor material are formed over the release layer. A first dielectric layer is formed over the plurality of devices such that all exposed surfaces of the plurality of devices are covered by the first dielectric layer. The plurality of devices are chemically attached to a receiving device made of a second semiconductor material different than the first semiconductor material, the receiving device having a receiving substrate attached to a surface of the receiving device opposite the plurality of devices. The release layer is etched to release the donor substrate from the plurality of devices. A second dielectric layer is applied over the plurality of devices and the receiving device to mechanically attach the plurality of devices to the receiving device.

  12. 21 CFR 872.1740 - Caries detection device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Caries detection device. 872.1740 Section 872.1740...) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1740 Caries detection device. (a) Identification. The caries detection device is a device intended to show the existence of decay in a patient's tooth...

  13. 21 CFR 892.2010 - Medical image storage device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Medical image storage device. 892.2010 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2010 Medical image storage device. (a) Identification. A medical image storage device is a device that provides electronic storage and retrieval...

  14. 21 CFR 892.2010 - Medical image storage device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Medical image storage device. 892.2010 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2010 Medical image storage device. (a) Identification. A medical image storage device is a device that provides electronic storage and retrieval...

  15. 21 CFR 892.2010 - Medical image storage device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Medical image storage device. 892.2010 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2010 Medical image storage device. (a) Identification. A medical image storage device is a device that provides electronic storage and retrieval...

  16. 21 CFR 892.2010 - Medical image storage device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Medical image storage device. 892.2010 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2010 Medical image storage device. (a) Identification. A medical image storage device is a device that provides electronic storage and retrieval...

  17. 21 CFR 886.1450 - Corneal radius measuring device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Corneal radius measuring device. 886.1450 Section... (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Diagnostic Devices § 886.1450 Corneal radius measuring device. (a) Identification. A corneal radius measuring device is an AC-powered device intended to measure...

  18. 21 CFR 886.4360 - Ocular surgery irrigation device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Ocular surgery irrigation device. 886.4360 Section... (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Surgical Devices § 886.4360 Ocular surgery irrigation device. (a) Identification. An ocular surgery irrigation device is a device intended to be suspended over the...

  19. 21 CFR 886.4360 - Ocular surgery irrigation device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Ocular surgery irrigation device. 886.4360 Section... (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Surgical Devices § 886.4360 Ocular surgery irrigation device. (a) Identification. An ocular surgery irrigation device is a device intended to be suspended over the...

  20. 21 CFR 886.4360 - Ocular surgery irrigation device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Ocular surgery irrigation device. 886.4360 Section... (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Surgical Devices § 886.4360 Ocular surgery irrigation device. (a) Identification. An ocular surgery irrigation device is a device intended to be suspended over the...

  1. 21 CFR 886.4360 - Ocular surgery irrigation device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Ocular surgery irrigation device. 886.4360 Section... (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Surgical Devices § 886.4360 Ocular surgery irrigation device. (a) Identification. An ocular surgery irrigation device is a device intended to be suspended over the...

  2. 21 CFR 886.4360 - Ocular surgery irrigation device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Ocular surgery irrigation device. 886.4360 Section... (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Surgical Devices § 886.4360 Ocular surgery irrigation device. (a) Identification. An ocular surgery irrigation device is a device intended to be suspended over the...

  3. 21 CFR 892.2010 - Medical image storage device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Medical image storage device. 892.2010 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2010 Medical image storage device. (a) Identification. A medical image storage device is a device that provides electronic storage and retrieval...

  4. 21 CFR 872.1820 - Dental x-ray exposure alignment device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Dental x-ray exposure alignment device. 872.1820... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1820 Dental x-ray exposure alignment device. (a) Identification. A dental x-ray exposure alignment device is a device intended to position x...

  5. 21 CFR 872.1840 - Dental x-ray position indicating device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Dental x-ray position indicating device. 872.1840... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1840 Dental x-ray position indicating device. (a) Identification. A dental x-ray position indicating device is a device, such as a collimator...

  6. 21 CFR 872.1840 - Dental x-ray position indicating device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Dental x-ray position indicating device. 872.1840... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1840 Dental x-ray position indicating device. (a) Identification. A dental x-ray position indicating device is a device, such as a collimator...

  7. 21 CFR 872.1820 - Dental x-ray exposure alignment device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Dental x-ray exposure alignment device. 872.1820... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1820 Dental x-ray exposure alignment device. (a) Identification. A dental x-ray exposure alignment device is a device intended to position x...

  8. 21 CFR 872.1820 - Dental x-ray exposure alignment device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Dental x-ray exposure alignment device. 872.1820... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1820 Dental x-ray exposure alignment device. (a) Identification. A dental x-ray exposure alignment device is a device intended to position x...

  9. 21 CFR 872.1820 - Dental x-ray exposure alignment device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Dental x-ray exposure alignment device. 872.1820... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1820 Dental x-ray exposure alignment device. (a) Identification. A dental x-ray exposure alignment device is a device intended to position x...

  10. 21 CFR 872.1840 - Dental x-ray position indicating device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Dental x-ray position indicating device. 872.1840... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1840 Dental x-ray position indicating device. (a) Identification. A dental x-ray position indicating device is a device, such as a collimator...

  11. 21 CFR 872.1840 - Dental x-ray position indicating device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Dental x-ray position indicating device. 872.1840... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1840 Dental x-ray position indicating device. (a) Identification. A dental x-ray position indicating device is a device, such as a collimator...

  12. 21 CFR 872.1820 - Dental x-ray exposure alignment device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Dental x-ray exposure alignment device. 872.1820... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1820 Dental x-ray exposure alignment device. (a) Identification. A dental x-ray exposure alignment device is a device intended to position x...

  13. 21 CFR 872.1840 - Dental x-ray position indicating device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Dental x-ray position indicating device. 872.1840... (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1840 Dental x-ray position indicating device. (a) Identification. A dental x-ray position indicating device is a device, such as a collimator...

  14. 21 CFR 892.2040 - Medical image hardcopy device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Medical image hardcopy device. 892.2040 Section... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2040 Medical image hardcopy device. (a) Identification. A medical image hardcopy device is a device that produces a visible printed record of a medical...

  15. 21 CFR 892.2040 - Medical image hardcopy device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Medical image hardcopy device. 892.2040 Section... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2040 Medical image hardcopy device. (a) Identification. A medical image hardcopy device is a device that produces a visible printed record of a medical...

  16. 21 CFR 892.2040 - Medical image hardcopy device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Medical image hardcopy device. 892.2040 Section... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2040 Medical image hardcopy device. (a) Identification. A medical image hardcopy device is a device that produces a visible printed record of a medical...

  17. 21 CFR 892.2040 - Medical image hardcopy device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Medical image hardcopy device. 892.2040 Section... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2040 Medical image hardcopy device. (a) Identification. A medical image hardcopy device is a device that produces a visible printed record of a medical...

  18. 21 CFR 892.1610 - Diagnostic x-ray beam-limiting device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Diagnostic x-ray beam-limiting device. 892.1610... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1610 Diagnostic x-ray beam-limiting device. (a) Identification. A diagnostic x-ray beam-limiting device is a device such as a collimator, a...

  19. 21 CFR 892.1610 - Diagnostic x-ray beam-limiting device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Diagnostic x-ray beam-limiting device. 892.1610... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1610 Diagnostic x-ray beam-limiting device. (a) Identification. A diagnostic x-ray beam-limiting device is a device such as a collimator, a...

  20. 21 CFR 892.1610 - Diagnostic x-ray beam-limiting device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Diagnostic x-ray beam-limiting device. 892.1610... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1610 Diagnostic x-ray beam-limiting device. (a) Identification. A diagnostic x-ray beam-limiting device is a device such as a collimator, a...

  1. 21 CFR 892.1610 - Diagnostic x-ray beam-limiting device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Diagnostic x-ray beam-limiting device. 892.1610... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1610 Diagnostic x-ray beam-limiting device. (a) Identification. A diagnostic x-ray beam-limiting device is a device such as a collimator, a...

