Science.gov

Sample records for atp-binding site lesions

  1. Functionally Important ATP Binding and Hydrolysis Sites in Escherichia coli MsbA †

    PubMed Central

    Westfahl, Kathryn M.; Merten, Jacqueline A.; Buchaklian, Adam H.; Klug, Candice S.

    2009-01-01

    ATP-binding cassette (ABC) transporters make up one of the largest classes of proteins found in nature, and their ability to move a variety of substrates across the membrane using energy from the binding or hydrolysis of ATP is essential to an array of human pathologies and to bacterial viability. MsbA is an essential ABC transporter that specifically transports lipid A across the inner membranes of Gram-negative organisms such as Escherichia coli. The exact mechanisms of function during the binding and hydrolysis of ATP at the molecular level remain unclear. The studies presented and summarized in this work directly address the role and local dynamics of specific residues within the conserved ABC motifs in E. coli MsbA using in vivo growth and biochemical activity assays coupled with site-directed spin labeling electron paramagnetic resonance (EPR) spectroscopy motional and accessibility analysis. This first comprehensive analysis of the specific residues in these motifs within MsbA indicates that closure of the dimer interface does not occur upon ATP binding in this transporter. PMID:19053284

  2. Formycin triphosphate as a probe for the ATP binding site involved in the activation of guanylate cyclase.

    PubMed

    Chang, C H; Yu, Z N; Song, D L

    1992-10-01

    Formycin A triphosphate (FTP), a fluorescent analog of ATP, slightly increased basal guanylate cyclase activity, but significantly potentiated guanylate cyclase activity stimulated by atrial natriuretic factor (ANF) in rat lung membranes. FTP potentiated ANF-stimulated guanylate cyclase activity with an EC50 at about 90 microM and inhibited ATP-stimulated guanylate cyclase activity with an IC50 at about 100 microM. These results indicate that FTP binds more tightly than ATP for the same binding site. Therefore, FTP would be an excellent tool for studying the ATP binding site.

  3. ATP binding and hydrolysis steps of the uni-site catalysis by the mitochondrial F(1)-ATPase are affected by inorganic phosphate.

    PubMed

    Milgrom, Yakov M

    2010-10-01

    The effect of inorganic phosphate (P(i)) on uni-site ATP binding and hydrolysis by the nucleotide-depleted F(1)-ATPase from beef heart mitochondria (ndMF(1)) has been investigated. It is shown for the first time that P(i) decreases the apparent rate constant of uni-site ATP binding by ndMF(1) 3-fold with the K(d) of 0.38+/-0.14mM. During uni-site ATP hydrolysis, P(i) also shifts equilibrium between bound ATP and ADP+P(i) in the direction of ATP synthesis with the K(d) of 0.17+/-0.03mM. However, 10mM P(i) does not significantly affect ATP binding during multi-site catalysis.

  4. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site

    PubMed Central

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R.; Phillips, Chris; Augustin, Martin A.; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek

    2016-01-01

    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5–inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  5. Consensus topography in the ATP binding site of the simian virus 40 and polyomavirus large tumor antigens

    SciTech Connect

    Bradley, M.K.; Smith, T.F.; Lathrop, R.H.; Livingston, D.M.; Webster, T.A.

    1987-06-01

    The location and sequence composition of a consensus element of the nucleotide binding site in both simian virus 40 (SV40) and polyomavirus (PyV) large tumor antigens (T antigens) can be predicted with the assistance of a computer-based pattern-matching system, ARIADNE. The latter was used to optimally align elements of T antigen primary sequence and predicted secondary structure with a descriptor for a mononucleotide binding fold. Additional consensus elements of the nucleotide binding site in these two proteins were derived from comparisons of T antigen primary and predicted secondary structures with x-ray structures of the nucleotide binding sites in four otherwise unrelated proteins. Each of these elements was predicted to be encompassed within a 110-residue segment that is highly conserved between the two T antigens residues 418-528 in SV 40 T antigen and residues 565-675 in PyV. Results of biochemical and immunologic experiments on the nucleotide binding behavior of these proteins using (/sup 32/P)-Amp-labeled SV40 T antigen, were found to be consistent with these predictions. Taken together, the latter have resulted in a topological model of the ATP binding site in these two oncogene products.

  6. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

    PubMed Central

    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi

    2017-01-01

    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer. PMID:28245558

  7. Optimization of the degenerated interfacial ATP binding site improves the function of disease-related mutant cystic fibrosis transmembrane conductance regulator (CFTR) channels.

    PubMed

    Tsai, Ming-Feng; Jih, Kang-Yang; Shimizu, Hiroyasu; Li, Min; Hwang, Tzyh-Chang

    2010-11-26

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, an ATP binding cassette (ABC) protein whose defects cause the deadly genetic disease cystic fibrosis (CF), encompasses two nucleotide binding domains (NBD1 and NBD2). Recent studies indicate that in the presence of ATP, the two NBDs coalesce into a dimer, trapping an ATP molecule in each of the two interfacial composite ATP binding sites (site 1 and site 2). Experimental evidence also suggests that CFTR gating is mainly controlled by ATP binding and hydrolysis in site 2, whereas site 1, which harbors several non-canonical substitutions in ATP-interacting motifs, is considered degenerated. The CF-associated mutation G551D, by introducing a bulky and negatively charged side chain into site 2, completely abolishes ATP-induced openings of CFTR. Here, we report a strategy to optimize site 1 for ATP binding by converting two amino acid residues to ABC consensus (i.e. H1348G) or more commonly seen residues in other ABC proteins (i.e. W401Y,W401F). Introducing either one or both of these mutations into G551D-CFTR confers ATP responsiveness for this disease-associated mutant channel. We further showed that the same maneuver also improved the function of WT-CFTR and the most common CF-associated ΔF508 channels, both of which rely on site 2 for gating control. Thus, our results demonstrated that the degenerated site 1 can be rebuilt to complement or support site 2 for CFTR function. Possible approaches for developing CFTR potentiators targeting site 1 will be discussed.

  8. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    SciTech Connect

    Zoghbi, M. E.; Altenberg, G. A.

    2013-10-15

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.

  9. The Deviant ATP-binding Site of the Multidrug Efflux Pump Pdr5 Plays an Active Role in the Transport Cycle*

    PubMed Central

    Furman, Christopher; Mehla, Jitender; Ananthaswamy, Neeti; Arya, Nidhi; Kulesh, Bridget; Kovach, Ildiko; Ambudkar, Suresh V.; Golin, John

    2013-01-01

    Pdr5 is the founding member of a large subfamily of evolutionarily distinct, clinically important fungal ABC transporters containing a characteristic, deviant ATP-binding site with altered Walker A, Walker B, Signature (C-loop), and Q-loop residues. In contrast to these motifs, the D-loops of the two ATP-binding sites have similar sequences, including a completely conserved aspartate residue. Alanine substitution mutants in the deviant Walker A and Signature motifs retain significant, albeit reduced, ATPase activity and drug resistance. The D-loop residue mutants D340A and D1042A showed a striking reduction in plasma membrane transporter levels. The D1042N mutation localized properly had nearly WT ATPase activity but was defective in transport and was profoundly hypersensitive to Pdr5 substrates. Therefore, there was a strong uncoupling of ATPase activity and drug efflux. Taken together, the properties of the mutants suggest an additional, critical intradomain signaling role for deviant ATP-binding sites. PMID:24019526

  10. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-02-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme.

  11. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed Central

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-01-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme. Images PMID:2869483

  12. Functional roles of ATP-binding residues in the catalytic site of human mitochondrial NAD(P)+-dependent malic enzyme.

    PubMed

    Hung, Hui-Chih; Chien, Yu-Ching; Hsieh, Ju-Yi; Chang, Gu-Gang; Liu, Guang-Yaw

    2005-09-27

    Human mitochondrial NAD(P)+-dependent malic enzyme is inhibited by ATP. The X-ray crystal structures have revealed that two ATP molecules occupy both the active and exo site of the enzyme, suggesting that ATP might act as an allosteric inhibitor of the enzyme. However, mutagenesis studies and kinetic evidences indicated that the catalytic activity of the enzyme is inhibited by ATP through a competitive inhibition mechanism in the active site and not in the exo site. Three amino acid residues, Arg165, Asn259, and Glu314, which are hydrogen-bonded with NAD+ or ATP, are chosen to characterize their possible roles on the inhibitory effect of ATP for the enzyme. Our kinetic data clearly demonstrate that Arg165 is essential for catalysis. The R165A enzyme had very low enzyme activity, and it was only slightly inhibited by ATP and not activated by fumarate. The values of K(m,NAD) and K(i,ATP) to both NAD+ and malate were elevated. Elimination of the guanidino side chain of R165 made the enzyme defective on the binding of NAD+ and ATP, and it caused the charge imbalance in the active site. These effects possibly caused the enzyme to malfunction on its catalytic power. The N259A enzyme was less inhibited by ATP but could be fully activated by fumarate at a similar extent compared with the wild-type enzyme. For the N259A enzyme, the value of K(i,ATP) to NAD+ but not to malate was elevated, indicating that the hydrogen bonding between ATP and the amide side chain of this residue is important for the binding stability of ATP. Removal of this side chain did not cause any harmful effect on the fumarate-induced activation of the enzyme. The E314A enzyme, however, was severely inhibited by ATP and only slightly activated by fumarate. The values of K(m,malate), K(m,NAD), and K(i,ATP) to both NAD+ and malate for E314A were reduced to about 2-7-folds compared with those of the wild-type enzyme. It can be concluded that mutation of Glu314 to Ala eliminated the repulsive effects

  13. Phosphorylation at Ser²⁶ in the ATP-binding site of Ca²⁺/calmodulin-dependent kinase II as a mechanism for switching off the kinase activity.

    PubMed

    Yilmaz, Mehtap; Gangopadhyay, Samudra S; Leavis, Paul; Grabarek, Zenon; Morgan, Kathleen G

    2013-02-07

    CaMKII (Ca²⁺/calmodulin-dependent kinase II) is a serine/threonine phosphotransferase that is capable of long-term retention of activity due to autophosphorylation at a specific threonine residue within each subunit of its oligomeric structure. The γ isoform of CaMKII is a significant regulator of vascular contractility. Here, we show that phosphorylation of CaMKII γ at Ser²⁶, a residue located within the ATP-binding site, terminates the sustained activity of the enzyme. To test the physiological importance of phosphorylation at Ser²⁶, we generated a phosphospecific Ser²⁶ antibody and demonstrated an increase in Ser²⁶ phosphorylation upon depolarization and contraction of blood vessels. To determine if the phosphorylation of Ser²⁶ affects the kinase activity, we mutated Ser²⁶ to alanine or aspartic acid. The S26D mutation mimicking the phosphorylated state of CaMKII causes a dramatic decrease in Thr²⁸⁷ autophosphorylation levels and greatly reduces the catalytic activity towards an exogenous substrate (autocamtide-3), whereas the S26A mutation has no effect. These data combined with molecular modelling indicate that a negative charge at Ser²⁶ of CaMKII γ inhibits the catalytic activity of the enzyme towards its autophosphorylation site at Thr²⁸⁷ most probably by blocking ATP binding. We propose that Ser²⁶ phosphorylation constitutes an important mechanism for switching off CaMKII activity.

  14. Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.

    PubMed

    Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K

    2015-03-27

    The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium.

  15. 4,6-Substituted-1,3,5-triazin-2(1H)-ones as monocyclic catalytic inhibitors of human DNA topoisomerase IIα targeting the ATP binding site.

    PubMed

    Pogorelčnik, Barbara; Janežič, Matej; Sosič, Izidor; Gobec, Stanislav; Solmajer, Tom; Perdih, Andrej

    2015-08-01

    Human DNA topoisomerase IIα (htIIα) is a validated target for the development of novel anticancer agents. Starting from our discovered 4-amino-1,3,5-triazine inhibitors of htIIα, we investigated a library of 2,4,6-trisubstituted-1,3,5-triazines for novel inhibitors that bind to the htIIα ATP binding site using a combination of structure-based and ligand-based pharmacophore models and molecular docking. 4,6-substituted-1,3,5-triazin-2(1H)-ones 8, 9 and 14 were identified as novel inhibitors with activity comparable to the established drug etoposide (1). Compound 8 inhibits the htIIα decatenation in a superior fashion to etoposide. Cleavage assays demonstrated that selected compounds 8 and 14 do not act as poisons and antagonize the poison effect of etoposide. Microscale thermophoresis (MST) confirmed binding of compound 8 to the htIIα ATPase domain and compound 14 effectively inhibits the htIIα mediated ATP hydrolysis. The molecular dynamics simulation study provides further insight into the molecular recognition. The 4,6-disubstituted-1,3,5-triazin-2(1H)-ones represent the first validated monocyclic class of catalytic inhibitors that bind to the to the htIIα ATPase domain.

  16. Characterization of [35S]-ATP alpha S and [3H]-alpha, beta-MeATP binding sites in rat brain cortical synaptosomes: regulation of ligand binding by divalent cations.

    PubMed

    Schäfer, R; Reiser, G

    1997-07-01

    1. We made a comparative analysis of the binding characteristics of the radioligands [35S]-ATP alpha S and [3H]-alpha, beta-MeATP in order to test whether these ligands can be used to analyse P2-purinoceptors in synaptosomal membranes from rat brain cortex. 2. Synaptosomes possess sites with high affinity for [35S]-ATP alpha S (Kd = 22.2 +/- 9.1 nM, Bmax = 14.8 pmol mg-1 protein). The rank order of the competition potency of the different compounds (ATP alpha S, ATP, ATP gamma S > ADP beta S, 2-MeSATP > deoxyATP, ADP > > UTP, alpha, beta-MeATP, AMP, Reactive Blue-2, suramin, isoPPADS) is consistent with pharmacological properties of P2Y-purinoceptors. 3. Under identical conditions [35S]-ATP alpha S and [3H]-alpha, beta-MeATP bind to different binding sites at synaptosomal membranes from rat brain cortex. The affinity of the [3H]-alpha, beta-MeATP binding sites (Kd = 13.7 +/- 1.8 nM, Bmax = 6.34 +/- 0.28 pmol mg-1 protein) was 38 fold higher than the potency of alpha, beta-MeATP to displace [35S]-ATP alpha S binding (Ki = 0.52 microM). ATP and ADP beta S competed at both binding sites with different affinities, 60 fold and 175 fold, respectively. The other agonists tested (2-MeSATP, UTP, GTP) did not affect specific [35H]-alpha, beta-MeATP binding at concentrations up to 100 microM. The antagonists (suramin, isoPPADS, Evan's Blue) showed completely different affinities for both binding sites. 4. Binding of [35S]-ATP alpha S on synaptosomes was regulated by GTP, which is indicative for G-protein coupled receptors. The Kd value for the high affinity binding site was reduced in the presence of GTP about 5 fold (from 1.8 nM to 8.6 nM). In the presence of Mg2+ the affinity was increased (Kd 1.8 nM versus 22 nM in the absence of Mg2+). 5. The binding of both radioligands was regulated in an opposite manner by physiological concentrations of Ca2+ and Mg2+. Binding of [3H]-alpha, beta-MeATP to synaptosomal membranes was increased 3 fold by raising the Ca2+ concentration

  17. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric

    2012-10-24

    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  18. Existence of a low-affinity ATP-binding site in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles: evidence from binding of 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP and -[3H]ATP.

    PubMed

    Suzuki, H; Kubota, T; Kubo, K; Kanazawa, T

    1990-07-31

    ATP-binding sites in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles were titrated with 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP (TNP-AMP) or -[3H]ATP (TNP-ATP) in the absence of Ca2+ at pH 7.0 and 0 degrees C by using a centrifugation procedure. In some measurements, the bound TNP-nucleotides were chased with ATP. The data were analyzed by best-fit computer programs as well as by Scatchard plots. The results showed the existence of 1 mol of TNP-AMP binding sites with high affinity (Kd = 7.62 nM) per mole of phosphorylatable sites. The affinity of these sites for ATP (Kd = 10.1 microM) agreed with that of catalytic sites for ATP in the absence of Ca2+. The results further showed the existence of 2 mol of TNP-ATP binding sites with uniform affinity (Kd = 156 nM) per mole of phosphorylatable sites. Half of the bound TNP-ATP was fully chased by low concentrations of ATP. The affinity of this class of the sites for ATP (Kd = 8.9 microM) again agreed with that of catalytic sites for ATP. The other half of the bound TNP-ATP was fully chased only by much higher concentrations of ATP. Thus, the affinity of this class of the sites for ATP (Kd = 791 microM) was much lower than that of catalytic sites for ATP. Similar measurements were performed with sarcoplasmic reticulum vesicles pretreated by N-(iodoacetyl)-N'-(5-sulfo-1-naphthyl)ethylenediamine. Although the affinities for TNP-ATP and for ATP were appreciably altered by this pretreatment, the results were essentially the same as those obtained with native vesicles.(ABSTRACT TRUNCATED AT 250 WORDS)

  19. The nodulin vfENOD18 is an ATP-binding protein in infected cells of Vicia faba L. nodules.

    PubMed

    Becker, J D; Moreira, L M; Kapp, D; Frosch, S C; Pühler, A; Perlic, A M

    2001-12-01

    Recently we described the novel nodulin gene VfENOD18, whose corresponding transcripts were restricted to the nitrogen-fixing zone III of broad bean root nodules. To characterize VfENOD18 on the protein level, polyclonal antibodies were generated using the purified recombinant VfENOD18 protein produced in Escherichia coli by employing the pMAL-c expression system. These antibodies recognized immunoreactive proteins isolated from indeterminate nodules of different leguminous plants, but also from non-symbiotic tissues of Glycine max and from tissues of Arabidopsis thaliana and Zea mays. Using immunogold labelling the nodulin VfENOD18 was localized to the cytoplasm of infected cells in the nitrogen-fixing zone of broad bean nodules. Due to the homology of the VfENOD18 sequence to that of the ATP-binding protein MJ0577 from the hyperthermophile Methanococcus jannaschii the recombinant VfENOD18 protein was tested for ATP-binding. Using the biotin photoaffinity ATP analogue 8N3ATP[gamma]biotin it could be demonstrated that VfENOD18 is an ATP-binding protein. PCR experiments revealed that the amino acid sequences of the putative C-terminal ATP-binding sites of the VfENOD 18 homologues from Lens culinaris, Vicia hirsuta, Vicia sativa and Vicia villosa were conserved. We propose that VfENOD18 is a member of a novel family of ATP-binding proteins in plants.

  20. Evidence of a calcium-induced structural change in the ATP-binding site of the sarcoplasmic-reticulum Ca2+-ATPase using terbium formycin triphosphate as an analogue of Mg-ATP.

    PubMed

    Girardet, J L; Dupont, Y; Lacapere, J J

    1989-09-01

    Terbium ions and terbium formycin triphosphate have been used to investigate the interactions between the cation and nucleotide binding sites of the sarcoplasmic reticulum Ca2+-ATPase. Three classes of Tb3+-binding sites have been found: a first class of low-affinity (Kd = 10 microM) corresponds to magnesium binding sites, located near a tryptophan residue of the protein; a second class of much higher affinity (less than 0.1 microM) corresponds to the calcium transport sites, their occupancy by terbium induces the E1 to E2 conformational change of the Ca2+-ATPase; a third class of sites is revealed by following the fluorescence transfer from formycin triphosphate (FTP) to terbium, evidencing that terbium ions can also bind into the nucleotide binding site at the same time as FTP. Substitution of H2O by D2O shows that Tb-FTP binding to the enzyme nucleotide site is associated with an important dehydration of the terbium ions associated with FTP. Two terbium ions, at least, bind to the Ca2+-ATPase in the close vicinity of FTP when this nucleotide is bound to the ATPase nucleotide site. Addition of calcium quenches the fluorescence signal of the terbium-FTP complex bound to the enzyme. Calcium concentration dependence shows that this effect is associated with the replacement of terbium by calcium in the transport sites, inducing the E2----E1 transconformation when calcium is bound. One interpretation of this fluorescence quenching is that the E1----E2 transition induces an important structural change in the nucleotide site. Another interpretation is that the high-affinity calcium sites are located very close to the Tb-FTP complex bound to the nucleotide site.

  1. Identification of ATP-binding regions in the RyR1 Ca²⁺ release channel.

    PubMed

    Popova, Olga B; Baker, Mariah R; Tran, Tina P; Le, Tri; Serysheva, Irina I

    2012-01-01

    ATP is an important modulator of gating in type 1 ryanodine receptor (RyR1), also known as a Ca²⁺ release channel in skeletal muscle cells. The activating effect of ATP on this channel is achieved by directly binding to one or more sites on the RyR1 protein. However, the number and location of these sites have yet to be determined. To identify the ATP-binding regions within RyR1 we used 2N₃ATP-2',3'-Biotin-LC-Hydrazone (BioATP-HDZ), a photo-reactive ATP analog to covalently label the channel. We found that BioATP-HDZ binds RyR1 specifically with an IC₅₀ = 0.6±0.2 mM, comparable with the reported EC50 for activation of RyR1 with ATP. Controlled proteolysis of labeled RyR1 followed by sequence analysis revealed three fragments with apparent molecular masses of 95, 45 and 70 kDa that were crosslinked by BioATP-HDZ and identified as RyR1 sequences. Our analysis identified four glycine-rich consensus motifs that can potentially constitute ATP-binding sites and are located within the N-terminal 95-kDa fragment. These putative nucleotide-binding sequences include amino acids 699-704, 701-706, 1081-1084 and 1195-1200, which are conserved among the three RyR isoforms. Located next to the N-terminal disease hotspot region in RyR1, these sequences may communicate the effects of ATP-binding to channel function by tuning conformational motions within the neighboring cytoplasmic regulatory domains. Two other labeled fragments lack ATP-binding consensus motifs and may form non-canonical ATP-binding sites. Based on domain topology in the 3D structure of RyR1 it is also conceivable that the identified ATP-binding regions, despite their wide separation in the primary sequence, may actually constitute the same non-contiguous ATP-binding pocket within the channel tetramer.

  2. ATP-binding cassette transporters in reproduction: a new frontier

    PubMed Central

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.

    2016-01-01

    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  3. The oxidation-state-dependent ATP-binding site of cytochrome c. Implication of an essential arginine residue and the effect of occupancy on the oxidation-reduction potential.

    PubMed Central

    Corthésy, B E; Wallace, C J

    1988-01-01

    Arg-91 is not part of the active site of cytochrome c that mediates binding and electron transfer, yet it is absolutely conserved in eukaryotic cytochromes c, indicating a special function. The physicochemical properties of analogues are unaffected by the modification of this residue, so they can be used with confidence to study the role of Arg-91. We have established limiting conditions under which this residue alone is specifically modified by cyclohexane-1,2-dione, and have subsequently shown that ATP, and to a lesser extent ADP or Pi, protects it from the action of the reagent in an oxidation-state-dependent manner. These observations strongly support the idea that this site exerts a controlling influence on cytochrome c activity in the electron transport or other cellular redox systems, and we have commenced a study of how that influence might operate. We find that the redox potentials of both cytochrome c and analogue are little affected by changing ATP or Pi concentrations. PMID:2843168

  4. Activation of ATP binding for the autophosphorylation of DosS, a Mycobacterium tuberculosis histidine kinase lacking an ATP lid motif.

    PubMed

    Cho, Ha Yeon; Lee, Young-Hoon; Bae, Young-Seuk; Kim, Eungbin; Kang, Beom Sik

    2013-05-03

    The sensor histidine kinases of Mycobacterium tuberculosis, DosS and DosT, are responsible for sensing hypoxic conditions and consist of sensor and kinase cores responsible for accepting signals and phosphorylation activity, respectively. The kinase core contains a dimerization and histidine phosphate-accepting (DHp) domain and an ATP binding domain (ABD). The 13 histidine kinase genes of M. tuberculosis can be grouped based on the presence or absence of the ATP lid motif and F box (elements known to play roles in ATP binding) in their ABDs; DosS and DosT have ABDs lacking both these elements, and the crystal structures of their ABDs indicated that they were unsuitable for ATP binding, as a short loop covers the putative ATP binding site. Although the ABD alone cannot bind ATP, the kinase core is functional in autophosphorylation. Appropriate spatial arrangement of the ABD and DHp domain within the kinase core is required for both autophosphorylation and ATP binding. An ionic interaction between Arg(440) in the DHp domain and Glu(537) in the short loop of the ABD is available and may open the ATP binding site, by repositioning the short loop away from the site. Mutations at Arg(440) and Glu(537) reduce autophosphorylation activity. Unlike other histidine kinases containing an ATP lid, which protects bound ATP, DosS is unable to accept ATP until the ABD is properly positioned relative to the histidine; this may prevent unexpected ATP reactions. ATP binding can, therefore, function as a control mechanism for histidine kinase activity.

  5. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi

    2016-01-01

    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  6. ATP binding cassette G transporters and plant male reproduction

    PubMed Central

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing

    2016-01-01

    ABSTRACT The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field. PMID:26906115

  7. Complexed Structures of Formylglycinamide Ribonucleotide Amidotransferase from Thermotoga maritima Describe a Novel ATP Binding Protein Superfamily

    SciTech Connect

    Morar, Mariya; Anand, Ruchi; Hoskins, Aaron A.; Stubbe, JoAnne; Ealick, Steven E.

    2008-09-11

    Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent synthesis of formylglycinamidine ribonucleotide (FGAM) from formylglycinamide ribonucleotide (FGAR) and glutamine in the fourth step of the purine biosynthetic pathway. FGAR-AT is encoded by the purL gene. Two types of PurL have been detected. The first type, found in eukaryotes and Gram-negative bacteria, consists of a single 140 kDa polypeptide chain and is designated large PurL (lgPurL). The second type, small PurL (smPurL), is found in archaea and Gram-positive bacteria and consists of an 80 kDa polypeptide chain. SmPurL requires two additional gene products, PurQ and PurS, for activity. PurL is a member of a protein superfamily that contains a novel ATP-binding domain. Structures of several members of this superfamily are available in the unliganded form. We determined five different structures of FGAR-AT from Thermotoga maritima in the presence of substrates, a substrate analogue, and a product. These complexes have allowed a detailed description of the novel ATP-binding motif. The availability of a ternary complex enabled mapping of the active site, thus identifying potential residues involved in catalysis. The complexes show a conformational change in the active site compared to the unliganded structure. Surprising discoveries, an ATP molecule in an auxiliary site of the protein and the conformational changes associated with its binding, provoke speculation about the regulatory role of the auxiliary site in formation of the PurLSQ complex as well as the evolutionary relationship of PurLs from different organisms.

  8. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    NASA Astrophysics Data System (ADS)

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-06-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH. radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD.-, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396-. Its negative charge could trigger conformational changes necessary for signal transduction.

  9. ATP-Binding Cassette Efflux Transporters in Human Placenta

    PubMed Central

    Ni, Zhanglin; Mao, Qingcheng

    2010-01-01

    Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087

  10. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    PubMed Central

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-01-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH· radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD·−, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396−. Its negative charge could trigger conformational changes necessary for signal transduction. PMID:24898692

  11. Human erythrocyte dematin and protein 4.2 (pallidin) are ATP binding proteins.

    PubMed

    Azim, A C; Marfatia, S M; Korsgren, C; Dotimas, E; Cohen, C M; Chishti, A H

    1996-03-05

    Dematin and protein 4.2 are peripheral membrane proteins associated with the cytoplasmic surface of the human erythrocyte plasma membrane. Isoforms of dematin and protein 4.2 exist in many nonerythroid cells. In solution, dematin is a trimeric protein containing two subunits of 48 kDa and one subunit of 52 kDa. Recent determination of the primary structure of the 52 kDa subunit of dematin showed that it contains an additional 22-amino acid sequence in the headpiece domain. An alignment of the 22-amino acid insertion sequence revealed that the 52 kDa subunit of dematin shares a novel 11-amino acid motif with protein 4.2. In this communication, we report that the conserved 11-amino acid motif in dematin52 and protein 4.2 contains a nucleotide binding P-loop. Direct binding of ATP is demonstrated to the glutathione S-transferase fusion proteins containing corresponding segments of dematin52 and protein 4.2 as well as to purified protein 4.2. The binding of ATP to the recombinant domains of dematin52 and protein 4.2 is specific, saturable, and of high affinity. The nucleotide specificity of the P-loop is restricted to ATP since no detectable binding was observed with GTP. These results show that the 11-amino acid motif provides an ATP binding site in dematin52 and protein 4.2. Although the functional significance of ATP binding is not yet clear, our findings open new perspectives for the function of dematin and protein 4.2 in vivo.

  12. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  13. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum

    PubMed Central

    2013-01-01

    Background The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control. PMID:23324493

  14. Biophysical Approaches Facilitate Computational Drug Discovery for ATP-Binding Cassette Proteins

    PubMed Central

    Molinski, Steven V.; Bozóky, Zoltán; Iram, Surtaj H.

    2017-01-01

    Although membrane proteins represent most therapeutically relevant drug targets, the availability of atomic resolution structures for this class of proteins has been limited. Structural characterization has been hampered by the biophysical nature of these polytopic transporters, receptors, and channels, and recent innovations to in vitro techniques aim to mitigate these challenges. One such class of membrane proteins, the ATP-binding cassette (ABC) superfamily, are broadly expressed throughout the human body, required for normal physiology and disease-causing when mutated, yet lacks sufficient structural representation in the Protein Data Bank. However, recent improvements to biophysical techniques (e.g., cryo-electron microscopy) have allowed for previously “hard-to-study” ABC proteins to be characterized at high resolution, providing insight into molecular mechanisms-of-action as well as revealing novel druggable sites for therapy design. These new advances provide ample opportunity for computational methods (e.g., virtual screening, molecular dynamics simulations, and structure-based drug design) to catalyze the discovery of novel small molecule therapeutics that can be easily translated from computer to bench and subsequently to the patient's bedside. In this review, we explore the utility of recent advances in biophysical methods coupled with well-established in silico techniques towards drug development for diseases caused by dysfunctional ABC proteins.

  15. An ATP-binding cassette transporter is a major glycoprotein of sea urchin sperm membranes.

    PubMed

    Mengerink, Kathryn J; Vacquier, Victor D

    2002-10-25

    Sperm are terminally differentiated cells that undergo several membrane-altering events before fusion with eggs. One event, the sea urchin sperm acrosome reaction (AR), is blocked by the lectin wheat germ agglutinin (WGA). In an effort to identify proteins involved in the AR induction, the peptide sequence was obtained from a 220-kDa WGA-binding protein. Degenerate PCR and library screening resulted in the full-length deduced amino acid sequence of an ATP-binding cassette transporter, suABCA. The protein of 1,764 residues has two transmembrane regions, two nucleotide-binding domains, and is most closely related to the human ABC subfamily A member 3 transporter (ABCA3). Sequence analysis suggests a large extracellular loop between transmembrane spanning segments 7 and 8, with five N-linked glycosylation sites. An antibody made to the loop region binds to non-permeabilized cells, supporting that this region is extracellular. suABCA is found in sperm membrane vesicles, it can be solubilized with nonionic detergents, and it shifts from 220 to 200 kDa upon protein:N-glycanase F digestion. suABCA localizes to the entire surface of sperm in a punctate pattern, but is not detected in lipid rafts. Based on its relationship to subfamily A, suABCA is most likely involved in phospholipid or cholesterol transport. This is the first investigation of an ABC transporter in animal sperm.

  16. The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity

    PubMed Central

    Tameling, Wladimir I. L.; Elzinga, Sandra D. J.; Darmin, Patricia S.; Vossen, Jack H.; Takken, Frank L. W.; Haring, Michel A.; Cornelissen, Ben J. C.

    2002-01-01

    Most plant disease resistance (R) genes known today encode proteins with a central nucleotide binding site (NBS) and a C-terminal Leu-rich repeat (LRR) domain. The NBS contains three ATP/GTP binding motifs known as the kinase-1a or P-loop, kinase-2, and kinase-3a motifs. In this article, we show that the NBS of R proteins forms a functional nucleotide binding pocket. The N-terminal halves of two tomato R proteins, I-2 conferring resistance to Fusarium oxysporum and Mi-1 conferring resistance to root-knot nematodes and potato aphids, were produced as glutathione S-transferase fusions in Escherichia coli. In a filter binding assay, purified I-2 was found to bind ATP rather than other nucleoside triphosphates. ATP binding appeared to be fully dependent on the presence of a divalent cation. A mutant I-2 protein containing a mutation in the P-loop showed a strongly reduced ATP binding capacity. Thin layer chromatography revealed that both I-2 and Mi-1 exerted ATPase activity. Based on the strong conservation of NBS domains in R proteins of the NBS-LRR class, we propose that they all are capable of binding and hydrolyzing ATP. PMID:12417711

  17. ATP-Binding Pocket-Targeted Suppression of Src and Syk by Luteolin Contributes to Its Anti-Inflammatory Action

    PubMed Central

    Lee, Jeong-Oog; Jeong, Deok; Kim, Mi-Yeon; Cho, Jae Youl

    2015-01-01

    Luteolin is a flavonoid identified as a major anti-inflammatory component of Artemisia asiatica. Numerous reports have demonstrated the ability of luteolin to suppress inflammation in a variety of inflammatory conditions. However, its exact anti-inflammatory mechanism has not been fully elucidated. In the present study, the anti-inflammatory mode of action in activated macrophages of luteolin from Artemisia asiatica was examined by employing immunoblotting analysis, a luciferase reporter gene assay, enzyme assays, and an overexpression strategy. Luteolin dose-dependently inhibited the secretion of nitric oxide (NO) and prostaglandin E2 (PGE2) and diminished the levels of mRNA transcripts of inducible NO synthase (iNOS), tumor necrosis factor- (TNF-) α, and cyclooxygenase-2 (COX-2) in lipopolysaccharide- (LPS-) and pam3CSK-treated macrophage-like RAW264.7 cells without displaying cytotoxicity. Luteolin displayed potent NO-inhibitory activity and also suppressed the nuclear translocation of NF-κB (p65 and p50) via blockade of Src and Syk, but not other mitogen-activated kinases. Overexpression of wild type Src and point mutants thereof, and molecular modelling studies, suggest that the ATP-binding pocket may be the luteolin-binding site in Src. These results strongly suggest that luteolin may exert its anti-inflammatory action by suppressing the NF-κB signaling cascade via blockade of ATP binding in Src and Syk. PMID:26236111

  18. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes

    SciTech Connect

    Miao, Y.C.; Liu, C.

    2010-12-28

    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  19. Influence of ATP-binding cassette transporters in root exudation of phytoalexins, signals, and disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The roots of plants secrete compounds as a way to exchange information with organ-isms living in the soil. Here, we report the involvement of seven root-expressed ATP-binding cassette (ABC) transporters corresponding to both full and half-size molecules (Atabcg36, Atabcg37, Atabcc5, Atabcf1, Atabcf3...

  20. CpABC, a Cryptosporidium parvum ATP-binding cassette protein at the host–parasite boundary in intracellular stages

    PubMed Central

    Perkins, Margaret E.; Riojas, Ynolde A.; Wu, Teresa W.; Le Blancq, Sylvie M.

    1999-01-01

    The intracellular parasite Cryptosporidium parvum develops inside a vacuole at the apex of its epithelial host cell. The developing parasite is separated from the host cell cytoplasm by a zone of attachment that consists of an extensively folded membranous structure known as the feeder organelle. It has been proposed that the feeder organelle is the site of regulation of transport of nutrients and drugs into the parasite. In this report, we localize an ≈200-kDa integral membrane protein, CpABC, from Cryptosporidium parvum to the host–parasite boundary, possibly the feeder organelle. The predicted amino acid sequence of CpABC has significant structural similarity with the cystic fibrosis conductance regulator and the multidrug resistance protein subfamily of ATP-binding cassette proteins. This is an example of a parasite-encoded transport protein localized at the parasite–host interface of an intracellular protozoan. PMID:10318953

  1. The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase

    PubMed Central

    Ding, Hao; Guo, Manhong; Vidhyasagar, Venkatasubramanian; Talwar, Tanu; Wu, Yuliang

    2015-01-01

    Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI). The Q motif, consisting of nine amino acids (GFXXPXPIQ) with an invariant glutamine (Q) residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11) gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase. PMID:26474416

  2. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification

    PubMed Central

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.

    2015-01-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175

  3. An ATP-binding cassette transporter-like complex governs cell-wall hydrolysis at the bacterial cytokinetic ring.

    PubMed

    Yang, Desirée C; Peters, Nick T; Parzych, Katherine R; Uehara, Tsuyoshi; Markovski, Monica; Bernhardt, Thomas G

    2011-11-08

    ATP-binding cassette transporters are ubiquitous membrane protein complexes that move substrates across membranes. They do so using ATP-induced conformational changes in their nucleotide-binding domains to alter the conformation of the transport cavity formed by their transmembrane domains. In Escherichia coli, an ATP-binding cassette transporter-like complex composed of FtsE (nucleotide-binding domain) and FtsX (transmembrane domain) has long been known to be important for cytokinesis, but its role in the process has remained mysterious. Here we identify FtsEX as a regulator of cell-wall hydrolysis at the division site. Cell-wall material synthesized by the division machinery is shared initially by daughter cells and must be split by hydrolytic enzymes called "amidases" to drive daughter-cell separation. We recently showed that the amidases require activation at the cytokinetic ring by proteins with LytM domains, of which EnvC is the most critical. In this report, we demonstrate that FtsEX directly recruits EnvC to the septum via an interaction between EnvC and a periplasmic loop of FtsX. Importantly, we also show that FtsEX variants predicted to be ATPase defective still recruit EnvC to the septum but fail to promote cell separation. Our results thus suggest that amidase activation via EnvC in the periplasm is regulated by conformational changes in the FtsEX complex mediated by ATP hydrolysis in the cytoplasm. Since FtsE has been reported to interact with the tubulin-like FtsZ protein, our model provides a potential mechanism for coupling amidase activity with the contraction of the FtsZ cytoskeletal ring.

  4. ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Jielou

    2004-03-01

    Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.

  5. The power stroke driven by ATP binding in CFTR as studied by molecular dynamics simulations.

    PubMed

    Furukawa-Hagiya, Tomoka; Furuta, Tadaomi; Chiba, Shuntaro; Sohma, Yoshiro; Sakurai, Minoru

    2013-01-10

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the ATP binding cassette (ABC) protein superfamily. Currently, it remains unclear how ATP binding causes the opening of the channel gate at the molecular level. To clarify this mechanism, we first constructed an atomic model of the inward-facing CFTR using the X-ray structures of other ABC proteins. Molecular dynamics (MD) simulations were then performed to explore the structure and dynamics of the inward-facing CFTR in a membrane environment. In the MgATP-bound state, two nucleotide-binding domains (NBDs) formed a head-to-tail type of dimer, in which the ATP molecules were sandwiched between the Walker A and signature motifs. Alternatively, one of the final MD structures in the apo state was similar to that of a "closed-apo" conformation found in the X-ray analysis of ATP-free MsbA. Principal component analysis for the MD trajectory indicated that NBD dimerization causes significant structural and dynamical changes in the transmembrane domains (TMDs), which is likely indicative of the formation of a chloride ion access path. This study suggests that the free energy gain from ATP binding acts as a driving force not only for NBD dimerization but also for NBD-TMD concerted motions.

  6. Molecular determinants for ATP-binding in proteins: a data mining and quantum chemical analysis.

    PubMed

    Mao, Lisong; Wang, Yanli; Liu, Yuemin; Hu, Xiche

    2004-02-20

    intermolecular interactions of large biomolecular systems becomes computationally feasible. The establishment of the molecular basis for recognition of the adenine moiety of ATP in proteins will directly impact molecular design of ATP-binding site targeted enzyme inhibitors such as kinase inhibitors.

  7. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.

    PubMed

    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés

    2014-12-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  8. The rem Mutations in the ATP-Binding Groove of the Rad3/XPD Helicase Lead to Xeroderma pigmentosum-Cockayne Syndrome-Like Phenotypes

    PubMed Central

    Montelone, Beth A.; Aguilera, Andrés

    2014-01-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease. PMID:25500814

  9. Structural and Enzymatic Insights into the ATP Binding and Autophosphorylation Mechanism of a Sensor Histidine Kinase*

    PubMed Central

    Trajtenberg, Felipe; Graña, Martin; Ruétalo, Natalia; Botti, Horacio; Buschiazzo, Alejandro

    2010-01-01

    DesK is a sensor histidine kinase (HK) that allows Bacillus subtilis to respond to cold shock, triggering the adaptation of membrane fluidity via transcriptional control of a fatty acid desaturase. It belongs to the HK family HPK7, which includes the nitrogen metabolism regulators NarX/Q and the antibiotic sensor LiaS among other important sensor kinases. Structural information on different HK families is still scarce and several questions remain, particularly concerning the molecular features that determine HK specificity during its catalytic autophosphorylation and subsequent response-regulator phosphotransfer reactions. To analyze the ATP-binding features of HPK7 HKs and dissect their mechanism of autophosphorylation at the molecular level, we have studied DesK in complex with ATP using high resolution structural approaches in combination with biochemical studies. We report the first crystal structure of an HK in complex with its natural nucleotidic substrate. The general fold of the ATP-binding domain of DesK is conserved, compared with well studied members of other families. Yet, DesK displays a far more compact structure at the ATP-binding pocket: the ATP lid loop is much shorter with no secondary structural organization and becomes ordered upon ATP loading. Sequence conservation mapping onto the molecular surface, semi-flexible protein-protein docking simulations, and structure-based point mutagenesis allow us to propose a specific domain-domain geometry during autophosphorylation catalysis. Supporting our hypotheses, we have been able to trap an autophosphorylating intermediate state, by protein engineering at the predicted domain-domain interaction surface. PMID:20507988

  10. Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.

    PubMed

    Bompadre, Silvia G; Hwang, Tzyh-Chang

    2007-08-25

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

  11. Structural characterization of an MJ1267 ATP-binding cassette crystal with a complex pattern of twinning caused by promiscuous fiber packing.

    PubMed

    Yuan, Yu-Ren; Martsinkevich, Oskana; Hunt, John F

    2003-02-01

    ATP-binding cassettes represent the motor domains in ABC transporters, a superfamily of integral membrane-protein pumps that couple the hydrolysis of ATP to transmembrane solute translocation. A crystal of a Mg-ADP complex of the MJ1267 ATP-binding cassette was obtained that produced a diffraction pattern characterized by pathological streaking of the spots in the a* x b* plane. While the Laue symmetry of the diffraction pattern was P3;1m, the crystal was determined to be twinned based on intensity statistics, molecular-replacement analysis and difference Fourier analysis of an engineered single-site methylmercury derivative. The unit cell contains three similar 3(1) fibers, with two of them related by primarily translational non-crystallographic symmetry (NCS) and the third related to the first two by approximate twofold screw operations whose rotational components are very similar to the twinning operator. The promiscuous packing of these 3(1) fibers, which make both parallel and antiparallel interactions in the primary crystal lattice, can explain the twinning tendency based on the ability of the twin-related lattices to interact with one another while making only one slightly sub-optimal intermolecular contact per unit cell in the boundary region. The promiscuous fiber packing can also explain the streaking in the diffraction pattern based on the ability to form a variety of different lattices with similar inter-fiber packing interactions. The crystal structure was refined as a twin in space group P3(1) using the program CNS, yielding a free R factor of 28.9% at 2.6 A and a refined twin fraction of 0.50. The structure shows a rigid-body rotation of the ABC-transporter-specific alpha-helical subdomain (ABCalpha subdomain) in MJ1267 compared with the conformation observed for the same protein in a C2 crystal lattice; this observation suggests that the ABCalpha subdomain is flexibly attached to the F1-type ATP-binding core of the ATP-binding cassette when Mg

  12. The Lipid Bilayer Modulates the Structure and Function of an ATP-binding Cassette Exporter.

    PubMed

    Zoghbi, Maria E; Cooper, Rebecca S; Altenberg, Guillermo A

    2016-02-26

    ATP-binding cassette exporters use the energy of ATP hydrolysis to transport substrates across membranes by switching between inward- and outward-facing conformations. Essentially all structural studies of these proteins have been performed with the proteins in detergent micelles, locked in specific conformations and/or at low temperature. Here, we used luminescence resonance energy transfer spectroscopy to study the prototypical ATP-binding cassette exporter MsbA reconstituted in nanodiscs at 37 °C while it performs ATP hydrolysis. We found major differences when comparing MsbA in these native-like conditions with double electron-electron resonance data and the crystal structure of MsbA in the open inward-facing conformation. The most striking differences include a significantly smaller separation between the nucleotide-binding domains and a larger fraction of molecules with associated nucleotide-binding domains in the nucleotide-free apo state. These studies stress the importance of studying membrane proteins in an environment that approaches physiological conditions.

  13. Formation of a Chloride-conducting State in the Maltose ATP-binding Cassette (ABC) Transporter.

    PubMed

    Carlson, Michael L; Bao, Huan; Duong, Franck

    2016-06-03

    ATP-binding cassette transporters use an alternating access mechanism to move substrates across cellular membranes. This mode of transport ensures the selective passage of molecules while preserving membrane impermeability. The crystal structures of MalFGK2, inward- and outward-facing, show that the transporter is sealed against ions and small molecules. It has yet to be determined whether membrane impermeability is maintained when MalFGK2 cycles between these two conformations. Through the use of a mutant that resides in intermediate conformations close to the transition state, we demonstrate that not only is chloride conductance occurring, but also to a degree large enough to compromise cell viability. Introduction of mutations in the periplasmic gate lead to the formation of a channel that is quasi-permanently open. MalFGK2 must therefore stay away from these ion-conducting conformations to preserve the membrane barrier; otherwise, a few mutations that increase access to the ion-conducting states are enough to convert an ATP-binding cassette transporter into a channel.

  14. Modulating the function of ATP-binding cassette subfamily G member 2 (ABCG2) with inhibitor cabozantinib.

    PubMed

    Zhang, Guan-Nan; Zhang, Yun-Kai; Wang, Yi-Jun; Barbuti, Anna Maria; Zhu, Xi-Jun; Yu, Xin-Yue; Wen, Ai-Wen; Wurpel, John N D; Chen, Zhe-Sheng

    2017-01-25

    Cabozantinib (XL184) is a small molecule tyrosine kinase receptor inhibitor, which targets c-Met and VEGFR2. Cabozantinib has been approved by the Food and Drug Administration to treat advanced medullary thyroid cancer and renal cell carcinoma. In the present study, we evaluated the ability of cabozantinib to modulate the function of the ATP-binding cassette subfamily G member 2 (ABCG2) by sensitizing cells that are resistant to ABCG2 substrate antineoplastic drugs. We used a drug-selected resistant cell line H460/MX20 and three ABCG2 stable transfected cell lines ABCG2-482-R2, ABCG2-482-G2, and ABCG2-482-T7, which overexpress ABCG2. Cabozantinib, at non-toxic concentrations (3 or 5μM), sensitized the ABCG2-overexpressing cells to mitoxantrone, SN-38, and topotecan. Our results indicate that cabozantinib reverses ABCG2-mediated multidrug resistance by antagonizing the drug efflux function of the ABCG2 transporter instead of downregulating its expression. The molecular docking analysis indicates that cabozantinib binds to the drug-binding site of the ABCG2 transporter. Overall, our findings demonstrate that cabozantinib inhibits the ABCG2 transporter function and consequently enhances the effect of the antineoplastic agents that are substrates of ABCG2. Cabozantinib may be a useful agent in anticancer treatment regimens for patients who are resistant to ABCG2 substrate drugs.

  15. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification.

    PubMed

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L

    2015-11-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.

  16. Trapping the transition state of an ATP-binding cassette transporter: Evidence for a concerted mechanism of maltose transport

    PubMed Central

    Chen, Jue; Sharma, Susan; Quiocho, Florante A.; Davidson, Amy L.

    2001-01-01

    High-affinity uptake into bacterial cells is mediated by a large class of periplasmic binding protein-dependent transport systems, members of the ATP-binding cassette superfamily. In the maltose transport system of Escherichia coli, the periplasmic maltose-binding protein binds its substrate maltose with high affinity and, in addition, stimulates the ATPase activity of the membrane-associated transporter when maltose is present. Vanadate inhibits maltose transport by trapping ADP in one of the two nucleotide-binding sites of the membrane transporter immediately after ATP hydrolysis, consistent with its ability to mimic the transition state of the γ-phosphate of ATP during hydrolysis. Here we report that the maltose-binding protein becomes tightly associated with the membrane transporter in the presence of vanadate and simultaneously loses its high affinity for maltose. These results suggest a general model explaining how ATP hydrolysis is coupled to substrate transport in which a binding protein stimulates the ATPase activity of its cognate transporter by stabilizing the transition state. PMID:11171984

  17. Isolation and characterization of the ATP-binding cassette (ABC) transporter system genes from loofah witches' broom phytoplasma.

    PubMed

    Huang, Chun-Lin; Ho, Kuo-Chieh

    2007-10-01

    A clone containing a 3903 bp EcoRI-restriction fragment was obtained from a lambda(ZAP) genomic library of loofah witches' broom (LfWB) phytoplasma by plaque hybridization using a PCR fragment as a probe. Sequence analysis revealed that this fragment contained three open reading frames (ORFs). The deduced amino acid sequences of ORF 1 and ORF 2 showed a high homology with the ATP-binding proteins of the ABC transporter system genes of prokaryotes and eukaryotes, and encoded proteins with a molecular mass of 36 and 30 kDa, respectively. Based on amino acid sequence similarity, secondary structure, hydrophilicity and a signal peptide sequence at the N-terminus, we predicted that ORF 3 might encode a specific solute-binding prolipoprotein of the ABC transporter system with a molecular mass of 62 kDa. The cleavage site of this prolipoprotein signal peptide was similar to those of gram-positive bacteria. In addition to nutrient uptake, ABC transporter systems of bacteria also play a role in signal transduction, drug-resistance and perhaps virulence. The possible implications of the system to the survival and the pathogenesis of phytoplasma were discussed.

  18. Conservation of an ATP-binding domain among RecA proteins from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r.

    PubMed

    Knight, K L; Hess, R M; McEntee, K

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N3ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the [alpha-32P]8N3ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T31 of the E. coli K-12 RecA protein, which was the unique site of 8N3ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10(7) years.

  19. Conservation of an ATP-binding domain among recA proteins from Proteus vulgaris, erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r

    SciTech Connect

    Knight, K.L.; Hess, R.M.; McEntee, K.

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N/sub 3/ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the (..cap alpha..-/sup 32/P)8N/sub 3/ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T/sub 31/ of the E. coli K-12 RecA protein, which was the unique site of 8N/sub 3/ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10/sup 7/ years.

  20. Transport in technicolor: Mapping ATP-binding cassette transporters in sea urchin embryos

    PubMed Central

    Gökirmak, Tufan; Shipp, Lauren E.; Campanale, Joseph P.; Nicklisch, Sascha C.T.; Hamdoun, Amro

    2014-01-01

    One quarter of eukaryotic genes encode membrane proteins. These include nearly 1000 transporters that translocate nutrients, signaling molecules, and xenobiotics across membranes. While it is well appreciated that membrane transport is critical for development, the specific roles of many transporters have remained cryptic, in part because of their abundance and the diversity of their substrates. Multi-drug resistance ATP-binding cassette (ABC) efflux transporters are one example of cryptic membrane proteins. Although most organisms utilize these ABC transporters during embryonic development, many of these transporters have broad substrate specificity, and their developmental functions remain incompletely understood. Here, we review advances in our understanding of ABC transporters in sea urchin embryos, and methods developed to spatially and temporally map these proteins. These studies reveal that multifunctional transporters are required for signaling, homeostasis, and protection of the embryo, and shed light on how they are integrated into ancestral developmental pathways recapitulated in disease. PMID:25156004

  1. ATP-binding cassette transporters in tumor endothelial cells and resistance to metronomic chemotherapy.

    PubMed

    Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro

    2017-02-16

    Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters.

  2. Protection against chemotherapy-induced alopecia: targeting ATP-binding cassette transporters in the hair follicle?

    PubMed

    Haslam, Iain S; Pitre, Aaron; Schuetz, John D; Paus, Ralf

    2013-11-01

    Currently, efficacious treatments for chemotherapy-induced alopecia (hair loss) are lacking, and incidences of permanent hair loss following high-dose chemotherapy are on the increase. In this article, we describe mechanisms by which the pharmacological defense status of the hair follicle might be enhanced, thereby reducing the accumulation of cytotoxic cancer drugs and preventing or reducing hair loss and damage. We believe this could be achieved via the selective increase in ATP-binding cassette (ABC) transporter expression within the hair follicle epithelium, following application of topical agonists for regulatory nuclear receptors. Clinical application would require the development of hair follicle-targeted formulations, potentially utilizing nanoparticle technology. This novel approach has the potential to yield entirely new therapeutic options for the treatment and management of chemotherapy-induced alopecia, providing significant psychological and physical benefit to cancer patients.

  3. The ATP binding cassette transporter, ABCG1, localizes to cortical actin filaments

    PubMed Central

    Pandzic, Elvis; Gelissen, Ingrid C.; Whan, Renee; Barter, Philip J.; Sviridov, Dmitri; Gaus, Katharina; Rye, Kerry-Anne; Cochran, Blake J.

    2017-01-01

    The ATP-binding cassette sub-family G member 1 (ABCG1) exports cellular cholesterol to high-density lipoproteins (HDL). However, a number of recent studies have suggested ABCG1 is predominantly localised to intracellular membranes. In this study, we found that ABCG1 was organized into two distinct cellular pools: one at the plasma membrane and the other associated with the endoplasmic reticulum (ER). The plasma membrane fraction was organized into filamentous structures that were associated with cortical actin filaments. Inhibition of actin polymerization resulted in complete disruption of ABCG1 filaments. Cholesterol loading of the cells increased the formation of the filamentous ABCG1, the proximity of filamentous ABCG1 to actin filaments and the diffusion rate of membrane associated ABCG1. Our findings suggest that the actin cytoskeleton plays a critical role in the plasma membrane localization of ABCG1. PMID:28165022

  4. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3

    PubMed Central

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea

    2015-01-01

    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter. PMID:26295388

  5. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  6. Structure-Function Analysis of Peroxisomal ATP-binding Cassette Transporters Using Chimeric Dimers*

    PubMed Central

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W.; Lopez, Tatiana E.; Dias, Alexandre M. M.; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J.; Trompier, Doriane; Savary, Stéphane

    2014-01-01

    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. PMID:25043761

  7. ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.

    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  8. Structure, function, and evolution of bacterial ATP-binding cassette systems

    SciTech Connect

    Davidson, A.L.; Dassa, E.; Orelle, C.; Chen, J.

    2010-07-27

    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed in Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and

  9. Computational characterization of TTHA0379: A potential glycerophosphocholine binding protein of Ugp ATP-binding cassette transporter.

    PubMed

    Chandravanshi, Monika; Gogoi, Prerana; Kanaujia, Shankar Prasad

    2016-11-05

    For the de novo biosynthesis of phospholipids, byproducts such as sn-glycerol-3-phosphate (G3P) and glycerophosphocholine (GPC) of glycerophospholipid metabolic pathway are imported inside the cell by an ATP-binding cassette (ABC) transporter known as UgpABCE. Of which, UgpA and UgpE constitutes the transmembrane domains (TMDs), UgpC forms the dimer of ATP-hydrolyzing component and UgpB is the periplasmic substrate binding protein. Structurally, UgpABCE transporter displays similarity to the maltose ABC transporter of Escherichia coli; thus, has been grouped into the CUT1 (Carbohydrate Uptake Transporter-1) family of bacterial ABC transporters. Being a member of CUT1 family, several Ugp (Uptake glycerol phosphate) protein sequences in biological database(s) exhibit sequence and structure similarity to sugar ABC transporters and have been annotated as sugar binding proteins; one of such proteins is TTHA0379 from Thermus thermophilus HB8. Here, in this study, we used computational method(s) to distinguish UgpB and sugar binding proteins based on their primary and tertiary structure features. A comprehensive analysis of these proteins indicates that they are evolutionarily related to each other having common conserved features at their primary and tertiary structure levels. However, they display differences at their active sites owing to the dissimilarity in their ligand preferences. In addition, phylogenetic analysis of TTHA0379 along with UgpB and sugar binding proteins reveals that both the groups of proteins forms two distinct clades and TTHA0379 groups with UgpB proteins. Furthermore, analysis of the ligand binding pocket shows that all the essential features of glycerophosphocholine binding protein i.e. UgpB, are conserved in TTHA0379 as well. Combining these features, here, we designate TTHA0379 to be a GPC binding protein.

  10. Alternating access to the transmembrane domain of the ATP-binding cassette protein cystic fibrosis transmembrane conductance regulator (ABCC7).

    PubMed

    Wang, Wuyang; Linsdell, Paul

    2012-03-23

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is a member of the ATP-binding cassette (ABC) protein family, most members of which act as active transporters. Actively transporting ABC proteins are thought to alternate between "outwardly facing" and "inwardly facing" conformations of the transmembrane substrate pathway. In CFTR, it is assumed that the outwardly facing conformation corresponds to the channel open state, based on homology with other ABC proteins. We have used patch clamp recording to quantify the rate of access of cysteine-reactive probes to cysteines introduced into two different transmembrane regions of CFTR from both the intracellular and extracellular solutions. Two probes, the large [2-sulfonatoethyl]methanethiosulfonate (MTSES) molecule and permeant Au(CN)(2)(-) ions, were applied to either side of the membrane to modify cysteines substituted for Leu-102 (first transmembrane region) and Thr-338 (sixth transmembrane region). Channel opening and closing were altered by mutations in the nucleotide binding domains of the channel. We find that, for both MTSES and Au(CN)(2)(-), access to these two cysteines from the cytoplasmic side is faster in open channels, whereas access to these same sites from the extracellular side is faster in closed channels. These results are consistent with alternating access to the transmembrane regions, however with the open state facing inwardly and the closed state facing outwardly. Our findings therefore prompt revision of current CFTR structural and mechanistic models, as well as having broader implications for transport mechanisms in all ABC proteins. Our results also suggest possible locations of both functional and dysfunctional ("vestigial") gates within the CFTR permeation pathway.

  11. The Hypertrophic Cardiomyopathy Myosin Mutation R453C Alters ATP Binding and Hydrolysis of Human Cardiac β-Myosin*

    PubMed Central

    Bloemink, Marieke; Deacon, John; Langer, Stephen; Vera, Carlos; Combs, Ariana; Leinwand, Leslie; Geeves, Michael A.

    2014-01-01

    The human hypertrophic cardiomyopathy mutation R453C results in one of the more severe forms of the myopathy. Arg-453 is found in a conserved surface loop of the upper 50-kDa domain of the myosin motor domain and lies between the nucleotide binding pocket and the actin binding site. It connects to the cardiomyopathy loop via a long α-helix, helix O, and to Switch-2 via the fifth strand of the central β-sheet. The mutation is, therefore, in a position to perturb a wide range of myosin molecular activities. We report here the first detailed biochemical kinetic analysis of the motor domain of the human β-cardiac myosin carrying the R453C mutation. A recent report of the same mutation (Sommese, R. F., Sung, J., Nag, S., Sutton, S., Deacon, J. C., Choe, E., Leinwand, L. A., Ruppel, K., and Spudich, J. A. (2013) Proc. Natl. Acad. Sci. U.S.A. 110, 12607–12612) found reduced ATPase and in vitro motility but increased force production using an optical trap. Surprisingly, our results show that the mutation alters few biochemical kinetic parameters significantly. The exceptions are the rate constants for ATP binding to the motor domain (reduced by 35%) and the ATP hydrolysis step/recovery stroke (slowed 3-fold), which could be the rate-limiting step for the ATPase cycle. Effects of the mutation on the recovery stroke are consistent with a perturbation of Switch-2 closure, which is required for the recovery stroke and the subsequent ATP hydrolysis. PMID:24344137

  12. Solution structure and function in trifluoroethanol of PP-50, an ATP-binding peptide from F1ATPase.

    PubMed

    Chuang, W J; Abeygunawardana, C; Gittis, A G; Pedersen, P L; Mildvan, A S

    1995-05-10

    PP-50, a synthetic peptide, based on residues 141-190 of the beta-subunit of mitochondrial F1ATPase, containing the GX4GKT consensus sequence for nucleoside triphosphate binding, binds ATP tightly (Kd = 17.5 microM) as found by fluorescence titration at pH 4.0. CD and 2D proton NMR studies at pH 4.0 revealed two beta-turns, regions of extended secondary structure, transient tertiary structure, and flexibility in the GX4GKT region (W.J. Chuang, C. Abeygunawardana, P. L. Pedersen, and A. S. Mildvan, 1992, Biochemistry 31, 7915-7921). CD titration of PP-50 with trifluoroethanol (TFE) reveals a decrease in ellipticity at 208 and 222 nm, saturating at 25% TFE. Computer analysis indicates that 25% TFE increases the helix content from 5.8 to 28.6%, decreases the beta-structure from 30.2 to 20.2% and decreases the coil content from 64 to 51.2%. Fluorescence titrations of H2ATP2- with PP-50 in 25% TFE yields a Kd of 7.3 microM, 2.4-fold tighter than in H2O, probably due to TFE increasing the activity of H2ATP2- . PP-50 completely quenches the fluorescence of H2ATP2- in 25% TFE, while in H2O the fluorescence quenching is only 62%. In H2O the binding of H2ATP2- increases the structure of PP-50 as detected by CD, but in 25% TFE no significant change in CD is found on binding either H2ATP2- or Mg2+ HATP (Kd = 14 microM). The complete proton NMR spectrum of PP-50 in 25% TFE has been assigned. The solution structure, determined by distance geometry, molecular dynamics with simulated annealing, and energy minimization, consists of a coil (residues 1-8), a strand (residues 9-12), a loop (residues 13-22) containing the GX4GKT consensus sequence (residues 16-23), an alpha-helix (residues 23-36), a turn (residues 38-41), and a coil (residues 42-50), similar to that of the corresponding region of the X-ray structure of F1ATPase (J.P. Abrahams, A.G.W. Leslie, R. Lutter, and J. E. Walker, 1994 Nature 370, 621-628) and to the structure of a homologous peptide from the ATP-binding site of

  13. Agrobacterium rhizogenes GALLS Protein Contains Domains for ATP Binding, Nuclear Localization, and Type IV Secretion▿

    PubMed Central

    Hodges, Larry D.; Vergunst, Annette C.; Neal-McKinney, Jason; den Dulk-Ras, Amke; Moyer, Deborah M.; Hooykaas, Paul J. J.; Ream, Walt

    2006-01-01

    Agrobacterium tumefaciens and Agrobacterium rhizogenes are closely related plant pathogens that cause different diseases, crown gall and hairy root. Both diseases result from transfer, integration, and expression of plasmid-encoded bacterial genes located on the transferred DNA (T-DNA) in the plant genome. Bacterial virulence (Vir) proteins necessary for infection are also translocated into plant cells. Transfer of single-stranded DNA (ssDNA) and Vir proteins requires a type IV secretion system, a protein complex spanning the bacterial envelope. A. tumefaciens translocates the ssDNA-binding protein VirE2 into plant cells, where it binds single-stranded T-DNA and helps target it to the nucleus. Although some strains of A. rhizogenes lack VirE2, they are pathogenic and transfer T-DNA efficiently. Instead, these bacteria express the GALLS protein, which is essential for their virulence. The GALLS protein can complement an A. tumefaciens virE2 mutant for tumor formation, indicating that GALLS can substitute for VirE2. Unlike VirE2, GALLS contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. Both GALLS and VirE2 contain nuclear localization sequences and a C-terminal type IV secretion signal. Here we show that mutations in any of these domains abolished the ability of GALLS to substitute for VirE2. PMID:17012398

  14. Structure-guided Development of Specific Pyruvate Dehydrogenase Kinase Inhibitors Targeting the ATP-binding Pocket*

    PubMed Central

    Tso, Shih-Chia; Qi, Xiangbing; Gui, Wen-Jun; Wu, Cheng-Yang; Chuang, Jacinta L.; Wernstedt-Asterholm, Ingrid; Morlock, Lorraine K.; Owens, Kyle R.; Scherer, Philipp E.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.

