Sample records for attenuates bone cancer-induced

  1. Acupuncture for Cancer-Induced Bone Pain?

    PubMed Central

    Paley, Carole A.; Bennett, Michael I.; Johnson, Mark I.


    Bone pain is the most common type of pain in cancer. Bony metastases are common in advanced cancers, particularly in multiple myeloma, breast, prostate or lung cancer. Current pain-relieving strategies include the use of opioid-based analgesia, bisphosphonates and radiotherapy. Although patients experience some pain relief, these interventions may produce unacceptable side-effects which inevitably affect the quality of life. Acupuncture may represent a potentially valuable adjunct to existing strategies for pain relief and it is known to be relatively free of harmful side-effects. Although acupuncture is used in palliative care settings for all types of cancer pain the evidence-base is sparse and inconclusive and there is very little evidence to show its effectiveness in relieving cancer-induced bone pain (CIBP). The aim of this critical review is to consider the known physiological effects of acupuncture and discuss these in the context of the pathophysiology of malignant bone pain. The aim of future research should be to produce an effective protocol for treating CIBP with acupuncture based on a sound, evidence-based rationale. The physiological mechanisms presented in this review suggest that this is a realistic objective. PMID:21799687

  2. Upregulation of (C-X-C motif) Ligand 13 (CXCL13) Attenuates Morphine Analgesia in Rats with Cancer-Induced Bone Pain

    PubMed Central

    Wang, Shi-Feng; Dong, Cheng-Gong; Yang, Xue; Yin, Jian-Jun


    Background The aim of this study was to investigate the role of chemokine (C-X-C motif) ligand 13 (CXCL13) in morphine tolerance in rats with cancer-induced bone pain (CIBP). Material/Methods We established a rat CIBP model and a rat CIBP-morphine tolerance (BM) model. BM rats were intrathecally administered rmCXCL13, neutralizing anti-CXCL13, and normal saline, while the control group rats underwent a sham operation and were injected with normal saline. The morphine analgesia was assessed by measuring mechanical withdrawal threshold (MWT) and mechanical withdrawal duration (MWD) at various time points. The co-expressions of CXCL13 and NeuN were measured by immunofluorescence double-staining. CXCL13 protein and mRNA expressions were detected by Western blot and quantitative real-time polymerase chain reaction (RT-qPCR), respectively. Results Compared to the sham-operation (S) group, the BM group showed obviously decreased MWT and increased MWD on Day 9 after CIBP, but obviously increased MWT and decreased MWD on Day 3 after morphine administration; subsequently, the MWT was decreased and MWD was increased (all P<0.05). In comparison with the S+saline group, increased MWT and decreased MWD were observed in BM rats on Day 3 after anti-CXCL13 administration, and obviously decreased MWT and increased MWD were found in BM rats on Day 3 after rmCXCL13 administration (all P<0.05). Conclusions Up-regulated CXCL13 has a negative role in morphine analgesia in relief of CIBP, which may provide a new target for the management of CIBP. PMID:27892451

  3. Pain and nociception: mechanisms of cancer-induced bone pain.


    Falk, Sarah; Dickenson, Anthony H


    Cancer pain, especially pain caused by metastasis to bone, is a severe type of pain, and unless the cause and consequences can be resolved, the pain will become chronic. As detection and survival among patients with cancer have improved, pain has become an increasing challenge, because traditional therapies are often only partially effective. Until recently, knowledge of cancer pain mechanisms was poor compared with understanding of neuropathic and inflammatory pain states. We now view cancer-induced bone pain as a complex pain state involving components of both inflammatory and neuropathic pain but also exhibiting elements that seem unique to cancer pain. In addition, the pain state is often unpredictable, and the intensity of the pain is highly variable, making it difficult to manage. The establishment of translational animal models has started to reveal some of the molecular components involved in cancer pain. We present the essential pharmacologic and neurobiologic mechanisms involved in the generation and continuance of cancer-induced bone pain and discuss these in the context of understanding and treating patients. We discuss changes in peripheral signaling in the area of tumor growth, examine spinal cord mechanisms of sensitization, and finally address central processing. Our aim is to provide a mechanistic background for the sensory characteristics of cancer-induced bone pain as a basis for better understanding and treating this condition.