  2. 21 CFR 892.1610 - Diagnostic x-ray beam-limiting device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Diagnostic x-ray beam-limiting device. 892.1610... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1610 Diagnostic x-ray beam-limiting device. (a) Identification. A diagnostic x-ray beam-limiting device is a device such as a collimator, a...

  3. 21 CFR 864.9195 - Blood mixing devices and blood weighing devices.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Blood mixing devices and blood weighing devices... Manufacture Blood and Blood Products § 864.9195 Blood mixing devices and blood weighing devices. (a) Identification. A blood mixing device is a device intended for medical purposes that is used to mix blood or...

  4. 21 CFR 864.9195 - Blood mixing devices and blood weighing devices.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Blood mixing devices and blood weighing devices... Manufacture Blood and Blood Products § 864.9195 Blood mixing devices and blood weighing devices. (a) Identification. A blood mixing device is a device intended for medical purposes that is used to mix blood or...

  5. 21 CFR 864.9195 - Blood mixing devices and blood weighing devices.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Blood mixing devices and blood weighing devices... Manufacture Blood and Blood Products § 864.9195 Blood mixing devices and blood weighing devices. (a) Identification. A blood mixing device is a device intended for medical purposes that is used to mix blood or...

  6. 21 CFR 864.9195 - Blood mixing devices and blood weighing devices.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Blood mixing devices and blood weighing devices... Manufacture Blood and Blood Products § 864.9195 Blood mixing devices and blood weighing devices. (a) Identification. A blood mixing device is a device intended for medical purposes that is used to mix blood or...

  7. 21 CFR 864.9195 - Blood mixing devices and blood weighing devices.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Blood mixing devices and blood weighing devices... Manufacture Blood and Blood Products § 864.9195 Blood mixing devices and blood weighing devices. (a) Identification. A blood mixing device is a device intended for medical purposes that is used to mix blood or...

  8. 78 FR 16865 - Certain Electronic Devices, Including Wireless Communication Devices, Portable Music and Data...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-19

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-794] Certain Electronic Devices, Including Wireless Communication Devices, Portable Music and Data Processing Devices, and Tablet Computers... certain electronic devices, including wireless communication devices, portable music and data processing...

  9. Continuation of copper and levonorgestrel intrauterine devices: a retrospective cohort study.

    PubMed

    Phillips, Sharon J; Hofler, Lisa G; Modest, Anna M; Harvey, Lara F B; Wu, Lily H; Hacker, Michele R

    2017-07-01

    Studies conflict on whether the duration of use of the copper intrauterine device is longer than that of the levonorgestrel intrauterine device, and whether women who continue using intrauterine devices differ from those who discontinue. We sought to assess continuation rates and performance of levonorgestrel intrauterine devices compared with copper intrauterine devices over a 5-year period. We performed a retrospective cohort study of 1164 individuals who underwent intrauterine device placement at an urban academic medical center. The analysis focused on a comparison of continuation rates between those using levonorgestrel intrauterine device and copper intrauterine device, factors associated with discontinuation, and intrauterine device performance. We assessed the differences in continuation at discrete time points, pregnancy, and expulsion rates using χ 2 tests and calculated hazard ratios using a multivariable Cox model. Of 1164 women who underwent contraceptive intrauterine device insertion, 956 had follow-up data available. At 2 years, 64.9% of levonorgestrel intrauterine device users continued their device, compared with 57.7% of copper intrauterine device users (P = .11). At 4 years, continuation rates were 45.1% for levonorgestrel intrauterine device and 32.6% for copper intrauterine device (P < .01), and at 5 years continuation rates were 28.1% for levonorgestrel intrauterine device and 23.8% for copper intrauterine device (P = .33). Black race, primiparity, and age were positively associated with discontinuation; education was not. The hazard ratio for discontinuation of levonorgestrel intrauterine device compared with copper intrauterine device >4 years was 0.71 (95% confidence interval, 0.55-0.93) and >5 years was 0.82 (95% confidence interval, 0.64-1.05) after adjusting for race, age, parity, and education. Copper intrauterine device users were more likely to experience expulsion (10.2% copper intrauterine device vs 4.9% levonorgestrel intrauterine device, P < .01) over the study period and to become pregnant in the first year of use (1.6% copper intrauterine device vs 0.1% levonorgestrel intrauterine device, P < .01). We found a difference in continuation rates between levonorgestrel and copper intrauterine device users at 4 years but not at 5 years. Copper intrauterine device users were more likely to experience expulsion and pregnancy. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Continuation of copper and levonorgestrel intrauterine devices: a retrospective cohort study

    PubMed Central

    Phillips, Sharon J.; Hofler, Lisa G.; Modest, Anna M.; Harvey, Lara F. B.; Wu, Lily H.; Hacker, Michele R.

    2018-01-01

    Background Studies conflict on whether the duration of use of the copper intrauterine device is longer than that of the levonorgestrel intra-uterine device, and whether women who continue using intrauterine devices differ from those who discontinue. Objective We sought to assess continuation rates and performance of levonorgestrel intrauterine devices compared with copper intrauterine devices over a 5-year period. Study Design We performed a retrospective cohort study of 1164 individuals who underwent intrauterine device placement at an urban academic medical center. The analysis focused on a comparison of continuation rates between those using levonorgestrel intrauterine device and copper intrauterine device, factors associated with discontinuation, and intrauterine device performance. We assessed the differences in continuation at discrete time points, pregnancy, and expulsion rates using χ2 tests and calculated hazard ratios using a multivariable Cox model. Results Of 1164 women who underwent contraceptive intrauterine device insertion, 956 had follow-up data available. At 2 years, 64.9% of levonorgestrel intrauterine device users continued their device, compared with 57.7% of copper intrauterine device users (P = .11). At 4 years, continuation rates were 45.1% for levonorgestrel intrauterine device and 32.6% for copper intrauterine device (P < .01), and at 5 years continuation rates were 28.1% for levonorgestrel intrauterine device and 23.8% for copper intrauterine device (P = .33). Black race, primiparity, and age were positively associated with discontinuation; education was not. The hazard ratio for discontinuation of levonorgestrel intrauterine device compared with copper intrauterine device >4 years was 0.71 (95% confidence interval, 0.55–0.93) and >5 years was 0.82 (95% confidence interval, 0.64–1.05) after adjusting for race, age, parity, and education. Copper intrauterine device users were more likely to experience expulsion (10.2% copper intrauterine device vs 4.9% levonorgestrel intrauterine device, P < .01) over the study period and to become pregnant in the first year of use (1.6% copper intrauterine device vs 0.1% levonorgestrel intrauterine device, P < .01). Conclusion We found a difference in continuation rates between levonorgestrel and copper intrauterine device users at 4 years but not at 5 years. Copper intrauterine device users were more likely to experience expulsion and pregnancy. PMID:28315664

  11. Evaluation of tissue interactions with mechanical elements of a transscleral drug delivery device.

    PubMed

    Cohen, Sarah J; Chan, Robison V Paul; Keegan, Mark; Andreoli, Christopher M; Borenstein, Jeffrey T; Miller, Joan W; Gragoudas, Evangelos S

    2012-03-12

    The goal of this work was to evaluate tissue-device interactions due to implantation of a mechanically operated drug delivery system onto the posterior sclera. Two test devices were designed and fabricated to model elements of the drug delivery device-one containing a free-spinning ball bearing and the other encasing two articulating gears. Openings in the base of test devices modeled ports for drug passage from device to sclera. Porous poly(tetrafluoroethylene) (PTFE) membranes were attached to half of the gear devices to minimize tissue ingrowth through these ports. Test devices were sutured onto rabbit eyes for 10 weeks. Tissue-device interactions were evaluated histologically and mechanically after removal to determine effects on device function and changes in surrounding tissue. Test devices were generally well-tolerated during residence in the animal. All devices encouraged fibrous tissue formation between the sclera and the device, fibrous tissue encapsulation and invasion around the device, and inflammation of the conjunctiva. Gear devices encouraged significantly greater inflammation in all cases and a larger rate of tissue ingrowth. PTFE membranes prevented tissue invasion through the covered drug ports, though tissue migrated in through other smaller openings. The torque required to turn the mechanical elements increased over 1000 times for gear devices, but only on the order of 100 times for membrane-covered gear devices and less than 100 times for ball bearing devices. Maintaining a lower device profile, minimizing microscale motion on the eye surface and covering drug ports with a porous membrane may minimize inflammation, decreasing the risk of damage to surrounding tissues and minimizing disruption of device operation.