    2014-01-01

    Pyruvate dehydrogenase kinase isoforms (PDKs 1–4) negatively regulate activity of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation. PDK isoforms are up-regulated in obesity, diabetes, heart failure, and cancer and are potential therapeutic targets for these important human diseases. Here, we employed a structure-guided design to convert a known Hsp90 inhibitor to a series of highly specific PDK inhibitors, based on structural conservation in the ATP-binding pocket. The key step involved the substitution of a carbonyl group in the parent compound with a sulfonyl in the PDK inhibitors. The final compound of this series, 2-[(2,4-dihydroxyphenyl)sulfonyl]isoindoline-4,6-diol, designated PS10, inhibits all four PDK isoforms with IC50 = 0.8 μm for PDK2. The administration of PS10 (70 mg/kg) to diet-induced obese mice significantly augments pyruvate dehydrogenase complex activity with reduced phosphorylation in different tissues. Prolonged PS10 treatments result in improved glucose tolerance and notably lessened hepatic steatosis in the mouse model. The results support the pharmacological approach of targeting PDK to control both glucose and fat levels in obesity and type 2 diabetes. PMID:24356970

  15. Caveolin-1 and ATP binding cassette transporter A1 and G1-mediated cholesterol efflux.

    PubMed

    Wang, Faqi; Gu, Hong-mei; Zhang, Da-wei

    2014-01-01

    Atherosclerosis is one major cause of cardiovascular diseases, the leading cause of death in industrialized countries. Reverse cholesterol transport (RCT) is thought to be one primary pathway to protect against atherosclerosis. The first and rate-limiting step of RCT is ATP-binding cassette transport A1 (ABCA1) and ABCG1-mediated cholesterol efflux from the cells. Recently, caveolin-1 (CAV1), a scaffolding protein that organizes and concentrates certain caveolin-interacting signaling molecules and receptors within caveolae membranes, has been shown to regulate ABCA1 and ABCG1-mediated cholesterol efflux probably via interacting with them. In the present review, we summarize the current knowledge and views on the regulatory role of CAV1 on the cholesterol homeostasis with emphasis on the association of CAV1 with ABCA1 and ABCG1. We conclude that the dominance of the positive regulation by CAV1 on the ABCA1 and ABCG1-mediated cholesterol efflux is depending on the species, cell types, as well as the levels of CAV1 expression.

  16. Conformational Changes Produced by ATP Binding to the Plasma Membrane Calcium Pump*

    PubMed Central

    Mangialavori, Irene C.; Ferreira-Gomes, Mariela S.; Saffioti, Nicolás A.; González-Lebrero, Rodolfo M.; Rossi, Rolando C.; Rossi, Juan Pablo F. C.

    2013-01-01

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[125I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca2+ with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2′(3′)-O-(2,4,6-trinitrophenyl)adenosine 5′-triphosphate. To assess the conformational behavior of the Ca2+ binding domain, we also studied the occlusion of Ca2+, both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca2+ and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only. PMID:24025327

  17. Molecular Characterization of LjABCG1, an ATP-Binding Cassette Protein in Lotus japonicus

    PubMed Central

    Sugiyama, Akifumi; Fukuda, Shoju; Takanashi, Kojiro; Yoshioka, Miki; Yoshioka, Hirofumi; Narusaka, Yoshihiro; Narusaka, Mari; Kojima, Mikiko; Sakakibara, Hitoshi; Shitan, Nobukazu; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Yazaki, Kazufumi

    2015-01-01

    LjABCG1, a full-size ABCG subfamily of ATP-binding cassette proteins of a model legume, Lotus japonicus, was reported as a gene highly expressed during the early stages of nodulation, but have not been characterized in detail. In this study we showed that the induction of LjABCG1 expression was remarkable by methyl jasmonate treatment, and reporter gene experiments indicated that LjABCG1 was strongly expressed in the nodule parenchyma and cell layers adjacent to the root vascular tissue toward the nodule. LjABCG1 was suggested to be localized at the plasma membrane based on the fractionation of microsomal membranes as well as separation via aqueous two-phase partitioning. The physiological functions of LjABCG1 in symbiosis and pathogenesis were analyzed in homologous and heterologous systems. LjABCG1 knock-down L. japonicus plants did not show clear phenotypic differences in nodule formation, and not in defense against Pseudomonas syringae, either. In contrast, when LjABCG1 was expressed in the Arabidopsis pdr8-1 mutant, the penetration frequency of Phytophthora infestans, a potato late blight pathogen, was significantly reduced in LjABCG1/pdr8-1 than in pdr8-1 plants. This finding indicated that LjABCG1, at least partially, complemented the phenotype of pdr8 in Arabidopsis, suggesting the multiple roles of this protein in plant-microbe interactions. PMID:26418593

  18. A Plant Plasma Membrane ATP Binding Cassette–Type Transporter Is Involved in Antifungal Terpenoid Secretion

    PubMed Central

    Jasiński, Michal; Stukkens, Yvan; Degand, Hervé; Purnelle, Bénédicte; Marchand-Brynaert, Jacqueline; Boutry, Marc

    2001-01-01

    ATP binding cassette (ABC) transporters, which are found in all species, are known mainly for their ability to confer drug resistance. To date, most of the ABC transporters characterized in plants have been localized in the vacuolar membrane and are considered to be involved in the intracellular sequestration of cytotoxins. Working on the assumption that certain ABC transporters might be involved in defense metabolite secretion and their expression might be regulated by the concentration of these metabolites, we treated a Nicotiana plumbaginifolia cell culture with sclareolide, a close analog of sclareol, an antifungal diterpene produced at the leaf surface of Nicotiana spp; this resulted in the appearance of a 160-kD plasma membrane protein, which was partially sequenced. The corresponding cDNA (NpABC1) was cloned and shown to encode an ABC transporter. In vitro and in situ immunodetection showed NpABC1 to be localized in the plasma membrane. Under normal conditions, expression was found in the leaf epidermis. In cell culture and in leaf tissues, NpABC1 expression was strongly enhanced by sclareolide and sclareol. In parallel with NpABC1 induction, cells acquired the ability to excrete a labeled synthetic sclareolide derivative. These data suggest that NpABC1 is involved in the secretion of a secondary metabolite that plays a role in plant defense. PMID:11340184

  19. ATP binding by NLRP7 is required for inflammasome activation in response to bacterial lipopeptides.

    PubMed

    Radian, Alexander D; Khare, Sonal; Chu, Lan H; Dorfleutner, Andrea; Stehlik, Christian

    2015-10-01

    Nucleotide-binding oligimerization domain (NOD)-like receptors (NLRs) are pattern recognition receptors (PRRs) involved in innate immune responses. NLRs encode a central nucleotide-binding domain (NBD) consisting of the NAIP, CIITA, HET-E and TP1 (NACHT) domain and the NACHT associated domain (NAD), which facilitates receptor oligomerization and downstream inflammasome signaling. The NBD contains highly conserved regions, known as Walker motifs, that are required for nucleotide binding and hydrolysis. The NLR containing a PYRIN domain (PYD) 7 (NLRP7) has been recently shown to assemble an ASC and caspase-1-containing high molecular weight inflammasome complex in response to microbial acylated lipopeptides and Staphylococcus aureus infection. However, the molecular mechanism responsible for NLRP7 inflammasome activation is still elusive. Here we demonstrate that the NBD of NLRP7 is an ATP binding domain and has ATPase activity. We further show that an intact nucleotide-binding Walker A motif is required for NBD-mediated nucleotide binding and hydrolysis, oligomerization, and NLRP7 inflammasome formation and activity. Accordingly, THP-1 cells expressing a mutated Walker A motif display defective NLRP7 inflammasome activation, interleukin (IL)-1β release and pyroptosis in response to acylated lipopeptides and S. aureus infection. Taken together, our results provide novel insights into the mechanism of NLRP7 inflammasome assembly.

  20. A conserved mitochondrial ATP-binding cassette transporter exports glutathione polysulfide for cytosolic metal cofactor assembly.

    PubMed

    Schaedler, Theresia A; Thornton, Jeremy D; Kruse, Inga; Schwarzländer, Markus; Meyer, Andreas J; van Veen, Hendrik W; Balk, Janneke

    2014-08-22

    An ATP-binding cassette transporter located in the inner mitochondrial membrane is involved in iron-sulfur cluster and molybdenum cofactor assembly in the cytosol, but the transported substrate is unknown. ATM3 (ABCB25) from Arabidopsis thaliana and its functional orthologue Atm1 from Saccharomyces cerevisiae were expressed in Lactococcus lactis and studied in inside-out membrane vesicles and in purified form. Both proteins selectively transported glutathione disulfide (GSSG) but not reduced glutathione in agreement with a 3-fold stimulation of ATPase activity by GSSG. By contrast, Fe(2+) alone or in combination with glutathione did not stimulate ATPase activity. Arabidopsis atm3 mutants were hypersensitive to an inhibitor of glutathione biosynthesis and accumulated GSSG in the mitochondria. The growth phenotype of atm3-1 was strongly enhanced by depletion of the mitochondrion-localized, GSH-dependent persulfide oxygenase ETHE1, suggesting that the physiological substrate of ATM3 contains persulfide in addition to glutathione. Consistent with this idea, a transportomics approach using mass spectrometry showed that glutathione trisulfide (GS-S-SG) was transported by Atm1. We propose that mitochondria export glutathione polysulfide, containing glutathione and persulfide, for iron-sulfur cluster assembly in the cytosol.

  1. Conformational changes produced by ATP binding to the plasma membrane calcium pump.

    PubMed

    Mangialavori, Irene C; Ferreira-Gomes, Mariela S; Saffioti, Nicolás A; González-Lebrero, Rodolfo M; Rossi, Rolando C; Rossi, Juan Pablo F C

    2013-10-25

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[(125)I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca(2+) with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. To assess the conformational behavior of the Ca(2+) binding domain, we also studied the occlusion of Ca(2+), both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca(2+) and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only.

  2. The role of ATP binding cassette transporters in tissue defense and organ regeneration.

    PubMed

    Huls, Miriam; Russel, Frans G M; Masereeuw, Rosalinde

    2009-01-01

    ATP binding cassette (ABC) transporters are ATP-dependent membrane proteins predominantly expressed in excretory organs, such as the liver, intestine, blood-brain barrier, blood-testes barrier, placenta, and kidney. Here, they play an important role in the absorption, distribution, and excretion of drugs, xenobiotics, and endogenous compounds. In addition, the ABC transporters, P-glycoprotein (P-gp/ABCB1) and breast cancer resistance protein (BCRP/ABCG2), are highly expressed in a population of primitive stem cells: the side population (SP). SP cells were originally discovered in bone marrow by their capacity to exclude rhodamine 123 and Hoechst dye 33342; however, extensive research also revealed their presence in other nonhematopoietic tissues. The expression levels of BCRP and P-gp are tightly controlled and may determine the differentiation of SP cells toward other more specialized cell types. Although their exact function in these cells is still not clear, they may protect the cells by pumping out toxicants and harmful products of oxidative stress. Transplantation studies in animals revealed that bone marrow-derived SP cells contribute to organ repopulation and tissue repair after damage, e.g., in liver and heart. The role of SP cells in regeneration of damaged kidney segments is not yet clarified. This review focuses on the role of ABC transporters in tissue defense and regeneration, with specific attention to P-gp and BCRP in organ regeneration and repair.

  3. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    SciTech Connect

    C Simmons; C Magee; D Smith; L Lauman; J Chaput; J Allen

    2011-12-31

    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADP cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.

  4. Domain Interactions in the Yeast ATP Binding Cassette Transporter Ycf1p: Intragenic Suppressor Analysis of Mutations in the Nucleotide Binding Domains

    PubMed Central

    Falcón-Pérez, Juan M.; Martínez-Burgos, Mónica; Molano, Jesús; Mazón, María J.; Eraso, Pilar

    2001-01-01

    The yeast cadmium factor (Ycf1p) is a vacuolar ATP binding cassette (ABC) transporter required for heavy metal and drug detoxification. Cluster analysis shows that Ycf1p is strongly related to the human multidrug-associated protein (MRP1) and cystic fibrosis transmembrane conductance regulator and therefore may serve as an excellent model for the study of eukaryotic ABC transporter structure and function. Identifying intramolecular interactions in these transporters may help to elucidate energy transfer mechanisms during transport. To identify regions in Ycf1p that may interact to couple ATPase activity to substrate binding and/or movement across the membrane, we sought intragenic suppressors of ycf1 mutations that affect highly conserved residues presumably involved in ATP binding and/or hydrolysis. Thirteen intragenic second-site suppressors were identified for the D777N mutation which affects the invariant Asp residue in the Walker B motif of the first nucleotide binding domain (NBD1). Two of the suppressor mutations (V543I and F565L) are located in the first transmembrane domain (TMD1), nine (A1003V, A1021T, A1021V, N1027D, Q1107R, G1207D, G1207S, S1212L, and W1225C) are found within TMD2, one (S674L) is in NBD1, and another one (R1415G) is in NBD2, indicating either physical proximity or functional interactions between NBD1 and the other three domains. The original D777N mutant protein exhibits a strong defect in the apparent affinity for ATP and Vmax of transport. The phenotypic characterization of the suppressor mutants shows that suppression does not result from restoring these alterations but rather from a change in substrate specificity. We discuss the possible involvement of Asp777 in coupling ATPase activity to substrate binding and/or transport across the membrane. PMID:11466279

  5. ATP utilization by yeast replication factor C. IV. RFC ATP-binding mutants show defects in DNA replication, DNA repair, and checkpoint regulation.

    PubMed

    Schmidt, S L; Pautz, A L; Burgers, P M

    2001-09-14

    Replication factor C is required to load proliferating cell nuclear antigen onto primer-template junctions, using the energy of ATP hydrolysis. Four of the five RFC genes have consensus ATP-binding motifs. To determine the relative importance of these sites for proper DNA metabolism in the cell, the conserved lysine in the Walker A motif of RFC1, RFC2, RFC3, or RFC4 was mutated to either arginine or glutamic acid. Arginine mutations in all RFC genes tested permitted cell growth, although poor growth was observed for rfc2-K71R. A glutamic acid substitution resulted in lethality in RFC2 and RFC3 but not in RFC1 or RFC4. Most double mutants combining mutations in two RFC genes were inviable. Except for the rfc1-K359R and rfc4-K55E mutants, which were phenotypically similar to wild type in every assay, the mutants were sensitive to DNA-damaging agents. The rfc2-K71R and rfc4-K55R mutants show checkpoint defects, most likely in the intra-S phase checkpoint. Regulation of the damage-inducible RNR3 promoter was impaired in these mutants, and phosphorylation of Rad53p in response to DNA damage was specifically defective when cells were in S phase. No dramatic defects in telomere length regulation were detected in the mutants. These data demonstrate that the ATP binding function of RFC2 is important for both DNA replication and checkpoint function and, for the first time, that RFC4 also plays a role in checkpoint regulation.

  6. Detergent-free purification of ABC (ATP-binding-cassette) transporters.

    PubMed

    Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J

    2014-07-15

    ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.

  7. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos

    2014-01-01

    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  8. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.

    2014-01-01

    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  9. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells

    PubMed Central

    Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  10. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells.

    PubMed

    Lara, Flavio Alves; Pohl, Paula C; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H F; Almeida, Igor C; Vaz, Itabajara da Silva; Oliveira, Pedro L

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  11. Adipocyte ATP-binding cassette G1 promotes triglyceride storage, fat mass growth, and human obesity.

    PubMed

    Frisdal, Eric; Le Lay, Soazig; Hooton, Henri; Poupel, Lucie; Olivier, Maryline; Alili, Rohia; Plengpanich, Wanee; Villard, Elise F; Gilibert, Sophie; Lhomme, Marie; Superville, Alexandre; Miftah-Alkhair, Lobna; Chapman, M John; Dallinga-Thie, Geesje M; Venteclef, Nicolas; Poitou, Christine; Tordjman, Joan; Lesnik, Philippe; Kontush, Anatol; Huby, Thierry; Dugail, Isabelle; Clement, Karine; Guerin, Maryse; Le Goff, Wilfried

    2015-03-01

    The role of the ATP-binding cassette G1 (ABCG1) transporter in human pathophysiology is still largely unknown. Indeed, beyond its role in mediating free cholesterol efflux to HDL, the ABCG1 transporter equally promotes lipid accumulation in a triglyceride (TG)-rich environment through regulation of the bioavailability of lipoprotein lipase (LPL). Because both ABCG1 and LPL are expressed in adipose tissue, we hypothesized that ABCG1 is implicated in adipocyte TG storage and therefore could be a major actor in adipose tissue fat accumulation. Silencing of Abcg1 expression by RNA interference in 3T3-L1 preadipocytes compromised LPL-dependent TG accumulation during the initial phase of differentiation. Generation of stable Abcg1 knockdown 3T3-L1 adipocytes revealed that Abcg1 deficiency reduces TG storage and diminishes lipid droplet size through inhibition of Pparγ expression. Strikingly, local inhibition of adipocyte Abcg1 in adipose tissue from mice fed a high-fat diet led to a rapid decrease of adiposity and weight gain. Analysis of two frequent ABCG1 single nucleotide polymorphisms (rs1893590 [A/C] and rs1378577 [T/G]) in morbidly obese individuals indicated that elevated ABCG1 expression in adipose tissue was associated with increased PPARγ expression and adiposity concomitant to increased fat mass and BMI (haplotype AT>GC). The critical role of ABCG1 in obesity was further confirmed in independent populations of severe obese and diabetic obese individuals. This study identifies for the first time a major role of adipocyte ABCG1 in adiposity and fat mass growth and suggests that adipose ABCG1 might represent a potential therapeutic target in obesity.

  12. ATP binding cassette modulators control abscisic acid-regulated slow anion channels in guard cells

    PubMed Central

    Leonhardt, N; Vavasseur, A; Forestier, C

    1999-01-01

    In animal cells, ATP binding cassette (ABC) proteins are a large family of transporters that includes the sulfonylurea receptor and the cystic fibrosis transmembrane conductance regulator (CFTR). These two ABC proteins possess an ion channel activity and bind specific sulfonylureas, such as glibenclamide, but homologs have not been identified in plant cells. We recently have shown that there is an ABC protein in guard cells that is involved in the control of stomatal movements and guard cell outward K+ current. Because the CFTR, a chloride channel, is sensitive to glibenclamide and able to interact with K+ channels, we investigated its presence in guard cells. Potent CFTR inhibitors, such as glibenclamide and diphenylamine-2-carboxylic acid, triggered stomatal opening in darkness. The guard cell protoplast slow anion current that was recorded using the whole-cell patch-clamp technique was inhibited rapidly by glibenclamide in a dose-dependent manner; the concentration producing half-maximum inhibition was at 3 &mgr;M. Potassium channel openers, which bind to and act through the sulfonylurea receptor in animal cells, completely suppressed the stomatal opening induced by glibenclamide and recovered the glibenclamide-inhibited slow anion current. Abscisic acid is known to regulate slow anion channels and in our study was able to relieve glibenclamide inhibition of slow anion current. Moreover, in epidermal strip bioassays, the stomatal closure triggered by Ca2+ or abscisic acid was reversed by glibenclamide. These results suggest that the slow anion channel is an ABC protein or is tightly controlled by such a protein that interacts with the abscisic acid signal transduction pathway in guard cells. PMID:10368184

  13. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.

    PubMed

    Yang, Nuan; Driessen, Arnold J M

    2015-01-01

    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  14. Computer modelling reveals new conformers of the ATP binding loop of Na+/K+-ATPase involved in the transphosphorylation process of the sodium pump

    PubMed Central

    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm

    2017-01-01

    Hydrolysis of ATP by Na+/K+-ATPase, a P-Type ATPase, catalyzing active Na+ and K+ transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp369 to allow the transfer of ATP’s terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp369 is achieved, analogous molecular modeling of the M4–M5 loop of ATPase was performed using the crystal data of Na+/K+-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr338 and Ile760 of the α2-subunit of Na+/K+-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe475 in the N-domain, the other one close to Asp369 in the P-domain. However, binding of Mg2+•ATP to any of these sites in the “open conformation” may not lead to phosphorylation of Asp369. Additional conformations of the cytoplasmic loop were found wobbling between “open conformation” <==> “semi-open conformation <==> “closed conformation” in the absence of 2Mg2+•ATP. The cytoplasmic loop’s conformational change to the “semi-open conformation”—characterized by a hydrogen bond between Arg543 and Asp611—triggers by binding of 2Mg2+•ATP to a single ATP site and conversion to the “closed conformation” the phosphorylation of Asp369 in the P-domain, and hence the start of Na+/K+-activated ATP hydrolysis. PMID:28316890

  15. Single-molecule imaging of UvrA and UvrB recruitment to DNA lesions in living Escherichia coli

    PubMed Central

    Stracy, Mathew; Jaciuk, Marcin; Uphoff, Stephan; Kapanidis, Achillefs N.; Nowotny, Marcin; Sherratt, David J.; Zawadzki, Pawel

    2016-01-01

    Nucleotide excision repair (NER) removes chemically diverse DNA lesions in all domains of life. In Escherichia coli, UvrA and UvrB initiate NER, although the mechanistic details of how this occurs in vivo remain to be established. Here, we use single-molecule fluorescence imaging to provide a comprehensive characterization of the lesion search, recognition and verification process in living cells. We show that NER initiation involves a two-step mechanism in which UvrA scans the genome and locates DNA damage independently of UvrB. Then UvrA recruits UvrB from solution to the lesion. These steps are coordinated by ATP binding and hydrolysis in the ‘proximal' and ‘distal' UvrA ATP-binding sites. We show that initial UvrB-independent damage recognition by UvrA requires ATPase activity in the distal site only. Subsequent UvrB recruitment requires ATP hydrolysis in the proximal site. Finally, UvrA dissociates from the lesion complex, allowing UvrB to orchestrate the downstream NER reactions. PMID:27562541

  16. Activity-Based Proteomics Reveals Heterogeneous Kinome and ATP-Binding Proteome Responses to MEK Inhibition in KRAS Mutant Lung Cancer.

    PubMed

    Kim, Jae-Young; Stewart, Paul A; Borne, Adam L; Fang, Bin; Welsh, Eric A; Chen, Yian Ann; Eschrich, Steven A; Koomen, John M; Haura, Eric B

    2016-06-01

    One way cancer cells can escape from targeted agents is through their ability to evade drug effects by rapidly rewiring signaling networks. Many protein classes, such as kinases and metabolic enzymes, are regulated by ATP binding and hydrolysis. We hypothesized that a system-level profiling of drug-induced alterations in ATP-binding proteomes could offer novel insights into adaptive responses. Here, we mapped global ATP-binding proteomes perturbed by two clinical MEK inhibitors, AZD6244 and MEK162, in KRAS mutant lung cancer cells as a model system harnessing a desthiobiotin-ATP probe coupled with LC-MS/MS. We observed strikingly unique ATP-binding proteome responses to MEK inhibition, which revealed heterogeneous drug-induced pathway signatures in each cell line. We also identified diverse kinome responses, indicating each cell adapts to MEK inhibition in unique ways. Despite the heterogeneity of kinome responses, decreased probe labeling of mitotic kinases and an increase of kinases linked to autophagy were identified to be common responses. Taken together, our study revealed a diversity of adaptive ATP-binding proteome and kinome responses to MEK inhibition in KRAS mutant lung cancer cells, and our study further demonstrated the utility of our approach to identify potential candidates of targetable ATP-binding enzymes involved in adaptive resistance and to develop rational drug combinations.

  17. ATP binding and hydrolysis-driven rate-determining events in the RFC-catalyzed PCNA clamp loading reaction.

    PubMed

    Sakato, Miho; Zhou, Yayan; Hingorani, Manju M

    2012-02-17

    The multi-subunit replication factor C (RFC) complex loads circular proliferating cell nuclear antigen (PCNA) clamps onto DNA where they serve as mobile tethers for polymerases and coordinate the functions of many other DNA metabolic proteins. The clamp loading reaction is complex, involving multiple components (RFC, PCNA, DNA, and ATP) and events (minimally: PCNA opening/closing, DNA binding/release, and ATP binding/hydrolysis) that yield a topologically linked clamp·DNA product in less than a second. Here, we report pre-steady-state measurements of several steps in the reaction catalyzed by Saccharomyces cerevisiae RFC and present a comprehensive kinetic model based on global analysis of the data. Highlights of the reaction mechanism are that ATP binding to RFC initiates slow activation of the clamp loader, enabling it to open PCNA (at ~2 s(-1)) and bind primer-template DNA (ptDNA). Rapid binding of ptDNA leads to formation of the RFC·ATP·PCNA(open)·ptDNA complex, which catalyzes a burst of ATP hydrolysis. Another slow step in the reaction follows ATP hydrolysis and is associated with PCNA closure around ptDNA (8 s(-1)). Dissociation of PCNA·ptDNA from RFC leads to catalytic turnover. We propose that these early and late rate-determining events are intramolecular conformational changes in RFC and PCNA that control clamp opening and closure, and that ATP binding and hydrolysis switch RFC between conformations with high and low affinities, respectively, for open PCNA and ptDNA, and thus bookend the clamp loading reaction.

  18. Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

    NASA Astrophysics Data System (ADS)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Klimanova, Elizaveta A.; Dergousova, Elena A.; Lopina, Olga D.; Makarov, Alexander A.

    2014-06-01

    Active transport of sodium and potassium ions by Na,K-ATPase is accompanied by the enzyme conformational transition between E1 and E2 states. ATP and ADP bind to Na,K-ATPase in the E1 conformation with similar affinity but the properties of enzyme in complexes with these nucleotides are different. We have studied thermodynamics of Na,K-ATPase binding with adenine nucleotides at different temperatures using isothermal titration calorimetry. Our data indicate that β-phosphate is involved in complex formation by increasing the affinity of adenine nucleotides to Na,K-ATPase by an order of magnitude, while γ-phosphate does not affect it. ATP binding to Na,K-ATPase in contrast to ADP binding generates a structural transition in the enzyme, which is consistent with the movement of a significant portion of the surface area to a solvent-protected state. We propose that ATP binding leads to convergence of the nucleotide-binding and phosphorylation domains transferring the enzyme from the ``E1-open'' to ``E1-closed'' conformation ready for phosphorylation.

  19. In vitro reassembly of the ribose ATP-binding cassette transporter reveals a distinct set of transport complexes.

    PubMed

    Clifton, Matthew C; Simon, Michael J; Erramilli, Satchal K; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A; Stauffacher, Cynthia V

    2015-02-27

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg(2+). We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg(2+), and VO4); a RbsAC complex in the presence of ADP and Mg(2+); and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters.

  20. Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics.

    PubMed

    Pan, Lurong; Aller, Stephen G

    2015-01-20

    P-glycoprotein (Pgp) is an ATP-binding cassette (ABC) transporter that alternates between inward- and outward-facing conformations to capture and force substrates out of cells like a peristaltic pump. The high degree of similarity in outward-facing structures across evolution of ABC transporters allowed construction of a high-confidence outward-facing Pgp atomic model based on crystal structures of outward-facing Sav1866 and inward-facing Pgp. The model adhered to previous experimentally determined secondary- and tertiary- configurations during all-atom molecular dynamics simulations in the presence or absence of MgATP. Three long lasting (>100 ns) meta-stable states were apparent in the presence of MgATP revealing new insights into alternating access. The two ATP-binding pockets are highly asymmetric resulting in differential control of overall structural dynamics and allosteric regulation of the drug-binding pocket. Equilibrated Pgp has a considerably different electrostatic profile compared to Sav1866 that implicates significant kinetic and thermodynamic differences in transport mechanisms.

  1. Lobular Distribution and Variability in Hepatic ATP Binding Cassette Protein B1 (ABCB1, P-gp): Ontogenetic Differences and Potential for Toxicity

    PubMed Central

    Abanda, Ngu Njei; Riches, Zoe; Collier, Abby C.

    2017-01-01

    The ATP Binding Cassette B1 (ABCB1) transporter has critical roles in endo- and xenobiotic efficacy and toxicity. To understand population variability in hepatic transport we determined ABCB1 mRNA and protein levels in total liver lysates sampled from 8 pre-defined sites (n = 24, 18–69 years), and in S9 from randomly acquired samples (n = 87, 7 days–87 years). ABCB1 levels did not differ significantly throughout individual livers and showed 4.4-fold protein variation between subjects. Neither mRNA nor protein levels varied with sex, ethnicity, obesity or triglycerides in lysates or S9 (that showed the same relationships), but protein levels were lower in pediatric S9 (p < 0.0001), with 76% of adult ABCB1 present at birth and predicted to mature in 5 years. Pediatric total liver lysates were not available. In summary, opportunistic collection for studying human hepatic ABCB1 is acceptable. Additionally, ABCB1 may be lower in children, indicating differential potential for toxicity and response to therapy in this special population. PMID:28218636

  2. Simulation of the coupling between nucleotide binding and transmembrane domains in the ATP binding cassette transporter BtuCD.

    PubMed

    Sonne, Jacob; Kandt, Christian; Peters, Günther H; Hansen, Flemming Y; Jensen, Morten Ø; Tieleman, D Peter

    2007-04-15

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B(12) importer BtuCD using perturbed elastic network calculations and biased molecular dynamics simulations. Both models predict that nucleotide release decreases the tilt between the two transmembrane domains and opens the cytoplasmic gate. Nucleotide binding has the opposite effect. The observed coupling may be relevant for all ABC transporters because of the conservation of nucleotide binding domains and the shared role of ATP in ABC transporters. The rearrangements in the cytoplasmic gate region do not provide enough space for B(12) to diffuse from the transporter pore into the cytoplasm, which could suggest that peristaltic forces are needed to exclude B(12) from the transporter pore.

  3. In Vitro Reassembly of the Ribose ATP-binding Cassette Transporter Reveals a Distinct Set of Transport Complexes*

    PubMed Central

    Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.

    2015-01-01

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465

  4. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.

    2009-01-01

    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  5. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard

    2012-01-01

    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg−1 min−1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ∼1 and 0.01 s−1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm−1), ADP (1101 and 1205 cm−1), and free phosphate (1078 cm−1). Cleavage of the β-phosphate–γ-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  6. Regulation of ATP-binding cassette transporters and cholesterol efflux by glucose in primary human monocytes and murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...

  7. LrABCF1, a GCN-type ATP-binding cassette transporter from Lilium regale, is involved in defense responses against viral and fungal pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...

  8. Skin Lesions on Common Bottlenose Dolphins (Tursiops truncatus) from Three Sites in the Northwest Atlantic, USA

    PubMed Central

    Hart, Leslie Burdett; Rotstein, Dave S.; Wells, Randall S.; Allen, Jason; Barleycorn, Aaron; Balmer, Brian C.; Lane, Suzanne M.; Speakman, Todd; Zolman, Eric S.; Stolen, Megan; McFee, Wayne; Goldstein, Tracey; Rowles, Teri K.; Schwacke, Lori H.

    2012-01-01

    Skin disease occurs frequently in many cetacean species across the globe; methods to categorize lesions have relied on photo-identification (photo-id), stranding, and by-catch data. The current study used photo-id data from four sampling months during 2009 to estimate skin lesion prevalence and type occurring on bottlenose dolphins (Tursiops truncatus) from three sites along the southeast United States coast [Sarasota Bay, FL (SSB); near Brunswick and Sapelo Island, GA (BSG); and near Charleston, SC (CHS)]. The prevalence of lesions was highest among BSG dolphins (P = 0.587) and lowest in SSB (P = 0.380), and the overall prevalence was significantly different among all sites (p<0.0167). Logistic regression modeling revealed a significant reduction in the odds of lesion occurrence for increasing water temperatures (OR = 0.92; 95%CI:0.906–0.938) and a significantly increased odds of lesion occurrence for BSG dolphins (OR = 1.39; 95%CI:1.203–1.614). Approximately one-third of the lesioned dolphins from each site presented with multiple types, and population differences in lesion type occurrence were observed (p<0.05). Lesions on stranded dolphins were sampled to determine the etiology of different lesion types, which included three visually distinct samples positive for herpesvirus. Although generally considered non-fatal, skin disease may be indicative of animal health or exposure to anthropogenic or environmental threats, and photo-id data provide an efficient and cost-effective approach to document the occurrence of skin lesions in free-ranging populations. PMID:22427955

  9. Polycyclic aromatic hydrocarbons (PAHs) mediate transcriptional activation of the ATP binding cassette transporter ABCB6 gene via the aryl hydrocarbon receptor (AhR).

    PubMed

    Chavan, Hemantkumar; Krishnamurthy, Partha

    2012-09-14

    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics.

  10. ATP binding by the P-loop NTPase OsYchF1 (an unconventional G protein) contributes to biotic but not abiotic stress responses

    PubMed Central

    Cheung, Ming-Yan; Li, Xiaorong; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yung, Yuk-Lin; Yu, Mei-Hui; Wong, Kam-Bo; Lam, Hon-Ming

    2016-01-01

    G proteins are involved in almost all aspects of the cellular regulatory pathways through their ability to bind and hydrolyze GTP. The YchF subfamily, interestingly, possesses the unique ability to bind both ATP and GTP, and is possibly an ancestral form of G proteins based on phylogenetic studies and is present in all kingdoms of life. However, the biological significance of such a relaxed ligand specificity has long eluded researchers. Here, we have elucidated the different conformational changes caused by the binding of a YchF homolog in rice (OsYchF1) to ATP versus GTP by X-ray crystallography. Furthermore, by comparing the 3D relationships of the ligand position and the various amino acid residues at the binding sites in the crystal structures of the apo-bound and ligand-bound versions, a mechanism for the protein’s ability to bind both ligands is revealed. Mutation of the noncanonical G4 motif of the OsYchF1 to the canonical sequence for GTP specificity precludes the binding/hydrolysis of ATP and prevents OsYchF1 from functioning as a negative regulator of plant-defense responses, while retaining its ability to bind/hydrolyze GTP and its function as a negative regulator of abiotic stress responses, demonstrating the specific role of ATP-binding/hydrolysis in disease resistance. This discovery will have a significant impact on our understanding of the structure–function relationships of the YchF subfamily of G proteins in all kingdoms of life. PMID:26912459

  11. Human Immunodeficiency Virus Protease Inhibitors Interact with ATP Binding Cassette Transporter 4/Multidrug Resistance Protein 4: A Basis for Unanticipated Enhanced Cytotoxicity

    PubMed Central

    Fukuda, Yu; Takenaka, Kazumasa; Sparreboom, Alex; Cheepala, Satish B.; Wu, Chung-Pu; Ekins, Sean; Ambudkar, Suresh V.

    2013-01-01

    Human immunodeficiency virus (HIV) pharmacotherapy, by combining different drug classes such as nucleoside analogs and HIV protease inhibitors (PIs), has increased HIV-patient life expectancy. Consequently, among these patients, an increase in non-HIV–associated cancers has produced a patient cohort requiring both HIV and cancer chemotherapy. We hypothesized that multidrug resistance protein 4/ATP binding cassette transporter 4 (MRP4/ABCC4), a widely expressed transporter of nucleoside-based antiviral medications as well as cancer therapeutics might interact with PIs. Among the PIs evaluated (nelfinavir, ritonavir, amprenavir, saquinavir, and indinavir), only nelfinavir both effectively stimulated MRP4 ATPase activity and inhibited substrate-stimulated ATPase activity. Saos2 and human embryonic kidney 293 cells engineered to overexpress MRP4 were then used to assess transport and cytotoxicity. MRP4 expression reduced intracellular accumulation of nelfinavir and consequently conferred survival advantage to nelfinavir cytotoxicity. Nelfinavir blocked Mrp4-mediated export, which is consistent with its ability to increase the sensitivity of MRP4-expressing cells to methotrexate. In contrast, targeted inactivation of Abcc4/Mrp4 in mouse cells specifically enhanced nelfinavir and 9-(2-phosphonylmethoxyethyl) adenine cytotoxicity. These results suggest that nelfinavir is both an inhibitor and substrate of MRP4. Because nelfinavir is a new MRP4/ABCC4 substrate, we developed a MRP4/ABCC4 pharmacophore model, which showed that the nelfinavir binding site is shared with chemotherapeutic substrates such as adefovir and methotrexate. Our studies reveal, for the first time, that nelfinavir, a potent and cytotoxic PI, is both a substrate and inhibitor of MRP4. These findings suggest that HIV-infected cancer patients receiving nelfinavir might experience both enhanced antitumor efficacy and unexpected adverse toxicity given the role of MRP4/ABCC4 in exporting nucleoside

  12. Fructose Uptake in Sinorhizobium meliloti Is Mediated by a High-Affinity ATP-Binding Cassette Transport System

    PubMed Central

    Lambert, Annie; Østerås, Magne; Mandon, Karine; Poggi, Marie-Christine; Le Rudulier, Daniel

    2001-01-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (Km of 6 μM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  13. Fructose uptake in Sinorhizobium meliloti is mediated by a high-affinity ATP-binding cassette transport system.

    PubMed

    Lambert, A; Østerås, M; Mandon, K; Poggi, M C; Le Rudulier, D

    2001-08-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (K(m) of 6 microM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  14. The PAL1 gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae

    PubMed Central

    1996-01-01

    The PAL1 gene was isolated using PCR and degenerate oligonucleotide primers corresponding to highly conserved amino acid sequence motifs diagnostic of the ATP-binding cassette domain of the superfamily of membrane-bound transport proteins typified by mammalian multidrug resistance transporter 1 and Saccharomyces cerevisiae Ste6. The deduced PAL1 gene product is similar in length to, has the same predicted topology as, and shares the highest degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP- binding cassette transporters thought to be constituents of the peroxisomal membrane. As judged by hybridization of a PAL1 probe to isolated RNA and by expression of a PAL1-lacZ fusion, a PAL1 transcript was only detectable when cells were grown on oleic acid, a carbon source which requires the biogenesis of functional peroxisomes for its metabolism. A pal1delta mutant grew normally on either glucose- or glycerol-containing media; however, unlike PAL1+ cells (or the pal1delta mutant carrying the PAL1 gene on a plasmid), pal1delta cells were unable to grow on either a solid medium or a liquid medium containing oleic acid as the sole carbon source. Antibodies raised against a chimeric protein in which the COOH-terminal domain of Pal1 was fused to glutathione S-transferase specifically recognized a protein in extracts from wild-type cells only when grown on oleic acid; this species represents the PAL1 gene product because it was missing in pal1delta cells and more abundant in pal1delta cells expressing PAL1 from a multicopy plasmid. The Pal1 polypeptide was highly enriched in the organellar pellet fraction prepared from wild-type cells by differential centrifugation and comigrated upon velocity sedimentation in a Nycodenz gradient with a known component of the peroxisomal matrix, e-oxoacyl-CoA thiolase. As judged by both subcellular fractionation and indirect

  15. ZRF1 mediates remodeling of E3 ligases at DNA lesion sites during nucleotide excision repair

    PubMed Central

    Gracheva, Ekaterina; Chitale, Shalaka; Wilhelm, Thomas; Rapp, Alexander; Byrne, Jonathan; Stadler, Jens; Medina, Rebeca; Cardoso, M. Cristina

    2016-01-01

    Faithful DNA repair is essential to maintain genome integrity. Ultraviolet (UV) irradiation elicits both the recruitment of DNA repair factors and the deposition of histone marks such as monoubiquitylation of histone H2A at lesion sites. Here, we report how a ubiquitin E3 ligase complex specific to DNA repair is remodeled at lesion sites in the global genome nucleotide excision repair (GG-NER) pathway. Monoubiquitylation of histone H2A (H2A-ubiquitin) is catalyzed predominantly by a novel E3 ligase complex consisting of DDB2, DDB1, CUL4B, and RING1B (UV–RING1B complex) that acts early during lesion recognition. The H2A-ubiquitin binding protein ZRF1 mediates remodeling of this E3 ligase complex directly at the DNA lesion site, causing the assembly of the UV–DDB–CUL4A E3 ligase complex (DDB1–DDB2–CUL4A-RBX1). ZRF1 is an essential factor in GG-NER, and its function at damaged chromatin sites is linked to damage recognition factor XPC. Overall, the results shed light on the interplay between epigenetic and DNA repair recognition factors at DNA lesion sites. PMID:27091446

  16. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera.

    PubMed

    Çakır, Birsen; Kılıçkaya, Ozan

    2013-01-01

    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 "full-size," 41 "half-size," and 15 "soluble" putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera.

  17. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W

    1992-01-01

    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  18. ABCC1, an ATP Binding Cassette Protein from Grape Berry, Transports Anthocyanidin 3-O-Glucosides[W][OA

    PubMed Central

    Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka

    2013-01-01

    Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325

  19. The ATP-binding cassette transporter-2 (ABCA2) regulates esterification of plasma membrane cholesterol by modulation of sphingolipid metabolism.

    PubMed

    Davis, Warren

    2014-01-01

    The ATP-binding cassette transporters are a large family (~48 genes divided into seven families A-G) of proteins that utilize the energy of ATP-hydrolysis to pump substrates across lipid bilayers against a concentration gradient. The ABC "A" subfamily is comprised of 13 members and transport sterols, phospholipids and bile acids. ABCA2 is the most abundant ABC transporter in human and rodent brain with highest expression in oligodendrocytes, although it is also expressed in neurons. Several groups have studied a possible connection between ABCA2 and Alzheimer's disease as well as early atherosclerosis. ABCA2 expression levels have been associated with changes in cholesterol and sphingolipid metabolism. In this paper, we hypothesized that ABCA2 expression level may regulate esterification of plasma membrane-derived cholesterol by modulation of sphingolipid metabolism. ABCA2 overexpression in N2a neuroblastoma cells was associated with an altered bilayer distribution of the sphingolipid ceramide that inhibited acylCoA:cholesterol acyltransferase (ACAT) activity and cholesterol esterification. In contrast, depletion of endogenous ABCA2 in the rat schwannoma cell line D6P2T increased esterification of plasma membrane cholesterol following treatment with exogenous bacterial sphingomyelinase. These findings suggest that control of ABCA2 expression level may be a key locus of regulation for esterification of plasma membrane-derived cholesterol through modulation of sphingolipid metabolism.

  20. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).

    PubMed

    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli

    2013-09-10

    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions.

  1. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.

    PubMed

    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang

    2013-08-01

    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  2. Linsitinib (OSI-906) antagonizes ATP-binding cassette subfamily G member 2 and subfamily C member 10-mediated drug resistance.

    PubMed

    Zhang, Hui; Kathawala, Rishil J; Wang, Yi-Jun; Zhang, Yun-Kai; Patel, Atish; Shukla, Suneet; Robey, Robert W; Talele, Tanaji T; Ashby, Charles R; Ambudkar, Suresh V; Bates, Susan E; Fu, Li-Wu; Chen, Zhe-Sheng

    2014-06-01

    In this study we investigated the effect of linsitinib on the reversal of multidrug resistance (MDR) mediated by the overexpression of the ATP-binding cassette (ABC) subfamily members ABCB1, ABCG2, ABCC1 and ABCC10. Our results indicate for the first time that linsitinib significantly potentiate the effect of anti-neoplastic drugs mitoxantrone (MX) and SN-38 in ABCG2-overexpressing cells; paclitaxel, docetaxel and vinblastine in ABCC10-overexpressing cells. Linsitinib moderately enhanced the cytotoxicity of vincristine in cell lines overexpressing ABCB1, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, linsitinib significantly increased the intracellular accumulation and decreased the efflux of [(3)H]-MX in ABCG2-overexpressing cells and [(3)H]-paclitaxel in ABCC10-overexpressing cells. However, linsitinib, at a concentration that reversed MDR, did not significantly alter the expression levels of either the ABCG2 or ABCC10 transporter proteins. Furthermore, linsitinib did not significantly alter the intracellular localization of ABCG2 or ABCC10. Moreover, linsitinib stimulated the ATPase activity of ABCG2 in a concentration-dependent manner. Overall, our study suggests that linsitinib attenuates ABCG2- and ABCC10-mediated MDR by directly inhibiting their function as opposed to altering ABCG2 or ABCC10 protein expression.

  3. Multiple ATP-binding cassette transporters are involved in insecticide resistance in the small brown planthopper, Laodelphax striatellus.

    PubMed

    Sun, H; Pu, J; Chen, F; Wang, J; Han, Z

    2017-03-16

    ATP-binding cassette (ABC) transporters are membrane-bound proteins involved in the movement of various substrates, including drugs and insecticides, across the lipid membrane. Demonstration of the role of human ABC transporters in multidrug resistance has led to speculation that they might be an important mechanism controlling the fate of insecticides in insects. However, the role of ABC transporters in insects remains largely unknown. The small brown planthopper, Laodelphax striatellus Fallén, has developed resistance to most of the insecticides used for its control. Our goals were to identify the ABC transporters in La. striatellus and to examine their involvement in resistance mechanisms, using related strains resistant to chlorpyrifos, deltamethrin and imidacloprid, compared with the susceptible strain. Based on the transcriptome of La. striatellus, 40 full-length ABC transporters belonging to the ABCA-ABCH subfamilies were identified. Quantitative PCR revealed that over 20% of genes were significantly up-regulated in different resistant strains, and eight genes from the ABCB/C/D/G subfamilies were up-regulated in all three resistant strains, compared with the susceptible strain. Furthermore, synergism studies showed verapamil significantly enhanced insecticide toxicity in various resistant strains but not in the susceptible strain. These results suggest that ABC transporters might be involved in resistance to multiple insecticides in La. striatellus.

  4. Simulated microgravity alters the expression of cytoskeleton- and ATP-binding-related genes in MLO-Y4 osteocytes

    NASA Astrophysics Data System (ADS)

    Chen, Zhihao; Zhao, Fan; Qi, Yiduo; Hu, Lifang; Li, Dijie; Yin, Chong; Su, Peihong; Zhang, Yan; Ma, Jianhua; Qian, Jing; Zhou, Hongpo; Zou, Yiwei; Qian, Airong

    2016-12-01

    Bone undergoes dynamic modelling and remodelling processes, and it requires gravity-mediated mechanical stimulation for the maintenance of mineral content and structure. Osteocytes are the most commonly found cells in the mature bone, and they are sensitive to mechanical changes. The purpose of this study was to investigate the effects of microgravity simulated with a random position machine (RPM) on the gene expression profile of osteocytes. Genes sensitive to RPM treatment were sorted on the basis of biological processes, interactions and signalling pathways. Overall, 504 differentially expressed genes (DEGs) in osteocytes cultured under RPM conditions were found. The DEGs were further analysed using bioinformatics tools such as DAVID and iReport. A total of 15 ATP-binding and cytoskeleton-related genes were further confirmed by quantitative real-time PCR (qRT-PCR). Our findings demonstrate that the RPM affected the expression of genes involved in cytoskeleton remodelling and the energy-transfer process in osteocytes. The identification of mechanosensitive genes may enhance our understanding of the roles of osteocytes in mechanosensation and may provide some potential targets for preventing and treating bone-related diseases.

  5. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    SciTech Connect

    Kerem, B.; Zielenski, J.; Markiewicz, D.; Bozon, D.; Kennedy, D.; Rommens, J.M. ); Gazit, E. ); Yahav, J. ); Riordan, J.R. ); Collins, F.S. ); Tsui, Lapchee Univ. of Toronto, Ontario )

    1990-11-01

    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probably affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.

  6. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.

    PubMed

    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou

    2012-07-01

    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  7. Stickleback embryos use ATP-binding cassette transporters as a buffer against exposure to maternally derived cortisol

    PubMed Central

    Bukhari, Syed Abbas; Bell, Alison M.

    2016-01-01

    Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623

  8. An Allosteric Cross-Talk Between the Activation Loop and the ATP Binding Site Regulates the Activation of Src Kinase

    PubMed Central

    Pucheta-Martínez, Encarna; Saladino, Giorgio; Morando, Maria Agnese; Martinez-Torrecuadrada, Jorge; Lelli, Moreno; Sutto, Ludovico; D’Amelio, Nicola; Gervasio, Francesco Luigi

    2016-01-01

    Phosphorylation of the activation loop is a fundamental step in the activation of most protein kinases. In the case of the Src tyrosine kinase, a prototypical kinase due to its role in cancer and its historic importance, phosphorylation of tyrosine 416 in the activation loop is known to rigidify the structure and contribute to the switch from the inactive to a fully active form. However, whether or not phosphorylation is able per-se to induce a fully active conformation, that efficiently binds ATP and phosphorylates the substrate, is less clear. Here we employ a combination of solution NMR and enhanced-sampling molecular dynamics simulations to fully map the effects of phosphorylation and ATP/ADP cofactor loading on the conformational landscape of Src tyrosine kinase. We find that both phosphorylation and cofactor binding are needed to induce a fully active conformation. What is more, we find a complex interplay between the A-loop and the hinge motion where the phosphorylation of the activation-loop has a significant allosteric effect on the dynamics of the C-lobe. PMID:27063862

  9. An Allosteric Cross-Talk Between the Activation Loop and the ATP Binding Site Regulates the Activation of Src Kinase

    NASA Astrophysics Data System (ADS)

    Pucheta-Martínez, Encarna; Saladino, Giorgio; Morando, Maria Agnese; Martinez-Torrecuadrada, Jorge; Lelli, Moreno; Sutto, Ludovico; D’Amelio, Nicola; Gervasio, Francesco Luigi

    2016-04-01

    Phosphorylation of the activation loop is a fundamental step in the activation of most protein kinases. In the case of the Src tyrosine kinase, a prototypical kinase due to its role in cancer and its historic importance, phosphorylation of tyrosine 416 in the activation loop is known to rigidify the structure and contribute to the switch from the inactive to a fully active form. However, whether or not phosphorylation is able per-se to induce a fully active conformation, that efficiently binds ATP and phosphorylates the substrate, is less clear. Here we employ a combination of solution NMR and enhanced-sampling molecular dynamics simulations to fully map the effects of phosphorylation and ATP/ADP cofactor loading on the conformational landscape of Src tyrosine kinase. We find that both phosphorylation and cofactor binding are needed to induce a fully active conformation. What is more, we find a complex interplay between the A-loop and the hinge motion where the phosphorylation of the activation-loop has a significant allosteric effect on the dynamics of the C-lobe.

  10. Solution structure of the 45-residue MgATP-binding peptide of adenylate kinase as examined by 2-D NMR, FTIR, and CD spectroscopy.

    PubMed

    Fry, D C; Byler, D M; Susi, H; Brown, E M; Kuby, S A; Mildvan, A S

    1988-05-17

    The structure of a synthetic peptide corresponding to residues 1-45 of rabbit muscle adenylate kinase has been studied in aqueous solution by two-dimensional NMR, FTIR, and CD spectroscopy. This peptide, which binds MgATP and is believed to represent most of the MgATP-binding site of the enzyme [Fry, D.C., Kuby, S.A., & Mildvan, A.S. (1985) Biochemistry 24, 4680-4694], appears to maintain a conformation similar to that of residues 1-45 in the X-ray structure of intact porcine adenylate kinase [Sachsenheimer, W., & Schulz, G.E. (1977) J. Mol. Biol. 114, 23-26], with 42% of the residues of the peptide showing NOEs indicative of phi and psi angles corresponding to those found in the protein. The NMR studies suggest that the peptide is composed of two helical regions of residues 4-7 and 23-29, and three stretches of beta-strand at residues 8-15, 30-32, and 35-40, yielding an overall secondary structure consisting of 24% alpha-helix, 38% beta-structure, and 38% aperiodic. Although the resolution-enhanced amide I band of the peptide FTIR spectrum is broad and rather featureless, possibly due to disorder, it can be fit by using methods developed on well-characterized globular proteins. On this basis, the peptide consists of 35 +/- 10% beta-structure, 60 +/- 12% turns and aperiodic structure, and not more than 10% alpha-helix. The CD spectrum is best fit by assuming the presence of at most 13% alpha-helix in the peptide, 24 +/- 2% beta-structure, and 66 +/- 4% aperiodic. The inability of the high-frequency FTIR and CD methods to detect helices in the amount found by NMR may result from the short helical lengths as well as from static and dynamic disorder in the peptide. Upon binding of MgATP, numerous conformational changes in the backbone of the peptide are detected by NMR, with smaller alterations in the overall secondary structure as assessed by CD. Detailed assignments of resonances in the peptide spectrum and intermolecular NOEs between protons of bound MgATP and

  11. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance.

    PubMed

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols.

  12. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance

    PubMed Central

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols. PMID:25254091

  13. Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus

    PubMed Central

    2012-01-01

    Background The otrC gene of Streptomyces rimosus was previously annotated as an oxytetracycline (OTC) resistance protein. However, the amino acid sequence analysis of OtrC shows that it is a putative ATP-binding cassette (ABC) transporter with multidrug resistance function. To our knowledge, none of the ABC transporters in S. rimosus have yet been characterized. In this study, we aimed to characterize the multidrug exporter function of OtrC and evaluate its relevancy to OTC production. Results In order to investigate OtrC’s function, otrC is cloned and expressed in E. coli The exporter function of OtrC was identified by ATPase activity determination and ethidium bromide efflux assays. Also, the susceptibilities of OtrC-overexpressing cells to several structurally unrelated drugs were compared with those of OtrC-non-expressing cells by minimal inhibitory concentration (MIC) assays, indicating that OtrC functions as a drug exporter with a broad range of drug specificities. The OTC production was enhanced by 1.6-fold in M4018 (P = 0.000877) and 1.4-fold in SR16 (P = 0.00973) duplication mutants, while it decreased to 80% in disruption mutants (P = 0.0182 and 0.0124 in M4018 and SR16, respectively). Conclusions The results suggest that OtrC is an ABC transporter with multidrug resistance function, and plays an important role in self-protection by drug efflux mechanisms. This is the first report of such a protein in S. rimosus, and otrC could be a valuable target for genetic manipulation to improve the production of industrial antibiotics. PMID:22906146

  14. Functional Characterization of ATP-Binding Cassette Transporter A3 Mutations from Infants with Respiratory Distress Syndrome.

    PubMed

    Wambach, Jennifer A; Yang, Ping; Wegner, Daniel J; Heins, Hillary B; Kaliberova, Lyudmila N; Kaliberov, Sergey A; Curiel, David T; White, Frances V; Hamvas, Aaron; Hackett, Brian P; Cole, F Sessions

    2016-11-01

    Mutations in the ATP-binding cassette transporter A3 gene (ABCA3) result in severe neonatal respiratory distress syndrome and childhood interstitial lung disease. As most ABCA3 mutations are rare or private, determination of mutation pathogenicity is often based on results from in silico prediction tools, identification in unrelated diseased individuals, statistical association studies, or expert opinion. Functional biologic studies of ABCA3 mutations are needed to confirm mutation pathogenicity and inform clinical decision making. Our objective was to functionally characterize two ABCA3 mutations (p.R288K and p.R1474W) identified among term and late-preterm infants with respiratory distress syndrome with unclear pathogenicity in a genetically versatile model system. We performed transient transfection of HEK293T cells with wild-type or mutant ABCA3 alleles to assess protein processing with immunoblotting. We used transduction of A549 cells with adenoviral vectors, which concurrently silenced endogenous ABCA3 and expressed either wild-type or mutant ABCA3 alleles (p.R288K and p.R1474W) to assess immunofluorescent localization, ATPase activity, and organelle ultrastructure. Both ABCA3 mutations (p.R288K and p.R1474W) encoded proteins with reduced ATPase activity but with normal intracellular localization and protein processing. Ultrastructural phenotypes of lamellar body-like vesicles in A549 cells transduced with mutant alleles were similar to wild type. Mutant proteins encoded by ABCA3 mutations p.R288K and p.R1474W had reduced ATPase activity, a biologically plausible explanation for disruption of surfactant metabolism by impaired phospholipid transport into the lamellar body. These results also demonstrate the usefulness of a genetically versatile, human model system for functional characterization of ABCA3 mutations with unclear pathogenicity.

  15. Osimertinib (AZD9291) Attenuates the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCB1 in Vitro.

    PubMed

    Hsiao, Sung-Han; Lu, Yu-Jen; Li, Yan-Qing; Huang, Yang-Hui; Hsieh, Chia-Hung; Wu, Chung-Pu

    2016-06-06

    The effectiveness of cancer chemotherapy is often circumvented by multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) drug transporter ABCB1 (MDR1, P-glycoprotein). Several epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been shown previously capable of modulating the function of ABCB1 and reversing ABCB1-mediated MDR in human cancer cells. Furthermore, some TKIs are transported by ABCB1, which results in low oral bioavailability, reduced distribution, and the development of acquired resistance to these TKIs. In this study, we investigated the interaction between ABCB1 and osimertinib, a novel selective, irreversible third-generation EGFR TKI that has recently been approved by the U.S. Food and Drug Administration. We also evaluated the potential impact of ABCB1 on the efficacy of osimertinib in cancer cells, which can present a therapeutic challenge to clinicians in the future. We revealed that although osimertinib stimulates the ATPase activity of ABCB1, overexpression of ABCB1 does not confer resistance to osimertinib. Our results suggest that it is unlikely that the overexpression of ABCB1 can be a major contributor to the development of osimertinib resistance in cancer patients. More significantly, we revealed an additional action of osimertinib that directly inhibits the function of ABCB1 without affecting the expression level of ABCB1, enhances drug-induced apoptosis, and reverses the MDR phenotype in ABCB1-overexpressing cancer cells. Considering that osimertinib is a clinically approved third-generation EGFR TKI, our findings suggest that a combination therapy with osimertinib and conventional anticancer drugs may be beneficial to patients with MDR tumors.

  16. Genome-Wide Identification, Evolution, and Expression Analysis of the ATP-Binding Cassette Transporter Gene Family in Brassica rapa

    PubMed Central

    Yan, Chao; Duan, Weike; Lyu, Shanwu; Li, Ying; Hou, Xilin

    2017-01-01

    ATP-binding cassette (ABC) proteins can act as transporters of different substrates across biological membranes by hydrolyzing ATP. However, little information is available about ABC transporters in Brassica rapa, an important leafy vegetable. In the present study, we carried out genome-wide identification, characterization and molecular evolution analyses of ABC gene family in B. rapa and 9 other plant species. A total of 179 B. rapa ABC genes (BraABCs) were identified. Among them, 173 BraABCs were identified on 10 chromosomes. Based on phylogenetic analysis and domain organization, the BraABC family could be grouped into eight subfamilies. BraABCs in the same subfamily showed similar motif composition and exon-intron organization. Common and unique cis-elements involved in the transcriptional regulation were also identified in the promoter regions of BraABCs. Tissue-expression analysis of BraABCs demonstrated their diverse spatiotemporal expression profiles. Influences of the whole genome triplication (WGT) on the evolution of BraABCs were studied in detail. BraABCs were preferentially retained compared with their neighboring genes during diploidization after WGT. Synteny analysis identified 76 pairs of syntenic BraABC paralogs among the three subgenomes of B. rapa, and 10 paralog pairs underwent positive selection with ω (= Ka/Ks) ratios greater than 1. Analyses of the expression patterns of syntenic BraABC paralogs pairs across five tissues and under stress treatments revealed their functional conservation, sub-functionalization, neo-functionalization and pseudogenization during evolution. Our study presents a comprehensive overview of the ABC gene family in B. rapa and will be helpful for the further functional study of BraABCs in plant growth, development, and stress responses. PMID:28367152

  17. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis)

    PubMed Central

    Heumann, Jan; Taggart, John B.; Gharbi, Karim; Bron, James E.; Bekaert, Michaël; Sturm, Armin

    2015-01-01

    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance. PMID:26418738

  18. Identification of a MAP 2-like ATP-binding protein associated with axoplasmic vesicles that translocate on isolated microtubules

    PubMed Central

    1986-01-01

    Axoplasmic vesicles were purified and observed to translocate on isolated microtubules in an ATP-dependent, trypsin-sensitive manner, implying that ATP-binding polypeptides essential for force generation were present on the vesicle surface. To identify these proteins [alpha 32P]8-azidoadenosine 5'-triphosphate ([alpha 32P]8-N3ATP), a photoaffinity analogue of ATP, was used. The results presented here identify and characterize a vesicle-associated polypeptide having a relative molecular mass of 292 kD that bound [alpha 32P]8-N3ATP. The incorporation of label is ultraviolet light-dependent and ATP- sensitive. Moreover, the 292-kD polypeptide could be isolated in association with vesicles or microtubules, depending on the conditions used, and the data indicate that the 292-kD polypeptide is similar to mammalian brain microtubule-associated protein 2 (MAP 2) for the following reasons: The 292-kD polypeptide isolated from either squid axoplasm or optic lobe cross-reacts with antiserum to porcine brain MAP 2. Furthermore, it purifies with taxol-stabilized microtubules and is released with salt. Based on these characteristics, the 292-kD polypeptide is distinct from the known force-generating molecules myosin and flagellar dynein, as well as the 110-130-kD kinesin-like polypeptides that have recently been described (Brady, S. T., 1985, Nature (Lond.), 317:73-75; Vale, R. D., T. S. Reese, and M. P. Sheetz, 1985b, Cell, 42:39-50; Scholey, J. M., M. E. Porter, P. M. Grissom, and J. R. McIntosh, 1985, Nature (Lond.), 318:483-486). Because the 292-kD polypeptide binds ATP and is associated with vesicles that translocate on purified MAP-free microtubules in an ATP-dependent fashion, it is therefore believed to be involved in vesicle-microtubule interactions that promote organelle motility. PMID:3091608

  19. HER2 as therapeutic target for overcoming ATP-binding cassette transporter-mediated chemoresistance in small cell lung cancer.

