Science.gov

Sample records for atp-binding site lesions

  1. Elucidating the site of protein-ATP binding by top-down mass spectrometry.

    PubMed

    Yin, Sheng; Loo, Joseph A

    2010-06-01

    A Fourier-transform ion cyclotron resonance (FT-ICR) top-down mass spectrometry strategy for determining the adenosine triphosphate (ATP)-binding site on chicken adenylate kinase is described. Noncovalent protein-ligand complexes are readily detected by electrospray ionization mass spectrometry (ESI-MS), but the ability to detect protein-ligand complexes depends on their stability in the gas phase. Previously, we showed that collisionally activated dissociation (CAD) of protein-nucleotide triphosphate complexes yield products from the dissociation of a covalent phosphate bond of the nucleotide with subsequent release of the nucleotide monophosphate (Yin, S. et al., J. Am. Soc. Mass Spectrom. 2008, 19, 1199-1208). The intrinsic stability of electrostatic interactions in the gas phase allows the diphosphate group to remain noncovalently bound to the protein. This feature is exploited to yield positional information on the site of ATP-binding on adenylate kinase. CAD and electron capture dissociation (ECD) of the adenylate kinase-ATP complex generate product ions bearing mono- and diphosphate groups from regions previously suggested as the ATP-binding pocket by NMR and crystallographic techniques. Top-down MS may be a viable tool to determine the ATP-binding sites on protein kinases and identify previously unknown protein kinases in a functional proteomics study. Copyright 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  2. AZT resistance alters enzymatic properties and creates an ATP-binding site in SFVmac reverse transcriptase.

    PubMed

    Schneider, Anna; Schweimer, Kristian; Rösch, Paul; Wöhrl, Birgitta M

    2015-02-22

    The replication of simian foamy virus from macaques can be inhibited by the nucleoside reverse transcriptase inhibitor azidothymidine (AZT, zidovudine). Four substitutions in the protease-reverse transcriptase (PR-RT) protein (K211I, I224T, S345T, E350K) are necessary to obtain highly AZT resistant and fully replication competent virus. AZT resistance is based on the excision of the incorporated AZTMP in the presence of ATP. I224T is a polymorphism which is not essential for AZT resistance per se, but is important for regaining efficient replication of the resistant virus. We constructed PR-RT enzymes harboring one to four amino acid substitutions to analyze them biochemically and to determine their ability to remove the incorporated AZTMP. S345T is the only single substitution variant exhibiting significant AZTMP excision activity. Although K211I alone showed no AZTMP excision activity, excision efficiency doubled when K211I was present in combination with S345T and E350K. K211I also decreased nucleotide binding affinity and increased fidelity. NMR titration experiments revealed that a truncated version of the highly AZT resistant mt4 variant, comprising only the fingers-palm subdomains was able to bind ATP with a KD-value of ca. 7.6 mM, whereas no ATP binding could be detected in the corresponding wild type protein. We could show by NMR spectroscopy that S345T is responsible for ATP binding, probably by making a tryptophan residue accessible. Although AZT resistance in SFVmac is based on excision of the incorporated AZTMP like in HIV-1, the functions of the resistance substitutions in SFVmac PR-RT appear to be different. No mutation resulting in an aromatic residue like F/Y215 in HIV, which is responsible for π-π-stacking interactions with ATP, is present in SFVmac. Instead, S345T is responsible for creating an ATP binding site, probably by making an already existing tryptophan more accessible, which in turn can interact with ATP. This is in contrast to HIV-1

  3. Functionally Important ATP Binding and Hydrolysis Sites in Escherichia coli MsbA †

    PubMed Central

    Westfahl, Kathryn M.; Merten, Jacqueline A.; Buchaklian, Adam H.; Klug, Candice S.

    2009-01-01

    ATP-binding cassette (ABC) transporters make up one of the largest classes of proteins found in nature, and their ability to move a variety of substrates across the membrane using energy from the binding or hydrolysis of ATP is essential to an array of human pathologies and to bacterial viability. MsbA is an essential ABC transporter that specifically transports lipid A across the inner membranes of Gram-negative organisms such as Escherichia coli. The exact mechanisms of function during the binding and hydrolysis of ATP at the molecular level remain unclear. The studies presented and summarized in this work directly address the role and local dynamics of specific residues within the conserved ABC motifs in E. coli MsbA using in vivo growth and biochemical activity assays coupled with site-directed spin labeling electron paramagnetic resonance (EPR) spectroscopy motional and accessibility analysis. This first comprehensive analysis of the specific residues in these motifs within MsbA indicates that closure of the dimer interface does not occur upon ATP binding in this transporter. PMID:19053284

  4. Biophysical characterization of an indolinone inhibitor in the ATP-binding site of DNA gyrase.

    PubMed

    Oblak, Marko; Grdadolnik, Simona Golic; Kotnik, Miha; Poterszman, Arnaud; Atkinson, R Andrew; Nierengarten, Helene; Desplancq, Dominique; Moras, Dino; Solmajer, Tom

    2006-11-03

    Fighting bacterial resistance is a challenging task in the field of medicinal chemistry. DNA gyrase represents a validated antibacterial target and has drawn much interest in recent years. By a structure-based approach we have previously discovered compound 1, an indolinone derivative, possessing inhibitory activity against DNA gyrase. In the present paper, a detailed biophysical characterization of this inhibitor is described. Using mass spectrometry, NMR spectroscopy, and fluorescence experiments we have demonstrated that compound 1 binds reversibly to the ATP-binding site of the 24 kDa N-terminal fragment of DNA gyrase B from Escherichia coli (GyrB24) with low micromolar affinity. Based on these data, a plausible molecular model of compound 1 in the active site of GyrB24 was constructed. The predicted binding mode explains the competitive inhibitory mechanism with respect to ATP and forms a useful basis for further development of potent DNA gyrase inhibitors.

  5. Green tea catechins inhibit bacterial DNA gyrase by interaction with its ATP binding site.

    PubMed

    Gradisar, Helena; Pristovsek, Primoz; Plaper, Andreja; Jerala, Roman

    2007-01-25

    Catechins are the main ingredients of green tea extracts and have been shown to possess versatile biological activities, including antimicrobial. We determined that the catechins inhibit bacterial DNA gyrase by binding to the ATP binding site of the gyrase B subunit. In the group of four tested catechins, epigallocatechin gallate (EGCG) had the highest activity, followed by epicatechin gallate (ECG) and epigallocatechin (EGC). Specific binding to the N-terminal 24 kDa fragment of gyrase B was determined by fluorescence spectroscopy and confirmed using heteronuclear two-dimensional NMR spectroscopy of the EGCG-15N-labeled gyrase B fragment complex. Protein residues affected by binding to EGCG were identified through chemical shift perturbation. Molecular docking calculations suggest that the benzopyran ring of EGCG penetrates deeply into the active site while the galloyl moiety anchors it to the cleft through interactions with its hydroxyl groups, which explains the higher activity of EGCG and ECG.

  6. Distribution and characterisation of [3H]alpha,beta-methylene ATP binding sites in the rat.

    PubMed

    Michel, A D; Humphrey, P P

    1993-12-01

    Radioligand binding studies have been performed to study the distribution of the binding sites for the P2x purinoceptor selective agonist radioligand, [3H]alpha,beta-methylene ATP ([3H]alpha beta-meATP), in membranes prepared from various peripheral organs and several brain regions of the rat. In agreement with previous studies in the rat vas deferens, [3H]alpha beta-meATP labelled two populations of sites. One site exhibited high affinity for the ligand (Kd = 0.7 nM; Bmax = 1012 fmol.mg-1 protein) while the other site exhibited lower affinity (Kd = 70.8 nM) and higher capacity (Bmax) = 7470 fmol.mg-1 protein). In competition studies, using a low concentration of radioligand (1 nM), the high affinity alpha beta-meATP binding sites in vas deferens membranes could be preferentially labelled (84-91%). Under these conditions, the P2x purinoceptor agonists, alpha beta-meATP and beta, gamma-methylene ATP, had the highest affinity with pIC50 values of 8.3 and 7.3 respectively. The P2y purinoceptor agonist, 2-methyl-thio-ATP (2-me-S-ATP), had lower affinity (pIC50 = 6.7), while uridine triphosphate, adenosine diphosphate and adenosine, agonists at the P2u, P2t and P1 purinoceptors, respectively, possessed low affinity (pIC50 values < 5.6). In addition, the P2 purinoceptor antagonists, cibacron blue and suramin, inhibited binding over the same concentration range at which they behave as functional antagonists at the P2x purinoceptor. High and low affinity binding sites for [3H]alpha beta-meATP were also identified in a range of other peripheral tissues (spleen, heart and liver) and in several brain regions (striatum, cerebral cortex, hippocampus). In the spleen, heart, cerebral cortex and liver the Kd values at both the high affinity binding sites (Kd = 1-1.2 nM) and the low affinity binding sites (Kd = 98-158 nM) were similar to the respective Kd values at the high and low affinity binding sites in the vas deferens. In competition studies performed using a low

  7. Formycin triphosphate as a probe for the ATP binding site involved in the activation of guanylate cyclase.

    PubMed

    Chang, C H; Yu, Z N; Song, D L

    1992-10-01

    Formycin A triphosphate (FTP), a fluorescent analog of ATP, slightly increased basal guanylate cyclase activity, but significantly potentiated guanylate cyclase activity stimulated by atrial natriuretic factor (ANF) in rat lung membranes. FTP potentiated ANF-stimulated guanylate cyclase activity with an EC50 at about 90 microM and inhibited ATP-stimulated guanylate cyclase activity with an IC50 at about 100 microM. These results indicate that FTP binds more tightly than ATP for the same binding site. Therefore, FTP would be an excellent tool for studying the ATP binding site.

  8. ATP binding and hydrolysis steps of the uni-site catalysis by the mitochondrial F(1)-ATPase are affected by inorganic phosphate.

    PubMed

    Milgrom, Yakov M

    2010-10-01

    The effect of inorganic phosphate (P(i)) on uni-site ATP binding and hydrolysis by the nucleotide-depleted F(1)-ATPase from beef heart mitochondria (ndMF(1)) has been investigated. It is shown for the first time that P(i) decreases the apparent rate constant of uni-site ATP binding by ndMF(1) 3-fold with the K(d) of 0.38+/-0.14mM. During uni-site ATP hydrolysis, P(i) also shifts equilibrium between bound ATP and ADP+P(i) in the direction of ATP synthesis with the K(d) of 0.17+/-0.03mM. However, 10mM P(i) does not significantly affect ATP binding during multi-site catalysis.

  9. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site

    PubMed Central

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R.; Phillips, Chris; Augustin, Martin A.; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek

    2016-01-01

    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5–inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  10. Consensus topography in the ATP binding site of the simian virus 40 and polyomavirus large tumor antigens

    SciTech Connect

    Bradley, M.K.; Smith, T.F.; Lathrop, R.H.; Livingston, D.M.; Webster, T.A.

    1987-06-01

    The location and sequence composition of a consensus element of the nucleotide binding site in both simian virus 40 (SV40) and polyomavirus (PyV) large tumor antigens (T antigens) can be predicted with the assistance of a computer-based pattern-matching system, ARIADNE. The latter was used to optimally align elements of T antigen primary sequence and predicted secondary structure with a descriptor for a mononucleotide binding fold. Additional consensus elements of the nucleotide binding site in these two proteins were derived from comparisons of T antigen primary and predicted secondary structures with x-ray structures of the nucleotide binding sites in four otherwise unrelated proteins. Each of these elements was predicted to be encompassed within a 110-residue segment that is highly conserved between the two T antigens residues 418-528 in SV 40 T antigen and residues 565-675 in PyV. Results of biochemical and immunologic experiments on the nucleotide binding behavior of these proteins using (/sup 32/P)-Amp-labeled SV40 T antigen, were found to be consistent with these predictions. Taken together, the latter have resulted in a topological model of the ATP binding site in these two oncogene products.

  11. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites.

    PubMed

    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi

    2017-02-24

    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer.

  12. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

    PubMed Central

    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi

    2017-01-01

    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer. PMID:28245558

  13. Optimization of the degenerated interfacial ATP binding site improves the function of disease-related mutant cystic fibrosis transmembrane conductance regulator (CFTR) channels.

    PubMed

    Tsai, Ming-Feng; Jih, Kang-Yang; Shimizu, Hiroyasu; Li, Min; Hwang, Tzyh-Chang

    2010-11-26

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, an ATP binding cassette (ABC) protein whose defects cause the deadly genetic disease cystic fibrosis (CF), encompasses two nucleotide binding domains (NBD1 and NBD2). Recent studies indicate that in the presence of ATP, the two NBDs coalesce into a dimer, trapping an ATP molecule in each of the two interfacial composite ATP binding sites (site 1 and site 2). Experimental evidence also suggests that CFTR gating is mainly controlled by ATP binding and hydrolysis in site 2, whereas site 1, which harbors several non-canonical substitutions in ATP-interacting motifs, is considered degenerated. The CF-associated mutation G551D, by introducing a bulky and negatively charged side chain into site 2, completely abolishes ATP-induced openings of CFTR. Here, we report a strategy to optimize site 1 for ATP binding by converting two amino acid residues to ABC consensus (i.e. H1348G) or more commonly seen residues in other ABC proteins (i.e. W401Y,W401F). Introducing either one or both of these mutations into G551D-CFTR confers ATP responsiveness for this disease-associated mutant channel. We further showed that the same maneuver also improved the function of WT-CFTR and the most common CF-associated ΔF508 channels, both of which rely on site 2 for gating control. Thus, our results demonstrated that the degenerated site 1 can be rebuilt to complement or support site 2 for CFTR function. Possible approaches for developing CFTR potentiators targeting site 1 will be discussed.

  14. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    SciTech Connect

    Zoghbi, M. E.; Altenberg, G. A.

    2013-10-15

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.

  15. The crustacean gill (Na+,K+)-ATPase: allosteric modulation of high- and low-affinity ATP-binding sites by sodium and potassium.

    PubMed

    Masui, D C; Silva, E C C; Mantelatto, F L M; McNamara, J C; Barrabin, H; Scofano, H M; Fontes, C F L; Furriel, R P M; Leone, F A

    2008-11-15

    The blue crab, Callinectes danae, tolerates exposure to a wide salinity range employing mechanisms of compensatory ion uptake when in dilute media. Although the gill (Na+,K+)-ATPase is vital to hyperosmoregulatory ability, the interactions occurring at the sites of ATP binding on the molecule itself are unknown. Here, we investigate the modulation by Na+ and K+ of homotropic interactions between the ATP-binding sites, and of phosphoenzyme formation of the (Na+,K+)-ATPase from the posterior gills of this euryhaline crab. The contribution of the high- and low-affinity ATP-binding sites to maximum velocity was similar for both Na+ and K+. However, in contrast to Na+, a threshold K+ concentration triggers the appearance of the high-affinity binding sites, displacing the saturation curve to lower ATP concentrations.Further, a low-affinity site for phosphorylation is present on the enzyme. These findings reveal notable differences in the catalytic mechanism of the crustacean (Na+,K+)-ATPase compared to the vertebrate enzyme.

  16. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers*

    PubMed Central

    Zoghbi, Maria E.; Altenberg, Guillermo A.

    2013-01-01

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation. PMID:24129575

  17. The Deviant ATP-binding Site of the Multidrug Efflux Pump Pdr5 Plays an Active Role in the Transport Cycle*

    PubMed Central

    Furman, Christopher; Mehla, Jitender; Ananthaswamy, Neeti; Arya, Nidhi; Kulesh, Bridget; Kovach, Ildiko; Ambudkar, Suresh V.; Golin, John

    2013-01-01

    Pdr5 is the founding member of a large subfamily of evolutionarily distinct, clinically important fungal ABC transporters containing a characteristic, deviant ATP-binding site with altered Walker A, Walker B, Signature (C-loop), and Q-loop residues. In contrast to these motifs, the D-loops of the two ATP-binding sites have similar sequences, including a completely conserved aspartate residue. Alanine substitution mutants in the deviant Walker A and Signature motifs retain significant, albeit reduced, ATPase activity and drug resistance. The D-loop residue mutants D340A and D1042A showed a striking reduction in plasma membrane transporter levels. The D1042N mutation localized properly had nearly WT ATPase activity but was defective in transport and was profoundly hypersensitive to Pdr5 substrates. Therefore, there was a strong uncoupling of ATPase activity and drug efflux. Taken together, the properties of the mutants suggest an additional, critical intradomain signaling role for deviant ATP-binding sites. PMID:24019526

  18. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-02-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme.

  19. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed Central

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-01-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme. Images PMID:2869483

  20. Hyperactivity of the Arabidopsis cryptochrome (cry1) L407F mutant is caused by a structural alteration close to the cry1 ATP-binding site.

    PubMed

    Orth, Christian; Niemann, Nils; Hennig, Lars; Essen, Lars-Oliver; Batschauer, Alfred

    2017-08-04

    Plant cryptochromes (cry) act as UV-A/blue light receptors. The prototype, Arabidopsis thaliana cry1, regulates several light responses during the life cycle, including de-etiolation, and is also involved in regulating flowering time. The cry1 photocycle is initiated by light absorption by its FAD chromophore, which is most likely fully oxidized (FADox) in the dark state and photoreduced to the neutral flavin semiquinone (FADH°) in its lit state. Cryptochromes lack the DNA-repair activity of the closely related DNA photolyases, but they retain the ability to bind nucleotides such as ATP. The previously characterized L407F mutant allele of Arabidopsis cry1 is biologically hyperactive and seems to mimic the ATP-bound state of cry1, but the reason for this phenotypic change is unclear. Here, we show that cry1L407F can still bind ATP, has less pronounced photoreduction and formation of FADH° than wild-type cry1, and has a dark reversion rate 1.7 times lower than that of the wild type. The hyperactivity of cry1L407F is not related to a higher FADH° occupancy of the photoreceptor but is caused by a structural alteration close to the ATP-binding site. Moreover, we show that ATP binds to cry1 in both the dark and the lit states. This binding was not affected by cry1's C-terminal extension, which is important for signal transduction. Finally, we show that a recently discovered chemical inhibitor of cry1, 3-bromo-7-nitroindazole, competes for ATP binding and thereby diminishes FADH° formation, which demonstrates that both processes are important for cry1 function. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Functional roles of ATP-binding residues in the catalytic site of human mitochondrial NAD(P)+-dependent malic enzyme.

    PubMed

    Hung, Hui-Chih; Chien, Yu-Ching; Hsieh, Ju-Yi; Chang, Gu-Gang; Liu, Guang-Yaw

    2005-09-27

    Human mitochondrial NAD(P)+-dependent malic enzyme is inhibited by ATP. The X-ray crystal structures have revealed that two ATP molecules occupy both the active and exo site of the enzyme, suggesting that ATP might act as an allosteric inhibitor of the enzyme. However, mutagenesis studies and kinetic evidences indicated that the catalytic activity of the enzyme is inhibited by ATP through a competitive inhibition mechanism in the active site and not in the exo site. Three amino acid residues, Arg165, Asn259, and Glu314, which are hydrogen-bonded with NAD+ or ATP, are chosen to characterize their possible roles on the inhibitory effect of ATP for the enzyme. Our kinetic data clearly demonstrate that Arg165 is essential for catalysis. The R165A enzyme had very low enzyme activity, and it was only slightly inhibited by ATP and not activated by fumarate. The values of K(m,NAD) and K(i,ATP) to both NAD+ and malate were elevated. Elimination of the guanidino side chain of R165 made the enzyme defective on the binding of NAD+ and ATP, and it caused the charge imbalance in the active site. These effects possibly caused the enzyme to malfunction on its catalytic power. The N259A enzyme was less inhibited by ATP but could be fully activated by fumarate at a similar extent compared with the wild-type enzyme. For the N259A enzyme, the value of K(i,ATP) to NAD+ but not to malate was elevated, indicating that the hydrogen bonding between ATP and the amide side chain of this residue is important for the binding stability of ATP. Removal of this side chain did not cause any harmful effect on the fumarate-induced activation of the enzyme. The E314A enzyme, however, was severely inhibited by ATP and only slightly activated by fumarate. The values of K(m,malate), K(m,NAD), and K(i,ATP) to both NAD+ and malate for E314A were reduced to about 2-7-folds compared with those of the wild-type enzyme. It can be concluded that mutation of Glu314 to Ala eliminated the repulsive effects

  2. Position of the ATP-binding site of the Fe-protein relative to the iron-sulfur clusters 4Fe-4S and the iron-molybdenum-containing cofactor

    SciTech Connect

    Kondrat'eva, T.A.; Gvozdev, R.I.; Mitsova, I.Z.

    1986-06-10

    Nitrogenase was affinity labeled with epsilon-ATP at the ATP-binding sites and separated into protein components by ion exchange chromatography. In spectrofluorometric titration of the labeled Fe-protein with the native MoFe-protein from the wild strain of Azotobacter and the MoFe-protein not containing iron-sulfur clusters 4Fe-4S, a 4-6-fold quenching of the fluorescence of immobilized epsilon-ATP was observed. When the labeled Fe-protein was titrated with MoFe-protein from the Azotobacter mutant UW-45, on the contrary, there was a four-fold increase in the fluorescence of immobilized epsilon-ATP. Since the MoFe-protein of the Azotobacter mutant UW-45 differs from the MoFe-protein from the wild strain of Azotobacter only by the absence of an iron-molybdenum-containing cofactor (Fe-Mo-cofactor), it is suggested that the ATP-binding site of the Fe-protein is situated next to the FeMo-cofactor and at a distance from the iron-sulfur clusters 4Fe-4S when a complex is formed with the MoFe-protein. The formation of a complex is accompanied by a change in the conformation of the Fe-protein.

  3. Vanadate trapping of nucleotide at the ATP-binding sites of human multidrug resistance P-glycoprotein exposes different residues to the drug-binding site

    PubMed Central

    Loo, Tip W.; Clarke, David M.

    2002-01-01

    The human multidrug resistance P-glycoprotein uses ATP to transport a wide variety of structurally unrelated cytotoxic compounds out of the cell. In this study, we used cysteine-scanning mutagenesis and cross-linking studies to identify residues that are exposed to the drug-binding site upon vanadate trapping. In the absence of nucleotides, C222(TM4) was cross-linked to C868(TM10) and C872(TM10); C306(TM5) was cross-linked to C868(TM10), C872(TM10), C945(TM11), C982(TM12), and C984(TM12); and C339(TM6) was cross-linked to C868(TM10), C872(TM10), C942(TM11), C982(TM12), and C985(TM12). These cysteines are in the middle of the predicted transmembrane (TM) segments and form the drug-binding site. Cross-linking between 332C(TM6) and cysteines introduced at the extracellular side of other TM segments was also done. In the absence of nucleotides, residues 332C and 856C on the extracellular side of TMs 6 and 10, respectively, were cross-linked with a 13-Å cross-linker (M8M, 3,6-dioxaoctane-1,8-diyl bismethanethiosulfonate). ATP plus vanadate inhibited cross-linking between 332C(TM6) and 856C(TM10) as well as those in the drug-binding site. Instead, vanadate trapping promoted cross-linking between 332C(TM6) and 976C(TM12) with a 10-Å cross-linker (M6M, 1,6-hexanediyl bismethanethiosulfonate). When ATP hydrolysis was allowed to proceed, then 332C(TM12) could form a disulfide bond with 975C(TM12). The cross-linking pattern of 332C(TM6) with residues in TM10 and TM12 indicates that the drug-binding site undergoes dynamic and relatively large conformational changes, and that different residues are exposed to the drug-binding site during the resting phase, upon vanadate trapping and at the completion of the catalytic cycle. PMID:11891276

  4. The three-dimensional structure of MAP kinase p38[beta]: different features of the ATP-binding site in p38[beta] compared with p38[alpha

    SciTech Connect

    Patel, Sangita B.; Cameron, Patricia M.; O'Keefe, Stephen J.; Frantz-Wattley, Betsy; Thompson, Jed; O'Neill, Edward A.; Tennis, Trevor; Liu, Luping; Becker, Joseph W.; Scapin, Giovanna; Merck

    2010-10-18

    The p38 mitogen-activated protein kinases are activated in response to environmental stress and cytokines and play a significant role in transcriptional regulation and inflammatory responses. Of the four p38 isoforms known to date, two (p38{alpha} and p38{beta}) have been identified as targets for cytokine-suppressive anti-inflammatory drugs. Recently, it was reported that specific inhibition of the p38{alpha} isoform is necessary and sufficient for anti-inflammatory efficacy in vivo, while further inhibition of p38{beta} may not provide any additional benefit. In order to aid the development of p38{alpha}-selective compounds, the three-dimensional structure of p38{beta} was determined. To do so, the C162S and C119S,C162S mutants of human MAP kinase p38{beta} were cloned, expressed in Escherichia coli and purified. Initial screening hits in crystallization trials in the presence of an inhibitor led upon optimization to crystals that diffracted to 2.05 {angstrom} resolution and allowed structure determination (PDB codes 3gc8 and 3gc9 for the single and double mutant, respectively). The structure of the p38{alpha} C162S mutant in complex with the same inhibitor is also reported (PDB code 3gc7). A comparison between the structures of the two kinases showed that they are highly similar overall but that there are differences in the relative orientation of the N- and C-terminal domains that causes a reduction in the size of the ATP-binding pocket in p38{beta}. This difference in size between the two pockets could be exploited in order to achieve selectivity.

  5. Human small cell lung cancer NYH cells resistant to the bisdioxopiperazine ICRF-187 exhibit a functional dominant Tyr165Ser mutation in the Walker A ATP binding site of topoisomerase II alpha.

    PubMed

    Wessel, Irene; Jensen, Lars H; Renodon-Corniere, Axelle; Sorensen, Tina K; Nitiss, John L; Jensen, Peter B; Sehested, Maxwell

    2002-06-05

    Bisdioxopiperazine anti-cancer agents are catalytic inhibitors of topoisomerase II which by unknown means lock the enzyme in a closed clamp form and inhibit its ATPase activity. In order to demarcate a putative pharmacophore, we here describe a novel Tyr165Ser mutation in the enzyme's Walker A ATP binding site leading to specific bisdioxopiperazine resistance when transformed into a temperature-conditional yeast system. The Tyr165Ser mutation differed from a previously described Arg162Gln by being heterozygous and by purified Tyr165Ser enzyme being drug-resistant in a kinetoplast DNA decatenation enzymatic assay. This suggested dominant nature of Tyr165Ser was supported by co-transformation studies in yeast of plasmids carrying wild type and mutant genes. These results enable a model of the bisdioxopiperazine pharmacophore using the proposed asymmetric ATP hydrolysis of the enzyme.

  6. Phosphorylation at Ser²⁶ in the ATP-binding site of Ca²⁺/calmodulin-dependent kinase II as a mechanism for switching off the kinase activity.

    PubMed

    Yilmaz, Mehtap; Gangopadhyay, Samudra S; Leavis, Paul; Grabarek, Zenon; Morgan, Kathleen G

    2013-02-07

    CaMKII (Ca²⁺/calmodulin-dependent kinase II) is a serine/threonine phosphotransferase that is capable of long-term retention of activity due to autophosphorylation at a specific threonine residue within each subunit of its oligomeric structure. The γ isoform of CaMKII is a significant regulator of vascular contractility. Here, we show that phosphorylation of CaMKII γ at Ser²⁶, a residue located within the ATP-binding site, terminates the sustained activity of the enzyme. To test the physiological importance of phosphorylation at Ser²⁶, we generated a phosphospecific Ser²⁶ antibody and demonstrated an increase in Ser²⁶ phosphorylation upon depolarization and contraction of blood vessels. To determine if the phosphorylation of Ser²⁶ affects the kinase activity, we mutated Ser²⁶ to alanine or aspartic acid. The S26D mutation mimicking the phosphorylated state of CaMKII causes a dramatic decrease in Thr²⁸⁷ autophosphorylation levels and greatly reduces the catalytic activity towards an exogenous substrate (autocamtide-3), whereas the S26A mutation has no effect. These data combined with molecular modelling indicate that a negative charge at Ser²⁶ of CaMKII γ inhibits the catalytic activity of the enzyme towards its autophosphorylation site at Thr²⁸⁷ most probably by blocking ATP binding. We propose that Ser²⁶ phosphorylation constitutes an important mechanism for switching off CaMKII activity.

  7. Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.

    PubMed

    Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K

    2015-03-27

    The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium.

  8. GlnK, a PII-homologue: structure reveals ATP binding site and indicates how the T-loops may be involved in molecular recognition.

    PubMed

    Xu, Y; Cheah, E; Carr, P D; van Heeswijk, W C; Westerhoff, H V; Vasudevan, S G; Ollis, D L

    1998-09-11

    these crystals, GlnK occupies a position of 3-fold symmetry. ATP binds in a cleft on the side of the molecule. The cleft is suitably positioned for ATP to influence the flexible T-loops. It is found at the junction of two beta sheets and is formed by two peptides one of which contains a variant of the "Gly-loop" found in other mononucleotide binding proteins. This sequence, Thr-Gly-X-X-Gly-Asp-Gly-Lys-Ile-Phe, forms part of the B-loop and is conserved in a wide variety of organisms that include bacteria, algae and archeabacteria. This sequence is more highly conserved than the functional T-loop, suggesting that ATP has an important role in PII-like proteins. Copyright 1998 Academic Press.

  9. Profiling Protein Kinases and Other ATP Binding Proteins in Arabidopsis Using Acyl-ATP Probes*

    PubMed Central

    Villamor, Joji Grace; Kaschani, Farnusch; Colby, Tom; Oeljeklaus, Julian; Zhao, David; Kaiser, Markus; Patricelli, Matthew P.; van der Hoorn, Renier A. L.

    2013-01-01

    Many protein activities are driven by ATP binding and hydrolysis. Here, we explore the ATP binding proteome of the model plant Arabidopsis thaliana using acyl-ATP (AcATP)1 probes. These probes target ATP binding sites and covalently label lysine residues in the ATP binding pocket. Gel-based profiling using biotinylated AcATP showed that labeling is dependent on pH and divalent ions and can be competed by nucleotides. The vast majority of these AcATP-labeled proteins are known ATP binding proteins. Our search for labeled peptides upon in-gel digest led to the discovery that the biotin moiety of the labeled peptides is oxidized. The in-gel analysis displayed kinase domains of two receptor-like kinases (RLKs) at a lower than expected molecular weight, indicating that these RLKs lost the extracellular domain, possibly as a result of receptor shedding. Analysis of modified peptides using a gel-free platform identified 242 different labeling sites for AcATP in the Arabidopsis proteome. Examination of each individual labeling site revealed a preference of labeling in ATP binding pockets for a broad diversity of ATP binding proteins. Of these, 24 labeled peptides were from a diverse range of protein kinases, including RLKs, mitogen-activated protein kinases, and calcium-dependent kinases. A significant portion of the labeling sites could not be assigned to known nucleotide binding sites. However, the fact that labeling could be competed with ATP indicates that these labeling sites might represent previously uncharacterized nucleotide binding sites. A plot of spectral counts against expression levels illustrates the high specificity of AcATP probes for protein kinases and known ATP binding proteins. This work introduces profiling of ATP binding activities of a large diversity of proteins in plant proteomes. The data have been deposited in ProteomeXchange with the identifier PXD000188. PMID:23722185

  10. 4,6-Substituted-1,3,5-triazin-2(1H)-ones as monocyclic catalytic inhibitors of human DNA topoisomerase IIα targeting the ATP binding site.

    PubMed

    Pogorelčnik, Barbara; Janežič, Matej; Sosič, Izidor; Gobec, Stanislav; Solmajer, Tom; Perdih, Andrej

    2015-08-01

    Human DNA topoisomerase IIα (htIIα) is a validated target for the development of novel anticancer agents. Starting from our discovered 4-amino-1,3,5-triazine inhibitors of htIIα, we investigated a library of 2,4,6-trisubstituted-1,3,5-triazines for novel inhibitors that bind to the htIIα ATP binding site using a combination of structure-based and ligand-based pharmacophore models and molecular docking. 4,6-substituted-1,3,5-triazin-2(1H)-ones 8, 9 and 14 were identified as novel inhibitors with activity comparable to the established drug etoposide (1). Compound 8 inhibits the htIIα decatenation in a superior fashion to etoposide. Cleavage assays demonstrated that selected compounds 8 and 14 do not act as poisons and antagonize the poison effect of etoposide. Microscale thermophoresis (MST) confirmed binding of compound 8 to the htIIα ATPase domain and compound 14 effectively inhibits the htIIα mediated ATP hydrolysis. The molecular dynamics simulation study provides further insight into the molecular recognition. The 4,6-disubstituted-1,3,5-triazin-2(1H)-ones represent the first validated monocyclic class of catalytic inhibitors that bind to the to the htIIα ATPase domain.

  11. Characterization of [35S]-ATP alpha S and [3H]-alpha, beta-MeATP binding sites in rat brain cortical synaptosomes: regulation of ligand binding by divalent cations.

    PubMed

    Schäfer, R; Reiser, G

    1997-07-01

    1. We made a comparative analysis of the binding characteristics of the radioligands [35S]-ATP alpha S and [3H]-alpha, beta-MeATP in order to test whether these ligands can be used to analyse P2-purinoceptors in synaptosomal membranes from rat brain cortex. 2. Synaptosomes possess sites with high affinity for [35S]-ATP alpha S (Kd = 22.2 +/- 9.1 nM, Bmax = 14.8 pmol mg-1 protein). The rank order of the competition potency of the different compounds (ATP alpha S, ATP, ATP gamma S > ADP beta S, 2-MeSATP > deoxyATP, ADP > > UTP, alpha, beta-MeATP, AMP, Reactive Blue-2, suramin, isoPPADS) is consistent with pharmacological properties of P2Y-purinoceptors. 3. Under identical conditions [35S]-ATP alpha S and [3H]-alpha, beta-MeATP bind to different binding sites at synaptosomal membranes from rat brain cortex. The affinity of the [3H]-alpha, beta-MeATP binding sites (Kd = 13.7 +/- 1.8 nM, Bmax = 6.34 +/- 0.28 pmol mg-1 protein) was 38 fold higher than the potency of alpha, beta-MeATP to displace [35S]-ATP alpha S binding (Ki = 0.52 microM). ATP and ADP beta S competed at both binding sites with different affinities, 60 fold and 175 fold, respectively. The other agonists tested (2-MeSATP, UTP, GTP) did not affect specific [35H]-alpha, beta-MeATP binding at concentrations up to 100 microM. The antagonists (suramin, isoPPADS, Evan's Blue) showed completely different affinities for both binding sites. 4. Binding of [35S]-ATP alpha S on synaptosomes was regulated by GTP, which is indicative for G-protein coupled receptors. The Kd value for the high affinity binding site was reduced in the presence of GTP about 5 fold (from 1.8 nM to 8.6 nM). In the presence of Mg2+ the affinity was increased (Kd 1.8 nM versus 22 nM in the absence of Mg2+). 5. The binding of both radioligands was regulated in an opposite manner by physiological concentrations of Ca2+ and Mg2+. Binding of [3H]-alpha, beta-MeATP to synaptosomal membranes was increased 3 fold by raising the Ca2+ concentration

  12. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric

    2012-10-24

    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  13. Existence of a low-affinity ATP-binding site in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles: evidence from binding of 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP and -[3H]ATP.

    PubMed

    Suzuki, H; Kubota, T; Kubo, K; Kanazawa, T

    1990-07-31

    ATP-binding sites in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles were titrated with 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP (TNP-AMP) or -[3H]ATP (TNP-ATP) in the absence of Ca2+ at pH 7.0 and 0 degrees C by using a centrifugation procedure. In some measurements, the bound TNP-nucleotides were chased with ATP. The data were analyzed by best-fit computer programs as well as by Scatchard plots. The results showed the existence of 1 mol of TNP-AMP binding sites with high affinity (Kd = 7.62 nM) per mole of phosphorylatable sites. The affinity of these sites for ATP (Kd = 10.1 microM) agreed with that of catalytic sites for ATP in the absence of Ca2+. The results further showed the existence of 2 mol of TNP-ATP binding sites with uniform affinity (Kd = 156 nM) per mole of phosphorylatable sites. Half of the bound TNP-ATP was fully chased by low concentrations of ATP. The affinity of this class of the sites for ATP (Kd = 8.9 microM) again agreed with that of catalytic sites for ATP. The other half of the bound TNP-ATP was fully chased only by much higher concentrations of ATP. Thus, the affinity of this class of the sites for ATP (Kd = 791 microM) was much lower than that of catalytic sites for ATP. Similar measurements were performed with sarcoplasmic reticulum vesicles pretreated by N-(iodoacetyl)-N'-(5-sulfo-1-naphthyl)ethylenediamine. Although the affinities for TNP-ATP and for ATP were appreciably altered by this pretreatment, the results were essentially the same as those obtained with native vesicles.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Point mutations in human beta cardiac myosin heavy chain have differential effects on sarcomeric structure and assembly: an ATP binding site change disrupts both thick and thin filaments, whereas hypertrophic cardiomyopathy mutations display normal assembly.

    PubMed

    Becker, K D; Gottshall, K R; Hickey, R; Perriard, J C; Chien, K R

    1997-04-07

    Hypertrophic cardiomyopathy is a human heart disease characterized by increased ventricular mass, focal areas of fibrosis, myocyte, and myofibrillar disorganization. This genetically dominant disease can be caused by mutations in any one of several contractile proteins, including beta cardiac myosin heavy chain (beta MHC). To determine whether point mutations in human beta MHC have direct effects on interfering with filament assembly and sarcomeric structure, full-length wild-type and mutant human beta MHC cDNAs were cloned and expressed in primary cultures of neonatal rat ventricular cardiomyocytes (NRC) under conditions that promote myofibrillogenesis. A lysine to arginine change at amino acid 184 in the consensus ATP binding sequence of human beta MHC resulted in abnormal subcellular localization and disrupted both thick and thin filament structure in transfected NRC. Diffuse beta MHC K184R protein appeared to colocalize with actin throughout the myocyte, suggesting a tight interaction of these two proteins. Human beta MHC with S472V mutation assembled normally into thick filaments and did not affect sarcomeric structure. Two mutant myosins previously described as causing human hypertrophic cardiomyopathy, R249Q and R403Q, were competent to assemble into thick filaments producing myofibrils with well defined I bands, A bands, and H zones. Coexpression and detection of wild-type beta MHC and either R249Q or R403Q proteins in the same myocyte showed these proteins are equally able to assemble into the sarcomere and provided no discernible differences in subcellular localization. Thus, human beta MHC R249Q and R403Q mutant proteins were readily incorporated into NRC sarcomeres and did not disrupt myofilament formation. This study indicates that the phenotype of myofibrillar disarray seen in HCM patients which harbor either of these two mutations may not be directly due to the failure of the mutant myosin heavy chain protein to assemble and form normal sarcomeres

  15. Evidence of a calcium-induced structural change in the ATP-binding site of the sarcoplasmic-reticulum Ca2+-ATPase using terbium formycin triphosphate as an analogue of Mg-ATP.

    PubMed

    Girardet, J L; Dupont, Y; Lacapere, J J

    1989-09-01

    Terbium ions and terbium formycin triphosphate have been used to investigate the interactions between the cation and nucleotide binding sites of the sarcoplasmic reticulum Ca2+-ATPase. Three classes of Tb3+-binding sites have been found: a first class of low-affinity (Kd = 10 microM) corresponds to magnesium binding sites, located near a tryptophan residue of the protein; a second class of much higher affinity (less than 0.1 microM) corresponds to the calcium transport sites, their occupancy by terbium induces the E1 to E2 conformational change of the Ca2+-ATPase; a third class of sites is revealed by following the fluorescence transfer from formycin triphosphate (FTP) to terbium, evidencing that terbium ions can also bind into the nucleotide binding site at the same time as FTP. Substitution of H2O by D2O shows that Tb-FTP binding to the enzyme nucleotide site is associated with an important dehydration of the terbium ions associated with FTP. Two terbium ions, at least, bind to the Ca2+-ATPase in the close vicinity of FTP when this nucleotide is bound to the ATPase nucleotide site. Addition of calcium quenches the fluorescence signal of the terbium-FTP complex bound to the enzyme. Calcium concentration dependence shows that this effect is associated with the replacement of terbium by calcium in the transport sites, inducing the E2----E1 transconformation when calcium is bound. One interpretation of this fluorescence quenching is that the E1----E2 transition induces an important structural change in the nucleotide site. Another interpretation is that the high-affinity calcium sites are located very close to the Tb-FTP complex bound to the nucleotide site.

  16. Identification of ATP-binding regions in the RyR1 Ca²⁺ release channel.

    PubMed

    Popova, Olga B; Baker, Mariah R; Tran, Tina P; Le, Tri; Serysheva, Irina I

    2012-01-01

    ATP is an important modulator of gating in type 1 ryanodine receptor (RyR1), also known as a Ca²⁺ release channel in skeletal muscle cells. The activating effect of ATP on this channel is achieved by directly binding to one or more sites on the RyR1 protein. However, the number and location of these sites have yet to be determined. To identify the ATP-binding regions within RyR1 we used 2N₃ATP-2',3'-Biotin-LC-Hydrazone (BioATP-HDZ), a photo-reactive ATP analog to covalently label the channel. We found that BioATP-HDZ binds RyR1 specifically with an IC₅₀ = 0.6±0.2 mM, comparable with the reported EC50 for activation of RyR1 with ATP. Controlled proteolysis of labeled RyR1 followed by sequence analysis revealed three fragments with apparent molecular masses of 95, 45 and 70 kDa that were crosslinked by BioATP-HDZ and identified as RyR1 sequences. Our analysis identified four glycine-rich consensus motifs that can potentially constitute ATP-binding sites and are located within the N-terminal 95-kDa fragment. These putative nucleotide-binding sequences include amino acids 699-704, 701-706, 1081-1084 and 1195-1200, which are conserved among the three RyR isoforms. Located next to the N-terminal disease hotspot region in RyR1, these sequences may communicate the effects of ATP-binding to channel function by tuning conformational motions within the neighboring cytoplasmic regulatory domains. Two other labeled fragments lack ATP-binding consensus motifs and may form non-canonical ATP-binding sites. Based on domain topology in the 3D structure of RyR1 it is also conceivable that the identified ATP-binding regions, despite their wide separation in the primary sequence, may actually constitute the same non-contiguous ATP-binding pocket within the channel tetramer.

  17. ATP-binding cassette transporters in reproduction: a new frontier

    PubMed Central

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.

    2016-01-01

    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  18. The oxidation-state-dependent ATP-binding site of cytochrome c. Implication of an essential arginine residue and the effect of occupancy on the oxidation-reduction potential.

    PubMed Central

    Corthésy, B E; Wallace, C J

    1988-01-01

    Arg-91 is not part of the active site of cytochrome c that mediates binding and electron transfer, yet it is absolutely conserved in eukaryotic cytochromes c, indicating a special function. The physicochemical properties of analogues are unaffected by the modification of this residue, so they can be used with confidence to study the role of Arg-91. We have established limiting conditions under which this residue alone is specifically modified by cyclohexane-1,2-dione, and have subsequently shown that ATP, and to a lesser extent ADP or Pi, protects it from the action of the reagent in an oxidation-state-dependent manner. These observations strongly support the idea that this site exerts a controlling influence on cytochrome c activity in the electron transport or other cellular redox systems, and we have commenced a study of how that influence might operate. We find that the redox potentials of both cytochrome c and analogue are little affected by changing ATP or Pi concentrations. PMID:2843168

  19. Activation of ATP binding for the autophosphorylation of DosS, a Mycobacterium tuberculosis histidine kinase lacking an ATP lid motif.

    PubMed

    Cho, Ha Yeon; Lee, Young-Hoon; Bae, Young-Seuk; Kim, Eungbin; Kang, Beom Sik

    2013-05-03

    The sensor histidine kinases of Mycobacterium tuberculosis, DosS and DosT, are responsible for sensing hypoxic conditions and consist of sensor and kinase cores responsible for accepting signals and phosphorylation activity, respectively. The kinase core contains a dimerization and histidine phosphate-accepting (DHp) domain and an ATP binding domain (ABD). The 13 histidine kinase genes of M. tuberculosis can be grouped based on the presence or absence of the ATP lid motif and F box (elements known to play roles in ATP binding) in their ABDs; DosS and DosT have ABDs lacking both these elements, and the crystal structures of their ABDs indicated that they were unsuitable for ATP binding, as a short loop covers the putative ATP binding site. Although the ABD alone cannot bind ATP, the kinase core is functional in autophosphorylation. Appropriate spatial arrangement of the ABD and DHp domain within the kinase core is required for both autophosphorylation and ATP binding. An ionic interaction between Arg(440) in the DHp domain and Glu(537) in the short loop of the ABD is available and may open the ATP binding site, by repositioning the short loop away from the site. Mutations at Arg(440) and Glu(537) reduce autophosphorylation activity. Unlike other histidine kinases containing an ATP lid, which protects bound ATP, DosS is unable to accept ATP until the ABD is properly positioned relative to the histidine; this may prevent unexpected ATP reactions. ATP binding can, therefore, function as a control mechanism for histidine kinase activity.

  20. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi

    2016-01-01

    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  1. Topology of ATP-binding domain of adrenoleukodystrophy gene product in peroxisomes.

    PubMed

    Contreras, M; Sengupta, T K; Sheikh, F; Aubourg, P; Singh, I

    1996-10-15

    Adrenoleukodystrophy (X-ALD) is a demyelinating disorder characterized by the accumulation of saturated very-long-chain fatty acids (> C22:0) due to the impaired activity of lignoceroyl-CoA ligase. The gene responsible for the disease was found to code for a 84-kDa peroxisomal integral membrane protein. Its amino acid sequence has high homology with the ATP-binding cassette superfamily of transporters and it is predicted to have six membrane-spanning segments and a putative ATP-binding domain. To define the function of ALDP, we studied the topology of its ATP-binding domain by using antibodies (1D6) against a hydrophobic domain (amino acid residues 279 to 482) and antibodies (Abct) against the C-terminal 15-amino-acid hydrophilic domain (amino acid residues 731 to 745) of ALDP. The observation of punctate fluorescence in permeabilized ALD fibroblasts, using Abct antibodies but not with antibodies against catalase, suggests that the C-terminal segment of ALDP is projected toward the cytoplasm from the peroxisomal membrane. Trypsinization of intact peroxisomes under isotonic conditions abolishes the Abct antibody recognition site, whereas the 1D6 antibodies identify a degradation product of 43-kDa protein that has been protected and retained by the membrane. This again suggests that the C-terminal portion of the ALDP protein is located on the outside (cytoplasmic) face of the peroxisomal membrane. Additional support for this conclusion was obtained by purification of the ALDP C-terminal domain, released from purified rat liver peroxisomes incubated with the cytosolic fraction, using blue-Sepharose affinity chromatography. A 47-kDa peptide retained by the column was recognized by Western blot analysis with Abct antibodies against the C-terminal sequence of ALDP and this polypeptide on polyvinylidene difluoride membrane was able to bind [gamma-32P]ATP in vitro in the presence of Mg2+. These results demonstrate that the C-terminal peptide containing the ATP-binding

  2. Conserved mechanisms of microtubule-stimulated ADP release, ATP binding, and force generation in transport kinesins

    PubMed Central

    Atherton, Joseph; Farabella, Irene; Yu, I-Mei; Rosenfeld, Steven S; Houdusse, Anne; Topf, Maya; Moores, Carolyn A

    2014-01-01

    Kinesins are a superfamily of microtubule-based ATP-powered motors, important for multiple, essential cellular functions. How microtubule binding stimulates their ATPase and controls force generation is not understood. To address this fundamental question, we visualized microtubule-bound kinesin-1 and kinesin-3 motor domains at multiple steps in their ATPase cycles—including their nucleotide-free states—at ∼7 Å resolution using cryo-electron microscopy. In both motors, microtubule binding promotes ordered conformations of conserved loops that stimulate ADP release, enhance microtubule affinity and prime the catalytic site for ATP binding. ATP binding causes only small shifts of these nucleotide-coordinating loops but induces large conformational changes elsewhere that allow force generation and neck linker docking towards the microtubule plus end. Family-specific differences across the kinesin–microtubule interface account for the distinctive properties of each motor. Our data thus provide evidence for a conserved ATP-driven mechanism for kinesins and reveal the critical mechanistic contribution of the microtubule interface. DOI: http://dx.doi.org/10.7554/eLife.03680.001 PMID:25209998

  3. Invited review: Architectures and mechanisms of ATP binding cassette proteins.

    PubMed

    Hopfner, Karl-Peter

    2016-08-01

    ATP binding cassette (ABC) ATPases form chemo-mechanical engines and switches that function in a broad range of biological processes. Most prominently, a very large family of integral membrane NTPases-ABC transporters-catalyzes the import or export of a diverse molecules across membranes. ABC proteins are also important components of the chromosome segregation, recombination, and DNA repair machineries and regulate or catalyze critical steps of ribosomal protein synthesis. Recent structural and mechanistic studies draw interesting architectural and mechanistic parallels between diverse ABC proteins. Here, I review this state of our understanding how NTP-dependent conformational changes of ABC proteins drive diverse biological processes. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 492-504, 2016. © 2016 Wiley Periodicals, Inc.

  4. ATP binding cassette G transporters and plant male reproduction.

    PubMed

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing

    2016-01-01

    The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field.

  5. ATP binding cassette G transporters and plant male reproduction

    PubMed Central

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing

    2016-01-01

    ABSTRACT The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field. PMID:26906115

  6. Conformation of the ATP binding peptide in actin revealed by proton NMR spectroscopy

    SciTech Connect

    Barden, J.A.

    1987-09-22

    The actin peptide 106-124 exists in a completely conserved region of the sequence and binds strongly to both ATP and tripolyphosphate. Binding particularly affects residues 116 and 118 and generally affects the two segments 115-118 and 121-124. One-dimensional nuclear Overhauser enhancement difference spectroscopy was used to detect molecular interactions between both adjacent and nonadjacent residues. The N-terminal segment 106-112 was found to be largely extended. A sharp bend was detected between Pro-112 and Lys-113. The triphosphate moiety binds to the strongly hydrophilic central segment of the peptide. Evidence was obtained for a reverse turn involving residues 121-124. Amide proton temperature coefficients and coupling constants provide evidence for a type I ..beta..-turn. A model of the ATP binding site is proposed together with its relationship to other parts of the actin structure and to the phalloidin binding site.

  7. Complexed Structures of Formylglycinamide Ribonucleotide Amidotransferase from Thermotoga maritima Describe a Novel ATP Binding Protein Superfamily

    SciTech Connect

    Morar, Mariya; Anand, Ruchi; Hoskins, Aaron A.; Stubbe, JoAnne; Ealick, Steven E.

    2008-09-11

    Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent synthesis of formylglycinamidine ribonucleotide (FGAM) from formylglycinamide ribonucleotide (FGAR) and glutamine in the fourth step of the purine biosynthetic pathway. FGAR-AT is encoded by the purL gene. Two types of PurL have been detected. The first type, found in eukaryotes and Gram-negative bacteria, consists of a single 140 kDa polypeptide chain and is designated large PurL (lgPurL). The second type, small PurL (smPurL), is found in archaea and Gram-positive bacteria and consists of an 80 kDa polypeptide chain. SmPurL requires two additional gene products, PurQ and PurS, for activity. PurL is a member of a protein superfamily that contains a novel ATP-binding domain. Structures of several members of this superfamily are available in the unliganded form. We determined five different structures of FGAR-AT from Thermotoga maritima in the presence of substrates, a substrate analogue, and a product. These complexes have allowed a detailed description of the novel ATP-binding motif. The availability of a ternary complex enabled mapping of the active site, thus identifying potential residues involved in catalysis. The complexes show a conformational change in the active site compared to the unliganded structure. Surprising discoveries, an ATP molecule in an auxiliary site of the protein and the conformational changes associated with its binding, provoke speculation about the regulatory role of the auxiliary site in formation of the PurLSQ complex as well as the evolutionary relationship of PurLs from different organisms.

  8. ATP-Binding Cassette Efflux Transporters in Human Placenta

    PubMed Central

    Ni, Zhanglin; Mao, Qingcheng

    2010-01-01

    Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087

  9. ABCMdb reloaded: updates on mutations in ATP binding cassette proteins.

    PubMed

    Tordai, Hedvig; Jakab, Kristóf; Gyimesi, Gergely; András, Kinga; Brózik, Anna; Sarkadi, Balázs; Hegedus, Tamás

    2017-01-01

    ABC (ATP-Binding Cassette) proteins with altered function are responsible for numerous human diseases. To aid the selection of positions and amino acids for ABC structure/function studies we have generated a database, ABCMdb (Gyimesi et al. , ABCMdb: a database for the comparative analysis of protein mutations in ABC transporters, and a potential framework for a general application. Hum Mutat 2012; 33:1547-1556.), with interactive tools. The database has been populated with mentions of mutations extracted from full text papers, alignments and structural models. In the new version of the database we aimed to collect the effect of mutations from databases including ClinVar. Because of the low number of available data, even in the case of the widely studied disease-causing ABC proteins, we also included the possible effects of mutations based on SNAP2 and PROVEAN predictions. To aid the interpretation of variations in non-coding regions, the database was supplemented with related DNA level information. Our results emphasize the importance of in silico predictions because of the sparse information available on variants and suggest that mutations at analogous positions in homologous ABC proteins have a strong predictive power for the effects of mutations. Our improved ABCMdb advances the design of both experimental studies and meta-analyses in order to understand drug interactions of ABC proteins and the effects of mutations on functional expression.

  10. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    NASA Astrophysics Data System (ADS)

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-06-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH. radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD.-, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396-. Its negative charge could trigger conformational changes necessary for signal transduction.

  11. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    PubMed Central

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-01-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH· radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD·−, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396−. Its negative charge could trigger conformational changes necessary for signal transduction. PMID:24898692

  12. Peroxisomal ATP-binding cassette transporters form mainly tetramers.

    PubMed

    Geillon, Flore; Gondcaille, Catherine; Raas, Quentin; Dias, Alexandre M M; Pecqueur, Delphine; Truntzer, Caroline; Lucchi, Géraldine; Ducoroy, Patrick; Falson, Pierre; Savary, Stéphane; Trompier, Doriane

    2017-04-28

    ABCD1 and its homolog ABCD2 are peroxisomal ATP-binding cassette (ABC) half-transporters of fatty acyl-CoAs with both distinct and overlapping substrate specificities. Although it is established that ABC half-transporters have at least to dimerize to generate a functional unit, functional equivalents of tetramers (i.e. dimers of full-length transporters) have also been reported. However, oligomerization of peroxisomal ABCD transporters is incompletely understood but is of potential significance because more complex oligomerization might lead to differences in substrate specificity. In this work, we have characterized the quaternary structure of the ABCD1 and ABCD2 proteins in the peroxisomal membrane. Using various biochemical approaches, we clearly demonstrate that both transporters exist as both homo- and heterotetramers, with a predominance of homotetramers. In addition to tetramers, some larger molecular ABCD assemblies were also found but represented only a minor fraction. By using quantitative co-immunoprecipitation assays coupled with tandem mass spectrometry, we identified potential binding partners of ABCD2 involved in polyunsaturated fatty-acid metabolism. Interestingly, we identified calcium ATPases as ABCD2-binding partners, suggesting a role of ABCD2 in calcium signaling. In conclusion, we have shown here that ABCD1 and its homolog ABCD2 exist mainly as homotetramers in the peroxisomal membrane. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Human erythrocyte dematin and protein 4.2 (pallidin) are ATP binding proteins.

    PubMed

    Azim, A C; Marfatia, S M; Korsgren, C; Dotimas, E; Cohen, C M; Chishti, A H

    1996-03-05

    Dematin and protein 4.2 are peripheral membrane proteins associated with the cytoplasmic surface of the human erythrocyte plasma membrane. Isoforms of dematin and protein 4.2 exist in many nonerythroid cells. In solution, dematin is a trimeric protein containing two subunits of 48 kDa and one subunit of 52 kDa. Recent determination of the primary structure of the 52 kDa subunit of dematin showed that it contains an additional 22-amino acid sequence in the headpiece domain. An alignment of the 22-amino acid insertion sequence revealed that the 52 kDa subunit of dematin shares a novel 11-amino acid motif with protein 4.2. In this communication, we report that the conserved 11-amino acid motif in dematin52 and protein 4.2 contains a nucleotide binding P-loop. Direct binding of ATP is demonstrated to the glutathione S-transferase fusion proteins containing corresponding segments of dematin52 and protein 4.2 as well as to purified protein 4.2. The binding of ATP to the recombinant domains of dematin52 and protein 4.2 is specific, saturable, and of high affinity. The nucleotide specificity of the P-loop is restricted to ATP since no detectable binding was observed with GTP. These results show that the 11-amino acid motif provides an ATP binding site in dematin52 and protein 4.2. Although the functional significance of ATP binding is not yet clear, our findings open new perspectives for the function of dematin and protein 4.2 in vivo.

  14. Conformational change induced by ATP binding in the multidrug ATP-binding cassette transporter BmrA.

    PubMed

    Orelle, Cédric; Gubellini, Francesca; Durand, Anne; Marco, Sergio; Lévy, Daniel; Gros, Philippe; Di Pietro, Attilio; Jault, Jean-Michel

    2008-02-26

    ATP-binding cassette (ABC) transporters are involved in the transport of a wide variety of substrates, and ATP-driven dimerization of their nucleotide binding domains (NBDs) has been suggested to be one of the most energetic steps of their catalytic cycle. Taking advantage of the propensity of BmrA, a bacterial multidrug resistance ABC transporter, to form stable, highly ordered ring-shaped structures [Chami et al. (2002) J. Mol. Biol. 315, 1075-1085], we show here that addition of ATP in the presence of Mg2+ prevented ring formation or destroyed the previously formed rings. To pinpoint the catalytic step responsible for such an effect, two classes of hydrolysis-deficient mutants were further studied. In contrast to hydrolytically inactive glutamate mutants that behaved essentially as the wild-type, lysine Walker A mutants formed ring-shaped structures even in the presence of ATP-Mg. Although the latter mutants still bound ATP-Mg, and even slowly hydrolyzed it for the K380R mutant, they were most likely unable to undergo a proper NBD dimerization upon ATP-Mg addition. The ATP-driven dimerization step, which was still permitted in glutamate mutants and led to a stable conformation suitable to monitor the growth of 2D crystals, appeared therefore responsible for destabilization of the BmrA ring structures. Our results provide direct visual evidence that the ATP-induced NBD dimerization triggers a conformational change large enough in BmrA to destabilize the rings, which is consistent with the assumption that this step might constitute the "power stroke" for ABC transporters.

  15. ATP-binding motifs play key roles in Krp1p, kinesin-related protein 1, function for bi-polar growth control in fission yeast

    SciTech Connect

    Rhee, Dong Keun; Cho, Bon A; Kim, Hyong Bai . E-mail: hbkim5212@hotmail.com

    2005-06-03

    Kinesin is a microtubule-based motor protein with various functions related to the cell growth and division. It has been reported that Krp1p, kinesin-related protein 1, which belongs to the kinesin heavy chain superfamily, localizes on microtubules and may play an important role in cytokinesis. However, the function of Krp1p has not been fully elucidated. In this study, we overexpressed an intact form and three different mutant forms of Krp1p in fission yeast constructed by site-directed mutagenesis in two ATP-binding motifs or by truncation of the leucine zipper-like motif (LZiP). We observed hyper-extended microtubules and the aberrant nuclear shape in Krp1p-overexpressed fission yeast. As a functional consequence, a point mutation of ATP-binding domain 1 (G89E) in Krp1p reversed the effect of Krp1p overexpression in fission yeast, whereas the specific mutation in ATP-binding domain 2 (G238E) resulted in the altered cell polarity. Additionally, truncation of the leucine zipper-like domain (LZiP) at the C-terminal of Krp1p showed a normal nuclear division. Taken together, we suggest that krp1p is involved in regulation of cell-polarized growth through ATP-binding motifs in fission yeast.

  16. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  17. An open conformation of the Thermus thermophilus gyrase B ATP-binding domain.

    PubMed

    Lamour, Valérie; Hoermann, Laurence; Jeltsch, Jean-Marc; Oudet, Pierre; Moras, Dino

    2002-05-24

    DNA gyrase forms an A(2)B(2) tetramer involved in DNA replication, repair, recombination, and transcription in which the B subunit catalyzes ATP hydrolysis. The Thermus thermophilus and Escherichia coli gyrases are homologues and present the same catalytic activity. When compared with that of the E. coli 43K-5'-adenylyl-beta,gamma-imidodiphosphate complex, the crystal structure of Gyrase B 43K ATPase domain in complex with novobiocin, one of the most potent inhibitors of gyrase shows large conformational changes of the subdomains within the dimer. The stabilization of loop 98-118 closing the active site through dimeric contacts and interaction with domain 2 allows to observe novobiocin-protein interactions that could not be seen in the 24K-inhibitor complexes. Furthermore, this loop adopts a position which defines an "open" conformation of the active site in absence of ATP, in contrast with the "closed" conformation adopted upon ATP binding. All together, these results indicate how the subdomains may propagate conformational changes from the active site and provide crucial information for the design of more specific inhibitors.

  18. ATP binding/hydrolysis by and phosphorylation of peroxisomal ATP-binding cassette proteins PMP70 (ABCD3) and adrenoleukodystrophy protein (ABCD1).

    PubMed

    Tanaka, Arowu R; Tanabe, Kouichi; Morita, Masashi; Kurisu, Mikinori; Kasiwayama, Yoshinori; Matsuo, Michinori; Kioka, Noriyuki; Amachi, Teruo; Imanaka, Tsuneo; Ueda, Kazumitsu

    2002-10-18

    The 70-kDa peroxisomal membrane protein (PMP70) and adrenoleukodystrophy protein (ALDP), half-size ATP-binding cassette transporters, are involved in metabolic transport of long and very long chain fatty acids into peroxisomes. We examined the interaction of peroxisomal ATP-binding cassette transporters with ATP using rat liver peroxisomes. PMP70 was photoaffinity-labeled at similar efficiencies with 8-azido-[alpha-32P]ATP and 8-azido-[gamma-32P]ATP when peroxisomes were incubated with these nucleotides at 37 degrees C in the absence Mg2+ and exposed to UV light without removing unbound nucleotides. The photoaffinity-labeled PMP70 and ALDP were co-immunoprecipitated together with other peroxisomal proteins, which also showed tight ATP binding properties. Addition of Mg2+ reduced the photoaffinity labeling of PMP70 with 8-azido-[gamma-32P]ATP by 70%, whereas it reduced photoaffinity labeling with 8-azido-[alpha-32P]ATP by only 20%. However, two-thirds of nucleotide (probably ADP) was dissociated during removal of unbound nucleotides. These results suggest that ATP binds to PMP70 tightly in the absence of Mg2+, the bound ATP is hydrolyzed to ADP in the presence of Mg2+, and the produced ADP is dissociated from PMP70, which allows ATP hydrolysis turnover. Properties of photoaffinity labeling of ALDP were essentially similar to those of PMP70. Vanadate-induced nucleotide trapping in PMP70 and ALDP was not observed. PMP70 and ALDP were also phosphorylated at a tyrosine residue(s). ATP binding/hydrolysis by and phosphorylation of PMP70 and ALDP are involved in the regulation of fatty acid transport into peroxisomes.