  4. Cancer-induced bone pain: Mechanisms and models.


    Lozano-Ondoua, A N; Symons-Liguori, A M; Vanderah, T W


    Cancerous cells can originate in a number of different tissues such as prostate, breast and lung, but often go undetected and are non-painful. Many types of cancers have a propensity to metastasize to the bone microenvironment first. Tumor burden within the bone causes excruciating breakthrough pain with properties of ongoing pain that is inadequately managed with current analgesics. Part of this failure is due to the poor understanding of the etiology of cancer pain. Animal models of cancer-induced bone pain (CIBP) have revealed that the neurochemistry of cancer has features distinctive from other chronic pain states. For example, preclinical models of metastatic cancer often result in the positive modulation of neurotrophins, such as NGF and BDNF, that can lead to nociceptive sensitization. Preclinical cancer models also demonstrate nociceptive neuronal expression of acid-sensing receptors, such as ASIC1 and TRPV1, which respond to cancer-induced acidity within the bone. CIBP is correlated with a significant increase in pro-inflammatory mediators acting peripherally and centrally, contributing to neuronal hypersensitive states. Finally, cancer cells generate high levels of oxidative molecules that are thought to increase extracellular glutamate concentrations, thus activating primary afferent neurons. Knowledge of the unique neuro-molecular profile of cancer pain will ultimately lead to the development of novel and superior therapeutics for CIBP.

  5. Monocyte chemoattractant protein-1 contributes to morphine tolerance in rats with cancer-induced bone pain.


    Liu, Lei; Gao, Xiu-Juan; Ren, Chun-Guang; Hu, Ji-Hua; Liu, Xian-Wen; Zhang, Ping; Zhang, Zong-Wang; Fu, Zhi-Jian


    Cancer-induced bone pain can severely compromise the life quality of patients, while tolerance limits the use of opioids in the treatment of cancer pain. Monocyte chemoattractant protein-1 (MCP-1) is known to contribute to neuropathic pain. However, the role of spinal MCP-1 in the development of morphine tolerance in patients with cancer-induced bone pain remains unclear. The aim of the present study was to investigate the role of spinal MCP-1 in morphine tolerance in bone cancer pain rats (MTBP rats). Bone cancer pain was induced by intramedullary injection of Walker 256 cells into the tibia of the rats, while morphine tolerance was induced by continuous intrathecal injection of morphine over a period of 9 days. In addition, anti-MCP-1 antibodies were intrathecally injected to rats in various groups in order to investigate the association of MCP-1 with mechanical and heat hyperalgesia using the paw withdrawal threshold (PWT) and thermal withdrawal latency (TWL) tests, respectively. Furthermore, MCP-1 and CCR2 expression levels were measured using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis, and CCR2 expression levels were measured using RT-qPCR. The results indicated that MCP-1 and CCR2 expression levels were significantly increased in the spinal cord of MTBP rats. Intrathecal administration of anti-MCP-1 neutralizing antibodies was observed to attenuate the mechanical and thermal allodynia in MTBP rats. Therefore, the upregulation of spinal MCP-1 and CCR2 expression levels may contribute to the development of mechanical allodynia in MTBP rats. In conclusion, MCP-1/CCR2 signaling may serve a crucial role in morphine tolerance development in rats suffering from cancer-induced bone pain.

  6. Monocyte chemoattractant protein-1 contributes to morphine tolerance in rats with cancer-induced bone pain

    PubMed Central

    Liu, Lei; Gao, Xiu-Juan; Ren, Chun-Guang; Hu, Ji-Hua; Liu, Xian-Wen; Zhang, Ping; Zhang, Zong-Wang; Fu, Zhi-Jian


    Cancer-induced bone pain can severely compromise the life quality of patients, while tolerance limits the use of opioids in the treatment of cancer pain. Monocyte chemoattractant protein-1 (MCP-1) is known to contribute to neuropathic pain. However, the role of spinal MCP-1 in the development of morphine tolerance in patients with cancer-induced bone pain remains unclear. The aim of the present study was to investigate the role of spinal MCP-1 in morphine tolerance in bone cancer pain rats (MTBP rats). Bone cancer pain was induced by intramedullary injection of Walker 256 cells into the tibia of the rats, while morphine tolerance was induced by continuous intrathecal injection of morphine over a period of 9 days. In addition, anti-MCP-1 antibodies were intrathecally injected to rats in various groups in order to investigate the association of MCP-1 with mechanical and heat hyperalgesia using the paw withdrawal threshold (PWT) and thermal withdrawal latency (TWL) tests, respectively. Furthermore, MCP-1 and CCR2 expression levels were measured using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis, and CCR2 expression levels were measured using RT-qPCR. The results indicated that MCP-1 and CCR2 expression levels were significantly increased in the spinal cord of MTBP rats. Intrathecal administration of anti-MCP-1 neutralizing antibodies was observed to attenuate the mechanical and thermal allodynia in MTBP rats. Therefore, the upregulation of spinal MCP-1 and CCR2 expression levels may contribute to the development of mechanical allodynia in MTBP rats. In conclusion, MCP-1/CCR2 signaling may serve a crucial role in morphine tolerance development in rats suffering from cancer-induced bone pain. PMID:28352316