    PubMed

    Minami, Toshiyuki; Kijima, Takashi; Otani, Yasushi; Kohmo, Satoshi; Takahashi, Ryo; Nagatomo, Izumi; Hirata, Haruhiko; Suzuki, Mayumi; Inoue, Koji; Takeda, Yoshito; Kida, Hiroshi; Tachibana, Isao; Kumanogoh, Atsushi

    2012-04-01

    Small cell lung cancer (SCLC) easily acquires multidrug resistance after successful initial therapy. Overexpression of ATP-binding cassette (ABC) transporters is important for the multidrug resistance. Among them, ABCB1 and ABCG2 are known to be upregulated in chemoresistant SCLC cells. We found that human epidermal growth factor receptor 2 (HER2) expressions are also upregulated in chemoresistant SBC-3/ETP, SBC-3/SN-38, and SBC-3/CDDP cells, compared with chemosensitive SBC-3 cells. Lapatinib, a tyrosine kinase inhibitor of HER2, could not suppress proliferation of these HER2-positive SCLC cells alone but successfully restored chemosensitivity to etoposide and SN-38 with a clinically applicable concentration. The reversal effect of lapatinib was thought to be caused by inhibition of drug efflux pump functions of ABC transporters, although lapatinib itself has been reported to be a substrate for them. Moreover, knocking down of HER2 by an short interfering RNA weakened the effect of lapatinib on ABCB1, indicating the involvement of HER2 in the inhibitory mechanisms. Notably, we showed that caveolin-1 and Src play key roles in modulating ABCB1 function via HER2 inactivation. In SBC-3/ETP cells, dephosphorylation of HER2 by lapatinib activates Src and successively leads to increased caveolin-1 phosphorylation. Through this process, caveolin-1 dissociates from HER2 and strengthens association with ABCB1, and finally impairs the pump functions. Furthermore, we showed that treatment by lapatinib in combination with etoposide or irinotecan significantly suppresses the growth of subcutaneous SBC-3/ETP and SBC-3/SN-38 tumors in mice, respectively. Collectively, these results indicate that combination therapy with lapatinib and cytotoxic agents could conquer ABC transporter-mediated chemoresistance especially in HER2-positive SCLC.

  20. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine

    2016-01-01

    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  1. A Novel ATP-Binding Cassette Transporter Involved in Multidrug Resistance in the Phytopathogenic Fungus Penicillium digitatum

    PubMed Central

    Nakaune, Ryoji; Adachi, Kiichi; Nawata, Osamu; Tomiyama, Masamitsu; Akutsu, Katsumi; Hibi, Tadaaki

    1998-01-01

    Demethylation inhibitor (DMI)-resistant strains of the plant pathogenic fungus Penicillium digitatum were shown to be simultaneously resistant to cycloheximide, 4-nitroquinoline-N-oxide (4NQO), and acriflavine. A PMR1 (Penicillium multidrug resistance) gene encoding an ATP-binding cassette (ABC) transporter (P-glycoprotein) was cloned from a genomic DNA library of a DMI-resistant strain (LC2) of Penicillium digitatum by heterologous hybridization with a DNA fragment containing an ABC-encoding region from Botrytis cinerea. Sequence analysis revealed significant amino acid homology to the primary structures of PMR1 (protein encoded by the PMR1 gene) and ABC transporters of Saccharomyces cerevisiae (PDR5 and SNQ2), Schizosaccharomyces pombe (HBA2), Candida albicans (CDR1), and Aspergillus nidulans (AtrA and AtrB). Disruption of the PMR1 gene of P. digitatum DMI-resistant strain LC2 demonstrated that PMR1 was an important determinant of resistance to DMIs. The effective concentrations inhibiting radial growth by 50% (EC50s) and the MICs of fenarimol and bitertanol for the PMR1 disruptants (Δpmr1 mutants) were equivalent to those for DMI-sensitive strains. Northern blot analysis indicated that severalfold more PMR1 transcript accumulated in the DMI-resistant strains compared with those in DMI-sensitive strains in the absence of fungicide. In both DMI-resistant and -sensitive strains, transcription of PMR1 was strongly enhanced within 10 min after treatment with the DMI fungicide triflumizole. These results suggested that the toxicant efflux system comprised of PMR1 participates directly in the DMI resistance of the fungus. PMID:9758830

  2. Multidrug resistance in cancer chemotherapy and xenobiotic protection mediated by the half ATP-binding cassette transporter ABCG2.

    PubMed

    Han, B; Zhang, J-T

    2004-01-01

    ABCG2, also termed BCRP/MXR/ABCP, is a half ATP-binding cassette (ABC) transporter expressed on plasma membranes. ABCG2 was independently cloned from placenta as well as cell lines selected for resistance to mitoxantrone or anthracyclines. ABCG2 consists of a nucleotide-binding domain (NBD) at the amino terminus and a transmembrane domain (TMD) at the carboxyl terminus and it is postulated to form a homodimer to perform its biological functions. Over-expression of ABCG2 in cell lines confers resistance on a wide variety of anticancer drugs including mitoxantrone, daunorubicin, doxorubicin, topotecan and epirubicin. The expression of ABCG2 has been implicated in multidrug resistance (MDR) of acute myeloid leukemia and some solid tumors. In addition, ABCG2 can transport several fluorescent dyes or toxins. ABCG2 is found to be expressed in epithelial cells of intestine and colon, liver canaliculi, and renal tubules, where it serves to eliminate the plasma level of orally administered anticancer drugs as well as ingested toxins. ABCG2 is found to be highly expressed in placenta and the luminal surface of microvessel endothelium blood-brain barrier where it may play a role in limiting the penetration of drugs, such as topotecan from the maternal plasma into the fetus and from blood to brain. A variety of inhibitors for ABCG2 including GF120918 may prove useful for sensitizing cancer cells to chemotherapy or altering the distribution of orally administered drug substrates of ABCG2. Interestingly, ABCG2 is also expressed highly in hematopoietic stem cells. However, the function of ABCG2 in stem cells is currently unknown, although it may provide protection to stem cells from a variety of xenobiotics.

  3. Variations in ATP-Binding Cassette Transporter Regulation during the Progression of Human Nonalcoholic Fatty Liver DiseaseS⃞

    PubMed Central

    Hardwick, Rhiannon N.; Fisher, Craig D.; Canet, Mark J.; Scheffer, George L.

    2011-01-01

    Transporters located on the sinusoidal and canalicular membranes of hepatocytes regulate the efflux of drugs and metabolites into blood and bile, respectively. Changes in the expression or function of these transporters during liver disease may lead to a greater risk of adverse drug reactions. Nonalcoholic fatty liver disease (NAFLD) is a progressive condition encompassing the relatively benign steatosis and the more severe, inflammatory state of nonalcoholic steatohepatitis (NASH). Here, we present an analysis of the effect of NAFLD progression on the major ATP-binding cassette (ABC) efflux transport proteins ABCC1–6, ABCB1, and ABCG2. Human liver samples diagnosed as normal, steatotic, NASH (fatty), and NASH (not fatty) were analyzed. Increasing trends in mRNA expression of ABCC1, ABCC4–5, ABCB1, and ABCG2 were found with NAFLD progression, whereas protein levels of all transporters exhibited increasing trends with disease progression. Immunohistochemical staining of ABCC3, ABCB1, and ABCG2 revealed no alterations in cellular localization during NAFLD progression. ABCC2 staining revealed an alternative mechanism of regulation in NASH in which the transporter appears to be internalized away from the canalicular membrane. This correlated with a preferential shift in the molecular mass of ABCC2 from 200 to 180 kDa in NASH, which has been shown to be associated with a loss of glycosylation and internalization of the protein. These data demonstrate increased expression of multiple efflux transporters as well as altered cellular localization of ABCC2 in NASH, which may have profound effects on the ability of patients with NASH to eliminate drugs in an appropriate manner. PMID:21878559

  4. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed Central

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul

    2002-01-01

    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters. PMID:12057006

  5. Relationship between a point mutation S97C in CK1δ protein and its affect on ATP-binding affinity.

    PubMed

    Kumar, Ambuj; Rajendran, Vidya; Sethumadhavan, Rao; Purohit, Rituraj

    2014-01-01

    CK1δ (Casein kinase I isoform delta) is a member of CK1 kinase family protein that mediates neurite outgrowth and the function as brain-specific microtubule-associated protein. ATP binding kinase domain of CK1δ is essential for regulating several key cell cycle signal transduction pathways. Mutation in CK1δ protein is reported to cause cancers and affects normal brain development. S97C mutation in kinase domain of CK1δ protein has been involved to induce breast cancer and ductal carcinoma. We performed molecular docking studies to examine the effect of this mutation on its ATP-binding affinity. Further, we conducted molecular dynamics simulations to understand the structural consequences of S97C mutation over the kinase domain of CK1δ protein. Docking results indicated the loss of ATP-binding affinity of mutant structure, which were further rationalized by molecular dynamics simulations, where a notable loss in 3-D conformation of CK1δ kinase domain was observed in mutant as compared to native. Our results explained the underlying molecular mechanism behind the observed cancer associated phenotype caused by S97C mutation in CK1δ protein.

  6. About a switch: how P-glycoprotein (ABCB1) harnesses the energy of ATP binding and hydrolysis to do mechanical work.

    PubMed

    Sauna, Zuben E; Ambudkar, Suresh V

    2007-01-01

    The efflux of drugs by the multidrug transporter P-glycoprotein (Pgp; ABCB1) is one of the principal means by which cancer cells evade chemotherapy and exhibit multidrug resistance. Mechanistic studies of Pgp-mediated transport, however, transcend the importance of this protein per se as they help us understand the transport pathway of the ATP-binding cassette proteins in general. The ATP-binding cassette proteins comprise one of the largest protein families, are central to cellular physiology, and constitute important drug targets. The functional unit of Pgp consists of two nucleotide-binding domains (NBD) and two transmembrane domains that are involved in the transport of drug substrates. Early studies postulated that conformational changes as a result of ATP hydrolysis were transmitted to the transmembrane domains bringing about drug transport. More recent structural and biochemical studies on the other hand suggested that ATP binds at the interface of the two NBDs and induces the formation of a closed dimer, and it has been hypothesized that this dimerization and subsequent ATP hydrolysis powers transport. Based on the mutational and biochemical work on Pgp and structural studies with isolated NBDs, we review proposed schemes for the catalytic cycle of ATP hydrolysis and the transport pathway.

  7. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Icyuz, Mert; Chauvet, Sylvain; Tao, Binli; Hartman, John L.; Kirk, Kevin L.

    2015-01-01

    The ABCC transporter subfamily includes pumps, the long and short multidrug resistance proteins (MRPs), and an ATP-gated anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR). We show that despite their thermodynamic differences, these ABCC transporter subtypes use broadly similar mechanisms to couple their extracellular gates to the ATP occupancies of their cytosolic nucleotide binding domains. A conserved extracellular phenylalanine at this gate was a prime location for producing gain of function (GOF) mutants of a long MRP in yeast (Ycf1p cadmium transporter), a short yeast MRP (Yor1p oligomycin exporter), and human CFTR channels. Extracellular gate mutations rescued ATP binding mutants of the yeast MRPs and CFTR by increasing ATP sensitivity. Control ATPase-defective MRP mutants could not be rescued by this mechanism. A CFTR double mutant with an extracellular gate mutation plus a cytosolic GOF mutation was highly active (single-channel open probability >0.3) in the absence of ATP and protein kinase A, each normally required for CFTR activity. We conclude that all 3 ABCC transporter subtypes use similar mechanisms to couple their extracellular gates to ATP occupancy, and highly active CFTR channels that bypass defects in ATP binding or phosphorylation can be produced.—Wei, S., Roessler, B. C., Icyuz, M., Chauvet, S., Tao, B., Hartman IV, J. L., Kirk, K. L. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels. PMID:26606940

  8. Up-Regulation of the ATP-Binding Cassette Transporter A1 Inhibits Hepatitis C Virus Infection

    PubMed Central

    Gondeau, Claire; Douam, Florian; Lebreton, Stéphanie; Lagaye, Sylvie; Pol, Stanislas; Helle, François; Plengpanich, Wanee; Guérin, Maryse; Bourgine, Maryline; Michel, Marie Louise; Lavillette, Dimitri; Roingeard, Philippe; le Goff, Wilfried; Budkowska, Agata

    2014-01-01

    Hepatitis C virus (HCV) establishes infection using host lipid metabolism pathways that are thus considered potential targets for indirect anti-HCV strategies. HCV enters the cell via clathrin-dependent endocytosis, interacting with several receptors, and virus-cell fusion, which depends on acidic pH and the integrity of cholesterol-rich domains of the hepatocyte membrane. The ATP-binding Cassette Transporter A1 (ABCA1) mediates cholesterol efflux from hepatocytes to extracellular Apolipoprotein A1 and moves cholesterol within cell membranes. Furthermore, it generates high-density lipoprotein (HDL) particles. HDL protects against arteriosclerosis and cardiovascular disease. We show that the up-regulation of ABCA1 gene expression and its cholesterol efflux function in Huh7.5 hepatoma cells, using the liver X receptor (LXR) agonist GW3965, impairs HCV infection and decreases levels of virus produced. ABCA1-stimulation inhibited HCV cell entry, acting on virus-host cell fusion, but had no impact on virus attachment, replication, or assembly/secretion. It did not affect infectivity or properties of virus particles produced. Silencing of the ABCA1 gene and reduction of the specific cholesterol efflux function counteracted the inhibitory effect of the GW3965 on HCV infection, providing evidence for a key role of ABCA1 in this process. Impaired virus-cell entry correlated with the reorganisation of cholesterol-rich membrane microdomains (lipid rafts). The inhibitory effect could be reversed by an exogenous cholesterol supply, indicating that restriction of HCV infection was induced by changes of cholesterol content/distribution in membrane regions essential for virus-cell fusion. Stimulation of ABCA1 expression by GW3965 inhibited HCV infection of both human primary hepatocytes and isolated human liver slices. This study reveals that pharmacological stimulation of the ABCA1-dependent cholesterol efflux pathway disrupts membrane cholesterol homeostasis, leading to the

  9. Poloxamines display a multiple inhibitory activity of ATP-binding cassette (ABC) transporters in cancer cell lines.

    PubMed

    Cuestas, María L; Sosnik, Alejandro; Mathet, Verónica L

    2011-08-01

    Primary hepatocellular carcinoma is the third most common fatal cancer worldwide with more than 500,000 annual deaths. Approximately 40% of the patients with HCC showed tumoral overexpression of transmembrane proteins belonging to the ATP-binding cassette protein superfamily (ABC) which pump drugs out of cells. The overexpression of these efflux transporters confers on the cells a multiple drug resistance phenotype, which is considered a crucial cause of treatment refractoriness in patients with cancer. The aim of this study was to investigate the inhibitory effect of different concentrations of pH- and temperature-responsive X-shaped poly(ethylene oxide)-poly(propylene oxide) block copolymers (poloxamines, Tetronic, PEO-PPO) showing a wide range of molecular weights and EO/PO ratios on the functional activity of three different ABC proteins, namely P-glycoprotein (P-gp or MDR1), breast cancer resistance protein (BCRP), and multidrug resistance-associated protein MRP1, in two human hepatocarcinoma cell lines, HepG2 and Huh7. First, the cytotoxicity of the different copolymers (at different concentrations) on both liver carcinoma cell lines was thoroughly evaluated by means of apoptosis analysis using annexin V and propidium iodide (PI). Thus, viable cells (AV-/PI-), early apoptotic cells (AV+/PI-) and late apoptotic cells (V-FITC+/PI+) were identified. Results pointed out copolymers of intermediate to high hydrophobicity and intermediate molecular weight (e.g., T904) as the most cytotoxic. Then, DiOC2, rhodamine 123 and vinblastine were used as differential substrates of these pumps. HeLa, an epithelial cell line of human cervical cancer that does not express P-gp, was used exclusively as a control and enabled the discerning between P-gp and MRP1 inhibition. Moderate to highly hydrophobic poloxamines T304, T904 and T1301 showed inhibitory activity against P-gp and BCRP but not against MRP1 in both hepatic cell lines. A remarkable dependence of this effect on the

  10. Structural Models of Zebrafish (Danio rerio) NOD1 and NOD2 NACHT Domains Suggest Differential ATP Binding Orientations: Insights from Computational Modeling, Docking and Molecular Dynamics Simulations

    PubMed Central

    Maharana, Jitendra; Sahoo, Bikash Ranjan; Bej, Aritra; Sahoo, Jyoti Ranjan; Dehury, Budheswar; Patra, Mahesh Chandra; Martha, Sushma Rani; Balabantray, Sucharita; Pradhan, Sukanta Kumar; Behera, Bijay Kumar

    2015-01-01

    Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) and NOD2 are cytosolic pattern recognition receptors playing pivotal roles in innate immune signaling. NOD1 and NOD2 recognize bacterial peptidoglycan derivatives iE-DAP and MDP, respectively and undergoes conformational alternation and ATP-dependent self-oligomerization of NACHT domain followed by downstream signaling. Lack of structural adequacy of NACHT domain confines our understanding about the NOD-mediated signaling mechanism. Here, we predicted the structure of NACHT domain of both NOD1 and NOD2 from model organism zebrafish (Danio rerio) using computational methods. Our study highlighted the differential ATP binding modes in NOD1 and NOD2. In NOD1, γ-phosphate of ATP faced toward the central nucleotide binding cavity like NLRC4, whereas in NOD2 the cavity was occupied by adenine moiety. The conserved ‘Lysine’ at Walker A formed hydrogen bonds (H-bonds) and Aspartic acid (Walker B) formed electrostatic interaction with ATP. At Sensor 1, Arg328 of NOD1 exhibited an H-bond with ATP, whereas corresponding Arg404 of NOD2 did not. ‘Proline’ of GxP motif (Pro386 of NOD1 and Pro464 of NOD2) interacted with adenine moiety and His511 at Sensor 2 of NOD1 interacted with γ-phosphate group of ATP. In contrast, His579 of NOD2 interacted with the adenine moiety having a relatively inverted orientation. Our findings are well supplemented with the molecular interaction of ATP with NLRC4, and consistent with mutagenesis data reported for human, which indicates evolutionary shared NOD signaling mechanism. Together, this study provides novel insights into ATP binding mechanism, and highlights the differential ATP binding modes in zebrafish NOD1 and NOD2. PMID:25811192

  11. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  12. Evaluation of the role of ATP-binding cassette transporters as a defence mechanism against temephos in populations of Aedes aegypti

    PubMed Central

    Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim, Modesto Leite

    2014-01-01

    The role of ATP-binding cassette (ABC) transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM). The best result in the series was obtained with the addition of verapamil (40 μM), which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.

  13. Generalised anhidrosis: different lesion sites demonstrated by microneurography and skin biopsy.

    PubMed

    Donadio, V; Montagna, P; Nolano, M; Cortelli, P; Misciali, C; Pierangeli, G; Provitera, V; Casano, A; Baruzzi, A; Liguori, R

    2005-04-01

    Generalised anhidrosis (GA) shows a uniform clinical picture whether the pathogenesis involves intrinsic abnormalities of sweat glands or postganglionic sympathetic cholinergic nerve dysfunction. We describe two patients who presented intolerance to heat and anhidrosis. In the first patient, symptoms started at 33 years of age, and were associated with absent tendon reflexes and a mydriatic right pupil unreactive to light. The other patient had been unable to sweat since birth. GA was diagnosed on the basis of clinical findings and thermoregulatory tests. Microneurography and morphological analysis of the skin and its innervation disclosed a different lesion site underlying GA in the two patients, and distinguished between a postganglionic autonomic nerve fibre lesion and sweat gland dysfunction.

  14. Behavioral patterns and lesion sites associated with impaired processing of lexical and conceptual knowledge of actions.

    PubMed

    Kemmerer, David; Rudrauf, David; Manzel, Ken; Tranel, Daniel

    2012-07-01

    To further investigate the neural substrates of lexical and conceptual knowledge of actions, we administered a battery of six tasks to 226 brain-damaged patients with widely distributed lesions in the left and right cerebral hemispheres. The tasks probed lexical and conceptual knowledge of actions in a variety of verbal and non-verbal ways, including naming, word-picture matching, attribute judgments involving both words and pictures, and associative comparisons involving both words and pictures. Of the 226 patients who were studied, 61 failed one or more of the six tasks, with four patients being impaired on the entire battery, and varied numbers of patients being impaired on varied combinations of tasks. Overall, the 61 patients manifested a complex array of associations and dissociations across the six tasks. The lesion sites of 147 of the 226 patients were also investigated, using formal methods for lesion-deficit statistical mapping and power analysis of lesion overlap maps. Significant effects for all six tasks were found in the following left-hemisphere regions: the inferior frontal gyrus; the ventral precentral gyrus, extending superiorly into what are likely to be hand-related primary motor and premotor areas; and the anterior insula. In addition, significant effects for 4-5 tasks were found in not only the regions just mentioned, but also in several other left-hemisphere areas: the ventral postcentral gyrus; the supramarginal gyrus; and the posterior middle temporal gyrus. These results converge with previous research on the neural underpinnings of action words and concepts. However, the current study goes considerably beyond most previous investigations by providing extensive behavioral and lesion data for an unusually large and diverse sample of brain-damaged patients, and by incorporating multiple measures of verb comprehension. Regarding theoretical implications, the study provides new support for the Embodied Cognition Framework, which maintains that

  15. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense1

    PubMed Central

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc

    2005-01-01

    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865

  16. Radioguided occult lesion localization: better delineation of the injection site with a high-resolution collimator

    NASA Astrophysics Data System (ADS)

    Geissler, B.; De Freitas, D.; Cachin, F.; Mestas, D.; Lebouedec, G.; Maublant, J.

    2004-07-01

    Aim: Radioguided Occult Lesion Localization (ROLL) is a method for guiding the excision of occult breast lesions. A radiotracer is injected preoperatively in the tumor. The surgeon can locate the lesion with a gamma probe. It has been recommended that the tissue is resected where the activity falls rapidly. But this cut-off level can fluctuate depending on the user. The aim of this study was to compare the accuracy of two different types of collimation. Materials and methods: To simulate the detection of a radioactive "lesion", 0.2 ml of a solution of 99mTc labeled colloids (4 MBq) were deposited at 3 cm depth in a chunk of cow muscle. Detection was performed with a gamma probe (GammaSup, Clerad, F) equipped either with a regular or with an additional high-resolution collimator. The response curve was drawn moving laterally the probe on the chunk of cow by 5 mm steps. Edges of resection were determined with different cut-off levels (from 5 to 50% of maximum counts by 5% steps). Results: Without additional collimator, the mean distance between injection point and resection edge was 18 mm, standard deviation 7.8 mm with a range between 11 and 18 mm. With additional collimator, the mean distance decreased to 10 mm (-44%), standard deviation 4.2 mm (-46%) with a range between 6 and 10 mm. Conclusion: The results demonstrate that the additional collimator provides more precise and reproductive delineation of the injection site. It should be optimal for the ROLL technique.

  17. DNA lesions derived from the site selective oxidation of Guanine by carbonate radical anions.

    PubMed

    Joffe, Avrum; Geacintov, Nicholas E; Shafirovich, Vladimir

    2003-12-01

    Carbonate radical anions are potentially important oxidants of nucleic acids in physiological environments. However, the mechanisms of action are poorly understood, and the end products of oxidation of DNA by carbonate radicals have not been characterized. These oxidation pathways were explored in this work, starting from the laser pulse-induced generation of the primary radical species to the identification of the stable oxidative modifications (lesions). The cascade of events was initiated by utilizing 308 nm XeCl excimer laser pulses to generate carbonate radical anions on submicrosecond time scales. This laser flash photolysis method involved the photodissociation of persulfate to sulfate radical anions and the one electron oxidation of bicarbonate anions by the sulfate radicals to yield the carbonate radical anions. The latter were monitored by their characteristic transient absorption band at 600 nm. The rate constants of reactions of carbonate radicals with oligonucleotides increase in the ascending order: 5'-d(CCATCCTACC) [(5.7 +/- 0.6) x 10(6) M(-)(1) s(-)(1)] < 5'-d(TATAACGTTATA), self-complementary duplex [(1.4 +/- 0.2) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATCGCTACC [(2.4 +/- 0.3) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATC[8-oxo-G]CTACC) [(3.2 +/- 0.4) x 10(8) M(-)(1) s(-)(1)], where 8-oxo-G is 8-oxo-7,8-dihydroguanine, the product of a two electron oxidation of guanine. This remarkable enhancement of the rate constants is correlated with the presence of either G or 8-oxo-G bases in the oligonucleotides. The rate constant for the oxidation of G in a single-stranded oligonuclotide is faster by a factor of approximately 2 than in the double-stranded form. The site selective oxidation of G and 8-oxo-G residues by carbonate radicals results in the formation of unique end products, the diastereomeric spiroiminodihydantoin (Sp) lesions, the products of a four electron oxidation of guanine. These lesions, formed in high yields (40-60%), were isolated by reversed phase

  18. Reversible transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense of downhill ethidium uptake.

    PubMed

    Balakrishnan, Lekshmy; Venter, Henrietta; Shilling, Richard A; van Veen, Hendrik W

    2004-03-19

    The ATP dependence of ATP-binding cassette (ABC) transporters has led to the widespread acceptance that these systems are unidirectional. Interestingly, in the presence of an inwardly directed ethidium concentration gradient in ATP-depleted cells of Lactococcus lactis, the ABC multidrug transporter LmrA mediated the reverse transport (or uptake) of ethidium with an apparent K(t) of 2.0 microm. This uptake reaction was competitively inhibited by the LmrA substrate vinblastine and was significantly reduced by an E314A substitution in the membrane domain of the transporter. Similar to efflux, LmrA-mediated ethidium uptake was inhibited by the E512Q replacement in the Walker B region of the nucleotide-binding domain of the protein, which strongly reduced its drug-stimulated ATPase activity, consistent with published observations for other ABC transporters. The notion that ethidium uptake is coupled to the catalytic cycle in LmrA was further corroborated by studies in LmrA-containing cells and proteoliposomes in which reverse transport of ethidium was associated with the net synthesis of ATP. Taken together, these data demonstrate that the conformational changes required for drug transport by LmrA are (i) not too far from equilibrium under ATP-depleted conditions to be reversed by appropriate changes in ligand concentrations and (ii) not necessarily coupled to ATP hydrolysis, but associated with a reversible catalytic cycle. These findings and their thermodynamic implications shed new light on the mechanism of energy coupling in ABC transporters and have implications for the development of new modulators that could enable reverse transport-associated drug delivery in cells through their ability to uncouple ATP binding/hydrolysis from multidrug efflux.

  19. Maltose-binding protein effectively stabilizes the partially closed conformation of the ATP-binding cassette transporter MalFGK2.

    PubMed

    Weng, Jingwei; Gu, Shuo; Gao, Xin; Huang, Xuhui; Wang, Wenning

    2017-04-05

    Maltose transporter MalFGK2 is a type-I importer in the ATP-binding cassette (ABC) transporter superfamily. Upon the binding of its periplasmic binding protein, MalE, the ATPase activity of MalFGK2 can be greatly enhanced. Crystal structures of the MalFGK2-MalE-maltose complex in a so-called "pretranslocation" ("pre-T") state with a partially closed conformation suggest that the formation of this MalE-stabilized intermediate state is a key step leading to the outward-facing catalytic state. On the contrary, crosslinking and fluorescence studies suggest that ATP binding alone is sufficient to promote the outward-facing catalytic state, thereby doubting the role of MalE binding. To clarify the role of MalE binding and to gain deeper understanding of the molecular mechanisms of MalFGK2, we calculated the free energy surfaces (FESs) related to the lateral motion in the presence and absence of MalE using atomistic metadynamics simulations. The results showed that, in the absence of MalE, laterally closing motion was energetically forbidden but, upon MalE binding, more closed conformations similar to the pre-T state become more stable. The significant effect of MalE binding on the free energy landscapes was in agreement with crystallographic studies and confirmed the important role of MalE in stabilizing the pre-T state. Our simulations also revealed that the allosteric effect of MalE stimulation originates from the MalE-binding-promoted vertical motion between MalF and MalG cores, which was further supported by MD simulation of the MalE-independent mutant MalF500.

  20. Multiple-step kinetic mechanism of DNA-independent ATP binding and hydrolysis by Escherichia coli replicative helicase DnaB protein: quantitative analysis using the rapid quench-flow method.

    PubMed

    Rajendran, S; Jezewska, M J; Bujalowski, W

    2000-11-10

    The kinetic mechanism of DNA-independent binding and hydrolysis of ATP by the E. coli replicative helicase DnaB protein has been quantitatively examined using the rapid quench-flow technique. Single-turnover studies of ATP hydrolysis, in a non-interacting active site of the helicase, indicate that bimolecular association of ATP with the site is followed by the reversible hydrolysis of nucleotide triphosphate and subsequent conformational transition of the enzyme-product complex. The simplest mechanism, which describes the data, is a three-step sequential process defined by:¿eqalign¿¿¿rm Helicase+ATP¿&¿mathop¿¿rightleftharpoons¿ ¿k_1¿_¿k_¿-1¿¿¿¿rm (H-ATP)¿¿mathop¿¿rightleftharpoons¿ ¿k_2¿_¿k_¿-2¿¿¿¿rm (H-ADP¿cdot Pi)¿¿cr &¿mathop¿¿rightleftharpoons¿ ¿k_3¿_¿k_¿-3¿¿¿¿rm (H-ADP¿cdot Pi)¿ *¿The sequential character of the mechanism excludes conformational transitions of the DnaB helicase prior to ATP binding. Analysis of relaxation times and amplitudes of the reaction allowed us to estimate all rate and equilibrium constants of partial steps of the proposed mechanism. The intrinsic binding constant for the formation of the (H-ATP) complex is K(ATP)=(1.3+/-0.5)x10(5) M(-1). The analysis of the data indicates that a part of the ATP binding energy originates from induced structural changes of the DnaB protein-ATP complex prior to ATP hydrolysis. The equilibrium constant of the chemical interconversion is K(H)=k(2)/k(-2) approximately 2 while the subsequent conformational transition is characterized by K(3)=k(3)/k(-3) approximately 30. The low value of K(H) and the presence of the subsequent energetically favorable conformational step(s) strongly suggest that free energy is released from the enzyme-product complex in the conformational transitions following the chemical step and before the product release.The combined application of single and multiple-turnover approaches show that all six nucleotide-binding sites of the Dna

  1. Probing Enhanced Double-Strand Break Formation at Abasic Sites within Clustered Lesions in Nucleosome Core Particles.

    PubMed

    Banerjee, Samya; Chakraborty, Supratim; Jacinto, Marco Paolo; Paul, Michael D; Balster, Morgan V; Greenberg, Marc M

    2017-01-10

    DNA is rapidly cleaved under mild alkaline conditions at apyrimidinic/apurinic sites, but the half-life is several weeks in phosphate buffer (pH 7.5). However, abasic sites are ∼100-fold more reactive within nucleosome core particles (NCPs). Histone proteins catalyze the strand scission, and at superhelical location 1.5, the histone H4 tail is largely responsible for the accelerated cleavage. The rate constant for strand scission at an abasic site is enhanced further in a nucleosome core particle when it is part of a bistranded lesion containing a proximal strand break. Cleavage of this form results in a highly deleterious double-strand break. This acceleration is dependent upon the position of the abasic lesion in the NCP and its structure. The enhancement in cleavage rate at an apurinic/apyrimidinic site rapidly drops off as the distance between the strand break and abasic site increases and is negligible once the two forms of damage are separated by 7 bp. However, the enhancement of the rate of double-strand break formation increases when the size of the gap is increased from one to two nucleotides. In contrast, the cleavage rate enhancement at 2-deoxyribonolactone within bistranded lesions is more modest, and it is similar in free DNA and nucleosome core particles. We postulate that the enhanced rate of double-strand break formation at bistranded lesions containing apurinic/apyrimidinic sites within nucleosome core particles is a general phenomenon and is due to increased DNA flexibility.

  2. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    PubMed

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia.

  3. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia*

    PubMed Central

    Dong, Qian; Ernst, Sarah E.; Ostedgaard, Lynda S.; Shah, Viral S.; Ver Heul, Amanda R.; Welsh, Michael J.; Randak, Christoph O.

    2015-01-01

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P1,P5-di(adenosine-5′) pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5′-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5′-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl− channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. PMID:25887396

  4. Therapeutic benefits of carbon dioxide (CO2) laser on single-site HPV lesions in the lower female genital tract

    NASA Astrophysics Data System (ADS)

    Urru, Giovanni; Moretti, Gianfranco

    1998-01-01

    Numerous studies have shown contradictory variable percentages of recurrent HPV lesions, after various therapies. The present study therefore evaluates the effectiveness of CO2 laser vaporization in the treatment of single-site HPV lesions of the lower female genital tract in order to confirm the conviction that physical therapy alone, in agreement with some findings reported in the literature, is capable of guaranteeing a high cure rate in selected patients. From January 1995 to June 1996, seventy- five female patients were treated with CO2 laser vaporization for single-site genital HPV lesions, some of which were associated with low-grade intra-epithelial neoplasia. The success rate after 12 months proved to be 97%. The pre-existing clinical symptoms disappeared in all the patients treated. No complication in the vaporization procedure was encountered.

  5. Human Papillomavirus at Multiple Sites Associated with Anal Squamous Intraepithelial Lesions in HIV-Seropositive Individuals

    PubMed Central

    Chuang, Eleanore; Lim, Eunjung; Milne, Cris; Zhu, Xuemei; Agsalda, Melissa; Killeen, Jeffrey; Miller, F DeWolfe; Hernandez, Brenda Y.; Shiramizu, Bruce

    2016-01-01

    Objective HIV-Seropositive patients have higher risk of HPV infection even on anti-retroviral therapy. Infection with high-risk HPV genotypes can cause dysplasia leading to cancer. This study assessed HPV at different anatomical sites in HIV-seropositive individuals and factors associated with anal squamous intraepithelial lesions (ASIL). Methods Specimens were obtained from multiple anatomical sites for each participant in conjunction with routine screening for anal dysplasia. Female specimens included cervical and anal cytologies and oral wash. Male specimens included anal cytologies, oral wash, and exfoliated cells from penile head, penile shaft, scrotum, and from uncircumcised subjects, inner foreskin. Demographic and clinical characteristics were recorded. Following DNA extraction, HIV DNA copy was assessed by qPCR; HPV was genotyped. Statistical analyses included calculation of odds ratios (OR) and 95% confidence intervals (CI), t-tests or Mann-Whitney tests. Results Males were more likely to have ASIL: 29/50 (58%) compared to 1/11 females (9%) (OR=13.81, 95% CI: 1.64–116.32). HPV 6 or 11 in anal specimens was significantly associated with ASIL (OR= 6.29, 95% CI: 1.49–26.44). Number of HPV genotypes in anal specimens was also significant: ASIL+ (3.4 ± 3.1) versus ASIL− (1.6 ± 3.1) (p=0.009). Among 44 males, HPV was detected from at least one anatomical site for 33 participants (75%): 27 anus (61%), 19 oral wash (44%), 17 penile shaft (39%), 11 scrotum (26%), 10 penile head (23%), 0 foreskin. Detection of HPV in penile shaft specimens was significantly associated with ASIL (OR=6.79, 95% CI: 1.57–29.36) as was number of HPV genotypes in penile shaft specimens: ASIL+ (2.4 ± 4.0) versus ASIL− (0.6 ± 1.7) (p=0.025). Only 1/11 females had ASIL; only 1/11 females had cervical dysplasia: OR was not estimable due to small numbers. Conclusions Males were more prone to ASIL than females. HPV at anal as well as non-anal sites may be indicative of ASIL. PMID

  6. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood

    2013-10-18

    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  7. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  8. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism.

    PubMed

    Cho, Misuk; Henry, Elizabeth M; Lewis, Daniel R; Wu, Guosheng; Muday, Gloria K; Spalding, Edgar P

    2014-12-01

    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target.

  9. Structural and functional characterization of an orphan ATP-binding cassette ATPase involved in manganese utilization and tolerance in Leptospira spp.

    PubMed

    Benaroudj, Nadia; Saul, Frederick; Bellalou, Jacques; Miras, Isabelle; Weber, Patrick; Bondet, Vincent; Murray, Gerald L; Adler, Ben; Ristow, Paula; Louvel, Hélène; Haouz, Ahmed; Picardeau, Mathieu

    2013-12-01

    Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn(2+), we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn(2+), suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn(2+) toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg(2+)-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.

  10. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.

    PubMed

    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N

    2001-09-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  11. A 20(S)-protopanoxadiol derivative overcomes multi-drug resistance by antagonizing ATP-binding cassette subfamily B member 1 transporter function

    PubMed Central

    Chen, Wantao; Xu, Qin; Xiao, Meng; Hu, Lihong; Mao, Li; Wang, Xu

    2016-01-01

    In cancer cells, failure of chemotherapy is often caused by the ATP-binding cassette subfamily B member 1 (ABCB1), and few drugs have been successfully developed to overcome ABCB1-mediated multi-drug resistance (MDR). To suppress ABCB1 activity, we previously designed and synthesized a new series of derivatives based on 20(S)-protopanoxadiol (PPD). In the present study, we investigated the role of PPD derivatives in the function of ABC transporters. Non-toxic concentrations of the PPD derivative PPD12 sensitized ABCB1-overexpressing cells to their anti-cancer substrates better than either the parental PPD or inactive PPD11. PPD12 increased intracellular accumulation of adriamycin and rhodamine123 in resistant cancer cells. Although PPD12 did not suppress the expression of ABCB1 mRNA or protein, it stimulated the activity of ABCB1 ATPase. Because PPD12 is a competitive inhibitor, it was predicted to bind to the large hydrophobic cavity of homology-modeled human ABCB1. PPD12 also enhanced the efficacy of adriamycin against ABCB1-overexpressing KB/VCR xenografts in nude mice. In conclusion, PPD12 enhances the efficacy of substrate drugs in ABCB1-overexpressing cancer cells. These findings suggest that a combination therapy consisting of PPD12 with conventional chemotherapeutic agents may be an effective treatment for ABCB1-mediated MDR cancer patients. PMID:26824187

  12. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells.

    PubMed

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  13. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    PubMed Central

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.

    2001-01-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters. PMID:11514522

  14. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.

    2013-01-01

    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  15. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2005-12-30

    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  16. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    PubMed

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  17. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie

    2001-01-01

    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  18. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.

    PubMed

    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong

    2017-02-01

    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families.

  19. Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptis japonica

    PubMed Central

    Shitan, Nobukazu; Bazin, Ingrid; Dan, Kazuyuki; Obata, Kazuaki; Kigawa, Koji; Ueda, Kazumitsu; Sato, Fumihiko; Forestier, Cyrille; Yazaki, Kazufumi

    2003-01-01

    Alkaloids comprise one of the largest groups of plant secondary metabolites. Berberine, a benzylisoquinoline alkaloid, is preferentially accumulated in the rhizome of Coptis japonica, a ranunculaceous plant, whereas gene expression for berberine biosynthetic enzymes has been observed specifically in root tissues, which suggests that berberine synthesized in the root is transported to the rhizome, where there is high accumulation. We recently isolated a cDNA encoding a multidrug-resistance protein (MDR)-type ATP-binding cassette (ABC) transporter (Cjmdr1) from berberine-producing cultured C. japonica cells, which is highly expressed in the rhizome. Functional analysis of Cjmdr1 by using a Xenopus oocyte expression system showed that CjMDR1 transported berberine in an inward direction, resulting in a higher accumulation of berberine in Cjmdr1-injected oocytes than in the control. Typical inhibitors of ABC proteins, such as vanadate, nifedipine, and glibenclamide, as well as ATP depletion, clearly inhibited this CjMDR1-dependent berberine uptake, suggesting that CjMDR1 functioned as an ABC transporter. Conventional membrane separation methods showed that CjMDR1 was localized in the plasma membrane of C. japonica cells. In situ hybridization indicated that Cjmdr1 mRNA was expressed preferentially in xylem tissues of the rhizome. These findings strongly suggest that CjMDR1 is involved in the translocation of berberine from the root to the rhizome. PMID:12524452

  20. Genome-wide identification of ATP-binding cassette (ABC) transporters and conservation of their xenobiotic transporter function in the monogonont rotifer (Brachionus koreanus).

    PubMed

    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Young Hwan; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2017-03-01

    The ATP-binding cassette (ABC) transporter family is one of the largest gene family in animals, and members of this family are known to be involved in various biological processes due to their ability to transport a wide range of substrates across membranes using ATP cleavage-derived energy. We identified 61 ABC transporters in the genome of the monogonont rotifer Brachionus koreanus, and classified these into eight distinct subfamilies (A-H) by phylogenetic analysis. ABC transporters in the rotifer B. koreanus are comprised of 11 ABCA genes, 19 ABCB genes, 14 ABCC genes, 3 ABCD genes, 1 ABCE gene, 3 ABCF genes, 8 ABCG genes, and 2 ABCH genes. Extensive gene duplication and loss events in synteny were observed in several subfamilies. In particular, massive gene duplications of P-glycoproteins (P-gps), multidrug resistance proteins (MRPs), and Bk-Abcg-like proteins were observed. The ability of these B. koreanus proteins to function as multixenobiotic resistance (MXR) ABC transporters was validated using specific fluorescence substrates/inhibitors. The ABC transporter superfamily members identified in this study will be useful in future toxicological studies, and will facilitate comparative studies of the evolution of the ABC transporter superfamily in invertebrates.

  1. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter

    PubMed Central

    Alvarez, Frances Joan D.; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R. Michael; Klug, Candice S.; Davidson, Amy L.

    2015-01-01

    Summary MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance (EPR) spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP. PMID:26268698

  2. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    SciTech Connect

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  3. Roles of aldo-keto reductases 1B10 and 1C3 and ATP-binding cassette transporter in docetaxel tolerance.

    PubMed

    Matsunaga, Toshiyuki; Saito, Haruhi; Endo, Satoshi; Iguchi, Kazuhiro; Soda, Midori; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-12-01

    Docetaxel (DTX) is widely used for treatment of inveterate lung and prostate cancers, but its continuous administration elicits the hyposensitivity. Here, we established the DTX-resistant variants of human lung cancer A549 and androgen-independent prostate cancer Du145 cells and found that the resistance development provoked aberrant up-regulations of aldo-keto reductase (AKR) 1B10 and AKR1C3 in A549 and Du145 cells, respectively. In addition, the sensitivity to the DTX toxicity was significantly decreased and increased by overexpression and knockdown of the two AKR isoforms, respectively. Furthermore, the resistant cells exhibited a decreased level of reactive 4-hydroxy-2-nonenal formed during DTX treatment, and the decrease was alleviated by adding the AKR inhibitors, inferring that the two AKRs confer the chemoresistance through elevating the antioxidant properties. The development of DTX resistance was also associated with enhanced expression of an ATP-binding cassette (ABC) transporter ABCB1 among the ABC transporter isoforms. The combined treatment with inhibitors of the two AKRs and ABCB1 additively sensitized the resistant cells to DTX. Intriguingly, the AKR1B10 inhibitor also suppressed the lung cancer cross-resistance against cisplatin. The results suggest that combined treatment with AKRs (1B10 and 1C3) and ABCB1 inhibitors exerts overcoming effect against the cancer resistance to DTX and cisplatin, and can be used as the adjuvant therapy.

  4. Role of NH{sub 2}-terminal hydrophobic motif in the subcellular localization of ATP-binding cassette protein subfamily D: Common features in eukaryotic organisms

    SciTech Connect

    Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi

    2014-10-24

    Highlights: • ABCD proteins classifies based on with or without NH{sub 2}-terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH{sub 2}-terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH{sub 2}-terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH{sub 2}-terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH{sub 2}-terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH{sub 2}-terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH{sub 2}-terminal H0 motif in organelle targeting is widely conserved in living organisms.

  5. Inherited surfactant deficiency due to uniparental disomy of rare mutations in the surfactant protein-B and ATP binding cassette, subfamily A, member 3 genes

    PubMed Central

    Hamvas, Aaron; Nogee, Lawrence M.; Wegner, Daniel J.; DePass, Kelcey; Christodoulou, John; Bennetts, Bruce; McQuade, Leon R.; Gray, Peter H.; Deterding, Robin R.; Carroll, Travis R.; Kammesheidt, Anja; Kasch, Laura M.; Kulkarni, Shashikant; Cole, F. Sessions

    2009-01-01

    Objective To characterize inheritance of homozygous, rare, recessive loss-of-function mutations in the surfactant protein-B (SFTPB) or ATP binding cassette, subfamily A, member 3 (ABCA3) genes in newborns with lethal respiratory failure. Study design We resequenced parents whose infants were homozygous for mutations in SFTPB or ABCA3. For infants with only one heterozygous parent, we performed microsatellite analysis for chromosomes 2 (SFTPB) and 16 (ABCA3). Results We identified one infant homozygous for the c.1549C>GAA mutation (121ins2) in SFTPB for whom only the mother was heterozygous and 3 infants homozygous for mutations in ABCA3 (p.K914R, p.P147L, and c.806_7insGCT) for whom only the fathers were heterozygous. For the SP-B deficient infant, microsatellite markers confirmed maternal heterodisomy with segmental isodisomy. Microsatellite analysis confirmed paternal isodisomy for the three ABCA3 deficient infants. Two ABCA3 deficient infants underwent lung transplantation at 3 and 5 months of age, respectively, and two infants died. None exhibited any non-pulmonary phenotype. Conclusions Uniparental disomy should be suspected in infants with rare homozygous mutations in SFTPB or ABCA3. Confirmation of parental carrier status is important to provide recurrence risk and to monitor expression of other phenotypes that may emerge through reduction to homozygosity of recessive alleles. PMID:19647838

  6. Evaluation of a Brucella melitensis mutant deficient in O-polysaccharide export system ATP-binding protein as a rough vaccine candidate.

    PubMed

    Wang, Zhen; Niu, Jian Rui; Wang, Xiao Lei; Wu, Tong Lei; Cheng, Jie; Lu, Lin; Wu, Qing Min

    2014-08-01

    Rough Brucella mutants have been sought as vaccine candidates that do not interfere with the conventional serological diagnosis of brucellosis. In this study, a rough mutant of Brucella melitensis was generated by the disruption of the wzt gene, which encodes the O-polysaccharide (O-PS) export system ATP-binding protein. In vivo, the mutant 16MΔwzt was attenuated and conferred a level of protection against B. melitensis 16M challenge similar to that conferred by the vaccine strain B. melitensis M5 in mice. In pregnant sheep, the mutant 16MΔwzt did not induce abortion. In vitro, 16MΔwzt was more susceptible to polymyxin B and complement-mediated killing than B. melitensis 16M was. Most importantly, although 16MΔwzt had a rough phenotype, it was able to synthesize O-PS and did not induce detectable specific antibodies in sheep. These results suggested that 16MΔwzt deserved to further systematic evaluation as a vaccine for target animal hosts due to its promising features.

  7. Altered Profile of Secondary Metabolites in the Root Exudates of Arabidopsis ATP-Binding Cassette Transporter Mutants1[C][W][OA

    PubMed Central

    Badri, Dayakar V.; Loyola-Vargas, Victor M.; Broeckling, Corey D.; De-la-Peña, Clelia; Jasinski, Michal; Santelia, Diana; Martinoia, Enrico; Sumner, Lloyd W.; Banta, Lois M.; Stermitz, Frank; Vivanco, Jorge M.

    2008-01-01

    Following recent indirect evidence suggesting a role for ATP-binding cassette (ABC) transporters in root exudation of phytochemicals, we identified 25 ABC transporter genes highly expressed in the root cells most likely to be involved in secretion processes. Of these 25 genes, we also selected six full-length ABC transporters and a half-size transporter for in-depth molecular and biochemical analyses. We compared the exuded root phytochemical profiles of these seven ABC transporter mutants to those of the wild type. There were three nonpolar phytochemicals missing in various ABC transporter mutants compared to the wild type when the samples were analyzed by high-performance liquid chromatography-mass spectrometry. These data suggest that more than one ABC transporter can be involved in the secretion of a given phytochemical and that a transporter can be involved in the secretion of more than one secondary metabolite. The primary and secondary metabolites present in the root exudates of the mutants were also analyzed by gas chromatography-mass spectrometry, which allowed for the identification of groups of compounds differentially found in some of the mutants compared to the wild type. For instance, the mutant Atpdr6 secreted a lower level of organic acids and Atmrp2 secreted a higher level of amino acids as compared to the wild type. We conclude that the release of phytochemicals by roots is partially controlled by ABC transporters. PMID:18065561

  8. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae.

    PubMed Central

    Egner, R; Mahé, Y; Pandjaitan, R; Kuchler, K

    1995-01-01

    Multidrug resistance (MDR) to different cytotoxic compounds in the yeast Saccharomyces cerevisiae can arise from overexpression of the Pdr5 (Sts1, Ydr1, or Lem1) ATP-binding cassette (ABC) multidrug transporter. We have raised polyclonal antibodies recognizing the yeast Pdr5 ABC transporter to study its biogenesis and to analyze the molecular mechanisms underlying MDR development. Subcellular fractionation and indirect immunofluorescence experiments showed that Pdr5 is localized in the plasma membrane. In addition, pulse-chase radiolabeling of cells and immunoprecipitation indicated that Pdr5 is a short-lived membrane protein with a half-life of about 60 to 90 min. A dramatic metabolic stabilization of Pdr5 was observed in delta pep4 mutant cells defective in vacuolar proteinases, and indirect immunofluorescence showed that Pdr5 accumulates in vacuoles of stationary-phase delta pep4 mutant cells, demonstrating that Pdr5 turnover requires vacuolar proteolysis. However, Pdr5 turnover does not require a functional proteasome, since the half-life of Pdr5 was unaffected in either pre1-1 or pre1-1 pre2-1 mutants defective in the multicatalytic cytoplasmic proteasome that is essential for cytoplasmic protein degradation. Immunofluorescence analysis revealed that vacuolar delivery of Pdr5 is blocked in conditional end4 endocytosis mutants at the restrictive temperature, showing that endocytosis delivers Pdr5 from the plasma membrane to the vacuole. PMID:7565740

  9. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action.

    PubMed

    Bordignon, Enrica; Grote, Mathias; Schneider, Erwin

    2010-09-01

    The maltose/maltodextrin transport system of Escherichia coli/Salmonella, composed of periplasmic maltose-binding protein, MalE, the pore-forming subunits MalF and MalG, and a homodimer of the nucleotide-binding subunit, MalK, serves as a model for canonical ATP-binding cassette importers in general. The wealth of knowledge accumulated on the maltose transporter in more than three decades by genetic, molecular genetic and biochemical means was complemented more recently by crystal structures of the isolated MalK dimer and of two conformational states of the full transporter. Here, we summarize insights into the transport mechanism provided by these structures and draw the reader's attention to experimental tools by which the dynamics of the transporter can be studied during substrate translocation. A transport model is presented that integrates currently available biochemical, biophysical and structural data. We also present the state of knowledge on regulatory functions of the maltose transporter associated with the C-terminal domain of MalK. Finally, we will address the application of coarse-grained modelling to visualize the progression of the conformational changes of an ABC transporter with special emphasis on the maltose system, which can provide a model platform for testing and validating the bioinformatic tools.

  10. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter.

    PubMed

    Alvarez, Frances Joan D; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R Michael; Klug, Candice S; Davidson, Amy L

    2015-12-01

    MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP.

  11. Cuticular Defects in Oryza sativa ATP-binding Cassette Transporter G31 Mutant Plants Cause Dwarfism, Elevated Defense Responses and Pathogen Resistance.

    PubMed

    Garroum, Imène; Bidzinski, Przemyslaw; Daraspe, Jean; Mucciolo, Antonio; Humbel, Bruno M; Morel, Jean-Benoit; Nawrath, Christiane

    2016-06-01

    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between plant and environment. Homologs of the ATP-binding cassette (ABC) transporter AtABCG32/HvABCG31 clade are necessary for the formation of a functional cuticle in both monocots and dicots. Here we characterize the osabcg31 knockout mutant and hairpin RNA interference (RNAi)-down-regulated OsABCG31 plant lines having reduced plant growth and a permeable cuticle. The reduced content of cutin in leaves and structural alterations in the cuticle and at the cuticle-cell wall interface in plants compromised in OsABCG31 expression explain the cuticle permeability. Effects of modifications of the cuticle on plant-microbe interactions were evaluated. The cuticular alterations in OsABCG31-compromised plants did not cause deficiencies in germination of the spores or the formation of appressoria of Magnaporthe oryzae on the leaf surface, but a strong reduction of infection structures inside the plant. Genes involved in pathogen resistance were constitutively up-regulated in OsABCG31-compromised plants, thus being a possible cause of the resistance to M. oryzae and the dwarf growth phenotype. The findings show that in rice an abnormal cuticle formation may affect the signaling of plant growth and defense.

  12. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.

    PubMed

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane

    2011-05-01

    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  13. Identification of a gene linked to Rhizobium meliloti ntrA whose product is homologous to a family to ATP-binding proteins.

    PubMed Central

    Albright, L M; Ronson, C W; Nixon, B T; Ausubel, F M

    1989-01-01

    The ntrA gene of Rhizobium meliloti has recently been identified and shown to be required for a diverse set of metabolic functions (C. W. Ronson, B. T. Nixon, L. M. Albright, and F. M. Ausubel, J. Bacteriol. 169:2424-2431, 1987). As a result of sequencing the ntrA gene and its flanking regions from R. meliloti, we identified an open reading frame directly upstream of ntrA, ORF1, whose predicted product is homologous to a superfamily of ATP-binding proteins involved in transport, cell division, nodulation, and DNA repair. The homology of ORF1 to this superfamily and its proximity to ntrA led us to investigate its role in symbiosis by mutagenesis and expression studies. We were unable to isolate an insertion mutation in ORF1, suggesting that ORF1 may code for an essential function. We identified the start of transcription for the ntrA gene in vegetative cells and bacteroids and showed that ORF1 and ntrA are transcriptionally unlinked. ORF1 appears to be in an operon with one or more upstream genes. Images PMID:2703463

  14. Transgenic hybrid aspen overexpressing the Atwbc19 gene encoding an ATP-binding cassette transporter confers resistance to four aminoglycoside antibiotics.

    PubMed

    Kang, Byung-Guk; Ye, Xia; Osburn, Lori D; Stewart, C N; Cheng, Zong-Ming

    2010-06-01

    Antibiotic-resistance genes of bacterial origin are invaluable markers for plant genetic engineering. However, these genes are feared to pose possible risk to human health by horizontal gene transfer from transgenic plants to bacteria, potentially resulting in antibiotic-resistant pathogenic bacteria; this is a considerable regulatory concern in some countries. The Atwbc19 gene, encoding an Arabidopsis thaliana ATP-binding cassette transporter, has been reported to confer resistance to kanamycin specifically as an alternative to bacterial antibiotic-resistance genes. In this report, we transformed hybrid aspen (Populus canescens x P. grandidentata) with the Atwbc19 gene. Unlike Atwbc19-transgenic tobacco that was only resistant to kanamycin, the transgenic Populus plants also showed resistance to three other aminoglycoside antibiotics (neomycin, geneticin, and paromomycin) at comparable levels to plants containing a CaMV35S-nptII cassette. Although it is unknown why the transgenic Populus with the Atwbc19 gene is resistant to all aminoglycoside antibiotics tested, the broad utility of the Atwbc19 gene as a reporter gene is confirmed here in a second dicot species. Because the Atwbc19 gene is plant-ubiquitous, it might serve as an alternative selectable marker to current bacterial antibiotic-resistance marker genes and alleviate the potential risk for horizontal transfer of bacterial-resistance genes in transgenic plants.

  15. The Role of Arabidopsis ABCG9 and ABCG31 ATP Binding Cassette Transporters in Pollen Fitness and the Deposition of Steryl Glycosides on the Pollen Coat[W

    PubMed Central

    Choi, Hyunju; Ohyama, Kiyoshi; Kim, Yu-Young; Jin, Jun-Young; Lee, Saet Buyl; Yamaoka, Yasuyo; Muranaka, Toshiya; Suh, Mi Chung; Fujioka, Shozo; Lee, Youngsook

    2014-01-01

    The pollen coat protects pollen grains from harmful environmental stresses such as drought and cold. Many compounds in the pollen coat are synthesized in the tapetum. However, the pathway by which they are transferred to the pollen surface remains obscure. We found that two Arabidopsis thaliana ATP binding cassette transporters, ABCG9 and ABCG31, were highly expressed in the tapetum and are involved in pollen coat deposition. Upon exposure to dry air, many abcg9 abcg31 pollen grains shriveled up and collapsed, and this phenotype was restored by complementation with ABCG9pro:GFP:ABCG9. GFP-tagged ABCG9 or ABCG31 localized to the plasma membrane. Electron microscopy revealed that the mutant pollen coat resembled the immature coat of the wild type, which contained many electron-lucent structures. Steryl glycosides were reduced to about half of wild-type levels in the abcg9 abcg31 pollen, but no differences in free sterols or steryl esters were observed. A mutant deficient in steryl glycoside biosynthesis, ugt80A2 ugt80B1, exhibited a similar phenotype. Together, these results indicate that steryl glycosides are critical for pollen fitness, by supporting pollen coat maturation, and that ABCG9 and ABCG31 contribute to the accumulation of this sterol on the surface of pollen. PMID:24474628

  16. Effect of tacrolimus on activity and expression of P-glycoprotein and ATP-binding cassette transporter A5 (ABCA5) proteins in hematoencephalic barrier cells.

    PubMed

    Quezada, Claudia Andrea; Garrido, Wallys Ximena; González-Oyarzún, Mauricio Alejandro; Rauch, María Cecilia; Salas, Mónica Roxana; San Martín, Rody Enrique; Claude, Alejandro Andrés; Yañez, Alejandro Javier; Slebe, Juan Carlos; Cárcamo, Juan Guillermo

    2008-10-01

    Tacrolimus is an agent used in clinical immunosuppressive drug therapies. A wide spectrum of adverse effects has been reported in association with this immunosuppressor, including neurotoxic effect. The upper limit of therapeutic blood concentrations of tacrolimus has been described as 30 ng/ml in immunosuppressed patients. We investigated the effect of this therapeutic dose of tacrolimus on the expression and activity of the multidrug resistance protein 1 (MDR1 or Pgp, P-glycoprotein) and ATP-binding cassette transporters A5 (ABCA5) in human brain microvascular endothelial cells (HBMEC), derived from Blood-Brain Barrier (BBB) endothelium, these being the most predominantly expressed transcripts in these cells. The expression and activity of MDR1 transporter decreased with 30 ng/ml tacrolimus. The cell viability was not changed with the therapeutic dose used. By contrast, ABCA5 transcripts, of unknown role as yet, increased their expression at this concentration. We propose that the secondary cytotoxic effects of this immunosuppressor on CSN, besides the functional blockade related to multidrug resistance proteins, such as MDR1, and probably ABCA5, could be linked to variations in the expression levels of these proteins at the BBB.

  17. Kaempferol suppresses lipid accumulation in macrophages through the downregulation of cluster of differentiation 36 and the upregulation of scavenger receptor class B type I and ATP-binding cassette transporters A1 and G1.

    PubMed

    Li, Xiu-Ying; Kong, Ling-Xi; Li, Juan; He, Hai-Xia; Zhou, Yuan-Da

    2013-02-01

    The accumulation of foam cells in atherosclerotic lesions is a hallmark of early-stage atherosclerosis. Kaempferol has been shown to inhibit oxidized low-density lipoprotein (oxLDL) uptake by macrophages; however, the underlying molecular mechanisms are not yet fully investigated. In this study, we shown that treatment with kaempferol markedly suppresses oxLDL-induced macrophage foam cell formation, which occurs due to a decrease in lipid accumulation and an increase in cholesterol efflux from THP-1-derived macrophages. Additionally, the kaempferol treatment of macrophages led to the downregulation of cluster of differentiation 36 (CD36) protein levels, the upregulation of ATP-binding cassette (ABC) transporter A1 (ABCA1), scavenger receptor class B type I (SR-BI) and ABCG1 protein levels, while no effects on scavenger receptor A (SR-A) expression were observed. Kaempferol had similar effects on the mRNA and protein expression of ABCA1, SR-BI, SR-A, CD36 and ABCG1. The reduced CD36 expression following kaempferol treatment involved the inhibition of c-Jun-activator protein-1 (AP-1) nuclear translocation. The inhibition of AP-1 using the inhibitor, SP600125, confirmed this involvement, as the AP-1 inhibition significantly augmented the kaempferol-induced reduction in CD36 expression. Accordingly, the kaempferol-mediated suppression of lipid accumulation in macrophages was also augmented by SP600125. The increased expression of ABCA1, SR-BI and ABCG1 following kaempferol treatment was accompanied by the enhanced protein expression of heme oxygenase-1 (HO-1). This increase was reversed following the knockdown of the HO-1 gene using small hairpin RNA (shRNA). Moreover, the kaempferol-mediated attenuation of lipid accumulation and the promotion of cholesterol efflux was also inhibited by HO-1 shRNA. In conclusion, the c-Jun-AP‑1-dependent downregulation of CD36 and the HO-1-dependent upregulation of ABCG1, SR-BI and ABCA1 may mediate the beneficial effects of

  18. The effect of animal health products on the formation of injection site lesions in subprimals of experimentally injected beef calves.