  19. ATP Binding and Hydrolysis Properties of ABCB10 and Their Regulation by Glutathione

    PubMed Central

    Qiu, Wei; Liesa, Marc; Carpenter, Elizabeth P.; Shirihai, Orian S.

    2015-01-01

    ABCB10 (ATP binding cassette sub-family B10) is a mitochondrial inner-membrane ABC transporter. ABCB10 has been shown to protect the heart from the impact of ROS during ischemia-reperfusion and to allow for proper hemoglobin synthesis during erythroid development. ABC transporters are proteins that increase ATP binding and hydrolysis activity in the presence of the transported substrate. However, molecular entities transported by ABCB10 and its regulatory mechanisms are currently unknown. Here we characterized ATP binding and hydrolysis properties of ABCB10 by using the 8-azido-ATP photolabeling technique. This technique can identify potential ABCB10 regulators, transported substrates and amino-acidic residues required for ATP binding and hydrolysis. We confirmed that Gly497 and Lys498 in the Walker A motif, Glu624 in the Walker B motif and Gly602 in the C-Loop motif of ABCB10 are required for proper ATP binding and hydrolysis activity, as their mutation changed ABCB10 8-Azido-ATP photo-labeling. In addition, we show that the potential ABCB10 transported entity and heme precursor delta-aminolevulinic acid (dALA) does not alter 8-azido-ATP photo-labeling. In contrast, oxidized glutathione (GSSG) stimulates ATP hydrolysis without affecting ATP binding, whereas reduced glutathione (GSH) inhibits ATP binding and hydrolysis. Indeed, we detectABCB10 glutathionylation in Cys547 and show that it is one of the exposed cysteine residues within ABCB10 structure. In all, we characterize essential residues for ABCB10 ATPase activity and we provide evidence that supports the exclusion of dALA as a potential substrate directly transported by ABCB10. Last, we show the first molecular mechanism by which mitochondrial oxidative status, through GSH/GSSG, can regulate ABCB10. PMID:26053025

  20. Biophysical Approaches Facilitate Computational Drug Discovery for ATP-Binding Cassette Proteins

    PubMed Central

    Molinski, Steven V.; Bozóky, Zoltán; Iram, Surtaj H.

    2017-01-01

    Although membrane proteins represent most therapeutically relevant drug targets, the availability of atomic resolution structures for this class of proteins has been limited. Structural characterization has been hampered by the biophysical nature of these polytopic transporters, receptors, and channels, and recent innovations to in vitro techniques aim to mitigate these challenges. One such class of membrane proteins, the ATP-binding cassette (ABC) superfamily, are broadly expressed throughout the human body, required for normal physiology and disease-causing when mutated, yet lacks sufficient structural representation in the Protein Data Bank. However, recent improvements to biophysical techniques (e.g., cryo-electron microscopy) have allowed for previously “hard-to-study” ABC proteins to be characterized at high resolution, providing insight into molecular mechanisms-of-action as well as revealing novel druggable sites for therapy design. These new advances provide ample opportunity for computational methods (e.g., virtual screening, molecular dynamics simulations, and structure-based drug design) to catalyze the discovery of novel small molecule therapeutics that can be easily translated from computer to bench and subsequently to the patient's bedside. In this review, we explore the utility of recent advances in biophysical methods coupled with well-established in silico techniques towards drug development for diseases caused by dysfunctional ABC proteins. PMID:28409029

  1. The Role of ATP-Binding Cassette Transporters in Neuro-Inflammation: Relevance for Bioactive Lipids.

    PubMed

    Kooij, Gijs; van Horssen, Jack; Bandaru, Veera Venkata Ratnam; Haughey, Norman J; de Vries, Helga E

    2012-01-01

    ATP-binding cassette (ABC) transporters are highly expressed by brain endothelial cells that form the blood-brain barrier (BBB). These efflux pumps play an important role in maintaining brain homeostasis as they actively hinder the entry of unwanted blood-derived compounds into the central nervous system (CNS). Consequently, their high activity at the BBB has been a major hurdle for the treatment of several brain diseases, as they prevent numerous drugs to reach their site of action within the brain. Importantly, recent data indicate that endogenous substrates for ABC transporters may include inflammatory mediators, such as prostaglandins, leukotrienes, cytokines, chemokines, and bioactive lipids, suggesting a potential role for ABC transporters in immunological responses, and more specifically in inflammatory brain disorders, such as multiple sclerosis (MS). In this review, we will give a comprehensive overview of recent findings that illustrate this novel role for ABC transporters in neuro-inflammatory processes. Moreover, we will provide first insights into underlying mechanisms and focus on the importance for bioactive lipids, in particular platelet-activating factor, herein. A thorough understanding of these events may form the basis for the development for selective treatment modalities to dampen the neuro-inflammatory attack in MS and thereby reducing tissue damage.

  2. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum.

    PubMed

    Broehan, Gunnar; Kroeger, Tobias; Lorenzen, Marcé; Merzendorfer, Hans

    2013-01-16

    The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control.

  3. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum

    PubMed Central

    2013-01-01

    Background The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control. PMID:23324493

  4. An ATP-binding cassette transporter is a major glycoprotein of sea urchin sperm membranes.

    PubMed

    Mengerink, Kathryn J; Vacquier, Victor D

    2002-10-25

    Sperm are terminally differentiated cells that undergo several membrane-altering events before fusion with eggs. One event, the sea urchin sperm acrosome reaction (AR), is blocked by the lectin wheat germ agglutinin (WGA). In an effort to identify proteins involved in the AR induction, the peptide sequence was obtained from a 220-kDa WGA-binding protein. Degenerate PCR and library screening resulted in the full-length deduced amino acid sequence of an ATP-binding cassette transporter, suABCA. The protein of 1,764 residues has two transmembrane regions, two nucleotide-binding domains, and is most closely related to the human ABC subfamily A member 3 transporter (ABCA3). Sequence analysis suggests a large extracellular loop between transmembrane spanning segments 7 and 8, with five N-linked glycosylation sites. An antibody made to the loop region binds to non-permeabilized cells, supporting that this region is extracellular. suABCA is found in sperm membrane vesicles, it can be solubilized with nonionic detergents, and it shifts from 220 to 200 kDa upon protein:N-glycanase F digestion. suABCA localizes to the entire surface of sperm in a punctate pattern, but is not detected in lipid rafts. Based on its relationship to subfamily A, suABCA is most likely involved in phospholipid or cholesterol transport. This is the first investigation of an ABC transporter in animal sperm.

  5. The allosteric regulatory mechanism of the Escherichia coli MetNI methionine ATP binding cassette (ABC) transporter.

    PubMed

    Yang, Janet G; Rees, Douglas C

    2015-04-03

    The MetNI methionine importer of Escherichia coli, an ATP binding cassette (ABC) transporter, uses the energy of ATP binding and hydrolysis to catalyze the high affinity uptake of D- and L-methionine. Early in vivo studies showed that the uptake of external methionine is repressed by the level of the internal methionine pool, a phenomenon termed transinhibition. Our understanding of the MetNI mechanism has thus far been limited to a series of crystal structures in an inward-facing conformation. To understand the molecular mechanism of transinhibition, we studied the kinetics of ATP hydrolysis using detergent-solubilized MetNI. We find that transinhibition is due to noncompetitive inhibition by L-methionine, much like a negative feedback loop. Thermodynamic analyses revealed two allosteric methionine binding sites per transporter. This quantitative analysis of transinhibition, the first to our knowledge for a structurally defined transporter, builds upon the previously proposed structurally based model for regulation. This mechanism of regulation at the transporter activity level could be applicable to not only ABC transporters but other types of membrane transporters as well. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes.

    PubMed

    Miao, Yu-Chen; Liu, Chang-Jun

    2010-12-28

    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  7. The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity

    PubMed Central

    Tameling, Wladimir I. L.; Elzinga, Sandra D. J.; Darmin, Patricia S.; Vossen, Jack H.; Takken, Frank L. W.; Haring, Michel A.; Cornelissen, Ben J. C.

    2002-01-01

    Most plant disease resistance (R) genes known today encode proteins with a central nucleotide binding site (NBS) and a C-terminal Leu-rich repeat (LRR) domain. The NBS contains three ATP/GTP binding motifs known as the kinase-1a or P-loop, kinase-2, and kinase-3a motifs. In this article, we show that the NBS of R proteins forms a functional nucleotide binding pocket. The N-terminal halves of two tomato R proteins, I-2 conferring resistance to Fusarium oxysporum and Mi-1 conferring resistance to root-knot nematodes and potato aphids, were produced as glutathione S-transferase fusions in Escherichia coli. In a filter binding assay, purified I-2 was found to bind ATP rather than other nucleoside triphosphates. ATP binding appeared to be fully dependent on the presence of a divalent cation. A mutant I-2 protein containing a mutation in the P-loop showed a strongly reduced ATP binding capacity. Thin layer chromatography revealed that both I-2 and Mi-1 exerted ATPase activity. Based on the strong conservation of NBS domains in R proteins of the NBS-LRR class, we propose that they all are capable of binding and hydrolyzing ATP. PMID:12417711

  8. ATP-Binding Pocket-Targeted Suppression of Src and Syk by Luteolin Contributes to Its Anti-Inflammatory Action

    PubMed Central

    Lee, Jeong-Oog; Jeong, Deok; Kim, Mi-Yeon; Cho, Jae Youl

    2015-01-01

    Luteolin is a flavonoid identified as a major anti-inflammatory component of Artemisia asiatica. Numerous reports have demonstrated the ability of luteolin to suppress inflammation in a variety of inflammatory conditions. However, its exact anti-inflammatory mechanism has not been fully elucidated. In the present study, the anti-inflammatory mode of action in activated macrophages of luteolin from Artemisia asiatica was examined by employing immunoblotting analysis, a luciferase reporter gene assay, enzyme assays, and an overexpression strategy. Luteolin dose-dependently inhibited the secretion of nitric oxide (NO) and prostaglandin E2 (PGE2) and diminished the levels of mRNA transcripts of inducible NO synthase (iNOS), tumor necrosis factor- (TNF-) α, and cyclooxygenase-2 (COX-2) in lipopolysaccharide- (LPS-) and pam3CSK-treated macrophage-like RAW264.7 cells without displaying cytotoxicity. Luteolin displayed potent NO-inhibitory activity and also suppressed the nuclear translocation of NF-κB (p65 and p50) via blockade of Src and Syk, but not other mitogen-activated kinases. Overexpression of wild type Src and point mutants thereof, and molecular modelling studies, suggest that the ATP-binding pocket may be the luteolin-binding site in Src. These results strongly suggest that luteolin may exert its anti-inflammatory action by suppressing the NF-κB signaling cascade via blockade of ATP binding in Src and Syk. PMID:26236111

  9. Exploiting the Unique ATP-Binding Pocket of Toxoplasma Calcium-Dependent Protein Kinase 1 To Identify Its Substrates

    PubMed Central

    2013-01-01

    Apicomplexan parasites rely on calcium as a second messenger to regulate a variety of essential cellular processes. Calcium-dependent protein kinases (CDPK), which transduce these signals, are conserved among apicomplexans but absent from mammalian hosts, making them attractive targets for therapeutic intervention. Despite their importance, the signaling pathways CDPK regulate remain poorly characterized, and their protein substrates are completely unknown. In Toxoplasma gondii, CDPK1 is required for calcium-regulated secretion from micronemes, thereby controlling motility, invasion, and egress from host cells. CDPK1 is unique among parasite and mammalian kinases in containing glycine at the key “gatekeeper” residue, which results in an expanded ATP-binding pocket. In the present study, we use a synthetic ATPγS analogue that displays steric complementarity to the ATP-binding pocket and hence allows identification of protein substrates based on selective thiophosphorylation. The specificity of this approach was validated by the concordance between the identified phosphorylation sites and the in vitro substrate preference of CDPK1. We further demonstrate that the phosphorylation of predicted substrates is dependent on CDPK1 both in vivo and in vitro. This combined strategy for identifying the targets of specific protein kinases provides a platform for defining the roles of CDPKs in apicomplexans. PMID:23530747

  10. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes

    SciTech Connect

    Miao, Y.C.; Liu, C.

    2010-12-28

    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  11. Evidence for a Molecular Diode-based Mechanism in a Multispecific ATP-binding cassette (ABC) Exporter

    PubMed Central

    Mehla, Jitender; Ernst, Robert; Moore, Rachel; Wakschlag, Adina; Marquis, Mary Kate; Ambudkar, Suresh V.; Golin, John

    2014-01-01

    ATP-binding cassette multidrug efflux pumps transport a wide range of substrates. Current models suggest that a drug binds relatively tightly to a transport site in the transmembrane domains when the protein is in the closed inward facing conformation. Upon binding of ATP, the transporter can switch to an outward facing (drug off or drug releasing) structure of lower affinity. ATP hydrolysis is critically important for remodeling the drug-binding site to facilitate drug release and to reset the transporter for a new transport cycle. We characterized the novel phenotype of an S1368A mutant that lies in the putative drug-binding pocket of the yeast multidrug transporter Pdr5. This substitution created broad, severe drug hypersensitivity, although drug binding, ATP hydrolysis, and intradomain signaling were indistinguishable from the wild-type control. Several different rhodamine 6G efflux and accumulation assays yielded evidence consistent with the possibility that Ser-1368 prevents reentry of the excluded drug. PMID:25112867

  12. Influence of ATP-binding cassette transporters in root exudation of phytoalexins, signals, and disease resistance

    USDA-ARS?s Scientific Manuscript database

    The roots of plants secrete compounds as a way to exchange information with organ-isms living in the soil. Here, we report the involvement of seven root-expressed ATP-binding cassette (ABC) transporters corresponding to both full and half-size molecules (Atabcg36, Atabcg37, Atabcc5, Atabcf1, Atabcf3...

  13. Endothelial ATP-binding cassette G1 in mouse endothelium protects against hemodynamic-induced atherosclerosis

    SciTech Connect

    Xue, Shanshan; Wang, Jiaxing; Zhang, Xu; Shi, Ying; Li, Bochuan; Bao, Qiankun; Pang, Wei; Ai, Ding; Zhu, Yi; He, Jinlong

    2016-08-19

    Activated vascular endothelium inflammation under persistent hyperlipidemia is the initial step of atherogenesis. ATP-binding cassette G1 (ABCG1) is a crucial factor maintaining sterol and lipid homeostasis by transporting cholesterol efflux to high-density lipoprotein. In this study, we investigated the protective effects of ABCG1 in endothelial inflammation activation during early-stage atherogenesis in mice and the underlying mechanisms. Endothelial cell (EC)-specific ABCG1 transgenic (EC-ABCG1-Tg) mice were generated and cross-bred with low-density lipoprotein receptor–deficient (Ldlr{sup −/−}) mice. After a 4-week Western-type diet, the mice were sacrificed for assessing atherosclerosis. Human umbilical vein ECs were treated with different flows, and ABCG1 was adenovirally overexpressed to investigate the mechanism in vitro. Compared with Ldlr{sup −/−} mouse aortas, EC-ABCG1-Tg/Ldlr{sup −/−} aortas showed decreased early-stage lesions. Furthermore, the lesion area in the EC-ABCG1-Tg/Ldlr{sup −/−} mouse aortic arch but not thoracic aorta was significantly reduced, which suggests a protective role of ABCG1 under atheroprone flow. In vitro, overexpression of ABCG1 attenuated EC activation caused by oscillatory shear stress. Overexpression of ABCG1 blunted cholesterol-activated ECs in vitro. In exploring the mechanisms of ABCG1 attenuating endothelial inflammation, we found that ABCG1 inhibited oscillatory flow-activated nuclear factor kappa B and NLRP3 inflammasome in ECs. ABCG1 may play a protective role in early-stage atherosclerosis by reducing endothelial activation induced by oscillatory shear stress via suppressing the inflammatory response. - Highlights: • EC-ABCG1-Tg mice in a Ldlr{sup −/−} background showed decreased atherosclerosis. • Overexpression of ABCG1 in ECs decreased OSS-induced EC activation. • NLRP3 and NF-κB might be an underlying mechanism of ABCG1 protective role.

  14. Transcriptional Regulation of ATP-binding Cassette Transporter A1 Expression by a Novel Signaling Pathway*

    PubMed Central

    Chen, Xinping; Zhao, Yanfeng; Guo, Zhongmao; Zhou, Lichun; Okoro, Emmanuel U.; Yang, Hong

    2011-01-01

    ATP-binding cassette transporter A1 (ABCA1) is a membrane-bound protein that regulates the efflux of cholesterol derived from internalized lipoproteins. Using a mouse macrophage cell line, this report studied the impact of low-density lipoproteins (LDL) on ABCA1 expression and the signaling pathway responsible for lipoprotein-induced ABCA1 expression. Our data demonstrated that treatment of macrophages with LDL increased ABCA1 mRNA and protein levels 4.3- and 3.5-fold, respectively. LDL also induced an ∼2-fold increase in macrophage surface expression of ABCA1 and a 14-fold-increase in apolipoprotein AI-mediated cholesterol efflux. In addition, LDL significantly increased the level of phosphorylated specificity protein 1 (Sp1) and the amount of Sp1 bound to the ABCA1 promoter without alteration in total Sp1 protein level. Mutation of the Sp1 binding site in the ABCA1 promoter and inhibition of Sp1 DNA binding with mithramycin A suppressed the ABCA1 promoter activity and reduced the ABCA1 expression level induced by LDL. LDL treatment also elevated protein kinase C-ζ (PKC-ζ) phosphorylation and induced PKC-ζ binding with Sp1. Inhibition of PKC-ζ with kinase inhibitors or overexpression of kinase-dead PKC-ζ attenuated Sp1 phosphorylation and ABCA1 expression induced by LDL. These results demonstrate for the first time that activation of the PKCζ-Sp1 signaling cascade is a mechanism for regulation of LDL-induced ABCA1 expression. PMID:21257755

  15. CpABC, a Cryptosporidium parvum ATP-binding cassette protein at the host–parasite boundary in intracellular stages

    PubMed Central

    Perkins, Margaret E.; Riojas, Ynolde A.; Wu, Teresa W.; Le Blancq, Sylvie M.

    1999-01-01

    The intracellular parasite Cryptosporidium parvum develops inside a vacuole at the apex of its epithelial host cell. The developing parasite is separated from the host cell cytoplasm by a zone of attachment that consists of an extensively folded membranous structure known as the feeder organelle. It has been proposed that the feeder organelle is the site of regulation of transport of nutrients and drugs into the parasite. In this report, we localize an ≈200-kDa integral membrane protein, CpABC, from Cryptosporidium parvum to the host–parasite boundary, possibly the feeder organelle. The predicted amino acid sequence of CpABC has significant structural similarity with the cystic fibrosis conductance regulator and the multidrug resistance protein subfamily of ATP-binding cassette proteins. This is an example of a parasite-encoded transport protein localized at the parasite–host interface of an intracellular protozoan. PMID:10318953

  16. The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase

    PubMed Central

    Ding, Hao; Guo, Manhong; Vidhyasagar, Venkatasubramanian; Talwar, Tanu; Wu, Yuliang

    2015-01-01

    Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI). The Q motif, consisting of nine amino acids (GFXXPXPIQ) with an invariant glutamine (Q) residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11) gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase. PMID:26474416

  17. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification

    PubMed Central

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.

    2015-01-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175

  18. An ATP-binding cassette transporter-like complex governs cell-wall hydrolysis at the bacterial cytokinetic ring.

    PubMed

    Yang, Desirée C; Peters, Nick T; Parzych, Katherine R; Uehara, Tsuyoshi; Markovski, Monica; Bernhardt, Thomas G

    2011-11-08

    ATP-binding cassette transporters are ubiquitous membrane protein complexes that move substrates across membranes. They do so using ATP-induced conformational changes in their nucleotide-binding domains to alter the conformation of the transport cavity formed by their transmembrane domains. In Escherichia coli, an ATP-binding cassette transporter-like complex composed of FtsE (nucleotide-binding domain) and FtsX (transmembrane domain) has long been known to be important for cytokinesis, but its role in the process has remained mysterious. Here we identify FtsEX as a regulator of cell-wall hydrolysis at the division site. Cell-wall material synthesized by the division machinery is shared initially by daughter cells and must be split by hydrolytic enzymes called "amidases" to drive daughter-cell separation. We recently showed that the amidases require activation at the cytokinetic ring by proteins with LytM domains, of which EnvC is the most critical. In this report, we demonstrate that FtsEX directly recruits EnvC to the septum via an interaction between EnvC and a periplasmic loop of FtsX. Importantly, we also show that FtsEX variants predicted to be ATPase defective still recruit EnvC to the septum but fail to promote cell separation. Our results thus suggest that amidase activation via EnvC in the periplasm is regulated by conformational changes in the FtsEX complex mediated by ATP hydrolysis in the cytoplasm. Since FtsE has been reported to interact with the tubulin-like FtsZ protein, our model provides a potential mechanism for coupling amidase activity with the contraction of the FtsZ cytoskeletal ring.

  19. Characterization and functional analysis of the nucleotide binding fold in human peroxisomal ATP binding cassette transporters.

    PubMed

    Roerig, P; Mayerhofer, P; Holzinger, A; Gärtner, J

    2001-03-09

    The 70-kDa peroxisomal membrane protein (PMP70) and the adrenoleukodystrophy protein (ALDP) are half ATP binding cassette (ABC) transporters in the peroxisome membrane. Mutations in the ALD gene encoding ALDP result in the X-linked neurodegenerative disorder adrenoleukodystrophy. Plausible models exist to show a role for ATP hydrolysis in peroxisomal ABC transporter functions. Here, we describe the first measurements of the rate of ATP binding and hydrolysis by purified nucleotide binding fold (NBF) fusion proteins of PMP70 and ALDP. Both proteins act as an ATP specific binding subunit releasing ADP after ATP hydrolysis; they did not exhibit GTPase activity. Mutations in conserved residues of the nucleotidases (PMP70: G478R, S572I; ALDP: G512S, S606L) altered ATPase activity. Furthermore, our results indicate that these mutations do not influence homodimerization or heterodimerization of ALDP or PMP70. The study provides evidence that peroxisomal ABC transporters utilize ATP to become a functional transporter.

  20. Distinct roles for ATP binding and hydrolysis at individual subunits of an archaeal clamp loader

    PubMed Central

    Seybert, Anja; Wigley, Dale B

    2004-01-01

    Circular clamps are utilised by replicative polymerases to enhance processivity. The topological problem of loading a toroidal clamp onto DNA is overcome by ATP-dependent clamp loader complexes. Different organisms use related protein machines to load clamps, but the mechanisms by which they utilise ATP are surprisingly different. Using mutant clamp loaders that are deficient in either ATP binding or hydrolysis in different subunits, we show how the different subunits of an archaeal clamp loader use ATP binding and hydrolysis in distinct ways at different steps in the loading process. Binding of nucleotide by the large subunit and three of the four small subunits is sufficient for clamp loading. However, ATP hydrolysis by the small subunits is required for release of PCNA to allow formation of the complex between PCNA and the polymerase, while hydrolysis by the large subunit is required for catalytic clamp loading. PMID:15014449

  1. ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Jielou

    2004-03-01

    Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.

  2. Structure, Function, and Evolution of Bacterial ATP-Binding Cassette Systems

    PubMed Central

    Davidson, Amy L.; Dassa, Elie; Orelle, Cedric; Chen, Jue

    2008-01-01

    Summary: ATP-binding cassette (ABC) systems are universally distributed among living organisms and function in many different aspects of bacterial physiology. ABC transporters are best known for their role in the import of essential nutrients and the export of toxic molecules, but they can also mediate the transport of many other physiological substrates. In a classical transport reaction, two highly conserved ATP-binding domains or subunits couple the binding/hydrolysis of ATP to the translocation of particular substrates across the membrane, through interactions with membrane-spanning domains of the transporter. Variations on this basic theme involve soluble ABC ATP-binding proteins that couple ATP hydrolysis to nontransport processes, such as DNA repair and gene expression regulation. Insights into the structure, function, and mechanism of action of bacterial ABC proteins are reported, based on phylogenetic comparisons as well as classic biochemical and genetic approaches. The availability of an increasing number of high-resolution structures has provided a valuable framework for interpretation of recent studies, and realistic models have been proposed to explain how these fascinating molecular machines use complex dynamic processes to fulfill their numerous biological functions. These advances are also important for elucidating the mechanism of action of eukaryotic ABC proteins, because functional defects in many of them are responsible for severe human inherited diseases. PMID:18535149

  3. The power stroke driven by ATP binding in CFTR as studied by molecular dynamics simulations.

    PubMed

    Furukawa-Hagiya, Tomoka; Furuta, Tadaomi; Chiba, Shuntaro; Sohma, Yoshiro; Sakurai, Minoru

    2013-01-10

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the ATP binding cassette (ABC) protein superfamily. Currently, it remains unclear how ATP binding causes the opening of the channel gate at the molecular level. To clarify this mechanism, we first constructed an atomic model of the inward-facing CFTR using the X-ray structures of other ABC proteins. Molecular dynamics (MD) simulations were then performed to explore the structure and dynamics of the inward-facing CFTR in a membrane environment. In the MgATP-bound state, two nucleotide-binding domains (NBDs) formed a head-to-tail type of dimer, in which the ATP molecules were sandwiched between the Walker A and signature motifs. Alternatively, one of the final MD structures in the apo state was similar to that of a "closed-apo" conformation found in the X-ray analysis of ATP-free MsbA. Principal component analysis for the MD trajectory indicated that NBD dimerization causes significant structural and dynamical changes in the transmembrane domains (TMDs), which is likely indicative of the formation of a chloride ion access path. This study suggests that the free energy gain from ATP binding acts as a driving force not only for NBD dimerization but also for NBD-TMD concerted motions.

  4. Molecular determinants for ATP-binding in proteins: a data mining and quantum chemical analysis.

    PubMed

    Mao, Lisong; Wang, Yanli; Liu, Yuemin; Hu, Xiche

    2004-02-20

    intermolecular interactions of large biomolecular systems becomes computationally feasible. The establishment of the molecular basis for recognition of the adenine moiety of ATP in proteins will directly impact molecular design of ATP-binding site targeted enzyme inhibitors such as kinase inhibitors.

  5. Structural and Enzymatic Insights into the ATP Binding and Autophosphorylation Mechanism of a Sensor Histidine Kinase*

    PubMed Central

    Trajtenberg, Felipe; Graña, Martin; Ruétalo, Natalia; Botti, Horacio; Buschiazzo, Alejandro

    2010-01-01

    DesK is a sensor histidine kinase (HK) that allows Bacillus subtilis to respond to cold shock, triggering the adaptation of membrane fluidity via transcriptional control of a fatty acid desaturase. It belongs to the HK family HPK7, which includes the nitrogen metabolism regulators NarX/Q and the antibiotic sensor LiaS among other important sensor kinases. Structural information on different HK families is still scarce and several questions remain, particularly concerning the molecular features that determine HK specificity during its catalytic autophosphorylation and subsequent response-regulator phosphotransfer reactions. To analyze the ATP-binding features of HPK7 HKs and dissect their mechanism of autophosphorylation at the molecular level, we have studied DesK in complex with ATP using high resolution structural approaches in combination with biochemical studies. We report the first crystal structure of an HK in complex with its natural nucleotidic substrate. The general fold of the ATP-binding domain of DesK is conserved, compared with well studied members of other families. Yet, DesK displays a far more compact structure at the ATP-binding pocket: the ATP lid loop is much shorter with no secondary structural organization and becomes ordered upon ATP loading. Sequence conservation mapping onto the molecular surface, semi-flexible protein-protein docking simulations, and structure-based point mutagenesis allow us to propose a specific domain-domain geometry during autophosphorylation catalysis. Supporting our hypotheses, we have been able to trap an autophosphorylating intermediate state, by protein engineering at the predicted domain-domain interaction surface. PMID:20507988

  6. Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.

    PubMed

    Bompadre, Silvia G; Hwang, Tzyh-Chang

    2007-08-25

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

  7. The rem Mutations in the ATP-Binding Groove of the Rad3/XPD Helicase Lead to Xeroderma pigmentosum-Cockayne Syndrome-Like Phenotypes

    PubMed Central

    Montelone, Beth A.; Aguilera, Andrés

    2014-01-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease. PMID:25500814

  8. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.

    PubMed

    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés

    2014-12-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  9. Structural characterization of an MJ1267 ATP-binding cassette crystal with a complex pattern of twinning caused by promiscuous fiber packing.

    PubMed

    Yuan, Yu-Ren; Martsinkevich, Oskana; Hunt, John F

    2003-02-01

    ATP-binding cassettes represent the motor domains in ABC transporters, a superfamily of integral membrane-protein pumps that couple the hydrolysis of ATP to transmembrane solute translocation. A crystal of a Mg-ADP complex of the MJ1267 ATP-binding cassette was obtained that produced a diffraction pattern characterized by pathological streaking of the spots in the a* x b* plane. While the Laue symmetry of the diffraction pattern was P3;1m, the crystal was determined to be twinned based on intensity statistics, molecular-replacement analysis and difference Fourier analysis of an engineered single-site methylmercury derivative. The unit cell contains three similar 3(1) fibers, with two of them related by primarily translational non-crystallographic symmetry (NCS) and the third related to the first two by approximate twofold screw operations whose rotational components are very similar to the twinning operator. The promiscuous packing of these 3(1) fibers, which make both parallel and antiparallel interactions in the primary crystal lattice, can explain the twinning tendency based on the ability of the twin-related lattices to interact with one another while making only one slightly sub-optimal intermolecular contact per unit cell in the boundary region. The promiscuous fiber packing can also explain the streaking in the diffraction pattern based on the ability to form a variety of different lattices with similar inter-fiber packing interactions. The crystal structure was refined as a twin in space group P3(1) using the program CNS, yielding a free R factor of 28.9% at 2.6 A and a refined twin fraction of 0.50. The structure shows a rigid-body rotation of the ABC-transporter-specific alpha-helical subdomain (ABCalpha subdomain) in MJ1267 compared with the conformation observed for the same protein in a C2 crystal lattice; this observation suggests that the ABCalpha subdomain is flexibly attached to the F1-type ATP-binding core of the ATP-binding cassette when Mg

  10. New ATP-binding cassette A3 mutation causing surfactant metabolism dysfunction pulmonary type 3.

    PubMed

    Piersigilli, Fiammetta; Peca, Donatella; Campi, Francesca; Corsello, Mirta; Landolfo, Francesca; Boldrini, Renata; Danhaive, Olivier; Dotta, Andrea

    2015-10-01

    Respiratory distress syndrome (RDS) may occur in term and near-term infants because of mutations in surfactant-related genes. ATP-binding cassette A3 (ABCA3), a phospholipid carrier specifically expressed in the alveolar epithelium, is the most frequently involved protein. We report the case of a couple of late-preterm fraternal twin infants of opposite sex carrying the same compound heterozygous ABCA3 mutations, one of which has never been previously reported, with different disease severity, suggesting variable penetrance or sex-related differences. ABCA3 deficiency should be considered in term or near-term babies who develop unexplained RDS. © 2015 Japan Pediatric Society.

  11. Role of ATP binding and hydrolysis in assembly of MacAB-TolC macrolide transporter

    PubMed Central

    Lu, Shuo; Zgurskaya, Helen I.

    2012-01-01

    Summary MacB is a founding member of the Macrolide Exporter family of transporters belonging to the ATP-Binding Cassette superfamily. These proteins are broadly represented in genomes of both gram-positive and gram-negative bacteria and are implicated in virulence and protection against antibiotics and peptide toxins. MacB transporter functions together with MacA, a periplasmic membrane fusion protein, which stimulates MacB ATPase. In gram-negative bacteria, MacA is believed to couple ATP hydrolysis to transport of substrates across the outer membrane through a TolC-like channel. In this study, we report a real-time analysis of concurrent ATP hydrolysis and assembly of MacAB-TolC complex. MacB binds nucleotides with a low millimolar affinity and fast on- and off-rates. In contrast, MacA-MacB complex is formed with a nanomolar affinity, which further increases in the presence of ATP. Our results strongly suggest that association between MacA and MacB is stimulated by ATP binding to MacB but remains unchanged during ATP hydrolysis cycle. We also found that the large periplasmic loop of MacB plays the major role in coupling reactions separated in two different membranes. This loop is required for MacA-dependent stimulation of MacB ATPase and at the same time, contributes to recruitment of TolC into a trans-envelope complex. PMID:23057817

  12. Solution structure of an ATP-binding RNA aptamer reveals a novel fold.

    PubMed Central

    Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J

    1996-01-01

    In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406

  13. Role of ATP binding and hydrolysis in assembly of MacAB-TolC macrolide transporter.

    PubMed

    Lu, Shuo; Zgurskaya, Helen I

    2012-12-01

    MacB is a founding member of the Macrolide Exporter family of transporters belonging to the ATP-Binding Cassette superfamily. These proteins are broadly represented in genomes of both Gram-positive and Gram-negative bacteria and are implicated in virulence and protection against antibiotics and peptide toxins. MacB transporter functions together with MacA, a periplasmic membrane fusion protein, which stimulates MacB ATPase. In Gram-negative bacteria, MacA is believed to couple ATP hydrolysis to transport of substrates across the outer membrane through a TolC-like channel. In this study, we report a real-time analysis of concurrent ATP hydrolysis and assembly of MacAB-TolC complex. MacB binds nucleotides with a low millimolar affinity and fast on- and off-rates. In contrast, MacA-MacB complex is formed with a nanomolar affinity, which further increases in the presence of ATP. Our results strongly suggest that association between MacA and MacB is stimulated by ATP binding to MacB but remains unchanged during ATP hydrolysis cycle. We also found that the large periplasmic loop of MacB plays the major role in coupling reactions separated in two different membranes. This loop is required for MacA-dependent stimulation of MacB ATPase and at the same time, contributes to recruitment of TolC into a trans-envelope complex. © 2012 Blackwell Publishing Ltd.

  14. Origin licensing requires ATP binding and hydrolysis by the MCM replicative helicase.

    PubMed

    Coster, Gideon; Frigola, Jordi; Beuron, Fabienne; Morris, Edward P; Diffley, John F X

    2014-09-04

    Loading of the six related Minichromosome Maintenance (MCM) proteins as head-to-head double hexamers during DNA replication origin licensing is crucial for ensuring once-per-cell-cycle DNA replication in eukaryotic cells. Assembly of these prereplicative complexes (pre-RCs) requires the Origin Recognition Complex (ORC), Cdc6, and Cdt1. ORC, Cdc6, and MCM are members of the AAA+ family of ATPases, and pre-RC assembly requires ATP hydrolysis. Here we show that ORC and Cdc6 mutants defective in ATP hydrolysis are competent for origin licensing. However, ATP hydrolysis by Cdc6 is required to release nonproductive licensing intermediates. We show that ATP binding stabilizes the wild-type MCM hexamer. Moreover, by analyzing MCM containing mutant subunits, we show that ATP binding and hydrolysis by MCM are required for Cdt1 release and double hexamer formation. This work alters our view of how ATP is used by licensing factors to assemble pre-RCs. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Formation of a Chloride-conducting State in the Maltose ATP-binding Cassette (ABC) Transporter.

    PubMed

    Carlson, Michael L; Bao, Huan; Duong, Franck

    2016-06-03

    ATP-binding cassette transporters use an alternating access mechanism to move substrates across cellular membranes. This mode of transport ensures the selective passage of molecules while preserving membrane impermeability. The crystal structures of MalFGK2, inward- and outward-facing, show that the transporter is sealed against ions and small molecules. It has yet to be determined whether membrane impermeability is maintained when MalFGK2 cycles between these two conformations. Through the use of a mutant that resides in intermediate conformations close to the transition state, we demonstrate that not only is chloride conductance occurring, but also to a degree large enough to compromise cell viability. Introduction of mutations in the periplasmic gate lead to the formation of a channel that is quasi-permanently open. MalFGK2 must therefore stay away from these ion-conducting conformations to preserve the membrane barrier; otherwise, a few mutations that increase access to the ion-conducting states are enough to convert an ATP-binding cassette transporter into a channel.

  16. The Lipid Bilayer Modulates the Structure and Function of an ATP-binding Cassette Exporter.

    PubMed

    Zoghbi, Maria E; Cooper, Rebecca S; Altenberg, Guillermo A

    2016-02-26

    ATP-binding cassette exporters use the energy of ATP hydrolysis to transport substrates across membranes by switching between inward- and outward-facing conformations. Essentially all structural studies of these proteins have been performed with the proteins in detergent micelles, locked in specific conformations and/or at low temperature. Here, we used luminescence resonance energy transfer spectroscopy to study the prototypical ATP-binding cassette exporter MsbA reconstituted in nanodiscs at 37 °C while it performs ATP hydrolysis. We found major differences when comparing MsbA in these native-like conditions with double electron-electron resonance data and the crystal structure of MsbA in the open inward-facing conformation. The most striking differences include a significantly smaller separation between the nucleotide-binding domains and a larger fraction of molecules with associated nucleotide-binding domains in the nucleotide-free apo state. These studies stress the importance of studying membrane proteins in an environment that approaches physiological conditions.

  17. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification.

    PubMed

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L

    2015-11-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.

  18. ATP Binding to Hemoglobin Response Gene 1 Protein Is Necessary for Regulation of the Mating Type Locus in Candida albicans*

    PubMed Central

    Peterson, Alexander W.; Pendrak, Michael L.; Roberts, David D.

    2011-01-01

    HBR1 (hemoglobin response gene 1) is an essential gene in Candida albicans that positively regulates mating type locus MTLα gene expression and thereby regulates cell type-specific developmental genes. Hbr1p contains a phosphate-binding loop (P-loop), a highly conserved motif characteristic of ATP- and GTP-binding proteins. Recombinant Hbr1p was isolated in an oligomeric state that specifically bound ATP with Kd ∼2 μm. ATP but not ADP, AMP, GTP, or dATP specifically protected Hbr1p from proteolysis by trypsin. Site-directed mutagenesis of the highly conserved P-loop lysine (K22Q) and the less conserved glycine (G19S) decreased the binding affinity for soluble ATP and ATP immobilized through its γ-phosphate. ATP bound somewhat more avidly than ATPγS to wild type and mutant Hbr1p. Although Hbr1p exhibits sequence motifs characteristic of adenylate kinases, and adenylate kinase and ATPase activities have been reported for the apparent human ortholog of Hbr1p, assays for adenylate kinase activity, autophosphorylation, and ATPase activity proved negative. Overexpression of wild type but not the mutant forms of Hbr1p restored MTlα2 expression in an HBR1/hbr1 mutant, indicating that ATP binding to the P-loop is necessary for this function of Hbr1p. PMID:21372131

  19. Trapping the transition state of an ATP-binding cassette transporter: Evidence for a concerted mechanism of maltose transport

    PubMed Central

    Chen, Jue; Sharma, Susan; Quiocho, Florante A.; Davidson, Amy L.

    2001-01-01

    High-affinity uptake into bacterial cells is mediated by a large class of periplasmic binding protein-dependent transport systems, members of the ATP-binding cassette superfamily. In the maltose transport system of Escherichia coli, the periplasmic maltose-binding protein binds its substrate maltose with high affinity and, in addition, stimulates the ATPase activity of the membrane-associated transporter when maltose is present. Vanadate inhibits maltose transport by trapping ADP in one of the two nucleotide-binding sites of the membrane transporter immediately after ATP hydrolysis, consistent with its ability to mimic the transition state of the γ-phosphate of ATP during hydrolysis. Here we report that the maltose-binding protein becomes tightly associated with the membrane transporter in the presence of vanadate and simultaneously loses its high affinity for maltose. These results suggest a general model explaining how ATP hydrolysis is coupled to substrate transport in which a binding protein stimulates the ATPase activity of its cognate transporter by stabilizing the transition state. PMID:11171984

  20. Modulating the function of ATP-binding cassette subfamily G member 2 (ABCG2) with inhibitor cabozantinib.

    PubMed

    Zhang, Guan-Nan; Zhang, Yun-Kai; Wang, Yi-Jun; Barbuti, Anna Maria; Zhu, Xi-Jun; Yu, Xin-Yue; Wen, Ai-Wen; Wurpel, John N D; Chen, Zhe-Sheng

    2017-01-25

    Cabozantinib (XL184) is a small molecule tyrosine kinase receptor inhibitor, which targets c-Met and VEGFR2. Cabozantinib has been approved by the Food and Drug Administration to treat advanced medullary thyroid cancer and renal cell carcinoma. In the present study, we evaluated the ability of cabozantinib to modulate the function of the ATP-binding cassette subfamily G member 2 (ABCG2) by sensitizing cells that are resistant to ABCG2 substrate antineoplastic drugs. We used a drug-selected resistant cell line H460/MX20 and three ABCG2 stable transfected cell lines ABCG2-482-R2, ABCG2-482-G2, and ABCG2-482-T7, which overexpress ABCG2. Cabozantinib, at non-toxic concentrations (3 or 5μM), sensitized the ABCG2-overexpressing cells to mitoxantrone, SN-38, and topotecan. Our results indicate that cabozantinib reverses ABCG2-mediated multidrug resistance by antagonizing the drug efflux function of the ABCG2 transporter instead of downregulating its expression. The molecular docking analysis indicates that cabozantinib binds to the drug-binding site of the ABCG2 transporter. Overall, our findings demonstrate that cabozantinib inhibits the ABCG2 transporter function and consequently enhances the effect of the antineoplastic agents that are substrates of ABCG2. Cabozantinib may be a useful agent in anticancer treatment regimens for patients who are resistant to ABCG2 substrate drugs.

  1. Isolation and characterization of the ATP-binding cassette (ABC) transporter system genes from loofah witches' broom phytoplasma.

    PubMed

    Huang, Chun-Lin; Ho, Kuo-Chieh

    2007-10-01

    A clone containing a 3903 bp EcoRI-restriction fragment was obtained from a lambda(ZAP) genomic library of loofah witches' broom (LfWB) phytoplasma by plaque hybridization using a PCR fragment as a probe. Sequence analysis revealed that this fragment contained three open reading frames (ORFs). The deduced amino acid sequences of ORF 1 and ORF 2 showed a high homology with the ATP-binding proteins of the ABC transporter system genes of prokaryotes and eukaryotes, and encoded proteins with a molecular mass of 36 and 30 kDa, respectively. Based on amino acid sequence similarity, secondary structure, hydrophilicity and a signal peptide sequence at the N-terminus, we predicted that ORF 3 might encode a specific solute-binding prolipoprotein of the ABC transporter system with a molecular mass of 62 kDa. The cleavage site of this prolipoprotein signal peptide was similar to those of gram-positive bacteria. In addition to nutrient uptake, ABC transporter systems of bacteria also play a role in signal transduction, drug-resistance and perhaps virulence. The possible implications of the system to the survival and the pathogenesis of phytoplasma were discussed.

  2. Molecular Disruption of the Power Stroke in the ATP-binding Cassette Transport Protein MsbA*

    PubMed Central

    Doshi, Rupak; Ali, Anam; Shi, Wilma; Freeman, Elizabeth V.; Fagg, Lisa A.; van Veen, Hendrik W.

    2013-01-01

    ATP-binding cassette transporters affect drug pharmacokinetics and are associated with inherited human diseases and impaired chemotherapeutic treatment of cancers and microbial infections. Current alternating access models for ATP-binding cassette exporter activity suggest that ATP binding at the two cytosolic nucleotide-binding domains provides a power stroke for the conformational switch of the two membrane domains from the inward-facing conformation to the outward-facing conformation. In outward-facing crystal structures of the bacterial homodimeric ATP-binding cassette transporters MsbA from Gram-negative bacteria and Sav1866 from Staphylococcus aureus, two transmembrane helices (3 and 4) in the membrane domains have their cytoplasmic extensions in close proximity, forming a tetrahelix bundle interface. In biochemical experiments on MsbA from Escherichia coli, we show for the first time that a robust network of inter-monomer interactions in the tetrahelix bundle is crucial for the transmission of nucleotide-dependent conformational changes to the extracellular side of the membrane domains. Our observations are the first to suggest that modulation of tetrahelix bundle interactions in ATP-binding cassette exporters might offer a potent strategy to alter their transport activity. PMID:23306205

  3. Conservation of an ATP-binding domain among RecA proteins from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r.

    PubMed

    Knight, K L; Hess, R M; McEntee, K

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N3ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the [alpha-32P]8N3ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T31 of the E. coli K-12 RecA protein, which was the unique site of 8N3ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10(7) years.

  4. Conservation of an ATP-binding domain among recA proteins from Proteus vulgaris, erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r

    SciTech Connect

    Knight, K.L.; Hess, R.M.; McEntee, K.

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N/sub 3/ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the (..cap alpha..-/sup 32/P)8N/sub 3/ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T/sub 31/ of the E. coli K-12 RecA protein, which was the unique site of 8N/sub 3/ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10/sup 7/ years.

  5. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3.

    PubMed

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea

    2015-08-19

    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter.

  6. Role of family D ATP-binding cassette transporters (ABCD) in cancer.

    PubMed

    Hlaváč, Viktor; Souček, Pavel

    2015-10-01

    ATP-binding cassette (ABC) transporters, belonging to the family D, are expressed in peroxisomes, endoplasmic reticulum or lysosomes. ABCD transporters play a role in transport of lipids, bile acids and vitamin B12 and associate with peroxisomal disorders. ABCD1 performs transport of coenzyme A esters of very-long-chain fatty acids (VLCFA) in peroxisomes and a number of mutations in ABCD1 gene were linked to an X-linked adrenoleucodystrophy (X-ALD). The role of ABCD transporters in tumour growth has not been studied in detail, but there is some evidence that ABCDs levels differ between undifferentiated stem or tumour cells and differentiated cells suggesting a possible link to tumorigenesis. In this mini-review, we discuss the available information about the role of ABCD transporters in cancer. © 2015 Authors; published by Portland Press Limited.

  7. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3

    PubMed Central

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea

    2015-01-01

    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter. PMID:26295388

  8. ATP-binding cassette transporters in tumor endothelial cells and resistance to metronomic chemotherapy.

    PubMed

    Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro

    2017-02-16

    Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters.

  9. The ATP binding cassette transporter, ABCG1, localizes to cortical actin filaments

    PubMed Central

    Pandzic, Elvis; Gelissen, Ingrid C.; Whan, Renee; Barter, Philip J.; Sviridov, Dmitri; Gaus, Katharina; Rye, Kerry-Anne; Cochran, Blake J.

    2017-01-01

    The ATP-binding cassette sub-family G member 1 (ABCG1) exports cellular cholesterol to high-density lipoproteins (HDL). However, a number of recent studies have suggested ABCG1 is predominantly localised to intracellular membranes. In this study, we found that ABCG1 was organized into two distinct cellular pools: one at the plasma membrane and the other associated with the endoplasmic reticulum (ER). The plasma membrane fraction was organized into filamentous structures that were associated with cortical actin filaments. Inhibition of actin polymerization resulted in complete disruption of ABCG1 filaments. Cholesterol loading of the cells increased the formation of the filamentous ABCG1, the proximity of filamentous ABCG1 to actin filaments and the diffusion rate of membrane associated ABCG1. Our findings suggest that the actin cytoskeleton plays a critical role in the plasma membrane localization of ABCG1. PMID:28165022

  10. Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance.

    PubMed

    Li, Shuaizhang; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Heidi Qunhui; Cao, Zhengyu; Zhao, Bin

    2015-01-01

    The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

  11. Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance

    PubMed

    Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin

    2015-04-28

    The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

  12. Transport in technicolor: Mapping ATP-binding cassette transporters in sea urchin embryos

    PubMed Central

    Gökirmak, Tufan; Shipp, Lauren E.; Campanale, Joseph P.; Nicklisch, Sascha C.T.; Hamdoun, Amro

    2014-01-01

    One quarter of eukaryotic genes encode membrane proteins. These include nearly 1000 transporters that translocate nutrients, signaling molecules, and xenobiotics across membranes. While it is well appreciated that membrane transport is critical for development, the specific roles of many transporters have remained cryptic, in part because of their abundance and the diversity of their substrates. Multi-drug resistance ATP-binding cassette (ABC) efflux transporters are one example of cryptic membrane proteins. Although most organisms utilize these ABC transporters during embryonic development, many of these transporters have broad substrate specificity, and their developmental functions remain incompletely understood. Here, we review advances in our understanding of ABC transporters in sea urchin embryos, and methods developed to spatially and temporally map these proteins. These studies reveal that multifunctional transporters are required for signaling, homeostasis, and protection of the embryo, and shed light on how they are integrated into ancestral developmental pathways recapitulated in disease. PMID:25156004

  13. Protection against chemotherapy-induced alopecia: targeting ATP-binding cassette transporters in the hair follicle?

    PubMed

    Haslam, Iain S; Pitre, Aaron; Schuetz, John D; Paus, Ralf

    2013-11-01

    Currently, efficacious treatments for chemotherapy-induced alopecia (hair loss) are lacking, and incidences of permanent hair loss following high-dose chemotherapy are on the increase. In this article, we describe mechanisms by which the pharmacological defense status of the hair follicle might be enhanced, thereby reducing the accumulation of cytotoxic cancer drugs and preventing or reducing hair loss and damage. We believe this could be achieved via the selective increase in ATP-binding cassette (ABC) transporter expression within the hair follicle epithelium, following application of topical agonists for regulatory nuclear receptors. Clinical application would require the development of hair follicle-targeted formulations, potentially utilizing nanoparticle technology. This novel approach has the potential to yield entirely new therapeutic options for the treatment and management of chemotherapy-induced alopecia, providing significant psychological and physical benefit to cancer patients. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  15. Computer modelling reveals new conformers of the ATP binding loop of Na(+)/K(+)-ATPase involved in the transphosphorylation process of the sodium pump.

    PubMed

    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm; Amler, Evzen

    2017-01-01

    Hydrolysis of ATP by Na(+)/K(+)-ATPase, a P-Type ATPase, catalyzing active Na(+) and K(+) transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp(369) to allow the transfer of ATP's terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp(369) is achieved, analogous molecular modeling of the M4-M5 loop of ATPase was performed using the crystal data of Na(+)/K(+)-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr(338) and Ile(760) of the α2-subunit of Na(+)/K(+)-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe(475) in the N-domain, the other one close to Asp(369) in the P-domain. However, binding of Mg(2+)•ATP to any of these sites in the "open conformation" may not lead to phosphorylation of Asp(369). Additional conformations of the cytoplasmic loop were found wobbling between "open conformation" <==> "semi-open conformation <==> "closed conformation" in the absence of 2Mg(2+)•ATP. The cytoplasmic loop's conformational change to the "semi-open conformation"-characterized by a hydrogen bond between Arg(543) and Asp(611)-triggers by binding of 2Mg(2+)•ATP to a single ATP site and conversion to the "closed conformation" the phosphorylation of Asp(369) in the P-domain, and hence the start of Na(+)/K(+)-activated ATP hydrolysis.

  16. Structure-function analysis of peroxisomal ATP-binding cassette transporters using chimeric dimers.

    PubMed

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W; Lopez, Tatiana E; Dias, Alexandre M M; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J; Trompier, Doriane; Savary, Stéphane

    2014-08-29

    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Structure-Function Analysis of Peroxisomal ATP-binding Cassette Transporters Using Chimeric Dimers*

    PubMed Central

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W.; Lopez, Tatiana E.; Dias, Alexandre M. M.; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J.; Trompier, Doriane; Savary, Stéphane

    2014-01-01

    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. PMID:25043761

  18. Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains

    PubMed Central

    Kelly, Libusha; Fukushima, Hisayo; Karchin, Rachel; Gow, Jason M; Chinn, Leslie W; Pieper, Ursula; Segal, Mark R; Kroetz, Deanna L; Sali, Andrej

    2010-01-01

    The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small α-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily. PMID:20799350

  19. Anatomic Site Based Ploidy Analysis of Oral Premalignant Lesions

    PubMed Central

    Islam, M. N.; Kornberg, L.; Veenker, E.; Cohen, D. M.

    2009-01-01

    The location of oral leukoplakia correlates strongly with the probability of finding dysplastic or malignant alterations at biopsy. It is well established that early detection can dramatically improve the 5-year survival rates for oral squamous cell carcinomas. Since aneuploidy is predictive of future conversion to malignancy, we hypothesized that dysplastic lesions from high-risk sites (floor of mouth, tongue and lips) would exhibit greater aneuploidy than low-risk sites (palate, gingiva and buccal mucosa). Epithelial sections from 60 archival samples diagnosed as mild dysplasia (36 females, 20 males) from various high/low risk locations were stained with Blue Feulgen Stain for DNA Ploidy Analysis (Clarient, Aliso Viejo, CA) and ploidy was analyzed using a ChromaVision ACIS II (Clarient, ALiso Viejo, CA) Image cytometry system. A DNA histogram was generated using an image analyzing software that evaluated the amount of Feulgen stain which is proportional to the amount of nuclear DNA. An ANOVA analysis followed by the Student’s‘t’ test revealed significant differences between means (P ≤ 0.05). Lesions originating from lateral/ventral tongue (85%), floor of mouth (50%) and soft palate (44%) exhibited a higher frequency of aneuploidy than lesions from gingiva (22%) and lower lip (25%). This pilot study demonstrates that dysplastic lesions from high-risk sites such as the floor of the mouth and lateral/ventral tongue have higher frequency of aneuploidy. PMID:20237983

  20. Biochemical studies on the structure-function relationship of major drug transporters in the ATP-binding cassette family and solute carrier family.

    PubMed

    Hong, Mei

    2017-07-01

    Human drug transporters often play key roles in determining drug accumulation within cells. Their activities are often directly related to therapeutic efficacy, drug toxicity as well as drug-drug interactions. However, the progress for interpretation of their crystal structures is relatively slow. Hence, conventional biochemical studies together with computer modeling became useful manners to reveal essential structures of these membrane proteins. Over the years, quite a few structure-function relationship information had been obtained for members of the two major transporter families: the ATP-binding cassette family and the solute carrier family. Critical structural features of drug transporters include transmembrane domains, post-translational modification sites and domains for cell surface assembly and protein-protein interactions. Alterations at these important sites may affect protein stability, trafficking to the plasma membrane and/or ability of transporters to interact with substrates. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Synthetic Analogs of Curcumin Modulate the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCG2.

    PubMed

    Murakami, Megumi; Ohnuma, Shinobu; Fukuda, Michihiro; Chufan, Eduardo E; Kudoh, Katsuyoshi; Kanehara, Keigo; Sugisawa, Norihiko; Ishida, Masaharu; Naitoh, Takeshi; Shibata, Hiroyuki; Iwabuchi, Yoshiharu; Ambudkar, Suresh V; Unno, Michiaki

    2017-11-01

    Multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) transporters in cancer cells is a major obstacle in cancer chemotherapy. Previous studies have shown that curcumin, a natural product and a dietary constituent of turmeric, inhibits the function of MDR-related ABC transporters, including ABCB1, ABCC1, and especially ABCG2. However, the limited bioavailability of curcumin prevents its use for modulation of the function of these transporters in the clinical setting. In this study, we investigated the effects of 24 synthetic curcumin analogs with increased bioavailability on the transport function of ABCG2. The screening of the 24 synthetic analogs by means of flow cytometry revealed that four of the curcumin analogs (GO-Y030, GO-Y078, GO-Y168, and GO-Y172) significantly inhibited the efflux of the ABCG2 substrates, mitoxantrone and pheophorbide A, from ABCG2-overexpressing K562/breast cancer resistance protein (BCRP) cells. Biochemical analyses showed that GO-Y030, GO-Y078, and GO-Y172 stimulated the ATPase activity of ABCG2 at nanomolar concentrations and inhibited the photolabeling of ABCG2 with iodoarylazidoprazosin, suggesting that these analogs interact with the substrate-binding sites of ABCG2. In addition, when used in cytotoxicity assays, GO-Y030 and GO-Y078 were found to improve the sensitivity of the anticancer drug, SN-38, in K562/BCRP cells. Taken together, these results suggest that nontoxic synthetic curcumin analogs with increased bioavailability, especially GO-Y030 and GO-Y078, inhibit the function of ABCG2 by directly interacting at the substrate-binding site. These synthetic curcumin analogs could therefore be developed as potent modulators to overcome ABCG2-mediated MDR in cancer cells. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  2. ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.

    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  3. ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.

    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  4. ATP Binding by Proteasomal ATPases Regulates Cellular Assembly and Substrate-induced Functions of the 26 S Proteasome*

    PubMed Central

    Kim, Young-Chan; Li, Xiaohua; Thompson, David; DeMartino, George N.

    2013-01-01

    We examined the role of ATP binding by six different ATPase subunits (Rpt1–6) in the cellular assembly and molecular functions of mammalian 26 S proteasome. Four Rpt subunits (Rpt1–4) with ATP binding mutations were incompetent for cellular assembly into 26 S proteasome. In contrast, analogous mutants of Rpt5 and Rpt6 were incorporated normally into 26 S proteasomes in both intact cells and an in vitro assembly assay. Surprisingly, purified 26 S proteasomes containing either mutant Rpt5 or Rpt6 had normal basal ATPase activity and substrate gate opening for hydrolysis of short peptides. However, these mutant 26 S proteasomes were severely defective for ATP-dependent in vitro degradation of ubiquitylated and non-ubiquitylated proteins and did not display substrate-stimulated ATPase and peptidase activities characteristic of normal proteasomes. These results reveal differential roles of ATP binding by various Rpt subunits in proteasome assembly and function. They also indicate that substrate-stimulated ATPase activity and gating depend on the concerted action of a full complement of Rpt subunits competent for ATP binding and that this regulation is essential for normal proteolysis. Thus, protein substrates appear to promote their own degradation by stimulating proteasome functions involved in proteolysis. PMID:23212908

  5. Structure, function, and evolution of bacterial ATP-binding cassette systems

    SciTech Connect

    Davidson, A.L.; Dassa, E.; Orelle, C.; Chen, J.

    2010-07-27

    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed in Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and

  6. The Hypertrophic Cardiomyopathy Myosin Mutation R453C Alters ATP Binding and Hydrolysis of Human Cardiac β-Myosin*

    PubMed Central

    Bloemink, Marieke; Deacon, John; Langer, Stephen; Vera, Carlos; Combs, Ariana; Leinwand, Leslie; Geeves, Michael A.

    2014-01-01

    The human hypertrophic cardiomyopathy mutation R453C results in one of the more severe forms of the myopathy. Arg-453 is found in a conserved surface loop of the upper 50-kDa domain of the myosin motor domain and lies between the nucleotide binding pocket and the actin binding site. It connects to the cardiomyopathy loop via a long α-helix, helix O, and to Switch-2 via the fifth strand of the central β-sheet. The mutation is, therefore, in a position to perturb a wide range of myosin molecular activities. We report here the first detailed biochemical kinetic analysis of the motor domain of the human β-cardiac myosin carrying the R453C mutation. A recent report of the same mutation (Sommese, R. F., Sung, J., Nag, S., Sutton, S., Deacon, J. C., Choe, E., Leinwand, L. A., Ruppel, K., and Spudich, J. A. (2013) Proc. Natl. Acad. Sci. U.S.A. 110, 12607–12612) found reduced ATPase and in vitro motility but increased force production using an optical trap. Surprisingly, our results show that the mutation alters few biochemical kinetic parameters significantly. The exceptions are the rate constants for ATP binding to the motor domain (reduced by 35%) and the ATP hydrolysis step/recovery stroke (slowed 3-fold), which could be the rate-limiting step for the ATPase cycle. Effects of the mutation on the recovery stroke are consistent with a perturbation of Switch-2 closure, which is required for the recovery stroke and the subsequent ATP hydrolysis. PMID:24344137

  7. Alternating access to the transmembrane domain of the ATP-binding cassette protein cystic fibrosis transmembrane conductance regulator (ABCC7).

    PubMed

    Wang, Wuyang; Linsdell, Paul

    2012-03-23

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is a member of the ATP-binding cassette (ABC) protein family, most members of which act as active transporters. Actively transporting ABC proteins are thought to alternate between "outwardly facing" and "inwardly facing" conformations of the transmembrane substrate pathway. In CFTR, it is assumed that the outwardly facing conformation corresponds to the channel open state, based on homology with other ABC proteins. We have used patch clamp recording to quantify the rate of access of cysteine-reactive probes to cysteines introduced into two different transmembrane regions of CFTR from both the intracellular and extracellular solutions. Two probes, the large [2-sulfonatoethyl]methanethiosulfonate (MTSES) molecule and permeant Au(CN)(2)(-) ions, were applied to either side of the membrane to modify cysteines substituted for Leu-102 (first transmembrane region) and Thr-338 (sixth transmembrane region). Channel opening and closing were altered by mutations in the nucleotide binding domains of the channel. We find that, for both MTSES and Au(CN)(2)(-), access to these two cysteines from the cytoplasmic side is faster in open channels, whereas access to these same sites from the extracellular side is faster in closed channels. These results are consistent with alternating access to the transmembrane regions, however with the open state facing inwardly and the closed state facing outwardly. Our findings therefore prompt revision of current CFTR structural and mechanistic models, as well as having broader implications for transport mechanisms in all ABC proteins. Our results also suggest possible locations of both functional and dysfunctional ("vestigial") gates within the CFTR permeation pathway.

  8. Computational characterization of TTHA0379: A potential glycerophosphocholine binding protein of Ugp ATP-binding cassette transporter.