  12. 77 FR 60720 - Certain Electronic Devices, Including Wireless Commmunication Devices, Portable Music and Data...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-04

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-794] Certain Electronic Devices, Including Wireless Commmunication Devices, Portable Music and Data Processing Devices, and Tablet Computers... communication devices, portable music and data processing devices, and tablet computers, imported by Apple Inc...

  13. 21 CFR 892.2020 - Medical image communications device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Medical image communications device. 892.2020... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2020 Medical image communications device. (a) Identification. A medical image communications device provides electronic transfer of medical...

  14. 21 CFR 892.2020 - Medical image communications device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Medical image communications device. 892.2020... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2020 Medical image communications device. (a) Identification. A medical image communications device provides electronic transfer of medical...

  15. 21 CFR 892.2020 - Medical image communications device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Medical image communications device. 892.2020... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2020 Medical image communications device. (a) Identification. A medical image communications device provides electronic transfer of medical...

  16. 21 CFR 892.2020 - Medical image communications device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Medical image communications device. 892.2020... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2020 Medical image communications device. (a) Identification. A medical image communications device provides electronic transfer of medical...

  17. Release strategies for making transferable semiconductor structures, devices and device components

    DOEpatents

    Rogers, John A; Nuzzo, Ralph G; Meitl, Matthew; Ko, Heung Cho; Yoon, Jongseung; Menard, Etienne; Baca, Alfred J

    2014-11-25

    Provided are methods for making a device or device component by providing a multilayer structure having a plurality of functional layers and a plurality of release layers and releasing the functional layers from the multilayer structure by separating one or more of the release layers to generate a plurality of transferable structures. The transferable structures are printed onto a device substrate or device component supported by a device substrate. The methods and systems provide means for making high-quality and low-cost photovoltaic devices, transferable semiconductor structures, (opto-)electronic devices and device components.

  18. Release strategies for making transferable semiconductor structures, devices and device components

    DOEpatents

    Rogers, John A [Champaign, IL; Nuzzo, Ralph G [Champaign, IL; Meitl, Matthew [Raleigh, NC; Ko, Heung Cho [Urbana, IL; Yoon, Jongseung [Urbana, IL; Menard, Etienne [Durham, NC; Baca, Alfred J [Urbana, IL

    2011-04-26

    Provided are methods for making a device or device component by providing a multilayer structure having a plurality of functional layers and a plurality of release layers and releasing the functional layers from the multilayer structure by separating one or more of the release layers to generate a plurality of transferable structures. The transferable structures are printed onto a device substrate or device component supported by a device substrate. The methods and systems provide means for making high-quality and low-cost photovoltaic devices, transferable semiconductor structures, (opto-)electronic devices and device components.

  19. Release strategies for making transferable semiconductor structures, devices and device components

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rogers, John A.; Nuzzo, Ralph G.; Meitl, Matthew

    2016-05-24

    Provided are methods for making a device or device component by providing a multi layer structure having a plurality of functional layers and a plurality of release layers and releasing the functional layers from the multilayer structure by separating one or more of the release layers to generate a plurality of transferable structures. The transferable structures are printed onto a device substrate or device component supported by a device substrate. The methods and systems provide means for making high-quality and low-cost photovoltaic devices, transferable semiconductor structures, (opto-)electronic devices and device components.

  20. 21 CFR 872.1745 - Laser fluorescence caries detection device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Laser fluorescence caries detection device. 872... SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1745 Laser fluorescence caries detection device. (a) Identification. A laser fluorescence caries detection device is a laser, a...

  1. Extending Wi-Fi Direct for Automated Operations

    DTIC Science & Technology

    2015-03-01

    functionalities. These added functionalities include: automatic device discovery, a mutual awareness of capabilities between devices (inter-device capability ...functionalities include: automatic device discove1y, a mutual awareness of capabilities between devices (inter-device capability awareness...Figure 7. P2P Device GO Negotiation Request (The P2P IE includes P2P Capability , P2P Device Info, Group Owner Intent, Configuration Timeout, Listen

  2. 21 CFR 884.5360 - Contraceptive intrauterine device (IUD) and introducer.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Contraceptive intrauterine device (IUD) and... Gynecological Therapeutic Devices § 884.5360 Contraceptive intrauterine device (IUD) and introducer. (a) Identification. A contraceptive intrauterine device (IUD) is a device used to prevent pregnancy. The device is...

  3. 21 CFR 884.5360 - Contraceptive intrauterine device (IUD) and introducer.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Contraceptive intrauterine device (IUD) and... Gynecological Therapeutic Devices § 884.5360 Contraceptive intrauterine device (IUD) and introducer. (a) Identification. A contraceptive intrauterine device (IUD) is a device used to prevent pregnancy. The device is...

  4. 21 CFR 884.5360 - Contraceptive intrauterine device (IUD) and introducer.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Contraceptive intrauterine device (IUD) and... Gynecological Therapeutic Devices § 884.5360 Contraceptive intrauterine device (IUD) and introducer. (a) Identification. A contraceptive intrauterine device (IUD) is a device used to prevent pregnancy. The device is...

  5. 21 CFR 884.5360 - Contraceptive intrauterine device (IUD) and introducer.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Contraceptive intrauterine device (IUD) and... Gynecological Therapeutic Devices § 884.5360 Contraceptive intrauterine device (IUD) and introducer. (a) Identification. A contraceptive intrauterine device (IUD) is a device used to prevent pregnancy. The device is...

  6. 21 CFR 884.5360 - Contraceptive intrauterine device (IUD) and introducer.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Contraceptive intrauterine device (IUD) and... Gynecological Therapeutic Devices § 884.5360 Contraceptive intrauterine device (IUD) and introducer. (a) Identification. A contraceptive intrauterine device (IUD) is a device used to prevent pregnancy. The device is...

  7. 21 CFR 872.2060 - Jaw tracking device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Jaw tracking device. 872.2060 Section 872.2060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2060 Jaw tracking device. (a) Jaw tracking device...

  8. 21 CFR 872.2060 - Jaw tracking device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Jaw tracking device. 872.2060 Section 872.2060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2060 Jaw tracking device. (a) Jaw tracking device...

  9. 21 CFR 872.2060 - Jaw tracking device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Jaw tracking device. 872.2060 Section 872.2060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2060 Jaw tracking device. (a) Jaw tracking device...

  10. 21 CFR 872.2060 - Jaw tracking device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Jaw tracking device. 872.2060 Section 872.2060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.2060 Jaw tracking device. (a) Jaw tracking device...

  11. 21 CFR 801.437 - User labeling for devices that contain natural rubber.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... User labeling for devices that contain natural rubber. (a) Data in the Medical Device Reporting System... of the device packaging, the outside package, container or wrapper, and the immediate device package... panel of the device packaging, the outside package, container or wrapper, and the immediate device...

  12. 21 CFR 801.437 - User labeling for devices that contain natural rubber.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... User labeling for devices that contain natural rubber. (a) Data in the Medical Device Reporting System... of the device packaging, the outside package, container or wrapper, and the immediate device package... panel of the device packaging, the outside package, container or wrapper, and the immediate device...