    PubMed Central

    Van Donkersgoed, J; Dubeski, P L; VanderKop, M; Aalhus, J L; Bygrove, S; Starr, W N

    2000-01-01

    Two hundred and twenty beef calves were used in an experimental study to determine the occurrence of injection site lesions at slaughter (15 to 18 months of age) following subcutaneous and intramuscular injection of various products into the top hip (top butt), thigh (round), and neck or rib of calves at birth, branding, or weaning. Products tested were: 2 different preparations of selenium; a 2-way, a 7-way, and an 8-way clostridial bacterin; 2 combination 7-way clostridial and Haemophilus somnus bacterins; 2 H. somnus bacterins; 2 different 4-way modified-live viral respiratory vaccines; a 4-way killed viral and H. somnus vaccine; and penicillin, florfenicol, ceftiofur, trimethoprim-sulfa, and tilmicosin. The occurrence of lesions, number of steaks affected with lesions, the trim weight of lesions, the histological class of lesions, and the estimated economic losses are described. Generally, products administered subcutaneously in the neck produced minimal tissue damage and economic losses. Images Figure 1. Figure 2. Figure 3. PMID:10945127

  19. Immediate effects of rhythmic auditory stimulation on gait in stroke patients in relation to the lesion site

    PubMed Central

    Kobinata, Naomi; Ueno, Mai; Imanishi, Yukihito; Yoshikawa, Hideto

    2016-01-01

    [Purpose] Rhythmic auditory stimulation has been used in gait training for stroke patients. However, few studies have investigated its effects in relation to lesion sites. Therefore, this study examined the immediate effects of rhythmic auditory stimulation on gait in stroke patients with lesions in different regions. [Subjects and Methods] One hundred and five patients were recruited and divided into five groups according to the lesion site: cerebellum, pons and medulla, thalamus, putamen, and corona radiata. During training, participants walked to an auditory, continuous rhythmic beat, which was set to each individual’s cadence. [Results] Pre- versus post-test measures revealed significant increases in velocity and stride length in the cerebellum, pons and medulla, and thalamus groups. Although the putamen and corona radiata groups demonstrated increases in velocity and stride length, the increases were not significant. [Conclusion] Rhythmic auditory stimulation was effective in facilitating the prediction of motor timing and gait rhythm in stroke patients with lesions in the cerebellum, pons and medulla, and thalamus, which are associated with impairment of the timing mechanism. PMID:27799666

  20. Molecular phylogenetic study and expression analysis of ATP-binding cassette transporter gene family in Oryza sativa in response to salt stress.

    PubMed

    Saha, Jayita; Sengupta, Atreyee; Gupta, Kamala; Gupta, Bhaskar

    2015-02-01

    ATP-binding cassette (ABC) transporter is a large gene superfamily that utilizes the energy released from ATP hydrolysis for transporting myriad of substrates across the biological membranes. Although many investigations have been done on the structural and functional analysis of the ABC transporters in Oryza sativa, much less is known about molecular phylogenetic and global expression pattern of the complete ABC family in rice. In this study, we have carried out a comprehensive phylogenetic analysis constructing neighbor-joining and maximum-likelihood trees based on various statistical methods of different ABC protein subfamily of five plant lineages including Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Selaginella moellendorffii (lycophyte), Arabidopsis thaliana (dicot) and O. sativa (monocot) to explore the origin and evolutionary patterns of these ABC genes. We have identified several conserved motifs in nucleotide binding domain (NBD) of ABC proteins among all plant lineages during evolution. Amongst the different ABC protein subfamilies, 'ABCE' has not yet been identified in lower plant genomes (algae, moss and lycophytes). The result indicated that gene duplication and diversification process acted upon these genes as a major operative force creating new groups and subgroups and functional divergence during evolution. We have demonstrated that rice ABCI subfamily consists of only half size transporters that represented highly dynamic members showing maximum sequence variations among the other rice ABC subfamilies. The evolutionary and the expression analysis contribute to a deep insight into the evolution and diversity of rice ABC proteins and their roles in response to salt stress that facilitate our further understanding on rice ABC transporters.

  1. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris

    2011-01-01

    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  2. The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells.

    PubMed

    Davis, Warren

    2011-12-01

    The ATP-binding cassette transporter-2 (ABCA2) has been identified as a possible regulator of lipid metabolism. ABCA2 is most highly expressed in the brain but its effects on cholesterol homeostasis in neuronal-type cells have not been characterized. It is important to study the role of ABCA2 in regulating cholesterol homeostasis in neuronal-type cells because ABCA2 has been identified as a possible genetic risk factor for Alzheimer's disease. In this study, the effects of ABCA2 expression on cholesterol homeostasis were examined in mouse N2a neuroblastoma cells. ABCA2 reduced total, free- and esterified cholesterol levels as well as membrane cholesterol but did not perturb cholesterol distribution in organelle or lipid raft compartments. ABCA2 did not modulate de novo cholesterol biosynthesis from acetate. Cholesterol trafficking to the plasma membrane was not affected by ABCA2 but efflux to the physiological acceptor ApoE3 and mobilization of plasma membrane cholesterol to the endoplasmic reticulum for esterification were reduced by ABCA2. ABCA2 reduced esterification of serum and low-density lipoprotein-derived cholesterol but not 25-hydroxycholesterol. ABCA2 decreased low-density lipoprotein receptor (LDLR) mRNA and protein levels and increased its turnover rate. The surface expression of LDLR as well as the uptake of fluroresecent DiI-LDL was also reduced by ABCA2. Reduction of endogenous ABCA2 expression by RNAi treatment of N2a cells and rat primary cortical neurons produced the opposite effects of over-expression of ABCA2, increasing LDLR protein levels. This report identifies ABCA2 as a key regulator of cholesterol homeostasis and LDLR metabolism in neuronal cells.

  3. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B

    1996-01-01

    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  4. A Mutation within the Extended X Loop Abolished Substrate-induced ATPase Activity of the Human Liver ATP-binding Cassette (ABC) Transporter MDR3*

    PubMed Central

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-01-01

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467

  5. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    PubMed

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain.

  6. Effects of silencing the ATP-binding cassette protein E1 gene by electroporation on the proliferation and migration of EC109 human esophageal cancer cells.

    PubMed

    Li, Xiao-Rui; Yang, Liu-Zhong; Huo, Xiao-Qing; Wang, Ying; Yang, Qing-Hui; Zhang, Qing-Qin

    2015-07-01

    In the present study, the gene expression of ATP-binding cassette protein E1 (ABCE1) in the EC109 human esophageal cancer cell line was silenced using electroporation to examine the effect if the ABCE1 gene on the growth migration and cell cycle of cancer cells. The small interference (si)RNA sequence of ABCE1 was designed and synthesized to transfect the EC109 cells by electroporation. The mRNA and protein expression levels of ABCE1 were then detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The analysis of the cell cycle and apoptosis was performed using flow cytometry. The effect of silencing the ABCE1 gene on the proliferation, migration and invasive ability of the EC109 human esophageal cancer cells were assessed using a Cell counting kit-8 (CCK-8) and with proliferation, wound-healing and cell invasion assays. The mRNA and protein expression levels of ABCE1 were significantly lower in the experimental group compared with the control group (P<0.05). The apoptotic rate of the experimental group was markedly higher than the control group and blank group (P<0.01). The CCK-8 proliferation assay revealed that, compared with the control and blank groups, the proliferation of the EC109 cells in the experimental group was significantly inhibited (P<0.05). The wound healing assay revealed that the migration capacity of the cells in the experimental group was significantly decreased (P<0.05). The Transwell chamber assay demonstrated that the invasive ability of the EC109 cells in the experimental group was significantly decreased (P<0.01). These results revealed that ABCE1 is closely associated with cell proliferation, invasion and migration in esophageal cancer and silencing the ABCE1 gene by electroporation can significantly reduce the proliferation, invasion and migration capacity of EC109 cells in vitro.

  7. Immature human chorionic gonadotropin (hCG) in first trimester placental cells is bound to an ATP-binding protein forming high-molecular-weight hCG.

    PubMed

    Shimojo, M; Sakakibara, R; Ishiguro, M

    1993-07-01

    Human chorionic gonadotropin (hCG) in first trimester placental cells is made up of immature alpha- and beta-subunits containing only N-linked high-mannose sugar chains, which are of 21 kDa for the alpha-subunit and 23 and 19 kDa for the beta-subunit. However, the apparent molecular weight of immature hCG from placental cell extracts has been estimated from gel filtration to be much higher (100-200 kDa; high molecular weight-hCG, HMW-hCG) based on gel filtration than the theoretical value (approximately 44 kDa) of the alpha beta dimer (alpha beta-hCG). We prepared a gel-filtered fraction containing HMW-hCG and investigated treatments for converting it to alpha beta-hCG. We found that the molecular weight of HMW-hCG was decreased to close to that of alpha beta-hCG by treatment with acetone, proteases, or chelating agents. These treatments also shifted the isoelectric point of HMW-hCG from the acidic region (pI = 4-6) to the alkaline (pI = 9-11), approximating to that of alpha beta-hCG. We also found that HMW-hCG, but not acetone-treated HMW-hCG, bound to ATP-agarose resin. These results suggested that the immature alpha beta-hCG molecule in placental cells may be bound to an acidic ATP-binding protein to form HMW-hCG.

  8. Association of ATP-Binding Cassette Transporter A1 (ABCA1)-565 C/T Gene Polymorphism with Hypoalphalipoproteinemia and Serum Lipids, IL-6 and CRP Levels

    PubMed Central

    Babashamsi, Mohammad Mahdi; Halalkhor, Sohrab; Moradi Firouzjah, Hamid; Parsian, Hadi; Jalali, Seyed Farzad; Babashamsi, Mohammad

    2017-01-01

    Background: ATP-binding cassette transporter A1 (ABCA1) is a membrane integral protein which plays a vital role in High Density Lipoprotein (HDL) metabolism and exerts a protective effect against Hypoalphalipoproteinemia (HA) by mediation of rate-limiting step in HDL biogenesis. In addition, this protein possesses anti-inflammatory effects by inhibiting the production of some inflammatory cytokines in macrophages. This study investigated the association of ABCA1-565 C/T gene polymorphism with HA and serum lipids, IL-6 and CRP levels. Methods: A population which consisted of 101 HA and 95 normal subjects were genotyped for ABCA1-565C/T polymorphism by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). The serum concentrations of lipids, IL-6 and high sensitive-CRP (hs-CRP) were measured by the relevant methods. Results: The frequency of T allele was significantly higher in the HA group than the controls (31.7 vs. 19.5%, p=0.002). Thus, carriers of the T allele (CT and TT genotypes) had a higher risk for HA (p=0.016, OR=2.04, 95% CI=1.14–3.63). T allele carriers demonstrated decreased HDL-C and increased triglyceride, IL-6 and CRP levels than those with the CC genotype. Conclusion: This study suggests that the-565 C/T polymorphism of ABCA1 gene is associated with an increased risk of HA, decreased HDL-C and increased TG, IL-6 and CRP. PMID:28090279

  9. Functional interplay between the ATP binding cassette Msr(D) protein and the membrane facilitator superfamily Mef(E) transporter for macrolide resistance in Escherichia coli.

    PubMed

    Nunez-Samudio, Virginia; Chesneau, Olivier

    2013-04-01

    Macrolides have wide clinical applications in the treatment of community-acquired respiratory tract infections, among which streptococci are the most frequent causative agents. An active efflux-based mechanism of macrolide resistance, referred to as the M phenotype in streptococcal isolates, has been associated with the presence of mef genes that encode a subset of major facilitator superfamily (MFS) transporters like Mef(E). An msr(D) gene, adjacent to and co-transcribed with mef in the presence of erythromycin, has also been implicated in drug efflux, but its role remains elusive. Msr(D) belongs to the ATP binding cassette (ABC) proteins and harbors two fused nucleotide-binding domains with no membrane-spanning domains. The present work indicates that the major resistance traits of the M phenotype in Escherichia coli may be due to Msr(D) and not to Mef(E). Fluorescence microscopy using Mef(E) tagged with GFP linked low efficacy of the chimera in conferring macrolide resistance with improper subcellular localization. The active role of Msr(D) in directing Mef(E)-GFP to the cell poles was demonstrated, as was synergistic effect in terms of levels of resistance when both proteins were expressed. A trans-dominant negative mutation within ABC Msr(D) affecting MFS Mef(E) strongly suggests that both proteins can interact in vivo, and such a physical interaction was supported in vitro. This is the first reported example of a functional interplay between an ABC component and an MFS transporter. The direct involvement of Msr(D) in the efflux of macrolides remains to be demonstrated.

  10. Bacteriophage-mediated Glucosylation Can Modify Lipopolysaccharide O-Antigens Synthesized by an ATP-binding Cassette (ABC) Transporter-dependent Assembly Mechanism.

    PubMed

    Mann, Evan; Ovchinnikova, Olga G; King, Jerry D; Whitfield, Chris

    2015-10-16

    Lysogenic bacteriophages may encode enzymes that modify the structures of lipopolysaccharide O-antigen glycans, altering the structure of the bacteriophage receptor and resulting in serotype conversion. This can enhance virulence and has implications for antigenic diversity and vaccine development. Side chain glucosylation is a common modification strategy found in a number of bacterial species. To date, glucosylation has only been observed in O-antigens synthesized by Wzy-dependent pathways, one of the two most prevalent O-antigen synthesis systems. Here we exploited a heterologous system to study the glucosylation potential of a model O-antigen produced in an ATP-binding cassette (ABC) transporter-dependent system. Although O-antigen production is cryptic in Escherichia coli K-12, because of a mutation in the synthesis genes, it possesses a prophage glucosylation cluster, which modifies the GlcNAc residue in an α-l-Rha-(1→3)-d-GlcNAc motif found in the original O16 antigen. Raoultella terrigena ATCC 33257 produces an O-antigen possessing the same disaccharide motif, but its assembly uses an ABC transporter-dependent system. E. coli harboring the R. terrigena O-antigen biosynthesis genes produced an O-antigen displaying reduced reactivity toward antisera raised against the native R. terrigena repeat structure, indicative of an altered chemical structure. Structural determination using NMR revealed the addition of glucose side chains to the repeat units. O-antigen modification was dependent on a functional ABC transporter, consistent with modification in the periplasm, and was eliminated by deletion of the glucosylation genes from the E. coli chromosome, restoring native level antisera sensitivity and structure. There are therefore no intrinsic mechanistic barriers for bacteriophage-mediated O-antigen glucosylation in ABC transporter-dependent pathways.

  11. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.

    PubMed

    Schäfer-Somi, S; Palme, N

    2016-04-01

    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as < 50% progressive motility and/or > 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings.

  12. AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.

    PubMed Central

    Lu, Y P; Li, Z S; Drozdowicz, Y M; Hortensteiner, S; Martinoia, E; Rea, P A

    1998-01-01

    Three ATP binding cassette (ABC) transporter-like activities directed toward large amphipathic organic anions have recently been identified on the vacuolar membrane of plant cells. These are the Mg-ATP-energized, vanadate-inhibitable vacuolar accumulation of glutathione S-conjugates (GS conjugates), chlorophyll catabolites, and bile acids, respectively. Although each of these activities previously had been assigned to distinct pumps in native plant membranes, we describe here the molecular cloning, physical mapping, and heterologous expression of a gene, AtMRP2, from Arabidopsis thaliana that encodes a multispecific ABC transporter competent in the transport of both GS conjugates and chlorophyll catabolites. Unlike its isoform, AtMRP1, which transports the model Brassica napus chlorophyll catabolite transporter substrate Bn-NCC-1 at low efficiency, heterologously expressed AtMRP2 has the facility for simultaneous high-efficiency parallel transport of GS conjugates and Bn-NCC-1. The properties of AtMRP2 therefore establish a basis for the manipulation of two previously identified plant ABC transporter activities and provide an explanation for how the comparable transporter in native plant membranes would be systematically mistaken for two distinct transporters. These findings are discussed with respect to the functional organization of AtMRP2, the inability of AtMRP2 and AtMRP1 to transport the model bile acid transporter substrate taurocholate (despite the pronounced sensitivity of both to direct inhibition by this agent), the differential patterns of expression of their genes in the intact plant, and the high capacity of AtMRP2 for the transport of glutathionated herbicides and anthocyanins. PMID:9490749

  13. ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-Altritol and Galactitol Catabolic Pathways in Agrobacterium tumefaciens C58*

    PubMed Central

    Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.

    2015-01-01

    Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925

  14. Drug interaction between sunitinib and cimetidine and contribution of the efflux transporter ATP-binding cassette C2 to biliary excretion of sunitinib in rats.

    PubMed

    Arakawa-Todo, Maki; Ueyama, Jun; Nomura, Hiroshi; Abe, Fumie; Tsukiyama, Ikuto; Matsuura, Katsuhiko; Hasegawa, Takaaki

    2013-08-01

    The present study investigated the effect of the H2 antagonist cimetidine on the pharmacokinetics of a multi-targeted receptor tyrosine kinase (RTK) inhibitor, sunitinib, in Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic mutant rats (EHBR) lacking the efflux transporter, ATP-binding cassette C2 protein (ABCC2). Rats received an intraperitoneal injection of cimetidine (10 mg/kg) once a day for three days. On day 4, sunitinib (3 mg/kg) was administered intravenously 30 min after the final injection of cimetidine or saline to SD rats. Disappearance of sunitinib from plasma was significantly delayed by cimetidine. The pharmacokinetic parameter of sunitinib, systemic clearance (CLSYS), was significantly reduced and the half-life was significantly prolonged, with no change in the volume of distribution at steady-state (VSS). When the effect of cimetidine on the biliary excretion of sunitinib at steady-state condition was investigated in SD rats, cimetidine had no effect on some transporter-mediated biliary excretion of sunitinib. Furthermore, the contribution of ABCC2 to the biliary excretion of sunitinib was also examined in SD rats and EHBR. The biliary clearance of sunitinib was significantly lower in EHBR, but the biliary excretion rate of EHBR was not different from that of SD rats, and the contribution of biliary excretion to systemic elimination was small, suggesting that sunitinib is mainly eliminated by cytochrome P450 3A4 (CYP3A4)-mediated metabolism and is not excreted into the bile via ABCC2. These findings indicate that co-administration of cimetidine alters the pharmacokinetics of sunitinib probably due to inhibition of CYP3A4, suggesting the possibility that cimetidine should be used carefully for patients with cancer being treated with sunitinib therapy.

  15. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico

    2013-01-01

    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  16. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    PubMed

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  17. Effect of ATP-binding Cassette Transporter A1 (ABCA1) Gene Polymorphisms on Plasma Lipid Variables and Common Demographic Parameters in Greek Nurses

    PubMed Central

    Kolovou, Vana; Marvaki, Apostolia; Boutsikou, Maria; Vasilopoulos, Georgios; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa

    2016-01-01

    Objective: The present study is on line with our previous studies evaluating the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms on the lipid variables of Greek student-nurses. The current study was undertaken to (1) estimate the influence of variant(s) such as rs2066715 (V825I), R219K, R1587K, I883M of ABCA1 gene on lipid variables and (2) evaluate the effect of all four ABCA1 polymorphisms on common demographic parameters. Methods: The study population involved 432 unrelated nurses (86 men) who were genotyped for ABCA1 polymorphisms and correlated according to lipid variables [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] and demographic parameters (age, gender, BMI, waist circumference). Results: According to lipid variables concentration there was no difference between genotypes and alleles of V825I, R219K and I883M polymorphisms. The LDL-C concentration was 13% lower in RR compared with RK genotype (100.7 vs. 113.9 mg/dl, p=0.013) of R1587K gene polymorphism. In regression analysis the effects of age, gender and only R1587K gene polymorphism on LDL-C concentrations were proved significant. Additionally, LDL-C was increased (by 1.29 mg/dl on average) by every year of increase of age. Moreover, females had lower LDL-C concentrations as compared with males. Conclusion: Findings suggested that only R1587K polymorphism of ABCA1 gene was associated with lipid variables, age, and gender of Greek nurses. These findings may be helpful in assessing the risk factors for premature coronary heart disease and distinct individuals with lower/higher atherosclerotic burden. PMID:27990182

  18. OPA1-related auditory neuropathy: site of lesion and outcome of cochlear implantation

    PubMed Central

    Rossi, Roberta; Scimemi, Pietro; Cama, Elona; Valentino, Maria Lucia; La Morgia, Chiara; Caporali, Leonardo; Liguori, Rocco; Magnavita, Vincenzo; Monteleone, Anna; Biscaro, Ariella; Arslan, Edoardo; Carelli, Valerio

    2015-01-01

    amplitude and duration during rapid stimulation consistent with neural generation. The use of cochlear implant improved speech perception in all but one patient. Brainstem potentials were recorded in response to electrical stimulation in five of six subjects, whereas no compound action potential was evoked from the auditory nerve through the cochlear implant. These findings indicate that underlying the hearing impairment in patients carrying OPA1 missense mutations is a disordered synchrony in auditory nerve fibre activity resulting from neural degeneration affecting the terminal dendrites. Cochlear implantation improves speech perception and synchronous activation of auditory pathways by bypassing the site of lesion. PMID:25564500

  19. Lesion-induced DNA weak structural changes detected by pulsed EPR spectroscopy combined with site-directed spin labelling

    PubMed Central

    Sicoli, Giuseppe; Mathis, Gérald; Aci-Sèche, Samia; Saint-Pierre, Christine; Boulard, Yves; Gasparutto, Didier; Gambarelli, Serge

    2009-01-01

    Double electron-electron resonance (DEER) was applied to determine nanometre spin–spin distances on DNA duplexes that contain selected structural alterations. The present approach to evaluate the structural features of DNA damages is thus related to the interspin distance changes, as well as to the flexibility of the overall structure deduced from the distance distribution. A set of site-directed nitroxide-labelled double-stranded DNA fragments containing defined lesions, namely an 8-oxoguanine, an abasic site or abasic site analogues, a nick, a gap and a bulge structure were prepared and then analysed by the DEER spectroscopic technique. New insights into the application of 4-pulse DEER sequence are also provided, in particular with respect to the spin probes’ positions and the rigidity of selected systems. The lesion-induced conformational changes observed, which were supported by molecular dynamics studies, confirm the results obtained by other, more conventional, spectroscopic techniques. Thus, the experimental approaches described herein provide an efficient method for probing lesion-induced structural changes of nucleic acids. PMID:19304747

  20. Neither arginine nor histidine can carry out the function of lysine-295 in the ATP-binding site of p60src.

    PubMed Central

    Kamps, M P; Sefton, B M

    1986-01-01

    All 15 protein kinases whose amino acid sequence is known contain a lysine residue at a position homologous to that of lysine-295 in p60src, the transforming protein of Rous sarcoma virus. The ATP analog p-fluorosulfonyl 5'-benzoyl adenosine inactivates both p60src and the catalytic subunit of the cyclic AMP-dependent protein kinase by modification of this lysine. We used oligonucleotide-directed mutagenesis to examine the possible functions of this residue. Lysine-295 in p60src was replaced with a glutamic acid, an arginine, or a histidine residue, and mutant p60src proteins were characterized in chicken cells infected by mutant viruses. None of these three mutant p60src proteins had tyrosine protein kinase activity in vitro, and none induced morphological transformation of infected cells. Since neither a histidine nor an arginine residue can replace the function of lysine-295, we suggest that it carries out the specialized function of proton transfer in the phosphotransferase reaction. All three mutant viruses underwent reversion to wild type during passage in tissue culture. Because the rate with which this occurred differed significantly among the mutants, reversion appears to have resulted from errors in transcription, rather than from recombination with the cellular src gene. Images PMID:2430174

  1. NMR studies of the MgATP binding site of adenylate kinase and of a 45-residue peptide fragment of the enzyme.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1985-08-13

    Proton NMR was used to study the interaction of beta,gamma-bidentate Cr3+ATP and MgATP with rabbit muscle adenylate kinase, which has 194 amino acids, and with a synthetic peptide consisting of residues 1-45 of the enzyme, which has previously been shown to bind MgepsilonATP [Hamada, M., Palmieri, R. H., Russell, G. A., & Kuby, S. A. (1979) Arch. Biochem. Biophys. 195, 155-177]. The peptide is globular and binds Cr3+ATP competitively with MgATP with a dissociation constant, KD(Cr3+ATP) = 35 microM, comparable to that of the complete enzyme [KI(Cr3+ATP) = 12 microM]. Time-dependent nuclear Overhauser effects (NOE's) were used to measure interproton distances on enzyme- and peptide-bound MgATP. The correlation time was measured directly for peptide-bound MgATP by studying the frequency dependence of the NOE's at 250 and 500 MHz. The H2' to H1' distance so obtained (3.07 A) was within the range established by X-ray and model-building studies of nucleotides (2.9 +/- 0.2 A). Interproton distances yielded conformations of enzyme- and peptide-bound MgATP with indistinguishable anti-glycosyl torsional angles (chi = 63 +/- 12 degrees) and 3'-endo/O1'-endo ribose puckers (sigma = 96 +/- 12 degrees). Enzyme- and peptide-bound MgATP molecules exhibited different C4'-C5' torsional angles (gamma) of 170 degrees and 50 degrees, respectively. Ten intermolecular NOE's from protons of the enzyme and four such NOE's from protons of the peptide to protons of bound MgATP were detected, which indicated proximity of the adenine ribose moiety to the same residues on both the enzyme and the peptide. Paramagnetic effects of beta,gamma-bidentate Cr3+ATP on the longitudinal relaxation rates of protons of the peptide provided a set of distances to the side chains of five residues, which allowed the location of the bound Cr3+ atom to be uniquely defined. Distances from enzyme-bound Cr3+ATP to the side chains of three residues of the protein agreed with those measured for the peptide. The mutual consistency of interproton and Cr3+ to proton distances obtained in metal-ATP complexes of both the enzyme and the peptide suggests that the conformation of the peptide is very similar to that of residues 1-45 of the enzyme. When this was assumed to be the case and when molecular models and a computer graphics system were used, MgATP could be fit into the X-ray structure of adenylate kinase in a unique manner such that all of the distances determined by NMR were accommodated.(ABSTRACT TRUNCATED AT 400 WORDS)

  2. Discovery of 4,5,6,7-Tetrahydrobenzo[1,2-d]thiazoles as Novel DNA Gyrase Inhibitors Targeting the ATP-Binding Site.

    PubMed

    Tomašič, Tihomir; Katsamakas, Sotirios; Hodnik, Žiga; Ilaš, Janez; Brvar, Matjaž; Solmajer, Tom; Montalvão, Sofia; Tammela, Päivi; Banjanac, Mihailo; Ergović, Gabrijela; Anderluh, Marko; Peterlin Mašič, Lucija; Kikelj, Danijel

    2015-07-23

    Bacterial DNA gyrase and topoisomerase IV are essential enzymes that control the topological state of DNA during replication and validated antibacterial drug targets. Starting from a library of marine alkaloid oroidin analogues, we identified low micromolar inhibitors of Escherichia coli DNA gyrase based on the 5,6,7,8-tetrahydroquinazoline and 4,5,6,7-tetrahydrobenzo[1,2-d]thiazole scaffolds. Structure-based optimization of the initial hits resulted in low nanomolar E. coli DNA gyrase inhibitors, some of which exhibited micromolar inhibition of E. coli topoisomerase IV and of Staphylococcus aureus homologues. Some of the compounds possessed modest antibacterial activity against Gram positive bacterial strains, while their evaluation against wild-type, impA and ΔtolC E. coli strains suggests that they are efflux pump substrates and/or do not possess the physicochemical properties necessary for cell wall penetration. Our study provides a rationale for optimization of this class of compounds toward balanced dual DNA gyrase and topoisomerase IV inhibitors with antibacterial activity.

  3. Mycophenolic acid induces ATP-binding cassette transporter A1 (ABCA1) expression through the PPAR{gamma}-LXR{alpha}-ABCA1 pathway

    SciTech Connect

    Xu, Yanni; Lai, Fangfang; Xu, Yang; Wu, Yexiang; Liu, Qi; Li, Ni; Wei, Yuzhen; Feng, Tingting; Zheng, Zhihui; Jiang, Wei; Yu, Liyan; Hong, Bin; Si, Shuyi

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1. Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.

  4. Eroded enamel lesion remineralization by saliva as a possible factor in the site-specificity of human dental erosion.

    PubMed

    Amaechi, B T; Higham, S M

    2001-08-01

    The composition and flow of saliva, which determine its functions, vary within intraoral sites and among individuals. Also, the susceptibility to tooth erosion reportedly varies among individuals and within the dental arches. A possible effect of saliva on early-eroded lesions may be a contributory factor. The aims here were firstly to determine the remineralization of eroded enamel lesions by saliva, and secondly to investigate any variation of this remineralization within the dental arches and among individuals. Early enamel erosion was produced on human premolars using orange juice. Control sections and two test slabs were cut from each tooth. The two slabs from the same lesion were bonded with composite resins to the palatal surface of upper right lateral incisor teeth and the lingual surface of the lower right lateral incisor teeth of volunteers, who then chewed a sugar-free gum four times daily. After 28-day intraoral exposure, mineral loss (DeltaZ) and lesion depth (ld) were quantified using microradiography and the data analysed by paired t-test (n=10, alpha=0.05). Mean DeltaZ was significantly lower in the group of slabs positioned palatally (P<0.001) and lingually (P<0.001) when compared with the control group, and in the lingually placed group when compared with the palatally positioned (P<0.01). A significantly lower ld was observed in the group of slabs positioned palatally (P<0.05) and lingually (P<0.001) when compared with the control group, and in the lingually positioned group when compared with the palatally placed (P<0.05). It was concluded that saliva can remineralize early enamel erosion, and that the degree of remineralization varies within intraoral sites and may be responsible for the differing susceptibility to erosion within the dental arches.

  5. The effect of vitamin E supplementation on discoloration of injection-site lesions in retail cuts and the greening reaction observed in injection-site lesions in muscles of the chuck.

    PubMed

    Roeber, D L; Belk, K E; Engle, T E; Field, T G; Koontz, S R; Scanga, J A; Tatum, J D; Mason, G L; Van Metre, D; Garry, F B; Smith, G C

    2003-08-01

    Concern has been raised about green discoloration of injection-site lesions in chuck muscles in modified-atmosphere packages. Objectives were: 1) to recreate green lesions, 2) to compare the severity of discoloration of injection-site lesions in chucks from carcasses of control or vitamin E-supplemented steers, and 3) to identify pigment(s) responsible for discoloration via in vitro color reactions. In Exp. 1, 23 steers (BW = 415 kg; 37 d before harvest) were injected with one of 12 pharmaceuticals, following label directions for route and dose, with the exception of a 5-mL maximum dose, to identify a product that could result in discoloration. Two vaccines (Products A and B) resulted in greening. In Exp. 2, 50 steers were injected (i.m.) with Product A and assigned to the control or vitamin E (1,000 IU/steer daily for 60 d) group. After retail display, 80 and 72% of steaks from the control and treatment groups, respectively, were discolored. Although vitamin E did not reduce (P = 0.53) greening, there was a trend (P = 0.10) toward delay discoloration of lesions from the treatment group. In Phase I of Exp. 3, pigments extracted from green lesions obtained from Exp. 2 were compared with solutions, exposed to a high partial pressure of oxygen (ppO), of myoglobin (Mb), copper sulfate, hydrogen peroxide (H2O2), vaccine, and aluminum hydroxide either alone or in combination. In Phase II of Exp. 3, solutions of two or more of Mb, Cu, sodium sulfide, sodium sulfite, sodium sulfate (Na2SO4), and H2O2 were made at pH 7.2 or 5.5 and exposed to low or high ppO. Normal muscle tissue displayed a 3.2 and 56.7% decrease in absorbance/microg of protein as wavelength changed from 654 to 656 nm and 656 to 658 nm, respectively. Pigments from control and treatment group green tissue displayed a 164.5 and 621.3% increase, respectively, in absorbance/microg of protein as wavelength changed from 654 to 656 nm. As wavelength changed from 656 to 658 nm, the absorbance/microg of protein for

  6. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  7. Melanotic neuroectodermal tumor of infancy: Cytology and histopathology of a rare lesion at an uncommon site.

    PubMed

    Batta, Nishant; Narang, Vikram; Kaur, Harpreet; Selhi, Pavneet Kaur; Sood, Neena

    2016-11-07

    Melanotic neuroectodermal tumour of infancy is a rare, pigmented neoplasm generally arising in infants during the first year of life. The cytological features are rarely described in the literature. This case due to its rarity and unusual site emphasising the cytopathological features and the necessity of histology for differentiating it from other round cell tumours has been presented. Diagn. Cytopathol. 2016. © 2016 Wiley Periodicals, Inc.

  8. Exclusion of the retinoblastoma gene and chromosome 13q as the site of a primary lesion for human breast cancer.

    PubMed Central

    Bowcock, A M; Hall, J M; Hebert, J M; King, M C

    1990-01-01

    Chromosome 13q has been suggested as the site of a gene predisposing to human breast cancer, because loss of heterozygosity of alleles on this chromosome has been observed in some ductal breast tumors and because two breast cancer lines are altered at the retinoblastoma gene (RB1) at 13q14. To test this possibility, linkage of breast cancer susceptibility to 14 loci on chromosome 13q loci was assessed in extended families in which breast cancer is apparently inherited as an autosomal dominant trait. RB1 was excluded as the site of a breast cancer gene by a lod score of Z = -7.60 at close linkage for 13 families. Multipoint analysis yielded negative lod scores throughout the region between 13q12 and 13q34; over most of this distance, Z less than -2.0. Therefore, chromosome 13q appears to be excluded as the site of primary lesion for breast cancer in these families. In addition, comparison of tumor versus normal tissues of nonfamilial breast cancer patients revealed an alteration at the 5' end of RB1 in a mucoid carcinoma but no alterations of RB1 in five informative ductal adenocarcinomas. Linkage data and comparisons of tumor and normal tissues suggest that changes in the RBI locus either are secondary alterations associated with progression of some tumors or occur by chance. Images Figure 2 PMID:2294744

  9. Surgical site infection of scrotal and inguinal lesions after urologic surgery.

    PubMed

    Uehara, Teruhisa; Takahashi, Satoshi; Ichihara, Kohji; Hiyama, Yoshiki; Hashimoto, Jiro; Kurimura, Yuichiro; Masumori, Naoya

    2014-03-01

    To clarify the incidence of surgical site infection (SSI) after urological scrotal and inguinal surgical procedures and the preventive effect of antimicrobial prophylaxis for SSI, retrospective analysis was performed. The patients who underwent scrotal and inguinal operations from 2001 to 2010 were included in this analysis. A first or second generation cephalosporin was administered as antimicrobial prophylaxis just before the start of surgery and no additional prophylaxis was conducted. The surgery was classified into 76 (38%) cases with testicular sperm extraction (TESE), 72 (36%) with radical orchiectomy, 29 (14.5%) with bilateral orchiectomy (surgical castration) and 23 (11.5%) with other scrotal and inguinal operations. The median age and age range were 36 years and 18-81 years, respectively. SSI occurred in 7 (3.5%) cases. The frequencies of SSI were 6.5% in the patients with urological inguinal surgery and 1.6% in those with scrotal surgery. The frequency of SSI in the patients with urological inguinal surgery was not negligible even though it is considered a clean operation, and further analysis is warranted to prevent SSI.

  10. Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

    PubMed Central

    Cao, Yangrong; Cho, Sung-Hwan; Xu, Dong; Stacey, Gary

    2016-01-01

    DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecular interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. The in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues. PMID:27583834

  11. Prevalence of candida albicans in dental plaque and caries lesion of early childhood caries (ECC) according to sampling site

    PubMed Central

    Ghasempour, Maryam; Sefidgar, Seyed Ali Asghar; Eyzadian, Haniyeh; Gharakhani, Samaneh

    2011-01-01

    Background: Candida albicans may have cariogenic potential but its role in caries etiology has not been established. The aim of this study was to determine candida albicans in supragingival dental plaque and infected dentine of cervical and proximal in early childhood caries (ECC). Methods: This cross-sectional study was carried out on 6o children aged 2-5 years, which were divided into 3 groups: children with at least one cervical caries; children with at least one proximal caries and caries-free. The infected dentine was collected from cervical and proximal caries lesions and plaque samples were collected from the three groups in order to compare the frequency of candida albicans in the collected sites. All samples were cultured in Sabouraud and CHROMagar medium and the cases that were positive for candida albicans were cultured in germ tube. Data were collected and analyzed. Results: The mean age of the children was 3.9 years. From 100 samples, candida albicans samples were isolated in 55%, mold fungi were found in 29% cases and there was no fungal growth in 16% of the samples. In plaque samples, candida albicans were found in 15% of caries-free samples, 20% of the proximal and 80% of the cervical caries. In samples extracted from the caries, candida albicans were found in 60% of the proximal and 100% of the cervical caries. Mothers with university educational level had children with more cervical decays, caries free and proximal caries, respectively. Conclusion: The results showed that prevalence of Candida albicans in dental plaque and caries lesions of children with early childhood caries were relatively high and the prevalence was higher in cervical caries group. PMID:24551436

  12. Regeneration of nigrostriatal dopaminergic axons after transplantation of olfactory ensheathing cells and fibroblasts prevents fibrotic scar formation at the lesion site.

    PubMed

    Teng, Xichuan; Nagata, Isao; Li, Hong-Peng; Kimura-Kuroda, Junko; Sango, Kazunori; Kawamura, Koki; Raisman, Geoffrey; Kawano, Hitoshi

    2008-11-01

    The fibrotic scar formed after central nervous system injury has been considered an obstacle to axonal regeneration. The present study was designed to examine whether cell transplantation into a damaged central nervous system can reduce fibrotic scar formation and promote axonal regeneration. Nigrostriatal dopaminergic axons were unilaterally transected in rats and cultures of olfactory-ensheathing cells (OECs), and olfactory nerve fibroblasts were transplanted into the lesion site. In the absence of transplants, few tyrosine hydroxylase-immunoreactive axons extended across the lesion 2 weeks after the transection. Reactive astrocytes increased around the lesion, and a fibrotic scar containing type IV collagen deposits developed in the lesion center. The immunoreactivity of chondroitin sulfate side chains and core protein of NG2 proteoglycan increased in and around the lesion. One and 2 weeks after transection and simultaneous transplantation, dopaminergic axons regenerated across the transplanted tissues, which consisted of p75-immunoreactive OECs and fibronectin-immunoreactive fibroblasts. Reactive astrocytes and chondroitin sulfate immunoreactivity increased around the transplants, whereas the deposition of type IV collagen and fibrotic scar formation were completely prevented at the lesion site. Transplantation of meningeal fibroblasts similarly prevented the formation of the fibrotic scar, although its effect on regeneration was less potent than transplantation of OECs and olfactory nerve fibroblasts. The present results suggest that elimination of the inhibitory fibrotic scar is important for neural regeneration.

  13. CryoEM and Molecular Dynamics of the Circadian KaiB-KaiC Complex Indicates That KaiB Monomers Interact with KaiC and Block ATP Binding Clefts

    SciTech Connect

    Villarreal, Seth A.; Pattanayek, Rekha; Williams, Dewight R.; Mori, Tetsuya; Qin, Ximing; Johnson, Carl H.; Egli, Martin; Stewart, Phoebe L.

    2014-10-02

    The circadian control of cellular processes in cyanobacteria is regulated by a posttranslational oscillator formed by three Kai proteins. During the oscillator cycle, KaiA serves to promote autophosphorylation of KaiC while KaiB counteracts this effect. Here, we present a crystallographic structure of the wild-type Synechococcus elongatus KaiB and a cryo-electron microscopy (cryoEM) structure of a KaiBC complex. The crystal structure shows the expected dimer core structure and significant conformational variations of the KaiB C-terminal region, which is functionally important in maintaining rhythmicity. The KaiBC sample was formed with a C-terminally truncated form of KaiC, KaiC-Δ489, which is persistently phosphorylated. The KaiB–KaiC-Δ489 structure reveals that the KaiC hexamer can bind six monomers of KaiB, which form a continuous ring of density in the KaiBC complex. We performed cryoEM-guided molecular dynamics flexible fitting simulations with crystal structures of KaiB and KaiC to probe the KaiBC protein–protein interface. This analysis indicated a favorable binding mode for the KaiB monomer on the CII end of KaiC, involving two adjacent KaiC subunits and spanning an ATP binding cleft. A KaiC mutation, R468C, which has been shown to affect the affinity of KaiB for KaiC and lengthen the period in a bioluminescence rhythm assay, is found within the middle of the predicted KaiBC interface. The proposed KaiB binding mode blocks access to the ATP binding cleft in the CII ring of KaiC, which provides insight into how KaiB might influence the phosphorylation status of KaiC.

  14. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    SciTech Connect

    Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Shikazono, Naoya; Yokoya, Akinari; Katsumura, Yosuke

    2013-05-03

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.

  15. Functional activation independently contributes to naming ability and relates to lesion site in post-stroke aphasia.

    PubMed

    Skipper-Kallal, Laura M; Lacey, Elizabeth H; Xing, Shihui; Turkeltaub, Peter E

    2017-04-01

    Language network reorganization in aphasia may depend on the degree of damage in critical language areas, making it difficult to determine how reorganization impacts performance. Prior studies on remapping of function in aphasia have not accounted for the location of the lesion relative to critical language areas. They rectified this problem by using a multimodal approach, combining multivariate lesion-symptom mapping and fMRI in chronic aphasia to understand the independent contributions to naming performance of the lesion and the activity in both hemispheres. Activity was examined during two stages of naming: covert retrieval, and overt articulation. Regions of interest were drawn based on over- and under-activation, and in areas where activity had a bivariate relationship with naming. Regressions then tested whether activation of these regions predicted naming ability, while controlling for lesion size and damage in critical left hemisphere naming areas, as determined by lesion-symptom mapping. Engagement of the right superior temporal sulcus (STS) and disengagement of the left dorsal pars opercularis (dPOp) during overt naming was associated with better than predicted naming performance. Lesions in the left STS prevented right STS engagement and resulted in persistent left dPOp activation. In summary, changes in activity during overt articulation independently relate to naming outcomes, controlling for stroke severity. Successful remapping relates to network disruptions that depend on the location of the lesion in the left hemisphere. Hum Brain Mapp 38:2051-2066, 2017. © 2017 Wiley Periodicals, Inc.

  16. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette Transporter (ΔabcBA) Protects against Wild Type Brucella ovis in Rams

    PubMed Central

    Silva, Ana Patrícia C.; Macêdo, Auricélio A.; Costa, Luciana F.; Rocha, Cláudia E.; Garcia, Luize N. N.; Farias, Jade R. D.; Gomes, Priscilla P. R.; Teixeira, Gustavo C.; Fonseca, Kessler W. J.; Maia, Andréa R. F.; Neves, Gabriela G.; Romão, Everton L.; Silva, Teane M. A.; Mol, Juliana P. S.; Oliveira, Renata M.; Araújo, Márcio S. S.; Nascimento, Ernane F.; Martins-Filho, Olindo A.; Brandão, Humberto M.; Paixão, Tatiane A.; Santos, Renato L.

    2015-01-01

    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  17. An attenuated mutant of the Rv1747 ATP-binding cassette transporter of Mycobacterium tuberculosis and a mutant of its cognate kinase, PknF, show increased expression of the efflux pump-related iniBAC operon

    PubMed Central

    Spivey, Vicky L; Whalan, Rachael H; Hirst, Elizabeth M A; Smerdon, Stephen J; Buxton, Roger S

    2013-01-01

    The ATP-binding cassette transporter Rv1747 is required for the growth of Mycobacterium tuberculosis in mice and in macrophages. Its structure suggests it is an exporter. Rv1747 forms a two-gene operon with pknF coding for the serine/threonine protein kinase PknF, which positively modulates the function of the transporter. We show that deletion of Rv1747 or pknF results in a number of transcriptional changes which could be complemented by the wild type allele, most significantly up-regulation of the iniBAC genes. This operon is inducible by isoniazid and ethambutol and by a broad range of inhibitors of cell wall biosynthesis and is required for efflux pump functioning. However, neither the Rv1747 or pknF mutant showed increased susceptibility to a range of drugs and cell wall stress reagents including isoniazid and ethambutol, cell wall structure and cell division appear normal by electron microscopy, and no differences in lipoarabinomannan were found. Transcription from the pknF promoter was not induced by a range of stress reagents. We conclude that the loss of Rv1747 affects cell wall biosynthesis leading to the production of intermediates that cause induction of iniBAC transcription and implicates it in exporting a component of the cell wall, which is necessary for virulence. PMID:23915284

  18. Cross-reactivity of Antibodies Directed to the Gram-Negative Bacterium Neisseria gonorrhoeae With Heat Shock Protein 60 and ATP-Binding Protein Correlates to Reduced Mitochondrial Activity in HIBCPP Choroid Plexus Papilloma Cells.

    PubMed

    Reuss, B; Schroten, H; Ishikawa, H; Asif, A R

    2015-09-01

    Antibacterial antibodies can cause neurologic side-effects by cross-reactivity with cellular antigens. Here we investigated interactions of antibodies to Neisseria gonorrhoeae (α-NG) - maternal infections by which increases the offspring's risk for later psychosis-with HIBCPP cells, a cell culture model of choroid plexus epithelium. Immunocytochemistry and Western blotting with α-NG, revealed organelle-like intracellular staining in HIBCPP cells, and labelling of several immunoreactive bands in cellular protein. Two-dimensional Western blotting revealed several immunopositive spots, most prominent of which were identified by mass spectrometry as mitochondrially localized proteins heat shock protein 60 (Hsp60) and ATP-binding protein β-subunit (ATPB). Similarly α-NG interacted with commercial samples of these proteins as revealed by Western blotting. Three alternative methods (JC-1, Janus green and MTT staining) revealed α-NG to cause in HIBCPP cells a significant decrease in mitochondrial activity, which could be reverted by neuroleptic drugs. Immunoreactivity of α-NG with choroid plexus epithelium in human post mortem samples suggests in vivo relevance of these findings. Finally, distinctly different staining patterns of antibodies against Neisseria meningitidis (α-NM), confirmed antibody specificity. To our knowledge this is the first report that α-NG cross-reactivity with Hsp60 and ATPB impairs mitochondrial activity in choroid plexus epithelial cells, pathogenetic relevance of which needs further clarification.

  19. Change in ATP-binding cassette B1/19, glutamine synthetase and alcohol dehydrogenase gene expression during root elongation in Betula pendula Roth and Alnus glutinosa L. Gaertn in response to leachate and leonardite humic substances.

    PubMed

    Tahiri, Abdelghani; Delporte, Fabienne; Muhovski, Yordan; Ongena, Marc; Thonart, Philippe; Druart, Philippe

    2016-01-01

    Humic substances (HS) are complex and heterogeneous compounds of humified organic matter resulting from the chemical and microbiological decomposition of organic residues. HS have a positive effect on plant growth and development by improving soil structure and fertility. They have long been recognized as plant growth-promoting substances, particularly with regard to influencing nutrient uptake, root growth and architecture. The biochemical and molecular mechanisms through which HS influence plant physiology are not well understood. This study evaluated the bioactivity of landfill leachate and leonardite HS on alder (Alnus glutinosa L. Gaertn) and birch (Betula pendula Roth) during root elongation in vitro. Changes in root development were studied in relation to auxin, carbon and nitrogen metabolisms, as well as to the stress adaptive response. The cDNA fragments of putative genes encoding two ATP-binding cassette (ABC) transporters (ABCB1 and ABCB19) belonging to the B subfamily of plant ABC auxin transporters were cloned and sequenced. Molecular data indicate that HS and their humic acid (HA) fractions induce root growth by influencing polar auxin transport (PAT), as illustrated by the modulation of the ABCB transporter transcript levels (ABCB1 and ABCB19). There were also changes in alcohol dehydrogenase (ADH) and glutamine synthetase (GS) gene transcript levels in response to HS exposure. These findings confirmed that humic matter affects plant growth and development through various metabolic pathways, including hormonal, carbon and nitrogen metabolisms and stress response or signalization.

  20. Functional Dynamics Revealed by the Structure of the SufBCD Complex, a Novel ATP-binding Cassette (ABC) Protein That Serves as a Scaffold for Iron-Sulfur Cluster Biogenesis*

    PubMed Central

    Hirabayashi, Kei; Yuda, Eiki; Tanaka, Naoyuki; Katayama, Sumie; Iwasaki, Kenji; Matsumoto, Takashi; Kurisu, Genji; Outten, F. Wayne; Fukuyama, Keiichi; Takahashi, Yasuhiro; Wada, Kei

    2015-01-01

    ATP-binding cassette (ABC)-type ATPases are chemomechanical engines involved in diverse biological pathways. Recent genomic information reveals that ABC ATPase domains/subunits act not only in ABC transporters and structural maintenance of chromosome proteins, but also in iron-sulfur (Fe-S) cluster biogenesis. A novel type of ABC protein, the SufBCD complex, functions in the biosynthesis of nascent Fe-S clusters in almost all Eubacteria and Archaea, as well as eukaryotic chloroplasts. In this study, we determined the first crystal structure of the Escherichia coli SufBCD complex, which exhibits the common architecture of ABC proteins: two ABC ATPase components (SufC) with function-specific components (SufB-SufD protomers). Biochemical and physiological analyses based on this structure provided critical insights into Fe-S cluster assembly and revealed a dynamic conformational change driven by ABC ATPase activity. We propose a molecular mechanism for the biogenesis of the Fe-S cluster in the SufBCD complex. PMID:26472926

  1. Variants in the ATP-Binding Cassette Transporter (ABCA7), Apolipoprotein E ε4, and the Risk of Late-Onset Alzheimer Disease in African Americans

    PubMed Central

    Reitz, Christiane; Jun, Gyungah; Naj, Adam; Rajbhandary, Ruchita; Vardarajan, Badri Narayan; Wang, Li-San; Valladares, Otto; Lin, Chiao-Feng; Larson, Eric B.; Graff-Radford, Neill R.; Evans, Denis; De Jager, Philip L.; Crane, Paul K.; Buxbaum, Joseph D.; Murrell, Jill R.; Raj, Towfique; Ertekin-Taner, Nilufer; Logue, Mark; Baldwin, Clinton T.; Green, Robert C.; Barnes, Lisa L.; Cantwell, Laura B.; Fallin, M. Daniele; Go, Rodney C. P.; Griffith, Patrick; Obisesan, Thomas O.; Manly, Jennifer J.; Lunetta, Kathryn L.; Kamboh, M. Ilyas; Lopez, Oscar L.; Bennett, David A.; Hendrie, Hugh; Hall, Kathleen S.; Goate, Alison M.; Byrd, Goldie S.; Kukull, Walter A.; Foroud, Tatiana M.; Haines, Jonathan L.; Farrer, Lindsay A.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Mayeux, Richard

    2013-01-01

    Importance Genetic variants associated with susceptibility to late-onset Alzheimer disease are known for individuals of European ancestry, but whether the same or different variants account for the genetic risk of Alzheimer disease in African American individuals is unknown. Identification of disease-associated variants helps identify targets for genetic testing, prevention, and treatment. Objective To identify genetic loci associated with late-onset Alzheimer disease in African Americans. Design, Setting, and Participants The Alzheimer Disease Genetics Consortium (ADGC) assembled multiple data sets representing a total of 5896 African Americans (1968 case participants, 3928 control participants) 60 years or older that were collected between 1989 and 2011 at multiple sites. The association of Alzheimer disease with genotyped and imputed single-nucleotide polymorphisms (SNPs) was assessed in case-control and in family-based data sets. Results from individual data sets were combined to perform an inverse variance–weighted meta-analysis, first with genome-wide analyses and subsequently with gene-based tests for previously reported loci. Main Outcomes and Measures Presence of Alzheimer disease according to standardized criteria. Results Genome-wide significance in fully adjusted models (sex, age, APOE genotype, population stratification) was observed for a SNP in ABCA7 (rs115550680, allele = G; frequency, 0.09 cases and 0.06 controls; odds ratio [OR], 1.79 [95% CI, 1.47-2.12]; P = 2.2 × 10–9), which is in linkage disequilibrium with SNPs previously associated with Alzheimer disease in Europeans (0.8

  2. Induction of DNA strand breaks, base lesions and clustered damage sites in hydrated plasmid DNA films by ultrasoft X rays around the phosphorus K edge.

    PubMed

    Yokoya, Akinari; Cunniffe, Siobhan M T; Watanabe, Ritsuko; Kobayashi, Katsumi; O'Neill, Peter

    2009-09-01

    To characterize the DNA damage induced by K-shell ionization of phosphorus atom in DNA backbone on the level of hydration, the yields of DNA strand breaks and base lesions arising from the interaction of ultrasoft X rays with energies around the phosphorus K edge were determined using dry and fully hydrated pUC18 plasmid DNA samples. Base lesions and bistranded clustered DNA damage sites were revealed by postirradiation treatment with the base excision repair proteins endonuclease III (Nth) and formamidopyrimidine-DNA glycosylase (Fpg). The yield of prompt single-strand breaks (SSBs) with dry DNA irradiated at the phosphorus K resonance energy (2153 eV) is about one-third that below the phosphorus K edge (2147 eV). The yields of prompt double-strand breaks (DSBs) were found to be less dependent on the X-ray energy, with the yields being about two times lower when irradiated at 2153 eV. Heat-labile sites were not produced in detectable amounts. The yields of base lesions were dependent on the energy of the X rays, especially when the DNA was fully hydrated. Bistranded clustered DNA damage sites, revealed enzymatically as additional DSBs, were produced in dry as well as in hydrated DNA with all three energies of X rays. The yields of these enzyme-sensitive sites were also lower when irradiated at the phosphorus K resonance energy. On the other hand, the yields of prompt SSBs and enzyme-sensitive sites for the two off-resonance energies were, larger than those determined previously for gamma radiation. The results indicate that the photoelectric effect caused by X rays and dense ionization and excitation events along the tracks of low-energy secondary electrons are more effective at inducing SSBs and enzyme-sensitive sites. The complex types of damage, prompt and enzymatically induced DSBs, are preferentially induced by phosphorus K resonance at 2153 eV rather than simple SSBs and isolated base lesions, particularly in hydrated conditions. It is concluded that not

  3. Clostridial antibody response from injection-site lesions in beef cattle, long-term response to single or multiple doses, and response in newborn beef calves.

    PubMed

    Troxel, T R; Gadberry, M S; Wallace, W T; Kreider, D L; Shockey, J D; Colburn, E A; Widel, P; Nicholson, I

    2001-10-01

    Experiments were conducted to compare clostridial antibody response of beef heifers that do and do not develop injection-site lesions, evaluate long-term antibody response of a single- and multiple-dose toxoid, and evaluate the ability of a clostridial toxoid to elicit an active antibody response in newborn calves. In Exp. 1, 37 weaned heifers were vaccinated (d 0) with a clostridial vaccine (Alpha-7, 2 mL, s.c.). Serum samples were collected on d 0, 28, 56, 84, and 112 to determine clostridial antibody titers. On d 28, heifers were visually inspected and palpated for injection-site lesions. The percentage of heifers that developed lesions was 64.9%. Lesioned heifers had elevated antibody titers for Clostridium chauvoei (CC) on d 28 (P < 0.08) and 84 (P < 0.07) compared with non-lesioned heifers. Clostridium sordellii (CS) and perfringens type D (CPD) antibody titers were greater in lesioned heifers than in non-lesioned heifers on d 28 and 56. In Exp. 2, long-term antibody response of Alpha-7 (A7) and Ultrabac 7 (UB7) was investigated in stocker heifers. The A7 heifers (n = 15) received one 2-mL vaccination (d 0), and the UB7 heifers (n = 15) received a 5-mL vaccination on d 0 and 28. Blood samples were collected on d 0, 28, 56, 84, 112, 140, and 180. Clostridium chauvoei, CPD, and Cl. novyi (CN) antibody titers from the A7 heifers were greater than those from the UB7 heifers on d 28. Due to the second UB7 injection, CC, CS, CN, and Cl. perfringens type C (CPC) antibody titers were greater in UB7 heifers than in A7 heifers on d 56. By d 112, titers were not different, and by d 140 all antibody titers were below detectable levels. In Exp. 3, 58 pregnant, mature, crossbred cows were vaccinated with A7 before calving. At birth, calves were carefully observed to ensure consumption of colostrum. Calves were blocked according to parturition date, and calves in each block were randomly allocated to receive A7 (s.c. at 3 +/- 3 d of age) or remain unvaccinated controls

  4. Quercetin up-regulates expressions of peroxisome proliferator-activated receptor γ, liver X receptor α, and ATP binding cassette transporter A1 genes and increases cholesterol efflux in human macrophage cell line.

    PubMed

    Lee, Seung-Min; Moon, Jiyoung; Cho, Yoonsu; Chung, Ji Hyung; Shin, Min-Jeong

    2013-02-01

    Cholesterol-laden macrophages trigger accumulation of foam cells and increase the risk of developing atherosclerosis. We hypothesized that quercetin could lower the content of cholesterol in macrophages by regulating the expression of the ATP binding cassette transporter A1 (ABCA1) gene in differentiated human acute monocyte leukemia cell line (THP-1) cells and thereby reducing the chance of forming foam cells. Quercetin, in concentrations up to 30 μM, was not cytotoxic to differentiated THP-1 cells. Quercetin up-regulated both ABCA1 messenger RNA and protein expression in differentiated THP-1 cells, and its maximum effects were demonstrated at 0.3 μM for 4 to 8 hours in incubation. In addition, quercetin increased protein levels of peroxisome proliferator-activated receptor γ (PPARγ) and liver X receptor α (LXRα) within 2 hours of treatment. Because PPARγ and LXRα are important transcriptional factors for ABCA1, quercetin-induced up-regulation of ABCA1 may be mediated by increased expression levels of the PPARγ and LXRα genes. Furthermore, quercetin-enhanced cholesterol efflux from differentiated THP-1 cells to both high-density lipoprotein (HDL) and apolipoprotein A1. Quercetin at the dose of 0.15 μM elevated the cholesterol efflux only for HDL. At the dose of 0.3 μM, quercetin demonstrated effects both on HDL and apolipoprotein A1. Our data demonstrated that quercetin increased the expressions of PPARγ, LXRα, and ABCA1 genes and cholesterol efflux from THP-1 macrophages. Quercetin-induced expression of PPARγ and LXRα might subsequently affect up-regulation of their target gene ABCA1. Taken together, ingestion of quercetin or quercetin-rich foods could be an effective way to improve cholesterol efflux from macrophages, which would contribute to lowering the risk of atherosclerosis.

  5. Inducer exclusion in Firmicutes: Insights into the regulation of a carbohydrate ATP binding cassette transporter from Lactobacillus casei BL23 by the signal transducing protein P-Ser46-HPr.

    PubMed

    Homburg, Constanze; Bommer, Martin; Wuttge, Steven; Hobe, Carolin; Beck, Sebastian; Dobbek, Holger; Deutscher, Josef; Licht, Anke; Schneider, Erwin

    2017-03-30

    Catabolite repression is a mechanism that enables bacteria to control carbon utilization. As part of this global regulatory network, components of the phosphoenolpyruvate:carbohydrate phosphotransferase system inhibit the uptake of less favourable sugars when a preferred carbon source such as glucose is available. This process is termed inducer exclusion. In bacteria belonging to the phylum Firmicutes, HPr, phosphorylated at serine 46 (P-Ser46-HPr) is the key player but its mode of action is elusive. To address this question at the level of purified protein components, we have chosen a homolog of the E. coli maltose/maltodextrin ATP-binding cassette transporter from Lactobacillus casei (MalE1-MalF1G1K12 ) as a model system. We show that the solute binding protein, MalE1, binds linear and cyclic maltodextrins but not maltose. Crystal structures of MalE1 complexed with these sugars provide a clue why maltose is not a substrate. P-Ser46-HPr inhibited MalE1/maltotetraose-stimulated ATPase activity of the transporter incorporated in proteoliposomes. Furthermore, cross-linking experiments revealed that P-Ser46-HPr contacts the nucleotide-binding subunit, MalK1, in proximity to the Walker A motif. However, P-Ser46-HPr did not block binding of ATP to MalK1. Together, our findings provide first biochemical evidence that P-Ser-HPr arrests the transport cycle by preventing ATP hydrolysis at the MalK1 subunits of the transporter. This article is protected by copyright. All rights reserved.

  6. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2

    PubMed Central

    LI, QIONGYU; WANG, XIANGFENG; SHEN, ALING; ZHANG, YUCHEN; CHEN, YOUQIN; SFERRA, THOMAS J.; LIN, JIUMAO; PENG, JUN

    2015-01-01

    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC. PMID:26640560

  7. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2.

    PubMed

    Li, Qiongyu; Wang, Xiangfeng; Shen, Aling; Zhang, Yuchen; Chen, Youqin; Sferra, Thomas J; Lin, Jiumao; Peng, Jun

    2015-11-01

    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC.

  8. Natural allelic variants of bovine ATP-binding cassette transporter ABCG2: increased activity of the Ser581 variant and development of tools for the discovery of new ABCG2 inhibitors.

    PubMed

    Merino, Gracia; Real, Rebeca; Baro, Marta F; Gonzalez-Lobato, Lucia; Prieto, Julio G; Alvarez, Ana I; Marques, Margarita M

    2009-01-01

    ATP-binding cassette transporter ABCG2 [breast cancer resistance protein (BCRP)] is a member of the ABC transporter superfamily that actively extrudes xenotoxins from cells and is a major determinant of the bioavailability of many compounds. ABCG2 expression is strongly induced during lactation in the mammary gland and is related to the active secretion of drugs into the milk. The presence of drug residues and environmental pollutants in milk is an outstanding problem for human milk consumption and milk industrial processes, involving important risks to public health and the dairy industry. In cows, a single nucleotide polymorphism (SNP) in this protein has been described previously (Tyr581) and is associated with higher fat and protein percentages and lower milk yield. However, whether this amino acid substitution affects ABCG2-mediated drug transport in cows, including milk secretion, required further exploration. We cloned the two variants of bovine ABCG2 and evaluated the effect of this SNP on mitoxantrone accumulation assays performed in ovine primary fibroblasts transiently expressing either of the variants. It is interesting to note that statistically significant differences in activity between both variants were observed, and the Ser581 variant was related with an increased efflux activity. In addition, we demonstrated that genistein is a very good inhibitor of bovine ABCG2 and identified new inhibitors of the transporter, such as the macrocyclic lactones, ivermectin, and selamectin. Moreover, the inhibitory effect of these compounds on human and murine ABCG2 homologs was confirmed using transduced Marbin-Dabin canine kidney II cells. These findings may have important implications regarding the presence of drug residues in milk and drug interactions affecting the pharmacological behavior of ABCG2 substrates.

  9. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.

    PubMed

    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P

    2015-05-07

    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have therefore investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies therefore reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages. This article is protected by copyright. All rights reserved.

  10. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.

    PubMed

    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P

    2015-09-01

    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have, therefore, investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies, therefore, reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages.