    PubMed

    Chandravanshi, Monika; Gogoi, Prerana; Kanaujia, Shankar Prasad

    2016-11-05

    For the de novo biosynthesis of phospholipids, byproducts such as sn-glycerol-3-phosphate (G3P) and glycerophosphocholine (GPC) of glycerophospholipid metabolic pathway are imported inside the cell by an ATP-binding cassette (ABC) transporter known as UgpABCE. Of which, UgpA and UgpE constitutes the transmembrane domains (TMDs), UgpC forms the dimer of ATP-hydrolyzing component and UgpB is the periplasmic substrate binding protein. Structurally, UgpABCE transporter displays similarity to the maltose ABC transporter of Escherichia coli; thus, has been grouped into the CUT1 (Carbohydrate Uptake Transporter-1) family of bacterial ABC transporters. Being a member of CUT1 family, several Ugp (Uptake glycerol phosphate) protein sequences in biological database(s) exhibit sequence and structure similarity to sugar ABC transporters and have been annotated as sugar binding proteins; one of such proteins is TTHA0379 from Thermus thermophilus HB8. Here, in this study, we used computational method(s) to distinguish UgpB and sugar binding proteins based on their primary and tertiary structure features. A comprehensive analysis of these proteins indicates that they are evolutionarily related to each other having common conserved features at their primary and tertiary structure levels. However, they display differences at their active sites owing to the dissimilarity in their ligand preferences. In addition, phylogenetic analysis of TTHA0379 along with UgpB and sugar binding proteins reveals that both the groups of proteins forms two distinct clades and TTHA0379 groups with UgpB proteins. Furthermore, analysis of the ligand binding pocket shows that all the essential features of glycerophosphocholine binding protein i.e. UgpB, are conserved in TTHA0379 as well. Combining these features, here, we designate TTHA0379 to be a GPC binding protein.

  9. Solution structure and function in trifluoroethanol of PP-50, an ATP-binding peptide from F1ATPase.

    PubMed

    Chuang, W J; Abeygunawardana, C; Gittis, A G; Pedersen, P L; Mildvan, A S

    1995-05-10

    PP-50, a synthetic peptide, based on residues 141-190 of the beta-subunit of mitochondrial F1ATPase, containing the GX4GKT consensus sequence for nucleoside triphosphate binding, binds ATP tightly (Kd = 17.5 microM) as found by fluorescence titration at pH 4.0. CD and 2D proton NMR studies at pH 4.0 revealed two beta-turns, regions of extended secondary structure, transient tertiary structure, and flexibility in the GX4GKT region (W.J. Chuang, C. Abeygunawardana, P. L. Pedersen, and A. S. Mildvan, 1992, Biochemistry 31, 7915-7921). CD titration of PP-50 with trifluoroethanol (TFE) reveals a decrease in ellipticity at 208 and 222 nm, saturating at 25% TFE. Computer analysis indicates that 25% TFE increases the helix content from 5.8 to 28.6%, decreases the beta-structure from 30.2 to 20.2% and decreases the coil content from 64 to 51.2%. Fluorescence titrations of H2ATP2- with PP-50 in 25% TFE yields a Kd of 7.3 microM, 2.4-fold tighter than in H2O, probably due to TFE increasing the activity of H2ATP2- . PP-50 completely quenches the fluorescence of H2ATP2- in 25% TFE, while in H2O the fluorescence quenching is only 62%. In H2O the binding of H2ATP2- increases the structure of PP-50 as detected by CD, but in 25% TFE no significant change in CD is found on binding either H2ATP2- or Mg2+ HATP (Kd = 14 microM). The complete proton NMR spectrum of PP-50 in 25% TFE has been assigned. The solution structure, determined by distance geometry, molecular dynamics with simulated annealing, and energy minimization, consists of a coil (residues 1-8), a strand (residues 9-12), a loop (residues 13-22) containing the GX4GKT consensus sequence (residues 16-23), an alpha-helix (residues 23-36), a turn (residues 38-41), and a coil (residues 42-50), similar to that of the corresponding region of the X-ray structure of F1ATPase (J.P. Abrahams, A.G.W. Leslie, R. Lutter, and J. E. Walker, 1994 Nature 370, 621-628) and to the structure of a homologous peptide from the ATP-binding site of

  10. Conformational Changes Produced by ATP Binding to the Plasma Membrane Calcium Pump*

    PubMed Central

    Mangialavori, Irene C.; Ferreira-Gomes, Mariela S.; Saffioti, Nicolás A.; González-Lebrero, Rodolfo M.; Rossi, Rolando C.; Rossi, Juan Pablo F. C.

    2013-01-01

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[125I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca2+ with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2′(3′)-O-(2,4,6-trinitrophenyl)adenosine 5′-triphosphate. To assess the conformational behavior of the Ca2+ binding domain, we also studied the occlusion of Ca2+, both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca2+ and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only. PMID:24025327

  11. Homo- and heterodimerization of peroxisomal ATP-binding cassette half-transporters.

    PubMed

    Liu, L X; Janvier, K; Berteaux-Lecellier, V; Cartier, N; Benarous, R; Aubourg, P

    1999-11-12

    Mammalian peroxisomal proteins adrenoleukodystrophy protein (ALDP), adrenoleukodystrophy-related protein (ALDRP), and 70-kDa peroxisomal protein (PMP70) belong to the superfamily of ATP-binding cassette (ABC) transporters. Unlike many ABC transporters that are single functional proteins with two related halves, ALDP, ALDRP, and PMP70 have the structure of ABC half-transporters. The dysfunction of ALDP is responsible for X-linked adrenoleukodystrophy (X-ALD), a neurodegenerative disorder in which saturated very long-chain fatty acids accumulate because of their impaired peroxisomal beta-oxidation. No disease has so far been associated with mutations of adrenoleukodystrophy-related or PMP70 genes. It has been proposed that peroxisomal ABC transporters need to dimerize to exert import functions. Using the yeast two-hybrid system, we show that homo- as well as heterodimerization occur between the carboxyl-terminal halves of ALDP, ALDRP, and PMP70. Two X-ALD disease mutations located in the carboxyl-terminal half of ALDP affect both homo- and heterodimerization of ALDP. Co-immunoprecipitation demonstrated the homodimerization of ALDP, the heterodimerization of ALDP with PMP70 or ALDRP, and the heterodimerization of ALDRP with PMP70. These results provide the first evidence of both homo- and heterodimerization of mammalian ABC half-transporters and suggest that the loss of ALDP dimerization plays a role in X-ALD pathogenesis.

  12. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    SciTech Connect

    C Simmons; C Magee; D Smith; L Lauman; J Chaput; J Allen

    2011-12-31

    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADP cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.

  13. A-Subclass ATP-Binding Cassette Proteins in Brain Lipid Homeostasis and Neurodegeneration

    PubMed Central

    Piehler, Armin P.; Özcürümez, Mustafa; Kaminski, Wolfgang E.

    2012-01-01

    The A-subclass of ATP-binding cassette (ABC) transporters comprises 12 structurally related members of the evolutionarily highly conserved superfamily of ABC transporters. ABCA transporters represent a subgroup of “full-size” multispan transporters of which several members have been shown to mediate the transport of a variety of physiologic lipid compounds across membrane barriers. The importance of ABCA transporters in human disease is documented by the observations that so far four members of this protein family (ABCA1, ABCA3, ABCA4, ABCA12) have been causatively linked to monogenetic disorders including familial high-density lipoprotein deficiency, neonatal surfactant deficiency, degenerative retinopathies, and congenital keratinization disorders. Recent research also point to a significant contribution of several A-subfamily ABC transporters to neurodegenerative diseases, in particular Alzheimer’s disease (AD). This review will give a summary of our current knowledge of the A-subclass of ABC transporters with a special focus on brain lipid homeostasis and their involvement in AD. PMID:22403555

  14. ATP-binding cassette (ABC) proteins in aquatic invertebrates: Evolutionary significance and application in marine ecotoxicology.

    PubMed

    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Jae-Seong

    2017-04-01

    The ATP-binding cassette (ABC) protein superfamily is known to play a fundamental role in biological processes and is highly conserved across animal taxa. The ABC proteins function as active transporters for multiple substrates across the cellular membrane by ATP hydrolysis. As this superfamily is derived from a common ancestor, ABC genes have evolved via lineage-specific duplications through the process of adaptation. In this review, we summarized information about the ABC gene families in aquatic invertebrates, considering their evolution and putative functions in defense mechanisms. Phylogenetic analysis was conducted to examine the evolutionary significance of ABC gene families in aquatic invertebrates. Particularly, a massive expansion of multixenobiotic resistance (MXR)-mediated efflux transporters was identified in the absence of the ABCG2 (BCRP) gene in Ecdysozoa and Platyzoa, suggesting that a loss of Abcg2 gene occurred sporadically in these species during divergence of Protostome to Lophotrochozoa. Furthermore, in aquatic invertebrates, the ecotoxicological significance of MXR is discussed while considering the role of MXR-mediated efflux transporters in response to various environmental pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Serum albumin promotes ATP-binding cassette transporter-dependent sterol uptake in yeast.

    PubMed

    Marek, Magdalena; Silvestro, Daniele; Fredslund, Maria D; Andersen, Tonni G; Pomorski, Thomas G

    2014-12-01

    Sterol uptake in fungi is a multistep process that involves interaction between external sterols and the cell wall, incorporation of sterol molecules into the plasma membrane, and subsequent integration into intracellular membranes for turnover. ATP-binding cassette (ABC) transporters have been implicated in sterol uptake, but key features of their activity remain to be elucidated. Here, we apply fluorescent cholesterol (NBD-cholesterol) to monitor sterol uptake under anaerobic and aerobic conditions in two fungal species, Candida glabrata (Cg) and Saccharomyces cerevisiae (Sc). We found that in both fungal species, ABC transporter-dependent uptake of cholesterol under anaerobic conditions and in mutants lacking HEM1 gene is promoted in the presence of the serum protein albumin that is able to bind the sterol molecule. Furthermore, the C. glabrata ABC transporter CgAus1p expressed in S. cerevisiae requires the presence of serum or albumin for efficient cholesterol uptake. These results suggest that albumin can serve as sterol donor in ABC transporter-dependent sterol uptake, a process potentially important for growth of C. glabrata inside infected humans. © 2014 The Authors. FEMS Yeast Research published by John Wiley & Sons Ltd on behalf of Federation of European Microbiological Societies.

  16. Phylogenetic analysis of the ATP-binding cassette transporter family in three mosquito species.

    PubMed

    Lu, Hong; Xu, Yongyu; Cui, Feng

    2016-09-01

    The ATP-binding cassette (ABC) transporter family functions in the ATP-dependent transportation of various substrates across biological membranes. ABC proteins participate in various biological processes and insecticide resistance in insects, and are divided into eight subfamilies (A-H). Mosquitoes are important vectors of human diseases, but the mechanism by which the ABC transporter family evolves in mosquitoes is unknown. In this study, we classified and compared the ABC transporter families of three mosquitoes, namely, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus. The three mosquitoes have 55, 69, and 70 ABC genes, respectively. The C. p. quinquefasciatus had approximately 40% and 65% expansion in the ABCG subfamily, mainly in ABCG1/G4, compared with the two other mosquito species. The ABCB, ABCD, ABCE, and ABCF subfamilies were conserved in the three mosquito species. The C. p. quinquefasciatus transcriptomes during development showed that the ABCG and ABCC genes were mainly highly expressed at the egg and pupal stages. The pigment-transport relative brown, white, and scarlet, as well as the ABCF subfamily, were highly expressed at the egg stage. The highly expressed genes in larvae included three ABCA3 genes. The majority of the highly expressed genes in adults were ABCG1/4 genes. These results provided insights into the evolution of the ABC transporter family in mosquitoes. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Predictive Structure and Topology of Peroxisomal ATP-Binding Cassette (ABC) Transporters.

    PubMed

    Andreoletti, Pierre; Raas, Quentin; Gondcaille, Catherine; Cherkaoui-Malki, Mustapha; Trompier, Doriane; Savary, Stéphane

    2017-07-22

    The peroxisomal ATP-binding Cassette (ABC) transporters, which are called ABCD1, ABCD2 and ABCD3, are transmembrane proteins involved in the transport of various lipids that allow their degradation inside the organelle. Defective ABCD1 leads to the accumulation of very long-chain fatty acids and is associated with a complex and severe neurodegenerative disorder called X-linked adrenoleukodystrophy (X-ALD). Although the nucleotide-binding domain is highly conserved and characterized within the ABC transporters family, solid data are missing for the transmembrane domain (TMD) of ABCD proteins. The lack of a clear consensus on the secondary and tertiary structure of the TMDs weakens any structure-function hypothesis based on the very diverse ABCD1 mutations found in X-ALD patients. Therefore, we first reinvestigated thoroughly the structure-function data available and performed refined alignments of ABCD protein sequences. Based on the 2.85  Å resolution crystal structure of the mitochondrial ABC transporter ABCB10, here we propose a structural model of peroxisomal ABCD proteins that specifies the position of the transmembrane and coupling helices, and highlight functional motifs and putative important amino acid residues.

  18. Masitinib antagonizes ATP-binding cassette subfamily G member 2-mediated multidrug resistance

    PubMed Central

    KATHAWALA, RISHIL J.; CHEN, JUN-JIANG; ZHANG, YUN-KAI; WANG, YI-JUN; PATEL, ATISH; WANG, DE-SHEN; TALELE, TANAJI T.; ASHBY, CHARLES R.; CHEN, ZHE-SHENG

    2014-01-01

    In this in vitro study, we determined whether masitinib could reverse multidrug resistance (MDR) in cells overexpressing the ATP binding cassette subfamily G member 2 (ABCG2) transporter. Masitinib (1.25 and 2.5 μM) significantly decreases the resistance to mitoxantrone (MX), SN38 and doxorubicin in HEK293 and H460 cells overexpressing the ABCG2 transporter. In addition, masitinib (2.5 μM) significantly increased the intracellular accumulation of [3H]-MX, a substrate for ABCG2, by inhibiting the function of ABCG2 and significantly decreased the efflux of [3H]-MX. However, masitinib (2.5 μM) did not significantly alter the expression of the ABCG2 protein. In addition, a docking model suggested that masitinib binds within the transmembrane region of a homology-modeled human ABCG2 transporter. Overall, our in vitro findings suggest that masitinib reverses MDR to various anti-neoplastic drugs in HEK293 and H460 cells overexpressing ABCG2 by inhibiting their transport activity as opposed to altering their levels of expression. PMID:24626598

  19. Molecular Characterization of LjABCG1, an ATP-Binding Cassette Protein in Lotus japonicus

    PubMed Central

    Sugiyama, Akifumi; Fukuda, Shoju; Takanashi, Kojiro; Yoshioka, Miki; Yoshioka, Hirofumi; Narusaka, Yoshihiro; Narusaka, Mari; Kojima, Mikiko; Sakakibara, Hitoshi; Shitan, Nobukazu; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Yazaki, Kazufumi

    2015-01-01

    LjABCG1, a full-size ABCG subfamily of ATP-binding cassette proteins of a model legume, Lotus japonicus, was reported as a gene highly expressed during the early stages of nodulation, but have not been characterized in detail. In this study we showed that the induction of LjABCG1 expression was remarkable by methyl jasmonate treatment, and reporter gene experiments indicated that LjABCG1 was strongly expressed in the nodule parenchyma and cell layers adjacent to the root vascular tissue toward the nodule. LjABCG1 was suggested to be localized at the plasma membrane based on the fractionation of microsomal membranes as well as separation via aqueous two-phase partitioning. The physiological functions of LjABCG1 in symbiosis and pathogenesis were analyzed in homologous and heterologous systems. LjABCG1 knock-down L. japonicus plants did not show clear phenotypic differences in nodule formation, and not in defense against Pseudomonas syringae, either. In contrast, when LjABCG1 was expressed in the Arabidopsis pdr8-1 mutant, the penetration frequency of Phytophthora infestans, a potato late blight pathogen, was significantly reduced in LjABCG1/pdr8-1 than in pdr8-1 plants. This finding indicated that LjABCG1, at least partially, complemented the phenotype of pdr8 in Arabidopsis, suggesting the multiple roles of this protein in plant-microbe interactions. PMID:26418593

  20. Receptor-transporter interactions of canonical ATP-binding cassette import systems in prokaryotes.

    PubMed

    Schneider, Erwin; Eckey, Viola; Weidlich, Daniela; Wiesemann, Nicole; Vahedi-Faridi, Ardeshir; Thaben, Paul; Saenger, Wolfram

    2012-04-01

    ATP-binding cassette (ABC) transport systems mediate the translocation of solutes across biological membranes at the expense of ATP. They share a common modular architecture comprising two pore-forming transmembrane domains and two nucleotide binding domains. In prokaryotes, ABC transporters are involved in the uptake of a large variety of chemicals, including nutrients, osmoprotectants and signal molecules. In pathogenic bacteria, some ABC importers are virulence factors. Canonical ABC import systems require an additional component, a substrate-specific receptor or binding protein for function. Interaction of the liganded receptor with extracytoplasmic loop regions of the transmembrane domains initiate the transport cycle. In this review we summarize the current knowledge on receptor-transporter interplay provided by crystal structures as well as by biochemical and biophysical means. In particular, we focus on the maltose/maltodextrin transporter of enterobacteria and the transporters for positively charged amino acids from the thermophile Geobacillus stearothermophilus and Salmonella enterica serovar Typhimurium. Copyright © 2011 Elsevier GmbH. All rights reserved.

  1. A Plant Plasma Membrane ATP Binding Cassette–Type Transporter Is Involved in Antifungal Terpenoid Secretion

    PubMed Central

    Jasiński, Michal; Stukkens, Yvan; Degand, Hervé; Purnelle, Bénédicte; Marchand-Brynaert, Jacqueline; Boutry, Marc

    2001-01-01

    ATP binding cassette (ABC) transporters, which are found in all species, are known mainly for their ability to confer drug resistance. To date, most of the ABC transporters characterized in plants have been localized in the vacuolar membrane and are considered to be involved in the intracellular sequestration of cytotoxins. Working on the assumption that certain ABC transporters might be involved in defense metabolite secretion and their expression might be regulated by the concentration of these metabolites, we treated a Nicotiana plumbaginifolia cell culture with sclareolide, a close analog of sclareol, an antifungal diterpene produced at the leaf surface of Nicotiana spp; this resulted in the appearance of a 160-kD plasma membrane protein, which was partially sequenced. The corresponding cDNA (NpABC1) was cloned and shown to encode an ABC transporter. In vitro and in situ immunodetection showed NpABC1 to be localized in the plasma membrane. Under normal conditions, expression was found in the leaf epidermis. In cell culture and in leaf tissues, NpABC1 expression was strongly enhanced by sclareolide and sclareol. In parallel with NpABC1 induction, cells acquired the ability to excrete a labeled synthetic sclareolide derivative. These data suggest that NpABC1 is involved in the secretion of a secondary metabolite that plays a role in plant defense. PMID:11340184

  2. Caveolin-1 and ATP binding cassette transporter A1 and G1-mediated cholesterol efflux.

    PubMed

    Wang, Faqi; Gu, Hong-mei; Zhang, Da-wei

    2014-01-01

    Atherosclerosis is one major cause of cardiovascular diseases, the leading cause of death in industrialized countries. Reverse cholesterol transport (RCT) is thought to be one primary pathway to protect against atherosclerosis. The first and rate-limiting step of RCT is ATP-binding cassette transport A1 (ABCA1) and ABCG1-mediated cholesterol efflux from the cells. Recently, caveolin-1 (CAV1), a scaffolding protein that organizes and concentrates certain caveolin-interacting signaling molecules and receptors within caveolae membranes, has been shown to regulate ABCA1 and ABCG1-mediated cholesterol efflux probably via interacting with them. In the present review, we summarize the current knowledge and views on the regulatory role of CAV1 on the cholesterol homeostasis with emphasis on the association of CAV1 with ABCA1 and ABCG1. We conclude that the dominance of the positive regulation by CAV1 on the ABCA1 and ABCG1-mediated cholesterol efflux is depending on the species, cell types, as well as the levels of CAV1 expression.

  3. The Yeast Plasma Membrane ATP Binding Cassette (ABC) Transporter Aus1

    PubMed Central

    Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L.; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther

    2011-01-01

    The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter. PMID:21521689

  4. Agrobacterium rhizogenes GALLS Protein Contains Domains for ATP Binding, Nuclear Localization, and Type IV Secretion▿

    PubMed Central

    Hodges, Larry D.; Vergunst, Annette C.; Neal-McKinney, Jason; den Dulk-Ras, Amke; Moyer, Deborah M.; Hooykaas, Paul J. J.; Ream, Walt

    2006-01-01

    Agrobacterium tumefaciens and Agrobacterium rhizogenes are closely related plant pathogens that cause different diseases, crown gall and hairy root. Both diseases result from transfer, integration, and expression of plasmid-encoded bacterial genes located on the transferred DNA (T-DNA) in the plant genome. Bacterial virulence (Vir) proteins necessary for infection are also translocated into plant cells. Transfer of single-stranded DNA (ssDNA) and Vir proteins requires a type IV secretion system, a protein complex spanning the bacterial envelope. A. tumefaciens translocates the ssDNA-binding protein VirE2 into plant cells, where it binds single-stranded T-DNA and helps target it to the nucleus. Although some strains of A. rhizogenes lack VirE2, they are pathogenic and transfer T-DNA efficiently. Instead, these bacteria express the GALLS protein, which is essential for their virulence. The GALLS protein can complement an A. tumefaciens virE2 mutant for tumor formation, indicating that GALLS can substitute for VirE2. Unlike VirE2, GALLS contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. Both GALLS and VirE2 contain nuclear localization sequences and a C-terminal type IV secretion signal. Here we show that mutations in any of these domains abolished the ability of GALLS to substitute for VirE2. PMID:17012398

  5. Conformational changes produced by ATP binding to the plasma membrane calcium pump.

    PubMed

    Mangialavori, Irene C; Ferreira-Gomes, Mariela S; Saffioti, Nicolás A; González-Lebrero, Rodolfo M; Rossi, Rolando C; Rossi, Juan Pablo F C

    2013-10-25

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[(125)I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca(2+) with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. To assess the conformational behavior of the Ca(2+) binding domain, we also studied the occlusion of Ca(2+), both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca(2+) and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only.

  6. Structure-guided Development of Specific Pyruvate Dehydrogenase Kinase Inhibitors Targeting the ATP-binding Pocket*

    PubMed Central

    Tso, Shih-Chia; Qi, Xiangbing; Gui, Wen-Jun; Wu, Cheng-Yang; Chuang, Jacinta L.; Wernstedt-Asterholm, Ingrid; Morlock, Lorraine K.; Owens, Kyle R.; Scherer, Philipp E.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.

    2014-01-01

    Pyruvate dehydrogenase kinase isoforms (PDKs 1–4) negatively regulate activity of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation. PDK isoforms are up-regulated in obesity, diabetes, heart failure, and cancer and are potential therapeutic targets for these important human diseases. Here, we employed a structure-guided design to convert a known Hsp90 inhibitor to a series of highly specific PDK inhibitors, based on structural conservation in the ATP-binding pocket. The key step involved the substitution of a carbonyl group in the parent compound with a sulfonyl in the PDK inhibitors. The final compound of this series, 2-[(2,4-dihydroxyphenyl)sulfonyl]isoindoline-4,6-diol, designated PS10, inhibits all four PDK isoforms with IC50 = 0.8 μm for PDK2. The administration of PS10 (70 mg/kg) to diet-induced obese mice significantly augments pyruvate dehydrogenase complex activity with reduced phosphorylation in different tissues. Prolonged PS10 treatments result in improved glucose tolerance and notably lessened hepatic steatosis in the mouse model. The results support the pharmacological approach of targeting PDK to control both glucose and fat levels in obesity and type 2 diabetes. PMID:24356970

  7. A conserved mitochondrial ATP-binding cassette transporter exports glutathione polysulfide for cytosolic metal cofactor assembly.

    PubMed

    Schaedler, Theresia A; Thornton, Jeremy D; Kruse, Inga; Schwarzländer, Markus; Meyer, Andreas J; van Veen, Hendrik W; Balk, Janneke

    2014-08-22

    An ATP-binding cassette transporter located in the inner mitochondrial membrane is involved in iron-sulfur cluster and molybdenum cofactor assembly in the cytosol, but the transported substrate is unknown. ATM3 (ABCB25) from Arabidopsis thaliana and its functional orthologue Atm1 from Saccharomyces cerevisiae were expressed in Lactococcus lactis and studied in inside-out membrane vesicles and in purified form. Both proteins selectively transported glutathione disulfide (GSSG) but not reduced glutathione in agreement with a 3-fold stimulation of ATPase activity by GSSG. By contrast, Fe(2+) alone or in combination with glutathione did not stimulate ATPase activity. Arabidopsis atm3 mutants were hypersensitive to an inhibitor of glutathione biosynthesis and accumulated GSSG in the mitochondria. The growth phenotype of atm3-1 was strongly enhanced by depletion of the mitochondrion-localized, GSH-dependent persulfide oxygenase ETHE1, suggesting that the physiological substrate of ATM3 contains persulfide in addition to glutathione. Consistent with this idea, a transportomics approach using mass spectrometry showed that glutathione trisulfide (GS-S-SG) was transported by Atm1. We propose that mitochondria export glutathione polysulfide, containing glutathione and persulfide, for iron-sulfur cluster assembly in the cytosol.

  8. Tracing the structural evolution of eukaryotic ATP binding cassette transporter superfamily

    PubMed Central

    Xiong, Jie; Feng, Jinmei; Yuan, Dongxia; Zhou, Jun; Miao, Wei

    2015-01-01

    The ATP binding cassette (ABC) transporters superfamily is one of the largest classes of membrane proteins. The core of the ABC transporter protein is composed of transmembrane domains (TMDs) and nucleotide binding domains (NBD). Eukaryotes ABC transporters are classified into seven main families (ABCA to ABCG) based on sequence similarity and domain organizations. With different domain number and domain organizations, eukaryote ABC transporters show diverse structures: the single structure (NBD or TMD), the ABC2 structure (NBD-NBD), the half structure (TMD-NBD or NBD-TMD) and the full structure (TMD-NBD-TMD-NBD or NBD-TMD-NBD-TMD). However, studies on how various ABC transporter gene structures evolved is still absent. Therefore, in this study, we comprehensively investigated the structural evolution of eukaryotic ABC transporters. The seven eukaryote ABC transporter families (A to G) fell into three groups: A&G group, B,C&D group and E&F group. There were at least four times the number of NBD and TMD fusion events in the origin of the half structure transporter. Two fusion modes were found in the full and ABC2 structure origination. Based on these findings, we present a putative structural evolutionary path of eukaryote ABC transporters that will increase our understanding on their origin, divergence and function. PMID:26577702

  9. Inventory and analysis of ATP-binding cassette (ABC) systems in Brugia malayi.

    PubMed

    Ardelli, B F; Stitt, L E; Tompkins, J B

    2010-07-01

    ABC systems are one of the largest described protein superfamilies. These systems have a domain organization that may contain 1 or more transmembrane domains (ABC_TM1F) and 1 or 2 ATP-binding domains (ABC_2). The functions (e.g., import, export and DNA repair) of these proteins distinguish the 3 classes of ABC systems. Mining and PCR-based cloning were used to identify 33 putative ABC systems from the Brugia malayi genome. There were 31 class 2 genes, commonly called ABC transporters, and 2 class 3 genes. The ABC transporters were divided into subfamilies. Three belonged to subfamily A, 16 to subfamily B, 5 to subfamily C, 1 to subfamily E and 3 to subfamilies F and G, respectively. None were placed in subfamilies D and H. Similar to other ABC systems, the ABC_2 domain of B. malayi genes was conserved and contained the Walker A and B motifs, the signature sequence/linker region and the switch region with the conserved histidine. The ABC_TM1F domain was less conserved. The relative abundance of ABC systems was quantified using real-time reverse transcription PCR and was significantly higher in female adults of B. malayi than in males and microfilaria, particularly those in subfamilies B and C, which are associated with drug resistance.

  10. Akt isoform-dependent regulation of ATP-Binding cassette A1 expression by apolipoprotein E.

    PubMed

    Okoro, Emmanuel U; Guo, Zhongmao; Yang, Hong

    2016-08-12

    We previously reported that apolipoprotein E (apoE) upregulates ATP-binding cassette transporter A1 (ABCA1) transcription through phosphatidylinositol 3-kinase (PI3K). Here we demonstrate that treatment of murine macrophages with human apoE3 enhanced Akt phosphorylation, and upregulated ABCA1 protein and mRNA expression. Inhibition of PI3K weakened apoE3-induced Akt phosphorylation, and ABCA1 protein and mRNA increase. In contrast, inhibition of Akt only diminished apoE-induced ABCA1 protein but not the mRNA level. Suppression of protein synthesis did not erase the ability of apoE3 to increase ABCA1 protein level. Further, apoE3 increased the resistance of ABCA1 protein to calpain-mediated degradation without affecting calpain activity. Treatment of macrophages with apoE3 selectively enhanced the phosphorylation of Akt1 and Akt2, but not Akt3. Knockdown of Akt1 or Akt2 increased and decreased ABCA1 protein level, respectively; while overexpression of these Akt isoenzymes caused changes in ABCA1 protein level opposite to those induced by knockdown of the corresponding Akt. These data imply that apoE3 guards against calpain-mediated ABCA1 degradation through Akt2.

  11. Demonstration of phosphoryl group transfer indicates that the ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) exhibits adenylate kinase activity.

    PubMed

    Randak, Christoph O; Ver Heul, Amanda R; Welsh, Michael J

    2012-10-19

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a membrane-spanning adenosine 5'-triphosphate (ATP)-binding cassette (ABC) transporter. ABC transporters and other nuclear and cytoplasmic ABC proteins have ATPase activity that is coupled to their biological function. Recent studies with CFTR and two nonmembrane-bound ABC proteins, the DNA repair enzyme Rad50 and a structural maintenance of chromosome (SMC) protein, challenge the model that the function of all ABC proteins depends solely on their associated ATPase activity. Patch clamp studies indicated that in the presence of physiologically relevant concentrations of adenosine 5'-monophosphate (AMP), CFTR Cl(-) channel function is coupled to adenylate kinase activity (ATP+AMP <==> 2 ADP). Work with Rad50 and SMC showed that these enzymes catalyze both ATPase and adenylate kinase reactions. However, despite the supportive electrophysiological results with CFTR, there are no biochemical data demonstrating intrinsic adenylate kinase activity of a membrane-bound ABC transporter. We developed a biochemical assay for adenylate kinase activity, in which the radioactive γ-phosphate of a nucleotide triphosphate could transfer to a photoactivatable AMP analog. UV irradiation could then trap the (32)P on the adenylate kinase. With this assay, we discovered phosphoryl group transfer that labeled CFTR, thereby demonstrating its adenylate kinase activity. Our results also suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for adenylate kinase activity. These biochemical data complement earlier biophysical studies of CFTR and indicate that the ABC transporter CFTR can function as an adenylate kinase.

  12. ATP utilization by yeast replication factor C. IV. RFC ATP-binding mutants show defects in DNA replication, DNA repair, and checkpoint regulation.

    PubMed

    Schmidt, S L; Pautz, A L; Burgers, P M

    2001-09-14

    Replication factor C is required to load proliferating cell nuclear antigen onto primer-template junctions, using the energy of ATP hydrolysis. Four of the five RFC genes have consensus ATP-binding motifs. To determine the relative importance of these sites for proper DNA metabolism in the cell, the conserved lysine in the Walker A motif of RFC1, RFC2, RFC3, or RFC4 was mutated to either arginine or glutamic acid. Arginine mutations in all RFC genes tested permitted cell growth, although poor growth was observed for rfc2-K71R. A glutamic acid substitution resulted in lethality in RFC2 and RFC3 but not in RFC1 or RFC4. Most double mutants combining mutations in two RFC genes were inviable. Except for the rfc1-K359R and rfc4-K55E mutants, which were phenotypically similar to wild type in every assay, the mutants were sensitive to DNA-damaging agents. The rfc2-K71R and rfc4-K55R mutants show checkpoint defects, most likely in the intra-S phase checkpoint. Regulation of the damage-inducible RNR3 promoter was impaired in these mutants, and phosphorylation of Rad53p in response to DNA damage was specifically defective when cells were in S phase. No dramatic defects in telomere length regulation were detected in the mutants. These data demonstrate that the ATP binding function of RFC2 is important for both DNA replication and checkpoint function and, for the first time, that RFC4 also plays a role in checkpoint regulation.

  13. Domain Interactions in the Yeast ATP Binding Cassette Transporter Ycf1p: Intragenic Suppressor Analysis of Mutations in the Nucleotide Binding Domains

    PubMed Central

    Falcón-Pérez, Juan M.; Martínez-Burgos, Mónica; Molano, Jesús; Mazón, María J.; Eraso, Pilar

    2001-01-01

    The yeast cadmium factor (Ycf1p) is a vacuolar ATP binding cassette (ABC) transporter required for heavy metal and drug detoxification. Cluster analysis shows that Ycf1p is strongly related to the human multidrug-associated protein (MRP1) and cystic fibrosis transmembrane conductance regulator and therefore may serve as an excellent model for the study of eukaryotic ABC transporter structure and function. Identifying intramolecular interactions in these transporters may help to elucidate energy transfer mechanisms during transport. To identify regions in Ycf1p that may interact to couple ATPase activity to substrate binding and/or movement across the membrane, we sought intragenic suppressors of ycf1 mutations that affect highly conserved residues presumably involved in ATP binding and/or hydrolysis. Thirteen intragenic second-site suppressors were identified for the D777N mutation which affects the invariant Asp residue in the Walker B motif of the first nucleotide binding domain (NBD1). Two of the suppressor mutations (V543I and F565L) are located in the first transmembrane domain (TMD1), nine (A1003V, A1021T, A1021V, N1027D, Q1107R, G1207D, G1207S, S1212L, and W1225C) are found within TMD2, one (S674L) is in NBD1, and another one (R1415G) is in NBD2, indicating either physical proximity or functional interactions between NBD1 and the other three domains. The original D777N mutant protein exhibits a strong defect in the apparent affinity for ATP and Vmax of transport. The phenotypic characterization of the suppressor mutants shows that suppression does not result from restoring these alterations but rather from a change in substrate specificity. We discuss the possible involvement of Asp777 in coupling ATPase activity to substrate binding and/or transport across the membrane. PMID:11466279

  14. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.

    2014-01-01

    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  15. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells

    PubMed Central

    Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  16. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells.

    PubMed

    Lara, Flavio Alves; Pohl, Paula C; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H F; Almeida, Igor C; Vaz, Itabajara da Silva; Oliveira, Pedro L

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  17. Adipocyte ATP-binding cassette G1 promotes triglyceride storage, fat mass growth, and human obesity.

    PubMed

    Frisdal, Eric; Le Lay, Soazig; Hooton, Henri; Poupel, Lucie; Olivier, Maryline; Alili, Rohia; Plengpanich, Wanee; Villard, Elise F; Gilibert, Sophie; Lhomme, Marie; Superville, Alexandre; Miftah-Alkhair, Lobna; Chapman, M John; Dallinga-Thie, Geesje M; Venteclef, Nicolas; Poitou, Christine; Tordjman, Joan; Lesnik, Philippe; Kontush, Anatol; Huby, Thierry; Dugail, Isabelle; Clement, Karine; Guerin, Maryse; Le Goff, Wilfried

    2015-03-01

    The role of the ATP-binding cassette G1 (ABCG1) transporter in human pathophysiology is still largely unknown. Indeed, beyond its role in mediating free cholesterol efflux to HDL, the ABCG1 transporter equally promotes lipid accumulation in a triglyceride (TG)-rich environment through regulation of the bioavailability of lipoprotein lipase (LPL). Because both ABCG1 and LPL are expressed in adipose tissue, we hypothesized that ABCG1 is implicated in adipocyte TG storage and therefore could be a major actor in adipose tissue fat accumulation. Silencing of Abcg1 expression by RNA interference in 3T3-L1 preadipocytes compromised LPL-dependent TG accumulation during the initial phase of differentiation. Generation of stable Abcg1 knockdown 3T3-L1 adipocytes revealed that Abcg1 deficiency reduces TG storage and diminishes lipid droplet size through inhibition of Pparγ expression. Strikingly, local inhibition of adipocyte Abcg1 in adipose tissue from mice fed a high-fat diet led to a rapid decrease of adiposity and weight gain. Analysis of two frequent ABCG1 single nucleotide polymorphisms (rs1893590 [A/C] and rs1378577 [T/G]) in morbidly obese individuals indicated that elevated ABCG1 expression in adipose tissue was associated with increased PPARγ expression and adiposity concomitant to increased fat mass and BMI (haplotype AT>GC). The critical role of ABCG1 in obesity was further confirmed in independent populations of severe obese and diabetic obese individuals. This study identifies for the first time a major role of adipocyte ABCG1 in adiposity and fat mass growth and suggests that adipose ABCG1 might represent a potential therapeutic target in obesity.

  18. Detergent-free purification of ABC (ATP-binding-cassette) transporters.

    PubMed

    Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J

    2014-07-15

    ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.

  19. Small substrate transport and mechanism of a molybdate ATP binding cassette transporter in a lipid environment.

    PubMed

    Rice, Austin J; Harrison, Alistair; Alvarez, Frances J D; Davidson, Amy L; Pinkett, Heather W

    2014-05-23

    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. ATP binding cassette transporters modulate both coelenterazine- and D-luciferin- based bioluminescence imaging

    PubMed Central

    Huang, Ruimin; Vider, Jelena; Serganova, Inna; Blasberg, Ronald G.

    2014-01-01

    Bioluminescence imaging (BLI) of luciferase reporters provides a cost-effective and sensitive means to image biological processes. However, transport of luciferase substrates across the cell membrane does affect BLI-readout-intensity from intact living cells. To investigate the effect of ATP-binding cassette (ABC) transporters on BLI readout, we generated Click Beetle-(cLuc), Firefly-(fLuc), Renilla-(rLuc), and Gaussia-(gLuc) luciferase HEK-293 reporter cells that overexpressed different ABC-transporters (ABCB1, ABCC1 and ABCG2). In vitro studies showed a significant BLI intensity decrease in intact-cells compared to cell-lysates, when ABCG2 was overexpressed in HEK-293/cLuc, fLuc, and rLuc cells. Selective ABC-transporter inhibitors were also applied. Inhibition of ABCG2 activity increased the BLI intensity >2-fold in HEK-293/cLuc, fLuc and rLuc cells; inhibition of ABCB1 elevated the BLI intensity 2-fold only in HEK-293/rLuc cells. BLI of xenografts derived from HEK-293/ABC-transporter/luciferase-reporter cells confirmed the results of inhibitor treatment in vivo. These findings demonstrate that coelenterazine-based rLuc-BLI intensity can be modulated by ABCB1 and ABCG2. ABCG2 modulates D-luciferin-based BLI in a luciferase-type-independent manner. Little ABC-transporter effect on gLuc-BLI intensity is observed since a large fraction of gLuc is secreted. The expression level of ABC-transporters is one key factor affecting BLI intensity, and this may be particularly important in luciferase-based applications in stem cell research. PMID:21496450

  1. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos

    2014-01-01

    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  2. ATP-binding cassette sterol transporters are differentially expressed in normal and diseased human gallbladder.

    PubMed

    Yoon, Jai Hoon; Choi, Ho Soon; Jun, Dae Won; Yoo, Kyo-Sang; Lee, Jin; Yang, Sun Young; Kuver, Rahul

    2013-02-01

    Gallbladder epithelial cells (GBEC) are exposed to high cholesterol concentrations in bile, and export cholesterol via an ATP-binding cassette (ABC) transporter-mediated pathway in vitro. These findings suggest that aberrant expression and/or function of ABC sterol transporters may be associated with cholesterol-related gallbladder diseases (CAGD). In this study, we investigated the relative levels of the sterol transporters ABCA1, ABCG5, and ABCG8 in human gallbladders in CAGD, and the relationship between ABCA1 and inflammation. Expression of ABCA1, ABCG5, and ABCG8 was evaluated in 31 gallbladders with CAGD and 6 normal gallbladders by western blotting and immunohistochemistry. RT-PCR was used to measure ABCA1 mRNA expression. To investigate the relationship between ABCA1 and inflammation, wWestern blots were performed on cultured dog GBEC treated with lipopolysaccharide (LPS) using an anti-ABCA1 antibody. Immunohistochemistry showed ABCA1 to be localized predominantly to the basolateral membrane, while ABCG8 formed a diffuse intracellular pattern at the apical pole of human GBEC. ABCA1 and ABCG8 expression was more prominent in GBEC that were surrounded by cholesterol-laden macrophages. ABCA1 and ABCG8 expression was increased in gallbladders with CAGD. Western blots showed increased ABCA1, ABCG5, and ABCG8 expression in CAGD. ABCA1 mRNA levels were increased in all gallbladders with CAGD. LPS treatment of cultured dog GBEC enhanced ABCA1 expression. The sterol transporters ABCA1, ABCG5, and ABCG8 may play a role in the pathogenesis of human CAGD. Inflammation appears to be a key factor that increases ABCA1 expression and activity in the human gallbladder.

  3. ATP-binding cassette transporter A7 (ABCA7) loss of function alters Alzheimer amyloid processing.

    PubMed

    Satoh, Kanayo; Abe-Dohmae, Sumiko; Yokoyama, Shinji; St George-Hyslop, Peter; Fraser, Paul E

    2015-10-02

    The ATP-binding cassette transporter A7 (ABCA7) has been identified as a susceptibility factor of late onset Alzheimer disease in genome-wide association studies. ABCA7 has been shown to mediate phagocytosis and affect membrane trafficking. The current study examined the impact of ABCA7 loss of function on amyloid precursor protein (APP) processing and generation of amyloid-β (Aβ). Suppression of endogenous ABCA7 in several different cell lines resulted in increased β-secretase cleavage and elevated Aβ. ABCA7 knock-out mice displayed an increased production of endogenous murine amyloid Aβ42 species. Crossing ABCA7-deficient animals to an APP transgenic model resulted in significant increases in the soluble Aβ as compared with mice expressing normal levels of ABCA7. Only modest changes in the amount of insoluble Aβ and amyloid plaque densities were observed once the amyloid pathology was well developed, whereas Aβ deposition was enhanced in younger animals. In vitro studies indicated a more rapid endocytosis of APP in ABCA7 knock-out cells that is mechanistically consistent with the increased Aβ production. These in vitro and in vivo findings indicate a direct role of ABCA7 in amyloid processing that may be associated with its primary biological function to regulate endocytic pathways. Several potential loss-of-function ABCA7 mutations and deletions linked to Alzheimer disease that in some instances have a greater impact than apoE allelic variants have recently been identified. A reduction in ABCA7 expression or loss of function would be predicted to increase amyloid production and that may be a contributing factor in the associated Alzheimer disease susceptibility. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. A Novel Function of Apolipoprotein E: Upregulation of ATP-Binding Cassette Transporter A1 Expression

    PubMed Central

    Yang, Hong; Zhou, Lichun; Okoro, Emmanuel U.; Guo, Zhongmao

    2011-01-01

    Despite the well known importance of apolipoprotein (Apo) E in cholesterol efflux, the effect of ApoE on the expression of ATP-binding cassette transporter A1 (ABCA1) has never been investigated. The objective of this study was to determine the effect of ApoE on ApoB-carrying lipoprotein-induced expression of ABCA1, a protein that mediates cholesterol efflux. Our data demonstrate that ApoB-carrying lipoproteins obtained from both wild-type and ApoE knockout mice induced ApoAI-mediated cholesterol efflux in mouse macrophages, which was associated with an enhanced ABCA1 promoter activity, and an increased ABCA1 mRNA and protein expression. In addition, these lipoproteins increased the level of phosphorylated specificity protein 1 (Sp1) and the amount of Sp1 bound to the ABCA1 promoter. However, all these inductions were significantly diminished in cells treated with ApoE-free lipoproteins, when compared to those treated with wild-type lipoproteins. Enrichment with human ApoE3 reversed the reduced inducibility of ApoE-free lipoproteins. Moreover, we observed that inhibition of Sp1 DNA-binding by mithramycin A diminished ABCA1 expression and ApoAI-mediated cholesterol efflux induced by ApoB-carrying lipoproteins, and that mutation of the Sp1-binding motif in the ABCA1 promoter region diminished ApoB-carrying lipoprotein-induced ABCA1 promoter activity. Collectively, these data suggest that ApoE associated with ApoB-carrying lipoproteins has an upregulatory role on ABCA1 expression, and that induction of Sp1 phosphorylation is a mechanism by which ApoE upregulates ABCA1 expression. PMID:21779326

  5. ATP binding cassette modulators control abscisic acid-regulated slow anion channels in guard cells

    PubMed Central

    Leonhardt, N; Vavasseur, A; Forestier, C

    1999-01-01

    In animal cells, ATP binding cassette (ABC) proteins are a large family of transporters that includes the sulfonylurea receptor and the cystic fibrosis transmembrane conductance regulator (CFTR). These two ABC proteins possess an ion channel activity and bind specific sulfonylureas, such as glibenclamide, but homologs have not been identified in plant cells. We recently have shown that there is an ABC protein in guard cells that is involved in the control of stomatal movements and guard cell outward K+ current. Because the CFTR, a chloride channel, is sensitive to glibenclamide and able to interact with K+ channels, we investigated its presence in guard cells. Potent CFTR inhibitors, such as glibenclamide and diphenylamine-2-carboxylic acid, triggered stomatal opening in darkness. The guard cell protoplast slow anion current that was recorded using the whole-cell patch-clamp technique was inhibited rapidly by glibenclamide in a dose-dependent manner; the concentration producing half-maximum inhibition was at 3 &mgr;M. Potassium channel openers, which bind to and act through the sulfonylurea receptor in animal cells, completely suppressed the stomatal opening induced by glibenclamide and recovered the glibenclamide-inhibited slow anion current. Abscisic acid is known to regulate slow anion channels and in our study was able to relieve glibenclamide inhibition of slow anion current. Moreover, in epidermal strip bioassays, the stomatal closure triggered by Ca2+ or abscisic acid was reversed by glibenclamide. These results suggest that the slow anion channel is an ABC protein or is tightly controlled by such a protein that interacts with the abscisic acid signal transduction pathway in guard cells. PMID:10368184

  6. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.

    PubMed

    Yang, Nuan; Driessen, Arnold J M

    2015-01-01

    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  7. Computer modelling reveals new conformers of the ATP binding loop of Na+/K+-ATPase involved in the transphosphorylation process of the sodium pump

    PubMed Central

    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm

    2017-01-01

    Hydrolysis of ATP by Na+/K+-ATPase, a P-Type ATPase, catalyzing active Na+ and K+ transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp369 to allow the transfer of ATP’s terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp369 is achieved, analogous molecular modeling of the M4–M5 loop of ATPase was performed using the crystal data of Na+/K+-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr338 and Ile760 of the α2-subunit of Na+/K+-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe475 in the N-domain, the other one close to Asp369 in the P-domain. However, binding of Mg2+•ATP to any of these sites in the “open conformation” may not lead to phosphorylation of Asp369. Additional conformations of the cytoplasmic loop were found wobbling between “open conformation” <==> “semi-open conformation <==> “closed conformation” in the absence of 2Mg2+•ATP. The cytoplasmic loop’s conformational change to the “semi-open conformation”—characterized by a hydrogen bond between Arg543 and Asp611—triggers by binding of 2Mg2+•ATP to a single ATP site and conversion to the “closed conformation” the phosphorylation of Asp369 in the P-domain, and hence the start of Na+/K+-activated ATP hydrolysis. PMID:28316890

  8. Crystal structure of the peptidase domain of Streptococcus ComA, a bifunctional ATP-binding cassette transporter involved in the quorum-sensing pathway.

    PubMed

    Ishii, Seiji; Yano, Takato; Ebihara, Akio; Okamoto, Akihiro; Manzoku, Miho; Hayashi, Hideyuki

    2010-04-02

    ComA of Streptococcus is a member of the bacteriocin-associated ATP-binding cassette transporter family and is postulated to be responsible for both the processing of the propeptide ComC and secretion of the mature quorum-sensing signal. The 150-amino acid peptidase domain (PEP) of ComA specifically recognizes an extended region of ComC that is 15 amino acids in length. It has been proposed that an amphipathic alpha-helix formed by the N-terminal leader region of ComC, as well as the Gly-Gly motif at the cleavage site, is critical for the PEP-ComC interaction. To elucidate the substrate recognition mechanism, we determined the three-dimensional crystal structure of Streptococcus mutans PEP and then constructed models for the PEP.ComC complexes. PEP had an overall structure similar to the papain-like cysteine proteases as has long been predicted. The active site was located at the bottom of a narrow cleft, which is suitable for binding the Gly-Gly motif. Together with the results from mutational experiments, a shallow hydrophobic concave surface of PEP was proposed as a site that accommodates the N-terminal helix of ComC. This dual mode of substrate recognition would provide the small PEP domain with an extremely high substrate specificity.

  9. Injection-site lesions: incidence, tissue histology, collagen concentration, and muscle tenderness in beef rounds.

    PubMed

    George, M H; Morgan, J B; Glock, R D; Tatum, J D; Schmidt, G R; Sofos, J N; Cowman, G L; Smith, G C

    1995-12-01

    The national incidence and extent of injection-site lesions in the muscles of the round were determined via audits conducted at retail stores and in purveying establishments. Two additional experiments were conducted to examine the subsequent effects of pharmaceutical administration on tissue histology, soluble and insoluble collagen concentration, and muscle tenderness in beef bottom-rounds. Injection-site lesion incidence in beef round cuts audited at retail (n = 3,538) and in steak-cutting facilities (n = 15,464) was 8.45 and 10.04%, respectively, with an average lesion-trim of 314.7 and 191.59 g, respectively, in these two studies. Lesion classification revealed that 93.20 and 99.91% of lesions reported for the retail and purveyor audits, respectively, were chronologically aged lesions. Overall, 19,002 round cuts were examined, and injection-site lesion incidence (nationally) was 9.74%, whereas lesion-trim averaged 211.8 g. Warner-Bratzler shear measurements taken near lesions and in areas 7.62 cm from the lesions were higher (P < .001) for lesioned, than for control bottom-round steaks. Warner-Bratzler shear values for lesion cores were 3.5 times greater than those in paired control (non-affected) steaks. Concentrations of insoluble and soluble collagen were much higher (P < .001) at the site of the lesion center in lesion-afflicted vs control steaks. Histological determinations of the relative proportions of muscle, connective tissue and fat to a distance of 5.08 cm from the site of the lesion center confirmed that severe disruption of muscle tissue constituents and architecture had occurred. Injection-site lesions occur at an unacceptable frequency in the muscles of the round, and severe tissue changes accompany these lesions that can dramatically affect tenderness of those cuts.

  10. ATP binding and hydrolysis-driven rate-determining events in the RFC-catalyzed PCNA clamp loading reaction.

    PubMed

    Sakato, Miho; Zhou, Yayan; Hingorani, Manju M

    2012-02-17

    The multi-subunit replication factor C (RFC) complex loads circular proliferating cell nuclear antigen (PCNA) clamps onto DNA where they serve as mobile tethers for polymerases and coordinate the functions of many other DNA metabolic proteins. The clamp loading reaction is complex, involving multiple components (RFC, PCNA, DNA, and ATP) and events (minimally: PCNA opening/closing, DNA binding/release, and ATP binding/hydrolysis) that yield a topologically linked clamp·DNA product in less than a second. Here, we report pre-steady-state measurements of several steps in the reaction catalyzed by Saccharomyces cerevisiae RFC and present a comprehensive kinetic model based on global analysis of the data. Highlights of the reaction mechanism are that ATP binding to RFC initiates slow activation of the clamp loader, enabling it to open PCNA (at ~2 s(-1)) and bind primer-template DNA (ptDNA). Rapid binding of ptDNA leads to formation of the RFC·ATP·PCNA(open)·ptDNA complex, which catalyzes a burst of ATP hydrolysis. Another slow step in the reaction follows ATP hydrolysis and is associated with PCNA closure around ptDNA (8 s(-1)). Dissociation of PCNA·ptDNA from RFC leads to catalytic turnover. We propose that these early and late rate-determining events are intramolecular conformational changes in RFC and PCNA that control clamp opening and closure, and that ATP binding and hydrolysis switch RFC between conformations with high and low affinities, respectively, for open PCNA and ptDNA, and thus bookend the clamp loading reaction.

  11. Single-molecule imaging of UvrA and UvrB recruitment to DNA lesions in living Escherichia coli

    PubMed Central

    Stracy, Mathew; Jaciuk, Marcin; Uphoff, Stephan; Kapanidis, Achillefs N.; Nowotny, Marcin; Sherratt, David J.; Zawadzki, Pawel

    2016-01-01

    Nucleotide excision repair (NER) removes chemically diverse DNA lesions in all domains of life. In Escherichia coli, UvrA and UvrB initiate NER, although the mechanistic details of how this occurs in vivo remain to be established. Here, we use single-molecule fluorescence imaging to provide a comprehensive characterization of the lesion search, recognition and verification process in living cells. We show that NER initiation involves a two-step mechanism in which UvrA scans the genome and locates DNA damage independently of UvrB. Then UvrA recruits UvrB from solution to the lesion. These steps are coordinated by ATP binding and hydrolysis in the ‘proximal' and ‘distal' UvrA ATP-binding sites. We show that initial UvrB-independent damage recognition by UvrA requires ATPase activity in the distal site only. Subsequent UvrB recruitment requires ATP hydrolysis in the proximal site. Finally, UvrA dissociates from the lesion complex, allowing UvrB to orchestrate the downstream NER reactions. PMID:27562541

  12. Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

    NASA Astrophysics Data System (ADS)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Klimanova, Elizaveta A.; Dergousova, Elena A.; Lopina, Olga D.; Makarov, Alexander A.

    2014-06-01

    Active transport of sodium and potassium ions by Na,K-ATPase is accompanied by the enzyme conformational transition between E1 and E2 states. ATP and ADP bind to Na,K-ATPase in the E1 conformation with similar affinity but the properties of enzyme in complexes with these nucleotides are different. We have studied thermodynamics of Na,K-ATPase binding with adenine nucleotides at different temperatures using isothermal titration calorimetry. Our data indicate that β-phosphate is involved in complex formation by increasing the affinity of adenine nucleotides to Na,K-ATPase by an order of magnitude, while γ-phosphate does not affect it. ATP binding to Na,K-ATPase in contrast to ADP binding generates a structural transition in the enzyme, which is consistent with the movement of a significant portion of the surface area to a solvent-protected state. We propose that ATP binding leads to convergence of the nucleotide-binding and phosphorylation domains transferring the enzyme from the ``E1-open'' to ``E1-closed'' conformation ready for phosphorylation.

  13. Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics.

    PubMed

    Pan, Lurong; Aller, Stephen G

    2015-01-20

    P-glycoprotein (Pgp) is an ATP-binding cassette (ABC) transporter that alternates between inward- and outward-facing conformations to capture and force substrates out of cells like a peristaltic pump. The high degree of similarity in outward-facing structures across evolution of ABC transporters allowed construction of a high-confidence outward-facing Pgp atomic model based on crystal structures of outward-facing Sav1866 and inward-facing Pgp. The model adhered to previous experimentally determined secondary- and tertiary- configurations during all-atom molecular dynamics simulations in the presence or absence of MgATP. Three long lasting (>100 ns) meta-stable states were apparent in the presence of MgATP revealing new insights into alternating access. The two ATP-binding pockets are highly asymmetric resulting in differential control of overall structural dynamics and allosteric regulation of the drug-binding pocket. Equilibrated Pgp has a considerably different electrostatic profile compared to Sav1866 that implicates significant kinetic and thermodynamic differences in transport mechanisms.

  14. In vitro reassembly of the ribose ATP-binding cassette transporter reveals a distinct set of transport complexes.

    PubMed

    Clifton, Matthew C; Simon, Michael J; Erramilli, Satchal K; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A; Stauffacher, Cynthia V

    2015-02-27

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg(2+). We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg(2+), and VO4); a RbsAC complex in the presence of ADP and Mg(2+); and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters.

  15. Cloning and Iron Transportation of Nucleotide Binding Domain of Cryptosporidium andersoni ATP-Binding Cassette (CaABC) Gene.

    PubMed

    Wang, Ju-Hua; Xue, Xiu-Heng; Zhou, Jie; Fan, Cai-Yun; Xie, Qian-Qian; Wang, Pan

    2015-06-01

    Cryptosporidium andersoni ATP-binding cassette (CaABC) is an important membrane protein involved in substrate transport across the membrane. In this research, the nucleotide binding domain (NBD) of CaABC gene was amplified by PCR, and the eukaryotic expression vector of pEGFP-C1-CaNBD was reconstructed. Then, the recombinant plasmid of pEGFP-C1-CaNBD was transformed into the mouse intestinal epithelial cells (IECs) to study the iron transportation function of CaABC. The results indicated that NBD region of CaABC gene can significantly elevate the transport efficiency of Ca(2+), Mg(2+), K(+), and HCO3 (-) in IECs (P<0.05). The significance of this study is to find the ATPase inhibitors for NBD region of CaABC gene and to inhibit ATP binding and nutrient transport of CaABC transporter. Thus, C. andersoni will be killed by inhibition of nutrient uptake. This will open up a new way for treatment of cryptosporidiosis.

  16. Lobular Distribution and Variability in Hepatic ATP Binding Cassette Protein B1 (ABCB1, P-gp): Ontogenetic Differences and Potential for Toxicity

    PubMed Central

    Abanda, Ngu Njei; Riches, Zoe; Collier, Abby C.

    2017-01-01

    The ATP Binding Cassette B1 (ABCB1) transporter has critical roles in endo- and xenobiotic efficacy and toxicity. To understand population variability in hepatic transport we determined ABCB1 mRNA and protein levels in total liver lysates sampled from 8 pre-defined sites (n = 24, 18–69 years), and in S9 from randomly acquired samples (n = 87, 7 days–87 years). ABCB1 levels did not differ significantly throughout individual livers and showed 4.4-fold protein variation between subjects. Neither mRNA nor protein levels varied with sex, ethnicity, obesity or triglycerides in lysates or S9 (that showed the same relationships), but protein levels were lower in pediatric S9 (p < 0.0001), with 76% of adult ABCB1 present at birth and predicted to mature in 5 years. Pediatric total liver lysates were not available. In summary, opportunistic collection for studying human hepatic ABCB1 is acceptable. Additionally, ABCB1 may be lower in children, indicating differential potential for toxicity and response to therapy in this special population. PMID:28218636

  17. ATP-binding cassette and multidrug and toxic compound extrusion transporters in plants: a common theme among diverse detoxification mechanisms.

    PubMed

    Shoji, Tsubasa

    2014-01-01

    Plants have developed elaborate detoxification mechanisms to cope with a large number of potentially toxic compounds, which include exogenous xenobiotics and endogenous metabolites, especially secondary metabolites. After enzymatic modification or synthesis, such compounds are transported and accumulated in apoplastic cell walls or central vacuoles in plant cells. Membrane transporters actively catalyze translocation of a diverse range of these compounds across various membranes within cells. Biochemical, molecular, and genetic studies have begun to reveal functions of a handful of ATP-binding cassette and multidrug and toxic compound extrusion family transporters engaged in transport of organic xenobiotics, heavy metals, metalloids, aluminum, alkaloids, flavonoids, terpenoids, terpenoid-derived phytohormones, cuticle lipids, and monolignols in plants. This detoxification versatility and metabolic diversity may underlie the functional diversification in plants of these families of transporters, which are largely involved in multidrug resistance in microorganisms and animals. © 2014 Elsevier Inc. All rights reserved.

  18. Repositioning of Tyrosine Kinase Inhibitors as Antagonists of ATP-Binding Cassette Transporters in Anticancer Drug Resistance

    PubMed Central

    Wang, Yi-Jun; Zhang, Yun-Kai; Kathawala, Rishil J.; Chen, Zhe-Sheng

    2014-01-01

    The phenomenon of multidrug resistance (MDR) has attenuated the efficacy of anticancer drugs and the possibility of successful cancer chemotherapy. ATP-binding cassette (ABC) transporters play an essential role in mediating MDR in cancer cells by increasing efflux of drugs from cancer cells, hence reducing the intracellular accumulation of chemotherapeutic drugs. Interestingly, small-molecule tyrosine kinase inhibitors (TKIs), such as AST1306, lapatinib, linsitinib, masitinib, motesanib, nilotinib, telatinib and WHI-P154, have been found to have the capability to overcome anticancer drug resistance by inhibiting ABC transporters in recent years. This review will focus on some of the latest and clinical developments with ABC transporters, TKIs and anticancer drug resistance. PMID:25268163

  19. Simulation of the coupling between nucleotide binding and transmembrane domains in the ATP binding cassette transporter BtuCD.

    PubMed

    Sonne, Jacob; Kandt, Christian; Peters, Günther H; Hansen, Flemming Y; Jensen, Morten Ø; Tieleman, D Peter

    2007-04-15

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B(12) importer BtuCD using perturbed elastic network calculations and biased molecular dynamics simulations. Both models predict that nucleotide release decreases the tilt between the two transmembrane domains and opens the cytoplasmic gate. Nucleotide binding has the opposite effect. The observed coupling may be relevant for all ABC transporters because of the conservation of nucleotide binding domains and the shared role of ATP in ABC transporters. The rearrangements in the cytoplasmic gate region do not provide enough space for B(12) to diffuse from the transporter pore into the cytoplasm, which could suggest that peristaltic forces are needed to exclude B(12) from the transporter pore.

  20. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.

    2009-01-01

    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  1. In Vitro Reassembly of the Ribose ATP-binding Cassette Transporter Reveals a Distinct Set of Transport Complexes*

    PubMed Central

    Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.

    2015-01-01

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465

  2. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard

    2012-01-01

    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg−1 min−1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ∼1 and 0.01 s−1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm−1), ADP (1101 and 1205 cm−1), and free phosphate (1078 cm−1). Cleavage of the β-phosphate–γ-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  3. LrABCF1, a GCN-type ATP-binding cassette transporter from Lilium regale, is involved in defense responses against viral and fungal pathogens

    USDA-ARS?s Scientific Manuscript database

    ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...

  4. Regulation of ATP-binding cassette transporters and cholesterol efflux by glucose in primary human monocytes and murine bone marrow-derived macrophages

    USDA-ARS?s Scientific Manuscript database

    Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...