  13. 21 CFR 801.437 - User labeling for devices that contain natural rubber.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... User labeling for devices that contain natural rubber. (a) Data in the Medical Device Reporting System... of the device packaging, the outside package, container or wrapper, and the immediate device package... panel of the device packaging, the outside package, container or wrapper, and the immediate device...

  14. 21 CFR 801.437 - User labeling for devices that contain natural rubber.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... User labeling for devices that contain natural rubber. (a) Data in the Medical Device Reporting System... of the device packaging, the outside package, container or wrapper, and the immediate device package... panel of the device packaging, the outside package, container or wrapper, and the immediate device...

  15. 21 CFR 801.437 - User labeling for devices that contain natural rubber.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... User labeling for devices that contain natural rubber. (a) Data in the Medical Device Reporting System... of the device packaging, the outside package, container or wrapper, and the immediate device package... panel of the device packaging, the outside package, container or wrapper, and the immediate device...

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bolenbaugh, Jonathan M.; Naqi, Syed

    A method to operate a clutch device in an electro-mechanical transmission mechanically-operatively coupled to an internal combustion engine and at least one electric machine includes, in response to a failure condition detected within a flow control device configured to facilitate flow of hydraulic fluid for operating the clutch device, selectively preventing the flow of hydraulic fluid from entering the flow control device and feeding the clutch device. Synchronization of the clutch device is initiated when the clutch device is intended for activation, and only if the clutch device is synchronized, the flow of hydraulic fluid is selectively permitted to entermore » the flow control device to activate the clutch device.« less

  17. Evaluation of an investigational wearable injector in healthy human volunteers.

    PubMed

    Torjman, Marc C; Machnicki, Robert; Lessin, Jennifer; Loeum, Channy; Steinberger, Douglas; Mycroft, Sarah; Joseph, Jeffrey I

    2017-01-01

    Introduction of a wearable device for subcutaneous delivery of larger volume bolus injections would encourage patient compliance and reduce the burden on healthcare services. With one such wearable device commercially available, this study examined the safety and functionality of an investigational device in volunteers. Four devices were applied to the subject's abdomen: 1) Investigational Device, 2) Investigational Device: subject movement, 3) Control Device: FDA-cleared syringe driver with FDA-cleared infusion set, 4) Control Device: FDA-cleared syringe driver attached to investigational device. Three milliliters of saline were infused through the four devices over 3 minutes. 84 devices were applied to 21 subjects. Three milliliters of saline were safely delivered subcutaneously from the investigational and control devices. Two control devices had occlusions and in each case the pump reached its high pressure limit of 12 psi. VAS pain measurements showed minimal pain for all subjects. Pain scores were significantly (p < 0.001) higher than baseline at the end of injection: mean pain level ranged from 2.0-22.0 mm. The investigational device performed as intended with minimal pain during needle insertion and infusion, and no leaking of fluid at the skin puncture site. Two occlusions occurred with the control devices.

  18. The role of Cra in regulating acetate excretion and osmotic tolerance in E. coli K-12 and E. coli B at high density growth

    PubMed Central

    2011-01-01

    Background E. coli B (BL21), unlike E.coli K-12 (JM109) is insensitive to glucose concentration and, therefore, grows faster and produces less acetate than E. coli K-12, especially when growing to high cell densities at high glucose concentration. By performing genomic analysis, it was demonstrated that the cause of this difference in sensitivity to the glucose concentration is the result of the differences in the central carbon metabolism activity. We hypothesized that the global transcription regulator Cra (FruR) is constitutively expressed in E. coli B and may be responsible for the different behaviour of the two strains. To investigate this possibility and better understand the function of Cra in the two strains, cra - negative E. coli B (BL21) and E. coli K-12 (JM109) were prepared and their growth behaviour and gene expression at high glucose were evaluated using microarray and real-time PCR. Results The deletion of the cra gene in E. coli B (BL21) minimally affected the growth and maximal acetate accumulation, while the deletion of the same gene in E.coli K-12 (JM109) caused the cells to stop growing as soon as acetate concentration reached 6.6 g/L and the media conductivity reached 21 mS/cm. ppsA (gluconeogenesis gene), aceBA (the glyoxylate shunt genes) and poxB (the acetate producing gene) were down-regulated in both strains, while acs (acetate uptake gene) was down-regulated only in E.coli B (BL21). These transcriptional differences had little effect on acetate and pyruvate production. Additionally, it was found that the lower growth of E. coli K-12 (JM109) strain was the result of transcription inhibition of the osmoprotectant producing bet operon (betABT). Conclusions The transcriptional changes caused by the deletion of cra gene did not affect the activity of the central carbon metabolism, suggesting that Cra does not act alone; rather it interacts with other pleiotropic regulators to create a network of metabolic effects. An unexpected outcome of this work is the finding that cra deletion caused transcription inhibition of the bet operon in E. coli K-12 (JM109) but did not affect this operon transcription in E. coli B (BL21). This property, together with the insensitivity to high glucose concentrations, makes this the E. coli B (BL21) strain more resistant to environmental changes. PMID:21718532

  19. 77 FR 18829 - Gastroenterology and Urology Devices Panel of the Medical Devices Advisory Committee; Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-28

    ...] Gastroenterology and Urology Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting AGENCY... public. Name of Committee: Gastroenterology and Urology Devices Panel of the Medical Devices Advisory... and 11, 2012, the committee will discuss general issues related to medical devices intended for obese...

  20. 78 FR 77688 - Ophthalmic Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-24

    ...] Ophthalmic Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting AGENCY: Food and Drug...: Ophthalmic Devices Panel of the Medical Devices Advisory Committee. General Function of the Committee: To... Swink, Center for Devices and Radiological Health, Food and Drug Administration, 10903 New Hampshire Ave...

  1. 21 CFR 880.6310 - Medical device data system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... medical device data; (ii) The electronic storage of medical device data; (iii) The electronic conversion... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Medical device data system. 880.6310 Section 880... Devices § 880.6310 Medical device data system. (a) Identification. (1) A medical device data system (MDDS...

  2. 21 CFR 880.6310 - Medical device data system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... medical device data; (ii) The electronic storage of medical device data; (iii) The electronic conversion... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Medical device data system. 880.6310 Section 880... Devices § 880.6310 Medical device data system. (a) Identification. (1) A medical device data system (MDDS...

  3. 21 CFR 880.6310 - Medical device data system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... medical device data; (ii) The electronic storage of medical device data; (iii) The electronic conversion... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Medical device data system. 880.6310 Section 880... Devices § 880.6310 Medical device data system. (a) Identification. (1) A medical device data system (MDDS...

  4. 21 CFR 880.6310 - Medical device data system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... medical device data; (ii) The electronic storage of medical device data; (iii) The electronic conversion... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Medical device data system. 880.6310 Section 880... Devices § 880.6310 Medical device data system. (a) Identification. (1) A medical device data system (MDDS...

  5. 76 FR 29006 - In the Matter of Certain Motion-Sensitive Sound Effects Devices and Image Display Devices and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-19

    ... Effects Devices and Image Display Devices and Components and Products Containing Same; Notice of... United States after importation of certain motion-sensitive sound effects devices and image display... devices and image display devices and components and products containing same that infringe one or more of...

  6. CONTROL LIMITER DEVICE

    DOEpatents

    DeShong, J.A.

    1960-03-01

    A control-limiting device for monltoring a control system is described. The system comprises a conditionsensing device, a condition-varying device exerting a control over the condition, and a control means to actuate the condition-varying device. A control-limiting device integrates the total movement or other change of the condition-varying device over any interval of time during a continuum of overlapping periods of time, and if the tothl movement or change of the condition-varying device exceeds a preset value, the control- limiting device will switch the control of the operated apparatus from automatic to manual control.

  7. Eager protocol on a cache pipeline dataflow

    DOEpatents

    Ohmacht, Martin; Sugavanam, Krishnan

    2012-11-13

    A master device sends a request to communicate with a slave device to a switch. The master device waits for a period of cycles the switch takes to decide whether the master device can communicate with the slave device, and the master device sends data associated with the request to communicate at least after the period of cycles has passed since the master device sent the request to communicate to the switch without waiting to receive an acknowledgment from the switch that the master device can communicate with the slave device.