  11. Modulation of microRNA Expression in Subjects with Metabolic Syndrome and Decrease of Cholesterol Efflux from Macrophages via microRNA-33-Mediated Attenuation of ATP-Binding Cassette Transporter A1 Expression by Statins

    PubMed Central

    Tseng, Pei-Chi; Lee, Tzong-Shyuan; Lee, Wen-Jane; Chang, Pey-Jium; Chiang, An-Na

    2016-01-01

    Metabolic syndrome (MetS) is a complicated health problem that encompasses a variety of metabolic disorders. In this study, we analyzed the relationship between the major biochemical parameters associated with MetS and circulating levels of microRNA (miR)-33, miR-103, and miR-155. We found that miRNA-33 levels were positively correlated with levels of fasting blood glucose, glycosylated hemoglobin A1c, total cholesterol, LDL-cholesterol, and triacylglycerol, but negatively correlated with HDL-cholesterol levels. In the cellular study, miR-33 levels were increased in macrophages treated with high glucose and cholesterol-lowering drugs atorvastatin and pitavastatin. miR-33 has been reported to play an essential role in cholesterol homeostasis through ATP-binding cassette transporter A1 (ABCA1) regulation and reverse cholesterol transport. However, the molecular mechanism underlying the linkage between miR-33 and statin treatment remains unclear. In the present study, we investigated whether atorvastatin and pitavastatin exert their functions through the modulation of miR-33 and ABCA1-mediated cholesterol efflux from macrophages. The results showed that treatment of the statins up-regulated miR-33 expression, but down-regulated ABCA1 mRNA levels in RAW264.7 cells and bone marrow-derived macrophages. Statin-mediated ABCA1 regulation occurs at the post-transcriptional level through targeting of the 3′-UTR of the ABCA1 transcript by miR-33. Additionally, we found significant down-regulation of ABCA1 protein expression in macrophages treated with statins. Finally, we showed that high glucose and statin treatment significantly suppressed cholesterol efflux from macrophages. These findings have highlighted the complexity of statins, which may exert detrimental effects on metabolic abnormalities through regulation of miR-33 target genes. PMID:27139226

  12. Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice.

    PubMed

    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Park, Bo-Kyoung; Hahn, Tae-Wook

    2016-06-01

    Brucella abortus RB51 is an attenuated vaccine strain that has been most frequently used for bovine brucellosis. Although it is known to provide good protection in cattle, it still has some drawbacks including resistance to rifampicin, residual virulence and pathogenicity in humans. Thus, there has been a continuous interest on new safe and effective bovine vaccine candidates. In the present study, we have constructed unmarked mutants by deleting singly cydD and cydC genes, which encode ATP-binding cassette transporter proteins, from the chromosome of the virulent Brucella abortus isolate from Korean cow (referred to as IVK15). Both IVK15ΔcydD and ΔcydC mutants showed increased sensitivity to metal ions, hydrogen peroxide and acidic pH, which are mimic to intracellular environment during host infection. Additionally, the mutants exhibited a significant growth defect in RAW264.7 cells and greatly attenuated in mice. Vaccination of mice with either IVK15ΔcydC or IVK15ΔcydD mutant could elicit an anti-Brucella specific immunoglobulin G (IgG) and IgG subclass responses as well as enhance the secretion of interferon-gamma, and provided better protection against challenge with B. abortus strain 2308 than with the commercial B. abortus strain RB51 vaccine. Collectively, these results suggest that both IVK15ΔcydC and IVK15ΔcydD mutants could be an attenuated vaccine candidate against B. abortus.

  13. Different types of traumatic lesions on mediaeval skeletons from archaeological sites in Varese (North Italy): diagnosis on ante mortal fractures using macroscopic, radiological and CT analysis.

    PubMed

    Licata, Marta; Ronga, Mario; Cherubino, Paolo; Armocida, Giuseppe

    2014-02-01

    This is the medical history of three skeletons from archaeological sites in the province of Varese that are interesting because they show signs of traumatic injury to the skull and postcranial skeleton. Fractures of two of the skeletons were analysed by CT scan and radiological investigations to understand the extent of the damage and to hypothesise the cause. The study of lesions on ancient human remains is important to understand the degree of interpersonal violence within ancient communities and to reconstruct the dynamics of a violent episode.

  14. Relationships between toxicopathic hepatic lesions and exposure to chemical contaminants in English sole (Pleuronectes vetulus), starry flounder (Platichthys stellatus), and white croaker (Genyonemus lineatus) from selected marine sites on the Pacific Coast, USA.

    PubMed Central

    Myers, M S; Stehr, C M; Olson, O P; Johnson, L L; McCain, B B; Chan, S L; Varanasi, U

    1994-01-01

    Relationships between hepatic lesions and chemical contaminant concentrations in sediments, stomach contents, liver tissue, and bile were statistically evaluated in three species of bottomfish, English sole (Pleuronectes vetulus), starry flounder (Platichthys stellatus), and white croaker (Genyonemus lineatus), captured from 27 urban and nonurban sites on the Pacific Coast from Alaska to southern California. Lesions detected were neoplasms, preneoplastic foci of cellular alteration, nonneoplastic proliferative lesions, unique or specific degenerative/necrotic lesions, nonspecific degenerative/necrotic lesions, and hydropic vacuolation of biliary epithelial cells and hepatocytes. In general, lesion prevalences were significantly higher in all three species captured at chemically contaminated urban sites, and certain lesions had significantly higher relative risks of occurrence at urban sites in Puget Sound, San Francisco Bay, the vicinity of Los Angeles, and San Diego Bay. Concentrations of polycyclic aromatic hydrocarbons, polychlorinated biphenyls, DDT and its derivatives, and chlordanes and dieldrin in sediment, stomach contents, liver, and fluorescent aromatic compounds in bile were significant risk factors for the occurrence of neoplastic, preneoplastic, nonneoplastic proliferative, and specific degenerative/necrotic lesions, as well as hydropic vacuolation. Fish age also had a significant influence on occurrence of several hepatic lesions, but gender was rarely a significant risk factor. These relationships provide strong evidence for the involvement of environmental contaminants in the etiology of hepatic lesions in several marine bottomfish species and clearly indicate the utility of these lesions as biomarkers of contaminant-induced effects in wild fish. Images Figure 2. A Figure 2. B Figure 3. Figure 4. A Figure 4. B PMID:8033852

  15. Squamous cell carcinoma of unknown primary site presenting with an abdominal wall lesion as the primary symptom: A case report and review of the literature

    PubMed Central

    ZHANG, YINGLI; CHEN, BO; ZHU, JIANQING; CHEN, LU

    2015-01-01

    Squamous cell carcinoma of unknown primary site (SC CUP) is a rare malignant tumor, and its histogenesis and appropriate treatment are unclear. To the best of our knowledge, this type of carcinoma with abdominal wall lesions as the primary presenting symptom 3 months after laparoscopic surgery, has not been previously described in the literature. In the present study, a postmenopausal 54-year-old female patient was diagnosed with pain from the right abdominal puncture site 3 months after laparoscopic unilateral left salpingo-oophorectomy at a local hospital, at which time the left ovary and Fallopian tube were free of malignant tumor. Computed tomography (CT) imaging showed a subcutaneous nodule with a size of 6.2×3.3 cm. A wide excision of the lesion with safety margins and repair of the abdominal wall was performed, and the histopathological results and various investigations lead to the diagnosis of metastatic well-differentiated SC CUP. The patient underwent three surgeries and eight cycles of Taxol and cisplatin/carboplatin chemotherapy, and received a total of 10.8 Gy palliative radiation. However, the patient succumbed to intestinal bleeding, thrombocytopenia and multiple organ failure with pelvic recurrence and liver metastases at 10 months post-diagnosis. The prognosis of SC CUP, particularly with multiple metastases, is extremely poor. Although chemotherapy, surgery and radiotherapy have a certain role in the treatment, no regimen has been established as a standard therapy and palliative care could be recommended. PMID:26622812

  16. Phytosterols reduce cholesterol absorption by inhibition of 27-hydroxycholesterol generation, liver X receptor α activation, and expression of the basolateral sterol exporter ATP-binding cassette A1 in Caco-2 enterocytes.

    PubMed

    Brauner, Reinhard; Johannes, Christian; Ploessl, Florian; Bracher, Franz; Lorenz, Reinhard L

    2012-06-01

    Phytosterol-enriched foods are increasingly marketed to lower cholesterol levels and atherosclerosis in the general population. Phytosterols reduce cholesterol absorption, but the molecular mechanism is controversial. We therefore investigated the phytosterol effects on cholesterol metabolism in human enterocyte, hepatocyte, and macrophage models relevant for sterol absorption, reverse transport, and excretion. Isomolar sitosterol (50 μmol/L) was less effectively taken up by enterocytes than cholesterol but suppressed apical cholesterol uptake by 50% (P < 0.01) and basolateral secretion by two-thirds (P < 0.01) whether added in micelles or ethanol or complexed to cyclodextrin. In contrast, enterocytes handled nanomolar (3)H-sitosterol similarly to cholesterol. Enterocytes selectively oxidized all sterols to 27-hydroxy- and 27-carboxy-sterols. Conversion rates were much lower for sitosterol (0.05 ± 0.02 nmol/mg protein) and campesterol (0.48 ± 0.10) compared with cholesterol (3.73 ± 0.60) (P < 0.001). 27-Hydroxycholesterol (27OH-C) activated liver-X-receptor alpha (LXRα) (P < 0.01) and stimulated ATP-binding cassette transporter (ABC) A1 expression (P < 0.001) and basolateral systemic cholesterol secretion from enterocytes (P < 0.05). In co-incubations, phytosterols inhibited 27OH-C generation by sterol 27-hydroxylase (P < 0.001) and reduced LXRα-mediated ABCA1 expression (P < 0.01) and basolateral systemic cholesterol secretion. In contrast, ABCG8 transcription and apical sterol resecretion was unchanged by LXRα activation in human enterocytes. Exogenous LXRα agonists reverted sterol selectivity and phytosterol cholesterol interaction. Due to constitutive apical expression of ABCG5/G8 and LXRα-enhanced basolateral expression of ABCA1 in enterocytes, interference of phytosterols with the generation of the dominating LXRα-agonist 27OH-C blocks the self-priming component of cholesterol absorption. This local LXRα antagonism of dietary phytosterols

  17. Hospicells promote upregulation of the ATP-binding cassette genes by insulin-like growth factor-I via the JAK2/STAT3 signaling pathway in an ovarian cancer cell line

    PubMed Central

    BENABBOU, NADIA; MIRSHAHI, PEZHMAN; CADILLON, MÉLODIE; SORIA, JEANNETTE; THERWATH, AMU; MIRSHAHI, MASSOUD

    2013-01-01

    Interaction between tumor cells and their microenvironment has a crucial role in the development, progression and drug resistance of cancer. Our objective was to confirm the role of Hospicells, which are stromal cells from the cancer microenvironment, in drug resistance and tumor cell growth. We demonstrated that soluble factors secreted by Hospicells activate several genes and upregulate the JAK/STAT signaling pathway in ovarian cancer cell lines. Hospicells express all insulin-like growth factor (IGF) family as detected by gene array, RT-PCR, protein array and immunocytochemistry. While focusing attention on the microenvironment, we considered the role of IGF-I in proliferation and survival of ovarian cancer cells. Indeed, IGF-I is a major regulator of different stages of cancer development. We studied the effect of exogenously added IGF-I on the regulation of ATP-binding cassette (ABC) genes (MDR1, MRP1, MRP2, MRP3, MRP5 and BCRP) in the ovarian cancer cell line OVCAR3 and validated the results obtained using the IGF-IR antagonist picropodophyllin. IGF-I regulates the expression of ABC genes in OVCAR3 cells via the PI3-kinase, MEK and JAK2/STAT3 signaling pathways. The OVCAR3 cell line when co-cultured with Hospicells showed a marked degree of drug resistance. The drug resistance observed could be amplified with exogenous IGF-I. Addition of IGF-IR inhibitor, however, reduced the degree of resistance in these exposed cells. Cells that were treated with anticancer drugs and then exposed to IGF-I showed an increase in drug resistance and, thereby, an increase in cell survival. This observation indicates that drug resistance of OVCAR3 cells increases when there is synergy between OVCAR3 cells and Hospicells and it is amplified when IGF-I was exogenously added. In conclusion, inhibition of IGF-IR and targeting of the JAK2/STAT3 signaling pathway can be a target for ovarian cancer therapy. PMID:23857432

  18. Pharmacophore modeling of nilotinib as an inhibitor of ATP-binding cassette drug transporters and BCR-ABL kinase using a three-dimensional quantitative structure-activity relationship approach.

    PubMed

    Shukla, Suneet; Kouanda, Abdul; Silverton, Latoya; Talele, Tanaji T; Ambudkar, Suresh V

    2014-07-07

    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure-activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [(125)I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  19. Pharmacophore Modeling of Nilotinib as an Inhibitor of ATP-Binding Cassette Drug Transporters and BCR-ABL Kinase Using a Three-Dimensional Quantitative Structure–Activity Relationship Approach

    PubMed Central

    2015-01-01

    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure–activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [125I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  20. Co-expression of pregnane X receptor and ATP-binding cassette sub-family B member 1 in peripheral blood: A prospective indicator for drug resistance prediction in non-small cell lung cancer

    PubMed Central

    KONG, QINGNUAN; HAN, ZENGLEI; ZUO, XIAOLI; WEI, HONGJUN; HUANG, WEIQING

    2016-01-01

    The aim of the present study was to investigate the protein expression profiling of pregnane X receptor (PXR) and ATP-binding cassette sub-family B member 1 (ABCB1; also known as MDR1 or P-gp), present in the peripheral blood mononuclear cells (PBMCs) and cancerous tissues of cases of non-small cell lung cancer (NSCLC). Furthermore, the study aimed to assess the feasibility of predicting drug resistance through the medium of PBMCs. Of the subjects included in the study, 37 were histopathologically diagnosed with NSCLC and 17 were control patients without cancer. ThinPrep liquid-based smears with cytosine were applied in the examination of the PBMCs and proved quite effective in preserving the morphology and surface antigens of the lymphocytes. Measurements of expression levels in the PBMCs and cancerous tissues were obtained by immunohistochemical means. The results showed that, with the exception of the selective PXR expression in the normal lung tissues, the two types of proteins existed extensively throughout the PBMCs, normal tissues and tumors. Among the cancer patients, prior to chemotherapy, a significant rise in ABCB1 expression could be observed in the PBMCs, together with a similar rise in ABCB1 and PXR expression in the tumor specimens. Marked upregulation of the two proteins was detected in the PBMCs following 1 cycle of first-line chemotherapy. ABCB1 expression, correlated with PXR, persisted mostly in the PBMCs and tissue samples. When bound to and activated by ligands, PXR translocates from the cytoplasm to the nucleus of the cells. PXR subsequently binds to its DNA response elements as a heterodimer with the retinoid X receptor. A PXR translocation of moderate or low differentiation was identified in 3 cases of adenocarcinoma, which were co-expressing the two genes in the PBMCs prior to chemotherapy. During follow-up visits, tumor recurrence was observed within 3 months in 5 cases, which were characterized by PXR translocation. These findings

  1. Co-expression of pregnane X receptor and ATP-binding cassette sub-family B member 1 in peripheral blood: A prospective indicator for drug resistance prediction in non-small cell lung cancer.

    PubMed

    Kong, Qingnuan; Han, Zenglei; Zuo, Xiaoli; Wei, Hongjun; Huang, Weiqing

    2016-05-01

    The aim of the present study was to investigate the protein expression profiling of pregnane X receptor (PXR) and ATP-binding cassette sub-family B member 1 (ABCB1; also known as MDR1 or P-gp), present in the peripheral blood mononuclear cells (PBMCs) and cancerous tissues of cases of non-small cell lung cancer (NSCLC). Furthermore, the study aimed to assess the feasibility of predicting drug resistance through the medium of PBMCs. Of the subjects included in the study, 37 were histopathologically diagnosed with NSCLC and 17 were control patients without cancer. ThinPrep liquid-based smears with cytosine were applied in the examination of the PBMCs and proved quite effective in preserving the morphology and surface antigens of the lymphocytes. Measurements of expression levels in the PBMCs and cancerous tissues were obtained by immunohistochemical means. The results showed that, with the exception of the selective PXR expression in the normal lung tissues, the two types of proteins existed extensively throughout the PBMCs, normal tissues and tumors. Among the cancer patients, prior to chemotherapy, a significant rise in ABCB1 expression could be observed in the PBMCs, together with a similar rise in ABCB1 and PXR expression in the tumor specimens. Marked upregulation of the two proteins was detected in the PBMCs following 1 cycle of first-line chemotherapy. ABCB1 expression, correlated with PXR, persisted mostly in the PBMCs and tissue samples. When bound to and activated by ligands, PXR translocates from the cytoplasm to the nucleus of the cells. PXR subsequently binds to its DNA response elements as a heterodimer with the retinoid X receptor. A PXR translocation of moderate or low differentiation was identified in 3 cases of adenocarcinoma, which were co-expressing the two genes in the PBMCs prior to chemotherapy. During follow-up visits, tumor recurrence was observed within 3 months in 5 cases, which were characterized by PXR translocation. These findings

  2. Oxidative generation of guanine radicals by carbonate radicals and their reactions with nitrogen dioxide to form site specific 5-guanidino-4-nitroimidazole lesions in oligodeoxynucleotides.

    PubMed

    Joffe, Avrum; Mock, Steven; Yun, Byeong Hwa; Kolbanovskiy, Alexander; Geacintov, Nicholas E; Shafirovich, Vladimir

    2003-08-01

    A simple photochemical approach is described for synthesizing site specific, stable 5-guanidino-4-nitroimidazole (NIm) adducts in single- and double-stranded oligodeoxynucleotides containing single and multiple guanine residues. The DNA sequences employed, 5'-d(ACC CG(1)C G(2)TC CG(3)C G(4)CC) and 5'-d(ACC CG(1)C G(2)TC C), were a portion of exon 5 of the p53 tumor suppressor gene, including the codons 157 (G(2)) and 158 (G(3)) mutation hot spots in the former sequence with four Gs and the codon 157 (G(2)) mutation hot spot in the latter sequence with two Gs. The nitration of oligodeoxynucleotides was initiated by the selective photodissociation of persulfate anions to sulfate radicals induced by UV laser pulses (308 nm). In aqueous solutions, of bicarbonate and nitrite anions, the sulfate radicals generate carbonate anion radicals and nitrogen dioxide radicals by one electron oxidation of the respective anions. The guanine residue in the oligodeoxynucleotide is oxidized by the carbonate anion radical to form the neutral guanine radical. While the nitrogen dioxide radicals do not react with any of the intact DNA bases, they readily combine with the guanine radicals at either the C8 or the C5 positions. The C8 addition generates the well-known 8-nitroguanine (8-nitro-G) lesions, whereas the C5 attack produces unstable adducts, which rapidly decompose to NIm lesions. The maximum yields of the nitro products (NIm + 8-nitro-G) were typically in the range of 20-40%, depending on the number of guanine residues in the sequence. The ratio of the NIm to 8-nitro-G lesions gradually decreases from 3.4 in the model compound, 2',3',5'-tri-O-acetylguanosine, to 2.1-2.6 in the single-stranded oligodeoxynucleotides and to 0.8-1.1 in the duplexes. The adduct of the 5'-d(ACC CG(1)C G(2)TC C) oligodeoxynucleotide containing the NIm lesion in codon 157 (G(2)) was isolated in HPLC-pure form. The integrity of this adduct was established by a detailed analysis of exonuclease digestion

  3. Locomotor effects of imidazoline I2-site-specific ligands and monoamine oxidase inhibitors in rats with a unilateral 6-hydroxydopamine lesion of the nigrostriatal pathway

    PubMed Central

    MacInnes, Nicholas; Duty, Susan

    2004-01-01

    The present study examined the ability of the selective imidazoline I2-site ligands 2-(-2-benzofuranyl)-2-imidazoline (2-BFI) and 2-[4,5-dihydroimidaz-2-yl]-quinoline (BU224) and selected monoamine oxidase (MAO) inhibitors to evoke locomotor activity in rats bearing a lesion of the nigrostriatal pathway. Male Sprague–Dawley rats were injected with 12.5 μg 6-hydroxydopamine (6-OHDA) into the right median forebrain bundle to induce a unilateral lesion of the nigrostriatal tract. After 6 weeks, test drugs were administered either alone or in combination with L-DOPA (L-3,4-dihydroxyphenylamine) and the circling behaviour of animals was monitored as an index of anti-Parkinsonian activity. Intraperitoneal (i.p.) administration of the irreversible MAO-B inhibitor deprenyl (20 mg kg−1) or the imidazoline I2-site ligands BU224 (14 mg kg−1) and 2-BFI (7 and 14 mg kg−1) produced significant increases in ipsiversive rotations compared to vehicle controls totaling, at the highest respective doses tested, 521±120, 131±37 and 92.5±16.3 net contraversive rotations in 30 (deprenyl) or 60 (BU224 and 2-BFI) min. In contrast, the reversible MAO-A inhibitor moclobemide (2.5–10 mg kg−1) and the reversible MAO-B inhibitor lazabemide (2.5–10 mg kg−1) failed to instigate significant rotational behaviour compared to vehicle. Coadministration of lazabemide (10 mg kg−1), moclobemide (10 mg kg−1) or 2-BFI (14 mg kg−1) with L-DOPA (20 mg kg−1) significantly increased either the duration or total number of contraversive rotations emitted over the testing period in comparison to L-DOPA alone. These data suggest that I2-specific ligands have dual effects in the 6-OHDA-lesioned rat model of Parkinson's disease; a first effect associated with an increase in activity in the intact hemisphere, probably via an increase in striatal dopamine content, and a secondary action which, through the previously documented inhibition of MAO-A and/or MAO-B, increases the availability of

  4. Junctional adhesion molecule overexpression in Kaposi varicelliform eruption skin lesions - as a possible herpes virus entry site

    PubMed Central

    Abreu-Velez, Ana Maria; Klein, A. Deo; Howard, Michael S.

    2010-01-01

    Context: Herpes simplex virus (HSV) infection of the skin represents a common challenge in dermatology; however, currently the port of viral entry remains obscure. HSV is known to induce an immunoglobulin-binding cell surface receptor in infected cells that utilizes a non-immune mechanism. The replication of HSV in cultured cells is accompanied by the appearance of surface receptors with an affinity for the Fc region of immunoglobulin G. Case Report: We describe a 43 year old African American male who presented with a generalized rash, including intense pruritus and umbilicated vesiculopustules. The patient had been previously diagnosed and treated for psoriasis with methotrexate and prednisone. Hematoxylin and eosin demonstrated keratinocytes with ballooning degeneration within the epidermis. Direct immunofluorescence (DIF) results resembled the pattern of paraneoplastic pemphigus, with negative indirect immunofluorescence (IIF) results on rat bladder. Immunohistochemistry revealed deposits of the complement membrane attack complex within dermal sweat glands, as well as the presence of herpes simplex virus 1 on the skin. We report a case of Kaposi varicelliform eruption, a cutaneous eruption caused by a virus infecting patients with pre-existing dermatoses. Conclusion: HSV virus infection with over-expression of the junctional adhesion molecule close to herpetic infection sites may preferentially increase viral entry through the skin, possibly triggering a Kaposi varicelliform eruption. PMID:22558593

  5. Genetic variant of V825I in the ATP-binding cassette transporter A1 gene and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

    PubMed Central

    2011-01-01

    Background Several genetic variants in the ATP-binding cassette transporter A1 (ABCA1) gene have associated with modifications of serum high-density lipoprotein cholesterol (HDL-C) levels and the susceptibility for coronary heart disease, but the findings are still controversial in diverse racial/ethnic groups. Bai Ku Yao is an isolated subgroup of the Yao minority in southern China. The present study was undertaken to detect the possible association of V825I (rs2066715) polymorphism in the ABCA1 gene and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 677 subjects of Bai Ku Yao and 646 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Polymerase chain reaction and restriction fragment length polymorphism assay combined with gel electrophoresis were performed for the genotyping of V825I variant, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), HDL-C, apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.01 for all). The frequency of G and A alleles was 57.4% and 42.6% in Bai Ku Yao, and 57.7% and 42.3% in Han (P > 0.05); respectively. The frequency of GG, GA and AA genotypes was 33.7%, 47.4% and 18.9% in Bai Ku Yao, and 33.4%, 48.6% and 18.0% in Han (P > 0.05); respectively. There was no difference in the genotypic and allelic frequencies between males and females in the both ethnic groups. The subjects with AA genotype in Bai Ku Yao had higher serum TC levels than the subjects with GG and GA genotypes (P < 0.05). The participants with AA genotype in Han had lower serum HDL-C and ApoAI levels than the participants with GG and GA genotypes (P < 0.05 for each), but these results were found in males but not in females. Multivariate linear regression analysis showed that the levels of TC in Bai Ku Yao and HDL-C and ApoAI in male Han were correlated with genotypes (P < 0

  6. Establishment of an on-site diagnostic procedure for detection of orf virus from oral lesions of Japanese serows (Capricornis crispus) by loop-mediated isothermal amplification

    PubMed Central

    INOSHIMA, Yasuo; TAKASU, Masaki; ISHIGURO, Naotaka

    2016-01-01

    Orf virus infection has been prevalent continuously in the population of wild Japanese serows (Capricornis crispus), goat-like grazing cloven-hoofed mammal species that live mainly in mountainous areas of Japan. Currently, definitive diagnosis of infection requires time-consuming laboratory work. To diagnose rapidly on-site, we developed a field-friendly procedure for the detection of orf virus from oral cavity lesions. DNA was extracted from goat saliva spiked with orf virus as a proxy for Japanese serows by a commercial kit without the use of electricity, and the quality of the extracted DNA was evaluated by conventional polymerase chain reaction (PCR). Extracted DNA was amenable to DNA amplification, the same as when extracted in a laboratory. Next, to find optimal conditions for DNA amplification by loop-mediated isothermal amplification (LAMP), Bst and Csa DNA polymerases and 3 colorimetric indicators for visual diagnosis, hydroxy naphthol blue (HNB), malachite green and D-QUICK, were compared using a portable cordless incubator. The combination of Bst or Csa DNA polymerase with HNB was found to be easiest for visual diagnosis by the naked eye, and viral DNA was successfully amplified from all orf virus strains used. These results suggest that the procedure established here can work completely on-site and can be useful for definitive diagnosis and differentiation of orf virus infection in Japanese serows in remote mountainous areas. PMID:27628591

  7. Chemical repair activity of free radical scavenger edaravone: reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA.

    PubMed

    Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Lin, Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu, Haiying; Katsumura, Yosuke

    2015-01-01

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10(8) dm(3) mol(-1) s(-1) and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10-1000 μmol dm(-3)) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid.

  8. Reduced repair capacity of a DNA clustered damage site comprised of 8-oxo-7,8-dihydro-2'-deoxyguanosine and 2-deoxyribonolactone results in an increased mutagenic potential of these lesions

    DOE PAGES

    Cunniffe, Siobhan; O’Neill, Peter; Greenberg, Marc M.; ...

    2014-04-01

    A signature of ionizing radiation is the induction of DNA clustered damaged sites. Non-double strand break (DSB) clustered damage has been shown to compromise the base excision repair pathway, extending the lifetimes of the lesions within the cluster, compared to isolated lesions. This increases the likelihood the lesions persist to replication and thus increasing the mutagenic potential of the lesions within the cluster. Lesions formed by ionizing radiation include 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) and 2-deoxyribonolactone (dL). dL poses an additional challenge to the cell as it is not repaired by the short-patch base excision repair pathway. Here we show recalcitrant dL repairmore » is reflected in mutations observed when DNA containing it and a proximal 8-oxodGuo is replicated in Escherichia coli. 8-oxodGuo in close proximity to dL on the opposing DNA strand results in an enhanced frequency of mutation of the lesions within the cluster and a 20 base sequence flanking the clustered damage site in an E. coli based plasmid assay. In vitro repair of a dL lesion is reduced when compared to the repair of an abasic (AP) site and a tetrahydrofuran (THF), and this is due mainly to a reduction in the activity of polymerase β, leading to retarded FEN1 and ligase 1 activities. This study has given insights in to the biological effects of clusters containing dL.« less

  9. Crystal structure of human phosphoribosylpyrophosphate synthetase 1 reveals a novel allosteric site.

    PubMed

    Li, Sheng; Lu, Yongcheng; Peng, Baozhen; Ding, Jianping

    2007-01-01

    PRPP (phosphoribosylpyrophosphate) is an important metabolite essential for nucleotide synthesis and PRS (PRPP synthetase) catalyses synthesis of PRPP from R5P (ribose 5-phosphate) and ATP. The enzymatic activity of PRS is regulated by phosphate ions, divalent metal cations and ADP. In the present study we report the crystal structures of recombinant human PRS1 in complexes with SO4(2-) ions alone and with ATP, Cd2+ and SO4(2-) ions respectively. The AMP moiety of ATP binds at the ATP-binding site, and a Cd2+ ion binds at the active site and in a position to interact with the beta- and gamma-phosphates of ATP. A SO4(2-) ion, an analogue of the activator phosphate, was found to bind at both the R5P-binding site and the allosteric site defined previously. In addi-tion, an extra SO4(2-) binds at a site at the dimer interface between the ATP-binding site and the allosteric site. Binding of this SO4(2-) stabilizes the conformation of the flexible loop at the active site, leading to the formation of the active, open conformation which is essential for binding of ATP and initiation of the catalytic reaction. This is the first time that structural stabilization at the active site caused by binding of an activator has been observed. Structural and biochemical data show that mutations of some residues at this site influence the binding of SO4(2-) and affect the enzymatic activity. The results in the present paper suggest that this new SO4(2-)-binding site is a second allosteric site to regulate the enzymatic activity which might also exist in other eukaryotic PRSs (except plant PRSs of class II), but not in bacterial PRSs.

  10. Efficient cleavage of single and clustered AP site lesions within mono-nucleosome templates by CHO-K1 nuclear extract contrasts with retardation of incision by purified APE1.

    PubMed

    Eccles, Laura J; Menoni, Hervé; Angelov, Dimitar; Lomax, Martine E; O'Neill, Peter

    2015-11-01

    Clustered DNA damage is a unique characteristic of radiation-induced DNA damage and the formation of these sites poses a serious challenge to the cell's repair machinery. Within a cell DNA is compacted, with nucleosomes being the first order of higher level structure. However, few data are reported on the efficiency of clustered-lesion processing within nucleosomal DNA templates. Here, we show retardation of cleavage of a single AP site by purified APE1 when contained in nucleosomal DNA, compared to cleavage of an AP site in non-nucleosomal DNA. This retardation seen in nucleosomal DNA was alleviated by incubation with CHO-K1 nuclear extract. When clustered DNA damage sites containing bistranded AP sites were present in nucleosomal DNA, efficient cleavage of the AP sites was observed after treatment with nuclear extract. The resultant DSB formation led to DNA dissociating from the histone core and nucleosomal dispersion. Clustered damaged sites containing bistranded AP site/8-oxoG residues showed no retardation of cleavage of the AP site but retardation of 8-oxoG excision, compared to isolated lesions, thus DSB formation was not seen. An increased understanding of processing of clustered DNA damage in a nucleosomal environment may lead to new strategies to enhance the cytotoxic effects of radiotherapeutics.

  11. Brain Lesions

    MedlinePlus

    ... MRI scans, brain lesions appear as dark or light spots that don't look like normal brain tissue. Usually, a brain lesion is an incidental finding unrelated to the condition or symptom that led to the imaging test in the first place. ...

  12. Identification of the C4'-oxidized abasic site as the most abundant 2-deoxyribose lesion in radiation-damaged DNA using a novel HPLC-based approach.

    PubMed

    Roginskaya, Marina; Mohseni, Reza; Moore, Terence J; Bernhard, William A; Razskazovskiy, Yuriy

    2014-02-01

    A novel analytical high-performance liquid chromatography (HPLC)-based method of quantification of the yields of C4'-oxidized abasic sites, 1, in oxidatively damaged DNA has been elaborated. This new approach is based on efficient conversion of 1 into N-substituted 5-methylene-Δ(3)-pyrrolin-2-ones, 2, upon treatment of damaged DNA with primary amines in neutral or slightly acidic solutions with subsequent quantification of 2 by HPLC. The absolute and relative radiation-chemical yields of 1 in irradiated DNA solutions were re-evaluated using this method. The yields were compared with those of other 2-deoxyribose degradation products including 5-methylene-2(5H)-furanone, malondialdehyde, and furfural resulting from the C1', C4' and C5'-oxidations, respectively. The yield of free base release (FBR) determined in the same systems was employed as an internal measure of the total oxidative damage to the 2-deoxyribose moiety. Application of this technique identifies 1 as the most abundant sugar lesion in double-stranded (ds) DNA irradiated under air in solution (36% FBR). In single-stranded (ss) DNA this product is second by abundance (33% FBR) after 2-deoxyribonolactones (C1'-oxidation; 43% FBR). The production of nucleoside-5'-aldehydes (C5'-oxidation; 14% and 5% FBR in dsDNA and ssDNA, respectively) is in the third place. Taken together with the parallel reaction channel that converts C4'-radicals into malondialdehyde and 3'-phosphoglycolates, our results identify the C4'-oxidation as a prevalent pathway of oxidative damage to the sugar-phosphate backbone (50% or more of all 2-deoxyribose damages) in indirectly damaged DNA.

  13. Pink lesions.

    PubMed

    Giacomel, Jason; Zalaudek, Iris

    2013-10-01

    Dermoscopy (dermatoscopy or surface microscopy) is an ancillary dermatologic tool that in experienced hands can improve the accuracy of diagnosis of a variety of benign and malignant pigmented skin tumors. The early and more accurate diagnosis of nonpigmented, or pink, tumors can also be assisted by dermoscopy. This review focuses on the dermoscopic diagnosis of pink lesions, with emphasis on blood vessel morphology and pattern. A 3-step algorithm is presented, which facilitates the timely and more accurate diagnosis of pink tumors and subsequently guides the management for such lesions.

  14. DNA damage, severe organ lesions and high muscle levels of As and Hg in two benthic fish species from a chemical warfare agent dumping site in the Mediterranean Sea.

    PubMed

    Della Torre, Camilla; Petochi, Tommaso; Corsi, Ilaria; Dinardo, Maria Maddalena; Baroni, Davide; Alcaro, Luigi; Focardi, Silvano; Tursi, Angelo; Marino, Giovanna; Frigeri, Antonio; Amato, Ezio

    2010-04-01

    The aim of the present study was to evaluate the environmental threat to benthic species from chemical weapons dumped in the southern Adriatic Sea. An ecotoxicological approach using chemical analysis and biological responses was applied, in two sentinel species: the Blackbelly rosefish Helicolenus dactylopterus and European conger Conger conger. Specimen were collected in a stretch of sea, where had been dumped war materials and from a reference site free of ordnance. Residues of yperite, Hg and As were measured in fish fillets. Skin, liver, kidney and spleen were examined for histopathological and macroscopical lesions. Liver detoxifying capacities (EROD and UDPGT) and genotoxicity (comet assay) were also investigated. As and Hg levels were three-four times higher than those from the reference site in both species (p<0.001). Both species captured in dumping site showed clear signs of chronic illness according to the health assessment index (HAI). Deep ulcers and nodules were observed on skin and external organs. Histological lesions such as periportal and bile duct fibrosis, pericholangitis, steatosis, granuloma and elevated splenic MMCs were detected in liver and spleen. Significantly higher EROD activities were also found in both species from dumping site (p<0.01). Comet assay revealed genotoxicty in gills of C. conger from dumping site, indicating uptake of chemical warfare agents through fish gills. European conger was found to be a more sensitive bioindicator of this type of contamination than the Blackbelly rosefish.

  15. 21 CFR 882.4725 - Radiofrequency lesion probe.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .... (a) Identification. A radiofrequency lesion probe is a device connected to a radiofrequency (RF) lesion generator to deliver the RF energy to the site within the nervous system where a lesion is...

  16. 21 CFR 882.4725 - Radiofrequency lesion probe.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    .... (a) Identification. A radiofrequency lesion probe is a device connected to a radiofrequency (RF) lesion generator to deliver the RF energy to the site within the nervous system where a lesion is...

  17. 21 CFR 882.4725 - Radiofrequency lesion probe.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    .... (a) Identification. A radiofrequency lesion probe is a device connected to a radiofrequency (RF) lesion generator to deliver the RF energy to the site within the nervous system where a lesion is...

  18. 21 CFR 882.4725 - Radiofrequency lesion probe.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    .... (a) Identification. A radiofrequency lesion probe is a device connected to a radiofrequency (RF) lesion generator to deliver the RF energy to the site within the nervous system where a lesion is...

  19. 21 CFR 882.4725 - Radiofrequency lesion probe.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    .... (a) Identification. A radiofrequency lesion probe is a device connected to a radiofrequency (RF) lesion generator to deliver the RF energy to the site within the nervous system where a lesion is...

  20. Asymptomatic rectal mucosal lesions and hepatitis B surface antigen at sites of sexual contact in homosexual men with persistent hepatitis B virus infection.

    PubMed

    Reiner, N E; Judson, F N; Bond, W W; Francis, D P; Petersen, N J

    1982-02-01

    To ascertain why active and passive oral-anal and genital anal intercourse correlate strongly with hepatitis B virus (HBV) infection in homosexual men, we studied 22 men with HBV infection for the presence of hepatitis B surface antigen (HBsAg) in gingival and anorectal mucosa, feces, and semen. Thirteen of 22 (59%) patients had asymptomatic rectal mucosal lesions consisting of punctate bleeding points. Seventy-seven percent of swabbed specimens from lesions, 62% from feces, 59% from rectal mucosa, and 50% from anal canal mucosa contained HBsAg. Sera diluted serially and tested for HBsAg by radioimmunoassay showed that men with serum titers of 105 or greater were more likely to have HBsAg in specimens from lesions (p = 0.034), feces (p = 0.032), and normal mucosa (p = 0.001) than men with titers under 10 5. Asymptomatic rectal bleeding is frequent in homosexual men with persistent HBV infection. Rectal mucosa, feces, and anal canal mucosa become contaminated with HBsAg, creating a setting for de facto parenteral transmission when there is contact with oral or urethral mucosa.

  1. Conventional systemic treatments associated with therapeutic sites of local lesions of secondary syphilis in the oral cavity in patients with AIDS.

    PubMed

    Giovani, Elcio Magdalena; de Paula Neto, Edson Rodrigues; Vieira, Bruno Caputo; de Andrade, Daniela Miranda Richarte

    2012-01-01

    Patients with HIV infection may develop common diseases with atypical clinical features. HIV infection can change the classic clinical course of syphilis and increase the incidence of malignant syphilis. Malignant syphilis is a rare subtype of secondary syphilis that presents special clinical and histological features and has been associated with several processes characterized by variable degrees of immunosuppression. It is necessary to consider the possibility of this entity in the differential diagnoses in HIV-infected patients with cutaneous lesions. The dental surgeon (or oral surgeon) is vital to the medical team for promoting the health and improving the quality of life of syphilis patients. A patient with HIV infection was referred to us for complaints of a white patch on the tongue, stinging and burning sensation on the tongue, loss of taste, and dryness of the mouth. On clinical examination, the patient was found to have a tabetic gait (the Prussian soldier gait) associated with Charcot arthropathy. We also identified bilateral lesions with ulceration and exposure of the tissue that were tender, characterized by discrete necrosis. The treatment that was initiated at that time involved cleaning the area with gauze to remove all the white patches, followed by rinsing with bicarbonate in water (one teaspoon of baking soda dissolved in half a glass of water) four times a day. Additionally, fluconazole (100 mg/day for 7 days) was prescribed. We diagnosed secondary malignant syphilis of approximately 5 days duration. As an adjunctive therapy, we performed low-intensity laser treatment using a GaAsAl (gallium-aluminum arsenide) laser at 790 nm. With this treatment there was progressive resolution of the lesions.

  2. Infection with CagA-Positive Helicobacter Pylori Strain Containing Three EPIYA C Phosphorylation Sites is Associated with More Severe Gastric Lesions in Experimentally Infected Mongolian Gerbils (Meriones Unguiculatus)

    PubMed Central

    Junior, M. Ferreira; Batista, S.A.; Vidigal, P.V.T; Cordeiro, A.A.C.; Oliveira, F.M.S.; Prata, L.O.; Diniz, A.E.T.; Barral, C.M.; Barbuto, R.C.; Comes, A.D.; Araujo, I.D.; Queiroz, D.M.M.; Caliari, M.V.

    2015-01-01

    Infection with Helicobacter pylori strains containing high number of EPIYA-C phosphorylation sites in the CagA is associated with significant gastritis and increased risk of developing pre-malignant gastric lesions and gastric carcinoma. However, these findings have not been reproduced in animal models yet. Therefore, we investigated the effect on the gastric mucosa of Mongolian gerbil (Meriones unguiculatus) infected with CagA-positive H. pylori strains exhibiting one or three EPIYA-C phosphorilation sites. Mongolian gerbils were inoculated with H. pylori clonal isolates containing one or three EPIYA-C phosphorylation sites. Control group was composed by uninfected animals challenged with Brucella broth alone. Gastric fragments were evaluated by the modified Sydney System and digital morphometry. Clonal relatedness between the isolates was considered by the identical RAPD-PCR profiles and sequencing of five housekeeping genes, vacA i/d region and of oipA. The other virulence markers were present in both isolates (vacA s1i1d1m1, iceA2, and intact dupA). CagA of both isolates was translocated and phosphorylated in AGS cells. After 45 days of infection, there was a significant increase in the number of inflammatory cells and in the area of the lamina propria in the infected animals, notably in those infected by the CagA-positive strain with three EPIYA-C phosphorylation sites. After six months of infection, a high number of EPIYA-C phosphorylation sites was associated with progressive increase in the intensity of gastritis and in the area of the lamina propria. Atrophy, intestinal metaplasia, and dysplasia were also observed more frequently in animals infected with the CagA-positive isolate with three EPIYA-C sites. We conclude that infection with H. pylori strain carrying a high number of CagA EPIYA-C phosphorylation sites is associated with more severe gastric lesions in an animal model of H. pylori infection. PMID:26150158

  3. Sustained production of beta-glucuronidase from localized sites after AAV vector gene transfer results in widespread distribution of enzyme and reversal of lysosomal storage lesions in a large volume of brain in mucopolysaccharidosis VII mice.

    PubMed

    Skorupa, A F; Fisher, K J; Wilson, J M; Parente, M K; Wolfe, J H

    1999-11-01

    The lysosomal storage disorders are a large group of inherited diseases that involve central nervous system degeneration. The disease in the brain has generally been refractory to treatment, which will require long-term correction of lesions dispersed throughout the central nervous system to be effective. A promising approach is somatic gene therapy but the methods have so far been inadequate because they have only achieved short-term or localized improvements. A potential approach to overcome these limitations is to obtain sustained high level expression and secretion of the missing normal enzyme from a small group of cells for export to neighboring diseased cells, which might allow the therapeutic protein to reach distal sites. We tested this in a mouse model of mucopolysaccharidosis VII (Sly disease) using an adeno-associated virus vector. After a single treatment the vector continuously produced the normal enzyme from infected cells at the injection sites. The secreted enzyme was disseminated along most of the neuraxis, resulting in widespread reversal of the hallmark pathology. An extensive sphere of correction surrounding the transduction sites was created, suggesting that a limited number of appropriately spaced sites of gene transfer may provide overlapping spheres of enzyme diffusion to cover a large volume of brain tissue.

  4. Detection of T lymphocytes with a second-site mutation in skin lesions of atypical X-linked severe combined immunodeficiency mimicking Omenn syndrome.

    PubMed

    Wada, Taizo; Yasui, Masahiro; Toma, Tomoko; Nakayama, Yuko; Nishida, Mika; Shimizu, Masaki; Okajima, Michiko; Kasahara, Yoshihito; Koizumi, Shoichi; Inoue, Masami; Kawa, Keisei; Yachie, Akihiro

    2008-09-01

    X-linked severe combined immunodeficiency (XSCID) is caused by mutations of the common gamma chain (gammac) and usually characterized by the absence of T and natural killer (NK) cells. Here, we report an atypical case of XSCID presenting with autologous T and NK cells and Omenn syndrome-like manifestations. The patient carried a splice-site mutation (IVS1+5G>A) that caused most of the mRNA to be incorrectly spliced but produced normally spliced transcript in lesser amount, leading to residual gammac expression and development of T and NK cells. The skin biopsy specimen showed massive infiltration of revertant T cells. Those T cells were found to have a second-site mutation and result in complete restoration of correct splicing. These findings suggest that the clinical spectrum of XSCID is quite broad and includes atypical cases mimicking Omenn syndrome, and highlight the importance of revertant mosaicism as a possible cause for variable phenotypic expression.

  5. MicroRNA-320a and microRNA-4496 attenuate Helicobacter pylori cytotoxin-associated gene A (CagA)-induced cancer-initiating potential and chemoresistance by targeting β-catenin and ATP-binding cassette, subfamily G, member 2.

    PubMed

    Kang, Dong Woo; Yang, Eun Sun; Noh, Yu Na; Hwang, Won Chan; Jo, Se-Young; Suh, Young-Ah; Park, Won Sang; Choi, Kang-Yell; Min, Do Sik

    2017-04-01

    Infection with Helicobacter pylori is closely linked to an increased risk of gastric cancer. Although cytotoxin-associated gene A (CagA), a major virulence factor of H. pylori, is known to be a causal factor for gastric carcinogenesis, the molecular link between CagA and gastric cancer-initiating cell (CIC)-like properties remains elusive. Here, we demonstrate that CagA is required for increased expression of β-catenin and its target CIC markers via downregulation of microRNA (miR)-320a and miR-4496. CagA promoted gastric CIC properties and was responsible for chemoresistance. miR-320a and miR-4496 attenuated the in vitro self-renewal and tumour-initiating capacity of CagA-expressing CICs by targeting β-catenin. Moreover, miR-320a and miR-4496 decreased CagA-induced chemoresistance by targeting ATP-binding cassette, subfamily G, member 2 (ABCG2) at the transcriptional and post-transcriptional levels, respectively. Combination therapy with 5-fluorouracil and miR-320a/miR-4496 suppressed gastric tumourigenesis and metastatic potential in an orthotopic mouse model, probably via suppression of CagA-induced CIC properties and chemoresistance. Our results provide novel evidence that CIC properties, chemoresistance and tumourigenesis associated with H. pylori are linked to CagA-induced upregulation of β-catenin and ABCG2. These data provide novel insights into the molecular mechanisms of CagA-induced carcinogenisis and the therapeutic potential of of miR-320a and miR-4496. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  6. Microorganisms in closed periapical lesions.

    PubMed

    Abou-Rass, M; Bogen, G

    1998-01-01

    The purpose of this study was to investigate the microorganisms of strictly selected closed periapical lesions associated with both refractory endodontic therapy and pulpal calcification. Definitive criteria were established that assured complete clinical isolation of the periapical lesion from the oral and periodontal environment. A total of 13 criteria-referenced lesions were selected from 70 patients with endodontic surgical indications. A well controlled culturing method was used in all cases and samples were taken by one clinician at three separate sites during each surgery. Samples taken at the surgical window and within the body of the lesion served as controls, whilst a third sample was taken at the apex. In all 13 cases, samples taken from the apex yielded microorganisms comprising 63.6% obligate anaerobes and 36.4% facultative anaerobes. Prevalence of the isolated species was 31.8% for Actinomyces sp., 22.7% Propionibacterium sp., 18.2% Streptococcus sp., 13.6% Staphlyococcus sp., 4.6% Porphyromonas gingivalis, 4.6% Peptostreptococcus micros and 4.6% Gram-negative enterics. The results of this investigation indicate that closed periapical lesions associated with calcified teeth or those resistant to root canal treatment harbour bacteria. The inability to eradicate all root canal microorganisms during root canal treatment, along with anatomical factors, may allow further bacterial colonization of the root apex and surrounding periapical tissues, and consequently prevent healing.

  7. Example based lesion segmentation

    NASA Astrophysics Data System (ADS)

    Roy, Snehashis; He, Qing; Carass, Aaron; Jog, Amod; Cuzzocreo, Jennifer L.; Reich, Daniel S.; Prince, Jerry; Pham, Dzung

    2014-03-01

    Automatic and accurate detection of white matter lesions is a significant step toward understanding the progression of many diseases, like Alzheimer's disease or multiple sclerosis. Multi-modal MR images are often used to segment T2 white matter lesions that can represent regions of demyelination or ischemia. Some automated lesion segmentation methods describe the lesion intensities using generative models, and then classify the lesions with some combination of heuristics and cost minimization. In contrast, we propose a patch-based method, in which lesions are found using examples from an atlas containing multi-modal MR images and corresponding manual delineations of lesions. Patches from subject MR images are matched to patches from the atlas and lesion memberships are found based on patch similarity weights. We experiment on 43 subjects with MS, whose scans show various levels of lesion-load. We demonstrate significant improvement in Dice coefficient and total lesion volume compared to a state of the art model-based lesion segmentation method, indicating more accurate delineation of lesions.

  8. CXCL8((3-73))K11R/G31P antagonizes the neutrophil chemoattractants present in pasteurellosis and mastitis lesions and abrogates neutrophil influx into intradermal endotoxin challenge sites in vivo.

    PubMed

    Li, Fang; Zhang, Xiaobei; Mizzi, Chris; Gordon, John R

    2002-11-01

    The ELR(+) CXC chemokines are critical for protective neutrophil responses to most bacterial infections, but nevertheless can contribute importantly to the pathogenic effects of many inflammatory responses. We recently engineered a series of high affinity CXCL8/IL-8 antagonists, one of which, CXCL8((3-73))K11R/G31P, binds very strongly to neutrophils via the CXCR1 and CXCR2. Herein we show in competitive 125I-ligand binding assays that bovine CXCL8((3-73))K11R/G31P has an affinity for neutrophils that is 2-3 orders of magnitude higher than that of CXCL8/IL-8. Furthermore, when used at approximately 0.5 nM, CXCL8((3-73))K11R/G31P inhibited by 50% the chemotactic responses of neutrophils to 129 nM CXCL8/IL-8, but it also blocked chemotactic responses to the alternate ELR-CXC chemokines CXCL1/GRO alpha and CXCL5/ENA-78. Furthermore, CXCL8((3-73))K11R/G31P could inhibit by 93-97% the spectrum of neutrophil chemotactic activities present within wash fluids from clinical bacterial pneumonia or experimental endotoxin-induced mastitis lesions. Finally, intramuscular or subcutaneous application of CXCL8((3-73))K11R/G31P (75 micro g/kg) reduced by up to 97% neutrophil infiltration into intradermal endotoxin challenge sites in cattle, and prevented their circulating neutrophils from responding to CXCL8/IL-8 or ENA-78 in vitro. This data thus encourages further investigation of the potential impact of this novel antagonist on ELR-CXC chemokine-driven inflammatory disorders.

  9. Trinitrophenyl-ATP blocks colonic Cl- channels in planar phospholipid bilayers. Evidence for two nucleotide binding sites

    PubMed Central

    1993-01-01

    Outwardly rectifying 30-50-pS Cl- channels mediate cell volume regulation and transepithelial transport. Several recent reports indicate that rectifying Cl- channels are blocked after addition of ATP to the extracellular bath (Alton, E. W. F. W., S. D. Manning, P. J. Schlatter, D. M. Geddes, and A. J. Williams. 1991. Journal of Physiology. 443:137-159; Paulmichl, M., Y. Li, K. Wickman, M. Ackerman, E. Peralta, and D. Clapham. 1992. Nature. 356:238-241). Therefore, we decided to conduct a more detailed study of the ATP binding site using a higher affinity probe. We tested the ATP derivative, 2',3',O-(2,4,6- trinitrocyclohexadienylidene) adenosine 5'-triphosphate (TNP-ATP), which has a high affinity for certain nucleotide binding sites. Here we report that TNP-ATP blocked colonic Cl- channels when added to either bath and that blockade was consistent with the closed-open-blocked kinetic model. The TNP-ATP concentration required for a 50% decrease in open probability was 0.27 microM from the extracellular (cis) side and 20 microM from the cytoplasmic (trans) side. Comparison of the off rate constants revealed that TNP-ATP remained bound 28 times longer when added to the extracellular side compared with the cytoplasmic side. We performed competition studies to determine if TNP-ATP binds to the same sites as ATP. Addition of ATP to the same bath containing TNP-ATP reduced channel amplitude and increased the time the channel spent in the open and fast-blocked states (i.e., burst duration). This is the result expected if TNP-ATP and ATP compete for block, presumably by binding to common sites. In contrast, addition of ATP to the bath opposite to the side containing TNP-ATP reduced amplitude but did not alter burst duration. This is the result expected if opposite-sided TNP- ATP and ATP bind to different sites. In summary, we have identified an ATP derivative that has a nearly 10-fold higher affinity for reconstituted rectifying colonic Cl- channels than any previously

  10. Aetiology of abfraction lesions.

    PubMed

    Lyons, K

    2001-09-01

    The aetiology of abfraction lesions is complex. Most evidence indicates that physical loading forces are a major contributing factor, although they are unlikely to be entirely responsible. Intraoral chemical influences and toothbrush abrasion, combined with the dynamics of inter-occlusal activity such as chewing, swallowing, and parafunction, lead to stress corrosion and may contribute to abfraction lesions. The multifactorial aetiology that operates in the initiation and progression of these lesions has made investigation difficult. Various theories have been proposed and numerous surveys and studies conducted, but the primary causal factor has yet to be definitively determined. This review concludes that occlusal loading is the initiating factor in the development of abfraction lesions.

  11. Imaging Pediatric Vascular Lesions

    PubMed Central

    Nguyen, Tuyet A.; Krakowski, Andrew C.; Naheedy, John H.; Kruk, Peter G.

    2015-01-01

    Vascular anomalies are commonly encountered in pediatric and dermatology practices. Most of these lesions are benign and easy to diagnose based on history and clinical exam alone. However, in some cases the diagnosis may not be clear. This may be of particular concern given that vascular anomalies may occasionally be associated with an underlying syndrome, congenital disease, or serious, life-threatening condition. Defining the type of vascular lesion early and correctly is particularly important to determine the optimal approach to management and treatment of each patient. The care of pediatric patients often requires collaboration from a multitude of specialties including pediatrics, dermatology, plastic surgery, radiology, ophthalmology, and neurology. Although early characterization of vascular lesions is important, consensus guidelines regarding the evaluation and imaging of vascular anomalies does not exist to date. Here, the authors provide an overview of pediatric vascular lesions, current classification systems for characterizing these lesions, the various imaging modalities available, and recommendations for appropriate imaging evaluation. PMID:26705446

  12. Association of Malassezia species with psoriatic lesions.

    PubMed

    Rudramurthy, Shivaprakash M; Honnavar, Prasanna; Chakrabarti, Arunaloke; Dogra, Sunil; Singh, Pankaj; Handa, Sanjeev

    2014-08-01

    The aetiology of psoriasis remains elusive. Among multiple factors hypothesised, association of Malassezia spp. is supported by response to topical antifungals. The objective of this study was to evaluate the association of Malassezia spp. with psoriatic lesion. The subjects included 50 consecutive patients with psoriasis, and 50 age- and sex-matched healthy controls. Samples were collected using scotch tape over one square inch area from the lesional and non-lesional sites. The isolated Malassezia spp. were identified by phenotypic methods and confirmed by ITS2 PCR-RFLP and sequencing of D1/D2 region of 26S rDNA. Psoriatic lesions were seen commonly on scalp (28%, 14), chest (22%, 11) and arms (16%, 8). Majority of cases presented with chronic plaque form (76%, 38; P < 0.05). From psoriatic lesions, most frequently isolated Malassezia species was M. furfur (70.6%, 24), followed by M. japonica (11.8%, 4) and M. globosa (8.8%, 3). From healthy individuals M. furfur, M. sympodialis, mixture of M. furfur and M. globosa was isolated in 73.3%, 10% and 16.7% (22, 3 and 5) of cases respectively. The average number of colonies isolated from scalp lesions of the patients was significantly higher (P = 0.03) than healthy areas. Although no strong association of Malassezia species was formed with psoriatic lesion in general, the fungi may play a role in exacerbation of scalp psoriasis.

  13. Multifocal vascular lesions.

    PubMed

    Levin, Laura E; Lauren, Christine T

    2016-09-01

    Multifocal vascular lesions are important to recognize and appropriately diagnose. Generally first noticed on the skin, multifocal vascular lesions may have systemic involvement. Distinguishing among the different types of multifocal vascular lesions is often based on clinical features; however, radiological imaging and/or biopsy are frequently needed to identify distinct features and guide treatment. Knowledge of the systemic associations that can occur with different vascular anomalies may reduce life-threatening complications, such as coagulopathy, bleeding, cardiac compromise, and neurologic sequelae. This review provides a synopsis of the epidemiology, pathogenesis, presentation, workup, and treatment of several well-recognized multifocal vascular tumors and malformations.

  14. Oral Lesions in Neonates

    PubMed Central

    Rao, Roopa S; Majumdar, Barnali; Jafer, Mohammed; Maralingannavar, Mahesh; Sukumaran, Anil

    2016-01-01

    ABSTRACT Oral lesions in neonates represent a wide range of diseases often creating apprehension and anxiety among parents. Early examination and prompt diagnosis can aid in prudent management and serve as baseline against the future course of the disease. The present review aims to enlist and describe the diagnostic features of commonly encountered oral lesions in neonates. How to cite this article: Patil S, Rao RS, Majumdar B, Jafer M, Maralingannavar M, Sukumaran A. Oral Lesions in Neonates. Int J Clin Pediatr Dent 2016;9(2):131-138. PMID:27365934

  15. Incidental vertebral lesions.

    PubMed

    Coumans, Jean-Valery C E; Walcott, Brian P

    2011-12-01

    Incidental vertebral lesions on imaging of the spine are commonly encountered in clinical practice. Contributing factors include the aging population, the increasing prevalence of back pain, and increased usage of MR imaging. Additionally, refinements in CT and MR imaging have increased the number of demonstrable lesions. The management of incidental findings varies among practitioners and commonly depends more on practice style than on data or guidelines. In this article we review incidental findings within the vertebral column and review management of these lesions, based on available Class III data.

  16. Uterine Vascular Lesions

    PubMed Central

    Vijayakumar, Abhishek; Srinivas, Amruthashree; Chandrashekar, Babitha Moogali; Vijayakumar, Avinash

    2013-01-01

    Vascular lesions of the uterus are rare; most reported in the literature are arteriovenous malformations (AVMs). Uterine AVMs can be congenital or acquired. In recent years, there has been an increasing number of reports of acquired vascular lesions of the uterus following pregnancy, abortion, cesarean delivery, and curettage. It can be seen from these reports that there is confusion concerning the terminology of uterine vascular lesions. There is also a lack of diagnostic criteria and management guidelines, which has led to an increased number of unnecessary invasive procedures (eg, angiography, uterine artery embolization, hysterectomy for abnormal vaginal bleeding). This article familiarizes readers with various vascular lesions of the uterus and their management. PMID:24340126

  17. Skin lesion removal

    MedlinePlus

    ... removal; Basal cell cancer - removal; Actinic keratosis - removal; Wart - removal; Squamous cell - removal; Mole - removal; Nevus - removal; ... can remove: Benign or pre-malignant skin lesions Warts Moles Sunspots Hair Small blood vessels in the ...

  18. Bilateral lacrimal caruncle lesions

    PubMed Central

    Okumura, Yuta; Takai, Yoshiko; Yasuda, Shunsuke; Terasaki, Hiroko

    2017-01-01

    ABSTRACT A 65-year-old man was referred to our hospital for the treatment of a lesion on the medial lacrimal canthus of both eyes. He had a history of perinuclear anti-neutrophil cytoplasmic antibodies, i.e., pANCA-positive interstitial pneumonia. Orbital magnetic resonance imaging excluded space occupying lesions, and laboratory testing excluded thyroid-related diseases. The masses were excised, and histopathological examinations showed sebaceous gland hyperplasia and inflammatory changes around the gland. In addition, the specimen from the left eye showed a retention cyst possibly caused by an infection. It was also possible that the use of steroid was involved in the development of the lesions. A relationship between the ANCA and the lesions was not completely eliminated. PMID:28303065

  19. Potentially malignant oral lesions: clinicopathological correlations

    PubMed Central

    Maia, Haline Cunha de Medeiros; Pinto, Najara Alcântara Sampaio; Pereira, Joabe dos Santos; de Medeiros, Ana Miryam Costa; da Silveira, Éricka Janine Dantas; Miguel, Márcia Cristina da Costa

    2016-01-01

    ABSTRACT Objective To determine the incidence of potentially malignant oral lesions, and evaluate and correlate their clinical and pathological aspects. Methods The sample consisted of cases clinically diagnosed as oral leukoplakia, oral erythroplakia, erythroleukoplakia, actinic cheilitis, and oral lichen planus treated at a diagnostic center, between May 2012 and July 2013. Statistical tests were conducted adopting a significance level of 5% (p≤0.05). Results Out of 340 patients, 106 (31.2%) had potentially malignant oral lesions; and 61 of these (17.9%) were submitted to biopsy. Actinic cheilitis was the most frequent lesion (37.5%) and the lower lip was the most affected site (49.6%). Among 106 patients in the sample, 48 (45.3%) reported nicotine consumption, 35 (33%) reported alcohol intake and 34 (32.1%) sun exposure while working. When clinical and histopathological diagnoses were compared, oral erythroplakia and atypical ulcer were the lesions that exhibited greater compatibility (100% each). Conclusion In most cases, clinical and histopathological diagnoses were compatible. An association between the occurrence of erythroplakia, leukoplakia and erythroleukoplakia with smoking was observed. Similarly, an association between actinic cheilitis and sun exposure was noted. Erythroleukoplakia presented the highest malignancy grade in this study. Finally, dental surgeons should draw special attention to diagnosis of potentially malignant oral lesions, choose the best management, and control the lesions to avoid their malignant transformation. PMID:27074232

  20. Meniscal Ramp Lesions

    PubMed Central

    Chahla, Jorge; Dean, Chase S.; Moatshe, Gilbert; Mitchell, Justin J.; Cram, Tyler R.; Yacuzzi, Carlos; LaPrade, Robert F.

    2016-01-01

    Meniscal ramp lesions are more frequently associated with anterior cruciate ligament (ACL) injuries than previously recognized. Some authors suggest that this entity results from disruption of the meniscotibial ligaments of the posterior horn of the medial meniscus, whereas others support the idea that it is created by a tear of the peripheral attachment of the posterior horn of the medial meniscus. Magnetic resonance imaging (MRI) scans have been reported to have a low sensitivity, and consequently, ramp lesions often go undiagnosed. Therefore, to rule out a ramp lesion, an arthroscopic evaluation with probing of the posterior horn of the medial meniscus should be performed. Several treatment options have been reported, including nonsurgical management, inside-out meniscal repair, or all-inside meniscal repair. In cases of isolated ramp lesions, a standard meniscal repair rehabilitation protocol should be followed. However, when a concomitant ACL reconstruction (ACLR) is performed, the rehabilitation should follow the designated ACLR postoperative protocol. The purpose of this article was to review the current literature regarding meniscal ramp lesions and summarize the pertinent anatomy, biomechanics, diagnostic strategies, recommended treatment options, and postoperative protocol. PMID:27504467

  1. Non-infectious inflammatory genital lesions.

    PubMed

    Andreassi, Lucio; Bilenchi, Roberta

    2014-01-01

    The genitalia may be the site of non-infectious inflammatory lesions that are generally manifested as balanoposthitis and vulvovaginitis. In men, these forms constitute 50% of all balanoposthitis forms, and in women, vulvovaginitis frequency is even higher. They consist of genital locations of general skin diseases, such as psoriasis, lichen planus, lichen sclerosus, and other clinical entities with their own physiognomy, such as Zoon's balanitis-vulvitis. Diagnosis of genital non-infectious inflammatory lesions is usually made on clinical criteria. A biopsy is only necessary for the identification of clinical conditions that may simulate inflammatory form but are actually premalignant processes.