  5. ATP binding by the P-loop NTPase OsYchF1 (an unconventional G protein) contributes to biotic but not abiotic stress responses

    PubMed Central

    Cheung, Ming-Yan; Li, Xiaorong; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yung, Yuk-Lin; Yu, Mei-Hui; Wong, Kam-Bo; Lam, Hon-Ming

    2016-01-01

    G proteins are involved in almost all aspects of the cellular regulatory pathways through their ability to bind and hydrolyze GTP. The YchF subfamily, interestingly, possesses the unique ability to bind both ATP and GTP, and is possibly an ancestral form of G proteins based on phylogenetic studies and is present in all kingdoms of life. However, the biological significance of such a relaxed ligand specificity has long eluded researchers. Here, we have elucidated the different conformational changes caused by the binding of a YchF homolog in rice (OsYchF1) to ATP versus GTP by X-ray crystallography. Furthermore, by comparing the 3D relationships of the ligand position and the various amino acid residues at the binding sites in the crystal structures of the apo-bound and ligand-bound versions, a mechanism for the protein’s ability to bind both ligands is revealed. Mutation of the noncanonical G4 motif of the OsYchF1 to the canonical sequence for GTP specificity precludes the binding/hydrolysis of ATP and prevents OsYchF1 from functioning as a negative regulator of plant-defense responses, while retaining its ability to bind/hydrolyze GTP and its function as a negative regulator of abiotic stress responses, demonstrating the specific role of ATP-binding/hydrolysis in disease resistance. This discovery will have a significant impact on our understanding of the structure–function relationships of the YchF subfamily of G proteins in all kingdoms of life. PMID:26912459

  6. Human Immunodeficiency Virus Protease Inhibitors Interact with ATP Binding Cassette Transporter 4/Multidrug Resistance Protein 4: A Basis for Unanticipated Enhanced Cytotoxicity

    PubMed Central

    Fukuda, Yu; Takenaka, Kazumasa; Sparreboom, Alex; Cheepala, Satish B.; Wu, Chung-Pu; Ekins, Sean; Ambudkar, Suresh V.

    2013-01-01

    Human immunodeficiency virus (HIV) pharmacotherapy, by combining different drug classes such as nucleoside analogs and HIV protease inhibitors (PIs), has increased HIV-patient life expectancy. Consequently, among these patients, an increase in non-HIV–associated cancers has produced a patient cohort requiring both HIV and cancer chemotherapy. We hypothesized that multidrug resistance protein 4/ATP binding cassette transporter 4 (MRP4/ABCC4), a widely expressed transporter of nucleoside-based antiviral medications as well as cancer therapeutics might interact with PIs. Among the PIs evaluated (nelfinavir, ritonavir, amprenavir, saquinavir, and indinavir), only nelfinavir both effectively stimulated MRP4 ATPase activity and inhibited substrate-stimulated ATPase activity. Saos2 and human embryonic kidney 293 cells engineered to overexpress MRP4 were then used to assess transport and cytotoxicity. MRP4 expression reduced intracellular accumulation of nelfinavir and consequently conferred survival advantage to nelfinavir cytotoxicity. Nelfinavir blocked Mrp4-mediated export, which is consistent with its ability to increase the sensitivity of MRP4-expressing cells to methotrexate. In contrast, targeted inactivation of Abcc4/Mrp4 in mouse cells specifically enhanced nelfinavir and 9-(2-phosphonylmethoxyethyl) adenine cytotoxicity. These results suggest that nelfinavir is both an inhibitor and substrate of MRP4. Because nelfinavir is a new MRP4/ABCC4 substrate, we developed a MRP4/ABCC4 pharmacophore model, which showed that the nelfinavir binding site is shared with chemotherapeutic substrates such as adefovir and methotrexate. Our studies reveal, for the first time, that nelfinavir, a potent and cytotoxic PI, is both a substrate and inhibitor of MRP4. These findings suggest that HIV-infected cancer patients receiving nelfinavir might experience both enhanced antitumor efficacy and unexpected adverse toxicity given the role of MRP4/ABCC4 in exporting nucleoside

  7. Polycyclic aromatic hydrocarbons (PAHs) mediate transcriptional activation of the ATP binding cassette transporter ABCB6 gene via the aryl hydrocarbon receptor (AhR).

    PubMed

    Chavan, Hemantkumar; Krishnamurthy, Partha

    2012-09-14

    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics.

  8. Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways1[OPEN

    PubMed Central

    Lu, Xunli; Dittgen, Jan; Piślewska-Bednarek, Mariola; Molina, Antonio; Schneider, Bernd; Doubský, Jan; Schneeberger, Korbinian; Schulze-Lefert, Paul

    2015-01-01

    Arabidopsis (Arabidopsis thaliana) PENETRATION (PEN) genes quantitatively contribute to the execution of different forms of plant immunity upon challenge with diverse leaf pathogens. PEN3 encodes a plasma membrane-resident pleiotropic drug resistance-type ATP-binding cassette transporter and is thought to act in a pathogen-inducible and PEN2 myrosinase-dependent metabolic pathway in extracellular defense. This metabolic pathway directs the intracellular biosynthesis and activation of tryptophan-derived indole glucosinolates for subsequent PEN3-mediated efflux across the plasma membrane at pathogen contact sites. However, PEN3 also functions in abiotic stress responses to cadmium and indole-3-butyric acid (IBA)-mediated auxin homeostasis in roots, raising the possibility that PEN3 exports multiple functionally unrelated substrates. Here, we describe the isolation of a pen3 allele, designated pen3-5, that encodes a dysfunctional protein that accumulates in planta like wild-type PEN3. The specific mutation in pen3-5 uncouples PEN3 functions in IBA-stimulated root growth modulation, callose deposition induced with a conserved peptide epitope of bacterial flagellin (flg22), and pathogen-inducible salicylic acid accumulation from PEN3 activity in extracellular defense, indicating the engagement of multiple PEN3 substrates in different PEN3-dependent biological processes. We identified 4-O-β-d-glucosyl-indol-3-yl formamide (4OGlcI3F) as a pathogen-inducible, tryptophan-derived compound that overaccumulates in pen3 leaf tissue and has biosynthesis that is dependent on an intact PEN2 metabolic pathway. We propose that a precursor of 4OGlcI3F is the PEN3 substrate in extracellular pathogen defense. These precursors, the shared indole core present in IBA and 4OGlcI3F, and allele-specific uncoupling of a subset of PEN3 functions suggest that PEN3 transports distinct indole-type metabolites in distinct biological processes. PMID:26023163

  9. Polycyclic Aromatic Hydrocarbons (PAHs) Mediate Transcriptional Activation of the ATP Binding Cassette Transporter ABCB6 Gene via the Aryl Hydrocarbon Receptor (AhR)*

    PubMed Central

    Chavan, Hemantkumar; Krishnamurthy, Partha

    2012-01-01

    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics. PMID:22761424

  10. The PAL1 gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae

    PubMed Central

    1996-01-01

    The PAL1 gene was isolated using PCR and degenerate oligonucleotide primers corresponding to highly conserved amino acid sequence motifs diagnostic of the ATP-binding cassette domain of the superfamily of membrane-bound transport proteins typified by mammalian multidrug resistance transporter 1 and Saccharomyces cerevisiae Ste6. The deduced PAL1 gene product is similar in length to, has the same predicted topology as, and shares the highest degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP- binding cassette transporters thought to be constituents of the peroxisomal membrane. As judged by hybridization of a PAL1 probe to isolated RNA and by expression of a PAL1-lacZ fusion, a PAL1 transcript was only detectable when cells were grown on oleic acid, a carbon source which requires the biogenesis of functional peroxisomes for its metabolism. A pal1delta mutant grew normally on either glucose- or glycerol-containing media; however, unlike PAL1+ cells (or the pal1delta mutant carrying the PAL1 gene on a plasmid), pal1delta cells were unable to grow on either a solid medium or a liquid medium containing oleic acid as the sole carbon source. Antibodies raised against a chimeric protein in which the COOH-terminal domain of Pal1 was fused to glutathione S-transferase specifically recognized a protein in extracts from wild-type cells only when grown on oleic acid; this species represents the PAL1 gene product because it was missing in pal1delta cells and more abundant in pal1delta cells expressing PAL1 from a multicopy plasmid. The Pal1 polypeptide was highly enriched in the organellar pellet fraction prepared from wild-type cells by differential centrifugation and comigrated upon velocity sedimentation in a Nycodenz gradient with a known component of the peroxisomal matrix, e-oxoacyl-CoA thiolase. As judged by both subcellular fractionation and indirect

  11. Fructose Uptake in Sinorhizobium meliloti Is Mediated by a High-Affinity ATP-Binding Cassette Transport System

    PubMed Central

    Lambert, Annie; Østerås, Magne; Mandon, Karine; Poggi, Marie-Christine; Le Rudulier, Daniel

    2001-01-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (Km of 6 μM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  12. Fructose uptake in Sinorhizobium meliloti is mediated by a high-affinity ATP-binding cassette transport system.

    PubMed

    Lambert, A; Østerås, M; Mandon, K; Poggi, M C; Le Rudulier, D

    2001-08-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (K(m) of 6 microM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  13. An Operon for a Putative ATP-Binding Cassette Transport System Involved in Acetoin Utilization of Bacillus subtilis

    PubMed Central

    Yoshida, Ken-Ichi; Fujita, Yasutaro; Ehrlich, S. Dusko

    2000-01-01

    The ytrABCDEF operon of Bacillus subtilis was deduced to encode a putative ATP-binding cassette (ABC) transport system. YtrB and YtrE could be the ABC subunits, and YtrC and YtrD are highly hydrophobic and could form a channel through the cell membrane, while YtrF could be a periplasmic lipoprotein for substrate binding. Expression of the operon was examined in cells grown in a minimal medium. The results indicate that the expression was induced only early in the stationary phase. The six ytr genes form a single operon, transcribed from a putative ςA-dependent promoter present upstream of ytrA. YtrA, which possesses a helix-turn-helix motif of the GntR family, acts probably as a repressor and regulates its own transcription. Inactivation of the operon led to a decrease in maximum cell yield and less-efficient sporulation, suggesting its involvement in the growth in stationary phase and sporulation. It is known that B. subtilis produces acetoin as an external carbon storage compound and then reuses it later during stationary phase and sporulation. When either the entire ytr operon or its last gene, ytrF, was inactivated, the production of acetoin was not affected, but the reuse of acetoin became less efficient. We suggest that the Ytr transport system plays a role in acetoin utilization during stationary phase and sporulation. PMID:10986249

  14. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.

    PubMed

    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou

    2012-07-01

    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  15. A Saccharomyces cerevisiae homolog of the human adrenoleukodystrophy transporter is a heterodimer of two half ATP-binding cassette transporters.

    PubMed Central

    Shani, N; Valle, D

    1996-01-01

    The adrenoleukodystrophy protein (ALDP) and the 70-kDa peroxisomal membrane protein (PMP70) are half ATP-binding cassette (ABC) transporters in the human peroxisome membrane. ALDP and PMP70 share sequence homology and both are implicated in genetic diseases. PXA1 and YKL741 are Saccharomyces cerevisiae genes that encode homologs of ALDP and PMP70. Pxa1p, a putative ortholog of ALDP, is involved in peroxisomal beta-oxidation of fatty acids while YKL741 is an open reading frame found by the yeast genome sequencing project. Here we designate YKL741 as PXA2 and show that its protein product, Pxa2p, like Pxa1p, is associated with peroxisomes but not required for their assembly. Yeast strains carrying gene disruption of PXA1, PXA2, or both have similar and, in the case of the latter, nonadditive phenotypes. We also find that the stability of Pxa1p, but not Pxa2p, is markedly reduced in the absence of the other. Finally, we find that Pxa1p and Pxa2p coimmuno-precipitate. These genetic and physical data suggest that Pxa1p and Pxa2p heterodimerize to form a complete peroxisomal ABC transporter involved in fatty acid beta-oxidation. This result predicts the presence of similar heterodimeric ABC transporters in the mammalian peroxisome membrane. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8876235

  16. Multiple ATP-binding cassette transporters are involved in insecticide resistance in the small brown planthopper, Laodelphax striatellus.

    PubMed

    Sun, H; Pu, J; Chen, F; Wang, J; Han, Z

    2017-03-16

    ATP-binding cassette (ABC) transporters are membrane-bound proteins involved in the movement of various substrates, including drugs and insecticides, across the lipid membrane. Demonstration of the role of human ABC transporters in multidrug resistance has led to speculation that they might be an important mechanism controlling the fate of insecticides in insects. However, the role of ABC transporters in insects remains largely unknown. The small brown planthopper, Laodelphax striatellus Fallén, has developed resistance to most of the insecticides used for its control. Our goals were to identify the ABC transporters in La. striatellus and to examine their involvement in resistance mechanisms, using related strains resistant to chlorpyrifos, deltamethrin and imidacloprid, compared with the susceptible strain. Based on the transcriptome of La. striatellus, 40 full-length ABC transporters belonging to the ABCA-ABCH subfamilies were identified. Quantitative PCR revealed that over 20% of genes were significantly up-regulated in different resistant strains, and eight genes from the ABCB/C/D/G subfamilies were up-regulated in all three resistant strains, compared with the susceptible strain. Furthermore, synergism studies showed verapamil significantly enhanced insecticide toxicity in various resistant strains but not in the susceptible strain. These results suggest that ABC transporters might be involved in resistance to multiple insecticides in La. striatellus.

  17. Simulated microgravity alters the expression of cytoskeleton- and ATP-binding-related genes in MLO-Y4 osteocytes

    NASA Astrophysics Data System (ADS)

    Chen, Zhihao; Zhao, Fan; Qi, Yiduo; Hu, Lifang; Li, Dijie; Yin, Chong; Su, Peihong; Zhang, Yan; Ma, Jianhua; Qian, Jing; Zhou, Hongpo; Zou, Yiwei; Qian, Airong

    2016-12-01

    Bone undergoes dynamic modelling and remodelling processes, and it requires gravity-mediated mechanical stimulation for the maintenance of mineral content and structure. Osteocytes are the most commonly found cells in the mature bone, and they are sensitive to mechanical changes. The purpose of this study was to investigate the effects of microgravity simulated with a random position machine (RPM) on the gene expression profile of osteocytes. Genes sensitive to RPM treatment were sorted on the basis of biological processes, interactions and signalling pathways. Overall, 504 differentially expressed genes (DEGs) in osteocytes cultured under RPM conditions were found. The DEGs were further analysed using bioinformatics tools such as DAVID and iReport. A total of 15 ATP-binding and cytoskeleton-related genes were further confirmed by quantitative real-time PCR (qRT-PCR). Our findings demonstrate that the RPM affected the expression of genes involved in cytoskeleton remodelling and the energy-transfer process in osteocytes. The identification of mechanosensitive genes may enhance our understanding of the roles of osteocytes in mechanosensation and may provide some potential targets for preventing and treating bone-related diseases.

  18. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.

    PubMed

    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang

    2013-08-01

    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  19. Linsitinib (OSI-906) antagonizes ATP-binding cassette subfamily G member 2 and subfamily C member 10-mediated drug resistance.

    PubMed

    Zhang, Hui; Kathawala, Rishil J; Wang, Yi-Jun; Zhang, Yun-Kai; Patel, Atish; Shukla, Suneet; Robey, Robert W; Talele, Tanaji T; Ashby, Charles R; Ambudkar, Suresh V; Bates, Susan E; Fu, Li-Wu; Chen, Zhe-Sheng

    2014-06-01

    In this study we investigated the effect of linsitinib on the reversal of multidrug resistance (MDR) mediated by the overexpression of the ATP-binding cassette (ABC) subfamily members ABCB1, ABCG2, ABCC1 and ABCC10. Our results indicate for the first time that linsitinib significantly potentiate the effect of anti-neoplastic drugs mitoxantrone (MX) and SN-38 in ABCG2-overexpressing cells; paclitaxel, docetaxel and vinblastine in ABCC10-overexpressing cells. Linsitinib moderately enhanced the cytotoxicity of vincristine in cell lines overexpressing ABCB1, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, linsitinib significantly increased the intracellular accumulation and decreased the efflux of [(3)H]-MX in ABCG2-overexpressing cells and [(3)H]-paclitaxel in ABCC10-overexpressing cells. However, linsitinib, at a concentration that reversed MDR, did not significantly alter the expression levels of either the ABCG2 or ABCC10 transporter proteins. Furthermore, linsitinib did not significantly alter the intracellular localization of ABCG2 or ABCC10. Moreover, linsitinib stimulated the ATPase activity of ABCG2 in a concentration-dependent manner. Overall, our study suggests that linsitinib attenuates ABCG2- and ABCC10-mediated MDR by directly inhibiting their function as opposed to altering ABCG2 or ABCC10 protein expression.

  20. An operon for a putative ATP-binding cassette transport system involved in acetoin utilization of Bacillus subtilis.

    PubMed

    Yoshida, K I; Fujita, Y; Ehrlich, S D

    2000-10-01

    The ytrABCDEF operon of Bacillus subtilis was deduced to encode a putative ATP-binding cassette (ABC) transport system. YtrB and YtrE could be the ABC subunits, and YtrC and YtrD are highly hydrophobic and could form a channel through the cell membrane, while YtrF could be a periplasmic lipoprotein for substrate binding. Expression of the operon was examined in cells grown in a minimal medium. The results indicate that the expression was induced only early in the stationary phase. The six ytr genes form a single operon, transcribed from a putative sigma(A)-dependent promoter present upstream of ytrA. YtrA, which possesses a helix-turn-helix motif of the GntR family, acts probably as a repressor and regulates its own transcription. Inactivation of the operon led to a decrease in maximum cell yield and less-efficient sporulation, suggesting its involvement in the growth in stationary phase and sporulation. It is known that B. subtilis produces acetoin as an external carbon storage compound and then reuses it later during stationary phase and sporulation. When either the entire ytr operon or its last gene, ytrF, was inactivated, the production of acetoin was not affected, but the reuse of acetoin became less efficient. We suggest that the Ytr transport system plays a role in acetoin utilization during stationary phase and sporulation.

  1. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W

    1992-01-01

    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  2. ABCC1, an ATP Binding Cassette Protein from Grape Berry, Transports Anthocyanidin 3-O-Glucosides[W][OA

    PubMed Central

    Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka

    2013-01-01

    Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325

  3. The ATP-binding cassette transporter-2 (ABCA2) regulates esterification of plasma membrane cholesterol by modulation of sphingolipid metabolism.

    PubMed

    Davis, Warren

    2014-01-01

    The ATP-binding cassette transporters are a large family (~48 genes divided into seven families A-G) of proteins that utilize the energy of ATP-hydrolysis to pump substrates across lipid bilayers against a concentration gradient. The ABC "A" subfamily is comprised of 13 members and transport sterols, phospholipids and bile acids. ABCA2 is the most abundant ABC transporter in human and rodent brain with highest expression in oligodendrocytes, although it is also expressed in neurons. Several groups have studied a possible connection between ABCA2 and Alzheimer's disease as well as early atherosclerosis. ABCA2 expression levels have been associated with changes in cholesterol and sphingolipid metabolism. In this paper, we hypothesized that ABCA2 expression level may regulate esterification of plasma membrane-derived cholesterol by modulation of sphingolipid metabolism. ABCA2 overexpression in N2a neuroblastoma cells was associated with an altered bilayer distribution of the sphingolipid ceramide that inhibited acylCoA:cholesterol acyltransferase (ACAT) activity and cholesterol esterification. In contrast, depletion of endogenous ABCA2 in the rat schwannoma cell line D6P2T increased esterification of plasma membrane cholesterol following treatment with exogenous bacterial sphingomyelinase. These findings suggest that control of ABCA2 expression level may be a key locus of regulation for esterification of plasma membrane-derived cholesterol through modulation of sphingolipid metabolism.

  4. Citrulline increases cholesterol efflux from macrophages in vitro and ex vivo via ATP-binding cassette transporters

    PubMed Central

    Uto-Kondo, Harumi; Ayaori, Makoto; Nakaya, Kazuhiro; Takiguchi, Shunichi; Yakushiji, Emi; Ogura, Masatsune; Terao, Yoshio; Ozasa, Hideki; Sasaki, Makoto; Komatsu, Tomohiro; Sotherden, Grace Megumi; Hosoai, Tamaki; Sakurada, Masami; Ikewaki, Katsunori

    2014-01-01

    Reverse cholesterol transport (RCT) is a mechanism critical to the anti-atherogenic property of HDL. Although citrulline contributes to the amelioration of atherosclerosis via endothelial nitric oxide production, it remains unclear whether it affects RCT. This study was undertaken to clarify the effects of citrulline on expressions of specific transporters such as ATP binding cassette transporters (ABC)A1 and ABCG1, and the cholesterol efflux from macrophages to apolipoprotein (apo) A-I or HDL in vitro and ex vivo. Citrulline increased ABCA1 and ABCG1 mRNA and protein levels in THP-1 macrophages, translating into enhanced apoA-I- and HDL-mediated cholesterol efflux. In the human crossover study, 8 healthy male volunteers (age 30–49 years) consumed either 3.2 g/day citrulline or placebo for 1 week. Citrulline consumption brought about significant increases in plasma levels of citrulline and arginine. Supporting the in vitro data, monocyte-derived macrophages (MDM) differentiated under autologous post-citrulline sera demonstrated enhancement of both apoA-I- and HDL-mediated cholesterol efflux through increased ABCA1 and ABCG1 expressions, compared to MDM differentiated under pre-citrulline sera. However, the placebo did not modulate these parameters. Therefore, in addition to improving endothelium function, citrulline might have an anti-atherogenic property by increasing RCT of HDL. PMID:25120277

  5. HMG-CoA reductase inhibitors enhance phagocytosis by upregulating ATP-binding cassette transporter A7

    PubMed Central

    Tanaka, Nobukiyo; Abe-Dohmae, Sumiko; Iwamoto, Noriyuki; Fitzgerald, Michael L.; Yokoyama, Shinji

    2011-01-01

    We recently reported that the endogenous ATP-binding cassette transporter (ABC) A7 strongly associates with phagocytosis, being regulated by sterol regulatory element binding protein 2. We therefore examined the effect of statins on phagocytosis in vitro and in vivo through the SREBP-ABCA7. Phagocytosis was found to be enhanced by pravastatin, rosuvastatin and simvastatin and cyclodextrin in J774 macrophages, as cellular cholesterol was reduced and expressions of the cholesterol-related genes were modulated, including an increase of ABCA7 mRNA and decrease of ABCA1 mRNA. Conversely, knock-down of ABCA7 expression by siRNA ablated enhancement of phagocytosis by statins. In vivo, pravastatin enhanced phagocytosis in wild-type mice, but not in ABCA7-knockout mice. We thus concluded that statins enhance phagocytosis through the SREBP-ABCA7 pathway. These findings provide a molecular basis for enhancement of the host-defense system by statins showing that one of their “pleiotropic” effects is in fact achieved through their reaction to a primary target. PMID:21762915

  6. Helical apolipoproteins stabilize ATP-binding cassette transporter A1 by protecting it from thiol protease-mediated degradation.

    PubMed

    Arakawa, Reijiro; Yokoyama, Shinji

    2002-06-21

    ATP-binding cassette transporter (ABC) A1 was increased by apolipoprotein A-I without an increase of its message in THP-1 cells. The pulse label study demonstrated that apoA-I retarded degradation of ABCA1. Similar changes were demonstrated by apoA-II, but the effect of high density lipoprotein was almost negligible on the basis of equivalent protein concentration. Thiol protease inhibitors (leupeptin and N-acetyl-Leu-Leu-norleucinal (ALLN)) increased ABCA1 and slowed its decay in the cells, whereas none of the proteosome-specific inhibitor lactacystin, other protease inhibitors, or the lysosomal inhibitor NH(4)Cl showed such effects. The effects of apoA-I and ALLN were additive for the increase of ABCA1, and the apoA-I-mediated cellular lipid release was enhanced by ALLN. The data suggest that ABCA1 is rapidly degraded by a thiol protease(s) in the cells unless helical apolipoproteins in their lipid-free form stabilize ABCA1 by protecting it from protease-mediated degradation.

  7. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    SciTech Connect

    Kerem, B.; Zielenski, J.; Markiewicz, D.; Bozon, D.; Kennedy, D.; Rommens, J.M. ); Gazit, E. ); Yahav, J. ); Riordan, J.R. ); Collins, F.S. ); Tsui, Lapchee Univ. of Toronto, Ontario )

    1990-11-01

    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probably affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.

  8. A critical role of a carboxylate in proton conduction by the ATP-binding cassette multidrug transporter LmrA.

    PubMed

    Shilling, Richard; Federici, Luca; Walas, Fabien; Venter, Henrietta; Velamakanni, Saroj; Woebking, Barbara; Balakrishnan, Lekshmy; Luisi, Ben; van Veen, Hendrik W

    2005-10-01

    The ATP binding cassette (ABC) transporter LmrA from the bacterium Lactococcus lactis is a homolog of the human multidrug resistance P-glycoprotein (ABCB1), the activity of which impairs the efficacy of chemotherapy. In a previous study, LmrA was shown to mediate ethidium efflux by an ATP-dependent proton-ethidium symport reaction in which the carboxylate E314 is critical. The functional importance of this key residue for ABC proteins was suggested by its conservation in a wider family of related transporters; however, the structural basis of its role was not apparent. Here, we have used homology modeling to define the structural environment of E314. The residue is nested in a hydrophobic environment that probably elevates its pKa, accounting for the pH dependency of drug efflux that we report in this work. Functional analyses of wild-type and mutant proteins in cells and proteoliposomes support our proposal for the mechanistic role of E314 in proton-coupled ethidium transport. As the carboxylate is known to participate in proton translocation by secondary-active transporters, our observations suggest that this substituent can play a similar role in the activity of ABC transporters.

  9. ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages.

    PubMed

    Jehle, Andreas W; Gardai, Shyra J; Li, Suzhao; Linsel-Nitschke, Patrick; Morimoto, Konosuke; Janssen, William J; Vandivier, R William; Wang, Nan; Greenberg, Steven; Dale, Benjamin M; Qin, Chunbo; Henson, Peter M; Tall, Alan R

    2006-08-14

    The mammalian ATP-binding cassette transporters A1 and A7 (ABCA1 and -A7) show sequence similarity to CED-7, a Caenorhabditis elegans gene that mediates the clearance of apoptotic cells. Using RNA interference or gene targeting, we show that knock down of macrophage ABCA7 but not -A1 results in defective engulfment of apoptotic cells. In response to apoptotic cells, ABCA7 moves to the macrophage cell surface and colocalizes with the low-density lipoprotein receptor-related protein 1 (LRP1) in phagocytic cups. The cell surface localization of ABCA7 and LRP1 is defective in ABCA7-deficient cells. C1q is an opsonin of apoptotic cells that acts via phagocyte LRP1 to induce extracellular signal-regulated kinase (ERK) signaling. We show that ERK signaling is required for phagocytosis of apoptotic cells and that ERK phosphorylation in response to apoptotic cells or C1q is defective in ABCA7-deficient cells. These studies reveal a major role of ABCA7 and not -A1 in the clearance of apoptotic cells and therefore suggest that ABCA7 is an authentic orthologue of CED-7.

  10. ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages

    PubMed Central

    Jehle, Andreas W.; Gardai, Shyra J.; Li, Suzhao; Linsel-Nitschke, Patrick; Morimoto, Konosuke; Janssen, William J.; Vandivier, R. William; Wang, Nan; Greenberg, Steven; Dale, Benjamin M.; Qin, Chunbo; Henson, Peter M.; Tall, Alan R.

    2006-01-01

    The mammalian ATP-binding cassette transporters A1 and A7 (ABCA1 and -A7) show sequence similarity to CED-7, a Caenorhabditis elegans gene that mediates the clearance of apoptotic cells. Using RNA interference or gene targeting, we show that knock down of macrophage ABCA7 but not -A1 results in defective engulfment of apoptotic cells. In response to apoptotic cells, ABCA7 moves to the macrophage cell surface and colocalizes with the low-density lipoprotein receptor–related protein 1 (LRP1) in phagocytic cups. The cell surface localization of ABCA7 and LRP1 is defective in ABCA7-deficient cells. C1q is an opsonin of apoptotic cells that acts via phagocyte LRP1 to induce extracellular signal–regulated kinase (ERK) signaling. We show that ERK signaling is required for phagocytosis of apoptotic cells and that ERK phosphorylation in response to apoptotic cells or C1q is defective in ABCA7-deficient cells. These studies reveal a major role of ABCA7 and not -A1 in the clearance of apoptotic cells and therefore suggest that ABCA7 is an authentic orthologue of CED-7. PMID:16908670

  11. Genome-wide identification of whole ATP-binding cassette (ABC) transporters in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kim, Bo-Mi; Lee, Jae-Seong; Rhee, Jae-Sung

    2014-08-05

    The ATP-binding cassette (ABC) transporter superfamily is one of the largest transporter gene families and is observed in all animal taxa. Although a large set of transcriptomic data was recently assembled for several species of crustaceans, identification and annotation of the large ABC transporter gene family have been very challenging. In the intertidal copepod Tigriopus japonicus, 46 putative ABC transporters were identified using in silico analysis, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that the 46 T. japonicus ABC transporters are classified into eight subfamilies (A-H) that include all the members of all ABC subfamilies, consisting of five ABCA, five ABCB, 17 ABCC, three ABCD, one ABCE, three ABCF, seven ABCG, and five ABCH subfamilies. Of them, unique isotypic expansion of two clades of ABCC1 proteins was observed. Real-time RT-PCR-based heatmap analysis revealed that most T. japonicus ABC genes showed temporal transcriptional expression during copepod development. The overall transcriptional profile demonstrated that half of all T. japonicus ABC genes were strongly associated with at least one developmental stage. Of them, transcripts TJ-ABCH_88708 and TJ-ABCE1 were highly expressed during all developmental stages. The whole set of T. japonicus ABC genes and their phylogenetic relationships will provide a better understanding of the comparative evolution of essential gene family resources in arthropods, including the crustacean copepods.

  12. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).

    PubMed

    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli

    2013-09-10

    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Genome-wide identification, characterization and phylogenetic analysis of 50 catfish ATP-binding cassette (ABC) transporter genes.

    PubMed

    Liu, Shikai; Li, Qi; Liu, Zhanjiang

    2013-01-01

    Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.

  14. Decreased expression of an ATP-binding cassette transporter, MRP2, in human livers with hepatitis C virus infection.

    PubMed

    Hinoshita, E; Taguchi, K; Inokuchi, A; Uchiumi, T; Kinukawa, N; Shimada, M; Tsuneyoshi, M; Sugimachi, K; Kuwano, M

    2001-12-01

    To understand hepatic injury during the process of hepatitis viral infection, determination of liver-specific functions at molecular levels is critical. Because the transport of endogenous/exogenous toxic substances is an intrinsically important hepatic function, we examined whether expression of the ATP-binding cassette (ABC) transporter gene was affected in patients with hepatitis viral infection. To determine which ABC transporter was expressed differently in patients with hepatic viral infection, we assayed the expression of MDR1, MDR3, MRP1, MRP2, and MRP3 in non-cancerous regions in the liver of 42 patients with hepatic tumors using both quantitative RT-PCR and immunological staining analysis, and compared the hepatic expression levels between patients with hepatitis viral infection and non-infected controls. Of the five ABC transporter genes studied, the mRNAs of MRP2 and MRP3 were highly expressed in the human liver. There was a significant reduction in MRP2 expression to 29% in the virus-infected liver. Treatment of hepatic cells with inflammatory cytokines resulted in decreased mRNA levels of MRP2 and decreased MRP2 promoter activity. The down-regulation of MRP2 might induce a failure in the transport of various genotoxic substances in the liver with hepatitis virus infection.

  15. Association of ATP-Binding Cassette Transporter A1 Gene Polymorphisms in Type 2 Diabetes Mellitus among Malaysians.

    PubMed

    Haghvirdizadeh, Polin; Ramachandran, Vasudevan; Etemad, Ali; Heidari, Farzad; Ghodsian, Nooshin; Bin Ismail, Norzian; Ismail, Patimah

    2015-01-01

    Type 2 diabetes mellitus (T2DM) is a complex polygenic disorder characterized by impaired insulin resistance, insulin secretion, and dysregulation of lipid and protein metabolism with environmental and genetic factors. ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms are reported as the one of the genetic risk factors for T2DM in various populations with conflicting results. This study was conducted based on PCR-HRM to determine the frequency of ABCA1 gene by rs2230806 (R219K), rs1800977 (C69T), and rs9282541 (R230C) polymorphisms Malaysian subjects. A total of 164 T2DM and 165 controls were recruited and their genotypes for ABCA1 gene polymorphisms were determined based on the real time high resolution melting analysis. There was a significant difference between the subjects in terms of age, BMI, FPG, HbA1c, HDL, LDL, and TG (P < 0.05). There was a significant association between HOM of R219K (P = 0.005), among Malaysian subjects; moreover, allele frequency revealed the significant difference in A allele of R219K (P = 0.003). But, there was no significant difference in genotypic and allelic frequencies of C69T and R230C polymorphism. R219K polymorphism of ABCA1 gene can be considered as a genetic risk factor for T2DM subjects among Malaysians.

  16. Association of ATP-Binding Cassette Transporter A1 Gene Polymorphisms in Type 2 Diabetes Mellitus among Malaysians

    PubMed Central

    Haghvirdizadeh, Polin; Etemad, Ali; Heidari, Farzad; Ghodsian, Nooshin; Bin Ismail, Norzian

    2015-01-01

    Background. Type 2 diabetes mellitus (T2DM) is a complex polygenic disorder characterized by impaired insulin resistance, insulin secretion, and dysregulation of lipid and protein metabolism with environmental and genetic factors. ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms are reported as the one of the genetic risk factors for T2DM in various populations with conflicting results. This study was conducted based on PCR-HRM to determine the frequency of ABCA1 gene by rs2230806 (R219K), rs1800977 (C69T), and rs9282541 (R230C) polymorphisms Malaysian subjects. Methods. A total of 164 T2DM and 165 controls were recruited and their genotypes for ABCA1 gene polymorphisms were determined based on the real time high resolution melting analysis. Results. There was a significant difference between the subjects in terms of age, BMI, FPG, HbA1c, HDL, LDL, and TG (P < 0.05). There was a significant association between HOM of R219K (P = 0.005), among Malaysian subjects; moreover, allele frequency revealed the significant difference in A allele of R219K (P = 0.003). But, there was no significant difference in genotypic and allelic frequencies of C69T and R230C polymorphism. Conclusion. R219K polymorphism of ABCA1 gene can be considered as a genetic risk factor for T2DM subjects among Malaysians. PMID:26451383

  17. Whole-Genome Survey of the Putative ATP-Binding Cassette Transporter Family Genes in Vitis vinifera

    PubMed Central

    Çakır, Birsen; Kılıçkaya, Ozan

    2013-01-01

    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 “full-size,” 41 “half-size,” and 15 “soluble” putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera. PMID:24244377

  18. Exosomal evasion of humoral immunotherapy in aggressive B-cell lymphoma modulated by ATP-binding cassette transporter A3

    PubMed Central

    Aung, Thiha; Chapuy, Bjoern; Vogel, Daniel; Wenzel, Dirk; Oppermann, Martin; Lahmann, Marlen; Weinhage, Toni; Menck, Kerstin; Hupfeld, Timo; Koch, Raphael; Trümper, Lorenz; Wulf, Gerald G.

    2011-01-01

    Targeting the surface of malignant cells has evolved into a cornerstone in cancer therapy, paradigmatically introduced by the success of humoral immunotherapy against CD20 in malignant lymphoma. However, tumor cell susceptibility to immunochemotherapy varies, with mostly a fatal outcome in cases of resistant disease. Here, we show that lymphoma exosomes shield target cells from antibody attack and that exosome biogenesis is modulated by the lysosome-related organelle-associated ATP-binding cassette (ABC) transporter A3 (ABCA3). B-cell lymphoma cells released exosomes that carried CD20, bound therapeutic anti-CD20 antibodies, consumed complement, and protected target cells from antibody attack. ABCA3, previously shown to mediate resistance to chemotherapy, was critical for the amounts of exosomes released, and both pharmacological blockade and the silencing of ABCA3 enhanced susceptibility of target cells to antibody-mediated lysis. Mechanisms of cancer cell resistance to drugs and antibodies are linked in an ABCA3-dependent pathway of exosome secretion. PMID:21873242

  19. Stickleback embryos use ATP-binding cassette transporters as a buffer against exposure to maternally derived cortisol

    PubMed Central

    Bukhari, Syed Abbas; Bell, Alison M.

    2016-01-01

    Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623

  20. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera.

    PubMed

    Çakır, Birsen; Kılıçkaya, Ozan

    2013-01-01

    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 "full-size," 41 "half-size," and 15 "soluble" putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera.

  1. Skin Lesions on Common Bottlenose Dolphins (Tursiops truncatus) from Three Sites in the Northwest Atlantic, USA

    PubMed Central

    Hart, Leslie Burdett; Rotstein, Dave S.; Wells, Randall S.; Allen, Jason; Barleycorn, Aaron; Balmer, Brian C.; Lane, Suzanne M.; Speakman, Todd; Zolman, Eric S.; Stolen, Megan; McFee, Wayne; Goldstein, Tracey; Rowles, Teri K.; Schwacke, Lori H.

    2012-01-01

    Skin disease occurs frequently in many cetacean species across the globe; methods to categorize lesions have relied on photo-identification (photo-id), stranding, and by-catch data. The current study used photo-id data from four sampling months during 2009 to estimate skin lesion prevalence and type occurring on bottlenose dolphins (Tursiops truncatus) from three sites along the southeast United States coast [Sarasota Bay, FL (SSB); near Brunswick and Sapelo Island, GA (BSG); and near Charleston, SC (CHS)]. The prevalence of lesions was highest among BSG dolphins (P = 0.587) and lowest in SSB (P = 0.380), and the overall prevalence was significantly different among all sites (p<0.0167). Logistic regression modeling revealed a significant reduction in the odds of lesion occurrence for increasing water temperatures (OR = 0.92; 95%CI:0.906–0.938) and a significantly increased odds of lesion occurrence for BSG dolphins (OR = 1.39; 95%CI:1.203–1.614). Approximately one-third of the lesioned dolphins from each site presented with multiple types, and population differences in lesion type occurrence were observed (p<0.05). Lesions on stranded dolphins were sampled to determine the etiology of different lesion types, which included three visually distinct samples positive for herpesvirus. Although generally considered non-fatal, skin disease may be indicative of animal health or exposure to anthropogenic or environmental threats, and photo-id data provide an efficient and cost-effective approach to document the occurrence of skin lesions in free-ranging populations. PMID:22427955

  2. Ten problems and solutions when predicting individual outcome from lesion site after stroke.

    PubMed

    Price, Cathy J; Hope, Thomas M; Seghier, Mohamed L

    2017-01-15

    In this paper, we consider solutions to ten of the challenges faced when trying to predict an individual's functional outcome after stroke on the basis of lesion site. A primary goal is to find lesion-outcome associations that are consistently observed in large populations of stroke patients because consistent associations maximise confidence in future individualised predictions. To understand and control multiple sources of inter-patient variability, we need to systematically investigate each contributing factor and how each factor depends on other factors. This requires very large cohorts of patients, who differ from one another in typical and measurable ways, including lesion site, lesion size, functional outcome and time post stroke (weeks to decades). These multivariate investigations are complex, particularly when the contributions of different variables interact with one another. Machine learning algorithms can help to identify the most influential variables and indicate dependencies between different factors. Multivariate lesion analyses are needed to understand how the effect of damage to one brain region depends on damage or preservation in other brain regions. Such data-led investigations can reveal predictive relationships between lesion site and outcome. However, to understand and improve the predictions we need explanatory models of the neural networks and degenerate pathways that support functions of interest. This will entail integrating the results of lesion analyses with those from functional imaging (fMRI, MEG), transcranial magnetic stimulation (TMS) and diffusor tensor imaging (DTI) studies of healthy participants and patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Fragment-Based Screening Maps Inhibitor Interactions in the ATP-Binding Site of Checkpoint Kinase 2

    PubMed Central

    Silva-Santisteban, M. Cris; Westwood, Isaac M.; Boxall, Kathy; Brown, Nathan; Peacock, Sam; McAndrew, Craig; Barrie, Elaine; Richards, Meirion; Mirza, Amin; Oliver, Antony W.; Burke, Rosemary; Hoelder, Swen; Jones, Keith; Aherne, G. Wynne; Blagg, Julian; Collins, Ian; Garrett, Michelle D.; van Montfort, Rob L. M.

    2013-01-01

    Checkpoint kinase 2 (CHK2) is an important serine/threonine kinase in the cellular response to DNA damage. A fragment-based screening campaign using a combination of a high-concentration AlphaScreen™ kinase assay and a biophysical thermal shift assay, followed by X-ray crystallography, identified a number of chemically different ligand-efficient CHK2 hinge-binding scaffolds that have not been exploited in known CHK2 inhibitors. In addition, it showed that the use of these orthogonal techniques allowed efficient discrimination between genuine hit matter and false positives from each individual assay technology. Furthermore, the CHK2 crystal structures with a quinoxaline-based fragment and its follow-up compound highlight a hydrophobic area above the hinge region not previously explored in rational CHK2 inhibitor design, but which might be exploited to enhance both potency and selectivity of CHK2 inhibitors. PMID:23776527

  4. An Allosteric Cross-Talk Between the Activation Loop and the ATP Binding Site Regulates the Activation of Src Kinase

    NASA Astrophysics Data System (ADS)

    Pucheta-Martínez, Encarna; Saladino, Giorgio; Morando, Maria Agnese; Martinez-Torrecuadrada, Jorge; Lelli, Moreno; Sutto, Ludovico; D’Amelio, Nicola; Gervasio, Francesco Luigi

    2016-04-01

    Phosphorylation of the activation loop is a fundamental step in the activation of most protein kinases. In the case of the Src tyrosine kinase, a prototypical kinase due to its role in cancer and its historic importance, phosphorylation of tyrosine 416 in the activation loop is known to rigidify the structure and contribute to the switch from the inactive to a fully active form. However, whether or not phosphorylation is able per-se to induce a fully active conformation, that efficiently binds ATP and phosphorylates the substrate, is less clear. Here we employ a combination of solution NMR and enhanced-sampling molecular dynamics simulations to fully map the effects of phosphorylation and ATP/ADP cofactor loading on the conformational landscape of Src tyrosine kinase. We find that both phosphorylation and cofactor binding are needed to induce a fully active conformation. What is more, we find a complex interplay between the A-loop and the hinge motion where the phosphorylation of the activation-loop has a significant allosteric effect on the dynamics of the C-lobe.

  5. An Allosteric Cross-Talk Between the Activation Loop and the ATP Binding Site Regulates the Activation of Src Kinase

    PubMed Central

    Pucheta-Martínez, Encarna; Saladino, Giorgio; Morando, Maria Agnese; Martinez-Torrecuadrada, Jorge; Lelli, Moreno; Sutto, Ludovico; D’Amelio, Nicola; Gervasio, Francesco Luigi

    2016-01-01

    Phosphorylation of the activation loop is a fundamental step in the activation of most protein kinases. In the case of the Src tyrosine kinase, a prototypical kinase due to its role in cancer and its historic importance, phosphorylation of tyrosine 416 in the activation loop is known to rigidify the structure and contribute to the switch from the inactive to a fully active form. However, whether or not phosphorylation is able per-se to induce a fully active conformation, that efficiently binds ATP and phosphorylates the substrate, is less clear. Here we employ a combination of solution NMR and enhanced-sampling molecular dynamics simulations to fully map the effects of phosphorylation and ATP/ADP cofactor loading on the conformational landscape of Src tyrosine kinase. We find that both phosphorylation and cofactor binding are needed to induce a fully active conformation. What is more, we find a complex interplay between the A-loop and the hinge motion where the phosphorylation of the activation-loop has a significant allosteric effect on the dynamics of the C-lobe. PMID:27063862

  6. Diosgenin inhibits atherosclerosis via suppressing the MiR-19b-induced downregulation of ATP-binding cassette transporter A1.

    PubMed

    Lv, Yun-cheng; Yang, Jing; Yao, Feng; Xie, Wei; Tang, Yan-yan; Ouyang, Xin-ping; He, Ping-ping; Tan, Yu-lin; Li, Liang; Zhang, Min; Liu, Dan; Cayabyab, Francisco S; Zheng, Xi-Long; Tang, Chao-ke

    2015-05-01

    Diosgenin (Dgn), a structural analogue of cholesterol, has been reported to have the hypolipidemic and antiatherogenic properties, but the underlying mechanisms are not fully understood. Given the key roles of macrophages in cholesterol metabolism and atherogenesis, it is critical to investigate macrophage cholesterol efflux and development of atherosclerotic lesion after Dgn treatment. This study was designed to evaluate the potential effects of Dgn on macrophage cholesterol metabolism and the development of aortic atherosclerosis, and to explore its underlying mechanisms. Dgn significantly up-regulated the expression of ATP-binding cassette transporter A1 (ABCA1) protein, but didn't affect liver X receptor α levels in foam cells derived from human THP-1 macrophages and mouse peritoneal macrophages (MPMs) as determined by western blotting. The miR-19b levels were markedly down-regulated in Dgn-treated THP-1 macrophages/MPM-derived foam cells. Cholesterol transport assays revealed that treatment with Dgn alone or together with miR-19b inhibitor notably enhanced ABCA1-dependent cholesterol efflux, resulting in the reduced levels of total cholesterol, free cholesterol and cholesterol ester as determined by high-performance liquid chromatography. The fecal 3H-sterol originating from cholesterol-laden MPMs was increased in apolipoprotein E knockout mice treated with Dgn or both Dgn and antagomiR-19b. Treatment with Dgn alone or together with antagomiR-19b elevated plasma high-density lipoprotein levels, but reduced plasma low-density lipoprotein levels. Accordingly, aortic lipid deposition and plaque area were reduced, and collagen content and ABCA1 expression were increased in mice treated with Dgn alone or together with antagomiR-19b. However, miR-19b overexpression abrogated the lipid-lowering and atheroprotective effects induced by Dgn. The present study demonstrates that Dgn enhances ABCA1-dependent cholesterol efflux and inhibits aortic atherosclerosis

  7. Deficiency of brain ATP-binding cassette transporter A-1 exacerbates blood-brain barrier and white matter damage after stroke.

    PubMed

    Cui, Xu; Chopp, Michael; Zacharek, Alex; Karasinska, Joanna M; Cui, Yisheng; Ning, Ruizhuo; Zhang, Yi; Wang, Yun; Chen, Jieli

    2015-03-01

    The ATP-binding cassette transporter A-1 (ABCA1) gene is a key target of the transcription factors liver X receptors. Liver X receptor activation has anti-inflammatory and neuroprotective effects in animal ischemic stroke models. Here, we tested the hypothesis that brain ABCA1 reduces blood-brain barrier (BBB) and white matter (WM) impairment in the ischemic brain after stroke. Adult brain-specific ABCA1-deficient (ABCA1(-B/-B)) and floxed-control (ABCA1(fl/fl)) mice were subjected to permanent distal middle cerebral artery occlusion and were euthanized 7 days after distal middle cerebral artery occlusion. Functional outcome, infarct volume, BBB leakage, and WM damage were analyzed. Compared with ABCA1(fl/fl) mice, ABCA1(-B/-B) mice showed marginally (P=0.052) increased lesion volume but significantly increased BBB leakage and WM damage in the ischemic brain and more severe neurological deficits. Brain ABCA1-deficient mice exhibited increased the level of matrix metalloproteinase-9 and reduced the level of insulin-like growth factor 1 in the ischemic brain. BBB leakage was inversely correlated (r=-0.073; P<0.05) with aquaporin-4 expression. Reduction of insulin-like growth factor 1 and aquaporin-4, but upregulation of matrix metalloproteinase-9 expression were also found in the primary astrocyte cultures derived from ABCA1(-B/-B) mice. Cultured primary cortical neurons derived from C57BL/6 wild-type mice with ABCA1(-B/-B) astrocyte-conditioned medium exhibited decreased neurite outgrowth compared with culture with ABCA1(fl/fl) astrocyte-conditioned medium. ABCA1(-B/-B) primary cortical neurons show significantly decreased neurite outgrowth, which was attenuated by insulin-like growth factor 1 treatment. We demonstrate that brain ABCA1 deficiency increases BBB leakage, WM/axonal damage, and functional deficits after stroke. Concomitant reduction of insulin-like growth factor 1 and upregulation of matrix metalloproteinase-9 may contribute to brain ABCA1 deficiency

  8. ZRF1 mediates remodeling of E3 ligases at DNA lesion sites during nucleotide excision repair

    PubMed Central

    Gracheva, Ekaterina; Chitale, Shalaka; Wilhelm, Thomas; Rapp, Alexander; Byrne, Jonathan; Stadler, Jens; Medina, Rebeca; Cardoso, M. Cristina

    2016-01-01

    Faithful DNA repair is essential to maintain genome integrity. Ultraviolet (UV) irradiation elicits both the recruitment of DNA repair factors and the deposition of histone marks such as monoubiquitylation of histone H2A at lesion sites. Here, we report how a ubiquitin E3 ligase complex specific to DNA repair is remodeled at lesion sites in the global genome nucleotide excision repair (GG-NER) pathway. Monoubiquitylation of histone H2A (H2A-ubiquitin) is catalyzed predominantly by a novel E3 ligase complex consisting of DDB2, DDB1, CUL4B, and RING1B (UV–RING1B complex) that acts early during lesion recognition. The H2A-ubiquitin binding protein ZRF1 mediates remodeling of this E3 ligase complex directly at the DNA lesion site, causing the assembly of the UV–DDB–CUL4A E3 ligase complex (DDB1–DDB2–CUL4A-RBX1). ZRF1 is an essential factor in GG-NER, and its function at damaged chromatin sites is linked to damage recognition factor XPC. Overall, the results shed light on the interplay between epigenetic and DNA repair recognition factors at DNA lesion sites. PMID:27091446

  9. Solution structure of the 45-residue MgATP-binding peptide of adenylate kinase as examined by 2-D NMR, FTIR, and CD spectroscopy.

    PubMed

    Fry, D C; Byler, D M; Susi, H; Brown, E M; Kuby, S A; Mildvan, A S

    1988-05-17

    The structure of a synthetic peptide corresponding to residues 1-45 of rabbit muscle adenylate kinase has been studied in aqueous solution by two-dimensional NMR, FTIR, and CD spectroscopy. This peptide, which binds MgATP and is believed to represent most of the MgATP-binding site of the enzyme [Fry, D.C., Kuby, S.A., & Mildvan, A.S. (1985) Biochemistry 24, 4680-4694], appears to maintain a conformation similar to that of residues 1-45 in the X-ray structure of intact porcine adenylate kinase [Sachsenheimer, W., & Schulz, G.E. (1977) J. Mol. Biol. 114, 23-26], with 42% of the residues of the peptide showing NOEs indicative of phi and psi angles corresponding to those found in the protein. The NMR studies suggest that the peptide is composed of two helical regions of residues 4-7 and 23-29, and three stretches of beta-strand at residues 8-15, 30-32, and 35-40, yielding an overall secondary structure consisting of 24% alpha-helix, 38% beta-structure, and 38% aperiodic. Although the resolution-enhanced amide I band of the peptide FTIR spectrum is broad and rather featureless, possibly due to disorder, it can be fit by using methods developed on well-characterized globular proteins. On this basis, the peptide consists of 35 +/- 10% beta-structure, 60 +/- 12% turns and aperiodic structure, and not more than 10% alpha-helix. The CD spectrum is best fit by assuming the presence of at most 13% alpha-helix in the peptide, 24 +/- 2% beta-structure, and 66 +/- 4% aperiodic. The inability of the high-frequency FTIR and CD methods to detect helices in the amount found by NMR may result from the short helical lengths as well as from static and dynamic disorder in the peptide. Upon binding of MgATP, numerous conformational changes in the backbone of the peptide are detected by NMR, with smaller alterations in the overall secondary structure as assessed by CD. Detailed assignments of resonances in the peptide spectrum and intermolecular NOEs between protons of bound MgATP and

  10. Insight into Pleiotropic Drug Resistance ATP-binding Cassette Pump Drug Transport through Mutagenesis of Cdr1p Transmembrane Domains*

    PubMed Central

    Rawal, Manpreet Kaur; Khan, Mohammad Firoz; Kapoor, Khyati; Goyal, Neha; Sen, Sobhan; Saxena, Ajay Kumar; Lynn, Andrew M.; Tyndall, Joel D. A.; Monk, Brian C.; Cannon, Richard D.; Komath, Sneha Sudha; Prasad, Rajendra

    2013-01-01

    The fungal ATP-binding cassette (ABC) transporter Cdr1 protein (Cdr1p), responsible for clinically significant drug resistance, is composed of two transmembrane domains (TMDs) and two nucleotide binding domains (NBDs). We have probed the nature of the drug binding pocket by performing systematic mutagenesis of the primary sequences of the 12 transmembrane segments (TMSs) found in the TMDs. All mutated proteins were expressed equally well and localized properly at the plasma membrane in the heterologous host Saccharomyces cerevisiae, but some variants differed significantly in efflux activity, substrate specificity, and coupled ATPase activity. Replacement of the majority of the amino acid residues with alanine or glycine yielded neutral mutations, but about 42% of the variants lost resistance to drug efflux substrates completely or selectively. A predicted three-dimensional homology model shows that all the TMSs, apart from TMS4 and TMS10, interact directly with the drug-binding cavity in both the open and closed Cdr1p conformations. However, TMS4 and TMS10 mutations can also induce total or selective drug susceptibility. Functional data and homology modeling assisted identification of critical amino acids within a drug-binding cavity that, upon mutation, abolished resistance to all drugs tested singly or in combinations. The open and closed Cdr1p models enabled the identification of amino acid residues that bordered a drug-binding cavity dominated by hydrophobic residues. The disposition of TMD residues with differential effects on drug binding and transport are consistent with a large polyspecific drug binding pocket in this yeast multidrug transporter. PMID:23824183

  11. Osimertinib (AZD9291) Attenuates the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCB1 in Vitro.

    PubMed

    Hsiao, Sung-Han; Lu, Yu-Jen; Li, Yan-Qing; Huang, Yang-Hui; Hsieh, Chia-Hung; Wu, Chung-Pu

    2016-06-06

    The effectiveness of cancer chemotherapy is often circumvented by multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) drug transporter ABCB1 (MDR1, P-glycoprotein). Several epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been shown previously capable of modulating the function of ABCB1 and reversing ABCB1-mediated MDR in human cancer cells. Furthermore, some TKIs are transported by ABCB1, which results in low oral bioavailability, reduced distribution, and the development of acquired resistance to these TKIs. In this study, we investigated the interaction between ABCB1 and osimertinib, a novel selective, irreversible third-generation EGFR TKI that has recently been approved by the U.S. Food and Drug Administration. We also evaluated the potential impact of ABCB1 on the efficacy of osimertinib in cancer cells, which can present a therapeutic challenge to clinicians in the future. We revealed that although osimertinib stimulates the ATPase activity of ABCB1, overexpression of ABCB1 does not confer resistance to osimertinib. Our results suggest that it is unlikely that the overexpression of ABCB1 can be a major contributor to the development of osimertinib resistance in cancer patients. More significantly, we revealed an additional action of osimertinib that directly inhibits the function of ABCB1 without affecting the expression level of ABCB1, enhances drug-induced apoptosis, and reverses the MDR phenotype in ABCB1-overexpressing cancer cells. Considering that osimertinib is a clinically approved third-generation EGFR TKI, our findings suggest that a combination therapy with osimertinib and conventional anticancer drugs may be beneficial to patients with MDR tumors.

  12. Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus

    PubMed Central

    2012-01-01

    Background The otrC gene of Streptomyces rimosus was previously annotated as an oxytetracycline (OTC) resistance protein. However, the amino acid sequence analysis of OtrC shows that it is a putative ATP-binding cassette (ABC) transporter with multidrug resistance function. To our knowledge, none of the ABC transporters in S. rimosus have yet been characterized. In this study, we aimed to characterize the multidrug exporter function of OtrC and evaluate its relevancy to OTC production. Results In order to investigate OtrC’s function, otrC is cloned and expressed in E. coli The exporter function of OtrC was identified by ATPase activity determination and ethidium bromide efflux assays. Also, the susceptibilities of OtrC-overexpressing cells to several structurally unrelated drugs were compared with those of OtrC-non-expressing cells by minimal inhibitory concentration (MIC) assays, indicating that OtrC functions as a drug exporter with a broad range of drug specificities. The OTC production was enhanced by 1.6-fold in M4018 (P = 0.000877) and 1.4-fold in SR16 (P = 0.00973) duplication mutants, while it decreased to 80% in disruption mutants (P = 0.0182 and 0.0124 in M4018 and SR16, respectively). Conclusions The results suggest that OtrC is an ABC transporter with multidrug resistance function, and plays an important role in self-protection by drug efflux mechanisms. This is the first report of such a protein in S. rimosus, and otrC could be a valuable target for genetic manipulation to improve the production of industrial antibiotics. PMID:22906146

  13. Variations in ATP-Binding Cassette Transporter Regulation during the Progression of Human Nonalcoholic Fatty Liver DiseaseS⃞

    PubMed Central

    Hardwick, Rhiannon N.; Fisher, Craig D.; Canet, Mark J.; Scheffer, George L.

    2011-01-01

    Transporters located on the sinusoidal and canalicular membranes of hepatocytes regulate the efflux of drugs and metabolites into blood and bile, respectively. Changes in the expression or function of these transporters during liver disease may lead to a greater risk of adverse drug reactions. Nonalcoholic fatty liver disease (NAFLD) is a progressive condition encompassing the relatively benign steatosis and the more severe, inflammatory state of nonalcoholic steatohepatitis (NASH). Here, we present an analysis of the effect of NAFLD progression on the major ATP-binding cassette (ABC) efflux transport proteins ABCC1–6, ABCB1, and ABCG2. Human liver samples diagnosed as normal, steatotic, NASH (fatty), and NASH (not fatty) were analyzed. Increasing trends in mRNA expression of ABCC1, ABCC4–5, ABCB1, and ABCG2 were found with NAFLD progression, whereas protein levels of all transporters exhibited increasing trends with disease progression. Immunohistochemical staining of ABCC3, ABCB1, and ABCG2 revealed no alterations in cellular localization during NAFLD progression. ABCC2 staining revealed an alternative mechanism of regulation in NASH in which the transporter appears to be internalized away from the canalicular membrane. This correlated with a preferential shift in the molecular mass of ABCC2 from 200 to 180 kDa in NASH, which has been shown to be associated with a loss of glycosylation and internalization of the protein. These data demonstrate increased expression of multiple efflux transporters as well as altered cellular localization of ABCC2 in NASH, which may have profound effects on the ability of patients with NASH to eliminate drugs in an appropriate manner. PMID:21878559

  14. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence.

    PubMed

    Murphy, Timothy F; Brauer, Aimee L; Johnson, Antoinette; Kirkham, Charmaine

    2016-01-01

    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract.

  15. Determination of the quaternary structure of a bacterial ATP-binding cassette (ABC) transporter in living cells.

    PubMed

    Singh, Deo R; Mohammad, Mohammad M; Patowary, Suparna; Stoneman, Michael R; Oliver, Julie A; Movileanu, Liviu; Raicu, Valerică

    2013-02-01

    Pseudomonas aeruginosa is a pathogenic Gram-negative bacterium that affects patients with cystic fibrosis and immunocompromised individuals. This bacterium coexpresses two unique forms of lipopolysaccharides (LPSs) on its surface, the A- and B-band LPS, which are among the main virulence factors that contribute to its pathogenicity. The polysaccharides in A-band LPSs are synthesized in the cytoplasm and translocated into the periplasm via an ATP-binding cassette (ABC) transporter consisting of a transmembrane protein, Wzm, and a cytoplasmic nucleotide-binding protein, Wzt. Most of the biochemical studies of A-band PSs in Pseudomonas aeruginosa are focused on the stages of the synthesis and ligation of PS, leaving the export stage involving the ABC transporter mostly unexplored. This difficulty is compounded by the fact that the subunit composition and structure of this bi-component ABC transporter are still unknown. Here we propose a simple but powerful method, based on Förster Resonance Energy Transfer (FRET) and optical micro-spectroscopy technology, to probe the structure of dynamic (as opposed to static) protein complexes in living cells. We use this method to determine the association stoichiometry and quaternary structure of the Wzm-Wzt complex in living cells. It is found that Wzt forms a rhombus-shaped homo-tetramer which becomes a square upon co-expression with Wzm, and that Wzm forms a square-shaped homo-tetramer both in the presence and absence of Wzt. Based on these results, we propose a structural model for the double-tetramer complex formed by the bi-component ABC transporter in living cells. An understanding of the structure and behavior of this ABC transporter will help develop antibiotics targeting the biosynthesis of the A-band LPS endotoxin.

  16. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine

    2016-01-01

    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  17. Functional Characterization of ATP-Binding Cassette Transporter A3 Mutations from Infants with Respiratory Distress Syndrome.

    PubMed

    Wambach, Jennifer A; Yang, Ping; Wegner, Daniel J; Heins, Hillary B; Kaliberova, Lyudmila N; Kaliberov, Sergey A; Curiel, David T; White, Frances V; Hamvas, Aaron; Hackett, Brian P; Cole, F Sessions

    2016-11-01

    Mutations in the ATP-binding cassette transporter A3 gene (ABCA3) result in severe neonatal respiratory distress syndrome and childhood interstitial lung disease. As most ABCA3 mutations are rare or private, determination of mutation pathogenicity is often based on results from in silico prediction tools, identification in unrelated diseased individuals, statistical association studies, or expert opinion. Functional biologic studies of ABCA3 mutations are needed to confirm mutation pathogenicity and inform clinical decision making. Our objective was to functionally characterize two ABCA3 mutations (p.R288K and p.R1474W) identified among term and late-preterm infants with respiratory distress syndrome with unclear pathogenicity in a genetically versatile model system. We performed transient transfection of HEK293T cells with wild-type or mutant ABCA3 alleles to assess protein processing with immunoblotting. We used transduction of A549 cells with adenoviral vectors, which concurrently silenced endogenous ABCA3 and expressed either wild-type or mutant ABCA3 alleles (p.R288K and p.R1474W) to assess immunofluorescent localization, ATPase activity, and organelle ultrastructure. Both ABCA3 mutations (p.R288K and p.R1474W) encoded proteins with reduced ATPase activity but with normal intracellular localization and protein processing. Ultrastructural phenotypes of lamellar body-like vesicles in A549 cells transduced with mutant alleles were similar to wild type. Mutant proteins encoded by ABCA3 mutations p.R288K and p.R1474W had reduced ATPase activity, a biologically plausible explanation for disruption of surfactant metabolism by impaired phospholipid transport into the lamellar body. These results also demonstrate the usefulness of a genetically versatile, human model system for functional characterization of ABCA3 mutations with unclear pathogenicity.

  18. HER2 as therapeutic target for overcoming ATP-binding cassette transporter-mediated chemoresistance in small cell lung cancer.