  8. Two Different Maintenance Strategies in the Hospital Environment: Preventive Maintenance for Older Technology Devices and Predictive Maintenance for Newer High-Tech Devices.

    PubMed

    Sezdi, Mana

    2016-01-01

    A maintenance program generated through the consideration of characteristics and failures of medical equipment is an important component of technology management. However, older technology devices and newer high-tech devices cannot be efficiently managed using the same strategies because of their different characteristics. This study aimed to generate a maintenance program comprising two different strategies to increase the efficiency of device management: preventive maintenance for older technology devices and predictive maintenance for newer high-tech devices. For preventive maintenance development, 589 older technology devices were subjected to performance verification and safety testing (PVST). For predictive maintenance development, the manufacturers' recommendations were used for 134 high-tech devices. These strategies were evaluated in terms of device reliability. This study recommends the use of two different maintenance strategies for old and new devices at hospitals in developing countries. Thus, older technology devices that applied only corrective maintenance will be included in maintenance like high-tech devices.

  9. Two Different Maintenance Strategies in the Hospital Environment: Preventive Maintenance for Older Technology Devices and Predictive Maintenance for Newer High-Tech Devices

    PubMed Central

    Sezdi, Mana

    2016-01-01

    A maintenance program generated through the consideration of characteristics and failures of medical equipment is an important component of technology management. However, older technology devices and newer high-tech devices cannot be efficiently managed using the same strategies because of their different characteristics. This study aimed to generate a maintenance program comprising two different strategies to increase the efficiency of device management: preventive maintenance for older technology devices and predictive maintenance for newer high-tech devices. For preventive maintenance development, 589 older technology devices were subjected to performance verification and safety testing (PVST). For predictive maintenance development, the manufacturers' recommendations were used for 134 high-tech devices. These strategies were evaluated in terms of device reliability. This study recommends the use of two different maintenance strategies for old and new devices at hospitals in developing countries. Thus, older technology devices that applied only corrective maintenance will be included in maintenance like high-tech devices. PMID:27195666

  10. Radiology of cardiac devices and their complications

    PubMed Central

    Dipoce, J; Spindola-Franco, H

    2015-01-01

    This article familiarizes the reader with several different cardiac devices including pacemakers and implantable cardioverter defibrillators, intra-aortic balloon pumps, ventricular assist devices, valve replacements and repairs, shunt-occluding devices and passive constraint devices. Many cardiac devices are routinely encountered in clinical practice. Other devices are in the early stages of development, but circumstances suggest that they too will become commonly found. The radiologist must be familiar with these devices and their complications. PMID:25411826

  11. Wireless device monitoring systems and monitoring devices, and associated methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCown, Steven H; Derr, Kurt W; Rohde, Kenneth W

    Wireless device monitoring systems and monitoring devices include a communications module for receiving wireless communications of a wireless device. Processing circuitry is coupled with the communications module and configured to process the wireless communications to determine whether the wireless device is authorized or unauthorized to be present at the monitored area based on identification information of the wireless device. Methods of monitoring for the presence and identity of wireless devices are also provided.

  12. Localized electrical fine tuning of passive microwave and radio frequency devices

    DOEpatents

    Findikoglu, Alp T.

    2001-04-10

    A method and apparatus for the localized electrical fine tuning of passive multiple element microwave or RF devices in which a nonlinear dielectric material is deposited onto predetermined areas of a substrate containing the device. An appropriate electrically conductive material is deposited over predetermined areas of the nonlinear dielectric and the signal line of the device for providing electrical contact with the nonlinear dielectric. Individual, adjustable bias voltages are applied to the electrically conductive material allowing localized electrical fine tuning of the devices. The method of the present invention can be applied to manufactured devices, or can be incorporated into the design of the devices so that it is applied at the time the devices are manufactured. The invention can be configured to provide localized fine tuning for devices including but not limited to coplanar waveguides, slotline devices, stripline devices, and microstrip devices.

  13. Processing module operating methods, processing modules, and communications systems

    DOEpatents

    McCown, Steven Harvey; Derr, Kurt W.; Moore, Troy

    2014-09-09

    A processing module operating method includes using a processing module physically connected to a wireless communications device, requesting that the wireless communications device retrieve encrypted code from a web site and receiving the encrypted code from the wireless communications device. The wireless communications device is unable to decrypt the encrypted code. The method further includes using the processing module, decrypting the encrypted code, executing the decrypted code, and preventing the wireless communications device from accessing the decrypted code. Another processing module operating method includes using a processing module physically connected to a host device, executing an application within the processing module, allowing the application to exchange user interaction data communicated using a user interface of the host device with the host device, and allowing the application to use the host device as a communications device for exchanging information with a remote device distinct from the host device.

  14. Wafer bonded epitaxial templates for silicon heterostructures

    DOEpatents

    Atwater, Jr., Harry A.; Zahler, James M [Pasadena, CA; Morral, Anna Fontcubera I [Paris, FR

    2008-03-11

    A heterostructure device layer is epitaxially grown on a virtual substrate, such as an InP/InGaAs/InP double heterostructure. A device substrate and a handle substrate form the virtual substrate. The device substrate is bonded to the handle substrate and is composed of a material suitable for fabrication of optoelectronic devices. The handle substrate is composed of a material suitable for providing mechanical support. The mechanical strength of the device and handle substrates is improved and the device substrate is thinned to leave a single-crystal film on the virtual substrate such as by exfoliation of a device film from the device substrate. An upper portion of the device film exfoliated from the device substrate is removed to provide a smoother and less defect prone surface for an optoelectronic device. A heterostructure is epitaxially grown on the smoothed surface in which an optoelectronic device may be fabricated.

  15. Photoelectrochemically driven self-assembly method

    DOEpatents

    Nielson, Gregory N.; Okandan, Murat

    2017-01-17

    Various technologies described herein pertain to assembling electronic devices into a microsystem. The electronic devices are disposed in a solution. Light can be applied to the electronic devices in the solution. The electronic devices can generate currents responsive to the light applied to the electronic devices in the solution, and the currents can cause electrochemical reactions that functionalize regions on surfaces of the electronic devices. Additionally or alternatively, the light applied to the electronic devices in the solution can cause the electronic devices to generate electric fields, which can orient the electronic devices and/or induce movement of the electronic devices with respect to a receiving substrate. Further, electrodes on a receiving substrate can be biased to attract and form connections with the electronic devices having the functionalized regions on the surfaces. The microsystem can include the receiving substrate and the electronic devices connected to the receiving substrate.

  16. Wafer bonded epitaxial templates for silicon heterostructures

    NASA Technical Reports Server (NTRS)

    Atwater, Harry A., Jr. (Inventor); Zahler, James M. (Inventor); Morral, Anna Fontcubera I (Inventor)

    2008-01-01

    A heterostructure device layer is epitaxially grown on a virtual substrate, such as an InP/InGaAs/InP double heterostructure. A device substrate and a handle substrate form the virtual substrate. The device substrate is bonded to the handle substrate and is composed of a material suitable for fabrication of optoelectronic devices. The handle substrate is composed of a material suitable for providing mechanical support. The mechanical strength of the device and handle substrates is improved and the device substrate is thinned to leave a single-crystal film on the virtual substrate such as by exfoliation of a device film from the device substrate. An upper portion of the device film exfoliated from the device substrate is removed to provide a smoother and less defect prone surface for an optoelectronic device. A heterostructure is epitaxially grown on the smoothed surface in which an optoelectronic device may be fabricated.