  2. Intraventricular mass lesions

    SciTech Connect

    Morrison, G.; Sobel, D.F.; Kelley, W.M.; Norman, D.

    1984-11-01

    Determining the precise etiology of an intraventricular mass can be a difficult diagnostic problem. CT and angiographic findings were reviewed in a series of 73 patients who had intraventricular masses. The histologic diagnosis can be suggested preoperatively by an analysis of the frequency of lesions occurring at a given ventricular location, lesion density before and after administration of contrast material, age, and sex of the patient, morphologic appearance of the mass, and presence or absence of hydrocephalus. Angiography is useful when meningioma, choroid plexus papilloma and carcinoma, or arteriovenous malformation are considered.

  3. DIAGNOSTIC CRITERIA FOR PROLIFERATIVE THYROID LESIONS IN BONY FISHES

    EPA Science Inventory

    Criteria for distinguishing hyperplastic thyroid lesions from thyroid neoplasia in bony fishes have long been debated by scientists. Confusion exists because the thyroid tissue in most teleosts is unencapsulated, is occasionally found in ectopic sites, and is frequently predispos...

  4. Ossicular chain lesions in cholesteatoma.

    PubMed

    Albera, R; Canale, A; Piumetto, E; Lacilla, M; Dagna, F

    2012-10-01

    The aim of the study was to describe ossicle resorption in chronic otitis with cholesteatoma and correlate it with clinical parameters such as age, contralateral ear condition, tympanic membrane aspect, cholesteatoma pathogenesis and extension, associated lesions and hearing threshold. Preoperative clinical data were collected for 140 patients with chronic otitis with cholesteatoma, whose ossicles were evaluated during surgery. 82% of patients showed ossicle resorption, with incus damage in 78% of cases. Multiple involvement was found in 45% of cases and the incus-stapes association was the most frequent. In 13 patients (11%) with ossicle damage, the ossicular chain was in continuity with a hearing threshold similar to patients without ossicular resorption. Ossicles were always damaged in congenital cholesteatoma and in case of associated lesions. Cholesteatoma extension was related to the incidence of ossicle resorption (p < 0.0001). Air and bone conduction worsened as the number of involved ossicles increased, while the air-bone gap remained stable. In conclusion, the origin and location of cholesteatoma are related to the site of ossicular damage, which is subsequent to the contact between bone and cholesteatoma. Pure-tone audiometry and air-bone gap do not reflect actual ossicular chain status. None of the other preoperative clinical parameters considered were reliable predictors of the condition of the ossicular chain.

  5. A conformational analysis of mouse Nalp3 domain structures by molecular dynamics simulations, and binding site analysis.

    PubMed

    Sahoo, Bikash R; Maharana, Jitendra; Bhoi, Gopal K; Lenka, Santosh K; Patra, Mahesh C; Dikhit, Manas R; Dubey, Praveen K; Pradhan, Sukanta K; Behera, Bijay K

    2014-05-01

    Scrutinizing various nucleotide-binding oligomerization domain (NOD)-like receptor (NLR) genes in higher eukaryotes is very important for understanding the intriguing mechanism of the host defense against pathogens. The nucleotide-binding domain (NACHT), leucine-rich repeat (LRR), and pyrin domains (PYD)-containing protein 3 (Nalp3), is an intracellular innate immune receptor and is associated with several immune system related disorders. Despite Nalp3's protective role during a pathogenic invasion, the molecular features and structural organization of this crucial protein is poorly understood. Using comparative modeling and molecular dynamics simulations, we have studied the structural architecture of Nalp3 domains, and characterized the dynamic and energetic parameters of adenosine triphosphate (ATP) binding in NACHT, and pathogen-derived ligands muramyl dipeptide (MDP) and imidazoquinoline with LRR domains. The results suggested that walker A, B and extended walker B motifs were the key ATP binding regions in NACHT that mediate self-oligomerization. The analysis of the binding sites of MDP and imidazoquinoline revealed LRR 7-9 to be the most energetically favored site for imidazoquinoline interaction. However, the binding free energy calculations using the Molecular Mechanics/Poisson-Boltzmann Surface Area (MM/PBSA) method indicated that MDP is incompatible for activating the Nalp3 molecule in its monomeric form, and suggest its complex interaction with NOD2 or other NLRs accounts for MDP recognition. The high binding affinity of ATP with NACHT was correlated to the experimental data for human NLRs. Our binding site prediction for imidazoquinoline in LRR warrants further investigation via in vivo models. This is the first study that provides ligand recognition in mouse Nalp3 and its spatial structural arrangements.

  6. Chronic cutaneous lesions of sarcoidosis.

    PubMed

    Marchell, Richard M; Judson, Marc A

    2007-01-01

    Sarcoidosis involvement of the skin is common. The skin lesions of sarcoidosis may be nonspecific, showing a nondiagnostic inflammatory reaction pattern on histologic evaluation. Nonspecific skin lesions are often associated with an acute presentation of sarcoidosis and, in general, portend a good prognosis. Specific sarcoidosis skin lesions reveal typical sarcoid granulomas on histologic examination. These lesions tend to be chronic and require therapy for resolution. This article will review the epidemiology, diagnostic evaluation, and description of the various chronic skin lesions of sarcoidosis. Various images of these skin lesions will be demonstrated.

  7. [Managing focal incidental renal lesions].

    PubMed

    Nicolau, C; Paño, B; Sebastià, C

    2016-01-01

    Incidental renal lesions are relatively common in daily radiological practice. It is important to know the different diagnostic possibilities for incidentally detected lesions, depending on whether they are cystic or solid. The management of cystic lesions is guided by the Bosniak classification. In solid lesions, the goal is to differentiate between renal cancer and benign tumors such as fat-poor angiomyolipoma and oncocytoma. Radiologists need to know the recommendations for the management of these lesions and the usefulness of the different imaging techniques and interventional procedures in function of the characteristics of the incidental lesion and the patient's life expectancy.

  8. Partial excision of residual burn lesions.

    PubMed

    Engrav, L H; Gottlieb, J R; Millard, S P; Walkinshaw, M D; Heimbach, D M; Marvin, J A

    1987-01-01

    Most burn victims have unattractive residual lesions, which may include hypertrophic donor sites, unsightly skin grafts, hypertrophic scars, and mature scars with altered pigmentation or texture. Some of these lesions can be treated by total excision in one or more stages or they can be reconstructed utilizing grafts, flaps, Z-plasties, or tissue expansion. But frequently these procedures are either not indicated or not elected by the patient. In such a situation, the only surgical option is partial excision, with the goal of making the lesion less conspicuous and more easily concealed by clothing. Whether or not such partial excisions are worthwhile is the obvious question. We could not find an answer in the literature and therefore decided to review our own experience. Between 6/30/81 and 3/12/86, 92 such procedures were performed and followed in 25 patients. Partial excision of hypertrophic donor sites, unsightly skin grafts, and hypertrophic scars did yield improved appearance in most patients. However, partial excision of mature scars, ie, areas of altered pigmentation or texture, did not have the same success. We continue to treat the first three types of lesions in this fashion but no longer include the latter.

  9. Binding of the human nucleotide excision repair proteins XPA and XPC/HR23B to the 5R-thymine glycol lesion and structure of the cis-(5R,6S) thymine glycol epimer in the 5'-GTgG-3' sequence: destabilization of two base pairs at the lesion site.

    PubMed

    Brown, Kyle L; Roginskaya, Marina; Zou, Yue; Altamirano, Alvin; Basu, Ashis K; Stone, Michael P

    2010-01-01

    The 5R thymine glycol (5R-Tg) DNA lesion exists as a mixture of cis-(5R,6S) and trans-(5R,6R) epimers; these modulate base excision repair. We examine the 7:3 cis-(5R,6S):trans-(5R,6R) mixture of epimers paired opposite adenine in the 5'-GTgG-3' sequence with regard to nucleotide excision repair. Human XPA recognizes the lesion comparably to the C8-dG acetylaminoflourene (AAF) adduct, whereas XPC/HR23B recognition of Tg is superior. 5R-Tg is processed by the Escherichia coli UvrA and UvrABC proteins less efficiently than the C8-dG AAF adduct. For the cis-(5R, 6S) epimer Tg and A are inserted into the helix, remaining in the Watson-Crick alignment. The Tg N3H imine and A N(6) amine protons undergo increased solvent exchange. Stacking between Tg and the 3'-neighbor G*C base pair is disrupted. The solvent accessible surface and T(2) relaxation of Tg increases. Molecular dynamics calculations predict that the axial conformation of the Tg CH(3) group is favored; propeller twisting of the Tg*A pair and hydrogen bonding between Tg OH6 and the N7 atom of the 3'-neighbor guanine alleviate steric clash with the 5'-neighbor base pair. Tg also destabilizes the 5'-neighbor G*C base pair. This may facilitate flipping both base pairs from the helix, enabling XPC/HR23B recognition prior to recruitment of XPA.

  10. Network localization of neurological symptoms from focal brain lesions.

    PubMed

    Boes, Aaron D; Prasad, Sashank; Liu, Hesheng; Liu, Qi; Pascual-Leone, Alvaro; Caviness, Verne S; Fox, Michael D

    2015-10-01

    A traditional and widely used approach for linking neurological symptoms to specific brain regions involves identifying overlap in lesion location across patients with similar symptoms, termed lesion mapping. This approach is powerful and broadly applicable, but has limitations when symptoms do not localize to a single region or stem from dysfunction in regions connected to the lesion site rather than the site itself. A newer approach sensitive to such network effects involves functional neuroimaging of patients, but this requires specialized brain scans beyond routine clinical data, making it less versatile and difficult to apply when symptoms are rare or transient. In this article we show that the traditional approach to lesion mapping can be expanded to incorporate network effects into symptom localization without the need for specialized neuroimaging of patients. Our approach involves three steps: (i) transferring the three-dimensional volume of a brain lesion onto a reference brain; (ii) assessing the intrinsic functional connectivity of the lesion volume with the rest of the brain using normative connectome data; and (iii) overlapping lesion-associated networks to identify regions common to a clinical syndrome. We first tested our approach in peduncular hallucinosis, a syndrome of visual hallucinations following subcortical lesions long hypothesized to be due to network effects on extrastriate visual cortex. While the lesions themselves were heterogeneously distributed with little overlap in lesion location, 22 of 23 lesions were negatively correlated with extrastriate visual cortex. This network overlap was specific compared to other subcortical lesions (P < 10(-5)) and relative to other cortical regions (P < 0.01). Next, we tested for generalizability of our technique by applying it to three additional lesion syndromes: central post-stroke pain, auditory hallucinosis, and subcortical aphasia. In each syndrome, heterogeneous lesions that themselves had

  11. Gram stain of skin lesion

    MedlinePlus

    ... Names Skin lesion gram stain Images Viral lesion culture References Hall GS, Woods GL. Medical bacteriology. In: McPherson RA, Pincus MR, eds. Henry's Clinical Diagnosis and Management by Laboratory Methods . 22nd ed. Philadelphia, PA: Elsevier ...

  12. Klatskin-Like Lesions

    PubMed Central

    Senthil Kumar, M. P.; Marudanayagam, R.

    2012-01-01

    Hilar cholangiocarcinoma, also known as Klatskin tumour, is the commonest type of cholangiocarcinoma. It poses unique problems in the diagnosis and management because of its anatomical location. Curative surgery in the form of major hepatic resection entails significant morbidity. About 5–15% of specimens resected for presumed Klatskin tumour prove not to be cholangiocarcinomas. There are a number of inflammatory, infective, vascular, and other pathologies, which have overlapping clinical and radiological features with a Klatskin tumour, leading to misinterpretation. This paper aims to summarise the features of such Klatskin-like lesions that have been reported in surgical literature. PMID:22811587

  13. Cystic Lesions of the Mediastinum.

    PubMed

    Vargas, Daniel; Suby-Long, Thomas; Restrepo, Carlos S

    2016-06-01

    Cystic lesions are commonly seen in the mediastinum, and they may arise from virtually any organ. The vast majority of these lesions are benign and result in no symptoms. When large, cysts may produce symptoms related to compression of adjacent structures. The most common mediastinal cysts are pericardial and foregut duplication cysts. Both computed tomography and magnetic resonance are routinely used to evaluate these lesions. Although computed tomography offers superior spatial resolution, magnetic resonance is useful in differentiating cysts that contain proteinaceous material from solid lesions. Occasionally, cysts arise from solid lesions, such as thymoma or teratoma. Although cysts are alike in appearance, location helps narrowing the differential diagnoses.

  14. Skin lesion aspiration

    MedlinePlus

    ... Rashes Review Date 12/2/2014 Updated by: Richard J. Moskowitz, MD, dermatologist in private practice, Mineola, ... commercial use must be authorized in writing by ADAM Health Solutions. About MedlinePlus Site Map FAQs Customer ...

  15. Skin lesion biopsy

    MedlinePlus

    ... Chronic Review Date 12/2/2014 Updated by: Richard J. Moskowitz, MD, dermatologist in private practice, Mineola, ... commercial use must be authorized in writing by ADAM Health Solutions. About MedlinePlus Site Map FAQs Customer ...

  16. Human papillomavirus in oral lesions.

    PubMed

    González, Joaquín V; Gutiérrez, Rafael A; Keszler, Alicia; Colacino, Maria del Carmen; Alonio, Lidia V; Teyssie, Angelica R; Picconi, Maria Alejandra

    2007-01-01

    Growing evidence suggests a role for human papillomavirus (HPV) in oral cancer; however its involvement is still controversial. This study evaluates the frequency of HPV DNA in a variety of oral lesions in patients from Argentina. A total of 77 oral tissue samples from 66 patients were selected (cases); the clinical-histopathological diagnoses corresponded to: 11 HPV- associated benign lesions, 8 non-HPV associated benign lesions, 33 premalignant lesions and 25 cancers. Sixty exfoliated cell samples from normal oral mucosa were used as controls. HPV detection and typing were performed by polymerase chain reaction (PCR) using primers MY09, 11, combined with RFLP or alternatively PCR using primers GP5+, 6+ combined with dot blot hybridization. HPV was detected in 91.0% of HPV- associated benign lesions, 14.3% of non-HPV associated benign lesions, 51.5% of preneoplasias and 60.0% of cancers. No control sample tested HPV positive. In benign HPV- associated lesions, 30.0% of HPV positive samples harbored high-risk types, while in preneoplastic lesions the value rose to 59.9%. In cancer lesions, HPV detection in verrucous carcinoma was 88.9% and in squamous cell carcinoma 43.8%, with high-risk type rates of 75.5% and 85.6%, respectively. The high HPV frequency detected in preneoplastic and neoplastic lesions supports an HPV etiological role in at least a subset of oral cancers.

  17. Function of transcription factors at DNA lesions in DNA repair.

    PubMed

    Malewicz, Michal; Perlmann, Thomas

    2014-11-15

    Cellular systems for DNA repair ensure prompt removal of DNA lesions that threaten the genomic stability of the cell. Transcription factors (TFs) have long been known to facilitate DNA repair via transcriptional regulation of specific target genes encoding key DNA repair proteins. However, recent findings identified TFs as DNA repair components acting directly at the DNA lesions in a transcription-independent fashion. Together this recent progress is consistent with the hypothesis that TFs have acquired the ability to localize DNA lesions and function by facilitating chromatin remodeling at sites of damaged DNA. Here we review these recent findings and discuss how TFs may function in DNA repair.

  18. [Furcation lesions in deciduous teeth].

    PubMed

    Demars-Fremault, C; Pilipili Muhima, C

    1991-03-01

    The area of furcation of temporary molars constitutes a zone of exchanges and rearrangements relating to the evolution of the sub-adjacent permanent tooth. It is subjected to the eruption of the latter and to the physiological modifications of the temporary tooth. Moreover, this area is the site of above-mentioned inflammatory or infections conditions, maintained or aggravated by anatomical factors (accessory canals, thin pulpar floor, with little calcified dentine and broad tubuli), physiological factors (multiplication of accessory canals, decrease in the floor and migration of the epithelial attachment), endodontic factors (pulpal involvement and its complications) and periodontal factors (septum syndrome). The pathology of furcation is an evolving lesion. When discovered early it can be treated by endodontic therapy, while, in a later phase, it will require the extraction of the tooth. The assessment is made on the basis of a X-Ray examination which permits the temporary tooth to be situated in its stable or labile phase, the condition of the pulpal floor to be evaluated and the stage of sub-adjacent germ mineralisation to be estimated. A periodontal arrangement, by coronal reconstitution, conditions the reliability of the endodontic therapies.

  19. Automated Estimation Of Lesion Size

    NASA Astrophysics Data System (ADS)

    Ruttimann, Urs E.; Webber, Richard L.; Groenhuis, Roelf A. J.; Troullos, Emanuel; Rethman, Michael T.

    1985-06-01

    Two methods were studied of estimating automatically the relative volume of local lesions in digital subtractions radiographs. The first method approximates the projected, lesion area by an equivalent circular area, and the second by an equivalent polygonal area. Lesion volume is estimated in both methods as equivalent area times the average gray-level difference between the detected area and the surrounding background. Regression results of the estimated relative volume versus the calibrated size of lesions induced in dry human mandibles showed the polygonal approximation to be superior. This method also permitted successful monitoring of bone remodelling during the healing process of surgically induced lesions in dogs. The quantitative results, as well as the examples from in vivo lesions demonstrate feasibility and clinically relavance of the methodology.

  20. Proteome Profiling of Human Cutaneous Leishmaniasis Lesion

    PubMed Central

    da Silva Santos, Claire; Attarha, Sanaz; Saini, Ravi Kanth; Boaventura, Viviane; Costa, Jackson; Khouri, Ricardo; Barral-Netto, Manoel; Brodskyn, Cláudia Ida; Souchelnytskyi, Serhiy

    2015-01-01

    In this study, we used proteomics and biological network analysis to evaluate the potential biological processes and components present in the identified proteins of biopsies from cutaneous leishmaniasis (CL) patients infected by Leishmania braziliensis in comparison with normal skin. We identified 59 proteins differently expressed in samples from infected and normal skin. Biological network analysis employing identified proteins showed the presence of networks that may be involved in the cell death mediated by cytotoxic T lymphocytes. After immunohistochemical analyses, the expression of caspase-9, caspase-3, and granzyme B was validated in the tissue and positively correlated with the lesion size in CL patients. In conclusion, this work identified differentially expressed proteins in the inflammatory site of CL, revealed enhanced expression of caspase-9, and highlighted mechanisms associated with the progression of tissue damage observed in lesions. PMID:25207817

  1. Fuzzy description of skin lesions

    NASA Astrophysics Data System (ADS)

    Laskaris, Nikolaos; Ballerini, Lucia; Fisher, Robert B.; Aldridge, Ben; Rees, Jonathan

    2010-02-01

    We propose a system for describing skin lesions images based on a human perception model. Pigmented skin lesions including melanoma and other types of skin cancer as well as non-malignant lesions are used. Works on classification of skin lesions already exist but they mainly concentrate on melanoma. The novelty of our work is that our system gives to skin lesion images a semantic label in a manner similar to humans. This work consists of two parts: first we capture they way users perceive each lesion, second we train a machine learning system that simulates how people describe images. For the first part, we choose 5 attributes: colour (light to dark), colour uniformity (uniform to non-uniform), symmetry (symmetric to non-symmetric), border (regular to irregular), texture (smooth to rough). Using a web based form we asked people to pick a value of each attribute for each lesion. In the second part, we extract 93 features from each lesions and we trained a machine learning algorithm using such features as input and the values of the human attributes as output. Results are quite promising, especially for the colour related attributes, where our system classifies over 80% of the lesions into the same semantic classes as humans.

  2. Finding the imposter: brain connectivity of lesions causing delusional misidentifications.

    PubMed

    Darby, R Ryan; Laganiere, Simon; Pascual-Leone, Alvaro; Prasad, Sashank; Fox, Michael D

    2017-02-01

    SEE MCKAY AND FURL DOI101093/AWW323 FOR A SCIENTIFIC COMMENTARY ON THIS ARTICLE: Focal brain injury can sometimes lead to bizarre symptoms, such as the delusion that a family member has been replaced by an imposter (Capgras syndrome). How a single brain lesion could cause such a complex disorder is unclear, leading many to speculate that concurrent delirium, psychiatric disease, dementia, or a second lesion is required. Here we instead propose that Capgras and other delusional misidentification syndromes arise from single lesions at unique locations within the human brain connectome. This hypothesis is motivated by evidence that symptoms emerge from sites functionally connected to a lesion location, not just the lesion location itself. First, 17 cases of lesion-induced delusional misidentifications were identified and lesion locations were mapped to a common brain atlas. Second, lesion network mapping was used to identify brain regions functionally connected to the lesion locations. Third, regions involved in familiarity perception and belief evaluation, two processes thought to be abnormal in delusional misidentifications, were identified using meta-analyses of previous functional magnetic resonance imaging studies. We found that all 17 lesion locations were functionally connected to the left retrosplenial cortex, the region most activated in functional magnetic resonance imaging studies of familiarity. Similarly, 16 of 17 lesion locations were functionally connected to the right frontal cortex, the region most activated in functional magnetic resonance imaging studies of expectation violation, a component of belief evaluation. This connectivity pattern was highly specific for delusional misidentifications compared to four other lesion-induced neurological syndromes (P < 0.0001). Finally, 15 lesions causing other types of delusions were connected to expectation violation (P < 0.0001) but not familiarity regions, demonstrating specificity for delusion content. Our

  3. Fortuitously discovered liver lesions

    PubMed Central

    Dietrich, Christoph F; Sharma, Malay; Gibson, Robert N; Schreiber-Dietrich, Dagmar; Jenssen, Christian

    2013-01-01

    The fortuitously discovered liver lesion is a common problem. Consensus might be expected in terms of its work-up, and yet there is none. This stems in part from the fact that there is no preventive campaign involving the early detection of liver tumors other than for patients with known liver cirrhosis and oncological patients. The work-up (detection and differential diagnosis) of liver tumors comprises theoretical considerations, history, physical examination, laboratory tests, standard ultrasound, Doppler ultrasound techniques, contrast-enhanced ultrasound (CEUS), computed tomography and magnetic resonance imaging, as well as image-guided biopsy. CEUS techniques have proved to be the most pertinent method; these techniques became part of the clinical routine about 10 years ago in Europe and Asia and are used for a variety of indications in daily clinical practice. CEUS is in many cases the first and also decisive technical intervention for detecting and characterizing liver tumors. This development is reflected in many CEUS guidelines, e.g., in the European Federation of Societies for Ultrasound in Medicine and Biology (EFSUMB) guidelines 2004, 2008 and 2012 as well as the recently published World Federation for Ultrasound in Medicine and Biology-EFSUMB guidelines 2012. This article sets out considerations for making a structured work-up of incidental liver tumors feasible. PMID:23745019

  4. Lesion-symptom mapping of the human cerebellum.

    PubMed

    Timmann, D; Brandauer, B; Hermsdörfer, J; Ilg, W; Konczak, J; Gerwig, M; Gizewski, E R; Schoch, B

    2008-01-01

    High-resolution structural magnetic resonance imaging (MRI) has become a powerful tool in human cerebellar lesion studies. Structural MRI is helpful to analyse the localisation and extent of cerebellar lesions and to determine possible extracerebellar involvement. Functionally meaningful correlations between a cerebellar lesion site and behavioural data can be obtained both in subjects with degenerative as well as focal cerebellar disorders. In this review, examples are presented which demonstrate that MRI-based lesion-symptom mapping is helpful to study the function of cerebellar cortex and cerebellar nuclei. Behavioural measures were used which represent two main areas of cerebellar function, that is, motor coordination and motor learning. One example are correlations with clinical data which are in good accordance with the known functional compartmentalisation of the cerebellum in three sagittal zones: In patients with cerebellar cortical degeneration ataxia of stance and gait was correlated with atrophy of the medial (and intermediate) cerebellum, oculomotor disorders with the medial, dysarthria with the intermediate and limb ataxia with atrophy of the intermediate and lateral cerebellum. Similar findings were obtained in patients with focal lesions. In addition, in patients with acute focal lesions, a somatotopy in the superior cerebellar cortex was found which is in close relationship to animal data and functional MRI data in healthy control subjects. Finally, comparison of data in patients with acute and chronic focal lesions revealed that lesion site appears to be critical for motor recovery. Recovery after lesions to the nuclei of the cerebellum was less complete. Another example which extended knowledge about functional localisation within the cerebellum is classical conditioning of the eyeblink response, a simple form of motor learning. In healthy subjects, learning rate was related to the volume of the cortex of the posterior cerebellar lobe. In

  5. Factors associated with gastric lesions in thoroughbred racehorses.

    PubMed

    Murray, M J; Schusser, G F; Pipers, F S; Gross, S J

    1996-09-01

    Gastroscopic examinations were performed on 67 Thoroughbred horses in training at a race track and repeat examinations performed in 35 horses, 2 to 3 months later. Horses were age 2-9 years and included 16 two-year-olds, 32 three-year-olds and 19 horses > or = 4-years-old. Forty-two of the 67 horses had raced within the 2 months before the initial examination and the remaining 25 horses were in training. Sixty-two of the 67 horses (93%) had one or more lesions present in the gastric mucosa and lesions were present in all of the 42 horses that had raced. Thirty-two of the 35 horses, examined twice (91%), had gastric lesions on the first examination and all had lesions on the second examination. Four sites of the gastric squamous epithelium were graded for lesion severity on a scale of 0 to 10 and the mean maximum squamous mucosal lesion score was significantly (P < 0.01) greater for the second examination (4.89) than for the first examination (3.63). Maximum lesion scores were greater in 24 horses, no different in 5 horses and less in 6 horses on the second examination. The difference in mean maximum lesion scores between examinations was greatest in horses age 2 years, increasing from 1.75 to 4.00 (P = 0.014). Lesions in the gastric glandular mucosa also were scored on a scale of 0 to 10 and there was no difference in mean lesion scores in the glandular mucosa between the first and second examinations (1.89 vs. 1.90). Lesion scores were compared for gender, racing history and medication with nonsteroidal anti-inflammatory drugs, systemic corticosteroid or ACTH, or frusemide within the previous 2 months. Except for racing history, there were no significant differences in mean lesion scores for squamous or glandular mucosa based on these comparisons, indicating that there was no effect of gender or medication history on ulcer severity in the horses of our study. Mean maximum gastric squamous mucosal lesion score was significantly (P < 0.01) greater in horses that had

  6. Endoscopic band ligation for bleeding lesions in the small bowel

    PubMed Central

    Ikeya, Takashi; Ishii, Naoki; Shimamura, Yuto; Nakano, Kaoru; Ego, Mai; Nakamura, Kenji; Takagi, Koichi; Fukuda, Katsuyuki; Fujita, Yoshiyuki

    2014-01-01

    AIM: To investigate the safety and efficacy of endoscopic band ligation (EBL) for bleeding lesions in the small bowel. METHODS: This is a retrospective study evaluating EBL in six consecutive patients (three males, three females, 46-86 years of age) treated between May 2009 and February 2014: duodenal vascular ectasia; 1, jejunal bleeding diverticulum; 1, ileal Dieulafoy’s lesion; 1 and ileal bleeding diverticula; 3. The success of the initial hemostasis was evaluated, and patients were observed for early rebleeding (within 30 d after EBL), and complications such as perforation and abscess formation. Follow-up endoscopies were performed in four patients. RESULTS: Initial hemostasis was successfully achieved with EBL in all six patients. Eversion was not sufficient in four diverticular lesions. Early rebleeding occurred three days after EBL in one ileal diverticulum, and a repeat endoscopy revealed dislodgement of the O-band and ulcer formation at the banded site. This rebleeding was managed conservatively. Late rebleeding occurred in this case (13 and 21 mo after initial EBL), and re-EBL was performed. Follow-up endoscopies revealed scar formation and the disappearance of vascular lesions at the banded site in the case with a duodenal bleeding lesion, and unresolved ileal diverticula in three cases. Surgery or transarterial embolization was not required without any complications during the median follow-up period of 45 (range, 2-83) mo. CONCLUSION: EBL is a safe and effective endoscopic treatment for hemostasis of bleeding lesions in the small bowel. PMID:25324920

  7. Tumefactive Fibroinflammatory Lesion: A Diagnostic Dilemma

    PubMed Central

    Jain, Promil; Sen, Rajeev; Sharma, Nisha; Bhargava, Shilpi; Singh, Virender

    2017-01-01

    Tumefactive fibroinflammatory lesions (TFLs) are rare idiopathic benign fibrosclerosing lesions that clinically simulate a malignancy. TFLs are seen more frequently in males between 10 and 74 years of age. The usual site of involvement is the head and neck region, but rarely the extremities may be involved. Coexisting fibrosclerotic processes have been reported including retroperitoneal fibrosis, sclerosing cholangitis, sclerosing mediastinal fibrosis, and orbital pseudotumors. The etiology of this poorly understood entity remains unknown. Possible suggestions include exaggerated responses or autoimmune reactions to any chronic infection. The clinical and radiological appearance of TFLs is that of malignancy, but histopathology reveals them to be a benign process broadly classified under non-neoplastic, fibroinflammatory proliferations. The treatment strategies for these lesions are not well defined and variable and include steroids, surgery, and radiotherapy either alone or in combination. TFLs, albeit not fatal, have a high recurrence rate; patients should, therefore, be kept on long-term follow-up. We describe a young female patient presenting with a rapidly developing cheek swelling, which was diagnosed histopathologically as a TFLs. PMID:28360448

  8. Role of a cysteine residue in the active site of ERK and the MAPKK family

    SciTech Connect

    Ohori, Makoto; Kinoshita, Takayoshi; Yoshimura, Seiji; Warizaya, Masaichi; Nakajima, Hidenori . E-mail: hidenori.nakajima@jp.astellas.com; Miyake, Hiroshi

    2007-02-16

    Kinases of mitogen-activated protein kinase (MAPK) cascades, including extracellular signal-regulated protein kinase (ERK), represent likely targets for pharmacological intervention in proliferative diseases. Here, we report that FR148083 inhibits ERK2 enzyme activity and TGF{beta}-induced AP-1-dependent luciferase expression with respective IC{sub 50} values of 0.08 and 0.05 {mu}M. FR265083 (1'-2' dihydro form) and FR263574 (1'-2' and 7'-8' tetrahydro form) exhibited 5.5-fold less and no activity, respectively, indicating that both the {alpha},{beta}-unsaturated ketone and the conformation of the lactone ring contribute to this inhibitory activity. The X-ray crystal structure of the ERK2/FR148083 complex revealed that the compound binds to the ATP binding site of ERK2, involving a covalent bond to S{gamma} of ERK2 Cys166, hydrogen bonds with the backbone NH of Met108, N{zeta} of Lys114, backbone C=O of Ser153, N{delta}2 of Asn154, and hydrophobic interactions with the side chains of Ile31, Val39, Ala52, and Leu156. The covalent bond motif in the ERK2/FR148083 complex assures that the inhibitor has high activity for ERK2 and no activity for other MAPKs such as JNK1 and p38MAPK{alpha}/{beta}/{gamma}/{delta} which have leucine residues at the site corresponding to Cys166 in ERK2. On the other hand, MEK1 and MKK7, kinases of the MAPKK family which also can be inhibited by FR148083, contain a cysteine residue corresponding to Cys166 of ERK2. The covalent binding to the common cysteine residue in the ATP-binding site is therefore likely to play a crucial role in the inhibitory activity for these MAP kinases. These findings on the molecular recognition mechanisms of FR148083 for kinases with Cys166 should provide a novel strategy for the pharmacological intervention of MAPK cascades.

  9. Isolated paroxysmal dysarthria caused by a single demyelinating midbrain lesion.

    PubMed

    Codeluppi, Luca; Bigliardi, Guido; Chiari, Annalisa; Meletti, Stefano

    2013-10-16

    Paroxysmal dysarthria is an unusual condition characterised by brief episodes of dysarthria with the sudden onset and frequent recurrence. It has been mainly reported in multiple sclerosis and an association with midbrain lesions has been claimed; however, most of the reported patients had multiple brain alterations so it was difficult to associate this symptom with a specific lesion site. We illustrate the cases of two patients with an isolated demyelinating midbrain lesion presenting paroxysmal dysarthria as the only symptom; both participants had oligoclonal bands in the cerebrospinal fluid and an unremarkable follow-up. Both patients had benefit from carbamazepine treatment, similarly to previously reported cases. Our report confirms that a demyelinating midbrain lesion is sufficient to provoke paroxysmal dysarthria. It is noteworthy that an erroneous diagnosis of psychogenic disorders was initially made in both cases, highlighting the importance not to underestimate isolated paroxysmal symptoms in clinical practice.

  10. Polymorphous light eruption. Experimental reproduction of skin lesions

    SciTech Connect

    Hoelzle, E.; Plewig, G.; Hofmann, C.; Roser-Maass, E.

    1982-07-01

    The clinical features of polymorphous light eruption (PLE) are reviewed from the literature with special emphasis on the experimental reproduction of skin lesions. Our clinical experience with 180 patients is reported. In forty-three patients a newly developed UVA provocation test was performed. UVA, free of sunburn radiation (50-100 J/cm2), was administered, sometimes repeatedly up to four times, to large sites of previously involved skin. With this technic the reproduction of PLE lesions under laboratory conditions was possible in 90% of this group of forty-three patients. The diagnosis was substantiated by microscopic examination of genuine and experimentally induced lesions. Characteristic histologic features of PLE are described. Phototesting with large doses of UVA aids in confirming the diagnosis of PLE. Hitherto, this diagnosis depended often on exclusion of other dermatoses. Eusolex 8021, a UVA-effective sunscreen, blocked eruptions of PLE lesions under laboratory conditions. An effective means of treatment is offered by PUVA therapy.

  11. Long-term changes in striatal opioid systems after 6-hydroxydopamine lesion of rat substantia nigra.

    PubMed

    Smith, J A; Leslie, F M; Broide, R S; Loughlin, S E

    1993-08-01

    The effects of unilateral 6-hydroxydopamine lesion of the nigrostriatal pathway on striatal opioid peptides and receptors were determined at different time-intervals, from three days up to 24 weeks, post-lesion. Mu, delta and kappa opioid binding site densities in the ipsilateral caudate-putamen were decreased by 25-50% in rats which exhibited a greater than 90% loss of dopamine uptake sites. Differentiation of radioligand binding to kappa1 and kappa2 subtypes demonstrated a selective loss of kappa2 sites post-lesion. The onset of significant 6-hydroxydopamine lesion-induced changes in striatal opioid binding sites was delayed with respect to the loss of dopamine uptake sites. Furthermore, maximal loss of dopamine uptake sites was apparent within seven days post-lesion, but not until two to four weeks for mu, delta and kappa sites. In animals which exhibited an incomplete loss of dopamine uptake sites (less than 80%) there was no significant change in opioid binding site density. Striatal proenkephalin and prodynorphin messenger RNA levels were increased and decreased, respectively, after complete 6-hydroxydopamine lesion. Modulation of peptide messenger RNA levels was apparent within seven days and was maintained up to 24 weeks post-lesion. In contrast, proenkephalin and prodynorphin messenger RNA levels were unchanged in animals which exhibited an incomplete loss of striatal dopamine uptake sites. Taken together, these observations suggest that the majority of mu, delta and kappa2 opioid binding sites are localized on non-dopaminergic elements in the caudate-putamen, but that substantia nigra innervation plays a role in the control of striatal opioid receptor expression. The 6-hydroxydopamine lesion-induced decreases in striatal opioid binding site density may, in part, be a function of agonist-induced receptor downregulation. Alternatively, both opioid receptor and peptide expression in the caudate-putamen may be directly, but independently, regulated by ventral

  12. Nerve lesioning with direct current

    NASA Astrophysics Data System (ADS)

    Ravid, E. Natalie; Shi Gan, Liu; Todd, Kathryn; Prochazka, Arthur

    2011-02-01

    Spastic hypertonus (muscle over-activity due to exaggerated stretch reflexes) often develops in people with stroke, cerebral palsy, multiple sclerosis and spinal cord injury. Lesioning of nerves, e.g. with phenol or botulinum toxin is widely performed to reduce spastic hypertonus. We have explored the use of direct electrical current (DC) to lesion peripheral nerves. In a series of animal experiments, DC reduced muscle force by controlled amounts and the reduction could last several months. We conclude that in some cases controlled DC lesioning may provide an effective alternative to the less controllable molecular treatments available today.

  13. No Carious Cervical Lesions: Abfraction

    PubMed Central

    Shetty, Sumanth M; Shetty, Rashmi G; Mattigatti, Sudha; Managoli, Noopur A; Rairam, Surabhi G; Patil, Ashwini M

    2013-01-01

    Abfraction or Theory of Abfraction is a theory explaining the non-carious cervical lesions (NCCL). It suggests that they are caused by flexural forces, usually from cyclic loading; the enamel, especially at the cementoenamel junction (CEJ), undergoes this pattern of destruction by separating the enamel rods. Clinical aspect importance of these ineart lesions are at most important to be detected for early intervention and treatment modalities as options during the progression of the disease. How to cite this article: Shetty SM, Shetty RG, Mattigatti S, Managoli NA, Rairam SG, Patil AM. No Carious Cervical Lesions: Abfraction. J Int Oral Health 2013; 5(5):142-5. PMID:24324319

  14. No carious cervical lesions: abfraction.

    PubMed

    Shetty, Sumanth M; Shetty, Rashmi G; Mattigatti, Sudha; Managoli, Noopur A; Rairam, Surabhi G; Patil, Ashwini M

    2013-10-01

    Abfraction or Theory of Abfraction is a theory explaining the non-carious cervical lesions (NCCL). It suggests that they are caused by flexural forces, usually from cyclic loading; the enamel, especially at the cementoenamel junction (CEJ), undergoes this pattern of destruction by separating the enamel rods. Clinical aspect importance of these ineart lesions are at most important to be detected for early intervention and treatment modalities as options during the progression of the disease. How to cite this article: Shetty SM, Shetty RG, Mattigatti S, Managoli NA, Rairam SG, Patil AM. No Carious Cervical Lesions: Abfraction. J Int Oral Health 2013; 5(5):142-5.

  15. Dermoscopy of pigmented skin lesions.

    PubMed

    Soyer, H P; Argenziano, G; Chimenti, S; Ruocco, V

    2001-01-01

    This paper describes the basic concepts of dermoscopy, the various dermoscopic equipments and the standard criteria for diagnosing pigmented skin lesions. In assessing dermoscopic images, both global and local features can be recognized. These features will be systematically described and illustrated in Part I of this article. First, we will focus on 8 morphologically rather distinctive global features that allow a quick, preliminary categorization of a given pigmented skin lesion. Second, we will describe various local features representing the letters of the dermoscopic alphabet. The local features permit a more detailed assessment of pigmented skin lesions.

  16. Visualization of Epicardial Cryoablation Lesions using Endogenous Tissue Fluorescence

    PubMed Central

    Swift, Luther; Gil, Daniel A.B.; Jaimes, Rafael; Kay, Matthew; Mercader, Marco; Sarvazyan, Narine

    2014-01-01

    Background Percutaneous cryoballoon ablation is a commonly used procedure to treat atrial fibrillation. One of the major limitations of the procedure is the inability to directly visualize tissue damage and functional gaps between the lesions. We seek to develop an approach that will enable real-time visualization of tissue necrosis during cryo- or radiofrequency ablation procedures. Methods and Results Cryoablation of either blood-perfused or saline-perfused hearts was associated with a marked decrease in NADH fluorescence leading to a 60-70% loss of signal intensity at the lesion site. The total lesion area observed on the NADH channel exhibited a strong correlation with the area identified by triphenyl tetrazolium staining (r=0.89, p<0.001). At physiological temperatures, loss of NADH became visually apparent within 26±8 sec after detachment of the cryoprobe from the epicardial surface and plateaued within minutes after which the boundaries of the lesions remained stable for several hours. The loss of electrical activity within the cryoablation site exhibited a close spatial correlation with the loss of NADH (r=0.84±0.06, p<0.001). Cryoablation led to a decrease in diffuse reflectance across the entire visible spectrum which was in stark contrast to radiofrequency ablation that markedly increased the intensity of reflected light at the lesion sites. Conclusions We confirmed the feasibility of using endogenous NADH fluorescence for the real-time visualization of cryoablation lesions in blood-perfused cardiac muscle preparations and revealed similarities and differences between imaging cryo- and radiofrequency ablation lesions when using ultraviolet and visible light illumination. PMID:25141861

  17. Lesions of the avian pancreas.

    PubMed

    Schmidt, Robert E; Reavill, Drury R

    2014-01-01

    Although not well described, occasional reports of avian exocrine and endocrine pancreatic disease are available. This article describes the lesions associated with common diseases of the avian pancreas reported in the literature and/or seen by the authors.

  18. Herpes viral culture of lesion

    MedlinePlus

    ... virus; Herpes simplex virus culture Images Viral lesion culture References Costello M, Sabatini LM, Yungbluth M. Viral infections. In: McPherson RA, Pincus MR, eds. Henry's Clinical Diagnosis and Management by Laboratory Methods . 22nd ed. Philadelphia, PA: Elsevier ...

  19. Electrocautery for Precancerous Anal Lesions

    Cancer.gov

    Results from a randomized clinical trial conducted in Amsterdam suggest that electrocautery is better than topical imiquimod or fluorouracil at treating potentially precancerous anal lesions in HIV-positive men who have sex with men.

  20. Border preserving skin lesion segmentation

    NASA Astrophysics Data System (ADS)

    Kamali, Mostafa; Samei, Golnoosh

    2008-03-01

    Melanoma is a fatal cancer with a growing incident rate. However it could be cured if diagnosed in early stages. The first step in detecting melanoma is the separation of skin lesion from healthy skin. There are particular features associated with a malignant lesion whose successful detection relies upon accurately extracted borders. We propose a two step approach. First, we apply K-means clustering method (to 3D RGB space) that extracts relatively accurate borders. In the second step we perform an extra refining step for detecting the fading area around some lesions as accurately as possible. Our method has a number of novelties. Firstly as the clustering method is directly applied to the 3D color space, we do not overlook the dependencies between different color channels. In addition, it is capable of extracting fine lesion borders up to pixel level in spite of the difficulties associated with fading areas around the lesion. Performing clustering in different color spaces reveals that 3D RGB color space is preferred. The application of the proposed algorithm to an extensive data-base of skin lesions shows that its performance is superior to that of existing methods both in terms of accuracy and computational complexity.

  1. Simulation of spiculated breast lesions

    NASA Astrophysics Data System (ADS)

    Elangovan, Premkumar; Alrehily, Faisal; Pinto, R. Ferrari; Rashidnasab, Alaleh; Dance, David R.; Young, Kenneth C.; Wells, Kevin

    2016-03-01

    Virtual clinical trials are a promising new approach increasingly used for the evaluation and comparison of breast imaging modalities. A key component in such an assessment paradigm is the use of simulated pathology, in particular, simulation of lesions. Breast mass lesions can be generally classified into two categories based on their appearance; nonspiculated masses and spiculated masses. In our previous work, we have successfully simulated non-spiculated masses using a fractal growth process known as diffusion limited aggregation. In this new work, we have extended the DLA model to simulate spiculated lesions by using features extracted from patient DBT images containing spiculated lesions. The features extracted included spicule length, width, curvature and distribution. This information was used to simulate realistic looking spicules which were attached to the surface of a DLA mass to produce a spiculated mass. A batch of simulated spiculated masses was inserted into normal patient images and presented to an experienced radiologist for review. The study yielded promising results with the radiologist rating 60% of simulated lesions in 2D and 50% of simulated lesions in DBT as realistic.

  2. Pineal lesions: a multidisciplinary challenge.

    PubMed

    Westphal, Manfred; Emami, Pedram

    2015-01-01

    The pineal region is a complex anatomical compartment, harbouring the pineal gland surrounded by the quadrigeminal plate and the confluents of the internal cerebral veins to form the vein of Galen. The complexity of lesions in that region, however, goes far beyond the pineal parenchyma proper. Originating in the pineal gland, there are not only benign cysts but also numerous different tumour types. In addition, lesions such as tectal gliomas, tentorial meningiomas and choroid plexus papillomas arise from the surrounding structures, occupying that regions. Furthermore, the area has an affinity for metastatic lesions. Vascular lesions complete the spectrum mainly as small tectal arteriovenous malformations or cavernous haemangiomas.Taken together, there is a wide spectrum of lesions, many unique to that region, which call for a multidisciplinary approach. The limited access and anatomical complexity have generated a spectrum of anatomical approaches and raised the interest for neuroendoscopic approaches. Equally complex is the spectrum of treatment modalities such as microsurgery as the main option but stereotactic radiosurgery as an alternative or adjuvant to surgery for selected cases, radiation as for germinoma (see below) and or combinatorial chemotherapy, which may need to precede any other ablative technique as constituents.In this context, we review the current literature and our own series to obtain a snapshot sentiment of how to approach pineal lesions, how to interrelate alternative/competing concepts and review the recent technological advances.

  3. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing.

    PubMed

    Riedl, Jan; Ding, Yun; Fleming, Aaron M; Burrows, Cynthia J

    2015-11-06

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand.

  4. Neurophysiology and Neuroanatomy of Smooth Pursuit: Lesion Studies

    ERIC Educational Resources Information Center

    Sharpe, James A.

    2008-01-01

    Smooth pursuit impairment is recognized clinically by the presence of saccadic tracking of a small object and quantified by reduction in pursuit gain, the ratio of smooth eye movement velocity to the velocity of a foveal target. Correlation of the site of brain lesions, identified by imaging or neuropathological examination, with defective smooth…

  5. Coupling between ATP Binding and DNA Cleavage by DNA Topoisomerase II

    PubMed Central

    Mueller-Planitz, Felix; Herschlag, Daniel

    2008-01-01

    DNA topoisomerase II is a molecular machine that couples ATP hydrolysis to the transport of one DNA segment through a transient break in another segment. To learn about the energetic connectivity that underlies this coupling, we investigated how the ATPase domains exert control over DNA cleavage. We dissected the DNA cleavage reaction by measuring rate and equilibrium constants for the individual reaction steps utilizing defined DNA duplexes in the presence and absence of the nonhydrolyzable ATP analog 5′-adenylyl-β,γ-imidodiphosphate (AMPPNP). Our results revealed the existence of two enzyme conformations whose relative abundance is sensitive to the presence of nucleotides. The predominant species in the absence of nucleotides binds DNA at a diffusion limited rate but cannot efficiently cleave DNA. In the presence of AMPPNP, most of the enzyme is converted to a state in which DNA binding and release is extremely slow but which allows DNA cleavage. A minimal kinetic and thermodynamic framework is established that accounts for the cooperativity of cleavage of the two DNA strands in the presence and absence of bound AMPPNP and includes conformational steps revealed in the kinetic studies. The model unifies available kinetic, thermodynamic, and structural data to provide a description for the reaction in terms of the order and rate of individual reaction steps and the physical nature of the species on the reaction path. Furthermore, this reaction framework provides a foundation for a future in-depth analysis of energy transduction by topoisomerase II, for guiding and interpreting future structural studies, and for analyzing the mechanism of drugs that convert topoisomerase into a cellular poison. PMID:18403371

  6. ATP-binding cassette G5/G8 deficiency causes hypertriglyceridemia by affecting multiple metabolic pathways.

    PubMed

    Méndez-González, Jesús; Julve, Josep; Rotllan, Noemí; Llaverias, Gemma; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2011-12-01

    Mutations in ABCG5 or ABCG8 transporters are responsible for sitosterolemia, an autosomal recessive disease characterized by the accumulation of plant sterols. The aim of this study was to investigate the effects of ABCG5 and ABCG8 deficiency on TG metabolism in mice. Experiments were carried out in wild-type (G5/G8+/+) mice, mice heterozygous for ABCG5 and ABCG8 deficiency (G5/G8+/-) and ABCG5/G8-deficient (G5/G8-/-) mice fed a chow diet. Plasma TG were 2.6 and 4.3-fold higher in fasted G5/G8+/- and G5/G8-/- mice, respectively, than in G5/G8+/+ mice. Postprandial TG were 5-fold higher in G5/G8-/- mice. TG metabolism studies indicate that: first, the fractional catabolic rate was significantly lower in G5/G8+/- (1.3-fold) and G5/G8-/- mice (1.5-fold) compared to G5/G8+/+ and postheparin plasma lipoprotein lipase activities were significantly lower in G5/G8+/- (1.8-fold) and G5/G8-/- mice (5.4-fold) than in G5/G8+/+. Second, liver TG secretion was 1.3-fold higher in G5/G8+/- and G5/G8-/- than in G5/G8+/+ mice and this was associated with an increase in liver LXR, FAS, ACAC and CD36 gene expression. Third, TG intestinal secretion, determined after an oral fat gavage of glycerol tri[9,10(n)-(3)H] oleate, was 5.8-fold higher in G5/G8-/- than in G5/G8+/+ mice. Also, the HOMA index was 2.6-fold higher in G5/G8-/- than in G5/G8+/+ mice, reflecting a degree of insulin resistance. In conclusion, ABCG5/G8 deficiency in mice fed a chow diet markedly raises TG levels by impairing TG catabolism and by increasing liver and intestinal TG secretion.

  7. The ABCC6 transporter: what lessons can be learnt from other ATP-binding cassette transporters?

    PubMed Central

    Vanakker, Olivier M.; Hosen, Mohammad J.; Paepe, Anne De

    2013-01-01

    ABC transporters represent a large family of ATP-driven transmembrane transporters involved in uni- or bidirectional transfer of a large variety of substrates. Divided in seven families, they represent 48 transporter proteins, several of which have been associated with human disease. Among the latter is ABCC6, a unidirectional exporter protein primarily expressed in liver and kidney. ABCC6 deficiency has been shown to cause the ectopic mineralization disorder pseudoxanthoma elasticum (PXE), characterized by calcification and fragmentation of elastic fibers, resulting in oculocutaneous and cardiovascular symptoms. Unique in the group of connective tissue disorders, the pathophysiological relation between the ABCC6 transporter and ectopic mineralization in PXE remains enigmatic, not in the least because of lack of knowledge on the substrate(s) of ABCC6 and its unusual expression pattern. Because many features, including structure and transport mechanism, are shared by many ABC transporters, it is worthwhile to evaluate if and to what extent the knowledge on the physiology and pathophysiology of these other transporters may provide useful clues toward understanding the (patho)physiological role of ABCC6 and how its deficiency may be dealt with. PMID:24137173

  8. Marine medaka ATP-binding cassette (ABC) superfamily and new insight into teleost Abch nomenclature

    PubMed Central

    Jeong, Chang-Bum; Kim, Bo-Mi; Kang, Hye-Min; Choi, Ik-Young; Rhee, Jae-Sung; Lee, Jae-Seong

    2015-01-01

    The ABC gene family is recognized as one of the largest gene families in all kingdoms of life. Although many genes involved in the ABC superfamily have been annotated from several fish species, information on large sets of the ABC superfamily and their evolutionary characterization are still unclear. In the marine medaka Oryzias melastigma, 50 ABC transporters were identified with bioinformatics-aided in silico analyses, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that they could be classified into the eight subfamilies (A–H) that include all members of all ABC subfamilies. Interestingly, several teleosts’ Abcg members were closely clustered with Abch members in a distinctive clade. The abch gene was also observed in the coelacanth and the spotted gar, suggesting that this gene was retained from a bilaterian ancestor and that a gene loss event recently occurred in the tetrapod lineage. In teleosts, the nomenclature of previously annotated abcg genes should be considered carefully, as they form a distinctive clade with the marine medaka abch subfamily and other teleost abch genes, but not with the members of the Abcg subfamily. PMID:26472499

  9. ATP-binding cassette transporter enhances tolerance to DDT in Tetrahymena.

    PubMed

    Ning, YingZhi; Dang, Huai; Liu, GuangLong; Xiong, Jie; Yuan, DongXia; Feng, LiFang; Miao, Wei

    2015-03-01

    The reuse of dichlorodiphenyltrichloroethane (DDT) as an indoor residual spray was permitted by the World Health Organization in 2007, and approximately 14 countries still use DDT to control disease vectors. The extensive exposure of insects to DDT has resulted in the emergence of DDT resistance, especially in mosquitoes, and the mechanism for this resistance in mosquitoes has been widely reported. Spraying can also introduce DDT directly into surface water, and DDT can subsequently accumulate in microorganisms, but the mechanism for the resistance to DDT degradation in microorganisms is unclear. Using whole-genome microarray analysis, we detected an abcb15 gene that was up-regulated in a specific manner by DDT treatment in T. thermophile. The deduced ABCB15 peptide sequence had two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs) to form the structure TMD-NBD-TMD-NBD, and each NBD contained three conserved motifs: Walker-A, C-loop, and Walker-B, which indicated the T. thermophila abcb15 was a typical ABC transporter gene. The expression of ABCB15 fused with a C-terminal green fluorescent protein was found to be on the periphery of the cell, suggesting that ABCB15 was a membrane pump protein. In addition, cells with abcb15 partially knocked down (abcb15-KD) grew slower than wild-type cells in the presence of 256 mg L(-1) DDT, indicating the tolerance of abcb15-KD strain to DDT exposure was decreased. Thus, we suggest that in Tetrahymena, the membrane pump protein encoded by ABCT gene abcb15 can enhance the tolerance to DDT and protect cells from this exogenous toxin by efficiently pumping it to the extracellular space.

  10. The Streptomyces ATP-binding component MsiK assists in cellobiose and maltose transport.

    PubMed Central

    Schlösser, A; Kampers, T; Schrempf, H

    1997-01-01

    Streptomyces reticuli harbors an msiK gene which encodes a protein with an amino acid identify of 90% to a corresponding protein previously identified in Streptomyces lividans. Immunological studies revealed that S. lividans and S. reticuli synthesize their highest levels of MsiK during growth with cellobiose, but not with glucose. Moreover, moderate amounts of MsiK are produced by both species in the course of growth with maltose, melibiose, and xylose and by S. lividans in the presence of xylobiose and raffinose. In contrast, a recently identified cellobiose-binding protein and its distantly related homolog were only found if S. reticuli or S. lividans, respectively, was cultivated with cellobiose. Uptake of cellobiose and maltose was tested and ascertained for S. reticuli and S. lividans, but not for an msiK S. lividans mutant. However, transformants of this mutant carrying the S. reticuli or S. lividans msiK gene on a multicopy plasmid had regained the ability to transport both sugars. The data show that MsiK assists two ABC transport systems. PMID:9068663

  11. Coordinating Role of His216 in MgATP Binding and Cleavage in Pyruvate Carboxylase

    PubMed Central

    2015-01-01

    His216 is a well-conserved residue in pyruvate carboxylases and, on the basis of structures of the enzyme, appears to have a role in the binding of MgATP, forming an interaction with the 3′-hydroxyl group of the ribose ring. Mutation of this residue to asparagine results in a 9-fold increase in the Km for MgATP in its steady-state cleavage in the absence of pyruvate and a 3-fold increase in the Km for MgADP in its steady-state phosphorylation by carbamoyl phosphate. However, from single-turnover experiments of MgATP cleavage, the Kd of the enzyme·MgATP complex is essentially the same in the wild-type enzyme and H216N. Direct stopped-flow measurements of nucleotide binding and release using the fluorescent analogue FTP support these observations. However, the first-order rate constant for MgATP cleavage in the single-turnover experiments in H216N is only 0.75% of that for the wild-type enzyme, and thus, the MgATP cleavage step is rate-limiting in the steady state for H216N but not for the wild-type enzyme. Close examination of the structure of the enzyme suggested that His216 may also interact with Glu218, which in turn interacts with Glu305 to form a proton relay system involved in the deprotonation of bicarbonate. Single-turnover MgATP cleavage experiments with mutations of these two residues resulted in kinetic parameters similar to those observed in H216N. We suggest that the primary role of His216 is to coordinate the binding of MgATP and the deprotonation of bicarbonate in the reaction to form the putative carboxyphosphate intermediate by participation in a proton relay system involving Glu218 and Glu305. PMID:24460480

  12. ATP alone triggers the outward facing conformation of the maltose ATP-binding cassette transporter.

    PubMed

    Bao, Huan; Duong, Franck

    2013-02-01

    The maltose transporter MalFGK(2) is a study prototype for ABC importers. During catalysis, the MalFG membrane domain alternates between inward and outward facing conformations when the MalK dimer closes and hydrolyzes ATP. Because a rapid ATP hydrolysis depends on MalE and maltose, it has been proposed that closed liganded MalE facilitates the transition to the outward facing conformation. Here we find that, in contrast to the expected, ATP is sufficient for the closure of MalK and for the conversion of MalFG to the outward facing state. The outward facing transporter binds MalE with nanomolar affinity, yet neither MalE nor maltose is necessary or facilitates the transition. Thus, the rapid hydrolysis of ATP observed in the presence of MalE and maltose is not because closed liganded MalE accelerates the formation of the outward facing conformation. These findings have fundamental implications for the description of the transport reaction.

  13. Probing the ATP-Binding Pocket of Protein Kinase DYRK1A with Benzothiazole Fragment Molecules.

    PubMed

    Rothweiler, Ulli; Stensen, Wenche; Brandsdal, Bjørn Olav; Isaksson, Johan; Leeson, Frederick Alan; Engh, Richard Alan; Svendsen, John S Mjøen

    2016-11-10

    DYRK1A has emerged as a potential target for therapies of Alzheimer's disease using small molecules. On the basis of the observation of selective DYRK1A inhibition by firefly d-luciferin, we have explored static and dynamic structural properties of fragment sized variants of the benzothiazole scaffold with respect to DYRK1A using X-ray crystallography and NMR techniques. The compounds have excellent ligand efficiencies and show a remarkable diversity of binding modes in dynamic equilibrium. Binding geometries are determined in part by interactions often considered "weak", including "orthogonal multipolar" types represented by, for example, F-CO, sulfur-aromatic, and halogen-aromatic interactions, together with hydrogen bonds that are modulated by variation of electron withdrawing groups. These studies show how the benzothiazole scaffold is highly promising for the development of therapeutic DYRK1A inhibitors. In addition, the subtleties of the binding interactions, including dynamics, show how full structural studies are required to fully interpret the essential physical determinants of binding.

  14. Nodular lesions and mesangiolysis in diabetic nephropathy.

    PubMed

    Wada, Takashi; Shimizu, Miho; Yokoyama, Hitoshi; Iwata, Yasunori; Sakai, Yoshio; Kaneko, Shuichi; Furuichi, Kengo

    2013-02-01

    Diabetic nephropathy is a leading cause of end-stage renal failure all over the world. Advanced human diabetic nephropathy is characterized by the presence of specific lesions including nodular lesions, doughnut lesions, and exudative lesions. Thus far, animal models precisely mimicking advanced human diabetic nephropathy, especially nodular lesions, remain to be fully established. Animal models with spontaneous diabetic kidney diseases or with inducible kidney lesions may be useful for investigating the pathogenesis of diabetic nephropathy. Based on pathological features, we previously reported that diabetic glomerular nodular-like lesions were formed during the reconstruction process of mesangiolysis. Recently, we established nodular-like lesions resembling those seen in advanced human diabetic nephropathy through vascular endothelial injury and mesangiolysis by administration of monocrotaline. Here, in this review, we discuss diabetic nodular lesions and its animal models resembling human diabetic kidney lesions, with our hypothesis that endothelial cell injury and mesangiolysis might be required for nodular lesions.

  15. Inhibitory effect of pyridoxal 5'-phosphate on the DNA binding site of ATP-dependent deoxyribonuclease from Bacillus laterosporus.

    PubMed

    Fujiyoshi, T; Nakayama, J; Anai, M

    1981-04-01

    Bacillus laterosporus ATP-dependent deoxyribonuclease has been found to be inhibited by pyridoxal 5'-phosphate. The inhibition is specific for pyridoxal 5'-phosphate and pyridoxal which are required in relatively high concentrations. Pyridoxamine 5'-phosphate, pyridoxamine, and pyridoxine are ineffective. The inhibition is reversed by dilution or dialysis but can be changed to an irreversible inactivation by reduction of the enzyme . pyridoxal 5'-phosphate complex with sodium borohydride. The compound is a competitive inhibitor with respect to DNA but not ATP. Moreover, the presence of DNA substrate protects the enzyme against this inactivation but the presence of ATP shows no effect. The reduced enzyme . pyridoxal 5'-phosphate complex displays a new absorption maximum at 325 nm and a fluorescence emission at 390-400 nm when excited at 325 nm which are characteristic for epsilon-N-(phosphopyridoxyl)lysine. Thus, B. laterosporus DNase appears to have an essential lysine residue at the DNA binding site of the enzyme, and the enzyme possess two different active sites, a DNA binding site and an ATP binding site.

  16. Allosteric Coupling between the Intracellular Coupling Helix 4 and Regulatory Sites of the First Nucleotide-binding Domain of CFTR

    PubMed Central

    Dawson, Jennifer E.; Farber, Patrick J.; Forman-Kay, Julie D.

    2013-01-01

    Cystic fibrosis is caused by mutations in CFTR (cystic fibrosis transmembrane conductance regulator), leading to folding and processing defects and to chloride channel gating misfunction. CFTR is regulated by ATP binding to its cytoplasmic nucleotide-binding domains, NBD1 and NBD2, and by phosphorylation of the NBD1 regulatory insert (RI) and the regulatory extension (RE)/R region. These regulatory effects are transmitted to the rest of the channel via NBD interactions with intracellular domain coupling helices (CL), particularly CL4. Using a sensitive method for detecting inter-residue correlations between chemical shift changes in NMR spectra, an allosteric network was revealed within NBD1, with a construct lacking RI. The CL4-binding site couples to the RI-deletion site and the C-terminal residues of NBD1 that precede the R region in full-length CFTR. Titration of CL4 peptide into NBD1 perturbs the conformational ensemble in these sites with similar titration patterns observed in F508del, the major CF-causing mutant, and in suppressor mutants F494N, V510D and Q637R NBD1, as well as in a CL4-NBD1 fusion construct. Reciprocally, the C-terminal mutation, Q637R, perturbs dynamics in these three sites. This allosteric network suggests a mechanism synthesizing diverse regulatory NBD1 interactions and provides biophysical evidence for the allosteric coupling required for CFTR function. PMID:24058550

  17. THE EXPERIMENTAL VASCULAR LESIONS PRODUCED BY BACILLUS MALLEI

    PubMed Central

    Duval, Charles W.