    PubMed

    Minami, Toshiyuki; Kijima, Takashi; Otani, Yasushi; Kohmo, Satoshi; Takahashi, Ryo; Nagatomo, Izumi; Hirata, Haruhiko; Suzuki, Mayumi; Inoue, Koji; Takeda, Yoshito; Kida, Hiroshi; Tachibana, Isao; Kumanogoh, Atsushi

    2012-04-01

    Small cell lung cancer (SCLC) easily acquires multidrug resistance after successful initial therapy. Overexpression of ATP-binding cassette (ABC) transporters is important for the multidrug resistance. Among them, ABCB1 and ABCG2 are known to be upregulated in chemoresistant SCLC cells. We found that human epidermal growth factor receptor 2 (HER2) expressions are also upregulated in chemoresistant SBC-3/ETP, SBC-3/SN-38, and SBC-3/CDDP cells, compared with chemosensitive SBC-3 cells. Lapatinib, a tyrosine kinase inhibitor of HER2, could not suppress proliferation of these HER2-positive SCLC cells alone but successfully restored chemosensitivity to etoposide and SN-38 with a clinically applicable concentration. The reversal effect of lapatinib was thought to be caused by inhibition of drug efflux pump functions of ABC transporters, although lapatinib itself has been reported to be a substrate for them. Moreover, knocking down of HER2 by an short interfering RNA weakened the effect of lapatinib on ABCB1, indicating the involvement of HER2 in the inhibitory mechanisms. Notably, we showed that caveolin-1 and Src play key roles in modulating ABCB1 function via HER2 inactivation. In SBC-3/ETP cells, dephosphorylation of HER2 by lapatinib activates Src and successively leads to increased caveolin-1 phosphorylation. Through this process, caveolin-1 dissociates from HER2 and strengthens association with ABCB1, and finally impairs the pump functions. Furthermore, we showed that treatment by lapatinib in combination with etoposide or irinotecan significantly suppresses the growth of subcutaneous SBC-3/ETP and SBC-3/SN-38 tumors in mice, respectively. Collectively, these results indicate that combination therapy with lapatinib and cytotoxic agents could conquer ABC transporter-mediated chemoresistance especially in HER2-positive SCLC.

  19. A Novel ATP-Binding Cassette Transporter Involved in Multidrug Resistance in the Phytopathogenic Fungus Penicillium digitatum

    PubMed Central

    Nakaune, Ryoji; Adachi, Kiichi; Nawata, Osamu; Tomiyama, Masamitsu; Akutsu, Katsumi; Hibi, Tadaaki

    1998-01-01

    Demethylation inhibitor (DMI)-resistant strains of the plant pathogenic fungus Penicillium digitatum were shown to be simultaneously resistant to cycloheximide, 4-nitroquinoline-N-oxide (4NQO), and acriflavine. A PMR1 (Penicillium multidrug resistance) gene encoding an ATP-binding cassette (ABC) transporter (P-glycoprotein) was cloned from a genomic DNA library of a DMI-resistant strain (LC2) of Penicillium digitatum by heterologous hybridization with a DNA fragment containing an ABC-encoding region from Botrytis cinerea. Sequence analysis revealed significant amino acid homology to the primary structures of PMR1 (protein encoded by the PMR1 gene) and ABC transporters of Saccharomyces cerevisiae (PDR5 and SNQ2), Schizosaccharomyces pombe (HBA2), Candida albicans (CDR1), and Aspergillus nidulans (AtrA and AtrB). Disruption of the PMR1 gene of P. digitatum DMI-resistant strain LC2 demonstrated that PMR1 was an important determinant of resistance to DMIs. The effective concentrations inhibiting radial growth by 50% (EC50s) and the MICs of fenarimol and bitertanol for the PMR1 disruptants (Δpmr1 mutants) were equivalent to those for DMI-sensitive strains. Northern blot analysis indicated that severalfold more PMR1 transcript accumulated in the DMI-resistant strains compared with those in DMI-sensitive strains in the absence of fungicide. In both DMI-resistant and -sensitive strains, transcription of PMR1 was strongly enhanced within 10 min after treatment with the DMI fungicide triflumizole. These results suggested that the toxicant efflux system comprised of PMR1 participates directly in the DMI resistance of the fungus. PMID:9758830

  20. Overexpression of the ATP binding cassette gene ABCA1 determines resistance to Curcumin in M14 melanoma cells.

    PubMed

    Bachmeier, Beatrice E; Iancu, Cristina M; Killian, Peter H; Kronski, Emanuel; Mirisola, Valentina; Angelini, Giovanna; Jochum, Marianne; Nerlich, Andreas G; Pfeffer, Ulrich

    2009-12-23

    Curcumin induces apoptosis in many cancer cells and it reduces xenograft growth and the formation of lung metastases in nude mice. Moreover, the plant derived polyphenol has been reported to be able to overcome drug resistance to classical chemotherapy. These features render the drug a promising candidate for tumor therapy especially for cancers known for their high rates concerning therapy resistance like melanoma. We show here that the melanoma cell line M14 is resistant to Curcumin induced apoptosis, which correlates with the absence of any effect on NFkappaB signaling. We show that CXCL1 a chemokine that is down regulated in breast cancer cells by Curcumin in an NFkappaB dependent manner is expressed at variable levels in human melanomas. Yet in M14 cells, CXCL1 expression did not change upon Curcumin treatment. Following the hypothesis that Curcumin is rapidly removed from the resistant cells, we analyzed expression of known multi drug resistance genes and cellular transporters in M14 melanoma cells and in the Curcumin sensitive breast cancer cell line MDA-MB-231. ATP-binding cassette transporter ABCA1, a gene involved in the cellular lipid removal pathway is over-expressed in resistant M14 melanoma as compared to the sensitive MDA-MB-231 breast cancer cells. Gene silencing of ABCA1 by siRNA sensitizes M14 cells to the apoptotic effect of Curcumin most likely as a result of reduced basal levels of active NFkappaB. Moreover, ABCA1 silencing alone also induces apoptosis and reduces p65 expression. Resistance to Curcumin thus follows classical pathways and ABCA1 expression should be considered as response marker.

  1. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance.

    PubMed

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols.

  2. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance

    PubMed Central

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols. PMID:25254091

  3. Identification of a MAP 2-like ATP-binding protein associated with axoplasmic vesicles that translocate on isolated microtubules

    PubMed Central

    1986-01-01

    Axoplasmic vesicles were purified and observed to translocate on isolated microtubules in an ATP-dependent, trypsin-sensitive manner, implying that ATP-binding polypeptides essential for force generation were present on the vesicle surface. To identify these proteins [alpha 32P]8-azidoadenosine 5'-triphosphate ([alpha 32P]8-N3ATP), a photoaffinity analogue of ATP, was used. The results presented here identify and characterize a vesicle-associated polypeptide having a relative molecular mass of 292 kD that bound [alpha 32P]8-N3ATP. The incorporation of label is ultraviolet light-dependent and ATP- sensitive. Moreover, the 292-kD polypeptide could be isolated in association with vesicles or microtubules, depending on the conditions used, and the data indicate that the 292-kD polypeptide is similar to mammalian brain microtubule-associated protein 2 (MAP 2) for the following reasons: The 292-kD polypeptide isolated from either squid axoplasm or optic lobe cross-reacts with antiserum to porcine brain MAP 2. Furthermore, it purifies with taxol-stabilized microtubules and is released with salt. Based on these characteristics, the 292-kD polypeptide is distinct from the known force-generating molecules myosin and flagellar dynein, as well as the 110-130-kD kinesin-like polypeptides that have recently been described (Brady, S. T., 1985, Nature (Lond.), 317:73-75; Vale, R. D., T. S. Reese, and M. P. Sheetz, 1985b, Cell, 42:39-50; Scholey, J. M., M. E. Porter, P. M. Grissom, and J. R. McIntosh, 1985, Nature (Lond.), 318:483-486). Because the 292-kD polypeptide binds ATP and is associated with vesicles that translocate on purified MAP-free microtubules in an ATP-dependent fashion, it is therefore believed to be involved in vesicle-microtubule interactions that promote organelle motility. PMID:3091608

  4. Biotin uptake in prokaryotes by solute transporters with an optional ATP-binding cassette-containing module.

    PubMed

    Hebbeln, Peter; Rodionov, Dmitry A; Alfandega, Anja; Eitinger, Thomas

    2007-02-20

    BioMNY proteins are considered to constitute tripartite biotin transporters in prokaryotes. Recent comparative genomic and experimental analyses pointed to the similarity of BioMN to homologous modules of prokaryotic transporters mediating uptake of metals, amino acids, and vitamins. These systems resemble ATP-binding cassette-containing transporters and include typical ATPases (e.g., BioM). Absence of extracytoplasmic solute-binding proteins among the members of this group, however, is a distinctive feature. Genome context analyses uncovered that only one-third of the widespread bioY genes are linked to bioMN. Many bioY genes are located at loci encoding biotin biosynthesis, and others are unlinked to biotin metabolic or transport genes. Heterologous expression of the bioMNY operon and of the single bioY of the alpha-proteobacterium Rhodobacter capsulatus conferred biotin-transport activity on recombinant Escherichia coli cells. Kinetic analyses identified BioY as a high-capacity transporter that was converted into a high-affinity system in the presence of BioMN. BioMNY-mediated biotin uptake was severely impaired by replacement of the Walker A lysine residue in BioM, demonstrating dependency of high-affinity transport on a functional ATPase. Biochemical assays revealed that BioM, BioN, and BioY proteins form stable complexes in membranes of the heterologous host. Expression of truncated bio transport operons, each with one gene deleted, resulted in stable BioMN complexes but revealed only low amounts of BioMY and BioNY aggregates in the absence of the respective third partner. The results substantiate our earlier suggestion of a mechanistically novel group of membrane transporters.

  5. Biotin uptake in prokaryotes by solute transporters with an optional ATP-binding cassette-containing module

    PubMed Central

    Hebbeln, Peter; Rodionov, Dmitry A.; Alfandega, Anja; Eitinger, Thomas

    2007-01-01

    BioMNY proteins are considered to constitute tripartite biotin transporters in prokaryotes. Recent comparative genomic and experimental analyses pointed to the similarity of BioMN to homologous modules of prokaryotic transporters mediating uptake of metals, amino acids, and vitamins. These systems resemble ATP-binding cassette-containing transporters and include typical ATPases (e.g., BioM). Absence of extracytoplasmic solute-binding proteins among the members of this group, however, is a distinctive feature. Genome context analyses uncovered that only one-third of the widespread bioY genes are linked to bioMN. Many bioY genes are located at loci encoding biotin biosynthesis, and others are unlinked to biotin metabolic or transport genes. Heterologous expression of the bioMNY operon and of the single bioY of the α-proteobacterium Rhodobacter capsulatus conferred biotin-transport activity on recombinant Escherichia coli cells. Kinetic analyses identified BioY as a high-capacity transporter that was converted into a high-affinity system in the presence of BioMN. BioMNY-mediated biotin uptake was severely impaired by replacement of the Walker A lysine residue in BioM, demonstrating dependency of high-affinity transport on a functional ATPase. Biochemical assays revealed that BioM, BioN, and BioY proteins form stable complexes in membranes of the heterologous host. Expression of truncated bio transport operons, each with one gene deleted, resulted in stable BioMN complexes but revealed only low amounts of BioMY and BioNY aggregates in the absence of the respective third partner. The results substantiate our earlier suggestion of a mechanistically novel group of membrane transporters. PMID:17301237

  6. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis).

    PubMed

    Carmona-Antoñanzas, Greta; Carmichael, Stephen N; Heumann, Jan; Taggart, John B; Gharbi, Karim; Bron, James E; Bekaert, Michaël; Sturm, Armin

    2015-01-01

    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance.

  7. Genome-Wide Identification, Evolution, and Expression Analysis of the ATP-Binding Cassette Transporter Gene Family in Brassica rapa

    PubMed Central

    Yan, Chao; Duan, Weike; Lyu, Shanwu; Li, Ying; Hou, Xilin

    2017-01-01

    ATP-binding cassette (ABC) proteins can act as transporters of different substrates across biological membranes by hydrolyzing ATP. However, little information is available about ABC transporters in Brassica rapa, an important leafy vegetable. In the present study, we carried out genome-wide identification, characterization and molecular evolution analyses of ABC gene family in B. rapa and 9 other plant species. A total of 179 B. rapa ABC genes (BraABCs) were identified. Among them, 173 BraABCs were identified on 10 chromosomes. Based on phylogenetic analysis and domain organization, the BraABC family could be grouped into eight subfamilies. BraABCs in the same subfamily showed similar motif composition and exon-intron organization. Common and unique cis-elements involved in the transcriptional regulation were also identified in the promoter regions of BraABCs. Tissue-expression analysis of BraABCs demonstrated their diverse spatiotemporal expression profiles. Influences of the whole genome triplication (WGT) on the evolution of BraABCs were studied in detail. BraABCs were preferentially retained compared with their neighboring genes during diploidization after WGT. Synteny analysis identified 76 pairs of syntenic BraABC paralogs among the three subgenomes of B. rapa, and 10 paralog pairs underwent positive selection with ω (= Ka/Ks) ratios greater than 1. Analyses of the expression patterns of syntenic BraABC paralogs pairs across five tissues and under stress treatments revealed their functional conservation, sub-functionalization, neo-functionalization and pseudogenization during evolution. Our study presents a comprehensive overview of the ABC gene family in B. rapa and will be helpful for the further functional study of BraABCs in plant growth, development, and stress responses. PMID:28367152

  8. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis)

    PubMed Central

    Heumann, Jan; Taggart, John B.; Gharbi, Karim; Bron, James E.; Bekaert, Michaël; Sturm, Armin

    2015-01-01

    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance. PMID:26418738

  9. Prognostic value of number and site of calcified coronary lesions compared with the total score.

    PubMed

    Williams, Marcus; Shaw, Leslee J; Raggi, Paolo; Morris, Douglas; Vaccarino, Viola; Liu, Sandy T; Weinstein, Steven R; Mosler, Tristen P; Tseng, Philip H; Flores, Ferdinand R; Nasir, Khurram; Budoff, Matthew

    2008-01-01

    This study sought to evaluate the long-term prognostic value of the number and sites of calcified coronary lesions and to compare the accuracy of number of calcified lesions with the extent of total calcium score. There is a strong relationship between mortality and total coronary artery calcium (CAC) score. It is not known whether the number of calcified lesions or their location influences outcome. A total of 14,759 asymptomatic patients were referred for evaluation of CAC scanning using electron beam tomography. Univariable and multivariable Cox proportional hazards models were developed to estimate time to all-cause mortality at, on average, 6.8 years (n = 281). Risk-adjusted annual mortality was 0.19% (95% confidence interval 0.18% to 0.21%) for patients without any calcified lesions. For patients with >20 lesions, annual risk-adjusted mortality exceeded 2% per year. Mortality rates were significantly higher for left main lesions as compared to other coronary arteries with annual mortality rates of 1.3%, 2.1%, 9.2%, and 13.6% for 1 to 2, 3 to 5, and > or =6 lesions, respectively (p < 0.0001). For left main CAC scores of 0 to 10, 11 to 100, 101 to 399, and 400 to 999, annual risk-adjusted mortality was 0.33%, 0.81%, 1.73%, and 7.71%, respectively (p < 0.0001). All 4 patients with a CAC score of > or =1,000 in the left main died during follow-up. However, patients with more frequent calcified lesions also had higher CAC scores. Specifically, > or =81% of patients with >10 calcified lesions also had a CAC score > or =100. With exception, for patients with CAC scores > or =1,000, annual mortality was dramatically higher at 3.0% to 4.5% for those with 1 to 5 calcified lesions as compared with 1.1% to 2.0% for those with 6 or more lesions (p < 0.0001). We report that mortality rates increased proportionally with the number of calcified lesions. Although predictive information is contained in the number of calcified lesions, its added statistical value is minimal

  10. Biophysical changes of ATP binding pocket may explain loss of kinase activity in mutant DAPK3 in cancer: A molecular dynamic simulation analysis.

    PubMed

    Agarwal, Tarun; Annamalai, Nithyanan; Maiti, Tapas Kumar; Arsad, Hasni

    2016-04-10

    DAPK3 belongs to family of DAPK (death-associated protein kinases) and is involved in the regulation of progression of the cell cycle, cell proliferation, apoptosis and autophagy. It is considered as a tumor suppressor kinase, suggesting the loss of its function in case of certain specific mutations. The T112M, D161N and P216S mutations in DAPK3 have been observed in cancer patients. These DAPK3 mutants have been associated with very low kinase activity, which results in the cellular progression towards cancer. However, a clear understanding of the structural and biophysical variations that occur in DAPK3 with these mutations, resulting in the decreased kinase activity has yet not been deciphered. We performed a molecular dynamic simulation study to investigate such structural variations. Our results revealed that mutations caused a significant structural variation in DAPK3, majorly concentrated in the flexible loops that form part of the ATP binding pocket. Interestingly, D161N and P216S mutations collapsed the ATP binding pocket through flexible loops invasion, hindering ATP binding which resulted in very low kinase activity. On the contrary, T112M mutant DAPK3 reduces ATP binding potential through outward distortion of flexible loops. In addition, the mutant lacked characteristic features of the active protein kinase including proper interaction between HR/FD and DFG motifs, well structured hydrophobic spine and Lys42-Glu64 salt bridge interaction. These observations could possibly explain the underlying mechanism associated with the loss of kinase activity with T112M, D161N and P216S mutation in DAPK3. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. About a switch: how P-glycoprotein (ABCB1) harnesses the energy of ATP binding and hydrolysis to do mechanical work.

    PubMed

    Sauna, Zuben E; Ambudkar, Suresh V

    2007-01-01

    The efflux of drugs by the multidrug transporter P-glycoprotein (Pgp; ABCB1) is one of the principal means by which cancer cells evade chemotherapy and exhibit multidrug resistance. Mechanistic studies of Pgp-mediated transport, however, transcend the importance of this protein per se as they help us understand the transport pathway of the ATP-binding cassette proteins in general. The ATP-binding cassette proteins comprise one of the largest protein families, are central to cellular physiology, and constitute important drug targets. The functional unit of Pgp consists of two nucleotide-binding domains (NBD) and two transmembrane domains that are involved in the transport of drug substrates. Early studies postulated that conformational changes as a result of ATP hydrolysis were transmitted to the transmembrane domains bringing about drug transport. More recent structural and biochemical studies on the other hand suggested that ATP binds at the interface of the two NBDs and induces the formation of a closed dimer, and it has been hypothesized that this dimerization and subsequent ATP hydrolysis powers transport. Based on the mutational and biochemical work on Pgp and structural studies with isolated NBDs, we review proposed schemes for the catalytic cycle of ATP hydrolysis and the transport pathway.

  12. Relationship between a point mutation S97C in CK1δ protein and its affect on ATP-binding affinity.

    PubMed

    Kumar, Ambuj; Rajendran, Vidya; Sethumadhavan, Rao; Purohit, Rituraj

    2014-01-01

    CK1δ (Casein kinase I isoform delta) is a member of CK1 kinase family protein that mediates neurite outgrowth and the function as brain-specific microtubule-associated protein. ATP binding kinase domain of CK1δ is essential for regulating several key cell cycle signal transduction pathways. Mutation in CK1δ protein is reported to cause cancers and affects normal brain development. S97C mutation in kinase domain of CK1δ protein has been involved to induce breast cancer and ductal carcinoma. We performed molecular docking studies to examine the effect of this mutation on its ATP-binding affinity. Further, we conducted molecular dynamics simulations to understand the structural consequences of S97C mutation over the kinase domain of CK1δ protein. Docking results indicated the loss of ATP-binding affinity of mutant structure, which were further rationalized by molecular dynamics simulations, where a notable loss in 3-D conformation of CK1δ kinase domain was observed in mutant as compared to native. Our results explained the underlying molecular mechanism behind the observed cancer associated phenotype caused by S97C mutation in CK1δ protein.

  13. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul

    2002-10-01

    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters.

  14. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed Central

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul

    2002-01-01

    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters. PMID:12057006

  15. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Icyuz, Mert; Chauvet, Sylvain; Tao, Binli; Hartman, John L.; Kirk, Kevin L.

    2015-01-01

    The ABCC transporter subfamily includes pumps, the long and short multidrug resistance proteins (MRPs), and an ATP-gated anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR). We show that despite their thermodynamic differences, these ABCC transporter subtypes use broadly similar mechanisms to couple their extracellular gates to the ATP occupancies of their cytosolic nucleotide binding domains. A conserved extracellular phenylalanine at this gate was a prime location for producing gain of function (GOF) mutants of a long MRP in yeast (Ycf1p cadmium transporter), a short yeast MRP (Yor1p oligomycin exporter), and human CFTR channels. Extracellular gate mutations rescued ATP binding mutants of the yeast MRPs and CFTR by increasing ATP sensitivity. Control ATPase-defective MRP mutants could not be rescued by this mechanism. A CFTR double mutant with an extracellular gate mutation plus a cytosolic GOF mutation was highly active (single-channel open probability >0.3) in the absence of ATP and protein kinase A, each normally required for CFTR activity. We conclude that all 3 ABCC transporter subtypes use similar mechanisms to couple their extracellular gates to ATP occupancy, and highly active CFTR channels that bypass defects in ATP binding or phosphorylation can be produced.—Wei, S., Roessler, B. C., Icyuz, M., Chauvet, S., Tao, B., Hartman IV, J. L., Kirk, K. L. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels. PMID:26606940

  16. MicroRNA-19b promotes macrophage cholesterol accumulation and aortic atherosclerosis by targeting ATP-binding cassette transporter A1.

    PubMed

    Lv, Yun-Cheng; Tang, Yan-Yan; Peng, Juan; Zhao, Guo-Jun; Yang, Jing; Yao, Feng; Ouyang, Xin-Ping; He, Ping-Ping; Xie, Wei; Tan, Yu-Lin; Zhang, Min; Liu, Dan; Tang, Deng-Pei; Cayabyab, Francisco S; Zheng, Xi-Long; Zhang, Da-Wei; Tian, Guo-Ping; Tang, Chao-Ke

    2014-09-01

    Macrophage accumulation of cholesterol leads to foam cell formation which is a major pathological event of atherosclerosis. Recent studies have shown that microRNA (miR)-19b might play an important role in cholesterol metabolism and atherosclerotic diseases. Here, we have identified miR-19b binding to the 3'UTR of ATP-binding cassette transporter A1 (ABCA1) transporters, and further determined the potential roles of this novel interaction in atherogenesis. To investigate the molecular mechanisms involved in a miR-19b promotion of macrophage cholesterol accumulation and the development of aortic atherosclerosis. We performed bioinformatics analysis using online websites, and found that miR-19b was highly conserved during evolution and directly bound to ABCA1 mRNA with very low binding free energy. Luciferase reporter assay confirmed that miR-19b bound to 3110-3116 sites within ABCA1 3'UTR. MiR-19b directly regulated the expression levels of endogenous ABCA1 in foam cells derived from human THP-1 macrophages and mouse peritoneal macrophages (MPMs) as determined by qRT-PCR and western blot. Cholesterol transport assays revealed that miR-19b dramatically suppressed apolipoprotein AI-mediated ABCA1-dependent cholesterol efflux, resulting in the increased levels of total cholesterol (TC), free cholesterol (FC) and cholesterol ester (CE) as revealed by HPLC. The excretion of (3)H-cholesterol originating from cholesterol-laden MPMs into feces was decreased in mice overexpressing miR-19b. Finally, we evaluated the proatherosclerotic role of miR-19b in apolipoprotein E deficient (apoE(-/-)) mice. Treatment with miR-19b precursor reduced plasma high-density lipoprotein (HDL) levels, but increased plasma low-density lipoprotein (LDL) levels. Consistently, miR-19b precursor treatment increased aortic plaque size and lipid content, but reduced collagen content and ABCA1 expression. In contrast, treatment with the inhibitory miR-19b antisense oligonucleotides (ASO) prevented or

  17. Implications of cerebrovascular ATP-binding cassette transporter G1 (ABCG1) and apolipoprotein M in cholesterol transport at the blood-brain barrier.

    PubMed

    Kober, Alexandra Carmen; Manavalan, Anil Paul Chirackal; Tam-Amersdorfer, Carmen; Holmér, Andreas; Saeed, Ahmed; Fanaee-Danesh, Elham; Zandl, Martina; Albrecher, Nicole Maria; Björkhem, Ingemar; Kostner, Gerhard M; Dahlbäck, Björn; Panzenboeck, Ute

    2017-06-01

    Impaired cholesterol/lipoprotein metabolism is linked to neurodegenerative diseases such as Alzheimer's disease (AD). Cerebral cholesterol homeostasis is maintained by the highly efficient blood-brain barrier (BBB) and flux of the oxysterols 24(S)-hydroxycholesterol and 27-hydroxycholesterol, potent liver-X-receptor (LXR) activators. HDL and their apolipoproteins are crucial for cerebral lipid transfer, and loss of ATP binding cassette transporters (ABC)G1 and G4 results in toxic accumulation of oxysterols in the brain. The HDL-associated apolipoprotein (apo)M is positively correlated with pre-β HDL formation in plasma; its presence and function in the brain was thus far unknown. Using an in vitro model of the BBB, we examined expression, regulation, and functions of ABCG1, ABCG4, and apoM in primary porcine brain capillary endothelial cells (pBCEC). RT Q-PCR analyses and immunoblotting revealed that in addition to ABCA1 and scavenger receptor, class B, type I (SR-BI), pBCEC express high levels of ABCG1, which was up-regulated by LXR activation. Immunofluorescent staining, site-specific biotinylation and immunoprecipitation revealed that ABCG1 is localized both to early and late endosomes and on apical and basolateral plasma membranes. Using siRNA interference to silence ABCG1 (by 50%) reduced HDL-mediated [(3)H]-cholesterol efflux (by 50%) but did not reduce [(3)H]-24(S)-hydroxycholesterol efflux. In addition to apoA-I, pBCEC express and secrete apoM mainly to the basolateral (brain) compartment. HDL enhanced expression and secretion of apoM by pBCEC, apoM-enriched HDL promoted cellular cholesterol efflux more efficiently than apoM-free HDL, while apoM-silencing diminished cellular cholesterol release. We suggest that ABCG1 and apoM are centrally involved in regulation of cholesterol metabolism/turnover at the BBB. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Association of ATP binding cassette transporter G8 rs4148217 SNP and serum lipid levels in Mulao and Han nationalities.

    PubMed

    Li, Qing; Wei, Xian-Liang; Yin, Rui-Xing

    2012-05-01

    The association of ATP binding cassette transporter G8 gene (ABCG8) rs4148217 single nucleotide polymorphism (SNP) and serum lipid profiles is still controversial in diverse racial/ethnic groups. Mulao nationality is an isolated minority in China. The aim of this study was to evaluate the association of ABCG8 rs4148217 SNP and several environmental factors with serum lipid levels in the Guangxi Mulao and Han populations. A total of 634 subjects of Mulao nationality and 717 participants of Han nationality were randomly selected from our previous samples. Genotyping of the ABCG8 rs4148217 SNP was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. The genotypic and allelic frequencies of ABCG8 rs4148217 SNP were different between the two nationalities (P < 0.01 for each), the frequency of A allele was higher in Mulao than in Han. The A allele carriers in Han had lower high-density lipoprotein cholesterol (HDL-C) and apolipoprotein (Apo) A1 levels than the A allele noncarriers (P < 0.05 for each), whereas the A allele carriers in Mulao had lower ApoA1 levels than the A allele noncarriers (P < 0.05). Subgroup analyses showed that the A allele carriers in Han had lower HDL-C and higher triglyceride (TG) levels in females but not in males than the A allele noncarriers (P < 0.05 for each), and the A allele carriers in Mulao had lower ApoA1 levels in females but not in males than the A allele noncarriers (P < 0.05). The levels of TG and HDL-C in Han, and ApoA1 in Mulao were associated with genotypes in females but not in males (P < 0.05-0.01). Serum lipid parameters were also correlated with several environmental factors (P < 0.05-0.001). The ABCG8 rs4148217 SNP is associated with serum TG, HDL-C and ApoA1 levels in our study populations, but this association is different between the Mulao and Han populations. There is a sex (female

  19. Poloxamines display a multiple inhibitory activity of ATP-binding cassette (ABC) transporters in cancer cell lines.

    PubMed

    Cuestas, María L; Sosnik, Alejandro; Mathet, Verónica L

    2011-08-01

    Primary hepatocellular carcinoma is the third most common fatal cancer worldwide with more than 500,000 annual deaths. Approximately 40% of the patients with HCC showed tumoral overexpression of transmembrane proteins belonging to the ATP-binding cassette protein superfamily (ABC) which pump drugs out of cells. The overexpression of these efflux transporters confers on the cells a multiple drug resistance phenotype, which is considered a crucial cause of treatment refractoriness in patients with cancer. The aim of this study was to investigate the inhibitory effect of different concentrations of pH- and temperature-responsive X-shaped poly(ethylene oxide)-poly(propylene oxide) block copolymers (poloxamines, Tetronic, PEO-PPO) showing a wide range of molecular weights and EO/PO ratios on the functional activity of three different ABC proteins, namely P-glycoprotein (P-gp or MDR1), breast cancer resistance protein (BCRP), and multidrug resistance-associated protein MRP1, in two human hepatocarcinoma cell lines, HepG2 and Huh7. First, the cytotoxicity of the different copolymers (at different concentrations) on both liver carcinoma cell lines was thoroughly evaluated by means of apoptosis analysis using annexin V and propidium iodide (PI). Thus, viable cells (AV-/PI-), early apoptotic cells (AV+/PI-) and late apoptotic cells (V-FITC+/PI+) were identified. Results pointed out copolymers of intermediate to high hydrophobicity and intermediate molecular weight (e.g., T904) as the most cytotoxic. Then, DiOC2, rhodamine 123 and vinblastine were used as differential substrates of these pumps. HeLa, an epithelial cell line of human cervical cancer that does not express P-gp, was used exclusively as a control and enabled the discerning between P-gp and MRP1 inhibition. Moderate to highly hydrophobic poloxamines T304, T904 and T1301 showed inhibitory activity against P-gp and BCRP but not against MRP1 in both hepatic cell lines. A remarkable dependence of this effect on the

  20. Up-Regulation of the ATP-Binding Cassette Transporter A1 Inhibits Hepatitis C Virus Infection

    PubMed Central

    Gondeau, Claire; Douam, Florian; Lebreton, Stéphanie; Lagaye, Sylvie; Pol, Stanislas; Helle, François; Plengpanich, Wanee; Guérin, Maryse; Bourgine, Maryline; Michel, Marie Louise; Lavillette, Dimitri; Roingeard, Philippe; le Goff, Wilfried; Budkowska, Agata

    2014-01-01

    Hepatitis C virus (HCV) establishes infection using host lipid metabolism pathways that are thus considered potential targets for indirect anti-HCV strategies. HCV enters the cell via clathrin-dependent endocytosis, interacting with several receptors, and virus-cell fusion, which depends on acidic pH and the integrity of cholesterol-rich domains of the hepatocyte membrane. The ATP-binding Cassette Transporter A1 (ABCA1) mediates cholesterol efflux from hepatocytes to extracellular Apolipoprotein A1 and moves cholesterol within cell membranes. Furthermore, it generates high-density lipoprotein (HDL) particles. HDL protects against arteriosclerosis and cardiovascular disease. We show that the up-regulation of ABCA1 gene expression and its cholesterol efflux function in Huh7.5 hepatoma cells, using the liver X receptor (LXR) agonist GW3965, impairs HCV infection and decreases levels of virus produced. ABCA1-stimulation inhibited HCV cell entry, acting on virus-host cell fusion, but had no impact on virus attachment, replication, or assembly/secretion. It did not affect infectivity or properties of virus particles produced. Silencing of the ABCA1 gene and reduction of the specific cholesterol efflux function counteracted the inhibitory effect of the GW3965 on HCV infection, providing evidence for a key role of ABCA1 in this process. Impaired virus-cell entry correlated with the reorganisation of cholesterol-rich membrane microdomains (lipid rafts). The inhibitory effect could be reversed by an exogenous cholesterol supply, indicating that restriction of HCV infection was induced by changes of cholesterol content/distribution in membrane regions essential for virus-cell fusion. Stimulation of ABCA1 expression by GW3965 inhibited HCV infection of both human primary hepatocytes and isolated human liver slices. This study reveals that pharmacological stimulation of the ABCA1-dependent cholesterol efflux pathway disrupts membrane cholesterol homeostasis, leading to the

  1. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in sea lamprey and Japanese lamprey.

    PubMed

    Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming

    2015-06-06

    Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC

  2. Characterization and expression profiling of ATP-binding cassette transporter genes in the diamondback moth, Plutella xylostella (L.).

    PubMed

    Qi, Weiping; Ma, Xiaoli; He, Weiyi; Chen, Wei; Zou, Mingmin; Gurr, Geoff M; Vasseur, Liette; You, Minsheng

    2016-09-27

    ATP-binding cassette (ABC) transporters are one of the major transmembrane protein families found in all organisms and play important roles in transporting a variety of compounds across intra and extra cellular membranes. In some species, ABC transporters may be involved in the detoxification of substances such as insecticides. The diamondback moth, Plutella xylostella (L.), a destructive pest of cruciferous crops worldwide, is an important species to study as it is resistant to many types of insecticides as well as biological control Bacillus thuringiensis toxins. A total of 82 ABC genes were identified from our published P. xylostella genome, and grouped into eight subfamilies (ABCA-H) based on phylogenetic analysis. Genes of subfamilies ABCA, ABCC and ABCH were found to be expanded in P. xylostella compared with those in Bombyx mori, Manduca sexta, Heliconius melpomene, Danaus plexippus, Drosophila melanogaster, Tetranychus urticae and Homo sapiens. Phylogenetic analysis indicated that many of the ABC transporters in P. xylostella are orthologous to the well-studied ABC transporter genes in the seven other species. Transcriptome- and qRT-PCR-based analysis elucidated physiological effects of ABC gene expressions of P. xylostella which were developmental stage- and tissue-specific as well as being affected by whether or not the insects were from an insecticide-resistant strain. Two ABCC and one ABCA genes were preferentially expressed in midgut of the 4th-instar larvae of a susceptible strain (Fuzhou-S) suggesting their potential roles in metabolizing plant defensive chemicals. Most of the highly expressed genes in insecticide-resistant strains were also predominantly expressed in the tissues of Malpighian tubules and midgut. This is the most comprehensive study on identification, characterization and expression profiling of ABC transporter genes in P. xylostella to date. The diversified features and expression patterns of this gene family may be associated with

  3. Human small cell lung cancer NYH cells selected for resistance to the bisdioxopiperazine topoisomerase II catalytic inhibitor ICRF-187 demonstrate a functional R162Q mutation in the Walker A consensus ATP binding domain of the alpha isoform.

    PubMed

    Wessel, I; Jensen, L H; Jensen, P B; Falck, J; Rose, A; Roerth, M; Nitiss, J L; Sehested, M

    1999-07-15

    Bisdioxopiperazine drugs such as ICRF-187 are catalytic inhibitors of DNA topoisomerase II, with at least two effects on the enzyme: namely, locking it in a closed-clamp form and inhibiting its ATPase activity. This is in contrast to topoisomerase II poisons as etoposide and amsacrine (m-AMSA), which act by stabilizing enzyme-DNA-drug complexes at a stage in which the DNA gate strand is cleaved and the protein is covalently attached to DNA. Human small cell lung cancer NYH cells selected for resistance to ICRF-187 (NYH/187) showed a 25% increase in topoisomerase IIalpha level and no change in expression of the beta isoform. Sequencing of the entire topoisomerase IIalpha cDNA from NYH/187 cells demonstrated a homozygous G-->A point mutation at nucleotide 485, leading to a R162Q conversion in the Walker A consensus ATP binding site (residues 161-165 in the alpha isoform), this being the first drug-selected mutation described at this site. Western blotting after incubation with ICRF-187 showed no depletion of the alpha isoform in NYH/187 cells in contrast to wild-type (wt) cells, whereas equal depletion of the beta isoform was observed in the two sublines. Alkaline elution assay demonstrated a lack of inhibition of etoposide-induced DNA single-stranded breaks in NYH/187 cells, whereas this inhibition was readily apparent in NYH cells. Site-directed mutagenesis in human topoisomerase IIalpha introduced into a yeast Saccharomyces cerevisiae strain with a temperature-conditional yeast TOP2 mutant demonstrated that R162Q conferred resistance to the bisdioxopiperazines ICRF-187 and -193 but not to etoposide or m-AMSA. Both etoposide and m-AMSA induced more DNA cleavage with purified R162Q enzyme than with the wt. The R162Q enzyme has a 20-25% decreased catalytic capacity compared to the wt and was almost inactive at <0.25 mM ATP compared to the wt. Kinetoplast DNA decatenation by the R162Q enzyme at 1 mM ATP was not resistant to ICRF-187 compared to wt, whereas it was

  4. Site and size of multiple sclerosis lesions predict enhanced or decreased female orgasmic function.

    PubMed

    Winder, Klemens; Seifert, Frank; Koehn, Julia; Deutsch, Martina; Engelhorn, Tobias; Dörfler, Arnd; Lee, De-Hyung; Linker, Ralf A; Hilz, Max J

    2015-12-01

    Neuroimaging identified brain areas involved in female orgasm. In women with multiple sclerosis (MS), associations between orgasmic function and the site and size of MS-related magnetic resonance imaging (MRI) changes are undetermined. This study intended to correlate MS-associated cerebral lesion load and location with clinical scores of female orgasmic function. In 50 women with MS (mean age 37.0 ± 9.9 years), we assessed Female Sexual Function Index (FSFI) scores for orgasmic frequency, difficulty and satisfaction. We determined disease duration, Expanded Disability Status Scale (EDSS) scores, and cerebral MS-lesion load and location using T2-weighed 1.5 T MRIs. We correlated FSFI scores for orgasm with patient age, disease duration, EDSS scores, and cerebral MS-lesion load (Spearman rank correlation; significance: p < 0.05). FSFI scores for orgasm correlated inversely with MS-lesion load in the left temporal periventricular white matter and right middle-inferior occipital area, but directly with MS-lesion load in the right frontal primary motor cortex, left prefrontal/inferior frontal cortex, right amygdala, left temporal middle-inferior and fusiform areas, and midbrain. FSFI scores for orgasm did not correlate with patient age, disease duration and EDSS scores (p > 0.05). In conclusion, our results indicate that MS-lesions in left temporal periventricular and right visual association areas deteriorate orgasmic function. In contrast, direct correlations between frontotemporal or midbrain lesions and higher FSFI scores, indicating enhanced or disinhibited orgasmic function, suggest that these brain regions normally buffer orgasmic responses. Moreover, our results indicate that orgasmic dysfunction in women with MS evolves independently of disease duration and physical disability.

  5. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  6. ATP binding and hydrolysis disrupt the high-affinity interaction between the heme ABC transporter HmuUV and its cognate substrate-binding protein.

    PubMed

    Qasem-Abdullah, Hiba; Perach, Michal; Livnat-Levanon, Nurit; Lewinson, Oded

    2017-09-01

    Using the energy of ATP hydrolysis, ABC transporters catalyze the trans-membrane transport of molecules. In bacteria, these transporters partner with a high-affinity substrate-binding protein (SBP) to import essential micronutrients. ATP binding by Type I ABC transporters (importers of amino acids, sugars, peptides, and small ions) stabilizes the interaction between the transporter and the SBP, thus allowing transfer of the substrate from the latter to the former. In Type II ABC transporters (importers of trace elements, e.g. vitamin B12, heme, and iron-siderophores) the role of ATP remains debatable. Here we studied the interaction between the Yersinia pestis ABC heme importer (HmuUV) and its partner substrate-binding protein (HmuT). Using real-time surface plasmon resonance experiments and interaction studies in membrane vesicles, we find that in the absence of ATP the transporter and the SBP tightly bind. Substrate in excess inhibits this interaction, and ATP binding by the transporter completely abolishes it. To release the stable docked SBP from the transporter hydrolysis of ATP is required. Based on these results we propose a mechanism for heme acquisition by HmuUV-T where the substrate-loaded SBP docks to the nucleotide-free outward-facing conformation of the transporter. ATP binding leads to formation of an occluded state with the substrate trapped in the trans-membrane translocation cavity. Subsequent ATP hydrolysis leads to substrate delivery to the cytoplasm, release of the SBP, and resetting of the system. We propose that other Type II ABC transporters likely share the fundamentals of this mechanism. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

    PubMed Central

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.

    2014-01-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922

  8. Structural Models of Zebrafish (Danio rerio) NOD1 and NOD2 NACHT Domains Suggest Differential ATP Binding Orientations: Insights from Computational Modeling, Docking and Molecular Dynamics Simulations

    PubMed Central

    Maharana, Jitendra; Sahoo, Bikash Ranjan; Bej, Aritra; Sahoo, Jyoti Ranjan; Dehury, Budheswar; Patra, Mahesh Chandra; Martha, Sushma Rani; Balabantray, Sucharita; Pradhan, Sukanta Kumar; Behera, Bijay Kumar

    2015-01-01

    Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) and NOD2 are cytosolic pattern recognition receptors playing pivotal roles in innate immune signaling. NOD1 and NOD2 recognize bacterial peptidoglycan derivatives iE-DAP and MDP, respectively and undergoes conformational alternation and ATP-dependent self-oligomerization of NACHT domain followed by downstream signaling. Lack of structural adequacy of NACHT domain confines our understanding about the NOD-mediated signaling mechanism. Here, we predicted the structure of NACHT domain of both NOD1 and NOD2 from model organism zebrafish (Danio rerio) using computational methods. Our study highlighted the differential ATP binding modes in NOD1 and NOD2. In NOD1, γ-phosphate of ATP faced toward the central nucleotide binding cavity like NLRC4, whereas in NOD2 the cavity was occupied by adenine moiety. The conserved ‘Lysine’ at Walker A formed hydrogen bonds (H-bonds) and Aspartic acid (Walker B) formed electrostatic interaction with ATP. At Sensor 1, Arg328 of NOD1 exhibited an H-bond with ATP, whereas corresponding Arg404 of NOD2 did not. ‘Proline’ of GxP motif (Pro386 of NOD1 and Pro464 of NOD2) interacted with adenine moiety and His511 at Sensor 2 of NOD1 interacted with γ-phosphate group of ATP. In contrast, His579 of NOD2 interacted with the adenine moiety having a relatively inverted orientation. Our findings are well supplemented with the molecular interaction of ATP with NLRC4, and consistent with mutagenesis data reported for human, which indicates evolutionary shared NOD signaling mechanism. Together, this study provides novel insights into ATP binding mechanism, and highlights the differential ATP binding modes in zebrafish NOD1 and NOD2. PMID:25811192

  9. [The effect of soy isoflavones on ATP binding cassette A1 expression level in rats without ovaries with atherosclerotic plaque].

    PubMed

    Li, Xian-biao; Ji, Li-li; Li, Yong; Zhang, Yu-mei

    2009-10-01

    To study the effect of soy isoflavones (SI) on ATP binding cassette A1 (ABCA1) expression in rats without ovary with atherosclerosis. After they were raised for a week by given basic feed, the ovaries of 50 12-week old SPF rats were removed. The rats were randomly divided into groups by weight. Ten rats were selected as the basic control group (A) that basic feed was given all through the research. The other 40 rats were given high-fat diets and at the end of 4 weeks, these rats were randomly divided into four groups by blood lipid level: atherosclerotic model group (B) that was given high-fat diets through the research, low isoflavones group (C) that was given high-fat diets plus 30 mg/kg SI, middle isoflavones group (D) that was given high-fat diets plus 90 mg/kg SI, and high isoflavones group (E) that was given high-fat diets plus 270 mg/kg SI. After 22 weeks, all rats were executed to measure morphological change on the aorta wall, assessing the ABCA1 gene expression in aorta wall by real-time PCR and protein expression by Western blotting in aorta wall, small intestine and liver. Serum lipid level of A, B, C, D, E groups: TC levels were (6.82 +/- 0.22), (15.73 +/- 1.51), (10.77 +/- 1.12), (9.95 +/- 1.18), (9.11 +/- 1.12) mmol/L respectively (F = 72.882, P < 0.01); TG levels were: (2.49 +/- 0.24), (0.78 +/- 0.13), (0.39 +/- 0.08), (0.29 +/- 0.09), (0.24 +/- 0.09) mmol/L respectively (F = 378.515, P < 0.01); LDL-C levels were (1.29 +/- 0.08), (14.76 +/- 1.23), (8.18 +/- 0.80), (7.85 +/- 0.72), (7.16 +/- 0.64)mmol/L respectively (F = 320.936, P < 0.01); HDL-C levels were (1.94 +/- 0.18), (1.04 +/- 0.10), (1.55 +/- 0.14), (1.88 +/- 0.17), (2.11 +/- 0.22) mmol/L respectively (F = 49.450, P < 0.01). ABCA1 protein expression in intestine, liver and aorta: for A, B, C, E groups in intestine were 96.577 +/- 9.743, 5.218 +/- 2.048, 18.060 +/- 5.179, 54.725 +/- 8.960, respectively (F = 172.272, P < 0.01); ABCA1 protein expression in liver of groups of A, B, C, E were: 13

  10. Evaluation of the role of ATP-binding cassette transporters as a defence mechanism against temephos in populations of Aedes aegypti

    PubMed Central

    Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim, Modesto Leite

    2014-01-01

    The role of ATP-binding cassette (ABC) transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM). The best result in the series was obtained with the addition of verapamil (40 μM), which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.

  11. NpPDR1, a pleiotropic drug resistance-type ATP-binding cassette transporter from Nicotiana plumbaginifolia, plays a major role in plant pathogen defense.

    PubMed

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc

    2005-09-01

    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family.

  12. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense1

    PubMed Central

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc

    2005-01-01

    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865

  13. Generalised anhidrosis: different lesion sites demonstrated by microneurography and skin biopsy.

    PubMed

    Donadio, V; Montagna, P; Nolano, M; Cortelli, P; Misciali, C; Pierangeli, G; Provitera, V; Casano, A; Baruzzi, A; Liguori, R

    2005-04-01

    Generalised anhidrosis (GA) shows a uniform clinical picture whether the pathogenesis involves intrinsic abnormalities of sweat glands or postganglionic sympathetic cholinergic nerve dysfunction. We describe two patients who presented intolerance to heat and anhidrosis. In the first patient, symptoms started at 33 years of age, and were associated with absent tendon reflexes and a mydriatic right pupil unreactive to light. The other patient had been unable to sweat since birth. GA was diagnosed on the basis of clinical findings and thermoregulatory tests. Microneurography and morphological analysis of the skin and its innervation disclosed a different lesion site underlying GA in the two patients, and distinguished between a postganglionic autonomic nerve fibre lesion and sweat gland dysfunction.

  14. Behavioral patterns and lesion sites associated with impaired processing of lexical and conceptual knowledge of actions.

    PubMed

    Kemmerer, David; Rudrauf, David; Manzel, Ken; Tranel, Daniel

    2012-07-01

    To further investigate the neural substrates of lexical and conceptual knowledge of actions, we administered a battery of six tasks to 226 brain-damaged patients with widely distributed lesions in the left and right cerebral hemispheres. The tasks probed lexical and conceptual knowledge of actions in a variety of verbal and non-verbal ways, including naming, word-picture matching, attribute judgments involving both words and pictures, and associative comparisons involving both words and pictures. Of the 226 patients who were studied, 61 failed one or more of the six tasks, with four patients being impaired on the entire battery, and varied numbers of patients being impaired on varied combinations of tasks. Overall, the 61 patients manifested a complex array of associations and dissociations across the six tasks. The lesion sites of 147 of the 226 patients were also investigated, using formal methods for lesion-deficit statistical mapping and power analysis of lesion overlap maps. Significant effects for all six tasks were found in the following left-hemisphere regions: the inferior frontal gyrus; the ventral precentral gyrus, extending superiorly into what are likely to be hand-related primary motor and premotor areas; and the anterior insula. In addition, significant effects for 4-5 tasks were found in not only the regions just mentioned, but also in several other left-hemisphere areas: the ventral postcentral gyrus; the supramarginal gyrus; and the posterior middle temporal gyrus. These results converge with previous research on the neural underpinnings of action words and concepts. However, the current study goes considerably beyond most previous investigations by providing extensive behavioral and lesion data for an unusually large and diverse sample of brain-damaged patients, and by incorporating multiple measures of verb comprehension. Regarding theoretical implications, the study provides new support for the Embodied Cognition Framework, which maintains that

  15. A survey of injection site lesions in fed cattle in Canada.

    PubMed Central

    Van Donkersgoed, J; Dixon, S; Brand, G; VanderKop, M

    1997-01-01

    During November 1996 to January 1997, a survey was conducted at 5 Canadian purveyors to measure the prevalence of injection site lesions in the top butt, boneless blade, outside round, inside round, and eye of the round. As trimmers were cutting these subprimals into steaks, technicians monitored each steak for grossly obvious scars. These scars were trimmed, weighed, and scored as either a "clear scar," "woody callus," or "cyst." All scars were subsequently examined histologically and classified as a "clear scar," "woody callus," "scar with nodules," "mineralized scar," or "cyst." Pieces were observed for broken needles while being processed and none were found. The estimated prevalence of injection site lesions was 18.8% (95% CI, 16.4% to 21.2%) in top butts, 22.2% (95% CI, 18.8% to 25.7%) in boneless blades, 4.9% (95% CI, 3.6% to 6.3%) in the eye of round, 1.8% (95% CI, 1.1% to 2.9%) in the inside round, and 7.6% (95% CI, 5.6% to 9.8%) in the outside round. Some top butts originated from American fed cattle; the estimated prevalence of lesions was 9.0% (95% CI, 5.9% to 12.9%) in American top butts and 22.3% (95% CI, 19.4% to 25.3%) in Canadian top butts. The median weight of the lesions varied among subprimals and ranged from 64 g to 117 g. Histologically, 13% of the scars were clear scars, 47% were woody calluses, 5% were mineralized scars, 34% were scars with nodules, 0.2% were cysts, and 0.9% were normal fat infiltrations. An economic analysis estimated an average loss of $8.95 per fed animal processed or $19 million dollars annually to the Canadian beef industry from injection scars. PMID:9426942

  16. Utility of rapid on-site cytologic evaluation during endobronchial ultrasound with a guide sheath for peripheral pulmonary lesions.

    PubMed

    Izumo, Takehiro; Matsumoto, Yuji; Sasada, Shinji; Chavez, Christine; Nakai, Toshiyuki; Tsuchida, Takaaki

    2017-03-01

    The utility of rapid on-site evaluation during endobronchial ultrasound with a guide sheath for peripheral pulmonary lesions is unclear. The aim of this study was to evaluate the role of rapid on-site evaluation during endobronchial ultrasound with a guide sheath for peripheral pulmonary lesions. Consecutive patients who underwent endobronchial ultrasound with a guide sheath for the diagnosis of peripheral pulmonary lesions at our hospital between September 2012 and July 2014 were included in this retrospective study. Cytology slides were air-dried, and modified Giemsa (Diff-Quik) staining was used for rapid on-site evaluation. Additional smears were prepared for Papanicolaou staining and tissue samples were placed in formalin for histologic evaluation. The results of rapid on-site evaluation were compared with the final diagnoses of endobronchial ultrasound with a guide sheath. A total of 718 cases were included in the study population. The sensitivity, specificity, positive predictive value, negative predictive value and diagnostic accuracy of rapid on-site evaluation during endobronchial ultrasound with a guide sheath for peripheral pulmonary lesions was 88.6%, 65.9%, 81.2%, 77.7% and 80.1%, respectively. There were no procedure-related deaths. Rapid on-site evaluation during endobronchial ultrasound with a guide sheath had high sensitivity for peripheral pulmonary lesions. When carrying out rapid on-site evaluation of transbronchial biopsy samples from peripheral pulmonary lesions, careful interpretation and clinical correlation are necessary.

  17. Decipher the Mechanisms of Protein Conformational Changes Induced by Nucleotide Binding through Free-Energy Landscape Analysis: ATP Binding to Hsp70

    PubMed Central

    Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

    2013-01-01

    ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins

  18. Radioguided occult lesion localization: better delineation of the injection site with a high-resolution collimator

    NASA Astrophysics Data System (ADS)

    Geissler, B.; De Freitas, D.; Cachin, F.; Mestas, D.; Lebouedec, G.; Maublant, J.

    2004-07-01

    Aim: Radioguided Occult Lesion Localization (ROLL) is a method for guiding the excision of occult breast lesions. A radiotracer is injected preoperatively in the tumor. The surgeon can locate the lesion with a gamma probe. It has been recommended that the tissue is resected where the activity falls rapidly. But this cut-off level can fluctuate depending on the user. The aim of this study was to compare the accuracy of two different types of collimation. Materials and methods: To simulate the detection of a radioactive "lesion", 0.2 ml of a solution of 99mTc labeled colloids (4 MBq) were deposited at 3 cm depth in a chunk of cow muscle. Detection was performed with a gamma probe (GammaSup, Clerad, F) equipped either with a regular or with an additional high-resolution collimator. The response curve was drawn moving laterally the probe on the chunk of cow by 5 mm steps. Edges of resection were determined with different cut-off levels (from 5 to 50% of maximum counts by 5% steps). Results: Without additional collimator, the mean distance between injection point and resection edge was 18 mm, standard deviation 7.8 mm with a range between 11 and 18 mm. With additional collimator, the mean distance decreased to 10 mm (-44%), standard deviation 4.2 mm (-46%) with a range between 6 and 10 mm. Conclusion: The results demonstrate that the additional collimator provides more precise and reproductive delineation of the injection site. It should be optimal for the ROLL technique.

  19. Infrapatellar Straps Decrease Patellar Tendon Strain at the Site of the Jumper’s Knee Lesion

    PubMed Central

    Lavagnino, Michael; Arnoczky, Steven P.; Dodds, Julie; Elvin, Niell

    2011-01-01

    Background: The impetus for the use of patellar straps in the treatment of patellar tendinopathy has largely been based on empirical evidence and not on any mechanistic rationale. A computational model suggests that patellar tendinopathy may be a result of high localized tendon strains that occur at smaller patella–patellar tendon angles (PPTAs). Hypothesis: Infrapatellar straps will decrease the mean localized computational strain in the area of the patellar tendon commonly involved in jumper’s knee by increasing the PPTA. Study Design: Controlled laboratory study. Methods: Twenty adult males had lateral weightbearing and nonweightbearing radiographs of their knees taken with and without 1 of 2 infrapatellar straps at 60° of knee flexion. Morphologic measurements of PPTA and patellar tendon length with and without the straps were used as input data into a previously described computational model to calculate average and maximum strain at the common location of the jumper’s knee lesion during a simulated jump landing. Results: The infrapatellar bands decreased the predicted localized strain (average and maximum) in the majority of participants by increasing PPTA and/or decreasing patellar tendon length. When both PPTA and patellar tendon length were altered by the straps, there was a strong and significant correlation with the change in predicted average localized strain with both straps. Conclusion: Infrapatellar straps may limit excessive patella tendon strain at the site of the jumper’s knee lesion by increasing PPTA and decreasing patellar tendon length rather than by correcting some inherent anatomic or functional abnormality in the extensor apparatus. Clinical Relevance: The use of infrapatellar straps may help prevent excessive localized tendon strains at the site of the jumper’s knee lesion during a jump landing. PMID:23016021

  20. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    PubMed

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  1. Elevated rates of force development and MgATP binding in F764L and S532P myosin mutations causing dilated cardiomyopathy.

    PubMed

    Palmer, Bradley M; Schmitt, Joachim P; Seidman, Christine E; Seidman, J G; Wang, Yuan; Bell, Stephen P; Lewinter, Martin M; Maughan, David W

    2013-04-01

    Dilated cardiomyopathy (DCM) is a disease characterized by dilation of the ventricular chambers and reduced contractile function. We examined the contractile performance of chemically-skinned ventricular strips from two heterozygous murine models of DCM-causing missense mutations of myosin, F764L/+ and S532P/+, in an α-myosin heavy chain (MyHC) background. In Ca(2+)-activated skinned myocardial strips, the maximum developed tension in F764L/+ was only ~50% that of litter-mate controls (+/+). The F764L/+ also exhibited significantly reduced rigor stiffness, loaded shortening velocity and power output. Corresponding indices for S532P/+ strips were not different from controls. Manipulation of MgATP concentration in conjunction with measures of viscoelasticity, which provides estimates of myosin detachment rate 2πc, allowed us to probe the molecular basis of changes in crossbridge kinetics that occur with the myosin mutations. By examining the response of detachment rate to varying MgATP we found the rate of MgADP release was unaffected by the myosin mutations. However, MgATP binding rate was higher in the DCM groups compared to controls (422±109mM(-1)·s(-1) in F764L/+, 483±74mM(-1)·s(-1) in S532P/+ and 303±18mM(-1)·s(-1) in +/+). In addition, the rate constant of force development, 2πb, was significantly higher in DCM groups compared to controls (at 5mM MgATP: 36.9±4.9s(-1) in F764L/+, 32.9±4.5s(-1) in S532P/+ and 18.2±1.7s(-1) in +/+). These results suggest that elevated rates of force development and MgATP binding are features of cardiac myofilament function that underlie the development of DCM.

  2. Maltose-binding protein effectively stabilizes the partially closed conformation of the ATP-binding cassette transporter MalFGK2.

    PubMed

    Weng, Jingwei; Gu, Shuo; Gao, Xin; Huang, Xuhui; Wang, Wenning

    2017-04-05

    Maltose transporter MalFGK2 is a type-I importer in the ATP-binding cassette (ABC) transporter superfamily. Upon the binding of its periplasmic binding protein, MalE, the ATPase activity of MalFGK2 can be greatly enhanced. Crystal structures of the MalFGK2-MalE-maltose complex in a so-called "pretranslocation" ("pre-T") state with a partially closed conformation suggest that the formation of this MalE-stabilized intermediate state is a key step leading to the outward-facing catalytic state. On the contrary, crosslinking and fluorescence studies suggest that ATP binding alone is sufficient to promote the outward-facing catalytic state, thereby doubting the role of MalE binding. To clarify the role of MalE binding and to gain deeper understanding of the molecular mechanisms of MalFGK2, we calculated the free energy surfaces (FESs) related to the lateral motion in the presence and absence of MalE using atomistic metadynamics simulations. The results showed that, in the absence of MalE, laterally closing motion was energetically forbidden but, upon MalE binding, more closed conformations similar to the pre-T state become more stable. The significant effect of MalE binding on the free energy landscapes was in agreement with crystallographic studies and confirmed the important role of MalE in stabilizing the pre-T state. Our simulations also revealed that the allosteric effect of MalE stimulation originates from the MalE-binding-promoted vertical motion between MalF and MalG cores, which was further supported by MD simulation of the MalE-independent mutant MalF500.

  3. An ATP-Binding Cassette Transporter and Two rRNA Methyltransferases Are Involved in Resistance to Avilamycin in the Producer Organism Streptomyces viridochromogenes Tü57

    PubMed Central

    Weitnauer, Gabriele; Gaisser, Sibylle; Trefzer, Axel; Stockert, Sigrid; Westrich, Lucy; Quiros, Luis M.; Mendez, Carmen; Salas, Jose A.; Bechthold, Andreas

    2001-01-01

    Three different resistance factors from the avilamycin biosynthetic gene cluster of Streptomyces viridochromogenes Tü57, which confer avilamycin resistance when expressed in Streptomyces lividans TK66, were isolated. Analysis of the deduced amino acid sequences showed that AviABC1 is similar to a large family of ATP-binding transporter proteins and that AviABC2 resembles hydrophobic transmembrane proteins known to act jointly with the ATP-binding proteins. The deduced amino acid sequence of aviRb showed similarity to those of other rRNA methyltransferases, and AviRa did not resemble any protein in the databases. Independent expression in S. lividans TK66 of aviABC1 plus aviABC2, aviRa, or aviRb conferred different levels of resistance to avilamycin: 5, 10, or 250 μg/ml, respectively. When either aviRa plus aviRb or aviRa plus aviRb plus aviABC1 plus aviABC2 was coexpressed in S. lividans TK66, avilamycin resistance levels reached more than 250 μg/ml. Avilamycin A inhibited poly(U)-directed polyphenylalanine synthesis in an in vitro system using ribosomes of S. lividans TK66(pUWL201) (GWO), S. lividans TK66(pUWL201-Ra) (GWRa), or S. lividans TK66(pUWL201-Rb) (GWRb), whereas ribosomes of S. lividans TK66 containing pUWL201-Ra+Rb (GWRaRb) were highly resistant. aviRa and aviRb were expressed in Escherichia coli, and both enzymes were purified as fusion proteins to near homogeneity. Both enzymes showed rRNA methyltransferase activity using a mixture of 16S and 23S rRNAs from E. coli as the substrate. Coincubation experiments revealed that the enzymes methylate different positions of rRNA. PMID:11181344

  4. Reversible transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense of downhill ethidium uptake.

    PubMed

    Balakrishnan, Lekshmy; Venter, Henrietta; Shilling, Richard A; van Veen, Hendrik W

    2004-03-19

    The ATP dependence of ATP-binding cassette (ABC) transporters has led to the widespread acceptance that these systems are unidirectional. Interestingly, in the presence of an inwardly directed ethidium concentration gradient in ATP-depleted cells of Lactococcus lactis, the ABC multidrug transporter LmrA mediated the reverse transport (or uptake) of ethidium with an apparent K(t) of 2.0 microm. This uptake reaction was competitively inhibited by the LmrA substrate vinblastine and was significantly reduced by an E314A substitution in the membrane domain of the transporter. Similar to efflux, LmrA-mediated ethidium uptake was inhibited by the E512Q replacement in the Walker B region of the nucleotide-binding domain of the protein, which strongly reduced its drug-stimulated ATPase activity, consistent with published observations for other ABC transporters. The notion that ethidium uptake is coupled to the catalytic cycle in LmrA was further corroborated by studies in LmrA-containing cells and proteoliposomes in which reverse transport of ethidium was associated with the net synthesis of ATP. Taken together, these data demonstrate that the conformational changes required for drug transport by LmrA are (i) not too far from equilibrium under ATP-depleted conditions to be reversed by appropriate changes in ligand concentrations and (ii) not necessarily coupled to ATP hydrolysis, but associated with a reversible catalytic cycle. These findings and their thermodynamic implications shed new light on the mechanism of energy coupling in ABC transporters and have implications for the development of new modulators that could enable reverse transport-associated drug delivery in cells through their ability to uncouple ATP binding/hydrolysis from multidrug efflux.

  5. The human malaria parasite Plasmodium falciparum exports the ATP-binding cassette protein PFGCN20 to membrane structures in the host red blood cell.