  7. Angiotensin-(1-7)/Mas receptor as an antinociceptive agent in cancer-induced bone pain.


    Forte, Brittany L; Slosky, Lauren M; Zhang, Hong; Arnold, Moriah R; Staatz, William D; Hay, Meredith; Largent-Milnes, Tally M; Vanderah, Todd W


    Many cancerous solid tumors metastasize to the bone and induce pain (cancer-induced bone pain [CIBP]). Cancer-induced bone pain is often severe because of enhanced inflammation, rapid bone degradation, and disease progression. Opioids are prescribed to manage this pain, but they may enhance bone loss and increase tumor proliferation, further compromising patient quality of life. Angiotensin-(1-7) (Ang-(1-7)) binds and activates the Mas receptor (MasR). Angiotensin-(1-7)/MasR activation modulates inflammatory signaling after acute tissue insult, yet no studies have investigated whether Ang-(1-7)/MasR play a role in CIBP. We hypothesized that Ang-(1-7) inhibits CIBP by targeting MasR in a murine model of breast CIBP. 66.1 breast cancer cells were implanted into the femur of BALB/cAnNHsd mice as a model of CIBP. Spontaneous and evoked pain behaviors were assessed before and after acute and chronic administration of Ang-(1-7). Tissues were collected from animals for ex vivo analyses of MasR expression, tumor burden, and bone integrity. Cancer inoculation increased spontaneous pain behaviors by day 7 that were significantly reduced after a single injection of Ang-(1-7) and after sustained administration. Preadministration of A-779 a selective MasR antagonist prevented this reduction, whereas pretreatment with the AT2 antagonist had no effect; an AT1 antagonist enhanced the antinociceptive activity of Ang-(1-7) in CIBP. Repeated Ang-(1-7) administration did not significantly change tumor burden or bone remodeling. Data here suggest that Ang-(1-7)/MasR activation significantly attenuates CIBP, while lacking many side effects seen with opioids. Thus, Ang-(1-7) may be an alternative therapeutic strategy for the nearly 90% of patients with advanced-stage cancer who experience excruciating pain.

  8. Angiotensin-(1-7)/Mas receptor as an antinociceptive agent in cancer-induced bone pain

    PubMed Central

    Forte, Brittany L.; Slosky, Lauren M.; Zhang, Hong; Arnold, Moriah R.; Staatz, William D.; Hay, Meredith; Largent-Milnes, Tally M.; Vanderah, Todd W.


    Abstract Many cancerous solid tumors metastasize to the bone and induce pain (cancer-induced bone pain [CIBP]). Cancer-induced bone pain is often severe because of enhanced inflammation, rapid bone degradation, and disease progression. Opioids are prescribed to manage this pain, but they may enhance bone loss and increase tumor proliferation, further compromising patient quality of life. Angiotensin-(1-7) (Ang-(1-7)) binds and activates the Mas receptor (MasR). Angiotensin-(1-7)/MasR activation modulates inflammatory signaling after acute tissue insult, yet no studies have investigated whether Ang-(1-7)/MasR play a role in CIBP. We hypothesized that Ang-(1-7) inhibits CIBP by targeting MasR in a murine model of breast CIBP. 66.1 breast cancer cells were implanted into the femur of BALB/cAnNHsd mice as a model of CIBP. Spontaneous and evoked pain behaviors were assessed before and after acute and chronic administration of Ang-(1-7). Tissues were collected from animals for ex vivo analyses of MasR expression, tumor burden, and bone integrity. Cancer inoculation increased spontaneous pain behaviors by day 7 that were significantly reduced after a single injection of Ang-(1-7) and after sustained administration. Preadministration of A-779 a selective MasR antagonist prevented this reduction, whereas pretreatment with the AT2 antagonist had no effect; an AT1 antagonist enhanced the antinociceptive activity of Ang-(1-7) in CIBP. Repeated Ang-(1-7) administration did not significantly change tumor burden or bone remodeling. Data here suggest that Ang-(1-7)/MasR activation significantly attenuates CIBP, while lacking many side effects seen with opioids. Thus, Ang-(1-7) may be an alternative therapeutic strategy for the nearly 90% of patients with advanced-stage cancer who experience excruciating pain. PMID:27541850