    1907-01-01

    1. Bacillus malleiand its poison produce a variety of vascular lesions in the rabbit and the guinea pig. 2. The type of the lesion depends upon, (a) the virulence of the culture, (b) the sex of the animal and (c) the degree of acquired immunity. 3. The vascular changes of a proliferative and degenerative nature produced by the slow action of the glanders poison in rabbits and guinea pigs are analogous to the vascular lesions caused by sub-acute glanders infection in man. 4. The most common site of the glanders vascular lesions of animals and man is the peripheral vessels, and especially the smaller visceral arteries. 5. The aorta is a less common site of the experimental lesions. 6. The vascular lesions produced experimentally by Bacillus mallei and its poison consist of three processes, (a) exudation, (b) proliferation, (c) degeneration. 7. The lesions produced by sub-acute glanders in man consist of two processes, proliferation and degeneration. 8. The primary reaction of the vessels in experimental animals and in sub-acute human glanders consists of a proliferation of the endothelium of the intima. 9. The first degenerative changes observed in experimental animals and in sub-acute human glanders occur in the "innermost layer" of the media and not in the so-called " middle zone." 10. The cause of the degenerative change in the inner layer of the media appears to be interference with the nourishment of the circular muscle fibres of the media by proliferation of the endothelium of the intima. PMID:19867086

  18. Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis.

    PubMed

    Bolten, Marcel; Vahlensieck, Christian; Lipp, Colette; Leibundgut, Marc; Ban, Nenad; Weber-Ban, Eilika

    2017-03-10

    Analogous to eukaryotic ubiquitination, proteins in actinobacteria can be post-translationally modified in a process referred to as pupylation, the covalent attachment of prokaryotic ubiquitin-like protein Pup to lysine side chains of the target protein via an isopeptide bond. As in eukaryotes, an opposing activity counteracts the modification by specific cleavage of the isopeptide bond formed with Pup. However, the enzymes involved in pupylation and depupylation have evolved independently of ubiquitination and are related to the family of ATP-binding and hydrolyzing carboxylate-amine ligases of the glutamine synthetase type. Furthermore, the Pup ligase PafA and the depupylase Dop share close structural and sequence homology and have a common evolutionary history despite catalyzing opposing reactions. Here, we investigate the role played by the nucleotide in the active site of the depupylase Dop using a combination of biochemical experiments and X-ray crystallographic studies. We show that, although Dop does not turn over ATP stoichiometrically with substrate, the active site nucleotide species in Dop is ADP and inorganic phosphate rather than ATP, and that non-hydrolyzable analogs of ATP cannot support the enzymatic reaction. This finding suggests that the catalytic mechanism is more similar to the mechanism of the ligase PafA than previously thought and likely involves the transient formation of a phosphorylated Pup-intermediate. Evidence is presented for a mechanism where the inorganic phosphate acts as the nucleophilic species in amide bond cleavage and implications for Dop function are discussed.

  19. [Bone lesion in multiple myeloma].

    PubMed

    Ise, Mikiko; Takagi, Toshiyuki

    2007-12-01

    Bone destruction is a hallmark of multiple myeloma(MM). Almost all MM patients develop osteolytic bone lesions that can cause pathologic fractures and severe bone pain. Osteolytic lesions result from increased bone resorption due to osteoclast stimulation and decreased bone formation due to osteoblast inhibition. Plain radiography, CT, and MRI are established imaging techniques in MM. FDG-PET imaging is promising newer scanning technique under current evaluation. The aggressive features of MM bone lesions have significantly contributed to poor prognosis. Therefore, a systemic approach to analgesia, which includes radiotherapy and orthopedic intervention, must be applied as a part of the comprehensive care plan of MM patient. Bisphosphonates have been shown to reduce vertebral fractures and bone pain.

  20. Oral Lesions and Lymphoproliferative Disorders

    PubMed Central

    Castellarin, P.; Pozzato, G.; Tirelli, G.; Di Lenarda, R.; Biasotto, M.

    2010-01-01

    Lymphoproliferative disorders are heterogeneous malignancy characterized by the expansion of a lymphoid clone more or less differentiated. At the level of the oral cavity, the lymphoproliferative disorder can occur in various ways, most commonly as lymphoid lesions with extranodal externalization, but sometimes, oral lesions may represent a localization of a disease spread. With regard to the primary localizations of lymphoproliferative disorders, a careful examination of the head and neck, oral, and oropharyngeal area is necessary in order to identify suspicious lesions, and their early detection results in a better prognosis for the patient. Numerous complications have been described and frequently found at oral level, due to pathology or different therapeutic strategies. These complications require precise diagnosis and measures to oral health care. In all this, oral pathologists, as well as dental practitioners, have a central role in the treatment and long-term monitoring of these patients. PMID:20871659

  1. Renal lesions of nondomestic felids.

    PubMed

    Newkirk, K M; Newman, S J; White, L A; Rohrbach, B W; Ramsay, E C

    2011-05-01

    To comprehensively evaluate the occurrence of renal lesions in a variety of nondomestic felids, necropsy cases from 1978 to 2008 were reviewed from a municipal zoo and a large cat sanctuary for those in which the kidneys were examined histologically. Seventy exotic felids were identified (25 tigers, 18 lions, 6 cougars, 5 leopards, 3 snow leopards, 3 clouded leopards, 3 Canadian lynx, 2 ocelots, 2 bobcats, 2 cheetahs, 1 jaguar), and their histologic renal lesions were evaluated and compared. The most common lesion was tubulointerstitial nephritis (TIN); 36 of 70 (51%) cats were affected to some degree. Lymphocytic interstitial nephritis was the most common lesion in the tigers (9 of 25, 36%) and was rarely seen in other species. Although the renal pelvis was not available for all cats, 28 of 47 (60%) had some degree of lymphocytic pyelitis. There was no significant association between the presence of pyelitis and that of TIN. Only 1 cat had pyelonephritis. Renal papillary necrosis was present in 13 of 70 (19%) cats and was significantly associated with historical nonsteroidal anti-inflammatory drug treatment (odds ratio, 7.1; 95% confidence interval, 1.9 to 26.8). Only 1 cat (lion) had amyloid accumulation, and it was restricted to the corticomedullary junction. Primary glomerular lesions were absent in all cats. Intraepithelial pigment was identified in many of the cats but was not correlated with severity of TIN. Despite several previous reports describing primary glomerular disease or renal amyloidosis in exotic felids, these lesions were rare to absent in this population.

  2. Can Small Lesions Induce Language Reorganization as Large Lesions Do?

    ERIC Educational Resources Information Center

    Maestu, Fernando; Saldana, Cristobal; Amo, Carlos; Gonzalez-Hidalgo, Mercedes; Fernandez, Alberto; Fernandez, Santiago; Mata, Pedro; Papanicolaou, Andrew; Ortiz, Tomas

    2004-01-01

    Shift of the cortical mechanisms of language from the usually dominant left to the non-dominant right hemisphere has been demonstrated in the presence of large brain lesions. Here, we report a similar phenomenon in a patient with a cavernoma over the anterolateral superior temporal gyrus associated with epilepsy. Language mapping was performed by…

  3. [Interpreting the hospitalization experiences of patients with spine lesion].

    PubMed

    de Albuquerque, Ana Lúcia Pereira; de Freitas, Consuelo Helena Aires; Jorge, Maria Salete Bessa

    2009-01-01

    Qualitative study with theoretical axis in symbolic interactionism interpretative of Norman Denzin that had as objective to comprehend the meanings of experiences lived by being victim of spine lesion in context hospital and to describe the narratives in range of experiences lived. The subjects of research were seven patient victims of spine lesion traumatic hospitalized in unity of neurology of Institute Dr. José Frota, sited in Fortaleza/Ce. Interpreted hard fronting to balance of oneself, given to sudden breaking of trajectory of their lives, the organic alterations acquired that pass to be motives of fears, uncertain, non-comfort and menace to life that had along their families.

  4. Cutaneous lesions of the nose

    PubMed Central

    2010-01-01

    Skin diseases on the nose are seen in a variety of medical disciplines. Dermatologists, otorhinolaryngologists, general practitioners and general plastic and dermatologic surgeons are regularly consulted regarding cutaneous lesions on the nose. This article is the second part of a review series dealing with cutaneous lesions on the head and face, which are frequently seen in daily practice by a dermatologic surgeon. In this review, we focus on those skin diseases on the nose where surgery or laser therapy is considered a possible treatment option or that can be surgically evaluated. PMID:20525327

  5. Lesion detectability in digital radiography

    NASA Astrophysics Data System (ADS)

    Gagne, Robert M.; Boswell, Jonathan S.; Myers, Kyle J.; Peter, Guillaume

    2001-06-01

    The usefulness of Fourier-based measures of imaging performance has come into question for the evaluation of digital imaging systems. Figures of merit such as detective quantum efficiency are relevant for linear, shift-invariant systems with stationary noise. However, no digital imaging system is shift invariant, and realistic images do not satisfy the stationarity condition. Our methods for task- based evaluation of imaging systems, based on lesion detectability, do not require such assumptions. We have computed the performance of Hotelling and nonprewhitening matched-filter observers for the task of lesion detection in digital radiography.

  6. Investigation of brachial plexus traction lesions by peripheral and spinal somatosensory evoked potentials.

    PubMed Central

    Jones, S J

    1979-01-01

    Peripheral, spinal and cortical somatosensory evoked potentials were recorded in 26 patients with unilateral traction injuries of the brachial plexus ganglia. Of 10 cases explored surgically the recordings correctly anticipated the major site of the lesion in eight. PMID:422958

  7. [Combined polyurethane foam and hydrogel dressing. Outcome in lesions of diverse etiology].

    PubMed

    Rueda López, Justo; Arboix Perejamo, Montserrat; Muñoz Bueno, Ana Maria; Rosell Moreno, Carmen; Blanco Blanco, Joan; Ballester Torralba, Jordi; Gago Fornells, Manuel; García González, R Fernando

    2004-11-01

    The authors present an observational evaluation on the effectiveness of a dressing included in the Indafoam brand for treatment of skin lesions due to different etiology which have an acute or chronic diagnosis; the authors include some very valuable information for professionals who use combined polyurethane foam and hydrogel dressings in their daily practice. Due to their composition, these dressings may be considered combined dressings having only one structure which maintains a stable temperature at the lesion site; these dressings have a high absorption capacity which prevents maceration of the skin surrounding lesions and protects lesions from contamination by exogenous germs.

  8. Imaging inflammatory acne: lesion detection and tracking

    NASA Astrophysics Data System (ADS)

    Cula, Gabriela O.; Bargo, Paulo R.; Kollias, Nikiforos

    2010-02-01

    It is known that effectiveness of acne treatment increases when the lesions are detected earlier, before they could progress into mature wound-like lesions, which lead to scarring and discoloration. However, little is known about the evolution of acne from early signs until after the lesion heals. In this work we computationally characterize the evolution of inflammatory acne lesions, based on analyzing cross-polarized images that document acne-prone facial skin over time. Taking skin images over time, and being able to follow skin features in these images present serious challenges, due to change in the appearance of skin, difficulty in repositioning the subject, involuntary movement such as breathing. A computational technique for automatic detection of lesions by separating the background normal skin from the acne lesions, based on fitting Gaussian distributions to the intensity histograms, is presented. In order to track and quantify the evolution of lesions, in terms of the degree of progress or regress, we designed a study to capture facial skin images from an acne-prone young individual, followed over the course of 3 different time points. Based on the behavior of the lesions between two consecutive time points, the automatically detected lesions are classified in four categories: new lesions, resolved lesions (i.e. lesions that disappear completely), lesions that are progressing, and lesions that are regressing (i.e. lesions in the process of healing). The classification our methods achieve correlates well with visual inspection of a trained human grader.

  9. Cystic Lesions in Autoimmune Pancreatitis.

    PubMed

    Gompertz, Macarena; Morales, Claudia; Aldana, Hernán; Castillo, Jaime; Berger, Zoltán

    2015-01-01

    Autoimmune pancreatitis (AIP) can be chronic or recurrent, but frequently completely reversible after steroid treatment. A cystic lesion in AIP is a rare finding, and it can mimic a pancreatic cystic neoplasm. Difficulties in an exact diagnosis interfere with treatment, and surgery cannot be avoided in some cases. We report the history of a 63-year-old male presenting with jaundice and pruritus. AIP was confirmed by imaging and elevated IgG4 blood levels, and the patient completely recovered after corticosteroid therapy. One year later, he presented with a recurrent episode of AIP with elevated IgG4 levels, accompanied by the appearance of multiple intrapancreatic cystic lesions. All but 1 of these cysts disappeared after steroid treatment, but the remaining cyst in the pancreatic head was even somewhat larger 1 year later. Pancreatoduodenectomy was finally performed. Histology showed the wall of the cystic lesion to be fibrotic; the surrounding pancreatic tissue presented fibrosis, atrophy and lymphoplasmacytic infiltration by IgG4-positive cells, without malignant elements. Our case illustrates the rare possibility that cystic lesions can be part of AIP. These pseudocysts appear in the pancreatic segments involved in the autoimmune disease and can be a consequence of the local inflammation or related to ductal strictures. Steroid treatment should be initiated, after which these cysts can completely disappear with recovery from AIP. Surgical intervention may be necessary in some exceptional cases.

  10. Microbial community profiling shows dysbiosis in the lesional skin of Vitiligo subjects

    PubMed Central

    Ganju, Parul; Nagpal, Sunil; Mohammed, MH; Nishal Kumar, P; Pandey, Rajesh; Natarajan, Vivek T; Mande, Sharmila S.; Gokhale, Rajesh S.

    2016-01-01

    Healthy human skin harbours a diverse array of microbes that comprise the skin microbiome. Commensal bacteria constitute an important component of resident microbiome and are intricately linked to skin health. Recent studies describe an association between altered skin microbial community and epidemiology of diseases, like psoriasis, atopic dermatitis etc. In this study, we compare the differences in bacterial community of lesional and non-lesional skin of vitiligo subjects. Our study reveals dysbiosis in the diversity of microbial community structure in lesional skin of vitiligo subjects. Although individual specific signature is dominant over the vitiligo-specific microbiota, a clear decrease in taxonomic richness and evenness can be noted in lesional patches. Investigation of community specific correlation networks reveals distinctive pattern of interactions between resident bacterial populations of the two sites (lesional and non-lesional). While Actinobacterial species constitute the central regulatory nodes (w.r.t. degree of interaction) in non-lesional skin, species belonging to Firmicutes dominate on lesional sites. We propose that the changes in taxonomic characteristics of vitiligo lesions, as revealed by our study, could play a crucial role in altering the maintenance and severity of disease. Future studies would elucidate mechanistic relevance of these microbial dynamics that can provide new avenues for therapeutic interventions. PMID:26758568

  11. Photodynamic Therapy – A Non-invasive Treatment Modality for Precancerous Lesions

    PubMed Central

    Maloth, Kotya Naik; Velpula, Nagalaxmi; Kodangal, Srikanth; Sangmesh, Mithare; Vellamchetla, Kiran; Ugrappa, Sridevi; Meka, Nagajyothi

    2016-01-01

    Introduction: Oral premalignant lesions are conditions having high potential tendency for transformation into malignancy. The use of a conservative and effective treatment modality is one of the best strategies for cancer prevention. Photodynamic therapy (PDT) is a non-invasive method for topical and selective treatment of oral precancerous lesions. The present study was taken up to determine the efficacy of PDT in oral precancerous lesions. Methods: The study consisted 13 patients with 24 oral leukoplakia (OL) lesions and 8 with 20 oral lichen planus (OLP) lesions, divided into control and study groups. These lesions were affecting various intraoral sites, the buccal mucosa being the most common site followed by tongue and gingiva. The treatment regimen of PDT included 98% 5–aminolevulinic acid (5-ALA) which is topical applied and irradiated with light emitting diode (LED) of 420 nm wavelengths at several sessions. Results: In OL 16.6% of cases showed complete response, 66.6% partial response and 16.6% no response of the lesions to the treatment. In OLP 80% and 20% of the lesions showed partial and no response respectively. The differences with control groups for OL + OLP were found to be significant (P < 0.001). Conclusion: Based on the results of the present study, we can conclude that PDT appears to be a feasible alternative to conventional therapy for oral premalignant lesions. PMID:27330695

  12. Current advances in lesion-symptom mapping of the human cerebellum.

    PubMed

    Timmann, D; Konczak, J; Ilg, W; Donchin, O; Hermsdörfer, J; Gizewski, E R; Schoch, B

    2009-09-01

    While high-resolution structural magnetic resonance imaging (MRI) combined with newer analysis methods has become a powerful tool in human cerebral lesion studies, comparatively few studies have used these advanced imaging techniques to study lesions of the human cerebellum and their associated symptoms. This review will summarize the methodology of MRI-based lesion-symptom mapping of the human cerebellum and discuss its potential for gaining insights into cerebellar function. The investigation of patients with defined focal lesions yields the greatest potential for obtaining meaningful correlations between lesion site and behavioral deficits. In smaller groups of patients overlay plots and subtraction analysis are good options. If larger groups of patients are available, different statistical techniques have been introduced to compare behavior and lesion site on a voxel-by-voxel basis. Although localization in degenerative cerebellar disorders is less accurate because of the diffuse nature of the disease, certain information about the supposed function of larger subdivisions of the cerebellum can be gained. Examples are given which show that lesion-symptom mapping allows to investigate the function of the intermediate zone and cerebellar nuclei. We conclude that meaningful correlations between lesion site and behavioral data can be obtained in patients with degenerative as well as focal cerebellar disorders.

  13. Spatial contrast sensitivity in unilateral cerebral ischaemic lesions involving the posterior visual pathway.

    PubMed

    Bulens, C; Meerwaldt, J D; van der Wildt, G J; Keemink, C J

    1989-04-01

    Contrast sensitivity function was studied in 16 patients with unilateral ischaemic lesions involving the posterior visual pathway. Sixty-two percent of the patients showed contrast sensitivity loss in at least one eye for horizontal or vertical stimulus orientation. Visual perception was distorted in a qualitatively different way according to the anteroposterior site of the lesion. Patients with occipital or occipitotemporal lesions showed high spatial frequency selective losses and patients with temporal or parietal lesions low frequency selective losses. Stimulus orientation selectivity was observed in patients with lesions of the primary visual cortex as well as in patients with lesions anterior to the striate cortex. Contrast sensitivity orientation-selective losses were demonstrated in 14 of the 17 'affected' eyes.

  14. Hock lesions and free-stall design.

    PubMed

    Weary, D M; Taszkun, I

    2000-04-01

    We compared the prevalence and severity of skin lesions on the hocks of lactating dairy cows in southern British Columbia, comparing 20 farms using three common bedding surfaces: sawdust, sand, and geotextile mattresses. Skin lesions were scored at five positions on the hock. For each position we noted if the lesion showed inflammatory attributes, and then assigned a severity score. Of the 1752 lactating cows scored, 1267 cows (73%) had at least one hock lesion. Of those cows with lesions, 87% had lesions on both legs, 76% had lesions on more than one location on the hock, and 78% had a lesion of at least moderate severity (i.e., evidence of skin breakage or an area of hair loss >10 cm2). Lesions were most prevalent on farms that used geotextile mattresses (91% of cows) and least common on farms that used sand (24% of cows). Moreover, lesions on cows from farms using mattresses were more numerous and more severe than those on cows from sand-bedded farms. The prevalence and severity of lesions on farms using sawdust was intermediate. Lesions also varied in relation to location on the hock. For farms using geotextile mattresses, lesions were more common and more severe on the lateral surfaces of both the tuber calcis and the tarsal joint. On farms using sawdust, lesions were common on the dorsal surface of the tuber calcis and the lateral surfaces of both the tuber calcis and the tarsal joint. Lesions were rare on all five positions for cows from sand-bedded farms. Among the 10 farms sampled using sawdust, we found a significant negative relationship between the length of the stall and severity of lesions. For cows with lesions, the number and severity of lesions increased with age.

  15. Pathological laughter and crying in patients with pontine lesions.

    PubMed

    Elyas, Amin E; Bulters, Diederik O; Sparrow, Owen C

    2011-12-01

    Pathological laughter and crying (PLC) has been widely documented in the medical literature in association with various pathological processes in the brainstem, particularly infarction. However, it remains poorly understood. The authors present a case report and analyze all the cases in the literature to try to localize a putative faciorespiratory center. This 13-year-old girl developed a pontine abscess subsequent to sphenoid sinusitis. This increased in size despite antibiotic treatment, and she developed PLC. The abscess was then stereotactically aspirated, with resolution of the symptoms. A PubMed search of the term "pathological laughter and crying" was performed. From these papers all reported cases of PLC were identified. Cases without neuroimaging were excluded. The remaining cases were categorized as small lesions permitting accurate localization within the pons, or large nonlocalizing lesions. All images of localizing lesions were magnified to the same size and placed on a grid. From this an area of maximal overlap was identified. The authors identified 7 cases of small localizing lesions with adequate imaging. The area of maximal overlap was in the region of the anterior paramedian pons. All the lesions involved this region of the pons. There were 28 further reports of large lesions that either resulted in gross compressive distortion of the pons or diffusely infiltrated it, and thus, although implicating involvement of a pontine center, did not allow for localization of a specific region of the pons. The authors report a case of PLC caused by a pontine abscess. Symptoms were reversible with stereotactically assisted aspiration and antibiotic administration. Analysis of the lesions reported in the literature showed a pattern toward a regulatory center in the pons. The most consistently involved region was in the anterior paramedian pons, and this may be the site of a faciorespiratory center.

  16. Human Papillomavirus in the Lesions of the Oral Mucosa According to Topography

    PubMed Central

    Mravak-Stipetić, Marinka; Sabol, Ivan; Kranjčić, Josip; Knežević, Marjana; Grce, Magdalena

    2013-01-01

    Background The association between human papillomavirus (HPV) types and oral lesions has been shown in many studies. Considering the significance that HPV has in the development of malignant and potentially malignant disorders of the oral mucosa, the purpose of this study was to investigate the prevalence of HPV DNA in different oral lesions. In addition, we wanted to elucidate whether the HPV infection is associated predominantly with either the lesion or a particular anatomic site of the oral cavity. Methodology/Principal Findings The study included 246 subjects with different oral lesions, and 73 subjects with apparently healthy oral mucosa (controls). The oral lesions were classified according to their surface morphology and clinical diagnosis. The epithelial cells were collected with a cytobrush from different topographic sites in the oral cavity of the oral lesions and controls. The presence of HPV DNA was evaluated by consensus and type-specific primer-directed polymerase chain reaction. The HPV positivity was detected in 17.7% of oral lesions, significantly more than in apparently healthy mucosa (6.8%), with a higher presence in benign proliferative mucosal lesions (18.6%). High-risk HPV types were predominantly found in potentially malignant oral disorders (HPV16 in 4.3% and HPV31 in 3.4%), while benign proliferative lesions as well as healthy oral mucosa contained mainly undetermined HPV type (13.6 and 6.8%, respectively). Conclusions/Significance The distribution of positive HPV findings on the oral mucosa seems to be more associated with a particular anatomical site than the diagnosis itself. Samples taken from the vermilion border, labial commissures, and hard palate were most often HPV positive. Thus, topography plays a role in HPV prevalence findings in oral lesions. Because of the higher prevalence of the high-risk HPV types in potentially malignant oral disorders, these lesions need to be continuously controlled and treated. PMID:23922786

  17. Preoptic-hypothalamic periventricular lesions: thirst deficits and hypernatremia.

    PubMed

    Buggy, J; Jonhson, A K

    1977-07-01

    To assess the significance of stimulation studies suggesting an anteroventral third ventricle (AV3V) dipsogenic site of action for hyperosmotic and angiotensin thirst stimuli, electrolytic lesions of periventricular tissue surrounding AV3V were produced under ether anesthesia in rats preselected for responsiveness to subcutaneous angiotensin and hypertonic NaCl thirst challenges. Lesions limited to preoptic-anterior hypothalamic periventricular substrates resulted in adipsia; those rats resuming ad lib. drinking after a period of adipsia exhibited persistent drinking deficits to angiotensin and hypertonic NaCl thirst challenges, reduced drinking after water deprivation, and increased plasma osmolality and sodium. Drinking to polyethylene glycol-induced hypovolemia and feeding after food deprivation did not differ between lesioned and sham-lesioned animals. The disturbances in behavioral control of fluid balance imply that AV3V periventricular tissue normally plays a key role in mediating regulatory drinking. It is proposed that these AV3V periventricular lesion-induced effects on drinking behavior are due to destruction of receptors and/or integrative systems monitoring fluid-borne angiotensin and hyperosmotic stimuli.

  18. Covalently Linked Tandem Lesions in DNA

    PubMed Central

    Patrzyc, Helen B.; Dawidzik, Jean B.; Budzinski, Edwin E.; Freund, Harold G.; Wilton, John H.; Box, Harold C.

    2013-01-01

    Reactive oxygen species (ROS) generate a type of DNA damage called tandem lesions, two adjacent nucleotides both modified. A subcategory of tandem lesions consists of adjacent nucleotides linked by a covalent bond. Covalently linked tandem lesions generate highly characteristic liquid chromotography-tandem mass spectrometry (LC-MS/MS) elution profiles. We have used this property to comprehensively survey X-irradiated DNA for covalently linked tandem lesions. A total of 15 tandem lesions were detected in DNA irradiated in deoxygenated aqueous solution, five tandem lesions were detected in DNA that was irradiated in oxygenated solution. PMID:23106212

  19. Relocalization of DNA lesions to the nuclear pore complex

    PubMed Central

    Freudenreich, Catherine H.; Su, Xiaofeng A.

    2016-01-01

    Early screens in yeast for mutations exhibiting sensitivity to DNA damage identified nuclear pore components, but their role in DNA repair was not well understood. Over the last decade, studies have revealed that several types of persistent DNA lesions relocate to either the nuclear pore complex (NPC) or nuclear envelope (NE). Of these two sites, the nuclear pore appears to be crucial for DNA repair of persistent double-strand breaks, eroded telomeres and sites of fork collapse at expanded CAG repeats. Using a combination of cell biological imaging techniques and yeast genetic assays for DNA repair, researchers have begun to understand both the how and why of lesion relocation to the NPC. Here we review the types of lesions that relocate to the NPC, mediators of relocation and the functional consequences of relocation understood to date. The emerging theme is that relocation to the NPC regulates recombination to influence repair pathway choice and provide a rescue mechanism for lesions or DNA structures that are resistant to repair. PMID:27799300

  20. Dieulafoy's lesion of the rectum.

    PubMed

    Gul, Y A; Jabbar, M F; Karim, F A; Moissinac, K

    2002-06-01

    Dieulafoy's lesion is an uncommon cause of gastrointestinal haemorrhage. It may present with massive and life threatening bleed and although more common in the upper gastrointestinal tract, it is being increasingly reported as affecting the lower gastrointestinal tract. Diagnosis is usually achieved during proctoscopic and endoscopic visualization. In cases where there is profuse and torrential hemorrhage, angiography may help to confirm the diagnosis. There are a few treatment options available, all of which have a varying degree of success. More commonly than not, a combination of treatment is warranted as illustrated by our case. Recurrent bleeding may occur just as in cases of Dieulafoy's lesion affecting the upper gastrointestinal tract. Even though endoscopic visualization of the lower gastrointestinal tract in the presence of profuse lower gastrointestinal haemorrhage may not be possible, this important procedure should not be omitted as the bleeding source may be lying in a low and accessible location for prompt interventional haemorrhage control.

  1. Os Odontoideum: Rare Cervical Lesion

    DTIC Science & Technology

    2011-11-01

    the articulation between C1 and the os odontoideum on flexion imaging. The remainder of his cervical vertebral bodies had normal alignment with no...appears normal. Figure 3. Flexion view of plain cervical spine. This image shows abnormal translation of the articulation between C1 and the C2 os...worldwide. Peer Reviewed Title: Os Odontoideum: Rare Cervical Lesion Journal Issue: Western Journal of Emergency Medicine, 12(4) Author: Robson

  2. Vascular lesions in lupus nephritis.

    PubMed

    Grishman, E; Venkataseshan, V S

    1988-05-01

    Three groups of kidney specimens from patients with systemic lupus erythematosus (SLE) were examined for histologic evidence of vascular lesions in small arteries and arterioles. Group 1 consisted of 24 autopsy kidneys from patients who died before the advent of steroid therapy, and Group 2, of 26 more recent autopsy specimens from patients treated with steroids and/or immunosuppressive drugs. Group 3 comprised 276 renal biopsies. Group 1 showed characteristic subendothelial eosinophilic deposits in small arteries and arterioles of 8 cases; Group 2 showed similar lesions in 5 specimens, while 3 others revealed evidence of resorption of deposits. Deposits were characterized by clumping and were delimited toward the media by a thick basement membrane. Only one case showed necrotizing arteritis resembling polyarteritis nodosa. Group 3 presented vascular deposits in 19 cases and thrombotic microangiopathy in 2. Electron microscopic appearance of some of the deposits is described. Immunofluorescence microscopy showed a mixture of IgG, IgA, and IgM in 7 cases, a finding that was not seen in a group of non-lupus patients with various vascular lesions. Vascular deposits are generally rare in systemic lupus erythematosus, although in autopsies widely scattered involvement of arteries and arterioles was seen in nearly 1/3 of the cases. The deposits were more common in male patients. The evolution of the lesions could be followed through various stages to eventual sclerosis, particularly in patients treated with steroids or immunosuppressants. Some deposits appeared to resolve after treatment. Patients with vascular deposits had more severe glomerular disease and a more serious clinical course. Thrombotic microangiopathy appears to be a secondary phenomenon whose pathogenesis is unknown.

  3. Fibronectin in multiple sclerosis lesions.

    PubMed Central

    Sobel, R. A.; Mitchell, M. E.

    1989-01-01

    Cryostat sections of central nervous system (CNS) tissues of patients with multiple sclerosis (MS) and other CNS diseases were stained with antibodies to fibronectin, a macrophage fibronectin receptor component, fibrin/fibrinogen, and albumin using immunoperoxidase. In active, but not inactive, MS plaques vessel fibronectin was increased (to approximately 57% of Factor VIII+ vessels) over uninvolved MS and normal control white matter (P less than 0.001 for both). Fibronectin was primarily localized to vessel walls and amount of staining correlated with degree of inflammation. Active plaques and necrotic lesions also had extracellular fibronectin and fibrin/ogen. These molecules and the fibronectin receptor were found on macrophages. Albumin was more widely and diffusely distributed in lesions than fibronectin. Thus, in addition to extravasation from damaged vessels, fibronectin may be deposited on or synthesized by endothelial cells and macrophages in the CNS. Fibronectin could facilitate monocyte adhesion to endothelial cell luminal surfaces, promote migration of mononuclear cells, and enhance myelin phagocytosis in MS lesions. Images Figure 1 Figure 2 PMID:2528301

  4. Automatic segmentation of psoriasis lesions

    NASA Astrophysics Data System (ADS)

    Ning, Yang; Shi, Chenbo; Wang, Li; Shu, Chang

    2014-10-01

    The automatic segmentation of psoriatic lesions is widely researched these years. It is an important step in Computer-aid methods of calculating PASI for estimation of lesions. Currently those algorithms can only handle single erythema or only deal with scaling segmentation. In practice, scaling and erythema are often mixed together. In order to get the segmentation of lesions area - this paper proposes an algorithm based on Random forests with color and texture features. The algorithm has three steps. The first step, the polarized light is applied based on the skin's Tyndall-effect in the imaging to eliminate the reflection and Lab color space are used for fitting the human perception. The second step, sliding window and its sub windows are used to get textural feature and color feature. In this step, a feature of image roughness has been defined, so that scaling can be easily separated from normal skin. In the end, Random forests will be used to ensure the generalization ability of the algorithm. This algorithm can give reliable segmentation results even the image has different lighting conditions, skin types. In the data set offered by Union Hospital, more than 90% images can be segmented accurately.

  5. Imaging of skull base lesions.

    PubMed

    Kelly, Hillary R; Curtin, Hugh D

    2016-01-01

    Skull base imaging requires a thorough knowledge of the complex anatomy of this region, including the numerous fissures and foramina and the major neurovascular structures that traverse them. Computed tomography (CT) and magnetic resonance imaging (MRI) play complementary roles in imaging of the skull base. MR is the preferred modality for evaluation of the soft tissues, the cranial nerves, and the medullary spaces of bone, while CT is preferred for demonstrating thin cortical bone structure. The anatomic location and origin of a lesion as well as the specific CT and MR findings can often narrow the differential diagnosis to a short list of possibilities. However, the primary role of the imaging specialist in evaluating the skull base is usually to define the extent of the lesion and determine its relationship to vital neurovascular structures. Technologic advances in imaging and radiation therapy, as well as surgical technique, have allowed for more aggressive approaches and improved outcomes, further emphasizing the importance of precise preoperative mapping of skull base lesions via imaging. Tumors arising from and affecting the cranial nerves at the skull base are considered here.

  6. Menstrual bleeding from an endometriotic lesion.

    PubMed

    Burney, Richard O; Lathi, Ruth B

    2009-05-01

    We present a case in which endometriotic lesions were observed to be focally hemorrhagic at laparoscopy performed during menstruation. Red vesicular lesions likely represent early disease with intact capacity for hormonally induced menstrual bleeding.

  7. EttA regulates translation by binding to the ribosomal E site and restricting ribosome-tRNA dynamics

    PubMed Central

    Chen, Bo; Boël, Grégory; Hashem, Yaser; Ning, Wei; Fei, Jingyi; Wang, Chi; Gonzalez, Ruben L.; Hunt, John F.; Frank, Joachim

    2014-01-01

    Cells express many ribosome-interacting factors whose functions and molecular mechanisms remain unknown. Here, we elucidate the mechanism of a newly characterized regulatory translation factor, Energy-dependent Translational Throttle A (EttA), which is an Escherichia coli representative of the ATP-binding cassette F (ABC-F) protein family. Using cryo-EM, we demonstrate that the ATP-bound form of EttA binds to the ribosomal tRNA exit (E) site, where it forms bridging interactions between the ribosomal L1 stalk and the tRNA bound in the peptidyl-tRNA binding (P) site. Using single-molecule fluorescence resonance energy transfer (smFRET), we show that the ATP-bound form of EttA restricts ribosome and tRNA dynamics required for protein synthesis. This work represents the first example, to our knowledge, where the detailed molecular mechanism of any ABC-F family protein has been determined and establishes a framework for elucidating the mechanisms of other regulatory translation factors. PMID:24389465

  8. Structural characterization of the GSK-3beta active site using selective and non-selective ATP-mimetic inhibitors.

    PubMed

    Bertrand, J A; Thieffine, S; Vulpetti, A; Cristiani, C; Valsasina, B; Knapp, S; Kalisz, H M; Flocco, M

    2003-10-17

    GSK-3beta is a regulatory serine/threonine kinase with a plethora of cellular targets. Consequently, selective small molecule inhibitors of GSK-3beta may have a variety of therapeutic uses including the treatment of neurodegenerative diseases, type II diabetes and cancer. In order to characterize the active site of GSK-3beta, we determined crystal structures of unphosphorylated GSK-3beta in complex with selective and non-selective ATP-mimetic inhibitors. Analysis of the inhibitors' interactions with GSK-3beta in the structures reveals how the enzyme can accommodate a number of diverse molecular scaffolds. In addition, a conserved water molecule near Thr138 is identified that can serve a functional role in inhibitor binding. Finally, a comparison of the interactions made by selective and non-selective inhibitors highlights residues on the edge of the ATP binding-site that can be used to obtain inhibitor selectivity. Information gained from these structures provides a promising route for the design of second-generation GSK-3beta inhibitors.

  9. Frameless neuronavigation using the ISG-system in practice: from craniotomy to delineation of lesion.

    PubMed

    Kleinpeter, G; Lothaller, C

    2003-10-01

    The overall performance of a "pointer" neuronavigation system (the ISG ALLEGRO Viewing Wand) in everyday surgical use was evaluated by investigating the practical utility of the technical set-up for one particular surgical task. The basis of the analysis was the numerical evaluation of four areas of fundamental importance for most brain surgery: site and size of craniotomy, localisation of lesion, the trajectory through the brain, and the delineation of the lesion. In a protocol of 65 patients we based our examination on a subjective 4-point rating scale ranging from 0 (= no help) to 3 (= very helpful) for each of the four above categories. We investigated the potential influence of three factors: the lesions histology (4 groups), its size (3 categories) and the depth from the cortical surface (3 levels). Our experience is that the histology of the lesions has significant influence on the relative usefulness of neuronavigation for craniotomy (P < 0.017) and for delineation of the lesion (P < 0.003). We found neuronavigation most helpful for removing gliomas. Second, this system was found to be very helpful in locating small, hitherto hard-to-find, lesions (P < 0.01). Lesion's depth had no effect on the ratings (P > 0.2). Overall, the use of this system led to more precise skin incisions, better site and size of craniotomies tailored to the pathology, the trajectory through the brain, and to more precise delineation of the lesion.

  10. Fine Needle Aspiration Cytology of Papulonodular Lesions of Skin: A Study of 50 Cases

    PubMed Central

    Mahadevappa, Asha; Manjunath, Gubbanna Vimalambike

    2016-01-01

    Introduction Skin is one of the frequent site of disease in human body. Fine Needle Aspiration Cytology (FNAC) is a safe diagnostic method in these cases. FNAC has some limitation, particularly related to representativity of samples, exact typing of skin adnexal tumours and classifying the nature of metastatic cutaneous nodules. Thus, FNAC alone may not give a confirmative diagnosis regarding few skin lesions. Hence, histopathological study has been the standard technique for the diagnosis of skin lesions. Aim To study the FNAC findings in various papulonodular lesions and to correlate them with histopathological findings wherever possible. Materials and Methods In the present study, 50 cases of clinically diagnosed papulonodular lesions were evaluated by FNAC and correlated with histopathology wherever possible. Results There was 100% correlation in cases of epidermal cyst, leprosy, tuberculosis, actinomycosis, acute and chronic inflammatory lesions and 67% accuracy was seen in adnexal tumours. Aspiration cytology along with radiological studies proved very useful in classifying the nature of metastatic cutaneous nodules and suggesting the possible site of unknown primary. Sensitivity of FNAC for epidermal cyst and inflammatory lesions was 100%. In case of adnexal tumours, sensitivity and specificity was 67% and 50% respectively. Conclusion FNAC is a rapid, efficient, cost effective, relatively painless procedure and produces a speedy result with high diagnostic accuracy. It has high rates of sensitivity and specificity in diagnosing papulonodular lesions of skin and hence, is a valuable tool in the diagnosis and management of patients with papulonodular skin lesions. PMID:28208863

  11. Clustered DNA lesion repair in eukaryotes: relevance to mutagenesis and cell survival

    PubMed Central

    Sage, Evelyne; Harrison, Lynn

    2011-01-01

    A clustered DNA lesion, also known as a multiply damaged site, is defined as ≥ 2 damages in the DNA within 1–2 helical turns. Only ionizing radiation and certain chemicals introduce DNA damage in the genome in this non-random way. What is now clear is that the lethality of a damaging agent is not just related to the types of DNA lesions introduced, but also to how the damage is distributed in the DNA. Clustered DNA lesions were first hypothesized to exist in the 1990’s, and work has progressed where these complex lesions have been characterized and measured in irradiated as well as in non-irradiated cells. A clustered lesion can consist of single as well as double strand breaks, base damage and abasic sites, and the damages can be situated on the same strand or opposing strands. They include tandem lesions, double strand break (DSB) clusters and non-DSB clusters, and base excision repair as well as the DSB repair pathways can be required to remove these complex lesions. Due to the plethora of oxidative damage induced by ionizing radiation, and the repair proteins involved in their removal from the DNA, it has been necessary to study how repair systems handle these lesions using synthetic DNA damage. This review focuses on the repair process and mutagenic consequences of clustered lesions in yeast and mammalian cells. By examining the studies on synthetic clustered lesions, and the effects of low vs high LET radiation on mammalian cells or tissues, it is possible to extrapolate the potential biological relevance of these clustered lesions to the killing of tumor cells by radiotherapy and chemotherapy, and to the risk of cancer in non-tumor cells, and this will be discussed. PMID:21185841

  12. Promotion of endodontic lesions in rats by a novel extraradicular biofilm model using obturation materials.

    PubMed

    Kuremoto, Katsutaka; Noiri, Yuichiro; Ishimoto, Takuya; Yoneda, Naomichi; Yamamoto, Reiko; Maezono, Hazuki; Nakano, Takayoshi; Hayashi, Mikako; Ebisu, Shigeyuki

    2014-07-01

    Although extraradicular biofilm formation is related to refractory periapical periodontitis, the mechanism of extraradicular biofilm development, as well as its effect on periapical lesions, is unknown. Therefore, we aimed to develop an in vivo extraradicular biofilm model in rats and to identify and quantify extraradicular biofilm-forming bacteria while investigating the effect of extraradicular biofilms on periapical lesions. Periapical lesions were induced by exposing the pulpal tissue of the mandibular first molars of male Wistar rats to their oral environment. Four weeks later, gutta-percha points were excessively inserted into the mesial root canals of the right first molars (experimental sites) but not the left first molars (control sites). After 6 and 8 weeks of pulp exposure, the presence of extraradicular biofilms was confirmed histomorphologically, and biofilm-forming bacteria were identified by using classical culture methods. The biofilms were observed in the extraradicular area of the experimental sites. Similar species were detected both inside and outside the root canals. The bacterial count, quantified by real-time PCR assays, in the extraradicular area gradually increased in the experimental sites until 20 weeks after pulp exposure. After 8 weeks of pulp exposure, the periapical lesion volume that was measured by micro-computed tomography was significantly larger in the experimental sites than in the control sites (P < 0.05 by Welch's t test). These results suggest that we developed an extraradicular biofilm model in rats and that extraradicular biofilms affect developing periapical lesions.

  13. Promotion of Endodontic Lesions in Rats by a Novel Extraradicular Biofilm Model Using Obturation Materials

    PubMed Central

    Kuremoto, Katsutaka; Ishimoto, Takuya; Yoneda, Naomichi; Yamamoto, Reiko; Maezono, Hazuki; Nakano, Takayoshi; Hayashi, Mikako; Ebisu, Shigeyuki

    2014-01-01

    Although extraradicular biofilm formation is related to refractory periapical periodontitis, the mechanism of extraradicular biofilm development, as well as its effect on periapical lesions, is unknown. Therefore, we aimed to develop an in vivo extraradicular biofilm model in rats and to identify and quantify extraradicular biofilm-forming bacteria while investigating the effect of extraradicular biofilms on periapical lesions. Periapical lesions were induced by exposing the pulpal tissue of the mandibular first molars of male Wistar rats to their oral environment. Four weeks later, gutta-percha points were excessively inserted into the mesial root canals of the right first molars (experimental sites) but not the left first molars (control sites). After 6 and 8 weeks of pulp exposure, the presence of extraradicular biofilms was confirmed histomorphologically, and biofilm-forming bacteria were identified by using classical culture methods. The biofilms were observed in the extraradicular area of the experimental sites. Similar species were detected both inside and outside the root canals. The bacterial count, quantified by real-time PCR assays, in the extraradicular area gradually increased in the experimental sites until 20 weeks after pulp exposure. After 8 weeks of pulp exposure, the periapical lesion volume that was measured by micro-computed tomography was significantly larger in the experimental sites than in the control sites (P < 0.05 by Welch's t test). These results suggest that we developed an extraradicular biofilm model in rats and that extraradicular biofilms affect developing periapical lesions. PMID:24747900

  14. Airflow, gas deposition, and lesion distribution in the nasal passages.

    PubMed Central

    Morgan, K T; Monticello, T M

    1990-01-01

    The nasal passages of laboratory animals and man are complex, and lesions induced in the delicate nasal lining by inhaled air pollutants vary considerably in location and nature. The distribution of nasal lesions is generally a consequence of regional deposition of the inhaled material, local tissue susceptibility, or a combination of these factors. Nasal uptake and regional deposition are are influenced by numerous factors including the physical and chemical properties of the inhaled material, such as water solubility and reactivity; airborne concentration and length of exposure; the presence of other air contaminants such as particulate matter; nasal metabolism, and blood and mucus flow. For certain highly water-soluble or reactive gases, nasal airflow patterns play a major role in determining lesion distribution. Studies of nasal airflow in rats and monkeys, using casting and molding techniques combined with a water-dye model, indicate that nasal airflow patterns are responsible for characteristic differences in the distribution of nasal lesions induced by formaldehyde in these species. Local tissue susceptibility is also a complex issue that may be a consequence of many factors, including physiologic and metabolic characteristics of the diverse cell populations that comprise each of the major epithelial types lining the airways. Identification of the principal factors that influence the distribution and nature of nasal lesions is important when attempting the difficult process of determining potential human risks using data derived from laboratory animals. Toxicologic pathologists can contribute to this process by carefully identifying the site and nature of nasal lesions induced by inhaled materials. Images FIGURE 4. FIGURE 6. FIGURE 7. PMID:2200663

  15. Efficacy of autofluoroscence videoendoscopy in the diagnosis of laryngeal lesions

    PubMed Central

    Saetti, R; Derosas, F; Silvestrini, M; Narne, S

    2007-01-01

    Summary Aim of this prospective preliminary study was to assess effectiveness and reliability of autofluorescence endoscopy in the diagnosis of laryngeal lesions, in particular, evaluating whether it could represent an improvement in comparison to standard endoscopy alone. A total of 81 laryngeal biopsy specimens, taken from 46 consecutive patients who underwent intra-operative endoscopic assessment in a period of 2 years, were examined. Thirteen patients underwent the procedure for presumed benign lesions; the other 33 cases for pre-operative endoscopic suspicion of pre-cancerous or cancerous lesions. In our experience, autofluorescence evaluation seemed to accurately delineate the limits of the tumour and the possible presence of second primary, proving a useful guide in the choice of sites to make a biopsy. In particular, this endoscopic method has proved to be characterized by higher sensitivity and specificity not inferior to standard endoscopy, both in the discrimination between benign and preneoplastic/neoplastic lesions and between pre-neoplastic and neoplastic. Correct choice of the application field is mandatory in order to obtain the maximum effectiveness of this method. Autofluorescence endoscopy, in fact, was found to be very useful in the evaluation of untreated tissues with suspected pre-cancerous or cancerous lesions. On the contrary, in the study of “frankly benign” laryngeal lesions, this exam does not improve upon the results obtained by standard endoscopy but increases the risk of false positives. The best results can be obtained only by integration of data provided by both white-light and accurate auto-fluorescence endoscopic assessment. PMID:17957848

  16. A bizarre abdominal cystic lesion.

    PubMed

    Zucchini, Giorgia; Pezzilli, Raffaele; Ricci, Claudio; Casadei, Riccardo; Santini, Donatella; Calculli, Lucia; Corinaldesi, Roberto

    2010-09-06

    In spite of careful intraoperative precautions and gauze counts, mistakes can still occur during surgery. In the case reported, a retained gauze leaved during a surgical approach for removing a solid-cystic papillary tumor localized in the pancreatic tail, caused both persistent abdominal discomfort and the presence of an abdominal cystic lesion at imaging techniques. When a previous operative history is present, a foreign body should be taken into account in the differential diagnosis of a patient with an intra-abdominal cystic mass. Finally, radio-opaque marker should be routinely used by surgeons in order to reach a correct diagnosis in operated patients having retained gauze.

  17. Brainstem tegmental lesions in neonates with hypoxic-ischemic encephalopathy: Magnetic resonance diagnosis and clinical outcome

    PubMed Central

    Quattrocchi, Carlo Cosimo; Fariello, Giuseppe; Longo, Daniela

    2016-01-01

    Lesions of the brainstem have been reported in the clinical scenarios of hypoxic-ischemic encephalopathy (HIE), although the prevalence of these lesions is probably underestimated. Neuropathologic studies have demonstrated brainstem involvement in severely asphyxiated infants as an indicator of poor outcome. Among survivors to HIE, the most frequent clinical complaints that may be predicted by brainstem lesions include feeding problems, speech, language and communication problems and visual impairments. Clinical series, including vascular and metabolic etiologies, have found selective involvement of the brainstem with the demonstration of symmetric bilateral columnar lesions of the tegmentum. The role of brainstem lesions in HIE is currently a matter of debate, especially when tegmental lesions are present in the absence of supra-tentorial lesions. Differential diagnosis of tegmental lesions in neonates and infants include congenital metabolic syndromes and drug-related processes. Brainstem injury with the presence of supratentorial lesions is a predictor of poor outcome and high rates of mortality and morbidity. Further investigation will be conducted to identify specific sites of the brainstem that are vulnerable to hypoxic-ischemic and toxic-metabolic insults. PMID:26981220

  18. Structural evidence for substrate-induced synergism and half-sites reactivity in biotin carboxylase

    SciTech Connect

    Mochalkin, Igor; Miller, J. Richard; Evdokimov, Artem; Lightle, Sandra; Yan, Chunhong; Stover, Charles Ken; Waldrop, Grover L.

    2008-10-24

    Bacterial acetyl-CoA carboxylase is a multifunctional biotin-dependent enzyme that consists of three separate proteins: biotin carboxylase (BC), biotin carboxyl carrier protein (BCCP), and carboxyltransferase (CT). Acetyl-CoA carboxylase is a potentially attractive target for novel antibiotics because it catalyzes the first committed step in fatty acid biosynthesis. In the first half-reaction, BC catalyzes the ATP-dependent carboxylation of BCCP. In the second half-reaction, the carboxyl group is transferred from carboxybiotinylated BCCP to acetyl-CoA to produce malonyl-CoA. A series of structures of BC from several bacteria crystallized in the presence of various ATP analogs is described that addresses three major questions concerning the catalytic mechanism. The structure of BC bound to AMPPNP and the two catalytically essential magnesium ions resolves inconsistencies between the kinetics of active-site BC mutants and previously reported BC structures. Another structure of AMPPNP bound to BC shows the polyphosphate chain folded back on itself, and not in the correct (i.e., extended) conformation for catalysis. This provides the first structural evidence for the hypothesis of substrate-induced synergism, which posits that ATP binds nonproductively to BC in the absence of biotin. The BC homodimer has been proposed to exhibit half-sites reactivity where the active sites alternate or 'flip-flop' their catalytic cycles. A crystal structure of BC showed the ATP analog AMPPCF{sub 2}P bound to one subunit while the other subunit was unliganded. The liganded subunit was in the closed or catalytic conformation while the unliganded subunit was in the open conformation. This provides the first structural evidence for half-sites reactivity in BC.

  19. Structural evidence for substrate-induced synergism and half-sites reactivity in biotin carboxylase

    PubMed Central

    Mochalkin, Igor; Miller, J. Richard; Evdokimov, Artem; Lightle, Sandra; Yan, Chunhong; Stover, Charles Ken; Waldrop, Grover L.

    2008-01-01

    Bacterial acetyl-CoA carboxylase is a multifunctional biotin-dependent enzyme that consists of three separate proteins: biotin carboxylase (BC), biotin carboxyl carrier protein (BCCP), and carboxyltransferase (CT). Acetyl-CoA carboxylase is a potentially attractive target for novel antibiotics because it catalyzes the first committed step in fatty acid biosynthesis. In the first half-reaction, BC catalyzes the ATP-dependent carboxylation of BCCP. In the second half-reaction, the carboxyl group is transferred from carboxybiotinylated BCCP to acetyl-CoA to produce malonyl-CoA. A series of structures of BC from several bacteria crystallized in the presence of various ATP analogs is described that addresses three major questions concerning the catalytic mechanism. The structure of BC bound to AMPPNP and the two catalytically essential magnesium ions resolves inconsistencies between the kinetics of active-site BC mutants and previously reported BC structures. Another structure of AMPPNP bound to BC shows the polyphosphate chain folded back on itself, and not in the correct (i.e., extended) conformation for catalysis. This provides the first structural evidence for the hypothesis of substrate-induced synergism, which posits that ATP binds nonproductively to BC in the absence of biotin. The BC homodimer has been proposed to exhibit half-sites reactivity where the active sites alternate or “flip-flop” their catalytic cycles. A crystal structure of BC showed the ATP analog AMPPCF2P bound to one subunit while the other subunit was unliganded. The liganded subunit was in the closed or catalytic conformation while the unliganded subunit was in the open conformation. This provides the first structural evidence for half-sites reactivity in BC. PMID:18725455

  20. Structural basis for allosteric cross-talk between the asymmetric nucleotide binding sites of a heterodimeric ABC exporter

    PubMed Central

    Hohl, Michael; Hürlimann, Lea M.; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G.; Bordignon, Enrica; Seeger, Markus A.

    2014-01-01

    ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5′-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport. PMID:25030449

  1. Mechanism of RNA polymerase II bypass of oxidative cyclopurine DNA lesions

    SciTech Connect

    Walmacq, Celine; Wang, Lanfeng; Chong, Jenny; Scibelli, Kathleen; Lubkowska, Lucyna; Gnatt, Averell; Brooks, Philip J.; Wang, Dong; Kashlev, Mikhail

    2015-01-20

    In human cells, the oxidative DNA lesion 8,5'-cyclo-2'-deoxyadenosine (CydA) induces prolonged stalling of RNA polymerase II (Pol II) followed by transcriptional bypass, generating both error-free and mutant transcripts with AMP misincorporated immediately downstream from the lesion. Here, we present biochemical and crystallographic evidence for the mechanism of CydA recognition. Pol II stalling results from impaired loading of the template base (5') next to CydA into the active site, leading to preferential AMP misincorporation. Such predominant AMP insertion, which also occurs at an abasic site, is unaffected by the identity of the 5´-templating base, indicating that it derives from nontemplated synthesis according to an A rule known for DNA polymerases and recently identified for Pol II bypass of pyrimidine dimers. Subsequent to AMP misincorporation, Pol II encounters a major translocation block that is slowly overcome. The translocation block combined with the poor extension of the dA.rA mispair reduce transcriptional mutagenesis. Moreover, increasing the active-site flexibility by mutation in the trigger loop, which increases the ability of Pol II to accommodate the bulky lesion, and addition of transacting factor TFIIF facilitate CydA bypass. Thus, blocking lesion entry to the active site, trans-lesion A rule synthesis, and translocation block are common features of transcription across different bulky DNA lesions.

  2. Mechanism of RNA polymerase II bypass of oxidative cyclopurine DNA lesions

    DOE PAGES

    Walmacq, Celine; Wang, Lanfeng; Chong, Jenny; ...

    2015-01-20

    In human cells, the oxidative DNA lesion 8,5'-cyclo-2'-deoxyadenosine (CydA) induces prolonged stalling of RNA polymerase II (Pol II) followed by transcriptional bypass, generating both error-free and mutant transcripts with AMP misincorporated immediately downstream from the lesion. Here, we present biochemical and crystallographic evidence for the mechanism of CydA recognition. Pol II stalling results from impaired loading of the template base (5') next to CydA into the active site, leading to preferential AMP misincorporation. Such predominant AMP insertion, which also occurs at an abasic site, is unaffected by the identity of the 5´-templating base, indicating that it derives from nontemplated synthesismore » according to an A rule known for DNA polymerases and recently identified for Pol II bypass of pyrimidine dimers. Subsequent to AMP misincorporation, Pol II encounters a major translocation block that is slowly overcome. The translocation block combined with the poor extension of the dA.rA mispair reduce transcriptional mutagenesis. Moreover, increasing the active-site flexibility by mutation in the trigger loop, which increases the ability of Pol II to accommodate the bulky lesion, and addition of transacting factor TFIIF facilitate CydA bypass. Thus, blocking lesion entry to the active site, trans-lesion A rule synthesis, and translocation block are common features of transcription across different bulky DNA lesions.« less

  3. Computer-aided tracking of MS lesions

    NASA Astrophysics Data System (ADS)

    Sturm, Deborah; Gurwitz Kletenik, Devorah; Koshy, Philip

    2011-03-01

    Multiple Sclerosis (MS) lesions are known to change over time. The location, size and shape characteristics of lesions are often used to diagnose and to track disease progression. We have improved our lesion-browsing tool that allows users to automatically locate successive significant lesions in a MRI stack. In addition, an automatic alignment feature was implemented to facilitate comparisons across stacks. A lesion stack is formed that can be browsed independently or in tandem with the image windows. Lesions of interest can then be measured, rendered and rotated. Multiple windows allow the viewer to compare the size and shape of lesions from the MRI images of the same patient taken at different time intervals.

  4. Oxidative stress enzyme and histopathological lesions in Colossoma macropomum (pisces, ariidae) for environmental impact assessment

    NASA Astrophysics Data System (ADS)

    Andrade, Ticianne de Sousa de Oliveira Mota; Sousa, Debora Batista Pinheiro; Dantas, Janaina Gomes; Castro, Jonatas da Silva; Neta, Raimunda Nonata Fortes Carvalho

    2015-12-01

    This study used oxidative stress enzyme (Glutathione S-Transferase and Catalase), histopathological lesions (Branchial lesions) and biometric data in the freshwater fish tambaqui, Colossoma macropomum, to assess environmental impacts in an Environmental Protection Area at São Luis, Brazil. Fish were sampled from two locations (A1 = contaminated area and A2 = reference site) within the protected area on four occasions. The activity of catalase (CAT) and glutathione S-transferase (GST) in C. macropomum was compared with biometric data and histopathological lesions. Results have shown that biometric data decreased significantly in fish (p<0.05) at the contaminated site. The activity of CAT was higher in fish specifically caught in A1. A significant difference was observed in the GST activity in the liver of C. macropomum when comparing fish from the contaminated site and those from the reference site (p<0.05).

  5. Beyond the lesion: the epileptogenic networks around cavernous angiomas.

    PubMed

    Sevy, Amandine; Gavaret, Martine; Trebuchon, Agnès; Vaugier, Lisa; Wendling, Fabrice; Carron, Romain; Regis, Jean; Chauvel, Patrick; Gonigal, Aileen Mc; Bartolomei, Fabrice

    2014-05-01

    The relationship between epileptogenic lesions and the extension of epileptogenicity is a major challenge in presurgical evaluation of drug resistant epilepsies. In this study, we aimed at quantifying the epileptogenic properties of brain structures explored by depth electrodes in patients investigated by stereoelectroencephalography (SEEG) and suffering from focal drug-resistant epilepsy associated with cavernous angioma (CA). Epileptogenicity of the perilesional region and distant brain areas was calculated according to the "epileptogenicity index" (EI), a technique that allows mathematical quantification of rapid discharges at seizure onset taking into account the time at which the discharge occurs. Thirteen seizures from 6 patients were studied. Localization of the cavernoma was the frontal lobe (two cases), the temporal lobe (three cases) or the anterior insula (one case). Visual inspection of the ictal discharge showed that in the majority of cases (5/6) the perilesional region was either not involved or involved with other distant sites. Using EI quantification, complex patterns of epileptogenicity were observed in five patients. A large number of brain regions out of the lesional region disclosed higher values than the lesion site. Mean values in the perilesional region and in the extralesional sites were not significantly different (p=0.34). Complex organization of the epileptogenic zone may be found in drug-resistant CA associated epilepsy. Thus, this result should be borne in mind when patients with CA and drug resistant epilepsy are investigated. If there is a suspicion of a larger epileptogenic zone than the lesion, intra-cerebral exploration by SEEG may be required before surgery that may be guided by the definition of the EZ.

  6. Tractographic Analysis of Historical Lesion Surgery for Depression

    PubMed Central

    Schoene-Bake, Jan-Christoph; Parpaley, Yaroslav; Weber, Bernd; Panksepp, Jaak; Hurwitz, Trevor A; Coenen, Volker A

    2010-01-01

    Various surgical brain ablation procedures for the treatment of refractory depression were developed in the twentieth century. Most notably, key target sites were (i) the anterior cingulum, (ii) the anterior limb of the internal capsule, and (iii) the subcaudate white matter, which were regarded as effective targets. Long-term symptom remissions were better following lesions of the anterior internal capsule and subcaudate white matter than of the cingulum. It is possible that the observed clinical improvements of these various surgical procedures may reflect shared influences on presently unspecified brain affect-regulating networks. Such possibilities can now be analyzed using modern brain connectivity procedures such as diffusion tensor imaging (DTI) tractography. We determined whether the shared connectivities of the above lesion sites in healthy volunteers might explain the therapeutic effects of the various surgical approaches. Accordingly, modestly sized historical lesions, especially of the anatomical overlap areas, were ‘implanted' in brain-MRI scans of 53 healthy subjects. These were entered as seed regions for probabilistic DTI connectivity reconstructions. We analyzed for the shared connectivities of bilateral anterior capsulotomy, anterior cingulotomy, subcaudate tractotomy, and stereotactic limbic leucotomy (a combination of the last two lesion sites). Shared connectivities between the four surgical approaches mapped onto the most mediobasal aspects of bilateral frontal lobe fibers, including the forceps minor and the anterior thalamic radiations that contacted subgenual cingulate regions. Anatomically, convergence of these shared connectivities may derive from the superolateral branch of the medial forebrain bundle (MFB), a structure that connects these frontal areas to the origin of the mesolimbic dopaminergic ‘reward' system in the midbrain ventral tegmental area. Thus, all four surgical anti-depressant approaches may be promoting positive

  7. Molecular changes in skin pigmented lesions of the coral trout Plectropomus leopardus.

    PubMed

    Lerebours, Adélaïde; Chapman, Emma C; Sweet, Michael J; Heupel, Michelle R; Rotchell, Jeanette M

    2016-09-01

    A high prevalence of skin pigmented lesions of 15% was recently reported in coral trout Plectropomus leopardus, a commercially important marine fish, inhabiting the Great Barrier Reef. Herein, fish were sampled at two offshore sites, characterised by high and low lesion prevalence. A transcriptomic approach using the suppressive subtractive hybridisation (SSH) method was used to analyse the differentially expressed genes between lesion and normal skin samples. Transcriptional changes of 14 genes were observed in lesion samples relative to normal skin samples. These targeted genes encoded for specific proteins which are involved in general cell function but also in different stages disrupted during the tumourigenesis process of other organisms, such as cell cycling, cell proliferation, skeletal organisation and cell migration. The results highlight transcripts that are associated with the lesion occurrence, contributing to a better understanding of the molecular aetiology of this coral trout skin disease.