    PubMed

    Bozdech, Z; VanWye, J; Haldar, K; Schurr, E

    1998-11-30

    PFGCN20 is a member of the ATP-binding cassette family of proteins that is closely related to the yeast translational regulator Gcn20p. We have generated a polyclonal antibody against the N-terminal region of PFGCN20 and studied the cellular localization of PFGCN20 throughout the erythrocytic life cycle of Plasmodium falciparum. PFGCN20 was found to be present at all stages and a pronounced export of PFGCN20 into the erythrocyte was observed in the trophozoite and schizont stages. In the indirect immunofluorescence assay, PFGCN20 was found to display significant colocalization with antigens detected by the monoclonal antibody 41E11. In contrast, there was only a minimal overlap of PFGCN20 localization with EMP2 and HRP2. Immunoelectron microscopy demonstrated a pronounced accumulation of PFGCN20 in the lumen of the parasitophorous vacuole and deconvolution fluorescence microscopy showed membrane association with selective regions of a tubovesicular network in the red cell. We also observed a concentration of PFGCN20 in electron-dense plaques just underneath the parasite's plasma membrane and an association of PFGCN20 with cytoplasmic vesicular structures within the parasite. The observed export of PFGCN20 and its association with the tubovesicular network in host red cells, may be indicative of the fact that PFGCN20 functions as ATP-binding subunit of an unknown multimeric ABC-transporter. The cytoplasmic localization of PFGCN20 in the parasite, however, suggests that the involvement of PFGCN20 in translational regulation or other cytoplasmic biological functions cannot be ruled out.

  6. A novel ATP-binding cassette transporter is responsible for resistance to viologen herbicides in the cyanobacterium Synechocystis sp. PCC 6803.

    PubMed

    Prosecka, Jana; Orlov, Artem V; Fantin, Yuri S; Zinchenko, Vladislav V; Babykin, Michael M; Tichy, Martin

    2009-08-01

    The charged quaternary ammonium compounds--methyl, ethyl and benzyl viologens--generate reactive oxygen species in photosynthetic cells. Three independent methyl viologen-resistant spontaneous mutants of Synechocystis sp. PCC 6803 were identified, in which the conserved R115 residue of the Slr1174 protein was replaced with G115, L115 and C115. The Slr1174 protein of the DUF990 family is related to the permease subunit of an ABC-2-type transporter and its R115 mutation was found to be solely responsible for the observed methyl viologen resistance. Bioinformatic analysis showed that in various bacterial genomes, two genes encoding another permease subunit and the ATPase component of an ATP-binding cassette transporter form putative operons with slr1174 orthologs, suggesting that the protein products of these genes may form functional transporters. The corresponding genes in Synechocystis sp. PCC 6803, i.e. slr0610 for the permease and slr1901 for the ATPase, did not form such an operon. However, insertional inactivation of any slr1174, slr0610 or slr1901 genes in both the wild-type and the R115-resistant mutant resulted in increased sensitivity to methyl, ethyl and benzyl viologens; moreover, single- and double-insertion mutants did not differ in their viologen sensitivity. Our data suggest that Slr1901, Slr1174 and Slr0610 form a heteromeric ATP-binding cassette-type viologen exporter, in which each component is critical for viologen extrusion. Because the greatest increase in mutant sensitivity was observed in the case of ethyl viologen, the three proteins have been named EvrA (Slr1901), EvrB (Slr1174) and EvrC (Slr0610). This is the first report of a function for a DUF990 family protein.

  7. Multiple-step kinetic mechanism of DNA-independent ATP binding and hydrolysis by Escherichia coli replicative helicase DnaB protein: quantitative analysis using the rapid quench-flow method.

    PubMed

    Rajendran, S; Jezewska, M J; Bujalowski, W

    2000-11-10

    The kinetic mechanism of DNA-independent binding and hydrolysis of ATP by the E. coli replicative helicase DnaB protein has been quantitatively examined using the rapid quench-flow technique. Single-turnover studies of ATP hydrolysis, in a non-interacting active site of the helicase, indicate that bimolecular association of ATP with the site is followed by the reversible hydrolysis of nucleotide triphosphate and subsequent conformational transition of the enzyme-product complex. The simplest mechanism, which describes the data, is a three-step sequential process defined by:¿eqalign¿¿¿rm Helicase+ATP¿&¿mathop¿¿rightleftharpoons¿ ¿k_1¿_¿k_¿-1¿¿¿¿rm (H-ATP)¿¿mathop¿¿rightleftharpoons¿ ¿k_2¿_¿k_¿-2¿¿¿¿rm (H-ADP¿cdot Pi)¿¿cr &¿mathop¿¿rightleftharpoons¿ ¿k_3¿_¿k_¿-3¿¿¿¿rm (H-ADP¿cdot Pi)¿ *¿The sequential character of the mechanism excludes conformational transitions of the DnaB helicase prior to ATP binding. Analysis of relaxation times and amplitudes of the reaction allowed us to estimate all rate and equilibrium constants of partial steps of the proposed mechanism. The intrinsic binding constant for the formation of the (H-ATP) complex is K(ATP)=(1.3+/-0.5)x10(5) M(-1). The analysis of the data indicates that a part of the ATP binding energy originates from induced structural changes of the DnaB protein-ATP complex prior to ATP hydrolysis. The equilibrium constant of the chemical interconversion is K(H)=k(2)/k(-2) approximately 2 while the subsequent conformational transition is characterized by K(3)=k(3)/k(-3) approximately 30. The low value of K(H) and the presence of the subsequent energetically favorable conformational step(s) strongly suggest that free energy is released from the enzyme-product complex in the conformational transitions following the chemical step and before the product release.The combined application of single and multiple-turnover approaches show that all six nucleotide-binding sites of the Dna

  8. DNA lesions derived from the site selective oxidation of Guanine by carbonate radical anions.

    PubMed

    Joffe, Avrum; Geacintov, Nicholas E; Shafirovich, Vladimir

    2003-12-01

    Carbonate radical anions are potentially important oxidants of nucleic acids in physiological environments. However, the mechanisms of action are poorly understood, and the end products of oxidation of DNA by carbonate radicals have not been characterized. These oxidation pathways were explored in this work, starting from the laser pulse-induced generation of the primary radical species to the identification of the stable oxidative modifications (lesions). The cascade of events was initiated by utilizing 308 nm XeCl excimer laser pulses to generate carbonate radical anions on submicrosecond time scales. This laser flash photolysis method involved the photodissociation of persulfate to sulfate radical anions and the one electron oxidation of bicarbonate anions by the sulfate radicals to yield the carbonate radical anions. The latter were monitored by their characteristic transient absorption band at 600 nm. The rate constants of reactions of carbonate radicals with oligonucleotides increase in the ascending order: 5'-d(CCATCCTACC) [(5.7 +/- 0.6) x 10(6) M(-)(1) s(-)(1)] < 5'-d(TATAACGTTATA), self-complementary duplex [(1.4 +/- 0.2) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATCGCTACC [(2.4 +/- 0.3) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATC[8-oxo-G]CTACC) [(3.2 +/- 0.4) x 10(8) M(-)(1) s(-)(1)], where 8-oxo-G is 8-oxo-7,8-dihydroguanine, the product of a two electron oxidation of guanine. This remarkable enhancement of the rate constants is correlated with the presence of either G or 8-oxo-G bases in the oligonucleotides. The rate constant for the oxidation of G in a single-stranded oligonuclotide is faster by a factor of approximately 2 than in the double-stranded form. The site selective oxidation of G and 8-oxo-G residues by carbonate radicals results in the formation of unique end products, the diastereomeric spiroiminodihydantoin (Sp) lesions, the products of a four electron oxidation of guanine. These lesions, formed in high yields (40-60%), were isolated by reversed phase

  9. Injection-site lesion prevalence and potential risk factors in UK beef cattle.

    PubMed

    Cresswell, E; Remnant, J; Butterworth, A; Wapenaar, W

    2017-01-21

    Injectable veterinary medicinal products (VMPs) are widely used in cattle in the UK, and in particular vaccines are often used on large numbers of animals in the herd. The formation of injection-site lesions (ISLs) is a risk when using injectable products and has potential consequences for meat quality, animal welfare and beef industry income. This study used carcase observation in four abattoirs in England to determine ISL prevalence in beef cattle. Additionally, a questionnaire survey was used to investigate vaccination technique among UK beef farmers. The ISL prevalence was 4.1 per cent (95 per cent CI 3.4 per cent to 4.9 per cent). A potential difference between sites being used for vaccination and the distribution of ISLs on carcases suggested that factors other than vaccination were contributing to ISL incidence. Questionnaire responses highlighted deficits in good vaccination practices such as using the recommended site of injection and needle hygiene. The role of the veterinarian in knowledge transfer is crucial in providing practical injection advice when prescribing vaccines and other VMPs. This study identified factors to address when aiming to reduce ISL formation in UK beef animals. British Veterinary Association.

  10. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    PubMed

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia.

  11. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia*

    PubMed Central

    Dong, Qian; Ernst, Sarah E.; Ostedgaard, Lynda S.; Shah, Viral S.; Ver Heul, Amanda R.; Welsh, Michael J.; Randak, Christoph O.

    2015-01-01

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P1,P5-di(adenosine-5′) pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5′-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5′-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl− channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. PMID:25887396

  12. Probing Enhanced Double-Strand Break Formation at Abasic Sites within Clustered Lesions in Nucleosome Core Particles.

    PubMed

    Banerjee, Samya; Chakraborty, Supratim; Jacinto, Marco Paolo; Paul, Michael D; Balster, Morgan V; Greenberg, Marc M

    2017-01-10

    DNA is rapidly cleaved under mild alkaline conditions at apyrimidinic/apurinic sites, but the half-life is several weeks in phosphate buffer (pH 7.5). However, abasic sites are ∼100-fold more reactive within nucleosome core particles (NCPs). Histone proteins catalyze the strand scission, and at superhelical location 1.5, the histone H4 tail is largely responsible for the accelerated cleavage. The rate constant for strand scission at an abasic site is enhanced further in a nucleosome core particle when it is part of a bistranded lesion containing a proximal strand break. Cleavage of this form results in a highly deleterious double-strand break. This acceleration is dependent upon the position of the abasic lesion in the NCP and its structure. The enhancement in cleavage rate at an apurinic/apyrimidinic site rapidly drops off as the distance between the strand break and abasic site increases and is negligible once the two forms of damage are separated by 7 bp. However, the enhancement of the rate of double-strand break formation increases when the size of the gap is increased from one to two nucleotides. In contrast, the cleavage rate enhancement at 2-deoxyribonolactone within bistranded lesions is more modest, and it is similar in free DNA and nucleosome core particles. We postulate that the enhanced rate of double-strand break formation at bistranded lesions containing apurinic/apyrimidinic sites within nucleosome core particles is a general phenomenon and is due to increased DNA flexibility.

  13. Conformational changes of the histidine ATP-binding cassette transporter studied by double electron-electron resonance spectroscopy.

    PubMed

    Sippach, Michael; Weidlich, Daniela; Klose, Daniel; Abé, Christoph; Klare, Johann; Schneider, Erwin; Steinhoff, Heinz-Jürgen

    2014-07-01

    The conformational dynamics of the histidine ABC transporter HisQMP2 from Salmonella enterica serovar Typhimurium, reconstituted into liposomes, is studied by site-directed spin labeling and double electron-electron resonance spectroscopy in the absence of nucleotides, in the ATP-bound, and in the post-hydrolysis state. The results show that the inter-dimer distances as measured between the Q-loops of HisP2 in the intact transporter resemble those determined for the maltose transporter in all three states of the hydrolysis cycle. Only in the presence of liganded HisJ the closed conformation of the nucleotide binding sites is achieved revealing the transmembrane communication of the presence of substrate. Two conformational states can be distinguished for the periplasmic moiety of HisQMP2 as detected by differences in distributions of interspin distances between positions 86 and 96 or 104 and 197. The observed conformational changes are correlated to proposed open, semi-open and closed conformations of the nucleotide binding domains HisP2. Our results are in line with a rearrangement of transmembrane helices 4 and 4' of HisQM during the closed to the semi-open transition of HisP2 driven by the reorientation of the coupled helices 3a and 3b to occur upon hydrolysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    PubMed Central

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.

    2001-01-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters. PMID:11514522

  15. ATP-binding and -hydrolysis activities of ALDP (ABCD1) and ALDRP (ABCD2), human peroxisomal ABC proteins, overexpressed in Sf21 cells.

    PubMed

    Morita, Masashi; Kurisu, Mikinori; Kashiwayama, Yoshinori; Yokota, Sadaki; Imanaka, Tsuneo

    2006-09-01

    The peroxisomal ATP-binding cassette (ABC) proteins, adrenoleukodystrophy protein (ALDP, ABCD1) and ALD-related protein (ALDRP, ABCD2), were expressed in Spodoptera frugiperda 21 (Sf21) insect cells using a baculovirus-mediated expression system. Immunoelectron microscopy and subcellular fractionation revealed that the overexpressed ALDP was distributed in various subcellular organelles including mitochondria, nucleus and peroxisomes. The ALDP was not extractable with Na(2)CO(3) treatment, suggesting that it integrated into membranes. ATPase activity was detected in the membrane fraction expressing ALDP. The nucleotide-binding capacities of the expressed ALDP were estimated by the binding to ATP- or ADP-agarose. ALDP exhibited an affinity to both ADP and ATP. In contrast, ALDRP exhibited an affinity to ADP but scarcely to ATP. The ALDP in the Sf21 membrane fraction was extracted with n-dodecyl-beta-maltoside and successively purified with a chelate column. The nucleotide-binding and ATPase activities of the purified ALDP were, however, not detected. It may be that certain membranous components are required for the activity. We demonstrate for the first time that the peroxisomal ABC proteins can be expressed in Sf21 membranes maintaining their nucleotide-binding abilities and ATPase activities, and the expressed proteins will be of use for further characterization.

  16. Evaluation of a Brucella melitensis mutant deficient in O-polysaccharide export system ATP-binding protein as a rough vaccine candidate.

    PubMed

    Wang, Zhen; Niu, Jian Rui; Wang, Xiao Lei; Wu, Tong Lei; Cheng, Jie; Lu, Lin; Wu, Qing Min

    2014-08-01

    Rough Brucella mutants have been sought as vaccine candidates that do not interfere with the conventional serological diagnosis of brucellosis. In this study, a rough mutant of Brucella melitensis was generated by the disruption of the wzt gene, which encodes the O-polysaccharide (O-PS) export system ATP-binding protein. In vivo, the mutant 16MΔwzt was attenuated and conferred a level of protection against B. melitensis 16M challenge similar to that conferred by the vaccine strain B. melitensis M5 in mice. In pregnant sheep, the mutant 16MΔwzt did not induce abortion. In vitro, 16MΔwzt was more susceptible to polymyxin B and complement-mediated killing than B. melitensis 16M was. Most importantly, although 16MΔwzt had a rough phenotype, it was able to synthesize O-PS and did not induce detectable specific antibodies in sheep. These results suggested that 16MΔwzt deserved to further systematic evaluation as a vaccine for target animal hosts due to its promising features.

  17. Roles of aldo-keto reductases 1B10 and 1C3 and ATP-binding cassette transporter in docetaxel tolerance.

    PubMed

    Matsunaga, Toshiyuki; Saito, Haruhi; Endo, Satoshi; Iguchi, Kazuhiro; Soda, Midori; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-12-01

    Docetaxel (DTX) is widely used for treatment of inveterate lung and prostate cancers, but its continuous administration elicits the hyposensitivity. Here, we established the DTX-resistant variants of human lung cancer A549 and androgen-independent prostate cancer Du145 cells and found that the resistance development provoked aberrant up-regulations of aldo-keto reductase (AKR) 1B10 and AKR1C3 in A549 and Du145 cells, respectively. In addition, the sensitivity to the DTX toxicity was significantly decreased and increased by overexpression and knockdown of the two AKR isoforms, respectively. Furthermore, the resistant cells exhibited a decreased level of reactive 4-hydroxy-2-nonenal formed during DTX treatment, and the decrease was alleviated by adding the AKR inhibitors, inferring that the two AKRs confer the chemoresistance through elevating the antioxidant properties. The development of DTX resistance was also associated with enhanced expression of an ATP-binding cassette (ABC) transporter ABCB1 among the ABC transporter isoforms. The combined treatment with inhibitors of the two AKRs and ABCB1 additively sensitized the resistant cells to DTX. Intriguingly, the AKR1B10 inhibitor also suppressed the lung cancer cross-resistance against cisplatin. The results suggest that combined treatment with AKRs (1B10 and 1C3) and ABCB1 inhibitors exerts overcoming effect against the cancer resistance to DTX and cisplatin, and can be used as the adjuvant therapy.

  18. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae.

    PubMed Central

    Egner, R; Mahé, Y; Pandjaitan, R; Kuchler, K

    1995-01-01

    Multidrug resistance (MDR) to different cytotoxic compounds in the yeast Saccharomyces cerevisiae can arise from overexpression of the Pdr5 (Sts1, Ydr1, or Lem1) ATP-binding cassette (ABC) multidrug transporter. We have raised polyclonal antibodies recognizing the yeast Pdr5 ABC transporter to study its biogenesis and to analyze the molecular mechanisms underlying MDR development. Subcellular fractionation and indirect immunofluorescence experiments showed that Pdr5 is localized in the plasma membrane. In addition, pulse-chase radiolabeling of cells and immunoprecipitation indicated that Pdr5 is a short-lived membrane protein with a half-life of about 60 to 90 min. A dramatic metabolic stabilization of Pdr5 was observed in delta pep4 mutant cells defective in vacuolar proteinases, and indirect immunofluorescence showed that Pdr5 accumulates in vacuoles of stationary-phase delta pep4 mutant cells, demonstrating that Pdr5 turnover requires vacuolar proteolysis. However, Pdr5 turnover does not require a functional proteasome, since the half-life of Pdr5 was unaffected in either pre1-1 or pre1-1 pre2-1 mutants defective in the multicatalytic cytoplasmic proteasome that is essential for cytoplasmic protein degradation. Immunofluorescence analysis revealed that vacuolar delivery of Pdr5 is blocked in conditional end4 endocytosis mutants at the restrictive temperature, showing that endocytosis delivers Pdr5 from the plasma membrane to the vacuole. PMID:7565740

  19. Genome-wide analysis of ATP-binding cassette (ABC) proteins in a model legume plant, Lotus japonicus: comparison with Arabidopsis ABC protein family.

    PubMed

    Sugiyama, Akifumi; Shitan, Nobukazu; Sato, Shusei; Nakamura, Yasukazu; Tabata, Satoshi; Yazaki, Kazufumi

    2006-10-31

    ATP-binding cassette (ABC) proteins constitute a large family in plants with more than 120 members each in Arabidopsis and rice, and have various functions including the transport of auxin and alkaloid, as well as the regulation of stomata movement. In this report, we carried out genome-wide analysis of ABC protein genes in a model legume plant, Lotus japonicus. For analysis of the Lotus genome sequence, we devised a new method 'domain-based clustering analysis', where domain structures like the nucleotide-binding domain (NBD) and transmembrane domain (TMD), instead of full-length amino acid sequences, are used to compare phylogenetically each other. This method enabled us to characterize fragments of ABC proteins, which frequently appear in a draft sequence of the Lotus genome. We identified 91 putative ABC proteins in L. japonicus, i.e. 43 'full-size', 40 'half-size' and 18 'soluble' putative ABC proteins. The characteristic feature of the composition is that Lotus has extraordinarily many paralogs similar to AtMRP14 and AtPDR12, which are at least six and five members, respectively. Expression analysis of the latter genes performed with real-time quantitative reverse transcription-PCR revealed their putative involvement in the nodulation process.

  20. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.

    2013-01-01

    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  1. The E23 early gene of Drosophila encodes an ecdysone-inducible ATP-binding cassette transporter capable of repressing ecdysone-mediated gene activation

    PubMed Central

    Hock, Tommy; Cottrill, Tracy; Keegan, John; Garza, Dan

    2000-01-01

    At the onset of Drosophila metamorphosis, the steroid hormone 20-OH ecdysone directly induces a small number of early puffs in the polytene chromosomes of the larval salivary gland. Proteins encoded by the early genes corresponding to these transcriptional puffs then regulate the activity of both the early puffs themselves and a much larger set of late puffs. Three of these early genes encode transcription factors that play critical regulatory roles during metamorphosis. Here we report the cloning, DNA sequence, genomic structure, ecdysone inducibility, and temporal expression of an early gene residing in the 23E early puff and denoted E23 (Early gene at 23). In contrast to other early genes, E23 encodes a protein with similarity to ATP-binding cassette transporters. Using heat shock-inducible transgenes, we found that E23 overexpression not only produces phenotypic abnormalities and lethality, but also interferes with ecdysone-mediated gene activation, demonstrating that E23 is capable of modulating the ecdysone response. Our results suggest the existence of a previously unrecognized regulatory mechanism for modulating steroid hormone signaling in Drosophila. PMID:10931948

  2. The Arabidopsis PLEIOTROPIC DRUG RESISTANCE8/ABCG36 ATP binding cassette transporter modulates sensitivity to the auxin precursor indole-3-butyric acid.

    PubMed

    Strader, Lucia C; Bartel, Bonnie

    2009-07-01

    Plants have developed numerous mechanisms to store hormones in inactive but readily available states, enabling rapid responses to environmental changes. The phytohormone auxin has a number of storage precursors, including indole-3-butyric acid (IBA), which is apparently shortened to active indole-3-acetic acid (IAA) in peroxisomes by a process similar to fatty acid beta-oxidation. Whereas metabolism of auxin precursors is beginning to be understood, the biological significance of the various precursors is virtually unknown. We identified an Arabidopsis thaliana mutant that specifically restores IBA, but not IAA, responsiveness to auxin signaling mutants. This mutant is defective in PLEIOTROPIC DRUG RESISTANCE8 (PDR8)/PENETRATION3/ABCG36, a plasma membrane-localized ATP binding cassette transporter that has established roles in pathogen responses and cadmium transport. We found that pdr8 mutants display defects in efflux of the auxin precursor IBA and developmental defects in root hair and cotyledon expansion that reveal previously unknown roles for IBA-derived IAA in plant growth and development. Our results are consistent with the possibility that limiting accumulation of the IAA precursor IBA via PDR8-promoted efflux contributes to auxin homeostasis.

  3. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    PubMed

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  4. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    SciTech Connect

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  5. Lipid Absorption Defects in Intestine-specific Microsomal Triglyceride Transfer Protein and ATP-binding Cassette Transporter A1-deficient Mice*

    PubMed Central

    Iqbal, Jahangir; Parks, John S.; Hussain, M. Mahmood

    2013-01-01

    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92–95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations. PMID:24019513

  6. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie

    2001-01-01

    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  7. Conformational shift in the closed state of GroEL induced by ATP-binding triggers a transition to the open state

    PubMed Central

    Suzuki, Yuka; Yura, Kei

    2016-01-01

    We investigated the effect of ATP binding to GroEL and elucidated a role of ATP in the conformational change of GroEL. GroEL is a tetradecamer chaperonin that helps protein folding by undergoing a conformational change from a closed state to an open state. This conformational change requires ATP, but does not require the hydrolysis of the ATP. The following three types of conformations are crystalized and the atomic coordinates are available; closed state without ATP, closed state with ATP and open state with ADP. We conducted simulations of the conformational change using Elastic Network Model from the closed state without ATP targeting at the open state, and from the closed state with ATP targeting at the open state. The simulations emphasizing the lowest normal mode showed that the one started with the closed state with ATP, rather than the one without ATP, reached a conformation closer to the open state. This difference was mainly caused by the changes in the positions of residues in the initial structure rather than the changes in “connectivity” of residues within the subunit. Our results suggest that ATP should behave as an insulator to induce conformation population shift in the closed state to the conformation that has a pathway leading to the open state. PMID:27924266

  8. Inherited surfactant deficiency due to uniparental disomy of rare mutations in the surfactant protein-B and ATP binding cassette, subfamily A, member 3 genes

    PubMed Central

    Hamvas, Aaron; Nogee, Lawrence M.; Wegner, Daniel J.; DePass, Kelcey; Christodoulou, John; Bennetts, Bruce; McQuade, Leon R.; Gray, Peter H.; Deterding, Robin R.; Carroll, Travis R.; Kammesheidt, Anja; Kasch, Laura M.; Kulkarni, Shashikant; Cole, F. Sessions

    2009-01-01

    Objective To characterize inheritance of homozygous, rare, recessive loss-of-function mutations in the surfactant protein-B (SFTPB) or ATP binding cassette, subfamily A, member 3 (ABCA3) genes in newborns with lethal respiratory failure. Study design We resequenced parents whose infants were homozygous for mutations in SFTPB or ABCA3. For infants with only one heterozygous parent, we performed microsatellite analysis for chromosomes 2 (SFTPB) and 16 (ABCA3). Results We identified one infant homozygous for the c.1549C>GAA mutation (121ins2) in SFTPB for whom only the mother was heterozygous and 3 infants homozygous for mutations in ABCA3 (p.K914R, p.P147L, and c.806_7insGCT) for whom only the fathers were heterozygous. For the SP-B deficient infant, microsatellite markers confirmed maternal heterodisomy with segmental isodisomy. Microsatellite analysis confirmed paternal isodisomy for the three ABCA3 deficient infants. Two ABCA3 deficient infants underwent lung transplantation at 3 and 5 months of age, respectively, and two infants died. None exhibited any non-pulmonary phenotype. Conclusions Uniparental disomy should be suspected in infants with rare homozygous mutations in SFTPB or ABCA3. Confirmation of parental carrier status is important to provide recurrence risk and to monitor expression of other phenotypes that may emerge through reduction to homozygosity of recessive alleles. PMID:19647838

  9. Pathogen-responsive expression of a putative ATP-binding cassette transporter gene conferring resistance to the diterpenoid sclareol is regulated by multiple defense signaling pathways in Arabidopsis.

    PubMed

    Campbell, Emma J; Schenk, Peer M; Kazan, Kemal; Penninckx, Iris A M A; Anderson, Jonathan P; Maclean, Don J; Cammue, Bruno P A; Ebert, Paul R; Manners, John M

    2003-11-01

    The ATP-binding cassette (ABC) transporters are encoded by large gene families in plants. Although these proteins are potentially involved in a number of diverse plant processes, currently, very little is known about their actual functions. In this paper, through a cDNA microarray screening of anonymous cDNA clones from a subtractive library, we identified an Arabidopsis gene (AtPDR12) putatively encoding a member of the pleiotropic drug resistance (PDR) subfamily of ABC transporters. AtPDR12 displayed distinct induction profiles after inoculation of plants with compatible and incompatible fungal pathogens and treatments with salicylic acid, ethylene, or methyl jasmonate. Analysis of AtPDR12 expression in a number of Arabidopsis defense signaling mutants further revealed that salicylic acid accumulation, NPR1 function, and sensitivity to jasmonates and ethylene were all required for pathogen-responsive expression of AtPDR12. Germination assays using seeds from an AtPDR12 insertion line in the presence of sclareol resulted in lower germination rates and much stronger inhibition of root elongation in the AtPDR12 insertion line than in wild-type plants. These results suggest that AtPDR12 may be functionally related to the previously identified ABC transporters SpTUR2 and NpABC1, which transport sclareol. Our data also point to a potential role for terpenoids in the Arabidopsis defensive armory.

  10. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.

    PubMed

    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong

    2017-02-01

    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families.

  11. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter

    PubMed Central

    Alvarez, Frances Joan D.; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R. Michael; Klug, Candice S.; Davidson, Amy L.

    2015-01-01

    Summary MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance (EPR) spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP. PMID:26268698

  12. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism.

    PubMed

    Cho, Misuk; Henry, Elizabeth M; Lewis, Daniel R; Wu, Guosheng; Muday, Gloria K; Spalding, Edgar P

    2014-12-01

    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target.

  13. Differential Phospholipid Substrates and Directional Transport by ATP-binding Cassette Proteins ABCA1, ABCA7, and ABCA4 and Disease-causing Mutants*♦

    PubMed Central

    Quazi, Faraz; Molday, Robert S.

    2013-01-01

    ABCA1, ABCA7, and ABCA4 are members of the ABCA subfamily of ATP-binding cassette transporters that share extensive sequence and structural similarity. Mutations in ABCA1 cause Tangier disease characterized by defective cholesterol homeostasis and high density lipoprotein (HDL) deficiency. Mutations in ABCA4 are responsible for Stargardt disease, a degenerative disorder associated with severe loss in central vision. Although cell-based studies have implicated ABCA proteins in lipid transport, the substrates and direction of transport have not been firmly established. We have purified and reconstituted ABCA1, ABCA7, and ABCA4 into liposomes for fluorescent-lipid transport studies. ABCA1 actively exported or flipped phosphatidylcholine, phosphatidylserine, and sphingomyelin from the cytoplasmic to the exocytoplasmic leaflet of membranes, whereas ABCA7 preferentially exported phosphatidylserine. In contrast, ABCA4 transported phosphatidylethanolamine in the reverse direction. The same phospholipids stimulated the ATPase activity of these ABCA transporters. The transport and ATPase activities of ABCA1 and ABCA4 were reduced by 25% in the presence of 20% cholesterol. Nine ABCA1 Tangier mutants and the corresponding ABCA4 Stargardt mutants showed significantly reduced phospholipid transport activity and subcellular mislocalization. These studies provide the first direct evidence for ABCA1 and ABCA7 functioning as phospholipid transporters and suggest that this activity is an essential step in the loading of apoA-1 with phospholipids for HDL formation. PMID:24097981

  14. Interaction of extracellular domain 2 of the human retina-specific ATP-binding cassette transporter (ABCA4) with all-trans-retinal.

    PubMed

    Biswas-Fiss, Esther E; Kurpad, Deepa S; Joshi, Kinjalben; Biswas, Subhasis B

    2010-06-18

    The retina-specific ATP-binding cassette (ABC) transporter, ABCA4, is essential for transport of all-trans-retinal from the rod outer segment discs in the retina and is associated with a broad range of inherited retinal diseases, including Stargardt disease, autosomal recessive cone rod dystrophy, and fundus flavimaculatus. A unique feature of the ABCA subfamily of ABC transporters is the presence of highly conserved, long extracellular loops or domains (ECDs) with unknown function. The high degree of sequence conservation and mapped disease-associated mutations in these domains suggests an important physiological significance. Conformational analysis using CD spectroscopy of purified, recombinant ECD2 protein demonstrated that it has an ordered and stable structure composed of 27 +/- 3% alpha-helix, 20 +/- 3% beta-pleated sheet, and 53 +/- 3% coil. Significant conformational changes were observed in disease-associated mutant proteins. Using intrinsic tryptophan fluorescence emission spectrum of ECD2 polypeptide and fluorescence anisotropy, we have demonstrated that this domain specifically interacts with all-trans-retinal. Furthermore, the retinal interaction appeared preferential for the all-trans-isomer and was directly measurable through fluorescence anisotropy analysis. Our results demonstrate that the three macular degeneration-associated mutations lead to significant changes in the secondary structure of the ECD2 domain of ABCA4, as well as in its interaction with all-trans-retinal.

  15. Structural and functional characterization of an orphan ATP-binding cassette ATPase involved in manganese utilization and tolerance in Leptospira spp.

    PubMed

    Benaroudj, Nadia; Saul, Frederick; Bellalou, Jacques; Miras, Isabelle; Weber, Patrick; Bondet, Vincent; Murray, Gerald L; Adler, Ben; Ristow, Paula; Louvel, Hélène; Haouz, Ahmed; Picardeau, Mathieu

    2013-12-01

    Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn(2+), we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn(2+), suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn(2+) toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg(2+)-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.

  16. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.

    PubMed

    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N

    2001-09-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  17. The ATP-binding cassette transporter A1 regulates phosphoantigen release and Vγ9Vδ2 T cell activation by dendritic cells

    PubMed Central

    Castella, Barbara; Kopecka, Joanna; Sciancalepore, Patrizia; Mandili, Giorgia; Foglietta, Myriam; Mitro, Nico; Caruso, Donatella; Novelli, Francesco; Riganti, Chiara; Massaia, Massimo

    2017-01-01

    Vγ9Vδ2 T cells are activated by phosphoantigens, such as isopentenyl pyrophosphate (IPP), which is generated in the mevalonate pathway of antigen-presenting cells. IPP is released in the extracellular microenvironment via unknown mechanisms. Here we show that the ATP-binding cassette transporter A1 (ABCA1) mediates extracellular IPP release from dendritic cells (DC) in cooperation with apolipoprotein A-I (apoA-I) and butyrophilin-3A1. IPP concentrations in the supernatants are sufficient to induce Vγ9Vδ2 T cell proliferation after DC mevalonate pathway inhibition with zoledronic acid (ZA). ZA treatment increases ABCA1 and apoA-I expression via IPP-dependent LXRα nuclear translocation and PI3K/Akt/mTOR pathway inhibition. These results close the mechanistic gap in our understanding of extracellular IPP release from DC and provide a framework to fine-tune Vγ9Vδ2 T cell activation via mevalonate and PI3K/Akt/mTOR pathway modulation. PMID:28580927

  18. Suppression of the ATP-binding cassette transporter ABCC4 impairs neuroblastoma tumour growth and sensitises to irinotecan in vivo.

    PubMed

    Murray, Jayne; Valli, Emanuele; Yu, Denise M T; Truong, Alan M; Gifford, Andrew J; Eden, Georgina L; Gamble, Laura D; Hanssen, Kimberley M; Flemming, Claudia L; Tan, Alvin; Tivnan, Amanda; Allan, Sophie; Saletta, Federica; Cheung, Leanna; Ruhle, Michelle; Schuetz, John D; Henderson, Michelle J; Byrne, Jennifer A; Norris, Murray D; Haber, Michelle; Fletcher, Jamie I

    2017-09-01

    The ATP-binding cassette transporter ABCC4 (multidrug resistance protein 4, MRP4) mRNA level is a strong predictor of poor clinical outcome in neuroblastoma which may relate to its export of endogenous signalling molecules and chemotherapeutic agents. We sought to determine whether ABCC4 contributes to development, growth and drug response in neuroblastoma in vivo. In neuroblastoma patients, high ABCC4 protein levels were associated with reduced overall survival. Inducible knockdown of ABCC4 strongly inhibited the growth of human neuroblastoma cells in vitro and impaired the growth of neuroblastoma xenografts. Loss of Abcc4 in the Th-MYCN transgenic neuroblastoma mouse model did not impact tumour formation; however, Abcc4-null neuroblastomas were strongly sensitised to the ABCC4 substrate drug irinotecan. Our findings demonstrate a role for ABCC4 in neuroblastoma cell proliferation and chemoresistance and provide rationale for a strategy where inhibition of ABCC4 should both attenuate the growth of neuroblastoma and sensitise tumours to ABCC4 chemotherapeutic substrates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptis japonica

    PubMed Central

    Shitan, Nobukazu; Bazin, Ingrid; Dan, Kazuyuki; Obata, Kazuaki; Kigawa, Koji; Ueda, Kazumitsu; Sato, Fumihiko; Forestier, Cyrille; Yazaki, Kazufumi

    2003-01-01

    Alkaloids comprise one of the largest groups of plant secondary metabolites. Berberine, a benzylisoquinoline alkaloid, is preferentially accumulated in the rhizome of Coptis japonica, a ranunculaceous plant, whereas gene expression for berberine biosynthetic enzymes has been observed specifically in root tissues, which suggests that berberine synthesized in the root is transported to the rhizome, where there is high accumulation. We recently isolated a cDNA encoding a multidrug-resistance protein (MDR)-type ATP-binding cassette (ABC) transporter (Cjmdr1) from berberine-producing cultured C. japonica cells, which is highly expressed in the rhizome. Functional analysis of Cjmdr1 by using a Xenopus oocyte expression system showed that CjMDR1 transported berberine in an inward direction, resulting in a higher accumulation of berberine in Cjmdr1-injected oocytes than in the control. Typical inhibitors of ABC proteins, such as vanadate, nifedipine, and glibenclamide, as well as ATP depletion, clearly inhibited this CjMDR1-dependent berberine uptake, suggesting that CjMDR1 functioned as an ABC transporter. Conventional membrane separation methods showed that CjMDR1 was localized in the plasma membrane of C. japonica cells. In situ hybridization indicated that Cjmdr1 mRNA was expressed preferentially in xylem tissues of the rhizome. These findings strongly suggest that CjMDR1 is involved in the translocation of berberine from the root to the rhizome. PMID:12524452

  20. Identification of an Amino Acid Residue Critical for Plasma Membrane Localization of ATP-Binding Cassette Transporter G1--Brief Report.

    PubMed

    Gu, Hong-mei; Wang, Faqi; Alabi, Adekunle; Deng, Shijun; Qin, Shucun; Zhang, Da-wei

    2016-02-01

    ATP-binding cassette transporter G1 (ABCG1) mediates cholesterol efflux to lipidated lipoproteins. Conflicting data about cellular localization of ABCG1 and its effect on cholesterol efflux have been reported. Here, we investigated the underlying mechanisms for these different observations. Confocal microscopy and biotinylation were used to assess cell surface localization of ABCG1. We found that mouse ABCG1 (mABCG1) used in one previous study has a substitution of Leu to Pro at position 550 (mG1-L550P). When the corresponding Leu at position 562 in human ABCG1 (hABCG1) was mutated to Pro (hG1-L562P), the mutant hABCG1, like mG1-L550P, mainly resided intracellularly, whereas wild-type mABCG1 and hABCG1 were localized on the plasma membrane. However, replacement of this Leu with Pro had no significant effect on mABCG1- and hABCG1-mediated cholesterol efflux. Leu at position 550/562 in mABCG1/hABCG1 is critical for their plasma membrane localization but not for ABCG1-mediated cholesterol efflux. Our findings indicate that the substitution of Leu to Pro at position 550 in mABCG1 may contribute to the non-cell surface localization of mABCG1 observed in the previous study. © 2015 American Heart Association, Inc.

  1. Genome-wide identification of ATP-binding cassette (ABC) transporters and conservation of their xenobiotic transporter function in the monogonont rotifer (Brachionus koreanus).

    PubMed

    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Young Hwan; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2017-03-01

    The ATP-binding cassette (ABC) transporter family is one of the largest gene family in animals, and members of this family are known to be involved in various biological processes due to their ability to transport a wide range of substrates across membranes using ATP cleavage-derived energy. We identified 61 ABC transporters in the genome of the monogonont rotifer Brachionus koreanus, and classified these into eight distinct subfamilies (A-H) by phylogenetic analysis. ABC transporters in the rotifer B. koreanus are comprised of 11 ABCA genes, 19 ABCB genes, 14 ABCC genes, 3 ABCD genes, 1 ABCE gene, 3 ABCF genes, 8 ABCG genes, and 2 ABCH genes. Extensive gene duplication and loss events in synteny were observed in several subfamilies. In particular, massive gene duplications of P-glycoproteins (P-gps), multidrug resistance proteins (MRPs), and Bk-Abcg-like proteins were observed. The ability of these B. koreanus proteins to function as multixenobiotic resistance (MXR) ABC transporters was validated using specific fluorescence substrates/inhibitors. The ABC transporter superfamily members identified in this study will be useful in future toxicological studies, and will facilitate comparative studies of the evolution of the ABC transporter superfamily in invertebrates.

  2. The Yersiniabactin-Associated ATP Binding Cassette Proteins YbtP and YbtQ Enhance Escherichia coli Fitness during High-Titer Cystitis

    PubMed Central

    Koh, Eun-Ik; Hung, Chia S.

    2016-01-01

    The Yersinia high-pathogenicity island (HPI) is common to multiple virulence strategies used by Escherichia coli strains associated with urinary tract infection (UTI). Among the genes in this island are ybtP and ybtQ, encoding distinctive ATP binding cassette (ABC) proteins associated with iron(III)-yersiniabactin import in Yersinia pestis. In this study, we compared the impact of ybtPQ on a model E. coli cystitis strain during in vitro culture and experimental murine infections. A ybtPQ-null mutant exhibited no growth defect under standard culture conditions, consistent with nonessentiality in this background. A growth defect phenotype was observed and genetically complemented in vitro during iron(III)-yersiniabactin-dependent growth. Following inoculation into the bladders of C3H/HEN and C3H/HeOuJ mice, this strain exhibited a profound, 106-fold competitive infection defect in the subgroup of mice that progressed to high-titer bladder infections. These results identify a virulence role for YbtPQ in the highly inflammatory microenvironment characteristic of high-titer cystitis. The profound competitive defect may relate to the apparent selection of Yersinia HPI-positive E. coli in uncomplicated clinical UTIs. PMID:26883590

  3. Intracellular ATP-binding cassette transporter A3 is expressed in lung cancer cells and modulates susceptibility to cisplatin and paclitaxel.

    PubMed

    Overbeck, Tobias R; Hupfeld, Timo; Krause, Doris; Waldmann-Beushausen, Regina; Chapuy, Bjoern; Güldenzoph, Bjoern; Aung, Thiha; Inagaki, Nobuya; Schöndube, Friedrich A; Danner, Bernhard C; Truemper, Lorenz; Wulf, Gerald G

    2013-01-01

    Patients with advanced-stage bronchial cancer benefit from systemic cytostatic therapy, in particular from regimens integrating cisplatin and taxanes. However, eventual disease progression leads to a fatal outcome in most cases, originating from tumor cells resisting chemotherapy. We here show that the intracellular ATP-binding cassette transporter A3 (ABCA3), previously recognized as critical for the secretion of surfactant components from type 2 pneumocytes, is expressed in non-small-cell lung cancer (NSCLC) cells. With some heterogeneity in a given specimen, expression levels detected immunohistochemically in primary cancer tissue were highest in adenocarcinomas and lowest in small cell lung cancers. Genetic silencing of ABCA3 in the NSCLC cell line models A549, NCI-H1650 and NCI-H1975 significantly increased tumor cell susceptibility to the cytostatic effects of both cisplatin (in all cell lines) and paclitaxel (in two of three cell lines). Taken together, ABCA3 emerges as a modulator of NSCLC cell susceptibility to cytostatic therapy. Copyright © 2013 S. Karger AG, Basel.

  4. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio).

    PubMed

    Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng

    2016-01-01

    The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.

  5. Whole-Transcriptome Survey of the Putative ATP-Binding Cassette (ABC) Transporter Family Genes in the Latex-Producing Laticifers of Hevea brasiliensis

    PubMed Central

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 ‘full-size’, 21 ‘half-size’ and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis. PMID:25615936

  6. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio)

    PubMed Central

    Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.

    2016-01-01

    The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731

  7. Reversal of multidrug resistance by the inhibition of ATP-binding cassette pumps employing "Generally Recognized As Safe" (GRAS) nanopharmaceuticals: A review.

    PubMed

    Sosnik, Alejandro

    2013-11-01

    Pumps of the ATP-binding cassette superfamily (ABCs) regulate the access of drugs to the intracellular space. In this context, the overexpression of ABCs is a well-known mechanism of multidrug resistance (MDR) in cancer and infectious diseases (e.g., viral hepatitis and the human immunodeficiency virus) and is associated with therapeutic failure. Since their discovery, ABCs have emerged as attractive therapeutic targets and the search of compounds that inhibit their genetic expression and/or their functional activity has gained growing interest. Different generations of pharmacological ABC inhibitors have been explored over the last four decades to address resistance in cancer, though clinical results have been somehow disappointing. "Generally Recognized As Safe" (GRAS) is a U.S. Food and Drug Administration designation for substances that are accepted as safe for addition in food. Far from being "inert", some amphiphilic excipients used in the production of pharmaceutical products have been shown to inhibit the activity of ABCs in MDR tumors, emerging as a clinically translatable approach to overcome resistance. The present article initially overviews the classification, structure and function of the different ABCs, with emphasis on those pumps related to drug resistance. Then, the different attempts to capitalize on the activity of GRAS nanopharmaceuticals as ABC inhibitors are discussed. © 2013.

  8. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2005-12-30

    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  9. ATP-binding cassette G-subfamily transporter 2 regulates cell cycle progression and asymmetric division in mouse cardiac side population progenitor cells.

    PubMed

    Sereti, Konstantina-Ioanna; Oikonomopoulos, Angelos; Unno, Kazumasa; Cao, Xin; Qiu, Yiling; Liao, Ronglih

    2013-01-04

    After cardiac injury, cardiac progenitor cells are acutely reduced and are replenished in part by regulated self-renewal and proliferation, which occurs through symmetric and asymmetric cellular division. Understanding the molecular cues controlling progenitor cell self-renewal and lineage commitment is critical for harnessing these cells for therapeutic regeneration. We previously have found that the cell surface ATP-binding cassette G-subfamily transporter 2 (Abcg2) influences the proliferation of cardiac side population (CSP) progenitor cells, but through unclear mechanisms. To determine the role of Abcg2 on cell cycle progression and mode of division in mouse CSP cells. Herein, using CSP cells isolated from wild-type and Abcg2 knockout mice, we found that Abcg2 regulates G1-S cell cycle transition by fluorescence ubiquitination cell cycle indicators, cell cycle-focused gene expression arrays, and confocal live-cell fluorescent microscopy. Moreover, we found that modulation of cell cycle results in transition from symmetric to asymmetric cellular division in CSP cells lacking Abcg2. Abcg2 modulates CSP cell cycle progression and asymmetric cell division, establishing a mechanistic link between this surface transporter and cardiac progenitor cell function. Greater understanding of progenitor cell biology and, in particular, the regulation of resident progenitor cell homeostasis is vital for guiding the future development of cell-based therapies for cardiac regeneration.

  10. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  11. The ATP-binding cassette transporter ABCG2 protects against pressure overload-induced cardiac hypertrophy and heart failure by promoting angiogenesis and antioxidant response.

    PubMed

    Higashikuni, Yasutomi; Sainz, Julie; Nakamura, Kazuto; Takaoka, Minoru; Enomoto, Soichiro; Iwata, Hiroshi; Tanaka, Kimie; Sahara, Makoto; Hirata, Yasunobu; Nagai, Ryozo; Sata, Masataka

    2012-03-01

    ATP-binding cassette transporter subfamily G member 2 (ABCG2), expressed in microvascular endothelial cells in the heart, has been suggested to regulate several tissue defense mechanisms. This study was performed to elucidate its role in pressure overload-induced cardiac hypertrophy. Pressure overload was induced in 8- to 12-week-old wild-type and Abcg2-/- mice by transverse aortic constriction (TAC). Abcg2-/- mice showed exaggerated cardiac hypertrophy and ventricular remodeling after TAC compared with wild-type mice. In the early phase after TAC, functional impairment in angiogenesis and antioxidant response in myocardium was found in Abcg2-/- mice. In vitro experiments demonstrated that ABCG2 regulates transport of glutathione, an important endogenous antioxidant, from microvascular endothelial cells. Besides, glutathione transported from microvascular endothelial cells in ABCG2-dependent manner ameliorated oxidative stress-induced cardiomyocyte hypertrophy. In vivo, glutathione levels in plasma and the heart were increased in wild-type mice but not in Abcg2-/- mice after TAC. Treatment with the superoxide dismutase mimetic ameliorated cardiac hypertrophy in Abcg2-/- mice after TAC to the same extent as that in wild-type mice, although cardiac dysfunction with impaired angiogenesis was observed in Abcg2-/- mice. ABCG2 protects against pressure overload-induced cardiac hypertrophy and heart failure by promoting angiogenesis and antioxidant response.

  12. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells.

    PubMed

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  13. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood

    2013-10-18

    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  14. A 20(S)-protopanoxadiol derivative overcomes multi-drug resistance by antagonizing ATP-binding cassette subfamily B member 1 transporter function

    PubMed Central

    Chen, Wantao; Xu, Qin; Xiao, Meng; Hu, Lihong; Mao, Li; Wang, Xu

    2016-01-01

    In cancer cells, failure of chemotherapy is often caused by the ATP-binding cassette subfamily B member 1 (ABCB1), and few drugs have been successfully developed to overcome ABCB1-mediated multi-drug resistance (MDR). To suppress ABCB1 activity, we previously designed and synthesized a new series of derivatives based on 20(S)-protopanoxadiol (PPD). In the present study, we investigated the role of PPD derivatives in the function of ABC transporters. Non-toxic concentrations of the PPD derivative PPD12 sensitized ABCB1-overexpressing cells to their anti-cancer substrates better than either the parental PPD or inactive PPD11. PPD12 increased intracellular accumulation of adriamycin and rhodamine123 in resistant cancer cells. Although PPD12 did not suppress the expression of ABCB1 mRNA or protein, it stimulated the activity of ABCB1 ATPase. Because PPD12 is a competitive inhibitor, it was predicted to bind to the large hydrophobic cavity of homology-modeled human ABCB1. PPD12 also enhanced the efficacy of adriamycin against ABCB1-overexpressing KB/VCR xenografts in nude mice. In conclusion, PPD12 enhances the efficacy of substrate drugs in ABCB1-overexpressing cancer cells. These findings suggest that a combination therapy consisting of PPD12 with conventional chemotherapeutic agents may be an effective treatment for ABCB1-mediated MDR cancer patients. PMID:26824187

  15. A Member of the PLEIOTROPIC DRUG RESISTANCE Family of ATP Binding Cassette Transporters Is Required for the Formation of a Functional Cuticle in Arabidopsis[W

    PubMed Central

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane

    2011-01-01

    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell. PMID:21628525

  16. Transgenic hybrid aspen overexpressing the Atwbc19 gene encoding an ATP-binding cassette transporter confers resistance to four aminoglycoside antibiotics.

    PubMed

    Kang, Byung-Guk; Ye, Xia; Osburn, Lori D; Stewart, C N; Cheng, Zong-Ming

    2010-06-01

    Antibiotic-resistance genes of bacterial origin are invaluable markers for plant genetic engineering. However, these genes are feared to pose possible risk to human health by horizontal gene transfer from transgenic plants to bacteria, potentially resulting in antibiotic-resistant pathogenic bacteria; this is a considerable regulatory concern in some countries. The Atwbc19 gene, encoding an Arabidopsis thaliana ATP-binding cassette transporter, has been reported to confer resistance to kanamycin specifically as an alternative to bacterial antibiotic-resistance genes. In this report, we transformed hybrid aspen (Populus canescens x P. grandidentata) with the Atwbc19 gene. Unlike Atwbc19-transgenic tobacco that was only resistant to kanamycin, the transgenic Populus plants also showed resistance to three other aminoglycoside antibiotics (neomycin, geneticin, and paromomycin) at comparable levels to plants containing a CaMV35S-nptII cassette. Although it is unknown why the transgenic Populus with the Atwbc19 gene is resistant to all aminoglycoside antibiotics tested, the broad utility of the Atwbc19 gene as a reporter gene is confirmed here in a second dicot species. Because the Atwbc19 gene is plant-ubiquitous, it might serve as an alternative selectable marker to current bacterial antibiotic-resistance marker genes and alleviate the potential risk for horizontal transfer of bacterial-resistance genes in transgenic plants.

  17. The Role of Arabidopsis ABCG9 and ABCG31 ATP Binding Cassette Transporters in Pollen Fitness and the Deposition of Steryl Glycosides on the Pollen Coat[W

    PubMed Central

    Choi, Hyunju; Ohyama, Kiyoshi; Kim, Yu-Young; Jin, Jun-Young; Lee, Saet Buyl; Yamaoka, Yasuyo; Muranaka, Toshiya; Suh, Mi Chung; Fujioka, Shozo; Lee, Youngsook

    2014-01-01

    The pollen coat protects pollen grains from harmful environmental stresses such as drought and cold. Many compounds in the pollen coat are synthesized in the tapetum. However, the pathway by which they are transferred to the pollen surface remains obscure. We found that two Arabidopsis thaliana ATP binding cassette transporters, ABCG9 and ABCG31, were highly expressed in the tapetum and are involved in pollen coat deposition. Upon exposure to dry air, many abcg9 abcg31 pollen grains shriveled up and collapsed, and this phenotype was restored by complementation with ABCG9pro:GFP:ABCG9. GFP-tagged ABCG9 or ABCG31 localized to the plasma membrane. Electron microscopy revealed that the mutant pollen coat resembled the immature coat of the wild type, which contained many electron-lucent structures. Steryl glycosides were reduced to about half of wild-type levels in the abcg9 abcg31 pollen, but no differences in free sterols or steryl esters were observed. A mutant deficient in steryl glycoside biosynthesis, ugt80A2 ugt80B1, exhibited a similar phenotype. Together, these results indicate that steryl glycosides are critical for pollen fitness, by supporting pollen coat maturation, and that ABCG9 and ABCG31 contribute to the accumulation of this sterol on the surface of pollen. PMID:24474628

  18. Role of NH{sub 2}-terminal hydrophobic motif in the subcellular localization of ATP-binding cassette protein subfamily D: Common features in eukaryotic organisms

    SciTech Connect

    Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi

    2014-10-24

    Highlights: • ABCD proteins classifies based on with or without NH{sub 2}-terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH{sub 2}-terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH{sub 2}-terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH{sub 2}-terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH{sub 2}-terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH{sub 2}-terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH{sub 2}-terminal H0 motif in organelle targeting is widely conserved in living organisms.

  19. Identification of a gene linked to Rhizobium meliloti ntrA whose product is homologous to a family to ATP-binding proteins.

    PubMed Central

    Albright, L M; Ronson, C W; Nixon, B T; Ausubel, F M

    1989-01-01

    The ntrA gene of Rhizobium meliloti has recently been identified and shown to be required for a diverse set of metabolic functions (C. W. Ronson, B. T. Nixon, L. M. Albright, and F. M. Ausubel, J. Bacteriol. 169:2424-2431, 1987). As a result of sequencing the ntrA gene and its flanking regions from R. meliloti, we identified an open reading frame directly upstream of ntrA, ORF1, whose predicted product is homologous to a superfamily of ATP-binding proteins involved in transport, cell division, nodulation, and DNA repair. The homology of ORF1 to this superfamily and its proximity to ntrA led us to investigate its role in symbiosis by mutagenesis and expression studies. We were unable to isolate an insertion mutation in ORF1, suggesting that ORF1 may code for an essential function. We identified the start of transcription for the ntrA gene in vegetative cells and bacteroids and showed that ORF1 and ntrA are transcriptionally unlinked. ORF1 appears to be in an operon with one or more upstream genes. Images PMID:2703463

  20. Cuticular Defects in Oryza sativa ATP-binding Cassette Transporter G31 Mutant Plants Cause Dwarfism, Elevated Defense Responses and Pathogen Resistance.

    PubMed

    Garroum, Imène; Bidzinski, Przemyslaw; Daraspe, Jean; Mucciolo, Antonio; Humbel, Bruno M; Morel, Jean-Benoit; Nawrath, Christiane

    2016-06-01

    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between plant and environment. Homologs of the ATP-binding cassette (ABC) transporter AtABCG32/HvABCG31 clade are necessary for the formation of a functional cuticle in both monocots and dicots. Here we characterize the osabcg31 knockout mutant and hairpin RNA interference (RNAi)-down-regulated OsABCG31 plant lines having reduced plant growth and a permeable cuticle. The reduced content of cutin in leaves and structural alterations in the cuticle and at the cuticle-cell wall interface in plants compromised in OsABCG31 expression explain the cuticle permeability. Effects of modifications of the cuticle on plant-microbe interactions were evaluated. The cuticular alterations in OsABCG31-compromised plants did not cause deficiencies in germination of the spores or the formation of appressoria of Magnaporthe oryzae on the leaf surface, but a strong reduction of infection structures inside the plant. Genes involved in pathogen resistance were constitutively up-regulated in OsABCG31-compromised plants, thus being a possible cause of the resistance to M. oryzae and the dwarf growth phenotype. The findings show that in rice an abnormal cuticle formation may affect the signaling of plant growth and defense.

  1. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.

    PubMed

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane

    2011-05-01

    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  2. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action.

    PubMed

    Bordignon, Enrica; Grote, Mathias; Schneider, Erwin

    2010-09-01

    The maltose/maltodextrin transport system of Escherichia coli/Salmonella, composed of periplasmic maltose-binding protein, MalE, the pore-forming subunits MalF and MalG, and a homodimer of the nucleotide-binding subunit, MalK, serves as a model for canonical ATP-binding cassette importers in general. The wealth of knowledge accumulated on the maltose transporter in more than three decades by genetic, molecular genetic and biochemical means was complemented more recently by crystal structures of the isolated MalK dimer and of two conformational states of the full transporter. Here, we summarize insights into the transport mechanism provided by these structures and draw the reader's attention to experimental tools by which the dynamics of the transporter can be studied during substrate translocation. A transport model is presented that integrates currently available biochemical, biophysical and structural data. We also present the state of knowledge on regulatory functions of the maltose transporter associated with the C-terminal domain of MalK. Finally, we will address the application of coarse-grained modelling to visualize the progression of the conformational changes of an ABC transporter with special emphasis on the maltose system, which can provide a model platform for testing and validating the bioinformatic tools.

  3. Peroxisomal ATP-Binding Cassette Transporter COMATOSE and the Multifunctional Protein ABNORMAL INFLORESCENCE MERISTEM Are Required for the Production of Benzoylated Metabolites in Arabidopsis Seeds1[W

    PubMed Central

    Bussell, John D.; Reichelt, Michael; Wiszniewski, Andrew A.G.; Gershenzon, Jonathan; Smith, Steven M.

    2014-01-01

    Secondary metabolites derived from benzoic acid (BA) are of central importance in the interactions of plants with pests, pathogens, and symbionts and are potentially important in plant development. Peroxisomal β-oxidation has recently been shown to contribute to BA biosynthesis in plants, but not all of the enzymes involved have been defined. In this report, we demonstrate that the peroxisomal ATP-binding cassette transporter COMATOSE is required for the accumulation of benzoylated secondary metabolites in Arabidopsis (Arabidopsis thaliana) seeds, including benzoylated glucosinolates and substituted hydroxybenzoylcholines. The ABNORMAL INFLORESCENCE MERISTEM protein, one of two multifunctional proteins encoded by Arabidopsis, is essential for the accumulation of these compounds, and MULTIFUNCTIONAL PROTEIN2 contributes to the synthesis of substituted hydroxybenzoylcholines. Of the two major 3-ketoacyl coenzyme A thiolases, KAT2 plays the primary role in BA synthesis. Thus, BA biosynthesis in Arabidopsis employs the same core set of β-oxidation enzymes as in the synthesis of indole-3-acetic acid from indole-3-butyric acid. PMID:24254312

  4. Effect of tacrolimus on activity and expression of P-glycoprotein and ATP-binding cassette transporter A5 (ABCA5) proteins in hematoencephalic barrier cells.

    PubMed

    Quezada, Claudia Andrea; Garrido, Wallys Ximena; González-Oyarzún, Mauricio Alejandro; Rauch, María Cecilia; Salas, Mónica Roxana; San Martín, Rody Enrique; Claude, Alejandro Andrés; Yañez, Alejandro Javier; Slebe, Juan Carlos; Cárcamo, Juan Guillermo

    2008-10-01

    Tacrolimus is an agent used in clinical immunosuppressive drug therapies. A wide spectrum of adverse effects has been reported in association with this immunosuppressor, including neurotoxic effect. The upper limit of therapeutic blood concentrations of tacrolimus has been described as 30 ng/ml in immunosuppressed patients. We investigated the effect of this therapeutic dose of tacrolimus on the expression and activity of the multidrug resistance protein 1 (MDR1 or Pgp, P-glycoprotein) and ATP-binding cassette transporters A5 (ABCA5) in human brain microvascular endothelial cells (HBMEC), derived from Blood-Brain Barrier (BBB) endothelium, these being the most predominantly expressed transcripts in these cells. The expression and activity of MDR1 transporter decreased with 30 ng/ml tacrolimus. The cell viability was not changed with the therapeutic dose used. By contrast, ABCA5 transcripts, of unknown role as yet, increased their expression at this concentration. We propose that the secondary cytotoxic effects of this immunosuppressor on CSN, besides the functional blockade related to multidrug resistance proteins, such as MDR1, and probably ABCA5, could be linked to variations in the expression levels of these proteins at the BBB.

  5. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter.

    PubMed

    Alvarez, Frances Joan D; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R Michael; Klug, Candice S; Davidson, Amy L

    2015-12-01

    MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP.

  6. Altered Profile of Secondary Metabolites in the Root Exudates of Arabidopsis ATP-Binding Cassette Transporter Mutants1[C][W][OA

    PubMed Central

    Badri, Dayakar V.; Loyola-Vargas, Victor M.; Broeckling, Corey D.; De-la-Peña, Clelia; Jasinski, Michal; Santelia, Diana; Martinoia, Enrico; Sumner, Lloyd W.; Banta, Lois M.; Stermitz, Frank; Vivanco, Jorge M.

    2008-01-01

    Following recent indirect evidence suggesting a role for ATP-binding cassette (ABC) transporters in root exudation of phytochemicals, we identified 25 ABC transporter genes highly expressed in the root cells most likely to be involved in secretion processes. Of these 25 genes, we also selected six full-length ABC transporters and a half-size transporter for in-depth molecular and biochemical analyses. We compared the exuded root phytochemical profiles of these seven ABC transporter mutants to those of the wild type. There were three nonpolar phytochemicals missing in various ABC transporter mutants compared to the wild type when the samples were analyzed by high-performance liquid chromatography-mass spectrometry. These data suggest that more than one ABC transporter can be involved in the secretion of a given phytochemical and that a transporter can be involved in the secretion of more than one secondary metabolite. The primary and secondary metabolites present in the root exudates of the mutants were also analyzed by gas chromatography-mass spectrometry, which allowed for the identification of groups of compounds differentially found in some of the mutants compared to the wild type. For instance, the mutant Atpdr6 secreted a lower level of organic acids and Atmrp2 secreted a higher level of amino acids as compared to the wild type. We conclude that the release of phytochemicals by roots is partially controlled by ABC transporters. PMID:18065561

  7. Apolipoprotein M expression increases the size of nascent pre beta HDL formed by ATP binding cassette transporter A1.

    PubMed

    Mulya, Anny; Seo, Jeongmin; Brown, Amanda L; Gebre, Abraham K; Boudyguina, Elena; Shelness, Gregory S; Parks, John S

    2010-03-01

    Apolipoprotein M (apoM) is a novel apolipoprotein that is reportedly necessary for pre beta HDL formation; however, its detailed function remains unknown. We investigated the biogenesis and properties of apoM and its effects on the initial steps of nascent pre beta HDL assembly by ABCA1 in HEK293 cells. Transiently transfected apoM was localized primarily in the endomembrane compartment. Pulse-chase analyses demonstrated that apoM is inefficiently secreted, relative to human serum albumin, and that approximately 50% remains membrane-associated after extraction with sodium carbonate, pH 11.5. To investigate the role of apoM in nascent pre beta HDL formation, ABCA1-expressing or control cells, transfected with empty vector, apoM, or C-terminal epitope-tagged apoM (apoM-C-FLAG), were incubated with (125)I-apoA-I for 24 h. Conditioned media were harvested and fractionated by fast-protein liquid chromatography (FPLC) to monitor HDL particle size. Pre beta HDL particles were formed effectively in the absence of apoM expression; however, increased apoM expression stimulated the formation of larger-sized nascent pre beta HDLs. Immunoprecipitation with anti-apoA-I antibody followed by apoM Western blot analysis revealed that little secreted apoM was physically associated with pre beta HDL. Our results suggest that apoM is an atypical secretory protein that is not necessary for ABCA1-dependent pre beta HDL formation but does stimulate the formation of larger-sized pre beta HDL. We propose that apoM may function catalytically at an intracellular site to transfer lipid onto pre beta HDL during or after their formation by ABCA1.