  17. Event-recording devices with identification codes

    NASA Technical Reports Server (NTRS)

    Watters, David G. (Inventor); Huestis, David L. (Inventor); Bahr, Alfred J. (Inventor); Vidmar, Robert J. (Inventor)

    2003-01-01

    A recording device allows wireless interrogation to determine its identity and its state. The state indicates whether one or more physical or chemical events have taken place. In effect, the one or more physical or chemical events are recorded by the device. The identity of the device allows it to be distinguished from a number of similar devices. The recording device may be used in an array of devices that allows wireless probing by an interrogation unit. When probed, each device tells the interrogator who it is and what state it is in. The devices allow multiple use and the interrogator may use a logical reset to determine the state of each device. The interrogator can thus easily identify particular items in an array that have reached a particular condition. The device may record the status of each device in a database to maintain a history for each.

  18. Evaluation of Tissue Interactions with Mechanical Elements of a Transscleral Drug Delivery Device

    PubMed Central

    Cohen, Sarah J.; Chan, Robison V. Paul; Keegan, Mark; Andreoli, Christopher M.; Borenstein, Jeffrey T.; Miller, Joan W.; Gragoudas, Evangelos S.

    2012-01-01

    The goal of this work was to evaluate tissue-device interactions due to implantation of a mechanically operated drug delivery system onto the posterior sclera. Two test devices were designed and fabricated to model elements of the drug delivery device—one containing a free-spinning ball bearing and the other encasing two articulating gears. Openings in the base of test devices modeled ports for drug passage from device to sclera. Porous poly(tetrafluoroethylene) (PTFE) membranes were attached to half of the gear devices to minimize tissue ingrowth through these ports. Test devices were sutured onto rabbit eyes for 10 weeks. Tissue-device interactions were evaluated histologically and mechanically after removal to determine effects on device function and changes in surrounding tissue. Test devices were generally well-tolerated during residence in the animal. All devices encouraged fibrous tissue formation between the sclera and the device, fibrous tissue encapsulation and invasion around the device, and inflammation of the conjunctiva. Gear devices encouraged significantly greater inflammation in all cases and a larger rate of tissue ingrowth. PTFE membranes prevented tissue invasion through the covered drug ports, though tissue migrated in through other smaller openings. The torque required to turn the mechanical elements increased over 1000 times for gear devices, but only on the order of 100 times for membrane-covered gear devices and less than 100 times for ball bearing devices. Maintaining a lower device profile, minimizing microscale motion on the eye surface and covering drug ports with a porous membrane may minimize inflammation, decreasing the risk of damage to surrounding tissues and minimizing disruption of device operation. PMID:24300189

  19. What people know about electronic devices: A descriptive study

    NASA Astrophysics Data System (ADS)

    Kieras, D. E.

    1982-10-01

    Informal descriptive results on the nature of people's natural knowledge of electronic devices are presented. Expert and nonexpert subjects were given an electronic device to examine and describe orally. The devices ranged from familiar everyday devices, to those familiar only to the expert, to unusual devices unfamiliar even to an expert. College students were asked to describe everyday devices from memory. The results suggest that device knowledge consists of the major categories of what the device is for, how it is used, its structure in terms of subdevices, its physical layout, how it works, and its behavior. A preliminary theoretical framework for device knowledge is that it consists of a hierarchy of schemas, corresponding to a hierarchial decomposition of the device into subdevices, with each level containing the major categories of information.

  20. 75 FR 35495 - Ophthalmic Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-22

    ...] Ophthalmic Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting AGENCY: Food and Drug...: Ophthalmic Devices Panel of the Medical Devices Advisory Committee. General Function of the Committee: To... Glaukos iStent Trabecular Micro-Bypass Stent, Model GTS-100 L/R, sponsored by Glaukos Corp. The device is...

  1. 76 FR 50485 - Obstetrics and Gynecology Devices Panel of the Medical Devices Advisory Committee; Amendment of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-15

    ...] Obstetrics and Gynecology Devices Panel of the Medical Devices Advisory Committee; Amendment of Notice AGENCY... an amendment to the notice of meeting of the Obstetrics and Gynecology Devices Panel of the Medical... Obstetrics and Gynecology Devices Panel of the Medical Devices Advisory Committee would be held on September...

  2. 75 FR 61507 - General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Amendment of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-05

    ...] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Amendment of Notice... announcing an amendment to the notice of meeting of the General and Plastic Surgery Devices Panel of the..., FDA announced that a meeting of the General and Plastic Surgery Devices Panel of the Medical Devices...

  3. Hardware device binding and mutual authentication

    DOEpatents

    Hamlet, Jason R; Pierson, Lyndon G

    2014-03-04

    Detection and deterrence of device tampering and subversion by substitution may be achieved by including a cryptographic unit within a computing device for binding multiple hardware devices and mutually authenticating the devices. The cryptographic unit includes a physically unclonable function ("PUF") circuit disposed in or on the hardware device, which generates a binding PUF value. The cryptographic unit uses the binding PUF value during an enrollment phase and subsequent authentication phases. During a subsequent authentication phase, the cryptographic unit uses the binding PUF values of the multiple hardware devices to generate a challenge to send to the other device, and to verify a challenge received from the other device to mutually authenticate the hardware devices.

  4. 78 FR 1247 - Certain Electronic Devices, Including Wireless Communication Devices, Tablet Computers, Media...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... Wireless Communication Devices, Tablet Computers, Media Players, and Televisions, and Components Thereof... devices, including wireless communication devices, tablet computers, media players, and televisions, and... wireless communication devices, tablet computers, media players, and televisions, and components thereof...

  5. Tracking down a solution: exploring the acceptability and value of wearable GPS devices for older persons, individuals with a disability and their support persons.

    PubMed

    Williamson, Brittany; Aplin, Tammy; de Jonge, Desleigh; Goyne, Matthew

    2017-11-01

    To explore the acceptability and value of three wearable GPS devices for older persons and individuals with a disability and safety concerns when accessing the community. This pilot study explored six wearers' and their support persons' experience of using three different wearable GPS devices (a pendant, watch, and mini GPS phone), each for a two-week period. Participants identified safety as the main value of using a wearable GPS device. The acceptability and value of these devices was strongly influenced by device features, ease of use, cost, appearance, the reliability of the GPS coordinates, the wearer's health condition and the users familiarity with technology. Overall, participants indicated that they preferred the pendant. Wearable GPS devices are potentially useful in providing individuals who have safety concerns with reassurance and access to assistance as required. To ensure successful utilization, future device design and device selection should consider the user's familiarity with technology and their health condition. This study also revealed that not all wearable GPS devices provide continuous location tracking. It is therefore critical to ensure that the device's location tracking functions address the wearer's requirements and reason for using the device. Implications for Rehabilitation The acceptability and usability of wearable GPS devices is strongly influenced by the device features, ease of use, cost, appearance, the reliability of the device to provide accurate and timely GPS coordinates, as well as the health condition of the wearer and their familiarity with technology. Wearable GPS devices need to be simple to use and support and training is essential to ensure they are successfully utilized. Not all wearable GPS devices provide continuous location tracking and accuracy of location is impacted by line of sight to satellites. Therefore, care needs to be taken when choosing a suitable device, to ensure that the device's location tracking features are based on the wearer's requirements and value behind using the device.