  8. Effect of fluoride, lesion baseline severity and mineral distribution on lesion progression.

    PubMed

    Lippert, F; Butler, A; Lynch, R J M; Hara, A T

    2012-01-01

    The present study investigated the effects of fluoride (F) concentration, lesion baseline severity (ΔZ(base)) and mineral distribution on lesion progression. Artificial caries lesions were created using three protocols [methylcellulose acid gel (MeC), hydroxyethylcellulose acid gel (HEC), carboxymethylcellulose acid solution (CMC)] and with low and high ΔZ(base) groups by varying demineralization times within protocols. Subsequently, lesions were immersed in a demineralizing solution for 24 h in the presence of 0, 1, 2 or 5 ppm F. Changes in mineral distribution characteristics of caries lesions were studied using transverse microradiography. At baseline, the protocols yielded lesions with three distinctly different mineral distributions. Secondary demineralization revealed differences in F response between and within lesion types. In general, lowΔZ lesions were more responsive to F than highΔZ lesions. LowΔZ MeC lesions showed the greatest range of response among all lesions, whereas highΔZ HEC lesions were almost unaffected by F. Laminations were observed in the presence of F in all but highΔZ HEC and CMC lesions. Changes in mineral distribution effected by F were most pronounced in MeC lesions, with remineralization/mineral redeposition in the original lesion body at the expense of sound enamel beyond the original lesion in a dose-response manner. Both ΔZ(base) and lesion mineral distribution directly impact the F response and the extent of secondary demineralization of caries lesions. Further studies - in situ and on natural white spot lesions - are required to better mimic in vivo caries under laboratory conditions.

  9. Excision of Nonpalpable Breast Cancer with Indocyanine Green Fluorescence-Guided Occult Lesion Localization (IFOLL).

    PubMed

    Aydogan, Fatih; Ozben, Volkan; Aytac, Erman; Yilmaz, Halit; Cercel, Ali; Celik, Varol

    2012-02-01

    BACKGROUND: Currently employed techniques for the localization of nonpalpable breast lesions suffer from various limitations. In this paper, we report on 2 patients in order to introduce an alternative technique, indocyanine green fluorescence-guided occult lesion localization (IFOLL), and determine its applicability for the surgical removal of this type of breast lesions. CASE REPORTS: Preoperatively, one of the patients had a needle biopsy-proven diagnosis of breast cancer, and the other one had suspicious findings for malignancy. Lesion localization was performed within 1 h before surgery under ultrasonography control by injecting 2 ml and 0.2 ml of indocyanine green into the lesion and its subcutaneous tissue projection, respectively. During surgery, the site of skin incision and the resection margins were identified by observing the area of indocyanine-derived fluorescence under the guidance of a near-infrared-sensitive camera. In both cases, the breast lesion was correctly localized, and the area of fluorescence corresponded well to the site of the lesions. Subsequent surgical excision was successful with no complications. On histopathologic examination, the surgical margins were found to be clear. CONCLUSION: IFOLL seems to be a technically applicable and clinically acceptable procedure for the removal of nonpalpable breast cancer.

  10. Perianal Tick-Bite Lesion Caused by a Fully Engorged Female Amblyomma testudinarium

    PubMed Central

    Kang, Haeng An; Kim, Sung Sun; Joo, Hyun Soo; Chong, Won Seog

    2014-01-01

    A perianal tick and the surrounding skin were surgically excised from a 73-year-old man residing in a southwestern costal area of the Korean Peninsula. Microscopically a deep penetrating lesion was formed beneath the attachment site. Dense and mixed inflammatory cell infiltrations occurred in the dermis and subcutaneous tissues around the feeding lesion. Amorphous eosinophilic cement was abundant in the center of the lesion. The tick had Y-shaped anal groove, long mouthparts, ornate scutum, comma-shaped spiracular plate, distinct eyes, and fastoons. It was morphologically identified as a fully engorged female Amblyomma testudinarium. This is the third human case of Amblyomma tick infection in Korea. PMID:25548423

  11. Histopathological lesions associated with equine periodontal disease.

    PubMed

    Cox, Alistair; Dixon, Padraic; Smith, Sionagh

    2012-12-01

    Equine periodontal disease (EPD) is a common and painful condition, the aetiology and pathology of which are poorly understood. To characterise the histopathological lesions associated with EPD, the skulls of 22 horses were assessed grossly for the presence of periodontal disease, and a standard set of interdental tissues taken from each for histopathological examination. Histological features of EPD included ulceration and neutrophilic inflammation of the gingival epithelium. Mononuclear and eosinophilic inflammation of the gingival lamina propria and submucosa was commonly present irrespective of the presence or degree of periodontal disease. Gingival hyperplasia was present to some degree in all horses, and was only weakly associated with the degree of periodontal disease. In all horses dental plaque was present at the majority of sites examined and was often associated with histological evidence of peripheral cemental erosion. Bacteria (including spirochaetes in four horses) were identified in gingival samples by Gram and silver impregnation techniques and were significantly associated with the presence of periodontal disease. This is the first study to describe histological features of EPD, and the first to identify associated spirochaetes in some cases. Histological features were variable, and there was considerable overlap of some features between the normal and diseased gingiva. Further investigation into the potential role of bacteria in the pathogenesis and progression of EPD is warranted.

  12. Congenital lung lesions: Postnatal management and outcome.

    PubMed

    Parikh, Dakshesh H; Rasiah, Shree Vishna

    2015-08-01

    Antenatal diagnosis of lung lesion has become more accurate resulting in dilemma and controversies of its antenatal and postnatal management. Majority of antenatally diagnosed congenital lung lesions are asymptomatic in the neonatal age group. Large lung lesions cause respiratory compromise and inevitably require urgent investigations and surgery. The congenital lung lesion presenting with hydrops requires careful postnatal management of lung hypoplasia and persistent pulmonary hypertension. Preoperative stabilization with gentle ventilation with permissive hypercapnia and delayed surgery similar to congenital diaphragmatic hernia management has been shown to result in good outcome. The diagnostic investigations and surgical management of the asymptomatic lung lesions remain controversial. Postnatal management and outcome of congenital cystic lung lesions are discussed.

  13. Macrophages and smooth muscle cells express lipoprotein lipase in human and rabbit atherosclerotic lesions.

    PubMed Central

    Ylä-Herttuala, S; Lipton, B A; Rosenfeld, M E; Goldberg, I J; Steinberg, D; Witztum, J L

    1991-01-01

    Lipoprotein lipase (LPL; EC 3.1.1.34) may promote atherogenesis by producing remnant lipoproteins on the endothelial surface and by acting on lipoproteins in the artery wall. In vitro, smooth muscle cells and macrophages synthesize LPL, but in human carotid lesions only a few smooth muscle cells were reported to contain LPL protein. Endothelial cells do not synthesize LPL in vitro, but in normal arteries intense immunostaining for LPL is present on the endothelium. We used Northern blot analysis, in situ hybridization, and immunocytochemistry of human and rabbit arteries to determine cellular distribution and the site of the synthesis of LPL in atherosclerotic lesions. Northern blot analysis showed that LPL mRNA was detectable in macrophage-derived foam cells isolated from arterial lesions of "ballooned" cholesterol-fed rabbits. In situ hybridization studies of atherosclerotic lesions with an antisense riboprobe showed a strong hybridization signal for LPL mRNA in some, but not all, lesion macrophages, which were mostly located in the subendothelial and edge areas of the lesions. Also, some smooth muscle cells in lesion areas also expressed LPL mRNA. Immunocytochemistry of frozen sections of rabbit lesions with a monoclonal antibody to human milk LPL showed intense staining for LPL protein in macrophage-rich intimal lesions. The results suggest that lesion macrophages and macrophage-derived foam cells express LPL mRNA and protein. Some smooth muscle cells in the lesion areas also synthesize LPL. These data are consistent with an important role for LPL in atherogenesis. Images PMID:1719546

  14. Oral Lesions: The Clue to Diagnosis of Pemphigus Vulgaris

    PubMed Central

    Kuriachan, Diana; Suresh, Rakesh; Janardhanan, Mahija; Savithri, Vindhya

    2015-01-01

    Pemphigus is a group of potentially fatal dermatoses with both cutaneous and oral manifestations. Characterized by the appearance of vesicle or bullae, their manifestations in the oral cavity often precede those on the skin by many months or may remain as the only symptoms of the disease. It is therefore important that the oral manifestations of the disease are recognized on time, to make a proper diagnosis and initiate timely treatment. Here we present a case of Pemphigus Vulgaris (PV) that presented with oral lesions at multiple sites including tongue, to highlight the importance of timely recognition of the oral lesions during routine dental practice for the diagnosis and management of this disease. PMID:26664754

  15. Clinical features and histological description of tongue lesions in a large Northern Italian population

    PubMed Central

    Carbone, Mario; Arduino, Paolo-Giacomo; Carrozzo, Marco; Conrotto, Davide; Tanteri, Carlotta; Carbone, Lucio; Elia, Alessandra; Maragon, Zaira; Broccoletti, Roberto

    2015-01-01

    Background Only few studies on tongue lesions considered sizable populations, and contemporary literature does not provide a valid report regarding the epidemiology of tongue lesions within the Italian population. In this report, the histopathological and clinical appearance of 1.106 tongue lesions from northern Italians are described and discussed. Material and Methods The case records of patients referred for the diagnosis and management of tongue lesions, from October 1993 to October 2013, were reviewed. Histological data were also obtained and blindly reexamined. Results For instance, a biopsy performed on a lingual ulcer has a strong predicting association with a carcinoma, whereas a biopsy on a white lesion predicts for a leukoplakia or oral lichen planus. Moreover, a biopsy of erosion is representative of bullous diseases, whereas a biopsy on a verrucous-papillary lesion is significant for fibroma. Furthermore, carcinomas occur in the majority of cases on the lingual edge or pelvis, oral lichen planus is mainly seen on the edge, and fibromas mostly on the lingual tip. Conclusions The high frequency of tongue involvement of such different diseases emphasizes the importance of histological characterization and that some diseases occur more frequently than others, with a peculiar clinical aspect and a more common area. In fact our survey can help the clinician in advancing diagnostic hypothesis, on the basis of the elementary lesion and its site of involvement. Key words:Tongue lesions, clinical appearance, histological description. PMID:26241456

  16. Spinal focal lesion detection in multiple myeloma using multimodal image features

    NASA Astrophysics Data System (ADS)

    Fränzle, Andrea; Hillengass, Jens; Bendl, Rolf

    2015-03-01

    Multiple myeloma is a tumor disease in the bone marrow that affects the skeleton systemically, i.e. multiple lesions can occur in different sites in the skeleton. To quantify overall tumor mass for determining degree of disease and for analysis of therapy response, volumetry of all lesions is needed. Since the large amount of lesions in one patient impedes manual segmentation of all lesions, quantification of overall tumor volume is not possible until now. Therefore development of automatic lesion detection and segmentation methods is necessary. Since focal tumors in multiple myeloma show different characteristics in different modalities (changes in bone structure in CT images, hypointensity in T1 weighted MR images and hyperintensity in T2 weighted MR images), multimodal image analysis is necessary for the detection of focal tumors. In this paper a pattern recognition approach is presented that identifies focal lesions in lumbar vertebrae based on features from T1 and T2 weighted MR images. Image voxels within bone are classified using random forests based on plain intensities and intensity value derived features (maximum, minimum, mean, median) in a 5 x 5 neighborhood around a voxel from both T1 and T2 weighted MR images. A test data sample of lesions in 8 lumbar vertebrae from 4 multiple myeloma patients can be classified at an accuracy of 95% (using a leave-one-patient-out test). The approach provides a reasonable delineation of the example lesions. This is an important step towards automatic tumor volume quantification in multiple myeloma.

  17. Human papillomavirus DNA in oral mucosal lesions.

    PubMed

    Giovannelli, Lucia; Campisi, Giuseppina; Lama, Anna; Giambalvo, Ornella; Osborn, John; Margiotta, Valerio; Ammatuna, Pietro

    2002-03-15

    This study determined the presence of human papillomavirus (HPV) DNA in oral mucosa cells from 121 patients with different types of oral mucosal lesions (13 squamous cell carcinomas, 59 potentially malignant lesions, 49 benign erosive ulcerative lesions) and from 90 control subjects. HPV DNA was detected by nested polymerase chain reaction, and genotype was determined by DNA sequencing. HPV prevalence was 61.5% in carcinomas, 27.1% in potentially malignant lesions, 26.5% in erosive ulcerative lesions, and 5.5% in control subjects. The risk of malignant or potentially malignant lesions was associated with HPV and was statistically significant. HPV-18 was found in 86.5% of HPV-positive lesions but was not associated with a particular type of lesion and was found in 80% of the HPV-positive control subjects. HPV infection was related to older age but not to sex, smoking, or alcohol use; the presence of lesions in the oral cavity increased the risk of HPV infection.

  18. Comet Lesions in Patients with Pseudoxanthoma Elasticum

    PubMed Central

    Tatlıpınar, Sinan; Şahan, Berna; Altunsoy, Muhsin

    2015-01-01

    Pseudoxanthoma elasticum (PXE) is a genetic multisystemic disorder affecting the skin, eyes and cardiovascular system. Basic fundoscopic findings in PXE result from Bruch’s membrane involvement. The most important fundoscopic findings are angioid streaks. Other significant ocular findings are peau d’orange appearance, optic disc drusen, pattern dystrophy-like macular appearance, comet lesions, and choroidal neovascularization. Comet lesions are a pathognomonic ocular finding for PXE. The presence of both angioid streaks in the fundus and typical skin lesions should alert clinicians to PXE. Herein, we present two PXE cases with comet lesions. PMID:27800246

  19. [Aortic inflammatory lesions in Behçet's disease].

    PubMed

    Desbois, A-C; Wechsler, B; Cacoub, P; Saadoun, D

    2016-04-01

    The arterial lesions affect about 10% of patients with Behçet's disease (BD). Aortic inflammatory involvement includes predominantly aortic aneurysmal lesions affecting most often the abdominal aorta. They account for the severity of the disease and are a leading cause of death when they hit the aorta or pulmonary arteries. Within the arterial lesions of BD, aortic involvement is, with femoral lesions, the most common site involved (18-28% of patients with vascular disease). Unlike other large vessels vasculitis (i.e. giant cell arteritis and Takayasu's arteritis) diffuse aortitis is observed in less than 5% of patients with BD. Aortic lesions of BD may be asymptomatic (systematic imaging or occasionally associated with other vascular event) or be revealed by the occurrence of abdominal, thoracic or lumbar pain, or an aortic valve insufficiency. Fever is frequently associated. Increase in acute phase reactants is common in these patients. Histological analysis may show infiltration by lymphocytes, neutrophils and plasma cells in the media and adventitia and a proliferation of the vasa vasorum in the media as well as a fibroblastic proliferation. In the later phase, a fibrous thickening of the media and adventitia is observed as well as a proliferation and thickening of the vasa vasorum. The therapeutic management should always include a medical treatment for the control of inflammation (corticosteroids, immunosuppressive drugs and/or biotherapy) and often an endovascular or surgical treatment if the aneurysm is threatening. The choice between endovascular or surgical treatment is considered case by case, depending on the experience of the team, anatomical conditions and of the clinical presentation. In this review, we provide a detailed and updated review of the literature to describe the aortic inflammatory damage associated with Behçet's disease.

  20. Ibotenic acid lesions of the lateral hypothalamus: comparison with the electrolytic lesion syndrome.

    PubMed

    Winn, P; Tarbuck, A; Dunnett, S B

    1984-05-01

    Rats received either ibotenic acid, electrolytic or sham lesions of the lateral hypothalamic area. Compared to sham operated rats, both lesion groups showed aphagia and adipsia following the lesion; this was less severe in the ibotenic acid lesioned rats. Once recovered, the ibotenic acid lesioned rats showed residual regulatory impairments in their compensatory responses to glucoprivation and to extracellular and intracellular dehydration. However, unlike the electrolytic lesioned rats, those with ibotenic acid lesions did not show akinesia and exhibited normal responses to both d-amphetamine and apomorphine. Ibotenic acid lesions resulted in extensive loss of cell bodies within the lateral hypothalamic area while sparing ascending dopamine neurones. The results are interpreted as suggesting that the lateral hypothalamic area and ascending dopamine neurones are components of a single system involved in the regulation of food and water intake.

  1. Correlation of bistranded clustered abasic DNA lesion processing with structural and dynamic DNA helix distortion

    PubMed Central

    Bignon, Emmanuelle; Gattuso, Hugo; Morell, Christophe; Dehez, François; Georgakilas, Alexandros G.; Monari, Antonio; Dumont, Elise

    2016-01-01

    Clustered apurinic/apyrimidinic (AP; abasic) DNA lesions produced by ionizing radiation are by far more cytotoxic than isolated AP lesion entities. The structure and dynamics of a series of seven 23-bp oligonucleotides featuring simple bistranded clustered damage sites, comprising of two AP sites, zero, one, three or five bases 3′ or 5′ apart from each other, were investigated through 400 ns explicit solvent molecular dynamics simulations. They provide representative structures of synthetically engineered multiply damage sites-containing oligonucleotides whose repair was investigated experimentally (Nucl. Acids Res. 2004, 32:5609-5620; Nucl. Acids Res. 2002, 30: 2800–2808). The inspection of extrahelical positioning of the AP sites, bulge and non Watson–Crick hydrogen bonding corroborates the experimental measurements of repair efficiencies by bacterial or human AP endonucleases Nfo and APE1, respectively. This study provides unprecedented knowledge into the structure and dynamics of clustered abasic DNA lesions, notably rationalizing the non-symmetry with respect to 3′ to 5′ position. In addition, it provides strong mechanistic insights and basis for future studies on the effects of clustered DNA damage on the recognition and processing of these lesions by bacterial or human DNA repair enzymes specialized in the processing of such lesions. PMID:27587587

  2. Focal liver lesions found incidentally

    PubMed Central

    Algarni, Abdullah A; Alshuhri, Abdullah H; Alonazi, Majed M; Mourad, Moustafa Mabrouk; Bramhall, Simon R

    2016-01-01

    Incidentally found focal liver lesions are a common finding and a reason for referral to hepatobiliary service. They are often discovered in patients with history of liver cirrhosis, colorectal cancer, incidentally during work up for abdominal pain or in a trauma setting. Specific points should considered during history taking such as risk factors of liver cirrhosis; hepatitis, alcohol consumption, substance exposure or use of oral contraceptive pills and metabolic syndromes. Full blood count, liver function test and tumor markers can act as a guide to minimize the differential diagnosis and to categorize the degree of liver disease. Imaging should start with B-mode ultrasound. If available, contrast enhanced ultrasound is a feasible, safe, cost effective option and increases the ability to reach a diagnosis. Contrast enhanced computed tomography should be considered next. It is more accurate in diagnosis and better to study anatomy for possible operation. Contrast enhanced magnetic resonance is the gold standard with the highest sensitivity. If doubt still remains, the options are biopsy or surgical excision. PMID:27028805

  3. Precancerous lesions of oral mucosa

    PubMed Central

    Yardimci, Gurkan; Kutlubay, Zekayi; Engin, Burhan; Tuzun, Yalcin

    2014-01-01

    Precancerous lesions of oral mucosa, known as potentially malignant disorders in recent years, are consists of a group of diseases, which should be diagnosed in the early stage. Oral leukoplakia, oral submucous fibrosis, and oral erythroplakia are the most common oral mucosal diseases that have a very high malignant transformation rate. Oral lichen planus is one of the potentially malignant disorders that may be seen in six different subtypes including papular, reticular, plaque-like, atrophic, erosive, and bullous type, clinically. Atrophic and erosive subtypes have the greater increased malignant transformation risk compared to another subtypes. Although there are various etiological studies, the etiology of almost all these diseases is not fully understood. Geographically, etiologic factors may vary. The most frequently reported possible factors are tobacco use, alcohol drinking, chewing of betel quid containing areca nut, and solar rays. Early diagnosis is very important and can be lifesaving, because in late stages, they may be progressed to severe dysplasia and even carcinoma in situ and/or squamous cell carcinoma. For most diseases, treatment results are not satisfactory in spite of miscellaneous therapies. While at the forefront of surgical intervention, topical and systemic treatment alternatives such as corticosteroids, calcineurin inhibitors, and retinoids are widely used. PMID:25516862

  4. [Mandibular lesions in multiple myeloma].

    PubMed

    Scutellari, P N; Orzincolo, C

    1992-03-01

    A review was made of 237 cases of multiple myeloma seen at the Institute of Radiology and Hematology of the Ferrara University from 1984 through 1990. The results showed skeletal involvement of the mandible to be present in 25 patients (10.54%). The diagnosis of multiple myeloma was based on the following criteria: 1) increased number of abnormal, atypical or immature plasma cells in the bone marrow; 2) the presence of a monoclonal protein in the serum or urine; 3) bone lesions consistent with those of myeloma. Symptoms include pain and swelling of the oral cavity, tooth mobility and loss, numbness along the inferior dental nerve, and paresthesia of the lower lip. The typical radiographic appearance is a well-defined "punched-out" lytic defect, solitary or multiple; sometimes, the defect enlarges and appears "bubbly" or septated. Permeative lytic areas, with blurred outlines, are a rare pattern, which is radiologically indistinguishable from skeletal metastases. The involvement of the oral cavity and jaw in multiple myeloma has been often reported in literature: nevertheless, if radiographs of the jaws had been systematically taken in all the cases, its incidence would probably have been much higher than previously suspected.

  5. Estrogen-induced CCN1 is critical for establishment of endometriosis-like lesions in mice.

    PubMed

    Zhao, Yuechao; Li, Quanxi; Katzenellenbogen, Benita S; Lau, Lester F; Taylor, Robert N; Bagchi, Indrani C; Bagchi, Milan K

    2014-12-01

    Endometriosis is a prevalent gynecological disorder in which endometrial tissue proliferates in extrauterine sites, such as the peritoneal cavity, eventually giving rise to painful, invasive lesions. Dysregulated estradiol (E) signaling has been implicated in this condition. However, the molecular mechanisms that operate downstream of E in the ectopic endometrial tissue are unknown. To investigate these mechanisms, we used a mouse model of endometriosis. Endometrial tissue from donor mice was surgically transplanted on the peritoneal surface of immunocompetent syngeneic recipient mice, leading to the establishment of cystic endometriosis-like lesions. Our studies revealed that treatment with E led to an approximately 3-fold increase in the lesion size within a week of transplantation. E also caused a concomitant stimulation in the expression of connective tissue growth factor/Cyr61/Nov (CCN1), a secreted cysteine-rich matricellular protein, in the lesions. Interestingly, CCN1 is highly expressed in human ectopic endometriotic lesions. To address its role in endometriosis, endometrial tissue from Ccn1-null donor mice was transplanted in wild-type recipient mice. The resulting ectopic lesions were reduced up to 75% in size compared with wild-type lesions due to diminished cell proliferation and cyst formation. Notably, loss of CCN1 also disrupted the development of vascular networks in the ectopic lesions and reduced the expression of several angiogenic factors, such as vascular endothelial growth factor-A and vascular endothelial growth factor-C. These results suggest that CCN1, acting downstream of E, critically controls cell proliferation and neovascularization, which support the growth and survival of endometriotic tissue at ectopic sites. Blockade of CCN1 signaling during the early stages of lesion establishment may provide a therapeutic avenue to control endometriosis.

  6. Deceptive Lesions of Periodontium: A Case Series.

    PubMed

    Pandiar, Deepak; Pattamparambath, Manjusha; Kalathingal, Pranav Vijayan; Maliyekkal, Shameena Pallikandi; Vijay, Amol Nagrale

    2015-09-01

    Basic pathology of the common appearing diseases of the periodontium are not always common inflammatory reactions. The root cause may be malignant and metastatic lesions. Here, we present unusual causes of these common periodontal lesions. This article also stress upon the importance of histopathological examination of the surgically excised localized gingival swellings which fail to regress after conservative therapy.

  7. Osteochondral Lesions of the Talar Dome.

    PubMed

    Stone

    1996-03-01

    Osteochondral lesions of the talar dome are relatively common causes of ankle pain and disability. Trauma is the most common cause, but ischemic necrosis, en-docrine disorders, and genetic factors may have etiologic significance. Medial lesions are usually located posteriorly on the dome of the talus, whereas lateral lesions are most frequently located anteriorly. Although the staging system described by Berndt and Harty remains popular, it may not accurately reflect the integrity of the articular cartilage. Small lesions of the talar dome may be present despite a normal appearance on plain radiography. Bone scintigraphy may show increased radionuclide uptake in the talar dome. Magnetic resonance imaging is also sensitive for identifying intraosseous abnormalities in the talus and has the added benefit of revealing other types of soft-tissue lesions not visible on routine radiographic studies. Computed tomography remains the imaging technique of choice when delineation of a bone fragment is desired. Nonoperative management of osteochondral lesions, including restricted weight-bearing and/or immobilization, is recommended unless a loose fragment is clearly present. Surgical options include drilling (usually reserved for intact lesions), debridement of the lesion with curettage or abrasion of the bone bed, internal fixation of the fragment, and bone grafting. Recent technical advances allow these procedures to be performed arthroscopically, with potential reduction of surgical trauma, length of hospital stay, and complication rates.

  8. Pure Gerstmann's syndrome from a focal lesion.

    PubMed

    Roeltgen, D P; Sevush, S; Heilman, K M

    1983-01-01

    It is controversial whether a focal lesion can specifically induce Gerstmann's syndrome (dyscalculia, left-right disorientation, finger agnosia, and agraphia). Also, Gerstmann's tetrad has been attributed to other cerebral symptoms, particularly aphasia. We examined a patient who had all four symptoms of Gerstmann's syndrome, without other symptoms or signs, and who had a discrete left parietal lesion.

  9. Benign lesions of the external auditory canal.

    PubMed

    Tran, L P; Grundfast, K M; Selesnick, S H

    1996-10-01

    Benign mass lesions of the external auditory canal, such as exostoses and osteomas, are common findings on physical examination but most often do not require treatment. The differential diagnosis of lesions in the external auditory canal, however, should not be limited to those benign processes discussed here, but should also include infectious, dermatologic, congenital, and malignant processes.

  10. Pediatric Awake Craniotomy for Brain Lesions.

    PubMed

    Akay, Ali; Rükşen, Mete; Çetin, H Yurday; Seval, H Özer; İşlekel, Sertaç

    2016-01-01

    Awake craniotomy is a special method to prevent motor deficits during the resection of lesions that are located in, or close to, functional areas. Although it is more commonly performed in adult patients, reports of pediatric cases undergoing awake craniotomy are limited in the literature. In our clinic, where we frequently use awake craniotomy in adult patients, we performed this method in 2 selected pediatric cases for lesion surgery. At an early age, these 2 cases diagnosed with epilepsy presented cerebral lesions, but since the lesions enclosed functional areas, surgical resection was not regarded as a treatment option at this time. In these 2 pediatric cases, we successfully completed lesion surgery with awake craniotomy. The method and the techniques employed during surgery are presented concomitant with other reports in the literature.

  11. Detection of lesions in mammographic structure

    NASA Astrophysics Data System (ADS)

    Burgess, Arthur E.; Jacobson, Francine L.; Judy, Philip F.

    1999-05-01

    This paper is a report on very surprising results from recent work on detection of real lesions in digitized mammograms. The experiments were done using a novel experimental procedure with hybrid images. The lesions (signals) were real tumor masses extracted from breast tissue specimen radiographs. In the detection experiments, the tumors were added to digitized normal mammographic backgrounds. The results of this new work have been both novel and very surprising. Contrast thresholds increased with increasing lesion size for lesions larger than approximately 1 mm in diameter. Earlier work with white noise, radiographic image noise, computed tomography (CT) noise and some types of patient structure have accustomed us to a particular relationship between lesion size and contrast for constant detectability. All previous contrast/detail (CD) diagrams have been similar, the contrast threshold decreases as lesion size increases and flattens at large lesion sizes. The CD diagram for lesion detection in mammographic structure is completely different. It will be shown that this is a consequence of the power-law dependence of the projected breast tissue structure spectral density on spatial frequency. Mammographic tissue structure power spectra have the form P(f) equals B/f(beta ), with an average exponent of approximately 3 (range from 2 to 4), and are approximately isotropic (small angular dependence). Results for two-alternative forced-choice (2AFC) signal detection experiments using 4 tumor lesions and one mathematically generated signal will be presented. These results are for an unbiased selection of mammographic backgrounds. It is possible that an additional understanding of the effects of breast structure on lesion detectability can be obtained by investigating detectability in various classes of mammographic backgrounds. This will be the subject of future research.

  12. Radioguided localization of clinically occult breast lesions (ROLL): a pilot study.

    PubMed

    Medina-Franco, Heriberto; Abarca-Pérez, Leonardo; Ulloa-Gómez, José L; Romero, Cecilia

    2007-01-01

    Management of nonpalpable breast lesions requiring pathologic diagnosis has been with wire localization during the last few decades. Recently, radioguided localization (ROLL) became an alternative for this type of lesions. The objective of the present study was to evaluate the feasibility of this technique in a tertiary referral center in Mexico City. Consecutive patients requiring pathologic diagnosis from a nonpalpable breast lesion were included in the present study. On the same day of operation, all patients were injected with particles of human serum albumin. Localization of the lesion was performed in the operation theater with the aid of a hand-held gamma-probe. All lesions were identified in a control x-ray of the surgical specimen. Demographic, clinical, surgical and pathologic data were recorded. Forty patients with a mean age of 56.8 +/- 7.8 years were included. In 39 of the 40 patients (97.5%) the "hot spot" was identified easily. In all patients, the area of maximum radioactivity corresponded to the site of the lesion. Imaging confirmation of the lesion in the surgical specimen was done during the first excision in 37 patients (92.5%). In the remaining cases (7.5%), a wider excision was performed during the same procedure, finding the suspected lesion in all cases. Diagnosis of cancer was made in seven patients, (17.5%). There were no significant surgical complications. Our data suggest that ROLL offer a simple and reliable method to localize occult breast lesions, allowing complete removal of the lesion in 100% of the patients. Because of the small quantity of radioactivity, the procedure is safe for both patients and the medical staff, producing less discomfort in patients than wire localization.

  13. Local anesthesia of genital mucosa with a lidocaine/prilocaine combination cream before laser therapy of human papillomavirus lesions.

    PubMed

    Monsonego, J; Semaille, C

    2000-12-01

    The objective was to assess the efficacy of the lidocaine 2. 5%/prilocaine 2.5% combination cream during CO2 laser vaporisation treatment of human papillomavirus-related anogenital lesions. The cream was applied 1 to 30 min beforehand. Patients assessed pain using a visual analogue scale. Regardless of the site and lesion surface area, anaesthesia was greatest when the cream was applied 5 to 15 min before treatment. Extra-cervical lesions (vagina, vulva, perineum, anus) were globally less painful than cervical lesions. Lesion surface area is a decisive factor in pre-operative anaesthesia. Small surface-area lesions (< 1 cm2) had significantly greater anaesthesia than larger surface area-lesions (> 5 cm2) (p<0.00001). The study cream proved particularly useful for complete anaesthesia in ambulatory treatment of anal (70%) and urethral (60%) mucosa lesions compared to the uterine cervix (p = 0.03). In terms of anaesthetic efficacy and cost-related benefits, the lidocaine/prilocaine cream is an effective and interesting alternative to locoregional intra-lesional anaesthesia or even to general anaesthesia, for excision and destruction of human papillomavirus-related anogenital lesions.

  14. Bacteriology of diabetic foot lesions.

    PubMed

    Yoga, R; Khairul, A; Sunita, K; Suresh, C

    2006-02-01

    Infection plays a pivotal role in enhancing a diabetic foot at risk toward amputation. Effective antibiotic therapy against the offending pathogens is an important component of treatment of diabetic foot infections. Recognition of the pathogen is always difficult as the representative deep tissue sample for culture is surrounded by ulcer surface harbouring colonies of organisms frequently labelled as skin commensals. The emergent of resistant strains represents a compounding problem standing against efforts to prevent amputation. This study was undertaken to identify the pathogens associated with diabetic foot infection in terms of their frequency and sensitivity against certain commonly used antibiotics. Forty-four consecutive patients with open diabetic foot infections had wound swab taken for culture and sensitivity testing. Cultures positive were observed in 89% of the cases with Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeroginosa encountered in 20%, 14% and 14% of cases respectively. Mixed growths were isolated in 6% of cultures. All Staphylcoccus aureus isolates were resistant to Penicillin but 80% were sensitive to Erythromycin and Co-trimoxazole. Klebsiella pneumoniae isolates were sensitive to Methicillin and Gentamycin in 80% and 60% of cases respectively, and resistant to Ampicillin and Ceftazidime in 83% and 50% respectively. All Pseudomonas aeroginosa isolates were sensitive to Amikacin and Ciprofloxacin but 50% were resistant to Gentamycin. There was no single antibiotic possessing good coverage for all common organisms isolated from diabetic foot lesions. Staphylococcus aureus remains the predominant cause of diabetic foot infections followed by Klebsiela pneumonia and Pseudomonas aeroginosa. Most infections are monomicrobial. The emergence of multiresistant organisms is a worrying feature in diabetic foot infections.

  15. Mapping the Binding Site of the Inhibitor Tariquidar That Stabilizes the First Transmembrane Domain of P-glycoprotein*

    PubMed Central

    Loo, Tip W.; Clarke, David M.

    2015-01-01

    ABC (ATP-binding cassette) transporters are clinically important because drug pumps like P-glycoprotein (P-gp, ABCB1) confer multidrug resistance and mutant ABC proteins are responsible for many protein-folding diseases such as cystic fibrosis. Identification of the tariquidar-binding site has been the subject of intensive molecular modeling studies because it is the most potent inhibitor and corrector of P-gp. Tariquidar is a unique P-gp inhibitor because it locks the pump in a conformation that blocks drug efflux but activates ATPase activity. In silico docking studies have identified several potential tariquidar-binding sites. Here, we show through cross-linking studies that tariquidar most likely binds to sites within the transmembrane (TM) segments located in one wing or at the interface between the two wings (12 TM segments form 2 divergent wings). We then introduced arginine residues at all positions in the 12 TM segments (223 mutants) of P-gp. The rationale was that a charged residue in the drug-binding pocket would disrupt hydrophobic interaction with tariquidar and inhibit its ability to rescue processing mutants or stimulate ATPase activity. Arginines introduced at 30 positions significantly inhibited tariquidar rescue of a processing mutant and activation of ATPase activity. The results suggest that tariquidar binds to a site within the drug-binding pocket at the interface between the TM segments of both structural wings. Tariquidar differed from other drug substrates, however, as it stabilized the first TM domain. Stabilization of the first TM domain appears to be a key mechanism for high efficiency rescue of ABC processing mutants that cause disease. PMID:26507655

  16. Liver lesions in winter flounder (Pseudopleuronectes americanus) from Jamaica Bay, New York: Indications of environmental degradation

    USGS Publications Warehouse

    Augspurger, T.P.; Herman, R.L.; Tanacredi, J.T.; Hatfield, J.S.

    1994-01-01

    Liver sections of winter flounder (Pseudopleuronectes americanus) collected from Jamaica Bay and Shinnecock Bay, New York, in 1989, were examined microscopically to determine the pervasiveness of liver lesions observed previously in Jamaica Bay winter flounder. Neoplastic lesions were not detected in fish from Jamaica Bay or the Shinnecock Bay reference site. Twenty-two percent of Jamaica Bay winter flounder examined (n = 103) had unusual vacuolization of hepatocytes and biliary pre-ductal and ductal cells (referred to hereafter as the vacuolated cell lesion). The lesion, identical to that found in 25% of Jamaica Bay winter flounder examined in 1988, has previously been identified in fishes taken from highly polluted regions of the Atlantic coast (e.g., Boston Harbor, Massachusetts, and Black Rock Harbor, Connecticut). Prevalence of the vacuolated cell lesion in winter flounder from Jamaica Bay was significantly greater (p < 0.0001) than in 102 specimens collected from Shinnecock Bay. Current scientific literature indicates vacuolated hepatocytes and cholangiocytes are chronically injured and that the extent of their deformity is consistent with the action of a hepatotoxicant. The high prevalence of vacuolated hepatocytes in Jamaica Bay winter flounder and absence of the lesion in flounder from reference sites strongly supports the hypothesis that this impairment is a manifestation of a toxic condition in at least some portions of Jamaica Bay.

  17. Effect of the chest wall on breast lesion reconstruction

    PubMed Central

    Ardeshirpour, Yasaman; Huang, Minming; Zhu, Quing

    2009-01-01

    The chest wall underneath the breast tissue affects near-infrared (NIR) diffusive waves measured with reflection geometry. With the assistance of a co-registered ultrasound, the depth and the tilting angle of the chest wall can be determined and are used to model the breast as a two-layer medium. Finite element method (FEM) is suitable for modeling complex boundary conditions and is adapted to model the breast tissue and chest wall. Four parameters of bulk absorption and reduced scattering coefficients of these two layers are estimated and used for imaging reconstruction. Using a two-layer model, we have systematically investigated the effect of the chest wall on breast lesion reconstruction. Results have shown that chest-wall depth, titling angle, and difference between optical properties of two layers of lesion and reference sites affect the lesion reconstruction differently. Our analysis will be valuable and informative to researchers who are using reflectance geometry for breast imaging. The analysis can also provide guidelines for imaging operators to minimize image artifacts and to produce the best reconstruction results. PMID:19725717

  18. Esophageal subepithelial lesion diagnosed as malignant gastrointestinal neuroectodermal tumor.

    PubMed

    Kim, Sung Bum; Lee, Si Hyung; Gu, Mi Jin

    2015-05-14

    A 21-year-old male visited our hospital with a complaint of aggravating dysphagia and odynophagia for a few days. Esophagogastroduodenoscopy showed huge bulging mucosa with an intact surface causing luminal narrowing at 35 cm from the incisor teeth. Endoscopic ultrasonography showed an about 35 mm sized irregular margined in-homogenous hypoechoic lesion with an obscure layer of origin. Endoscopic ultrasonography fine needle aspiration revealed spindle cell proliferation without immunoreactivity for CD117, SMA, and cytokeratin. The patient underwent excision of the subepithelial lesion at the distal esophagus. On pathologic examination of the specimen, the tumor was composed of short fascicles of oval to spindle cells with eosinophilic and clear cytoplasm and vesicular nuclei. The tumor cells were positive for S-100 and SOX10 and negative for CD117, SMA, HMB-45, melan-A, cytokeratin, and CD99. The split-apart signal was detected in EWSR1 on FISH, suggesting a malignant gastrointestinal neuroectodermal tumor. At the time of writing, the patient is on radiation therapy at the operated site of esophagus and doing well, with no recurrence for three months. Malignant gastrointestinal neuroectodermal tumor is a rare gastrointestinal tumor with features of clear cell sarcoma, without melanocytic differentiation, and shows a poor prognosis. This is the first reported case of malignant gastrointestinal neuroectodermal tumor arising as subepithelial lesion in the esophagus.

  19. Colon Preneoplastic Lesions in Animal Models

    PubMed Central

    Suzui, Masumi; Morioka, Takamitsu; Yoshimi, Naoki

    2013-01-01

    The animal model is a powerful and fundamental tool in the field of biochemical research including toxicology, carcinogenesis, cancer therapeutics and prevention. In the carcinogenesis animal model system, numerous examples of preneoplastic lesions have been isolated and investigated from various perspectives. This may indicate that several options of endpoints to evaluate carcinogenesis effect or therapeutic outcome are presently available; however, classification of preneoplastic lesions has become complicated. For instance, these lesions include aberrant crypt foci (ACF), dysplastic ACF, flat ACF, β-catenin accumulated crypts, and mucin-depleted foci. These lesions have been induced by commonly used chemical carcinogens such as azoxymethane (AOM), 1,2-dimethylhydrazine (DMH), methylnitrosourea (MUN), or 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). Investigators can choose any procedures or methods to examine colonic preneoplastic lesions according to their interests and the objectives of their experiments. Based on topographical, histopathological, and biological features of colon cancer preneoplastic lesions in the animal model, we summarize and discuss the character and implications of these lesions. PMID:24526805

  20. Polypoidal Lesions in the Nasal Cavity

    PubMed Central

    Kumari M.K., Kalpana; K.C., Mahadeva

    2013-01-01

    Introduction: Nasal polyps are polypoidal masses arising from mucous membranes of nose and paranasal sinuses. They are overgrowths of the mucosa that frequently accompany allergic rhinitis. They are freely movable and nontender. Aims and Objectives: The purpose of this study was to study the histopathologic spectrum of polypoidal lesions of the nasal cavity. Materials and Methods: The study comprised of 100 consecutive cases of polypoidal lesions in the nasal cavity, received in the department of pathology. The age and sex of the patients were recorded. The tissues were routinely processed for histopathologic sections and stained with haematoxylin and eosin stains. Special stains like Periodic acid Schiff (PAS) was done wherever applicable. The cases were classified into neoplastic and nonneoplastic lesions. The neoplastic lesions were further classified according to WHO classification on histopathologic examination. Results: Analysis of 100 polypoidal lesions in the nose and paranasal sinuses with clinical diagnosis of nasal polyps, revealed 66 cases were nonneoplastic and 34 were neoplastic;17 (50%)were benign and 17(50%) were malignant. True nasal polyps both inflammatory and allergic together comprised 44 cases of the 100 polypoidal lesions in the nasal cavity. Angiofibroma and inverted papilloma were the most frequent benign tumour accounting for 12/17(0.7%). The most common malignant tumour was anaplastic carcinoma 7/17(0.4%). Nonneoplastic and benign tumours were common in younger age groups whereas malignant tumours were most common in older males. Conclusion: The majority of polypoidal lesions in the nasal cavity are nonneoplastic. PMID:23905098

  1. Hepatic lesions segmentation in ultrasound nonlinear imaging

    NASA Astrophysics Data System (ADS)

    Kissi, Adelaide A.; Cormier, Stephane; Pourcelot, Leandre; Tranquart, Francois

    2005-04-01

    Doppler has been used for many years for cardiovascular exploration in order to visualize the vessels walls and anatomical or functional diseases. The use of ultrasound contrast agents makes it possible to improve ultrasonic information. Nonlinear ultrasound imaging highlights the detection of these agents within an organ and hence is a powerful technique to image perfusion of an organ in real-time. The visualization of flow and perfusion provides important information for the diagnosis of various diseases as well as for the detection of tumors. However, the images are buried in noise, the speckle, inherent in the image formation. Furthermore at portal phase, there is often an absence of clear contrast between lesions and surrounding tissues because the organ is filled with agents. In this context, we propose a new method of automatic liver lesions segmentation in nonlinear imaging sequences for the quantification of perfusion. Our method of segmentation is divided into two stages. Initially, we developed an anisotropic diffusion step which raised the structural characteristics to eliminate the speckle. Then, a fuzzy competitive clustering process allowed us to delineate liver lesions. This method has been used to detect focal hepatic lesions (metastasis, nodular hyperplasia, adenoma). Compared to medical expert"s report obtained on 15 varied lesions, the automatic segmentation allows us to identify and delineate focal liver lesions during the portal phase which high accuracy. Our results show that this method improves markedly the recognition of focal hepatic lesions and opens the way for future precise quantification of contrast enhancement.

  2. Characterizing lesions in corals from American Samoa

    USGS Publications Warehouse

    Work, Thierry M.; Rameyer, R.A.

    2005-01-01

    The study of coral disease has suffered from an absence of systematic approaches that are commonly used to determine causes of diseases in animals. There is a critical need to develop a standardized and portable nomenclature for coral lesions in the field and to incorporate more commonly available biomedical tools in coral disease surveys to determine the potential causes of lesions in corals. We characterized lesions in corals from American Samoa based on gross and microscopic morphology and classified them as discoloration, growth anomalies, or tissue loss. The most common microscopic finding in corals manifesting discoloration was the depletion of zooxanthellae, followed by necrosis, sometimes associated with invasive algae or fungi. The most common microscopic lesion in corals manifesting tissue loss was cell necrosis often associated with algae, fungi, or protozoa. Corals with growth anomaly had microscopic evidence of hyperplasia of gastrovascular canals, followed by necrosis associated with algae or metazoa (polychaete worms). Several species of apparently normal corals also had microscopic changes, including the presence of bacterial aggregates or crustacea in tissues. A single type of gross lesion (e.g., discoloration) could have different microscopic manifestations. This phenomenon underlines the importance of using microscopy to provide a more systematic description of coral lesions and to detect potential pathogens associated with these lesions.

  3. The isolation of Actinomyces naeslundii from sound root surfaces and root carious lesions.

    PubMed

    Brailsford, S R; Lynch, E; Beighton, D

    1998-01-01

    The isolation of Actinomyces naeslundii from sound, exposed root surfaces (n = 56) and soft and leathery root carious lesions (n = 71) was investigated. Root carious lesions were sampled after the removal of overlying plaque. Supragingival plaque or carious dentine was sampled using a sterile excavator, the samples were disaggregated and cultured on both selective and non-selective media. A. naeslundii isolates were identified to the genospecies using specific antisera. Significantly greater numbers and proportions of A. naeslundii genospecies 2 than A. naeslundii genospecies 1 were isolated from all sites sampled. There was no significant difference between the numbers and proportions of the two genospecies isolated from leathery and soft lesions. The relationship between the presence of A. naeslundii genospecies and aciduric and acidogenic organisms was investigated. Those sound exposed root surfaces from which A. naeslundii genospecies 1 and/or 2 were isolated yielded significantly lower numbers of lactobacilli and yeasts than the surfaces from which A. naeslundii were not isolated. This difference was also found in leathery lesions but not soft root carious lesions. The microflora of soft root carious lesions was found to comprise primarily gram-positive pleomorphic rods which formed 70+/-7.8% of the flora, while in plaque from exposed root surfaces and in infected dentine from leathery lesions the gram-positive pleomorphic rods represented only 35% of the flora.

  4. Right Hemisphere Remapping of Naming Functions Depends on Lesion Size and Location in Poststroke Aphasia

    PubMed Central

    Skipper-Kallal, Laura M.; Lacey, Elizabeth H.; Xing, Shihui

    2017-01-01

    The study of language network plasticity following left hemisphere stroke is foundational to the understanding of aphasia recovery and neural plasticity in general. Damage in different language nodes may influence whether local plasticity is possible and whether right hemisphere recruitment is beneficial. However, the relationships of both lesion size and location to patterns of remapping are poorly understood. In the context of a picture naming fMRI task, we tested whether lesion size and location relate to activity in surviving left hemisphere language nodes, as well as homotopic activity in the right hemisphere during covert name retrieval and overt name production. We found that lesion size was positively associated with greater right hemisphere activity during both phases of naming, a pattern that has frequently been suggested but has not previously been clearly demonstrated. During overt naming, lesions in the inferior frontal gyrus led to deactivation of contralateral frontal areas, while lesions in motor cortex led to increased right motor cortex activity. Furthermore, increased right motor activity related to better naming performance only when left motor cortex was lesioned, suggesting compensatory takeover of speech or language function by the homotopic node. These findings demonstrate that reorganization of language function, and the degree to which reorganization facilitates aphasia recovery, is dependent on the size and site of the lesion. PMID:28168061

  5. Neurovestibular Compensation following Ototoxic Lesion and Labyrinthectomy

    PubMed Central

    Yazdanshenas, Hamed; Ashouri, Anousheh; Kaufman, Galen

    2016-01-01

    Introduction Unilateral labyrinthectomy and intra-tympanic gentamycin have been employed in the treatment of Ménière's disease, but the efficacy of these techniques has not been well established. Objective The objective of this study is to measure the time course of recovery from a unilateral labyrinthectomy either after ipsilateral topical treatment with gentamicin to the inner ear or without the previous insult. Methods Twenty-nine adult Mongolian gerbils were randomized into two experimental groups. Group 1 (n = 17) received a right ear gentamicin drug-induced lesion by unilateral labyrinthectomy (UL). Group 2 (n = 12) only received a right unilateral labyrinthectomy lesion. We measured the horizontal vestibulo-ocular responses in gerbils before and after the lesion. The gerbils received an angular acceleration stimulus and their eye movements were recorded. Results The gentamicin lesion resulted in a quicker recovery. Experimental groups underwent a similar time course of recovery. Statistical analysis showed no significant difference between the two groups. Both groups displayed adaptation to the lesion by day 21, but long-term compensation did not completely revert to the original pre-lesion state. Conclusions In a lesion requiring both static and dynamic compensation as in UL, the need for a static compensation may alter pre-existing compensation from a previous dynamic insult and require a new compensation. A previous lesion and adaptation is not preserved for a second lesion and the subject has to re-compensate. Therefore, surgical treatment in Meniere's disease such as UL can be considered without prior gentamicin treatment. Static and dynamic compensations do not appear to be as independent as previous studies have suggested. PMID:27096015

  6. Oral White Lesions Associated with Chewing Khat

    PubMed Central

    Gorsky, Meir; Epstein, Joel B; Levi, Harel; Yarom, Noam

    2004-01-01

    Introduction Khat is a cultivated plant whose leaves when chewed elevate mood. Unlike the chewing of betel nut, no association between the white oral mucosal lesions in khat users and oral malignancies has been reported. Chewing of khat has been documented in many countries and has increased with worldwide migration. The impact of chewing khat upon the oral mucosa is essentially unknown. Purpose The purpose of this study was to assess the occurrence of oral white changes in chronic khat chewers. Oral mucosal changes in a group of 47 Yemenite Israeli men over 30 years of age, who had chewed khat more than 3 years, were compared to those of 55 Yemenite men who did not chew. Results White lesions were significantly more prevalent in the khat chewers (83%) compared to the non chewing individuals (16%) (P < 0.001). White oral lesions were identified primarily on the lower buccal attached gingival mucosa, the alveolar mucosa and the lower mucobuccal fold on the chewing side (p < 0.001). There was no significant association between the occurrence of the white lesions and smoking. Even though the majority of the white lesions (85.4%) were homogenous, 71.4% of the non homogenous lesions were identified in khat chewers. Vital staining with toluidine blue and exfoliative cytology was conducted on a subset of patients with homogenous and non-homogenous oral lesions, and there were no findings suspicious for pre-malignant or malignant changes. Discussion This study demonstrated a relationship between khat chewing and oral white lesions, which we attribute to chronic local mechanical and chemical irritation of the mucosa. Our findings also suggest that mucosal changes associated with khat are benign, however, this initial study requires further studies including follow-up of khat users to confirm the current findings, including the likely benign changes associated with chronic use and histologic findings of clinical lesions.

  7. Oral White Lesions Associated with Chewing Khat

    PubMed Central

    Gorsky, Meir; Epstein, Joel B; Levi, Harel; Yarom, Noam

    2004-01-01

    Introduction Khat is a cultivated plant whose leaves when chewed elevate mood. Unlike the chewing of betel nut, no association between the white oral mucosal lesions in khat users and oral malignancies has been reported. Chewing of khat has been documented in many countries and has increased with worldwide migration. The impact of chewing khat upon the oral mucosa is essentially unknown. Purpose The purpose of this study was to assess the occurrence of oral white changes in chronic khat chewers. Oral mucosal changes in a group of 47 Yemenite Israeli men over 30 years of age, who had chewed khat more than 3 years, were compared to those of 55 Yemenite men who did not chew. Results White lesions were significantly more prevalent in the khat chewers (83%) compared to the non chewing individuals (16%) (P < 0.001). White oral lesions were identified primarily on the lower buccal attached gingival mucosa, the alveolar mucosa and the lower mucobuccal fold on the chewing side (p < 0.001). There was no significant association between the occurrence of the white lesions and smoking. Even though the majority of the white lesions (85.4%) were homogenous, 71.4% of the non homogenous lesions were identified in khat chewers. Vital staining with toluidine blue and exfoliative cytology was conducted on a subset of patients with homogenous and non-homogenous oral lesions, and there were no findings suspicious for pre-malignant or malignant changes. Discussion This study demonstrated a relationship between khat chewing and oral white lesions, which we attribute to chronic local mechanical and chemical irritation of the mucosa. Our findings also suggest that mucosal changes associated with khat are benign, however, this initial study requires further studies including follow-up of khat users to confirm the current findings, including the likely benign changes associated with chronic use and histologic findings of clinical lesions. PMID:19570281

  8. Sampling probability distributions of lesions in mammograms

    NASA Astrophysics Data System (ADS)

    Looney, P.; Warren, L. M.; Dance, D. R.; Young, K. C.

    2015-03-01

    One approach to image perception studies in mammography using virtual clinical trials involves the insertion of simulated lesions into normal mammograms. To facilitate this, a method has been developed that allows for sampling of lesion positions across the cranio-caudal and medio-lateral radiographic projections in accordance with measured distributions of real lesion locations. 6825 mammograms from our mammography image database were segmented to find the breast outline. The outlines were averaged and smoothed to produce an average outline for each laterality and radiographic projection. Lesions in 3304 mammograms with malignant findings were mapped on to a standardised breast image corresponding to the average breast outline using piecewise affine transforms. A four dimensional probability distribution function was found from the lesion locations in the cranio-caudal and medio-lateral radiographic projections for calcification and noncalcification lesions. Lesion locations sampled from this probability distribution function were mapped on to individual mammograms using a piecewise affine transform which transforms the average outline to the outline of the breast in the mammogram. The four dimensional probability distribution function was validated by comparing it to the two dimensional distributions found by considering each radiographic projection and laterality independently. The correlation of the location of the lesions sampled from the four dimensional probability distribution function across radiographic projections was shown to match the correlation of the locations of the original mapped lesion locations. The current system has been implemented as a web-service on a server using the Python Django framework. The server performs the sampling, performs the mapping and returns the results in a javascript object notation format.

  9. Functional Neuroanatomy and Behavioural Correlates of the Basal Ganglia: Evidence from Lesion Studies

    PubMed Central

    Ward, Peter; Seri, Stefano; Cavanna, Andrea Eugenio

    2013-01-01

    Introduction: The basal ganglia are interconnected with cortical areas involved in behavioural, cognitive and emotional processes, in addition to movement regulation. Little is known about which of these functions are associated with individual basal ganglia substructures. Methods: Pubmed was searched for literature related to behavioural, cognitive and emotional symptoms associated with focal lesions to basal ganglia structures in humans. Results: Six case-control studies and two case reports were identified as relevant. Lesion sites included the caudate nucleus, putamen and globus pallidus. These were associated with a spectrum of behavioural and cognitive symptoms, including abulia, poor working memory and deficits in emotional recognition. Discussion: It is often difficult to precisely map associations between cognitive, emotional or behavioural functions and particular basal ganglia substructures, due to the non-specific nature of the lesions. However, evidence from lesion studies shows that most symptoms correspond with established non-motor frontal-subcortical circuits. PMID:22713407

  10. [Liver ultrasound: focal lesions and diffuse diseases].

    PubMed

    Segura Grau, A; Valero López, I; Díaz Rodríguez, N; Segura Cabral, J M

    2016-01-01

    Liver ultrasound is frequently used as a first-line technique for the detection and characterization of the most common liver lesions, especially those incidentally found focal liver lesions, and for monitoring of chronic liver diseases. Ultrasound is not only used in the Bmode, but also with Doppler and, more recently, contrast-enhanced ultrasound. It is mainly used in the diagnosis of diffuse liver diseases, such as steatosis or cirrhosis. This article presents a practical approach for diagnosis workup, in which the different characteristics of the main focal liver lesions and diffuse liver diseases are reviewed.

  11. The Horizon for Treating Cutaneous Vascular Lesions

    PubMed Central

    Patel, Amit M.; Chou, Elizabeth L.; Findeiss, Laura; Kelly, Kristen M.

    2013-01-01

    Dermatologists encounter a wide range of cutaneous vascular lesions, including infantile hemangiomas, port-wine stain birthmarks, arteriovenous malformations, venous malformations, Kaposi sarcomas, angiosarcomas, and angiofibromas. Current treatment modalities to reduce these lesions include topical and/or intralesional steroids, laser therapy, surgical resection, and endovascular therapy. However, each method has limitations owing to recurrence, comorbidities, toxicity, or lesion location. Photodynamic therapy, antiangiogenic therapy, and evolving methods of sclerotherapy are promising areas of development that may mitigate limitations of current treatments and offer exciting options for patients and their physicians. PMID:22640429

  12. [Precancerous conditions and lesions of the stomach].

    PubMed

    Falt, P; Hanousek, M; Kundrátová, E; Urban, O

    2013-01-01

    Gastric carcinoma is a common malignant disease associated with an unfavorable prognosis in the case of late dia-gnosis. The most significant precancerous condition is chronic atrophic gastritis and intestinal metaplasia caused by Helicobacter pylori infection. These longlasting changes may lead to formation of dysplastic precancerous lesions. Upper endoscopy and histologic examination of forceps bio-psy specimens play a key role in the dia-gnosis of gastric precancerous conditions and lesions. Helicobacter pylori eradication therapy and endoscopic surveillance are main therapeutic modalities of gastric precancerous conditions. Localized precancerous lesions and early gastric neoplasia without the risk of lymphatic spread could be cured by means of endoscopic resection techniques.

  13. The horizon for treating cutaneous vascular lesions.

    PubMed

    Patel, Amit M; Chou, Elizabeth L; Findeiss, Laura; Kelly, Kristen M

    2012-06-01

    Dermatologists encounter a wide range of cutaneous vascular lesions, including infantile hemangiomas, port-wine stain birthmarks, arteriovenous malformations, venous malformations, Kaposi sarcomas, angiosarcomas, and angiofibromas. Current treatment modalities to reduce these lesions include topical and/or intralesional steroids, laser therapy, surgical resection, and endovascular therapy. However, each method has limitations owing to recurrence, comorbidities, toxicity, or lesion location. Photodynamic therapy, antiangiogenic therapy, and evolving methods of sclerotherapy are promising areas of development that may mitigate limitations of current treatments and offer exciting options for patients and their physicians.

  14. The effect of simulated metastatic lesions on the biomechanical behavior of the proximal femur.

    PubMed

    Benca, Emir; Reisinger, Andreas; Patsch, Janina M; Hirtler, Lena; Synek, Alexander; Stenicka, Sandra; Windhager, Reinhard; Mayr, Winfried; Pahr, Dieter H

    2017-02-27

    Pathologic fractures of femora in patients with metastatic cancer are associated with high morbidity and mortality. Prediction of impending fractures is based on unspecific clinical criteria or past clinician's experience, which leads to underestimation or overtreatment. The aim of this study was to investigate the effect of the site of metastatic lesions on biomechanical behavior of the proximal femur. Sixteen pairs of human femora were scanned with quantitative computed tomography (QCT) to asses bone mineral density. One femur of each pair remained intact while a defined lesion was reamed out in either the superolateral or inferomedial portion of the femoral neck of the contralateral femur. All femora were loaded in a mechanical test set-up mimicking one-legged stance and stiffness, failure load, and fracture location were determined. In the biomechanical experiments the superolateral lesion and the inferomedial lesion caused a stiffness reduction of 19% and 66%, respectively. The average failure load was 40% and 75% lower for specimens with the superolateral (4.53 ± 1.56 kN) and inferomedial (1.89 ± 1.73 kN) lesions, respectively, compared to intact specimens (7.66 ± 3.34 kN). Lesions in the femoral neck led to reduction in both stiffness and failure load of the proximal femur. Further, the site of the lesion had a large effect on the magnitude of the reduction in biomechanical properties. The presented data emphasize the importance of differentiating between locations of the lesion in pathologic fracture prediction of the metastatic femur and underline the insufficient accuracy of current predictive guidelines. This article is protected by copyright. All rights reserved.

  15. In vitro mutagenesis studies at the arginine residues of adenylate kinase. A revised binding site for AMP in the X-ray-deduced model.

    PubMed

    Kim, H J; Nishikawa, S; Tokutomi, Y; Takenaka, H; Hamada, M; Kuby, S A; Uesugi, S

    1990-02-06

    Although X-ray crystallographic and NMR studies have been made on the adenylate kinases, the substrate-binding sites are not unequivocally established. In an attempt to shed light on the binding sites for MgATP2- and for AMP2- in human cytosolic adenylate kinase (EC 2.7.4.3, hAK1), we have investigated the enzymic effects of replacement of the arginine residues (R44, R132, R138, and R149), which had been assumed by Pai et al. [Pai, E. F., Sachsenheimer, W., Schirmer, R. H., & Schulz, G. E. (1977) J. Mol. Biol. 114, 37-45] to interact with the phosphoryl groups of AMP2- and MgATP2-. With use of the site-directed mutagenesis method, point mutations were made in the artificial gene for hAK1 [Kim, H. J., Nishikawa, S., Tanaka, T., Uesugi, S., Takenaka, H., Hamada, M., & Kuby, S. A. (1989) Protein Eng. 2, 379-386] to replace these arginine residues with alanyl residues and yield the mutants R44A hAK1, R132A hAK1, R138A hAK1, and R149A hAK1. The resulting large increases in the Km,app values for AMP2- of the mutant enzymes, the relatively small increases in the Km,app values for MgATP2-, and the fact that the R132A, R138A, and R149A mutant enzymes proved to be very poor catalysts are consistent with the idea that the assigned substrate binding sites of Pai et al. (1977) have been reversed and that their ATP-binding site may be assigned as the AMP site.

  16. Human papillomavirus-32-associated focal epithelial hyperplasia accompanying HPV-16-positive papilloma-like lesions in oral mucosa.

    PubMed

    Liu, Na; Wang, Jiayi; Lei, Lei; Li, Yanzhong; Zhou, Min; Dan, Hongxia; Zeng, Xin; Chen, Qianming

    2013-05-01

    Human papillomavirus infection can cause a variety of benign or malignant oral lesions, and the various genotypes can cause distinct types of lesions. To our best knowledge, there has been no report of 2 different human papillomavirus-related oral lesions in different oral sites in the same patient before. This paper reported a patient with 2 different oral lesions which were clinically and histologically in accord with focal epithelial hyperplasia and oral papilloma, respectively. Using DNA extracted from these 2 different lesions, tissue blocks were tested for presence of human papillomavirus followed by specific polymerase chain reaction testing for 6, 11, 13, 16, 18, and 32 subtypes in order to confirm the clinical diagnosis. Finally, human papillomavirus-32-positive focal epithelial hyperplasia accompanying human papillomavirus-16-positive oral papilloma-like lesions were detected in different sites of the oral mucosa. Nucleotide sequence sequencing further confirmed the results. So in our clinical work, if the simultaneous occurrences of different human papillomavirus associated lesions are suspected, the multiple biopsies from different lesions and detection of human papillomavirus genotype are needed to confirm the diagnosis.

  17. Fractal analysis of tumoral lesions in brain.

    PubMed

    Martín-Landrove, Miguel; Pereira, Demian; Caldeira, María E; Itriago, Salvador; Juliac, María

    2007-01-01

    In this work, it is proposed a method for supervised characterization and classification of tumoral lesions in brain, based on the analysis of irregularities at the lesion contour on T2-weighted MR images. After the choice of a specific image, a segmentation procedure with a threshold selected from the histogram of intensity levels is applied to isolate the lesion, the contour is detected through the application of a gradient operator followed by a conversion to a "time series" using a chain code procedure. The correlation dimension is calculated and analyzed to discriminate between normal or malignant structures. The results found showed