  8. Human Papillomavirus at Multiple Sites Associated with Anal Squamous Intraepithelial Lesions in HIV-Seropositive Individuals

    PubMed Central

    Chuang, Eleanore; Lim, Eunjung; Milne, Cris; Zhu, Xuemei; Agsalda, Melissa; Killeen, Jeffrey; Miller, F DeWolfe; Hernandez, Brenda Y.; Shiramizu, Bruce

    2016-01-01

    Objective HIV-Seropositive patients have higher risk of HPV infection even on anti-retroviral therapy. Infection with high-risk HPV genotypes can cause dysplasia leading to cancer. This study assessed HPV at different anatomical sites in HIV-seropositive individuals and factors associated with anal squamous intraepithelial lesions (ASIL). Methods Specimens were obtained from multiple anatomical sites for each participant in conjunction with routine screening for anal dysplasia. Female specimens included cervical and anal cytologies and oral wash. Male specimens included anal cytologies, oral wash, and exfoliated cells from penile head, penile shaft, scrotum, and from uncircumcised subjects, inner foreskin. Demographic and clinical characteristics were recorded. Following DNA extraction, HIV DNA copy was assessed by qPCR; HPV was genotyped. Statistical analyses included calculation of odds ratios (OR) and 95% confidence intervals (CI), t-tests or Mann-Whitney tests. Results Males were more likely to have ASIL: 29/50 (58%) compared to 1/11 females (9%) (OR=13.81, 95% CI: 1.64–116.32). HPV 6 or 11 in anal specimens was significantly associated with ASIL (OR= 6.29, 95% CI: 1.49–26.44). Number of HPV genotypes in anal specimens was also significant: ASIL+ (3.4 ± 3.1) versus ASIL− (1.6 ± 3.1) (p=0.009). Among 44 males, HPV was detected from at least one anatomical site for 33 participants (75%): 27 anus (61%), 19 oral wash (44%), 17 penile shaft (39%), 11 scrotum (26%), 10 penile head (23%), 0 foreskin. Detection of HPV in penile shaft specimens was significantly associated with ASIL (OR=6.79, 95% CI: 1.57–29.36) as was number of HPV genotypes in penile shaft specimens: ASIL+ (2.4 ± 4.0) versus ASIL− (0.6 ± 1.7) (p=0.025). Only 1/11 females had ASIL; only 1/11 females had cervical dysplasia: OR was not estimable due to small numbers. Conclusions Males were more prone to ASIL than females. HPV at anal as well as non-anal sites may be indicative of ASIL. PMID

  9. Therapeutic benefits of carbon dioxide (CO2) laser on single-site HPV lesions in the lower female genital tract

    NASA Astrophysics Data System (ADS)

    Urru, Giovanni; Moretti, Gianfranco

    1998-01-01

    Numerous studies have shown contradictory variable percentages of recurrent HPV lesions, after various therapies. The present study therefore evaluates the effectiveness of CO2 laser vaporization in the treatment of single-site HPV lesions of the lower female genital tract in order to confirm the conviction that physical therapy alone, in agreement with some findings reported in the literature, is capable of guaranteeing a high cure rate in selected patients. From January 1995 to June 1996, seventy- five female patients were treated with CO2 laser vaporization for single-site genital HPV lesions, some of which were associated with low-grade intra-epithelial neoplasia. The success rate after 12 months proved to be 97%. The pre-existing clinical symptoms disappeared in all the patients treated. No complication in the vaporization procedure was encountered.

  10. Kaempferol suppresses lipid accumulation in macrophages through the downregulation of cluster of differentiation 36 and the upregulation of scavenger receptor class B type I and ATP-binding cassette transporters A1 and G1.

    PubMed

    Li, Xiu-Ying; Kong, Ling-Xi; Li, Juan; He, Hai-Xia; Zhou, Yuan-Da

    2013-02-01

    The accumulation of foam cells in atherosclerotic lesions is a hallmark of early-stage atherosclerosis. Kaempferol has been shown to inhibit oxidized low-density lipoprotein (oxLDL) uptake by macrophages; however, the underlying molecular mechanisms are not yet fully investigated. In this study, we shown that treatment with kaempferol markedly suppresses oxLDL-induced macrophage foam cell formation, which occurs due to a decrease in lipid accumulation and an increase in cholesterol efflux from THP-1-derived macrophages. Additionally, the kaempferol treatment of macrophages led to the downregulation of cluster of differentiation 36 (CD36) protein levels, the upregulation of ATP-binding cassette (ABC) transporter A1 (ABCA1), scavenger receptor class B type I (SR-BI) and ABCG1 protein levels, while no effects on scavenger receptor A (SR-A) expression were observed. Kaempferol had similar effects on the mRNA and protein expression of ABCA1, SR-BI, SR-A, CD36 and ABCG1. The reduced CD36 expression following kaempferol treatment involved the inhibition of c-Jun-activator protein-1 (AP-1) nuclear translocation. The inhibition of AP-1 using the inhibitor, SP600125, confirmed this involvement, as the AP-1 inhibition significantly augmented the kaempferol-induced reduction in CD36 expression. Accordingly, the kaempferol-mediated suppression of lipid accumulation in macrophages was also augmented by SP600125. The increased expression of ABCA1, SR-BI and ABCG1 following kaempferol treatment was accompanied by the enhanced protein expression of heme oxygenase-1 (HO-1). This increase was reversed following the knockdown of the HO-1 gene using small hairpin RNA (shRNA). Moreover, the kaempferol-mediated attenuation of lipid accumulation and the promotion of cholesterol efflux was also inhibited by HO-1 shRNA. In conclusion, the c-Jun-AP‑1-dependent downregulation of CD36 and the HO-1-dependent upregulation of ABCG1, SR-BI and ABCA1 may mediate the beneficial effects of

  11. Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

    PubMed Central

    Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling

    2014-01-01

    Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

  12. Intrinsic acyl-CoA thioesterase activity of a peroxisomal ATP binding cassette transporter is required for transport and metabolism of fatty acids.

    PubMed

    De Marcos Lousa, Carine; van Roermund, Carlo W T; Postis, Vincent L G; Dietrich, Daniela; Kerr, Ian D; Wanders, Ronald J A; Baldwin, Stephen A; Baker, Alison; Theodoulou, Frederica L

    2013-01-22

    Peroxisomes are organelles that perform diverse metabolic functions in different organisms, but a common function is β-oxidation of a variety of long chain aliphatic, branched, and aromatic carboxylic acids. Import of substrates into peroxisomes for β-oxidation is mediated by ATP binding cassette (ABC) transporter proteins of subfamily D, which includes the human adrenoleukodystropy protein (ALDP) defective in X-linked adrenoleukodystrophy (X-ALD). Whether substrates are transported as CoA esters or free acids has been a matter of debate. Using COMATOSE (CTS), a plant representative of the ABCD family, we demonstrate that there is a functional and physical interaction between the ABC transporter and the peroxisomal long chain acyl-CoA synthetases (LACS)6 and -7. We expressed recombinant CTS in insect cells and showed that membranes from infected cells possess fatty acyl-CoA thioesterase activity, which is stimulated by ATP. A mutant, in which Serine 810 is replaced by asparagine (S810N) is defective in fatty acid degradation in vivo, retains ATPase activity but has strongly reduced thioesterase activity, providing strong evidence for the biological relevance of this activity. Thus, CTS, and most likely the other ABCD family members, represent rare examples of polytopic membrane proteins with an intrinsic additional enzymatic function that may regulate the entry of substrates into the β-oxidation pathway. The cleavage of CoA raises questions about the side of the membrane where this occurs and this is discussed in the context of the peroxisomal coenzyme A (CoA) budget.

  13. Intrinsic acyl-CoA thioesterase activity of a peroxisomal ATP binding cassette transporter is required for transport and metabolism of fatty acids

    PubMed Central

    De Marcos Lousa, Carine; van Roermund, Carlo W. T.; Postis, Vincent L. G.; Dietrich, Daniela; Kerr, Ian D.; Wanders, Ronald J. A.; Baldwin, Stephen A.; Baker, Alison; Theodoulou, Frederica L.

    2013-01-01

    Peroxisomes are organelles that perform diverse metabolic functions in different organisms, but a common function is β-oxidation of a variety of long chain aliphatic, branched, and aromatic carboxylic acids. Import of substrates into peroxisomes for β-oxidation is mediated by ATP binding cassette (ABC) transporter proteins of subfamily D, which includes the human adrenoleukodystropy protein (ALDP) defective in X-linked adrenoleukodystrophy (X-ALD). Whether substrates are transported as CoA esters or free acids has been a matter of debate. Using COMATOSE (CTS), a plant representative of the ABCD family, we demonstrate that there is a functional and physical interaction between the ABC transporter and the peroxisomal long chain acyl-CoA synthetases (LACS)6 and -7. We expressed recombinant CTS in insect cells and showed that membranes from infected cells possess fatty acyl-CoA thioesterase activity, which is stimulated by ATP. A mutant, in which Serine 810 is replaced by asparagine (S810N) is defective in fatty acid degradation in vivo, retains ATPase activity but has strongly reduced thioesterase activity, providing strong evidence for the biological relevance of this activity. Thus, CTS, and most likely the other ABCD family members, represent rare examples of polytopic membrane proteins with an intrinsic additional enzymatic function that may regulate the entry of substrates into the β-oxidation pathway. The cleavage of CoA raises questions about the side of the membrane where this occurs and this is discussed in the context of the peroxisomal coenzyme A (CoA) budget. PMID:23288899

  14. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico

    2013-01-01

    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  15. Bacteriophage-mediated Glucosylation Can Modify Lipopolysaccharide O-Antigens Synthesized by an ATP-binding Cassette (ABC) Transporter-dependent Assembly Mechanism.

    PubMed

    Mann, Evan; Ovchinnikova, Olga G; King, Jerry D; Whitfield, Chris

    2015-10-16

    Lysogenic bacteriophages may encode enzymes that modify the structures of lipopolysaccharide O-antigen glycans, altering the structure of the bacteriophage receptor and resulting in serotype conversion. This can enhance virulence and has implications for antigenic diversity and vaccine development. Side chain glucosylation is a common modification strategy found in a number of bacterial species. To date, glucosylation has only been observed in O-antigens synthesized by Wzy-dependent pathways, one of the two most prevalent O-antigen synthesis systems. Here we exploited a heterologous system to study the glucosylation potential of a model O-antigen produced in an ATP-binding cassette (ABC) transporter-dependent system. Although O-antigen production is cryptic in Escherichia coli K-12, because of a mutation in the synthesis genes, it possesses a prophage glucosylation cluster, which modifies the GlcNAc residue in an α-l-Rha-(1→3)-d-GlcNAc motif found in the original O16 antigen. Raoultella terrigena ATCC 33257 produces an O-antigen possessing the same disaccharide motif, but its assembly uses an ABC transporter-dependent system. E. coli harboring the R. terrigena O-antigen biosynthesis genes produced an O-antigen displaying reduced reactivity toward antisera raised against the native R. terrigena repeat structure, indicative of an altered chemical structure. Structural determination using NMR revealed the addition of glucose side chains to the repeat units. O-antigen modification was dependent on a functional ABC transporter, consistent with modification in the periplasm, and was eliminated by deletion of the glucosylation genes from the E. coli chromosome, restoring native level antisera sensitivity and structure. There are therefore no intrinsic mechanistic barriers for bacteriophage-mediated O-antigen glucosylation in ABC transporter-dependent pathways. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. A new strategy of high-speed screening and quantitative structure-activity relationship analysis to evaluate human ATP-binding cassette transporter ABCG2-drug interactions.

    PubMed

    Saito, Hikaru; Hirano, Hiroyuki; Nakagawa, Hiroshi; Fukami, Takeaki; Oosumi, Keisuke; Murakami, Kaori; Kimura, Hiroko; Kouchi, Takayuki; Konomi, Mami; Tao, Eriko; Tsujikawa, Noboru; Tarui, Shigeki; Nagakura, Makoto; Osumi, Masako; Ishikawa, Toshihisa

    2006-06-01

    The human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR1/ABCP) plays a critical role in cellular protection against xenobiotics as well as pharmacokinetics of drugs in our body. In the present study, we aimed to analyze the quantitative structure-activity relationship (QSAR) latently residing in ABCG2-drug interactions. We first established standard methods for expression of human ABCG2 in insect cells, quality control of plasma membrane samples by using electron microscopy techniques, and high-speed screening of ABCG2 inhibition with test compounds. Plasma membrane vesicles prepared from ABCG2-expressing Sf9 cells were used as a model system to measure the ATP-dependent transport of [3H]methotrexate (MTX). Forty-nine different therapeutic drugs and natural compounds were tested for their ability to inhibit ABCG2-mediated MTX transport. Based on their inhibition profiles, we performed QSAR analysis using chemical fragmentation codes deduced from the structures of test compounds. Multiple linear regression analysis delineated a relationship between the structural components and the extent of ABCG2 inhibition, allowing us to identify one set of structure-specific chemical fragmentation codes that are closely correlated with the inhibition of ABCG2 transport activity. Based on the QSAR analysis data, we predicted the potency of gefitinib to inhibit ABCG2. The validity of our QSAR-based prediction for gefitinib was examined by actual experiments. Our kinetic analysis experiments suggest that the ABCG2-ATP complex binds gefitinib. The present study provides a new strategy for analyzing ABCG2-drug interactions. This strategy is considered to be practical and useful for the molecular designing of new ABCG2 modulators.

  17. An ATP Binding Cassette Transporter Mediates the Uptake of α-(1,6)-Linked Dietary Oligosaccharides in Bifidobacterium and Correlates with Competitive Growth on These Substrates*

    PubMed Central

    Fredslund, Folmer; Vujičić Žagar, Andreja; Andersen, Thomas Lars; Svensson, Birte; Slotboom, Dirk Jan

    2016-01-01

    The molecular details and impact of oligosaccharide uptake by distinct human gut microbiota (HGM) are currently not well understood. Non-digestible dietary galacto- and gluco-α-(1,6)-oligosaccharides from legumes and starch, respectively, are preferentially fermented by mainly bifidobacteria and lactobacilli in the human gut. Here we show that the solute binding protein (BlG16BP) associated with an ATP binding cassette (ABC) transporter from the probiotic Bifidobacterium animalis subsp. lactis Bl-04 binds α-(1,6)-linked glucosides and galactosides of varying size, linkage, and monosaccharide composition with preference for the trisaccharides raffinose and panose. This preference is also reflected in the α-(1,6)-galactoside uptake profile of the bacterium. Structures of BlG16BP in complex with raffinose and panose revealed the basis for the remarkable ligand binding plasticity of BlG16BP, which recognizes the non-reducing α-(1,6)-diglycoside in its ligands. BlG16BP homologues occur predominantly in bifidobacteria and a few Firmicutes but lack in other HGMs. Among seven bifidobacterial taxa, only those possessing this transporter displayed growth on α-(1,6)-glycosides. Competition assays revealed that the dominant HGM commensal Bacteroides ovatus was out-competed by B. animalis subsp. lactis Bl-04 in mixed cultures growing on raffinose, the preferred ligand for the BlG16BP. By comparison, B. ovatus mono-cultures grew very efficiently on this trisaccharide. These findings suggest that the ABC-mediated uptake of raffinose provides an important competitive advantage, particularly against dominant Bacteroides that lack glycan-specific ABC-transporters. This novel insight highlights the role of glycan transport in defining the metabolic specialization of gut bacteria. PMID:27502277

  18. Functional interplay between the ATP binding cassette Msr(D) protein and the membrane facilitator superfamily Mef(E) transporter for macrolide resistance in Escherichia coli.

    PubMed

    Nunez-Samudio, Virginia; Chesneau, Olivier

    2013-04-01

    Macrolides have wide clinical applications in the treatment of community-acquired respiratory tract infections, among which streptococci are the most frequent causative agents. An active efflux-based mechanism of macrolide resistance, referred to as the M phenotype in streptococcal isolates, has been associated with the presence of mef genes that encode a subset of major facilitator superfamily (MFS) transporters like Mef(E). An msr(D) gene, adjacent to and co-transcribed with mef in the presence of erythromycin, has also been implicated in drug efflux, but its role remains elusive. Msr(D) belongs to the ATP binding cassette (ABC) proteins and harbors two fused nucleotide-binding domains with no membrane-spanning domains. The present work indicates that the major resistance traits of the M phenotype in Escherichia coli may be due to Msr(D) and not to Mef(E). Fluorescence microscopy using Mef(E) tagged with GFP linked low efficacy of the chimera in conferring macrolide resistance with improper subcellular localization. The active role of Msr(D) in directing Mef(E)-GFP to the cell poles was demonstrated, as was synergistic effect in terms of levels of resistance when both proteins were expressed. A trans-dominant negative mutation within ABC Msr(D) affecting MFS Mef(E) strongly suggests that both proteins can interact in vivo, and such a physical interaction was supported in vitro. This is the first reported example of a functional interplay between an ABC component and an MFS transporter. The direct involvement of Msr(D) in the efflux of macrolides remains to be demonstrated.

  19. Association of ATP-Binding Cassette Transporter A1 (ABCA1)-565 C/T Gene Polymorphism with Hypoalphalipoproteinemia and Serum Lipids, IL-6 and CRP Levels

    PubMed Central

    Babashamsi, Mohammad Mahdi; Halalkhor, Sohrab; Moradi Firouzjah, Hamid; Parsian, Hadi; Jalali, Seyed Farzad; Babashamsi, Mohammad

    2017-01-01

    Background: ATP-binding cassette transporter A1 (ABCA1) is a membrane integral protein which plays a vital role in High Density Lipoprotein (HDL) metabolism and exerts a protective effect against Hypoalphalipoproteinemia (HA) by mediation of rate-limiting step in HDL biogenesis. In addition, this protein possesses anti-inflammatory effects by inhibiting the production of some inflammatory cytokines in macrophages. This study investigated the association of ABCA1-565 C/T gene polymorphism with HA and serum lipids, IL-6 and CRP levels. Methods: A population which consisted of 101 HA and 95 normal subjects were genotyped for ABCA1-565C/T polymorphism by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). The serum concentrations of lipids, IL-6 and high sensitive-CRP (hs-CRP) were measured by the relevant methods. Results: The frequency of T allele was significantly higher in the HA group than the controls (31.7 vs. 19.5%, p=0.002). Thus, carriers of the T allele (CT and TT genotypes) had a higher risk for HA (p=0.016, OR=2.04, 95% CI=1.14–3.63). T allele carriers demonstrated decreased HDL-C and increased triglyceride, IL-6 and CRP levels than those with the CC genotype. Conclusion: This study suggests that the-565 C/T polymorphism of ABCA1 gene is associated with an increased risk of HA, decreased HDL-C and increased TG, IL-6 and CRP. PMID:28090279

  20. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.

    PubMed

    Schäfer-Somi, S; Palme, N

    2016-04-01

    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as < 50% progressive motility and/or > 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings.

  1. Residues of a proposed gate region in type I ATP-binding cassette import systems are crucial for function as revealed by mutational analysis.

    PubMed

    Weidlich, Daniela; Wiesemann, Nicole; Heuveling, Johanna; Wardelmann, Kristina; Landmesser, Heidi; Sani, Katayoun Behnam; Worth, Catherine L; Preissner, Robert; Schneider, Erwin

    2013-09-01

    The type I ATP-binding cassette (ABC) importer for positively charged amino acids of the thermophilic bacterium Geobacillus stearothermophilus consists of the extracellular solute binding protein, ArtJ, and a homodimer each of the transmembrane subunit, ArtM, and the nucleotide-binding and -hydrolyzing subunit, ArtP. We have investigated the functional consequences of mutations affecting conserved residues from two peptide regions in ArtM, recently proposed to form a 'gate' by which access of a substrate to the translocation path is controlled (Hollenstein et al., 2007 [14]). Transporter variants were reconstituted into proteoliposomes and assayed for ArtJ/arginine-stimulated ATPase activity. Replacement of residues from region 1 (Arg-63, Pro-66) caused no or only moderate reduction in ATPase activity. In contrast, mutating residues from gate region 2 (Lys-159, Leu-163) resulted in a substantial increase in ATPase activity which, however, as demonstrated for variants ArtM(K159I) and ArtM(K159E), is not coupled to transport. Replacing homologous residues in the closely related histidine transporter of Salmonella enterica serovar Typhimurium (HisJ-QMP2) caused different phenotypes. Mutation to isoleucine of HisQ(K163) or HisM(H172), both homologous to ArtM(K159), abolished ATPase activity. The mutations most likely caused a structural change as revealed by limited proteolysis. In contrast, substantial, albeit reduced, enzymatic activity was observed with variants of HisQ(L167→G) or HisM(L176→G), both homologous to ArtM(L163). Our study provides the first experimental evidence in favor of a crucial role of residues from the proposed gate region in type I ABC importer function. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.

    PubMed Central

    Lu, Y P; Li, Z S; Drozdowicz, Y M; Hortensteiner, S; Martinoia, E; Rea, P A

    1998-01-01

    Three ATP binding cassette (ABC) transporter-like activities directed toward large amphipathic organic anions have recently been identified on the vacuolar membrane of plant cells. These are the Mg-ATP-energized, vanadate-inhibitable vacuolar accumulation of glutathione S-conjugates (GS conjugates), chlorophyll catabolites, and bile acids, respectively. Although each of these activities previously had been assigned to distinct pumps in native plant membranes, we describe here the molecular cloning, physical mapping, and heterologous expression of a gene, AtMRP2, from Arabidopsis thaliana that encodes a multispecific ABC transporter competent in the transport of both GS conjugates and chlorophyll catabolites. Unlike its isoform, AtMRP1, which transports the model Brassica napus chlorophyll catabolite transporter substrate Bn-NCC-1 at low efficiency, heterologously expressed AtMRP2 has the facility for simultaneous high-efficiency parallel transport of GS conjugates and Bn-NCC-1. The properties of AtMRP2 therefore establish a basis for the manipulation of two previously identified plant ABC transporter activities and provide an explanation for how the comparable transporter in native plant membranes would be systematically mistaken for two distinct transporters. These findings are discussed with respect to the functional organization of AtMRP2, the inability of AtMRP2 and AtMRP1 to transport the model bile acid transporter substrate taurocholate (despite the pronounced sensitivity of both to direct inhibition by this agent), the differential patterns of expression of their genes in the intact plant, and the high capacity of AtMRP2 for the transport of glutathionated herbicides and anthocyanins. PMID:9490749

  3. MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A

    2013-06-07

    The bile acid receptor farnesoid X receptor (FXR) regulates many aspects of lipid metabolism by variouscomplex and incompletely understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma high-density lipoprotein (HDL)-cholesterol levels. Here, we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lowers hepatic ABCA1 and plasma HDL levels. We identified 2 complementary sequences to miR-144 in the 3' untranslated region of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I protein, whereas overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we used tissue-specific FXR-deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal, FXR. Finally, we identified functional FXR response elements upstream of the miR-144 locus, consistent with direct FXR regulation. We have identified a novel pathway involving FXR, miR-144, and ABCA1 that together regulate plasma HDL-cholesterol.

  4. Drug interaction between sunitinib and cimetidine and contribution of the efflux transporter ATP-binding cassette C2 to biliary excretion of sunitinib in rats.

    PubMed

    Arakawa-Todo, Maki; Ueyama, Jun; Nomura, Hiroshi; Abe, Fumie; Tsukiyama, Ikuto; Matsuura, Katsuhiko; Hasegawa, Takaaki

    2013-08-01

    The present study investigated the effect of the H2 antagonist cimetidine on the pharmacokinetics of a multi-targeted receptor tyrosine kinase (RTK) inhibitor, sunitinib, in Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic mutant rats (EHBR) lacking the efflux transporter, ATP-binding cassette C2 protein (ABCC2). Rats received an intraperitoneal injection of cimetidine (10 mg/kg) once a day for three days. On day 4, sunitinib (3 mg/kg) was administered intravenously 30 min after the final injection of cimetidine or saline to SD rats. Disappearance of sunitinib from plasma was significantly delayed by cimetidine. The pharmacokinetic parameter of sunitinib, systemic clearance (CLSYS), was significantly reduced and the half-life was significantly prolonged, with no change in the volume of distribution at steady-state (VSS). When the effect of cimetidine on the biliary excretion of sunitinib at steady-state condition was investigated in SD rats, cimetidine had no effect on some transporter-mediated biliary excretion of sunitinib. Furthermore, the contribution of ABCC2 to the biliary excretion of sunitinib was also examined in SD rats and EHBR. The biliary clearance of sunitinib was significantly lower in EHBR, but the biliary excretion rate of EHBR was not different from that of SD rats, and the contribution of biliary excretion to systemic elimination was small, suggesting that sunitinib is mainly eliminated by cytochrome P450 3A4 (CYP3A4)-mediated metabolism and is not excreted into the bile via ABCC2. These findings indicate that co-administration of cimetidine alters the pharmacokinetics of sunitinib probably due to inhibition of CYP3A4, suggesting the possibility that cimetidine should be used carefully for patients with cancer being treated with sunitinib therapy.

  5. ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-Altritol and Galactitol Catabolic Pathways in Agrobacterium tumefaciens C58*

    PubMed Central

    Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.

    2015-01-01

    Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925

  6. A Mutation within the Extended X Loop Abolished Substrate-induced ATPase Activity of the Human Liver ATP-binding Cassette (ABC) Transporter MDR3*

    PubMed Central

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-01-01

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467

  7. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    PubMed

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain.

  8. Effects of silencing the ATP-binding cassette protein E1 gene by electroporation on the proliferation and migration of EC109 human esophageal cancer cells.

    PubMed

    Li, Xiao-Rui; Yang, Liu-Zhong; Huo, Xiao-Qing; Wang, Ying; Yang, Qing-Hui; Zhang, Qing-Qin

    2015-07-01

    In the present study, the gene expression of ATP-binding cassette protein E1 (ABCE1) in the EC109 human esophageal cancer cell line was silenced using electroporation to examine the effect if the ABCE1 gene on the growth migration and cell cycle of cancer cells. The small interference (si)RNA sequence of ABCE1 was designed and synthesized to transfect the EC109 cells by electroporation. The mRNA and protein expression levels of ABCE1 were then detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The analysis of the cell cycle and apoptosis was performed using flow cytometry. The effect of silencing the ABCE1 gene on the proliferation, migration and invasive ability of the EC109 human esophageal cancer cells were assessed using a Cell counting kit-8 (CCK-8) and with proliferation, wound-healing and cell invasion assays. The mRNA and protein expression levels of ABCE1 were significantly lower in the experimental group compared with the control group (P<0.05). The apoptotic rate of the experimental group was markedly higher than the control group and blank group (P<0.01). The CCK-8 proliferation assay revealed that, compared with the control and blank groups, the proliferation of the EC109 cells in the experimental group was significantly inhibited (P<0.05). The wound healing assay revealed that the migration capacity of the cells in the experimental group was significantly decreased (P<0.05). The Transwell chamber assay demonstrated that the invasive ability of the EC109 cells in the experimental group was significantly decreased (P<0.01). These results revealed that ABCE1 is closely associated with cell proliferation, invasion and migration in esophageal cancer and silencing the ABCE1 gene by electroporation can significantly reduce the proliferation, invasion and migration capacity of EC109 cells in vitro.

  9. Molecular phylogenetic study and expression analysis of ATP-binding cassette transporter gene family in Oryza sativa in response to salt stress.

    PubMed

    Saha, Jayita; Sengupta, Atreyee; Gupta, Kamala; Gupta, Bhaskar

    2015-02-01

    ATP-binding cassette (ABC) transporter is a large gene superfamily that utilizes the energy released from ATP hydrolysis for transporting myriad of substrates across the biological membranes. Although many investigations have been done on the structural and functional analysis of the ABC transporters in Oryza sativa, much less is known about molecular phylogenetic and global expression pattern of the complete ABC family in rice. In this study, we have carried out a comprehensive phylogenetic analysis constructing neighbor-joining and maximum-likelihood trees based on various statistical methods of different ABC protein subfamily of five plant lineages including Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Selaginella moellendorffii (lycophyte), Arabidopsis thaliana (dicot) and O. sativa (monocot) to explore the origin and evolutionary patterns of these ABC genes. We have identified several conserved motifs in nucleotide binding domain (NBD) of ABC proteins among all plant lineages during evolution. Amongst the different ABC protein subfamilies, 'ABCE' has not yet been identified in lower plant genomes (algae, moss and lycophytes). The result indicated that gene duplication and diversification process acted upon these genes as a major operative force creating new groups and subgroups and functional divergence during evolution. We have demonstrated that rice ABCI subfamily consists of only half size transporters that represented highly dynamic members showing maximum sequence variations among the other rice ABC subfamilies. The evolutionary and the expression analysis contribute to a deep insight into the evolution and diversity of rice ABC proteins and their roles in response to salt stress that facilitate our further understanding on rice ABC transporters.

  10. Effect of ATP-binding Cassette Transporter A1 (ABCA1) Gene Polymorphisms on Plasma Lipid Variables and Common Demographic Parameters in Greek Nurses

    PubMed Central

    Kolovou, Vana; Marvaki, Apostolia; Boutsikou, Maria; Vasilopoulos, Georgios; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa

    2016-01-01

    Objective: The present study is on line with our previous studies evaluating the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms on the lipid variables of Greek student-nurses. The current study was undertaken to (1) estimate the influence of variant(s) such as rs2066715 (V825I), R219K, R1587K, I883M of ABCA1 gene on lipid variables and (2) evaluate the effect of all four ABCA1 polymorphisms on common demographic parameters. Methods: The study population involved 432 unrelated nurses (86 men) who were genotyped for ABCA1 polymorphisms and correlated according to lipid variables [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] and demographic parameters (age, gender, BMI, waist circumference). Results: According to lipid variables concentration there was no difference between genotypes and alleles of V825I, R219K and I883M polymorphisms. The LDL-C concentration was 13% lower in RR compared with RK genotype (100.7 vs. 113.9 mg/dl, p=0.013) of R1587K gene polymorphism. In regression analysis the effects of age, gender and only R1587K gene polymorphism on LDL-C concentrations were proved significant. Additionally, LDL-C was increased (by 1.29 mg/dl on average) by every year of increase of age. Moreover, females had lower LDL-C concentrations as compared with males. Conclusion: Findings suggested that only R1587K polymorphism of ABCA1 gene was associated with lipid variables, age, and gender of Greek nurses. These findings may be helpful in assessing the risk factors for premature coronary heart disease and distinct individuals with lower/higher atherosclerotic burden. PMID:27990182

  11. MicroRNA-20a/b regulates cholesterol efflux through post-transcriptional repression of ATP-binding cassette transporter A1.

    PubMed

    Liang, Bin; Wang, Xin; Song, Xiaosu; Bai, Rui; Yang, Huiyu; Yang, Zhiming; Xiao, Chuanshi; Bian, Yunfei

    2017-09-01

    ATP-binding cassette transporter A1 (ABCA1) plays a crucial role in reverse cholesterol transport and exhibits anti-atherosclerosis effects. Some microRNAs (miRs) regulate ABCA1 expression, and recent studies have shown that miR-20a/b might play a critical role in atherosclerotic diseases. Here, we attempted to clarify the potential contribution of miR-20a/b in post-transcriptional regulation of ABCA1, cholesterol efflux, and atherosclerosis. We performed bioinformatics analysis and found that miR-20a/b was highly conserved and directly bound to ABCA1 mRNA with low binding free energy. Luciferase-reporter assay also confirmed that miR-20a/b significantly reduced luciferase activity associated with the ABCA1 3' untranslated region reporter construct. Additionally, miR-20a/b decreased ABCA1 expression, which, in turn, decreased cholesterol efflux and increased cholesterol content in THP-1 and RAW 264.7 macrophage-derived foam cells. In contrast, miR-20a/b inhibitors increased ABCA1 expression and cholesterol efflux, decreased cholesterol content, and inhibited foam-cell formation. Consistent with our in vitro results, miR-20a/b-treated ApoE(-/-) mice showed decreased ABCA1expression in the liver and reductions of reverse cholesterol transport in vivo. Furthermore, miR-20a/b regulated the formation of nascent high-density lipoprotein and promoted atherosclerotic development, whereas miR-20a/b knockdown attenuated atherosclerotic formation. miR-20 is a new miRNA capable of targeting ABCA1 and regulating ABCA1 expression. Therefore, miR-20 inhibition constitutes a new strategy for ABCA1-based treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Evaluation of the in vitro expression of ATP binding-cassette (ABC) proteins in an Ixodes ricinus cell line exposed to ivermectin.

    PubMed

    Mangia, Carlo; Vismarra, Alice; Kramer, Laura; Bell-Sakyi, Lesley; Porretta, Daniele; Otranto, Domenico; Epis, Sara; Grandi, Giulio

    2016-04-18

    Ticks are among the most important vectors of pathogens causing human and animal disease. Acaricides are used to control tick infestation, although there are increasing reports of resistance. Recently, over-expression of ATP-binding cassette (ABC) transporter proteins (P-glycoproteins, PgP) has been implicated in resistance to the acaricide ivermectin in the ticks Rhipicephalus (Boophilus) microplus and Rhipicephalus sanguineus sensu lato. Ixodid tick cell lines have been used to investigate drug resistance mechanisms. The aim of the present study was to evaluate expression of several PgPs in the Ixodes ricinus-derived cell line IRE/CTVM19 and to determine modulation of expression following treatment with ivermectin. IRE/CTVM19 cells were treated with different concentrations of ivermectin (0, 11, 22 or 33 μM) and incubated for 10 days. Evaluation of viability and relative expression of ABCB1, ABCB6, ABCB8 and ABCB10 genes were carried out at day 10 post treatment. Cell viability ranged between 84% and 92% with no significant differences between untreated and treated cells. qRT-PCR showed that ABC pump expression was not significantly modulated by ivermectin treatment. Expression of the ABCB8 PgP subfamily revealed a biphasic trend, based on the ivermectin concentration. ABCB6 and ABCB10 gene expression was not modulated by ivermectin treatment and ABCB1 expression was not detected. This is the first report of PgP expression in an I. ricinus-derived tick cell line. Development of an in vitro model for the study of acaricide resistance mechanisms would greatly facilitate screening for drug resistance in ticks.

  13. Detoxification of ivermectin by ATP binding cassette transporter C4 and cytochrome P450 monooxygenase 6CJ1 in the human body louse, Pediculus humanus humanus.

    PubMed

    Kim, J H; Gellatly, K J; Lueke, B; Kohler, M; Nauen, R; Murenzi, E; Yoon, K S; Clark, J M

    2017-09-27

    We previously observed that ivermectin-induced detoxification genes, including ATP binding cassette transporter C4 (PhABCC4) and cytochrome P450 6CJ1 (CYP6CJ1) were identified from body lice following a brief exposure to a sublethal dose of ivermectin using a non-invasive induction assay. In this current study, the functional properties of PhABCC4 and CYP6CJ1 were investigated after expression in either X. laevis oocytes or using a baculovirus expression system, respectively. Efflux of [(3) H]-9-(2-phosphonomethoxyethyl) adenine ([(3) H]-PMEA), a known ABCC4 substrate in humans, was detected from PhABCC4 cRNA-injected oocytes by liquid scintillation spectrophotometric analysis and PhABCC4 expression in oocytes was confirmed using ABC transporter inhibitors. Efflux was also determined to be ATP-dependent. Using a variety of insecticides in a competition assay, only co-injection of ivermectin and dichlorodiphenyltrichloroethane led to decreased efflux of [(3) H]-PMEA. PhABCC4-expressing oocytes also directly effluxed [(3) H]-ivermectin, which increased over time. In addition, ivermectin appeared to be oxidatively metabolized and/or sequestered, although at low levels, following functional expression of CYP6CJ1 along with cytochrome P450 reductase in Sf9 cells. Our study suggests that PhABCC4 and perhaps CYP6CJ1 are involved in the Phase III and Phase I xenobiotic metabolism of ivermectin, respectively, and may play an important role in the evolution of ivermectin resistance in lice and other insects as field selection occurs. © 2017 The Royal Entomological Society.

  14. Reduced platelet count, but no major platelet function abnormalities, are associated with loss-of-function ATP-binding cassette-1 gene mutations.

    PubMed

    Minuz, Pietro; Meneguzzi, Alessandra; Femia, Eti Alessandra; Fava, Cristiano; Calabria, Stefano; Scavone, Mariangela; Benati, Donatella; Poli, Giovanni; Zancanaro, Carlo; Calandra, Sebastiano; Lucchi, Tiziano; Cattaneo, Marco

    2017-08-15

    Loss-of-function mutations of the the ATP-binding cassette-1 (ABCA1) gene are the cause of Tangier disease (TD) in homozygous subjects and familial HDL deficiency (FHD) in heterozygous subjects. These disorders are characterized by reduced plasma HDL-cholesterol (HDL-C) and altered efflux of cholesterol from cells. Previous studies in TD patients and ABCA1(-/-) murine models reported defects in platelet count, morphology, and function, but the issue is still controversial. We analyzed three subjects with low to very low HDL-C levels due to the loss-of-function mutations of the ABCA1 gene. Two related patients with FHD were heterozygous carriers of two mutations on the same ABCA1 allele; one, with TD, was homozygous for a different mutation. Mild to moderate thrombocytopenia was observed in all the patients. No morphological platelet abnormalities were detected under optical or EM. History of moderate bleeding tendency was recorded only in one of the FHD patients. Only limited alterations in platelet aggregation and activation of the integrin αIIbβ3 were observed in one FHD patient. While α-granule secretion (P-selectin), content, and secretion of platelet δ-granules (serotonin, ATP, and ADP) and thromboxane (TX) A2 synthesis were normal in all the patients, the expression of lysosomal CD63, in response to some agonists, was reduced in TD patients. In conclusion, three patients carrying ABCA1 genetic variants had low platelet count, with the lowest values observed in TD, not associated with major alterations in platelet morphology and response to agonists or bleeding. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  15. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris

    2011-01-01

    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  16. The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells.

    PubMed

    Davis, Warren

    2011-12-01

    The ATP-binding cassette transporter-2 (ABCA2) has been identified as a possible regulator of lipid metabolism. ABCA2 is most highly expressed in the brain but its effects on cholesterol homeostasis in neuronal-type cells have not been characterized. It is important to study the role of ABCA2 in regulating cholesterol homeostasis in neuronal-type cells because ABCA2 has been identified as a possible genetic risk factor for Alzheimer's disease. In this study, the effects of ABCA2 expression on cholesterol homeostasis were examined in mouse N2a neuroblastoma cells. ABCA2 reduced total, free- and esterified cholesterol levels as well as membrane cholesterol but did not perturb cholesterol distribution in organelle or lipid raft compartments. ABCA2 did not modulate de novo cholesterol biosynthesis from acetate. Cholesterol trafficking to the plasma membrane was not affected by ABCA2 but efflux to the physiological acceptor ApoE3 and mobilization of plasma membrane cholesterol to the endoplasmic reticulum for esterification were reduced by ABCA2. ABCA2 reduced esterification of serum and low-density lipoprotein-derived cholesterol but not 25-hydroxycholesterol. ABCA2 decreased low-density lipoprotein receptor (LDLR) mRNA and protein levels and increased its turnover rate. The surface expression of LDLR as well as the uptake of fluroresecent DiI-LDL was also reduced by ABCA2. Reduction of endogenous ABCA2 expression by RNAi treatment of N2a cells and rat primary cortical neurons produced the opposite effects of over-expression of ABCA2, increasing LDLR protein levels. This report identifies ABCA2 as a key regulator of cholesterol homeostasis and LDLR metabolism in neuronal cells.

  17. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B

    1996-01-01

    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  18. Association of ATP-Binding Cassette Transporter (ABC) Gene Polymorphisms with Viral Load in Patients with Genotype 1 Hepatitis C Virus Infection.

    PubMed

    Chen, Long; Rao, Huiying; Zhang, Wei; Liu, Feng; Jiang, Dong; Wei, Lai

    2016-09-01

    ATP-binding cassette transporters (ABC) gene polymorphisms are associated with various biological functions, including hepatitis C virus (HCV) infection. This study aims to explore the impact of ABC transporters polymorphisms on HCV viral load in chronic treatment-naïve hepatitis C patients. We recruited 347 Chinese Han patients chronically infected with genotype 1 HCV in this study. Ten single nucleotide polymorphism (SNPs) in ABCA1, ABCB5, ABCB11, ABCG2, ABCG5, ABCG10 were analyzed by custom chip from Illumina. Allele frequency analysis and genotype frequency analysis were performed. Patients were categorized according to pretreatment HCV viral load (VL) with a cutoff level 600 000 IU/mL. No significant variations on gender and age were observed in the two groups. G allele of rs3890182 and C allele of rs1883025 in ABCA1 gene were significantly associated with lower HCV viral load (p = 0.013 and p = 0.006) in allele frequency analysis. GG genotype of rs3890182 and CC genotype of rs1883025 in ABCA1 gene were significantly associated with lower HCV viral load (p = 0.027 and p = 0.013) in genotype frequency analysis. Quantitative analysis showed significantly lower viral load in patients with CC genotype of rs1883025 (p = 0.012). Allele associated lower HCV viral load was reported to be associated with higher HDL cholesterol level. Our finding suggests that ABCA1 gene polymorphism in rs1883025 is significantly associated with HCV VL in patients infected with HCV genotype 1.

  19. Immature human chorionic gonadotropin (hCG) in first trimester placental cells is bound to an ATP-binding protein forming high-molecular-weight hCG.

    PubMed

    Shimojo, M; Sakakibara, R; Ishiguro, M

    1993-07-01

    Human chorionic gonadotropin (hCG) in first trimester placental cells is made up of immature alpha- and beta-subunits containing only N-linked high-mannose sugar chains, which are of 21 kDa for the alpha-subunit and 23 and 19 kDa for the beta-subunit. However, the apparent molecular weight of immature hCG from placental cell extracts has been estimated from gel filtration to be much higher (100-200 kDa; high molecular weight-hCG, HMW-hCG) based on gel filtration than the theoretical value (approximately 44 kDa) of the alpha beta dimer (alpha beta-hCG). We prepared a gel-filtered fraction containing HMW-hCG and investigated treatments for converting it to alpha beta-hCG. We found that the molecular weight of HMW-hCG was decreased to close to that of alpha beta-hCG by treatment with acetone, proteases, or chelating agents. These treatments also shifted the isoelectric point of HMW-hCG from the acidic region (pI = 4-6) to the alkaline (pI = 9-11), approximating to that of alpha beta-hCG. We also found that HMW-hCG, but not acetone-treated HMW-hCG, bound to ATP-agarose resin. These results suggested that the immature alpha beta-hCG molecule in placental cells may be bound to an acidic ATP-binding protein to form HMW-hCG.

  20. Effect of praziquantel on the differential expression of mouse hepatic genes and parasite ATP binding cassette transporter gene family members during Schistosoma mansoni infection.

    PubMed

    Sanchez, Melissa C; Krasnec, Katina V; Parra, Amalia S; von Cabanlong, Christian; Gobert, Geoffrey N; Umylny, Boris; Cupit, Pauline M; Cunningham, Charles

    2017-06-01

    Schistosomiasis is a chronic parasitic disease caused by sexually dimorphic blood flukes of the genus Schistosoma. Praziquantel (PZQ) is the only drug widely available to treat the disease but does not kill juvenile parasites. Here we report the use of next generation sequencing to study the transcriptional effect of PZQ on murine hepatic inflammatory, immune and fibrotic responses to Schistosoma mansoni worms and eggs. An initial T helper cell 1 (Th1) response is induced against schistosomes in mice treated with drug vehicle (Vh) around the time egg laying begins, followed by a T helper cell 2 (Th2) response and the induction of genes whose action leads to granuloma formation and fibrosis. When PZQ is administered at this time, there is a significant reduction in egg burden yet the hepatic Th1, Th2 and fibrotic responses are still observed in the absence of granuloma formation suggesting some degree of gene regulation may be induced by antigens released from the dying adult worms. Quantitative real-time PCR was used to examine the relative expression of 16 juvenile and adult S. mansoni genes during infection and their response to Vh and PZQ treatment in vivo. While the response of stress genes in adult parasites suggests the worms were alive immediately following exposure to PZQ, they were unable to induce transcription of any of the 9 genes encoding ATP-binding cassette (ABC) transporters tested. In contrast, juvenile schistosomes were able to significantly induce the activities of ABCB, C and G family members, underscoring the possibility that these efflux systems play a major role in drug resistance.

  1. ATP-binding cassette subfamily B member 1 polymorphisms do not determine cyclosporin exposure, acute rejection or nephrotoxicity after heart transplantation.

    PubMed

    Taegtmeyer, Anne B; Breen, Jane B; Smith, John; Burke, Margaret; Leaver, Neil; Pantelidis, Panagiotis; Lyster, Haifa; Yacoub, Magdi H; Barton, Paul J R; Banner, Nicholas R

    2010-01-15

    We hypothesized that genetic variation of ATP-binding cassette subfamily B member 1 (ABCB1) that encodes P-glycoprotein (involved in the uptake of cyclosporin A [CsA]) contributes to trough drug concentrations and thereby to CsA's immunosuppressive and toxic effects. Three hundred thirty-seven adult heart transplant recipients were studied retrospectively. White recipients receiving CsA at month 3 and years 1 to 5 after transplantation (n=192, 168, 156, 130, 95, and 74, respectively) were then studied with respect to ABCB1 genotype or haplotype and CsA disposition. Genotyping was performed using a gel-based polymerase chain reaction method. Dose- and weight-adjusted CsA trough concentrations ([microg/L]/[mg/kg]), time to first endomyocardial biopsy-proven acute rejection episode (grade>or=3A), weaning from steroids at 1 year, and renal function at 1 year posttransplant were measured. An association between dose- and weight-adjusted CsA trough concentrations and ABCB1 haplotypes was found, with 12/1236, 21/2677, 26/3435 CC/GG/CC individuals having significantly higher concentrations than TT/TT/TT individuals at years 1 and 5 (68.9+/-26.9 vs. 54.9+/-19.5 and 70.6+/-35 vs. 50.0+/-12.2 [microg/L]/[mg/kg] P<0.05, respectively) There was no difference in the incidence of acute rejection, steroid weaning, or renal impairment between the genotype or haplotype groups. The association of ABCB1 12/1236, 21/2677, and 26/3435 CC/GG/CC haplotype with increased CsA dose- and weight-adjusted CsA trough concentrations in this group of adult white heart transplant recipients was not consistent over time and had no effect on the incidence of acute rejection or on the development of renal impairment.

  2. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    PubMed

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  3. Up-regulation of ATP Binding Cassette Transporter A1 Expression by Very Low Density Lipoprotein Receptor and Apolipoprotein E Receptor 2*

    PubMed Central

    Chen, Xinping; Guo, Zhongmao; Okoro, Emmanuel U.; Zhang, Hongfeng; Zhou, LiChun; Lin, Xinhua; Rollins, Allman T.; Yang, Hong

    2012-01-01

    Activation of very low density lipoprotein receptor (VLDLR) and apolipoprotein E receptor 2 (apoER2) results in either pro- or anti-atherogenic effects depending on the ligand. Using reelin and apoE as ligands, we studied the impact of VLDLR- and apoER2-mediated signaling on the expression of ATP binding cassette transporter A1 (ABCA1) and cholesterol efflux using RAW264.7 cells. Treatment of these mouse macrophages with reelin or human apoE3 significantly increased ABCA1 mRNA and protein levels, and apoAI-mediated cholesterol efflux. In addition, both reelin and apoE3 significantly increased phosphorylated disabled-1 (Dab1), phosphatidylinositol 3-kinase (PI3K), protein kinase Cζ (PKCζ), and specificity protein 1 (Sp1). This reelin- or apoER2-mediated up-regulation of ABCA1 expression was suppressed by 1) knockdown of Dab1, VLDLR, and apoER2 with small interfering RNAs (siRNAs), 2) inhibition of PI3K and PKC with kinase inhibitors, 3) overexpression of kinase-dead PKCζ, and 4) inhibition of Sp1 DNA binding with mithramycin A. Activation of the Dab1-PI3K signaling pathway has been implicated in VLDLR- and apoER2-mediated cellular functions, whereas the PI3K-PKCζ-Sp1 signaling cascade has been implicated in the regulation of ABCA1 expression induced by apoE/apoB-carrying lipoproteins. Taken together, these data support a model in which activation of VLDLR and apoER2 by reelin and apoE induces ABCA1 expression and cholesterol efflux via a Dab1-PI3K-PKCζ-Sp1 signaling cascade. PMID:22170052

  4. Neither arginine nor histidine can carry out the function of lysine-295 in the ATP-binding site of p60src.

    PubMed Central

    Kamps, M P; Sefton, B M

    1986-01-01

    All 15 protein kinases whose amino acid sequence is known contain a lysine residue at a position homologous to that of lysine-295 in p60src, the transforming protein of Rous sarcoma virus. The ATP analog p-fluorosulfonyl 5'-benzoyl adenosine inactivates both p60src and the catalytic subunit of the cyclic AMP-dependent protein kinase by modification of this lysine. We used oligonucleotide-directed mutagenesis to examine the possible functions of this residue. Lysine-295 in p60src was replaced with a glutamic acid, an arginine, or a histidine residue, and mutant p60src proteins were characterized in chicken cells infected by mutant viruses. None of these three mutant p60src proteins had tyrosine protein kinase activity in vitro, and none induced morphological transformation of infected cells. Since neither a histidine nor an arginine residue can replace the function of lysine-295, we suggest that it carries out the specialized function of proton transfer in the phosphotransferase reaction. All three mutant viruses underwent reversion to wild type during passage in tissue culture. Because the rate with which this occurred differed significantly among the mutants, reversion appears to have resulted from errors in transcription, rather than from recombination with the cellular src gene. Images PMID:2430174

  5. Discovery of 4,5,6,7-Tetrahydrobenzo[1,2-d]thiazoles as Novel DNA Gyrase Inhibitors Targeting the ATP-Binding Site.

    PubMed

    Tomašič, Tihomir; Katsamakas, Sotirios; Hodnik, Žiga; Ilaš, Janez; Brvar, Matjaž; Solmajer, Tom; Montalvão, Sofia; Tammela, Päivi; Banjanac, Mihailo; Ergović, Gabrijela; Anderluh, Marko; Peterlin Mašič, Lucija; Kikelj, Danijel

    2015-07-23

    Bacterial DNA gyrase and topoisomerase IV are essential enzymes that control the topological state of DNA during replication and validated antibacterial drug targets. Starting from a library of marine alkaloid oroidin analogues, we identified low micromolar inhibitors of Escherichia coli DNA gyrase based on the 5,6,7,8-tetrahydroquinazoline and 4,5,6,7-tetrahydrobenzo[1,2-d]thiazole scaffolds. Structure-based optimization of the initial hits resulted in low nanomolar E. coli DNA gyrase inhibitors, some of which exhibited micromolar inhibition of E. coli topoisomerase IV and of Staphylococcus aureus homologues. Some of the compounds possessed modest antibacterial activity against Gram positive bacterial strains, while their evaluation against wild-type, impA and ΔtolC E. coli strains suggests that they are efflux pump substrates and/or do not possess the physicochemical properties necessary for cell wall penetration. Our study provides a rationale for optimization of this class of compounds toward balanced dual DNA gyrase and topoisomerase IV inhibitors with antibacterial activity.

  6. NMR studies of the MgATP binding site of adenylate kinase and of a 45-residue peptide fragment of the enzyme.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1985-08-13

    Proton NMR was used to study the interaction of beta,gamma-bidentate Cr3+ATP and MgATP with rabbit muscle adenylate kinase, which has 194 amino acids, and with a synthetic peptide consisting of residues 1-45 of the enzyme, which has previously been shown to bind MgepsilonATP [Hamada, M., Palmieri, R. H., Russell, G. A., & Kuby, S. A. (1979) Arch. Biochem. Biophys. 195, 155-177]. The peptide is globular and binds Cr3+ATP competitively with MgATP with a dissociation constant, KD(Cr3+ATP) = 35 microM, comparable to that of the complete enzyme [KI(Cr3+ATP) = 12 microM]. Time-dependent nuclear Overhauser effects (NOE's) were used to measure interproton distances on enzyme- and peptide-bound MgATP. The correlation time was measured directly for peptide-bound MgATP by studying the frequency dependence of the NOE's at 250 and 500 MHz. The H2' to H1' distance so obtained (3.07 A) was within the range established by X-ray and model-building studies of nucleotides (2.9 +/- 0.2 A). Interproton distances yielded conformations of enzyme- and peptide-bound MgATP with indistinguishable anti-glycosyl torsional angles (chi = 63 +/- 12 degrees) and 3'-endo/O1'-endo ribose puckers (sigma = 96 +/- 12 degrees). Enzyme- and peptide-bound MgATP molecules exhibited different C4'-C5' torsional angles (gamma) of 170 degrees and 50 degrees, respectively. Ten intermolecular NOE's from protons of the enzyme and four such NOE's from protons of the peptide to protons of bound MgATP were detected, which indicated proximity of the adenine ribose moiety to the same residues on both the enzyme and the peptide. Paramagnetic effects of beta,gamma-bidentate Cr3+ATP on the longitudinal relaxation rates of protons of the peptide provided a set of distances to the side chains of five residues, which allowed the location of the bound Cr3+ atom to be uniquely defined. Distances from enzyme-bound Cr3+ATP to the side chains of three residues of the protein agreed with those measured for the peptide. The mutual consistency of interproton and Cr3+ to proton distances obtained in metal-ATP complexes of both the enzyme and the peptide suggests that the conformation of the peptide is very similar to that of residues 1-45 of the enzyme. When this was assumed to be the case and when molecular models and a computer graphics system were used, MgATP could be fit into the X-ray structure of adenylate kinase in a unique manner such that all of the distances determined by NMR were accommodated.(ABSTRACT TRUNCATED AT 400 WORDS)

  7. The effect of animal health products on the formation of injection site lesions in subprimals of experimentally injected beef calves.

    PubMed Central

    Van Donkersgoed, J; Dubeski, P L; VanderKop, M; Aalhus, J L; Bygrove, S; Starr, W N

    2000-01-01

    Two hundred and twenty beef calves were used in an experimental study to determine the occurrence of injection site lesions at slaughter (15 to 18 months of age) following subcutaneous and intramuscular injection of various products into the top hip (top butt), thigh (round), and neck or rib of calves at birth, branding, or weaning. Products tested were: 2 different preparations of selenium; a 2-way, a 7-way, and an 8-way clostridial bacterin; 2 combination 7-way clostridial and Haemophilus somnus bacterins; 2 H. somnus bacterins; 2 different 4-way modified-live viral respiratory vaccines; a 4-way killed viral and H. somnus vaccine; and penicillin, florfenicol, ceftiofur, trimethoprim-sulfa, and tilmicosin. The occurrence of lesions, number of steaks affected with lesions, the trim weight of lesions, the histological class of lesions, and the estimated economic losses are described. Generally, products administered subcutaneously in the neck produced minimal tissue damage and economic losses. Images Figure 1. Figure 2. Figure 3. PMID:10945127

  8. Immediate effects of rhythmic auditory stimulation on gait in stroke patients in relation to the lesion site

    PubMed Central

    Kobinata, Naomi; Ueno, Mai; Imanishi, Yukihito; Yoshikawa, Hideto

    2016-01-01

    [Purpose] Rhythmic auditory stimulation has been used in gait training for stroke patients. However, few studies have investigated its effects in relation to lesion sites. Therefore, this study examined the immediate effects of rhythmic auditory stimulation on gait in stroke patients with lesions in different regions. [Subjects and Methods] One hundred and five patients were recruited and divided into five groups according to the lesion site: cerebellum, pons and medulla, thalamus, putamen, and corona radiata. During training, participants walked to an auditory, continuous rhythmic beat, which was set to each individual’s cadence. [Results] Pre- versus post-test measures revealed significant increases in velocity and stride length in the cerebellum, pons and medulla, and thalamus groups. Although the putamen and corona radiata groups demonstrated increases in velocity and stride length, the increases were not significant. [Conclusion] Rhythmic auditory stimulation was effective in facilitating the prediction of motor timing and gait rhythm in stroke patients with lesions in the cerebellum, pons and medulla, and thalamus, which are associated with impairment of the timing mechanism. PMID:27799666

  9. OPA1-related auditory neuropathy: site of lesion and outcome of cochlear implantation

    PubMed Central

    Rossi, Roberta; Scimemi, Pietro; Cama, Elona; Valentino, Maria Lucia; La Morgia, Chiara; Caporali, Leonardo; Liguori, Rocco; Magnavita, Vincenzo; Monteleone, Anna; Biscaro, Ariella; Arslan, Edoardo; Carelli, Valerio

    2015-01-01

    amplitude and duration during rapid stimulation consistent with neural generation. The use of cochlear implant improved speech perception in all but one patient. Brainstem potentials were recorded in response to electrical stimulation in five of six subjects, whereas no compound action potential was evoked from the auditory nerve through the cochlear implant. These findings indicate that underlying the hearing impairment in patients carrying OPA1 missense mutations is a disordered synchrony in auditory nerve fibre activity resulting from neural degeneration affecting the terminal dendrites. Cochlear implantation improves speech perception and synchronous activation of auditory pathways by bypassing the site of lesion. PMID:25564500

  10. Histomorphology and vascular lesions in dorsal rat skin used as injection sites for a subcutaneous toxicity study.

    PubMed

    Wells, Monique Y; Voute, Hélène; Bellingard, Valérie; Fisch, Cécile; Boulifard, Virginie; George, Catherine; Picaut, Philippe

    2010-02-01

    Subcutaneous injection of pharmaceutical compounds into the dorsal skin of rats is common in preclinical and nonclinical studies. However, no detailed histologic description of this anatomic location has been published to date. Following the observation of vascular lesions in the dorsum of rats in a thirteen-week toxicity study, a complementary study was performed on untreated Sprague-Dawley rats to evaluate the normal histology of the skin and subcutis, the potential effect of chronic subcutaneous injection on the morphology of the skin and its vasculature, and the spontaneous vascular pathology in the areas used as injection sites in the principal study. This study showed that saline injection did not fundamentally alter the morphology of the injection sites used for the principal study. Skin thickness was greater in males than in females. Although acellular intimal thickening occurred spontaneously in the dorsal skin of untreated males and females, only males had a spontaneous incidence of intimal hyperplasia. No site predilection for intimal lesions was apparent for either sex. Saline injection, or the physical trauma of injection, may induce intimal hyperplasia; males appear more likely to develop the lesion than do females. It is possible that acellular intimal thickening can progress to intimal hyperplasia under appropriate conditions.

  11. Processing of abasic site damaged lesions by APE1 enzyme on DNA adsorbed over normal and organomodified clay.

    PubMed

    Kumari, Bhavini; Banerjee, Shib Shankar; Singh, Vandana; Das, Prolay; Bhowmick, Anil K

    2014-10-01

    The efficiency of the apurinic/apyrimidinic endonuclease (APE1) DNA repair enzyme in the processing of abasic site DNA damage lesions at precise location in DNA oligomer duplexes that are adsorbed on clay surfaces was evaluated. Three different forms of clay namely montmorillonite, quaternary ammonium salt modified montmorillonite and its boiled counterpart i.e. partially devoid of organic moiety were used for a comparative study of adsorption, desorption and DNA repair efficiency on their surfaces. The interaction between the DNA and the clay was analysed by X-ray diffraction, Atomic force microscopy, UV-Vis spectroscopy and Infrared spectroscopy. The abasic site cleavage efficiency of APE1 enzyme was quantitatively evaluated by polyacrylamide gel electrophoresis. Apart from the difference in the DNA adsorption or desorption capacity of the various forms of clay, substantial variation in the repair efficiency of abasic sites initiated by the APE1 enzyme on the clay surfaces was observed. The incision efficiency of APE1 enzyme at abasic sites was found to be greatly diminished, when the DNA was adsorbed over organomodified montmorillonite. The reduced repair activity indicates an important role of the pendant surfactant groups on the clay surfaces in directing APE1 mediated cleavage of abasic site DNA damage lesions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Host response transcriptional profiling reveals extracellular components and ABC (ATP-binding cassette) transporters gene enrichment in typhoid fever-infected Nigerian children.

    PubMed

    Khoo, Sok Kean; Petillo, David; Parida, Mrutyunjaya; Tan, Aik Choon; Resau, James H; Obaro, Stephen K

    2011-09-13

    also be obtained from acute vs. convalescent phase during typhoid fever infection. We found novel down-regulation of ABC (ATP-binding cassette) transporters genes such as ABCA7, ABCC5, and ABCD4 and ATPase activity as the highest enriched pathway. We identified unique extracellular components and ABC transporters gene enrichments in typhoid fever-infected Nigerian children, which have never been reported. These enriched gene clusters may represent novel targeted pathways to improve diagnostic, prognostic, therapeutic and next-generation vaccine strategies for typhoid fever in Africa.

  13. Stage specific expression of ATP-binding cassette and solute carrier superfamily of transporter genes in mammary gland of riverine buffalo (Bubalus bubalis).