  9. Extracellular signal-regulated kinase activation in spinal astrocytes and microglia contributes to cancer-induced bone pain in rats.


    Wang, X-W; Li, T-T; Zhao, J; Mao-Ying, Q-L; Zhang, H; Hu, S; Li, Q; Mi, W-L; Wu, G-C; Zhang, Y-Q; Wang, Y-Q


    Cancer pain, especially cancer-induced bone pain, affects the quality of life of cancer patients, and current treatments for this pain are limited. The present study demonstrates that spinal extracellular signal-regulated kinase (ERK) activation in glial cells plays a crucial role in cancer-induced bone pain. From day 4 to day 21 after the intra-tibia inoculation with Walker 256 mammary gland carcinoma cells, significant mechanical allodynia was observed as indicated by the decrease of mechanical withdrawal thresholds in the von Frey hair test. Intra-tibia inoculation with carcinoma cells induced a vast and persistent (>21 D) activation of ERK in the bilateral L2-L3 and L4-L5 spinal dorsal horn. The increased pERK1/2-immunoreactivity was observed in both Iba-1-expressing microglia and GFAP-expressing astrocytes but not in NeuN-expressing neurons. A single intrathecal injection of the selective MEK (ERK kinase) inhibitors PD98059 (10 μg) on day 12 and U0126 (1.25 and 3 μg) on day 14, attenuated the bilateral mechanical allodynia in the von Frey hair test. Altogether, our results suggest that ERK activation in spinal microglia and astrocytes is correlated with the onset of allodynia and is important for allodynia maintenance in the cancer pain model. This study indicated that inhibition of the ERK pathway may provide a new therapy for cancer-induced bone pain.

  10. Overexpression of suppressor of cytokine signaling 3 in dorsal root ganglion attenuates cancer-induced pain in rats

    PubMed Central

    Wei, Jinrong; Li, Meng; Wang, Dieyu; Zhu, Hongyan; Kong, Xiangpeng; Wang, Shusheng; Zhou, You-Lang; Ju, Zhong; Jiang, Guo-Qin


    Background Cancer-induced pain (CIP) is one of the most severe types of chronic pain with which clinical treatment remains challenging and the involved mechanisms are largely unknown. Suppressor of cytokine signaling 3 (SOCS3) is an important intracellular protein and provides a classical negative feedback loop, thus involving in a wide variety of processes including inflammation and nociception. However, the role of SOCS3 pathway in CIP is poorly understood. The present study was designed to investigate the role of SOCS3 in dorsal root ganglion (DRG) in the development of CIP. Method CIP was established by injection of Walker 256 mammary gland tumor cells into the rat tibia canal. Whole-cell patch clamping and Western blotting were performed. Results Following the development of bone cancer, SOCS3 expression was significantly downregulated in rat DRGs at L2–L5 segments. Overexpression of SOCS3, using lentiviral-mediated production of SOCS3 at spinal cord level, drastically attenuated mechanical allodynia and body weight-bearing difference, but not thermal hyperalgesia in bone cancer rats. In addition, overexpression of SOCS3 reversed the hyperexcitability of DRG neurons innervating the tibia, and reduced abnormal expression of toll-like receptors 4 in the DRGs. Conclusions These results suggest that SOCS3 might be a key molecular involved in the development of complicated cancer pain and that overexpression of SOCS3 might be an important strategy for treatment for mechanical allodynia associated with bone cancer. PMID:28326931

  11. Involvement of spinal monocyte chemoattractant protein-1 (MCP-1) in cancer-induced bone pain in rats.


    Hu, Ji-Hua; Zheng, Xiao-Yan; Yang, Jian-Ping; Wang, Li-Na; Ji, Fu-Hai


    In this study, we examined the involvement of chemokine monocyte chemoattractant protein-1 (MCP-1) in the spinal cord of a rat model of cancer-induced bone pain (CIBP). In this model, CIBP was established by an intramedullary injection of Walker 256 cells into the tibia of rats. We observed a significant increase in expression levels of MCP-1 and its receptor CCR2 in the spinal cord of CIBP rats. Furthermore, the intrathecal administration of an anti-MCP-1 neutralizing antibody attenuated the mechanical allodynia established in CIBP rats. Likewise, an intrathecal injection of exogenous recombinant MCP-1 induced a striking mechanical allodynia in naïve rats. These results suggest that increases in spinal MCP-1 and CCR2 expression are involved in the development of mechanical allodynia associated with bone cancer rats.