  6. Techniques for trans-catheter retrieval of embolized Nit-Occlud® PDA-R and ASD-R devices.

    PubMed

    Sinha, Sanjay; Levi, Daniel; Peirone, Alejandro; Pedra, Carlos

    2018-02-15

    Nit-Occlud ® (atrial septal defect) ASD-R and (patent ductus arteriosus) PDA-R devices are used outside the United States for percutaneous closure of the patent ductus arteriosus and atrial septal defects. When embolization occurs, these devices have been difficult to retrieve. Bench simulations of retrieval of PDA-R and ASD-R devices were performed in a vascular model. Retrieval of each device was attempted using snare techniques or with bioptome forceps with a range of devices. The same devices were then intentionally embolized in an animal model. Retrieval methods were systematically tested in a range of sheath sizes, and graded in terms of difficulty and retrieval time. Devices that were grasped by the bioptome in the center of the proximal part of the devices were easily retrieved in both models. Bench studies determined the minimum sheath sizes needed for retrieval of each device with this method. In general sheathes two french sizes greater than the delivery sheath were successful with this technique. Three out of the four PDA-R devices were successfully retrieved in vivo. Two were retrieved by grasping the middle of the PA end of the PDA-R device with a Maslanka bioptome and one small PDA-R device was retrieved using a 10 mm Snare. Four of the five ASD-R devices were retrieved successfully grasping the right atrial ASD-R disc or by passing a wire through the device and snaring this loop. For ASD-R 28 and 30 mm devices, a double bioptome technique was needed to retrieve the device. ASD-R and PDA-R devices can be successfully retrieved in the catheterization lab. It is critical to grab the center portion of the right atrial disc of the ASD-R device or pulmonary portion of the PDA-R device and to use adequately sized sheathes. © 2018 Wiley Periodicals, Inc.

  7. Applications and Methods of Operating a Three-dimensional Nano-electro-mechanical Resonator and Related Devices

    NASA Technical Reports Server (NTRS)

    Kaul, Anupama B. (Inventor); Epp, Larry W. (Inventor); Bagge, Leif (Inventor)

    2013-01-01

    Carbon nanofiber resonator devices, methods for use, and applications of said devices are disclosed. Carbon nanofiber resonator devices can be utilized in or as high Q resonators. Resonant frequency of these devices is a function of configuration of various conducting components within these devices. Such devices can find use, for example, in filtering and chemical detection.

  8. Current state of medical device nomenclature and taxonomy systems in the UK: spotlight on GMDN and SNOMED CT

    PubMed Central

    White, Judith; Carolan-Rees, Grace

    2013-01-01

    A standardised terminology for describing medical devices can enable safe and unambiguous exchange of information. Proposed changes to EU-wide medical devices regulations mandate the use of such a system. This article reviews two important classification systems for medical devices in the UK. The Global Medical Device Nomenclature (GMDN) provides a classification system specifically for medical devices and diagnostics, and facilitates data exchange between manufacturers and regulators. SNOMED CT is the terminology of choice in the NHS for communicating, sharing and storing information about patients’ healthcare episodes. Harmonisation of GMDN and SNOMED CT will encourage use of single terminology throughout the lifetime of a device; from regulatory approval through clinical use and post-marketing surveillance. Manufacturers will be required to register medical devices with a European device database (Eudamed) and to fit certain devices with a Unique Device Identifier; both are efforts to improve transparency and traceability of medical devices. Successful implementation of these elements depends on having a consistent nomenclature for medical devices. PMID:23885299

  9. Examining the Relationship between Parental Involvement and Mobile Technology Use

    NASA Astrophysics Data System (ADS)

    Flowers, Toinette M.

    Understanding how mobile devices can enhance parent/teacher communication is important because parents play an important part in their children's learning. Research on parents' use of mobile devices to communicate with their children's teachers is limited. The purpose of this cross-sectional correlational study was to determine the relationships between parents' (a) knowledge of using mobile devices, (b) general use of mobile devices, (c) purpose for using mobile devices, (d) perceived ease of using mobile devices, (e) perceived usefulness of mobile devices, (f) attitude toward using mobile devices, and (g) use of mobile devices to communicate with teachers. The study was informed by the technology acceptance model and used a participant pool of 73 parents of high school students attending a Title I high school in a large Midwestern city in the United States. Data were collected using an online survey and analyzed using Pearson's correlations. The study results indicate significant correlations between parents' use of mobile devices to communicate with teachers and knowledge of using mobile devices, purpose for using mobile devices, perceived ease of using mobile devices, perceived usefulness of mobile devices, and attitudes toward using mobile devices. These findings suggest that parental use of mobile devices to communicate with teachers can be enhanced by administrators and school personnel using strategies that consider parents' and the school culture. Social implication includes sharing the results of this study with district and school administrators who have the power to implement programs that encourage and support the use of mobile devices as a communication tool between parents and teachers, therefore increasing parental involvement and ultimately student academic success.

  10. 21 CFR 882.5050 - Biofeedback device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Biofeedback device. 882.5050 Section 882.5050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Therapeutic Devices § 882.5050 Biofeedback device. (a...

  11. 21 CFR 872.3660 - Impression material.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3660 Impression material. (a) Identification. Impression material is a device composed of materials such as alginate or polysulfide intended to be placed... device is intended to provide models for study and for production of restorative prosthetic devices, such...

  12. 21 CFR 872.3660 - Impression material.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...) MEDICAL DEVICES DENTAL DEVICES Prosthetic Devices § 872.3660 Impression material. (a) Identification. Impression material is a device composed of materials such as alginate or polysulfide intended to be placed... device is intended to provide models for study and for production of restorative prosthetic devices, such...

  13. 78 FR 24775 - Certain Wireless Communication Devices, Portable Music and Data Processing Devices, Computers and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-26

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-745] Certain Wireless Communication Devices, Portable Music and Data Processing Devices, Computers and Components Thereof; Commission Decision... importation of certain wireless communication devices, portable music and data processing devices, computers...

  14. 78 FR 12785 - Certain Wireless Communication Devices, Portable Music and Data Processing Devices, Computers and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-25

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-745] Certain Wireless Communication Devices, Portable Music and Data Processing Devices, Computers and Components Thereof; Commission Decision... importation of certain wireless communication devices, portable music and data processing devices, computers...

  15. Three fundamental devices in one: a reconfigurable multifunctional device in two-dimensional WSe2

    NASA Astrophysics Data System (ADS)

    Dhakras, Prathamesh; Agnihotri, Pratik; Lee, Ji Ung

    2017-06-01

    The three pillars of semiconductor device technologies are (1) the p-n diode, (2) the metal-oxide-semiconductor field-effect transistor and (3) the bipolar junction transistor. They have enabled the unprecedented growth in the field of information technology that we see today. Until recently, the technological revolution for better, faster and more efficient devices has been governed by scaling down the device dimensions following Moore’s Law. With the slowing of Moore’s law, there is a need for alternative materials and computing technologies that can continue the advancement in functionality. Here, we describe a single, dynamically reconfigurable device that implements these three fundamental device functions. The device uses buried gates to achieve n- and p-channels and fits into a larger effort to develop devices with enhanced functionalities, including logic functions, over device scaling. As they are all surface conducting devices, we use one material parameter, the interface trap density of states, to describe the key figure-of-merit of each device.

  16. Content analysis of Australian direct-to-consumer websites for emerging breast cancer imaging devices.

    PubMed

    Vreugdenburg, Thomas D; Laurence, Caroline O; Willis, Cameron D; Mundy, Linda; Hiller, Janet E

    2014-09-01

    To describe the nature and frequency of information presented on direct-to-consumer websites for emerging breast cancer imaging devices. Content analysis of Australian website advertisements from 2 March 2011 to 30 March 2012, for three emerging breast cancer imaging devices: digital infrared thermal imaging, electrical impedance scanning and electronic palpation imaging. Type of imaging offered, device safety, device performance, application of device, target population, supporting evidence and comparator tests. Thirty-nine unique Australian websites promoting a direct-to-consumer breast imaging device were identified. Despite a lack of supporting evidence, 22 websites advertised devices for diagnosis, 20 advertised devices for screening, 13 advertised devices for prevention and 13 advertised devices for identifying breast cancer risk factors. Similarly, advertised ranges of diagnostic sensitivity (78%-99%) and specificity (44%-91%) were relatively high compared with published literature. Direct comparisons with conventional screening tools that favoured the new device were highly prominent (31 websites), and one-third of websites (12) explicitly promoted their device as a suitable alternative. Australian websites for emerging breast imaging devices, which are also available internationally, promote the use of such devices as safe and effective solutions for breast cancer screening and diagnosis in a range of target populations. Many of these claims are not supported by peer-reviewed evidence, raising questions about the manner in which these devices and their advertising material are regulated, particularly when they are promoted as direct alternatives to established screening interventions.