    PubMed

    Sharma, Ankita; Aggarwal, Jigyasa; Sodhi, Monika; Kishore, Amit; Mishra, B P; Mohanty, A K; Kataria, R S; Kaushik, Jai K; Mukesh, Manishi

    2014-01-01

    In the present study, expression level of various ATP-binding cassette (ABC) viz., ABCA1, ABCA7, ABCG1, ABCG2, and ABCG5; associated transcription factors viz., SREBF1, LXRα (NR1H3), PPARA, and Solute Carriers (SLC); or Glucose transporters (GLUT) viz., SLC2A1(GLUT1), SLC2A4 (GLUT4), SLC2A8 (GLUT8), and SLC2A12 (GLUT12) superfamily of transporters were compared across physiological stages of buffalo mammary gland. The relative expression of ABCA1, and ABCG1 was significantly (p < 0.05) higher in mammary gland of heifer followed by involution and lactation stages. Similarly, ABCA7 gene expression was highest in heifer mammary gland followed by lactation and involution stages. ABCG2 gene expression was significantly (p < 0.05) high in lactating mammary gland in comparison to involution and heifer stages. On the other hand, ABCG5 gene expression was highest in involuting mammary gland followed by lactation and involution stages. Additionally, the expression of LXRα SREBF1, and PPARA which are known to regulate some of the ABC tranporters were also analyzed. The expression of LXRα gene was high in involuting as compared to lactating mammary gland. In contrast, SREBF1 and PPARA expression was significantly (p < 0.05) high in lactating mammary gland. Among the several SLC transporters studied, SLC2A1, SLC2A4, and SLC2A8 showed significant (p < 0.05) higher expression during lactation stage, whereas SLC2A12 expression was greater during heifer stage suggesting SLC2A1, SLC2A4, and SLC2A8 to be the major transporters associated with glucose uptake in buffalo mammary gland. The expression profile of (lactoferrin) LTF, known to be expressed at high level in mammary gland during involution was also studied. As expected, its expression was significantly (p < 0.05) higher during involution in comparison to lactating mammary gland.in buffaloes as well. The inclusion of LTF as a control gene further provided the confidence in the buffalo mammary gland expression data generated

  14. Mycophenolic acid induces ATP-binding cassette transporter A1 (ABCA1) expression through the PPAR{gamma}-LXR{alpha}-ABCA1 pathway

    SciTech Connect

    Xu, Yanni; Lai, Fangfang; Xu, Yang; Wu, Yexiang; Liu, Qi; Li, Ni; Wei, Yuzhen; Feng, Tingting; Zheng, Zhihui; Jiang, Wei; Yu, Liyan; Hong, Bin; Si, Shuyi

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1. Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.

  15. Two homologous ATP-binding cassette transporter proteins, AtMDR1 and AtPGP1, regulate Arabidopsis photomorphogenesis and root development by mediating polar auxin transport.

    PubMed

    Lin, Rongcheng; Wang, Haiyang

    2005-06-01

    Light and auxin control many aspects of plant growth and development in an overlapping manner. We report here functional characterization of two closely related ABC (ATP-binding cassette) transporter genes, AtMDR1 and AtPGP1, in light and auxin responses. We showed that loss-of-function atmdr1 and atpgp1 mutants display hypersensitivity to far-red, red, and blue-light inhibition of hypocotyl elongation, reduced chlorophyll and anthocyanin accumulation, and abnormal expression of several light-responsive genes, including CAB3, RBCS, CHS, and PORA, under both darkness and far-red light conditions. In addition, we showed that the atmdr1-100 and atmdr1-100/atpgp1-100 mutants are defective in multiple aspects of root development, including increased root-growth sensitivity to 1-naphthalene acetic acid (1-NAA), and decreased sensitivity to naphthylphthalamic acid (NPA)-mediated inhibition of root elongation. Consistent with the proposed role of AtMDR1 in basipetal auxin transport, we found that expression of the auxin responsive DR5::GUS reporter gene in the central elongation zone is significantly reduced in the atmdr1-100 mutant roots treated with 1-NAA at the root tips, compared to similarly treated wild-type plants. Moreover, atmdr1-100, atpgp1-100, and their double mutants produced fewer lateral roots, in the presence or absence of 1-NAA or NPA. The atmdr1-100 and atmdr1-100/atpgp1-100 mutants also displayed enhanced root gravitropism. Genetic-epistasis analysis revealed that mutations in phyA largely suppress the randomized-hypocotyl growth and the short-hypocotyl phenotype of the atmdr1-100 mutants under far-red light, suggesting that phyA acts downstream of AtMDR1. Together, our results suggest that AtMDR1 and AtPGP1 regulate Arabidopsis (Arabidopsis thaliana) photomorphogenesis and multiple aspects of root development by mediating polar auxin transport.

  16. Using transcranial magnetic stimulation of the undamaged brain to identify lesion sites that predict language outcome after stroke

    PubMed Central

    Lorca-Puls, Diego L.; Gajardo-Vidal, Andrea; Seghier, Mohamed L.; Leff, Alexander P.; Sethi, Varun; Prejawa, Susan; Hope, Thomas M. H.; Devlin, Joseph T.

    2017-01-01

    Abstract Transcranial magnetic stimulation focused on either the left anterior supramarginal gyrus or opercular part of the left inferior frontal gyrus has been reported to transiently impair the ability to perform phonological more than semantic tasks. Here we tested whether phonological processing abilities were also impaired following lesions to these regions in right-handed, English speaking adults, who were investigated at least 1 year after a left-hemisphere stroke. When our regions of interest were limited to 0.5 cm3 of grey matter centred around sites that had been identified with transcranial magnetic stimulation-based functional localization, phonological impairments were observed in 74% (40/54) of patients with damage to the regions and 21% (21/100) of patients sparing these regions. This classification accuracy was better than that observed when using regions of interest centred on activation sites in previous functional magnetic resonance imaging studies of phonological processing, or transcranial magnetic stimulation sites that did not use functional localization. New regions of interest were generated by redefining the borders of each of the transcranial magnetic stimulation sites to include areas that were consistently damaged in the patients with phonological impairments. This increased the incidence of phonological impairments in the presence of damage to 85% (46/54) and also reduced the incidence of phonological impairments in the absence of damage to 15% (15/100). The difference in phonological processing abilities between those with and without damage to these ‘transcranial magnetic stimulation-guided’ regions remained highly significant even after controlling for the effect of lesion size. The classification accuracy of the transcranial magnetic stimulation-guided regions was validated in a second sample of 108 patients and found to be better than that for (i) functional magnetic resonance imaging-guided regions; (ii) a region identified

  17. Using transcranial magnetic stimulation of the undamaged brain to identify lesion sites that predict language outcome after stroke.

    PubMed

    Lorca-Puls, Diego L; Gajardo-Vidal, Andrea; Seghier, Mohamed L; Leff, Alexander P; Sethi, Varun; Prejawa, Susan; Hope, Thomas M H; Devlin, Joseph T; Price, Cathy J

    2017-06-01

    Transcranial magnetic stimulation focused on either the left anterior supramarginal gyrus or opercular part of the left inferior frontal gyrus has been reported to transiently impair the ability to perform phonological more than semantic tasks. Here we tested whether phonological processing abilities were also impaired following lesions to these regions in right-handed, English speaking adults, who were investigated at least 1 year after a left-hemisphere stroke. When our regions of interest were limited to 0.5 cm3 of grey matter centred around sites that had been identified with transcranial magnetic stimulation-based functional localization, phonological impairments were observed in 74% (40/54) of patients with damage to the regions and 21% (21/100) of patients sparing these regions. This classification accuracy was better than that observed when using regions of interest centred on activation sites in previous functional magnetic resonance imaging studies of phonological processing, or transcranial magnetic stimulation sites that did not use functional localization. New regions of interest were generated by redefining the borders of each of the transcranial magnetic stimulation sites to include areas that were consistently damaged in the patients with phonological impairments. This increased the incidence of phonological impairments in the presence of damage to 85% (46/54) and also reduced the incidence of phonological impairments in the absence of damage to 15% (15/100). The difference in phonological processing abilities between those with and without damage to these 'transcranial magnetic stimulation-guided' regions remained highly significant even after controlling for the effect of lesion size. The classification accuracy of the transcranial magnetic stimulation-guided regions was validated in a second sample of 108 patients and found to be better than that for (i) functional magnetic resonance imaging-guided regions; (ii) a region identified from an

  18. Anosognosia, neglect, extinction and lesion site predict impairment of daily living after right-hemispheric stroke.

    PubMed

    Vossel, Simone; Weiss, Peter H; Eschenbeck, Philipp; Fink, Gereon R

    2013-01-01

    Right-hemispheric stroke can give rise to manifold neuropsychological deficits, in particular, impairments of spatial perception which are often accompanied by reduced self-awareness of these deficits (anosognosia). To date, the specific contribution of these deficits to a patient's difficulties in daily life activities remains to be elucidated. In 55 patients with right-hemispheric stroke we investigated the predictive value of different neglect-related symptoms, visual extinction and anosognosia for the performance of standardized activities of daily living (ADL). The additional impact of lesion location was examined using voxel-based lesion-symptom mapping. Step-wise linear regression revealed that anosognosia for visuospatial deficits was the most important predictor for performance in standardized ADL. In addition, motor-intentional and perceptual-attentional neglect, extinction and cancellation task performance significantly predicted ADL performance. Lesions comprising the right frontal and cingulate cortex and adjacent white matter explained additional variance in the performance of standardized ADL, in that damage to these areas was related to lower performance than predicted by the regression model only. Our data show a decisive role of anosognosia for visuospatial deficits for impaired ADL and therefore outcome/disability after stroke. The findings further demonstrate that the severity of neglect and extinction also predicts ADL performance. Our results thus strongly suggest that right-hemispheric stroke patients should not only be routinely assessed for neglect and extinction but also for anosognosia to initiate appropriate rehabilitative treatment. The observation that right frontal lesions explain additional variance in ADL most likely reflects that dysfunction of the supervisory system also significantly impacts upon rehabilitation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Eroded enamel lesion remineralization by saliva as a possible factor in the site-specificity of human dental erosion.

    PubMed

    Amaechi, B T; Higham, S M

    2001-08-01

    The composition and flow of saliva, which determine its functions, vary within intraoral sites and among individuals. Also, the susceptibility to tooth erosion reportedly varies among individuals and within the dental arches. A possible effect of saliva on early-eroded lesions may be a contributory factor. The aims here were firstly to determine the remineralization of eroded enamel lesions by saliva, and secondly to investigate any variation of this remineralization within the dental arches and among individuals. Early enamel erosion was produced on human premolars using orange juice. Control sections and two test slabs were cut from each tooth. The two slabs from the same lesion were bonded with composite resins to the palatal surface of upper right lateral incisor teeth and the lingual surface of the lower right lateral incisor teeth of volunteers, who then chewed a sugar-free gum four times daily. After 28-day intraoral exposure, mineral loss (DeltaZ) and lesion depth (ld) were quantified using microradiography and the data analysed by paired t-test (n=10, alpha=0.05). Mean DeltaZ was significantly lower in the group of slabs positioned palatally (P<0.001) and lingually (P<0.001) when compared with the control group, and in the lingually placed group when compared with the palatally positioned (P<0.01). A significantly lower ld was observed in the group of slabs positioned palatally (P<0.05) and lingually (P<0.001) when compared with the control group, and in the lingually positioned group when compared with the palatally placed (P<0.05). It was concluded that saliva can remineralize early enamel erosion, and that the degree of remineralization varies within intraoral sites and may be responsible for the differing susceptibility to erosion within the dental arches.

  20. The effect of vitamin E supplementation on discoloration of injection-site lesions in retail cuts and the greening reaction observed in injection-site lesions in muscles of the chuck.

    PubMed

    Roeber, D L; Belk, K E; Engle, T E; Field, T G; Koontz, S R; Scanga, J A; Tatum, J D; Mason, G L; Van Metre, D; Garry, F B; Smith, G C

    2003-08-01

    Concern has been raised about green discoloration of injection-site lesions in chuck muscles in modified-atmosphere packages. Objectives were: 1) to recreate green lesions, 2) to compare the severity of discoloration of injection-site lesions in chucks from carcasses of control or vitamin E-supplemented steers, and 3) to identify pigment(s) responsible for discoloration via in vitro color reactions. In Exp. 1, 23 steers (BW = 415 kg; 37 d before harvest) were injected with one of 12 pharmaceuticals, following label directions for route and dose, with the exception of a 5-mL maximum dose, to identify a product that could result in discoloration. Two vaccines (Products A and B) resulted in greening. In Exp. 2, 50 steers were injected (i.m.) with Product A and assigned to the control or vitamin E (1,000 IU/steer daily for 60 d) group. After retail display, 80 and 72% of steaks from the control and treatment groups, respectively, were discolored. Although vitamin E did not reduce (P = 0.53) greening, there was a trend (P = 0.10) toward delay discoloration of lesions from the treatment group. In Phase I of Exp. 3, pigments extracted from green lesions obtained from Exp. 2 were compared with solutions, exposed to a high partial pressure of oxygen (ppO), of myoglobin (Mb), copper sulfate, hydrogen peroxide (H2O2), vaccine, and aluminum hydroxide either alone or in combination. In Phase II of Exp. 3, solutions of two or more of Mb, Cu, sodium sulfide, sodium sulfite, sodium sulfate (Na2SO4), and H2O2 were made at pH 7.2 or 5.5 and exposed to low or high ppO. Normal muscle tissue displayed a 3.2 and 56.7% decrease in absorbance/microg of protein as wavelength changed from 654 to 656 nm and 656 to 658 nm, respectively. Pigments from control and treatment group green tissue displayed a 164.5 and 621.3% increase, respectively, in absorbance/microg of protein as wavelength changed from 654 to 656 nm. As wavelength changed from 656 to 658 nm, the absorbance/microg of protein for

  1. Differential recognition of ultraviolet lesions by RecA protein. Possible mechanism for preferential targeting of SOS mutagenesis to (6-4) dipyrimidine sites

    SciTech Connect

    Rosenberg, M.; Echols, H. )

    1990-11-25

    A knowledge of the biochemical basis for UV-induced mutagenesis requires an understanding of the interaction of SOS-activated proteins with DNA polymerase at the replication-blocking dipyrimidine lesions. We have suggested previously that the presence of RecA in this multiprotein complex might be an important feature of induced mutagenesis because RecA associates preferentially with UV-irradiated double-stranded DNA compared to nonirradiated DNA. Previous work by others has indicated that (6-4) dipyrimidine lesions might be more mutagenic than the more common cyclobutane dimer. We have explored the possibility that RecA associates more efficiently with (6-4) lesions than with cyclobutane lesions. We have found that RecA binds DNA with (6-4) lesions much more efficiently than DNA with solely cyclobutane lesions. The distinction between substrates is probably achieved by differential nucleation of the RecA nucleoprotein filament. To investigate the structural basis for differential binding of RecA, we have estimated the unwinding of duplex DNA introduced by (6-4) and cyclobutane lesions. Our data indicate that (6-4) lesions introduce much greater distortion than cyclobutane dimers. We conclude that RecA probably binds preferentially at sites of (6-4) lesions in DNA and that this localization of RecA might target the mutagenic response more frequently to those sites.

  2. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  3. Bone marrow lesions predict site-specific cartilage defect development and volume loss: a prospective study in older adults

    PubMed Central

    2010-01-01

    Introduction Recent evidence suggests that bone marrow lesions (BMLs) play a pivotal role in knee osteoarthritis (OA). The aims of this study were to determine: 1) whether baseline BML presence and/or severity predict site-specific cartilage defect progression and cartilage volume loss; and 2) whether baseline cartilage defects predict site-specific BML progression. Methods A total of 405 subjects (mean age 63 years, range 52 to 79) were measured at baseline and approximately 2.7 years later. Magnetic resonance imaging (MRI) of the right knee was performed to measure knee cartilage volume, cartilage defects (0 to 4), and BMLs (0 to 3) at the medial tibial (MT), medial femoral (MF), lateral tibial (LT), and lateral femoral (LF) sites. Logistic regression and generalized estimating equations were used to examine the relationship between BMLs and cartilage defects and cartilage volume loss. Results At all four sites, baseline BML presence predicted defect progression (odds ratio (OR) 2.4 to 6.4, all P < 0.05), and cartilage volume loss (-0.9 to -2.9% difference per annum, all P < 0.05) at the same site. In multivariable analysis, there was a significant relationship between BML severity and defect progression at all four sites (OR 1.8 to 3.2, all P < 0.05) and BML severity and cartilage volume loss at the MF, LT, and LF sites (β -22.1 to -42.0, all P < 0.05). Additionally, baseline defect severity predicted BML progression at the MT and LF sites (OR 3.3 to 3.7, all P < 0.01). Lastly, there was a greater increase in cartilage volume loss at the MT and LT sites when both larger defects and BMLs were present at baseline (all P < 0.05). Conclusions Baseline BMLs predicted site-specific defect progression and cartilage volume loss in a dose-response manner suggesting BMLs may have a local effect on cartilage homeostasis. Baseline defects predicted site-specific BML progression, which may represent increased bone loading adjacent to defects. These results suggest BMLs and

  4. Melanotic neuroectodermal tumor of infancy: Cytology and histopathology of a rare lesion at an uncommon site.

    PubMed

    Batta, Nishant; Narang, Vikram; Kaur, Harpreet; Selhi, Pavneet Kaur; Sood, Neena

    2016-11-07

    Melanotic neuroectodermal tumour of infancy is a rare, pigmented neoplasm generally arising in infants during the first year of life. The cytological features are rarely described in the literature. This case due to its rarity and unusual site emphasising the cytopathological features and the necessity of histology for differentiating it from other round cell tumours has been presented. Diagn. Cytopathol. 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  5. Association of human papillomavirus type 16 with neoplastic lesions of the vulva and other genital sites by in situ hybridization.

    PubMed Central

    Gupta, J.; Pilotti, S.; Rilke, F.; Shah, K.

    1987-01-01

    The authors examined paraffin sections from 85 genital tract tissues from 49 cases for the presence of human papillomavirus (HPV) Types 6/11, 16, and 18 by stringent in situ hybridization using 35S-labeled viral DNA probes, and for viral capsid antigen by the immunoperoxidase test. The cases, selected mostly on the basis of vulvar pathology, were distributed as follows: early neoplasia (Group I, 6 cases); early neoplasia with viral cytopathic effect (CE) (Group II, 24 cases); and papillomavirus infection (PVI) (Group III, 19 cases). Available tissues from all affected sites were examined when the disease was multicentric. One or more viral DNAs were identified in 58% of 77 tissues from Groups II and III and in 2 of 8 tissues from Group I. HPV-6/11, HPV-16 and HPV-18 DNAs were detected, respectively, in 25, 24, and 2 tissues; 3 tissues were infected simultaneously with either two or three viruses. Viral DNA was identified at more than one site in 14 of 30 DNA-positive patients; in 10 of these, a single type was detected at all sites in the same patient. The viral DNA was localized mostly in areas showing viral cytopathology. The presence of HPV-16 correlated with neoplasia. HPV-16 DNA was identified in the 2 virus-positive tissues showing neoplasia, in 17 of 20 (85%) of the DNA-positive tissues showing neoplasia with CE, and in 5 of 25 (20%) of the DNA-positive tissues showing PVI. Conversely, HPV-6/11 was found in 25% of the DNA-positive tissues showing neoplasia with CE and in 80% of the cases of PVI. An HPV genome was identified in neoplastic cells in 14 instances; in all but 1 case, the genome was HPV-16. The association of HPV-16 with neoplasia was seen for both vulvar and cervical lesions. Viral antigen was detected in 83% of lesions associated with HPV 6/11 and in 62% of lesions associated with HPV-16. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:3034064

  6. NMR studies of abasic sites in DNA duplexes: Deoxyadenosine stacks into the helix opposite acyclic lesions

    SciTech Connect

    Kalnik, M.W.; Chang, Chienneng; Johnson, F.; Grollman, A.P.; Patel, D.J. )

    1989-04-18

    Proton and phosphorus NMR studies are reported for two complementary nonanucleotide duplexes containing acyclic abasic sites. The first duplex, d(C-A-T-G-A-G-T-A-C){center dot}d(G-T-A-C-P-C-A-T-G), contains an acyclic propanyl moiety, P, located opposite a deoxyadenosine at the center of the helix (designated AP{sub P} 9-mer duplex). The second duplex, d(C-A-T-G-A-G-T-A-C-){center dot}d(G-T-A-C-E-C-A-T-G), contains a similarly located acyclic ethanyl moiety, E (designated AP{sub E} 9-mer duplex). The ethanyl moiety is one carbon shorter than the natural carbon-phosphodiester backbone of a single nucleotide unit of DNA. The majority of the exchangeable and nonexchangeable base and sugar protons in both the AP{sub P} 9-mer and AP{sub E} 9-mer duplexes, including those at the abasic site, have been assigned by recording and analyzing two-dimensional phase-sensitive NOESY data sets in H{sub 2}O and D{sub 2}O solution between -5 and 5{degree}C. These spectroscopic observations establish that A5 inserts into the helix opposite the abasic site (P14 and El14) and stacks between the flanking G4{center dot}C15 and G6{center dot}C13 Watson-Crick base pairs in both the AP{sub P} 9-mer and AP{sub E} 9-mer duplexes. Proton NMR parameters for the Ap{sub P} 9-mer and AP{sub E}9-mer duplexes are similar to those reported previously. These proton NMR experiments demonstrate that the structures at abasic sites are very similar whether the five-membered ring is open or closed or whether the phosphodiester backbone is shortened by one carbon atom. Phosphorus spectra of the AP{sub P} 9-mer and AP{sub E} 9-mer duplexes (5{degree}C) indicate that the backbone conformation is similarly perturbed at three phosphodiester backbone torsion angles.

  7. Exclusion of the retinoblastoma gene and chromosome 13q as the site of a primary lesion for human breast cancer.

    PubMed Central

    Bowcock, A M; Hall, J M; Hebert, J M; King, M C

    1990-01-01

    Chromosome 13q has been suggested as the site of a gene predisposing to human breast cancer, because loss of heterozygosity of alleles on this chromosome has been observed in some ductal breast tumors and because two breast cancer lines are altered at the retinoblastoma gene (RB1) at 13q14. To test this possibility, linkage of breast cancer susceptibility to 14 loci on chromosome 13q loci was assessed in extended families in which breast cancer is apparently inherited as an autosomal dominant trait. RB1 was excluded as the site of a breast cancer gene by a lod score of Z = -7.60 at close linkage for 13 families. Multipoint analysis yielded negative lod scores throughout the region between 13q12 and 13q34; over most of this distance, Z less than -2.0. Therefore, chromosome 13q appears to be excluded as the site of primary lesion for breast cancer in these families. In addition, comparison of tumor versus normal tissues of nonfamilial breast cancer patients revealed an alteration at the 5' end of RB1 in a mucoid carcinoma but no alterations of RB1 in five informative ductal adenocarcinomas. Linkage data and comparisons of tumor and normal tissues suggest that changes in the RBI locus either are secondary alterations associated with progression of some tumors or occur by chance. Images Figure 2 PMID:2294744

  8. Is the Site of Back Pain Related to the Location of Magnetic Resonance Imaging Lesions in Patients With Chronic Back Pain? Results From the Spondyloarthritis Caught Early Cohort.

    PubMed

    de Hooge, Manouk; de Bruin, Freek; de Beer, Lieke; Bakker, Pauline; van den Berg, Rosaline; Ramiro, Sofia; van Gaalen, Floris; Fagerli, Karen; Landewé, Robert; van Oosterhout, Maikel; Ramonda, Roberta; Huizinga, Tom; Bloem, Hans; Reijnierse, Monique; van der Heijde, Désirée

    2017-05-01

    To determine associations between magnetic resonance imaging (MRI) lesions originating from either axial spondyloarthritis (SpA) or from degeneration and pain in patients with chronic back pain of <2 years duration. Patients from the Spondyloarthritis Caught Early (SPACE) cohort identified the sites of pain (thoracic, lumbar, buttock). The average MRI scores from 2 readers for axial SpA lesions and from 2 different readers for degenerative lesions were used. Associations between sacroiliac (SI) joint lesions and buttock pain were investigated by logistic regression analysis, and associations between axial SpA or degenerative lesions and pain in the spine (thoracic and lumbar) were investigated using generalized estimating equations. Interactions with sex, age, HLA-B27, and fulfillment of Assessment of SpondyloArthritis international Society (ASAS) criteria were tested. In 348 patients (126 males, 127 fulfilling ASAS criteria, mean age 29.4 years), spinal MRI (and SI joint images in 342) were available. Pain was localized in the thoracic spine (35.9%), the lumbar spine (82.5%), or in the buttock(s) (57.8%). Inflammatory lesions of the SI joint (odds ratio [OR] 1.06; P = 0.04) and erosions of the SI joint in patients <25 years (OR 1.16; P = 0.04) were associated with buttock pain. Axial SpA spinal lesions were not associated with pain. Modic type 1 lesions in patients >35 years (OR 5.19; P = 0.001), high-intensity zone lesions in females not fulfilling ASAS criteria (OR 5.09; P = 0.001), and herniation in various subgroups (OR range 2.07-4.66) were associated with pain. Specific degenerative lesions, but not typical axial SpA lesions, of the spine are associated with pain at the same location in some subgroups. Inflammatory lesions in the SI joint are associated with buttock pain. © 2016, American College of Rheumatology.

  9. Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

    PubMed Central

    Cao, Yangrong; Cho, Sung-Hwan; Xu, Dong; Stacey, Gary

    2016-01-01

    DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecular interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. The in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues. PMID:27583834

  10. Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

    DOE PAGES

    Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong; ...

    2016-09-01

    DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less

  11. Analysis of "hidden lesions" of the extra-articular biceps after subpectoral biceps tenodesis: the subpectoral portion as the optimal tenodesis site.

    PubMed

    Moon, Seong Cheol; Cho, Nam Su; Rhee, Yong Girl

    2015-01-01

    In biceps tenodesis for intra-articular tears, determining the distal extension of the lesions through the biceps groove is important in choosing the optimal tenodesis site. To determine the optimal tenodesis site by analyzing the extension and delamination of an extra-articular lesion, or a "hidden lesion," in the retrieved biceps after subpectoral biceps tenodesis. Case series; Level of evidence, 4. A total of 36 subpectoral tenodeses were performed, and the retrieved biceps were analyzed. The biceps lesions were divided into zones according to their location as follows: the proximal intra-articular (zone A), middle intragroove (zone B), and distal extra-articular portions (zone C); the lesions in zones B and C were called "hidden lesions." The length and delamination depth of the biceps tears were examined, and the severity of the accompanying tenosynovitis and degeneration was assessed. Tears invaded zone B in all the cases and extended to zone C in 28 cases (77.8%). Tenosynovitis was observed along the tear in 28 cases (77.8%) and extended to zone C in 26 cases (72.2%). The mean tear length in the hidden lesions, including the tear and tenosynovitis, was 34.2 mm. Degenerative changes in the proximal intra-articular and middle intragroove portions were observed in all the cases and up to the distal extra-articular portion in 29 cases (80.6%). In approximately 80% of the intra-articular biceps tears evaluated in this study, a "hidden lesion" was observed going beyond the bicipital groove and extending to the distal extra-articular portion. Therefore, the subpectoral portion may be considered the optimal tenodesis site for the complete removal of all hidden biceps lesions. © 2014 The Author(s).

  12. Surgical site infection of scrotal and inguinal lesions after urologic surgery.

    PubMed

    Uehara, Teruhisa; Takahashi, Satoshi; Ichihara, Kohji; Hiyama, Yoshiki; Hashimoto, Jiro; Kurimura, Yuichiro; Masumori, Naoya

    2014-03-01

    To clarify the incidence of surgical site infection (SSI) after urological scrotal and inguinal surgical procedures and the preventive effect of antimicrobial prophylaxis for SSI, retrospective analysis was performed. The patients who underwent scrotal and inguinal operations from 2001 to 2010 were included in this analysis. A first or second generation cephalosporin was administered as antimicrobial prophylaxis just before the start of surgery and no additional prophylaxis was conducted. The surgery was classified into 76 (38%) cases with testicular sperm extraction (TESE), 72 (36%) with radical orchiectomy, 29 (14.5%) with bilateral orchiectomy (surgical castration) and 23 (11.5%) with other scrotal and inguinal operations. The median age and age range were 36 years and 18-81 years, respectively. SSI occurred in 7 (3.5%) cases. The frequencies of SSI were 6.5% in the patients with urological inguinal surgery and 1.6% in those with scrotal surgery. The frequency of SSI in the patients with urological inguinal surgery was not negligible even though it is considered a clean operation, and further analysis is warranted to prevent SSI.

  13. CryoEM and Molecular Dynamics of the Circadian KaiB-KaiC Complex Indicates That KaiB Monomers Interact with KaiC and Block ATP Binding Clefts

    SciTech Connect

    Villarreal, Seth A.; Pattanayek, Rekha; Williams, Dewight R.; Mori, Tetsuya; Qin, Ximing; Johnson, Carl H.; Egli, Martin; Stewart, Phoebe L.

    2014-10-02

    The circadian control of cellular processes in cyanobacteria is regulated by a posttranslational oscillator formed by three Kai proteins. During the oscillator cycle, KaiA serves to promote autophosphorylation of KaiC while KaiB counteracts this effect. Here, we present a crystallographic structure of the wild-type Synechococcus elongatus KaiB and a cryo-electron microscopy (cryoEM) structure of a KaiBC complex. The crystal structure shows the expected dimer core structure and significant conformational variations of the KaiB C-terminal region, which is functionally important in maintaining rhythmicity. The KaiBC sample was formed with a C-terminally truncated form of KaiC, KaiC-Δ489, which is persistently phosphorylated. The KaiB–KaiC-Δ489 structure reveals that the KaiC hexamer can bind six monomers of KaiB, which form a continuous ring of density in the KaiBC complex. We performed cryoEM-guided molecular dynamics flexible fitting simulations with crystal structures of KaiB and KaiC to probe the KaiBC protein–protein interface. This analysis indicated a favorable binding mode for the KaiB monomer on the CII end of KaiC, involving two adjacent KaiC subunits and spanning an ATP binding cleft. A KaiC mutation, R468C, which has been shown to affect the affinity of KaiB for KaiC and lengthen the period in a bioluminescence rhythm assay, is found within the middle of the predicted KaiBC interface. The proposed KaiB binding mode blocks access to the ATP binding cleft in the CII ring of KaiC, which provides insight into how KaiB might influence the phosphorylation status of KaiC.

  14. Prevalence of candida albicans in dental plaque and caries lesion of early childhood caries (ECC) according to sampling site

    PubMed Central

    Ghasempour, Maryam; Sefidgar, Seyed Ali Asghar; Eyzadian, Haniyeh; Gharakhani, Samaneh

    2011-01-01

    Background: Candida albicans may have cariogenic potential but its role in caries etiology has not been established. The aim of this study was to determine candida albicans in supragingival dental plaque and infected dentine of cervical and proximal in early childhood caries (ECC). Methods: This cross-sectional study was carried out on 6o children aged 2-5 years, which were divided into 3 groups: children with at least one cervical caries; children with at least one proximal caries and caries-free. The infected dentine was collected from cervical and proximal caries lesions and plaque samples were collected from the three groups in order to compare the frequency of candida albicans in the collected sites. All samples were cultured in Sabouraud and CHROMagar medium and the cases that were positive for candida albicans were cultured in germ tube. Data were collected and analyzed. Results: The mean age of the children was 3.9 years. From 100 samples, candida albicans samples were isolated in 55%, mold fungi were found in 29% cases and there was no fungal growth in 16% of the samples. In plaque samples, candida albicans were found in 15% of caries-free samples, 20% of the proximal and 80% of the cervical caries. In samples extracted from the caries, candida albicans were found in 60% of the proximal and 100% of the cervical caries. Mothers with university educational level had children with more cervical decays, caries free and proximal caries, respectively. Conclusion: The results showed that prevalence of Candida albicans in dental plaque and caries lesions of children with early childhood caries were relatively high and the prevalence was higher in cervical caries group. PMID:24551436

  15. Regeneration of nigrostriatal dopaminergic axons after transplantation of olfactory ensheathing cells and fibroblasts prevents fibrotic scar formation at the lesion site.

    PubMed

    Teng, Xichuan; Nagata, Isao; Li, Hong-Peng; Kimura-Kuroda, Junko; Sango, Kazunori; Kawamura, Koki; Raisman, Geoffrey; Kawano, Hitoshi

    2008-11-01

    The fibrotic scar formed after central nervous system injury has been considered an obstacle to axonal regeneration. The present study was designed to examine whether cell transplantation into a damaged central nervous system can reduce fibrotic scar formation and promote axonal regeneration. Nigrostriatal dopaminergic axons were unilaterally transected in rats and cultures of olfactory-ensheathing cells (OECs), and olfactory nerve fibroblasts were transplanted into the lesion site. In the absence of transplants, few tyrosine hydroxylase-immunoreactive axons extended across the lesion 2 weeks after the transection. Reactive astrocytes increased around the lesion, and a fibrotic scar containing type IV collagen deposits developed in the lesion center. The immunoreactivity of chondroitin sulfate side chains and core protein of NG2 proteoglycan increased in and around the lesion. One and 2 weeks after transection and simultaneous transplantation, dopaminergic axons regenerated across the transplanted tissues, which consisted of p75-immunoreactive OECs and fibronectin-immunoreactive fibroblasts. Reactive astrocytes and chondroitin sulfate immunoreactivity increased around the transplants, whereas the deposition of type IV collagen and fibrotic scar formation were completely prevented at the lesion site. Transplantation of meningeal fibroblasts similarly prevented the formation of the fibrotic scar, although its effect on regeneration was less potent than transplantation of OECs and olfactory nerve fibroblasts. The present results suggest that elimination of the inhibitory fibrotic scar is important for neural regeneration.

  16. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    SciTech Connect

    Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Shikazono, Naoya; Yokoya, Akinari; Katsumura, Yosuke

    2013-05-03

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.

  17. The ATP binding cassette transporter A1 (ABCA1) modulates the development of aortic atherosclerosis in C57BL/6 and apoE-knockout mice

    PubMed Central

    Joyce, Charles W.; Amar, Marcelo J. A.; Lambert, Gilles; Vaisman, Boris L.; Paigen, Beverly; Najib-Fruchart, Jamila; Hoyt, Robert F.; Neufeld, Edward D.; Remaley, Alan T.; Fredrickson, Donald S.; Brewer, H. Bryan; Santamarina-Fojo, Silvia

    2002-01-01

    Identification of mutations in the ABCA1 transporter (ABCA1) as the genetic defect in Tangier disease has generated interest in modulating atherogenic risk by enhancing ABCA1 gene expression. To investigate the role of ABCA1 in atherogenesis, we analyzed diet-induced atherosclerosis in transgenic mice overexpressing human ABCA1 (hABCA1-Tg) and spontaneous lesion formation in hABCA1-Tg × apoE-knockout (KO) mice. Overexpression of hABCA1 in C57BL/6 mice resulted in a unique anti-atherogenic profile characterized by decreased plasma cholesterol (63%), cholesteryl ester (63%), free cholesterol (67%), non-high density lipoprotein (HDL)-cholesterol (53%), and apolipoprotein (apo) B (64%) but markedly increased HDL-cholesterol (2.8-fold), apoA-I (2.2-fold), and apoE (2.8-fold) levels. These beneficial changes in the lipid profile led to significantly lower (65%) aortic atherosclerosis in hABCA1-Tg mice. In marked contrast, ABCA1 overexpression had a minimal effect on the plasma lipid profile of apoE-KO mice and resulted in a 2- to 2.6-fold increase in aortic lesion area. These combined results indicate that overexpression of ABCA1 in C57BL/6 mice on a high cholesterol diet results in an atheroprotective lipoprotein profile and decreased atherosclerosis, and thus provide previously undocumented in vivo evidence of an anti-atherogenic role for the ABCA1 transporter. In contrast, overexpression of ABCA1 in an apoE-KO background led to increased atherosclerosis, further substantiating the important role of apoE in macrophage cholesterol metabolism and atherogenesis. In summary, these results establish that, in the presence of apoE, overexpression of ABCA1 modulates HDL as well as apoB-containing lipoprotein metabolism and reduces atherosclerosis in vivo, and indicate that pharmacological agents that will increase ABCA1 expression may reduce atherogenic risk in humans. PMID:11752403

  18. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette Transporter (ΔabcBA) Protects against Wild Type Brucella ovis in Rams

    PubMed Central

    Silva, Ana Patrícia C.; Macêdo, Auricélio A.; Costa, Luciana F.; Rocha, Cláudia E.; Garcia, Luize N. N.; Farias, Jade R. D.; Gomes, Priscilla P. R.; Teixeira, Gustavo C.; Fonseca, Kessler W. J.; Maia, Andréa R. F.; Neves, Gabriela G.; Romão, Everton L.; Silva, Teane M. A.; Mol, Juliana P. S.; Oliveira, Renata M.; Araújo, Márcio S. S.; Nascimento, Ernane F.; Martins-Filho, Olindo A.; Brandão, Humberto M.; Paixão, Tatiane A.; Santos, Renato L.

    2015-01-01

    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  19. Functional activation independently contributes to naming ability and relates to lesion site in post-stroke aphasia.

    PubMed

    Skipper-Kallal, Laura M; Lacey, Elizabeth H; Xing, Shihui; Turkeltaub, Peter E

    2017-04-01

    Language network reorganization in aphasia may depend on the degree of damage in critical language areas, making it difficult to determine how reorganization impacts performance. Prior studies on remapping of function in aphasia have not accounted for the location of the lesion relative to critical language areas. They rectified this problem by using a multimodal approach, combining multivariate lesion-symptom mapping and fMRI in chronic aphasia to understand the independent contributions to naming performance of the lesion and the activity in both hemispheres. Activity was examined during two stages of naming: covert retrieval, and overt articulation. Regions of interest were drawn based on over- and under-activation, and in areas where activity had a bivariate relationship with naming. Regressions then tested whether activation of these regions predicted naming ability, while controlling for lesion size and damage in critical left hemisphere naming areas, as determined by lesion-symptom mapping. Engagement of the right superior temporal sulcus (STS) and disengagement of the left dorsal pars opercularis (dPOp) during overt naming was associated with better than predicted naming performance. Lesions in the left STS prevented right STS engagement and resulted in persistent left dPOp activation. In summary, changes in activity during overt articulation independently relate to naming outcomes, controlling for stroke severity. Successful remapping relates to network disruptions that depend on the location of the lesion in the left hemisphere. Hum Brain Mapp 38:2051-2066, 2017. © 2017 Wiley Periodicals, Inc.

  20. An analysis of ATP binding with kinase catalytic subunit by molecular dynamics simulation of the CDK2 active kinase crystal lattice

    NASA Astrophysics Data System (ADS)

    Kretov, D. A.; Kholmurodov, Kh. T.; Koltovaya, N. A.

    2007-10-01

    Molecular dynamics simulation was used to analyze changes in the functionally significant structural elements of the crystal lattices of pT160-CDK2/cyclin and A/ATP-Mg2+/substrate complexes of the native (CDK2-G16) and mutant (CDK2-S16) active kinases at physiological temperatures (300 K). The structural rearrangement of ATP caused by changes in the kinase catalytic domain was studied. ATP was fixed by the ionic and H-bond interactions of several residues, including Lys33, Asp145, and side-chain amides of the G loop between β1 and β2. The binding of the kinases to complexes with cyclin and the phosphorylation of T160 in the active complex of the CDK2 kinase result in the ATP orientation more convenient for the transfer of the phosphate group to the substrate. An analysis of interatomic distances in the ATP active site region and Asp145, Asn132, Lys33 catalytic sites participating in the orientation of ATP phosphates revealed that the Asp 145 amino acid residue was situated noticeably closer to the ATP molecule in the native complex than in its mutant counterpart. The same is true of the arrangement of the Lys33 residue with respect to ATP.

  1. An attenuated mutant of the Rv1747 ATP-binding cassette transporter of Mycobacterium tuberculosis and a mutant of its cognate kinase, PknF, show increased expression of the efflux pump-related iniBAC operon

    PubMed Central

    Spivey, Vicky L; Whalan, Rachael H; Hirst, Elizabeth M A; Smerdon, Stephen J; Buxton, Roger S

    2013-01-01

    The ATP-binding cassette transporter Rv1747 is required for the growth of Mycobacterium tuberculosis in mice and in macrophages. Its structure suggests it is an exporter. Rv1747 forms a two-gene operon with pknF coding for the serine/threonine protein kinase PknF, which positively modulates the function of the transporter. We show that deletion of Rv1747 or pknF results in a number of transcriptional changes which could be complemented by the wild type allele, most significantly up-regulation of the iniBAC genes. This operon is inducible by isoniazid and ethambutol and by a broad range of inhibitors of cell wall biosynthesis and is required for efflux pump functioning. However, neither the Rv1747 or pknF mutant showed increased susceptibility to a range of drugs and cell wall stress reagents including isoniazid and ethambutol, cell wall structure and cell division appear normal by electron microscopy, and no differences in lipoarabinomannan were found. Transcription from the pknF promoter was not induced by a range of stress reagents. We conclude that the loss of Rv1747 affects cell wall biosynthesis leading to the production of intermediates that cause induction of iniBAC transcription and implicates it in exporting a component of the cell wall, which is necessary for virulence. PMID:23915284

  2. Change in ATP-binding cassette B1/19, glutamine synthetase and alcohol dehydrogenase gene expression during root elongation in Betula pendula Roth and Alnus glutinosa L. Gaertn in response to leachate and leonardite humic substances.

    PubMed

    Tahiri, Abdelghani; Delporte, Fabienne; Muhovski, Yordan; Ongena, Marc; Thonart, Philippe; Druart, Philippe

    2016-01-01

    Humic substances (HS) are complex and heterogeneous compounds of humified organic matter resulting from the chemical and microbiological decomposition of organic residues. HS have a positive effect on plant growth and development by improving soil structure and fertility. They have long been recognized as plant growth-promoting substances, particularly with regard to influencing nutrient uptake, root growth and architecture. The biochemical and molecular mechanisms through which HS influence plant physiology are not well understood. This study evaluated the bioactivity of landfill leachate and leonardite HS on alder (Alnus glutinosa L. Gaertn) and birch (Betula pendula Roth) during root elongation in vitro. Changes in root development were studied in relation to auxin, carbon and nitrogen metabolisms, as well as to the stress adaptive response. The cDNA fragments of putative genes encoding two ATP-binding cassette (ABC) transporters (ABCB1 and ABCB19) belonging to the B subfamily of plant ABC auxin transporters were cloned and sequenced. Molecular data indicate that HS and their humic acid (HA) fractions induce root growth by influencing polar auxin transport (PAT), as illustrated by the modulation of the ABCB transporter transcript levels (ABCB1 and ABCB19). There were also changes in alcohol dehydrogenase (ADH) and glutamine synthetase (GS) gene transcript levels in response to HS exposure. These findings confirmed that humic matter affects plant growth and development through various metabolic pathways, including hormonal, carbon and nitrogen metabolisms and stress response or signalization.

  3. ABCA1 (ATP-Binding Cassette Transporter A1) Mediates ApoA-I (Apolipoprotein A-I) and ApoA-I Mimetic Peptide Mobilization of Extracellular Cholesterol Microdomains Deposited by Macrophages.

    PubMed

    Jin, Xueting; Sviridov, Denis; Liu, Ying; Vaisman, Boris; Addadi, Lia; Remaley, Alan T; Kruth, Howard S

    2016-12-01

    We examined the function of ABCA1 (ATP-binding cassette transporter A1) in ApoA-I (apolipoprotein A-I) mobilization of cholesterol microdomains deposited into the extracellular matrix by cholesterol-enriched macrophages. We have also determined whether an ApoA-I mimetic peptide without and with complexing to sphingomyelin can mobilize macrophage-deposited cholesterol microdomains. Extracellular cholesterol microdomains deposited by cholesterol-enriched macrophages were detected with a monoclonal antibody, 58B1. ApoA-I and an ApoA-I mimetic peptide 5A mobilized cholesterol microdomains deposited by ABCA1(+/+) macrophages but not by ABCA1(-/-) macrophages. In contrast, ApoA-I mimetic peptide 5A complexed with sphingomyelin could mobilize cholesterol microdomains deposited by ABCA1(-/-) macrophages. Our findings show that a unique pool of extracellular cholesterol microdomains deposited by macrophages can be mobilized by both ApoA-I and an ApoA-I mimetic peptide but that mobilization depends on macrophage ABCA1. It is known that ABCA1 complexes ApoA-I and ApoA-I mimetic peptide with phospholipid, a cholesterol-solubilizing agent, explaining the requirement for ABCA1 in extracellular cholesterol microdomain mobilization. Importantly, ApoA-I mimetic peptide already complexed with phospholipid can mobilize macrophage-deposited extracellular cholesterol microdomains even in the absence of ABCA1. © 2016 American Heart Association, Inc.

  4. Pathogen-Responsive Expression of a Putative ATP-Binding Cassette Transporter Gene Conferring Resistance to the Diterpenoid Sclareol Is Regulated by Multiple Defense Signaling Pathways in Arabidopsis1

    PubMed Central

    Campbell, Emma J.; Schenk, Peer M.; Kazan, Kemal; Penninckx, Iris A.M.A.; Anderson, Jonathan P.; Maclean, Don J.; Cammue, Bruno P.A.; Ebert, Paul R.; Manners, John M.

    2003-01-01

    The ATP-binding cassette (ABC) transporters are encoded by large gene families in plants. Although these proteins are potentially involved in a number of diverse plant processes, currently, very little is known about their actual functions. In this paper, through a cDNA microarray screening of anonymous cDNA clones from a subtractive library, we identified an Arabidopsis gene (AtPDR12) putatively encoding a member of the pleiotropic drug resistance (PDR) subfamily of ABC transporters. AtPDR12 displayed distinct induction profiles after inoculation of plants with compatible and incompatible fungal pathogens and treatments with salicylic acid, ethylene, or methyl jasmonate. Analysis of AtPDR12 expression in a number of Arabidopsis defense signaling mutants further revealed that salicylic acid accumulation, NPR1 function, and sensitivity to jasmonates and ethylene were all required for pathogen-responsive expression of AtPDR12. Germination assays using seeds from an AtPDR12 insertion line in the presence of sclareol resulted in lower germination rates and much stronger inhibition of root elongation in the AtPDR12 insertion line than in wild-type plants. These results suggest that AtPDR12 may be functionally related to the previously identified ABC transporters SpTUR2 and NpABC1, which transport sclareol. Our data also point to a potential role for terpenoids in the Arabidopsis defensive armory. PMID:14526118

  5. Cross-reactivity of Antibodies Directed to the Gram-Negative Bacterium Neisseria gonorrhoeae With Heat Shock Protein 60 and ATP-Binding Protein Correlates to Reduced Mitochondrial Activity in HIBCPP Choroid Plexus Papilloma Cells.

    PubMed

    Reuss, B; Schroten, H; Ishikawa, H; Asif, A R

    2015-09-01

    Antibacterial antibodies can cause neurologic side-effects by cross-reactivity with cellular antigens. Here we investigated interactions of antibodies to Neisseria gonorrhoeae (α-NG) - maternal infections by which increases the offspring's risk for later psychosis-with HIBCPP cells, a cell culture model of choroid plexus epithelium. Immunocytochemistry and Western blotting with α-NG, revealed organelle-like intracellular staining in HIBCPP cells, and labelling of several immunoreactive bands in cellular protein. Two-dimensional Western blotting revealed several immunopositive spots, most prominent of which were identified by mass spectrometry as mitochondrially localized proteins heat shock protein 60 (Hsp60) and ATP-binding protein β-subunit (ATPB). Similarly α-NG interacted with commercial samples of these proteins as revealed by Western blotting. Three alternative methods (JC-1, Janus green and MTT staining) revealed α-NG to cause in HIBCPP cells a significant decrease in mitochondrial activity, which could be reverted by neuroleptic drugs. Immunoreactivity of α-NG with choroid plexus epithelium in human post mortem samples suggests in vivo relevance of these findings. Finally, distinctly different staining patterns of antibodies against Neisseria meningitidis (α-NM), confirmed antibody specificity. To our knowledge this is the first report that α-NG cross-reactivity with Hsp60 and ATPB impairs mitochondrial activity in choroid plexus epithelial cells, pathogenetic relevance of which needs further clarification.

  6. Tertiary-butylhydroquinone upregulates expression of ATP-binding cassette transporter A1 via nuclear factor E2-related factor 2/heme oxygenase-1 signaling in THP-1 macrophage-derived foam cells.

    PubMed

    Lu, Qian; Tang, Shi-Lin; Liu, Xiao-Yan; Zhao, Guo-Jun; Ouyang, Xin-Ping; Lv, Yun-Cheng; He, Ping-Ping; Yao, Feng; Chen, Wu-Jun; Tang, Yan-Yan; Zhang, Min; Zhang, Da-Wei; Yin, Kai; Tang, Chao-Ke

    2013-01-01

    Tert-butylhydroquinone (tBHQ), a synthetic phenolic antioxidant, is commonly used as a food preservative because of its potent antilipid peroxidation activity. Several lines of evidence have demonstrated that dietary supplementation with antioxidants has an antiatherogenic function through reducing cholesterol uptake or promoting reverse cholesterol transport. In this study, we investigated whether tBHQ affects expression of ATP-binding cassette transporter A1 (ABCA1) and the potential subsequent effect on cellular cholesterol homeostasis. tBHQ increased ABCA1 protein levels and markedly enhanced cholesterol efflux from THP-1 macrophage-derived foam cells. Furthermore, tBHQ reduced calpain-mediated ABCA1 proteolysis via activation of nuclear factor E2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1). Inhibition of HO-1 with a pharmacological inhibitor or siRNA and knockdown of Nrf2 suppressed the stimulatory effects of tBHQ on ABCA1 expression and calpain activity. Nrf2/HO-1 signaling is required for the regulation by tBHQ of ABCA1 expression and cholesterol efflux in macrophage-derived foam cells and an antiatherogenic role of tBHQ is suggested.

  7. Block of ATP-Binding Cassette B19 Ion Channel Activity by 5-Nitro-2-(3-Phenylpropylamino)-Benzoic Acid Impairs Polar Auxin Transport and Root Gravitropism1[OPEN

    PubMed Central

    Cho, Misuk; Henry, Elizabeth M.; Lewis, Daniel R.; Wu, Guosheng; Muday, Gloria K.

    2014-01-01

    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target. PMID:25324509

  8. Functional Dynamics Revealed by the Structure of the SufBCD Complex, a Novel ATP-binding Cassette (ABC) Protein That Serves as a Scaffold for Iron-Sulfur Cluster Biogenesis*

    PubMed Central

    Hirabayashi, Kei; Yuda, Eiki; Tanaka, Naoyuki; Katayama, Sumie; Iwasaki, Kenji; Matsumoto, Takashi; Kurisu, Genji; Outten, F. Wayne; Fukuyama, Keiichi; Takahashi, Yasuhiro; Wada, Kei

    2015-01-01

    ATP-binding cassette (ABC)-type ATPases are chemomechanical engines involved in diverse biological pathways. Recent genomic information reveals that ABC ATPase domains/subunits act not only in ABC transporters and structural maintenance of chromosome proteins, but also in iron-sulfur (Fe-S) cluster biogenesis. A novel type of ABC protein, the SufBCD complex, functions in the biosynthesis of nascent Fe-S clusters in almost all Eubacteria and Archaea, as well as eukaryotic chloroplasts. In this study, we determined the first crystal structure of the Escherichia coli SufBCD complex, which exhibits the common architecture of ABC proteins: two ABC ATPase components (SufC) with function-specific components (SufB-SufD protomers). Biochemical and physiological analyses based on this structure provided critical insights into Fe-S cluster assembly and revealed a dynamic conformational change driven by ABC ATPase activity. We propose a molecular mechanism for the biogenesis of the Fe-S cluster in the SufBCD complex. PMID:26472926

  9. Variants in the ATP-Binding Cassette Transporter (ABCA7), Apolipoprotein E ε4, and the Risk of Late-Onset Alzheimer Disease in African Americans

    PubMed Central

    Reitz, Christiane; Jun, Gyungah; Naj, Adam; Rajbhandary, Ruchita; Vardarajan, Badri Narayan; Wang, Li-San; Valladares, Otto; Lin, Chiao-Feng; Larson, Eric B.; Graff-Radford, Neill R.; Evans, Denis; De Jager, Philip L.; Crane, Paul K.; Buxbaum, Joseph D.; Murrell, Jill R.; Raj, Towfique; Ertekin-Taner, Nilufer; Logue, Mark; Baldwin, Clinton T.; Green, Robert C.; Barnes, Lisa L.; Cantwell, Laura B.; Fallin, M. Daniele; Go, Rodney C. P.; Griffith, Patrick; Obisesan, Thomas O.; Manly, Jennifer J.; Lunetta, Kathryn L.; Kamboh, M. Ilyas; Lopez, Oscar L.; Bennett, David A.; Hendrie, Hugh; Hall, Kathleen S.; Goate, Alison M.; Byrd, Goldie S.; Kukull, Walter A.; Foroud, Tatiana M.; Haines, Jonathan L.; Farrer, Lindsay A.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Mayeux, Richard

    2013-01-01

    Importance Genetic variants associated with susceptibility to late-onset Alzheimer disease are known for individuals of European ancestry, but whether the same or different variants account for the genetic risk of Alzheimer disease in African American individuals is unknown. Identification of disease-associated variants helps identify targets for genetic testing, prevention, and treatment. Objective To identify genetic loci associated with late-onset Alzheimer disease in African Americans. Design, Setting, and Participants The Alzheimer Disease Genetics Consortium (ADGC) assembled multiple data sets representing a total of 5896 African Americans (1968 case participants, 3928 control participants) 60 years or older that were collected between 1989 and 2011 at multiple sites. The association of Alzheimer disease with genotyped and imputed single-nucleotide polymorphisms (SNPs) was assessed in case-control and in family-based data sets. Results from individual data sets were combined to perform an inverse variance–weighted meta-analysis, first with genome-wide analyses and subsequently with gene-based tests for previously reported loci. Main Outcomes and Measures Presence of Alzheimer disease according to standardized criteria. Results Genome-wide significance in fully adjusted models (sex, age, APOE genotype, population stratification) was observed for a SNP in ABCA7 (rs115550680, allele = G; frequency, 0.09 cases and 0.06 controls; odds ratio [OR], 1.79 [95% CI, 1.47-2.12]; P = 2.2 × 10–9), which is in linkage disequilibrium with SNPs previously associated with Alzheimer disease in Europeans (0.8

  10. Variants in the ATP-binding cassette transporter (ABCA7), apolipoprotein E ϵ4,and the risk of late-onset Alzheimer disease in African Americans.

    PubMed

    Reitz, Christiane; Jun, Gyungah; Naj, Adam; Rajbhandary, Ruchita; Vardarajan, Badri Narayan; Wang, Li-San; Valladares, Otto; Lin, Chiao-Feng; Larson, Eric B; Graff-Radford, Neill R; Evans, Denis; De Jager, Philip L; Crane, Paul K; Buxbaum, Joseph D; Murrell, Jill R; Raj, Towfique; Ertekin-Taner, Nilufer; Logue, Mark; Baldwin, Clinton T; Green, Robert C; Barnes, Lisa L; Cantwell, Laura B; Fallin, M Daniele; Go, Rodney C P; Griffith, Patrick; Obisesan, Thomas O; Manly, Jennifer J; Lunetta, Kathryn L; Kamboh, M Ilyas; Lopez, Oscar L; Bennett, David A; Hendrie, Hugh; Hall, Kathleen S; Goate, Alison M; Byrd, Goldie S; Kukull, Walter A; Foroud, Tatiana M; Haines, Jonathan L; Farrer, Lindsay A; Pericak-Vance, Margaret A; Schellenberg, Gerard D; Mayeux, Richard

    2013-04-10

    Genetic variants associated with susceptibility to late-onset Alzheimer disease are known for individuals of European ancestry, but whether the same or different variants account for the genetic risk of Alzheimer disease in African American individuals is unknown. Identification of disease-associated variants helps identify targets for genetic testing, prevention, and treatment. To identify genetic loci associated with late-onset Alzheimer disease in African Americans. The Alzheimer Disease Genetics Consortium (ADGC) assembled multiple data sets representing a total of 5896 African Americans (1968 case participants, 3928 control participants) 60 years or older that were collected between 1989 and 2011 at multiple sites. The association of Alzheimer disease with genotyped and imputed single-nucleotide polymorphisms (SNPs) was assessed in case-control and in family-based data sets. Results from individual data sets were combined to perform an inverse variance-weighted meta-analysis, first with genome-wide analyses and subsequently with gene-based tests for previously reported loci. Presence of Alzheimer disease according to standardized criteria. Genome-wide significance in fully adjusted models (sex, age, APOE genotype, population stratification) was observed for a SNP in ABCA7 (rs115550680, allele = G; frequency, 0.09 cases and 0.06 controls; odds ratio [OR], 1.79 [95% CI, 1.47-2.12]; P = 2.2 × 10(-9)), which is in linkage disequilibrium with SNPs previously associated with Alzheimer disease in Europeans (0.8 < D' < 0.9). The effect size for the SNP in ABCA7 was comparable with that of the APOE ϵ4-determining SNP rs429358 (allele = C; frequency, 0.30 cases and 0.18 controls; OR, 2.31 [95% CI, 2.19-2.42]; P = 5.5 × 10(-47)). Several loci previously associated with Alzheimer disease but not reaching significance in genome-wide analyses were replicated in gene-based analyses accounting for linkage disequilibrium between markers and correcting for number of tests

  11. Carcinogenic effects of cadmium in the noble (NBL/Cr) rat: induction of pituitary, testicular, and injection site tumors and intraepithelial proliferative lesions of the dorsolateral prostate.

    PubMed

    Waalkes, M P; Anver, M; Diwan, B A

    1999-12-01

    Cadmium is a known human carcinogen based on findings of lung cancer in exposed populations. A more controversial target site for cadmium is the human prostate gland, for which some studies indicate a link between cadmium exposure and cancer. Our work in various strains of Wistar rats has shown that cadmium can induce tumors in the ventral lobe of the prostate. The relevance of this type of lesion to human prostate cancer has been questioned because the ventral lobe of the rat prostate, unlike the dorsolateral lobe, has no embryological homolog in the human gland. In this study we investigated the chronic toxic and carcinogenic effects of cadmium in the Noble (NBL/Cr) rat, with particular attention to lesions of the prostate. Cadmium chloride (CdCl2) was given as a single sc injection (0, 1, 2, 4, 8, 16, or 32 micromol/kg) to groups (initially n = 30) of 10-week-old rats. Rats were observed for up to 72 weeks following exposure. In rats that were injected with the lower doses of cadmium (< or =4 micromol/kg), a clear dose-related increase in proliferative lesions of the dorsolateral prostate occurred (0 micromol/kg = 36% incidence, 1 micromol/kg = 62%, 2 micromol/kg = 65%; 4 micromol/kg = 79%; trend p < 0.003). Lesions were described as intraepithelial hyperplasia with occasional areas of atypical epithelial cells, without stromal invasion. At higher doses (> or =8 micromol/kg) the proliferative-lesion response in the dorsolateral prostate gradually declined to near control levels (8 micromol/kg = 63%; 16 micromol/kg = 60%; 32 micromol/kg = 52%). The loss of prostatic response at the higher doses of cadmium was probably due to loss of testicular function secondary to cadmium treatment. This was reflected in a very high incidence (>90%) of lesions, indicative of testicular hypofunction, including tubular degeneration, mineralization, and interstitial (Leydig) cell tumors, at doses in excess of 16 micromol/kg. Malignant injection-site sarcomas occurred at the two

  12. Induction of DNA strand breaks, base lesions and clustered damage sites in hydrated plasmid DNA films by ultrasoft X rays around the phosphorus K edge.

    PubMed

    Yokoya, Akinari; Cunniffe, Siobhan M T; Watanabe, Ritsuko; Kobayashi, Katsumi; O'Neill, Peter

    2009-09-01

    To characterize the DNA damage induced by K-shell ionization of phosphorus atom in DNA backbone on the level of hydration, the yields of DNA strand breaks and base lesions arising from the interaction of ultrasoft X rays with energies around the phosphorus K edge were determined using dry and fully hydrated pUC18 plasmid DNA samples. Base lesions and bistranded clustered DNA damage sites were revealed by postirradiation treatment with the base excision repair proteins endonuclease III (Nth) and formamidopyrimidine-DNA glycosylase (Fpg). The yield of prompt single-strand breaks (SSBs) with dry DNA irradiated at the phosphorus K resonance energy (2153 eV) is about one-third that below the phosphorus K edge (2147 eV). The yields of prompt double-strand breaks (DSBs) were found to be less dependent on the X-ray energy, with the yields being about two times lower when irradiated at 2153 eV. Heat-labile sites were not produced in detectable amounts. The yields of base lesions were dependent on the energy of the X rays, especially when the DNA was fully hydrated. Bistranded clustered DNA damage sites, revealed enzymatically as additional DSBs, were produced in dry as well as in hydrated DNA with all three energies of X rays. The yields of these enzyme-sensitive sites were also lower when irradiated at the phosphorus K resonance energy. On the other hand, the yields of prompt SSBs and enzyme-sensitive sites for the two off-resonance energies were, larger than those determined previously for gamma radiation. The results indicate that the photoelectric effect caused by X rays and dense ionization and excitation events along the tracks of low-energy secondary electrons are more effective at inducing SSBs and enzyme-sensitive sites. The complex types of damage, prompt and enzymatically induced DSBs, are preferentially induced by phosphorus K resonance at 2153 eV rather than simple SSBs and isolated base lesions, particularly in hydrated conditions. It is concluded that not

  13. Modulation of microRNA Expression in Subjects with Metabolic Syndrome and Decrease of Cholesterol Efflux from Macrophages via microRNA-33-Mediated Attenuation of ATP-Binding Cassette Transporter A1 Expression by Statins

    PubMed Central

    Tseng, Pei-Chi; Lee, Tzong-Shyuan; Lee, Wen-Jane; Chang, Pey-Jium; Chiang, An-Na

    2016-01-01

    Metabolic syndrome (MetS) is a complicated health problem that encompasses a variety of metabolic disorders. In this study, we analyzed the relationship between the major biochemical parameters associated with MetS and circulating levels of microRNA (miR)-33, miR-103, and miR-155. We found that miRNA-33 levels were positively correlated with levels of fasting blood glucose, glycosylated hemoglobin A1c, total cholesterol, LDL-cholesterol, and triacylglycerol, but negatively correlated with HDL-cholesterol levels. In the cellular study, miR-33 levels were increased in macrophages treated with high glucose and cholesterol-lowering drugs atorvastatin and pitavastatin. miR-33 has been reported to play an essential role in cholesterol homeostasis through ATP-binding cassette transporter A1 (ABCA1) regulation and reverse cholesterol transport. However, the molecular mechanism underlying the linkage between miR-33 and statin treatment remains unclear. In the present study, we investigated whether atorvastatin and pitavastatin exert their functions through