  12. The cystine/glutamate antiporter system xc− drives breast tumor cell glutamate release and cancer-induced bone pain

    PubMed Central

    Slosky, Lauren M.; BassiriRad, Neemah M.; Symons, Ashley M.; Thompson, Michelle; Doyle, Timothy; Forte, Brittany L.; Staatz, William D.; Bui, Lynn; Neumann, William L.; Mantyh, Patrick W.; Salvemini, Daniela; Largent-Milnes, Tally M.; Vanderah, Todd W.


    Abstract Bone is one of the leading sites of metastasis for frequently diagnosed malignancies, including those arising in the breast, prostate and lung. Although these cancers develop unnoticed and are painless in their primary sites, bone metastases result in debilitating pain. Deeper investigation of this pain may reveal etiology and lead to early cancer detection. Cancer-induced bone pain (CIBP) is inadequately managed with current standard-of-care analgesics and dramatically diminishes patient quality of life. While CIBP etiology is multifaceted, elevated levels of glutamate, an excitatory neurotransmitter, in the bone-tumor microenvironment may drive maladaptive nociceptive signaling. Here, we establish a relationship between the reactive nitrogen species peroxynitrite, tumor-derived glutamate, and CIBP. In vitro and in a syngeneic in vivo model of breast CIBP, murine mammary adenocarcinoma cells significantly elevated glutamate via the cystine/glutamate antiporter system xc−. The well-known system xc− inhibitor sulfasalazine significantly reduced levels of glutamate and attenuated CIBP-associated flinching and guarding behaviors. Peroxynitrite, a highly reactive species produced in tumors, significantly increased system xc− functional expression and tumor cell glutamate release. Scavenging peroxynitrite with the iron and mangano-based porphyrins, FeTMPyP and SRI10, significantly diminished tumor cell system xc− functional expression, reduced femur glutamate levels and mitigated CIBP. In sum, we demonstrate how breast cancer bone metastases upregulate a cystine/glutamate co-transporter to elevate extracellular glutamate. Pharmacological manipulation of peroxynitrite or system xc− attenuates CIBP, supporting a role for tumor-derived glutamate in CIBP and validating the targeting of system xc− as a novel therapeutic strategy for the management of metastatic bone pain. PMID:27482630

  13. Regulation of breast cancer-induced bone lesions by β-catenin protein signaling.


    Chen, Yan; Shi, Heidi Y; Stock, Stuart R; Stern, Paula H; Zhang, Ming


    Breast cancer patients have an extremely high rate of bone metastases. Morphological analyses of the bones in most of the patients have revealed the mixed bone lesions, comprising both osteolytic and osteoblastic elements. β-Catenin plays a key role in both embryonic skeletogenesis and postnatal bone regeneration. Although this pathway is also involved in many bone malignancy, such as osteosarcoma and prostate cancer-induced bone metastases, its regulation of breast cancer bone metastases remains unknown. Here, we provide evidence that the β-catenin signaling pathway has a significant impact on the bone lesion phenotype. In this study, we established a novel mouse model of mixed bone lesions using intratibial injection of TM40D-MB cells, a breast cancer cell line that is highly metastatic to bone. We found that both upstream and downstream molecules of the β-catenin pathway are up-regulated in TM40D-MB cells compared with non-bone metastatic TM40D cells. TM40D-MB cells also have a higher T cell factor (TCF) reporter activity than TM40D cells. Inactivation of β-catenin in TM40D-MB cells through expression of a dominant negative TCF4 not only increases osteoclast differentiation in a tumor-bone co-culture system and enhances osteolytic bone destruction in mice, but also inhibits osteoblast differentiation. Surprisingly, although tumor cells overexpressing β-catenin did induce a slight increase of osteoblast differentiation in vitro, these cells display a minimal effect on osteoblastic bone formation in mice. These data collectively demonstrate that β-catenin acts as an important determinant in mixed bone lesions, especially in controlling osteoblastic effect within tumor-harboring bone environment.