  17. Lossless hybridization between photovoltaic and thermoelectric devices.

    PubMed

    Park, Kwang-Tae; Shin, Sun-Mi; Tazebay, Abdullah S; Um, Han-Don; Jung, Jin-Young; Jee, Sang-Won; Oh, Min-Wook; Park, Su-Dong; Yoo, Bongyoung; Yu, Choongho; Lee, Jung-Ho

    2013-01-01

    The optimal hybridization of photovoltaic (PV) and thermoelectric (TE) devices has long been considered ideal for the efficient harnessing solar energy. Our hybrid approach uses full spectrum solar energy via lossless coupling between PV and TE devices while collecting waste energy from thermalization and transmission losses from PV devices. Achieving lossless coupling makes the power output from the hybrid device equal to the sum of the maximum power outputs produced separately from individual PV and TE devices. TE devices need to have low internal resistances enough to convey photo-generated currents without sacrificing the PV fill factor. Concomitantly, a large number of p-n legs are preferred to drive a high Seebeck voltage in TE. Our simple method of attaching a TE device to a PV device has greatly improved the conversion efficiency and power output of the PV device (~30% at a 15°C temperature gradient across a TE device).

  18. Lossless hybridization between photovoltaic and thermoelectric devices

    PubMed Central

    Park, Kwang-Tae; Shin, Sun-Mi; Tazebay, Abdullah S.; Um, Han-Don; Jung, Jin-Young; Jee, Sang-Won; Oh, Min-Wook; Park, Su-Dong; Yoo, Bongyoung; Yu, Choongho; Lee, Jung-Ho

    2013-01-01

    The optimal hybridization of photovoltaic (PV) and thermoelectric (TE) devices has long been considered ideal for the efficient harnessing solar energy. Our hybrid approach uses full spectrum solar energy via lossless coupling between PV and TE devices while collecting waste energy from thermalization and transmission losses from PV devices. Achieving lossless coupling makes the power output from the hybrid device equal to the sum of the maximum power outputs produced separately from individual PV and TE devices. TE devices need to have low internal resistances enough to convey photo-generated currents without sacrificing the PV fill factor. Concomitantly, a large number of p-n legs are preferred to drive a high Seebeck voltage in TE. Our simple method of attaching a TE device to a PV device has greatly improved the conversion efficiency and power output of the PV device (~30% at a 15°C temperature gradient across a TE device). PMID:23820973

  19. 21 CFR 882.4250 - Cryogenic surgical device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cryogenic surgical device. 882.4250 Section 882.4250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Surgical Devices § 882.4250 Cryogenic surgical device...

  20. 21 CFR 882.4250 - Cryogenic surgical device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cryogenic surgical device. 882.4250 Section 882.4250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Surgical Devices § 882.4250 Cryogenic surgical device...

  1. 21 CFR 872.1870 - Sulfide detection device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Sulfide detection device. 872.1870 Section 872.1870 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1870 Sulfide detection device. (a) Identification...

  2. 21 CFR 872.1740 - Caries detection device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Caries detection device. 872.1740 Section 872.1740 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1740 Caries detection device. (a) Identification...

  3. 21 CFR 872.1740 - Caries detection device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Caries detection device. 872.1740 Section 872.1740 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1740 Caries detection device. (a) Identification...

  4. 78 FR 68853 - International Medical Device Regulators Forum; Medical Device Single Audit Program International...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-15

    ...] International Medical Device Regulators Forum; Medical Device Single Audit Program International Coalition Pilot... Drug Administration (FDA) is announcing participation in the Medical Device Single Audit Program International Coalition Pilot Program. The Medical Device Single Audit Program (MDSAP) was designed and...

  5. 21 CFR 866.2580 - Gas-generating device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Gas-generating device. 866.2580 Section 866.2580 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2580 Gas-generating device...

  6. 21 CFR 866.2580 - Gas-generating device.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Gas-generating device. 866.2580 Section 866.2580 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2580 Gas-generating device...

  7. 21 CFR 866.2580 - Gas-generating device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Gas-generating device. 866.2580 Section 866.2580 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2580 Gas-generating device...

  8. 21 CFR 866.2580 - Gas-generating device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Gas-generating device. 866.2580 Section 866.2580 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2580 Gas-generating device...

  9. 21 CFR 866.2580 - Gas-generating device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Gas-generating device. 866.2580 Section 866.2580 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2580 Gas-generating device...

  10. 77 FR 52759 - Certain Wireless Communication Devices, Portable Music and Data Processing Devices, Computers and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-30

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-745] Certain Wireless Communication Devices, Portable Music and Data Processing Devices, Computers and Components Thereof; Notice of... communication devices, portable music and data processing devices, computers and components thereof by reason of...

  11. 77 FR 51571 - Certain Wireless Communication Devices, Portable Music and Data Processing Devices, Computers...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-24

    ... Music and Data Processing Devices, Computers, and Components Thereof; Notice of Receipt of Complaint... complaint entitled Wireless Communication Devices, Portable Music and Data Processing Devices, Computers..., portable music and data processing devices, computers, and components thereof. The complaint names as...

  12. 21 CFR 874.5840 - Antistammering device.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Antistammering device. 874.5840 Section 874.5840 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES EAR, NOSE, AND THROAT DEVICES Therapeutic Devices § 874.5840 Antistammering device. (a...

  13. 21 CFR 874.5840 - Antistammering device.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Antistammering device. 874.5840 Section 874.5840 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES EAR, NOSE, AND THROAT DEVICES Therapeutic Devices § 874.5840 Antistammering device. (a...

  14. 21 CFR 874.5840 - Antistammering device.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Antistammering device. 874.5840 Section 874.5840 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES EAR, NOSE, AND THROAT DEVICES Therapeutic Devices § 874.5840 Antistammering device. (a...

  15. 21 CFR 874.5840 - Antistammering device.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Antistammering device. 874.5840 Section 874.5840 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES EAR, NOSE, AND THROAT DEVICES Therapeutic Devices § 874.5840 Antistammering device. (a...

  16. 21 CFR 810.10 - Cease distribution and notification order.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... (CONTINUED) MEDICAL DEVICES MEDICAL DEVICE RECALL AUTHORITY Mandatory Medical Device Recall Procedures § 810... usual name of the device; (iii) The model, catalog, or product code numbers of the device; and (iv) The... opportunity to consult with the agency, FDA finds that there is a reasonable probability that a device...

  17. 21 CFR 810.10 - Cease distribution and notification order.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... (CONTINUED) MEDICAL DEVICES MEDICAL DEVICE RECALL AUTHORITY Mandatory Medical Device Recall Procedures § 810... usual name of the device; (iii) The model, catalog, or product code numbers of the device; and (iv) The... opportunity to consult with the agency, FDA finds that there is a reasonable probability that a device...

  18. 21 CFR 884.5380 - Contraceptive tubal occlusion device (TOD) and introducer.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Contraceptive tubal occlusion device (TOD) and... Gynecological Therapeutic Devices § 884.5380 Contraceptive tubal occlusion device (TOD) and introducer. (a) Identification. A contraceptive tubal occlusion device (TOD) and introducer is a device designed to close a...

  19. 21 CFR 884.5380 - Contraceptive tubal occlusion device (TOD) and introducer.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Contraceptive tubal occlusion device (TOD) and... Gynecological Therapeutic Devices § 884.5380 Contraceptive tubal occlusion device (TOD) and introducer. (a) Identification. A contraceptive tubal occlusion device (TOD) and introducer is a device designed to close a...

  20. 21 CFR 884.5380 - Contraceptive tubal occlusion device (TOD) and introducer.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Contraceptive tubal occlusion device (TOD) and... Gynecological Therapeutic Devices § 884.5380 Contraceptive tubal occlusion device (TOD) and introducer. (a) Identification. A contraceptive tubal occlusion device (TOD) and introducer is a device designed to close a...

Top