  14. Intrathecal injection of lentivirus-mediated glial cell line-derived neurotrophic factor RNA interference relieves bone cancer-induced pain in rats.


    Meng, Fu-Fen; Xu, Yang; Dan, Qi-Qin; Wei, La; Deng, Ying-Jie; Liu, Jia; He, Mu; Liu, Wei; Xia, Qing-Jie; Zhou, Fiona H; Wang, Ting-Hua; Wang, Xi-Yan


    Bone cancer pain is a common symptom in cancer patients with bone metastases and the underlying mechanisms are largely unknown. The aim of this study is to explore the endogenous analgesic mechanisms to develop new therapeutic strategies for bone-cancer induced pain (BCIP) as a result of metastases. MRMT-1 tumor cells were injected into bilateral tibia of rats and X-rays showed that the area suffered from bone destruction, accompanied by an increase in osteoclast numbers. In addition, rats with bone cancer showed apparent mechanical and thermal hyperalgesia at day 28 after intratibial MRMT-1 inoculation. However, intrathecal injection of morphine or lentivirus-mediated glial cell line-derived neurotrophic factor RNAi (Lvs-siGDNF) significantly attenuated mechanical and thermal hyperalgesia, as shown by increases in paw withdrawal thresholds and tail-flick latencies, respectively. Furthermore, Lvs-siGDNF interference not only substantially downregulated GDNF protein levels, but also reduced substance P immunoreactivity and downregulated the ratio of pERK/ERK, where its activation is crucial for pain signaling, in the spinal dorsal horn of this model of bone-cancer induced pain. In this study, Lvs-siGDNF gene therapy appeared to be a beneficial method for the treatment of bone cancer pain. As the effect of Lvs-siGDNF to relieve pain was similar to morphine, but it is not a narcotic, the use of GDNF RNA interference may be considered as a new therapeutic strategy for the treatment of bone cancer pain in the future.

  15. Involvement of Spinal CCR5/PKCγ Signaling Pathway in the Maintenance of Cancer-Induced Bone Pain.


    Hang, Li-Hua; Li, Shu-Na; Dan, Xiang; Shu, Wei-Wei; Luo, Hong; Shao, Dong-Hua


    Cancer-induced bone pain (CIBP) is a challenging medical problem that considerably influences cancer patients' quality of life. Currently, few treatments have been developed to conquer CIBP because of a poor understanding of the potential mechanisms. Our previous work has proved that spinal RANTES (a major ligand for CCR5) was involved in the maintenance of CIBP. In this study, we attempted to investigate whether spinal CCR5 and its downstream PKCγ pathway is involved in the maintenance of CIBP. Inoculation of Walker 256 cells into the tibia could induce a marked mechanical allodynia with concomitant upregulation of spinal CCR5 and p-PKCγ expression from day 6 to day 15 after inoculation. Spinal CCR5 was prominently expressed in microglia, and mechanical allodynia was attenuated by intrathecal injection of DAPTA (a specific antagonist of CCR5) with downregulation of spinal CCR5 and p-PKCγ expression levels at day 15 in inoculated rats. Pre-intrathecal injection of RANTES could reverse the anti-allodynia effects of DAPTA. Intrathecal administration of GF109203X (an inhibitor of PKC) could alleviate mechanical allodynia as well as decrease of spinal p-PKCγ expression level, but no influence on spinal CCR5 level. Our findings suggest that CCR5/PKCγ signaling pathway in microglia may contribute to the maintenance of CIBP in rats.

  16. Differences in electrophysiological properties of functionally identified nociceptive sensory neurons in an animal model of cancer-induced bone pain

    PubMed Central

    Zhu, Yong Fang; Ungard, Robert; Seidlitz, Eric; Zacal, Natalie; Huizinga, Jan; Henry, James L


    Background Bone cancer pain is often severe, yet little is known about mechanisms generating this type of chronic pain. While previous studies have identified functional alterations in peripheral sensory neurons that correlate with bone tumours, none has provided direct evidence correlating behavioural nociceptive responses with properties of sensory neurons in an intact bone cancer model. Results In a rat model of prostate cancer-induced bone pain, we confirmed tactile hypersensitivity using the von Frey test. Subsequently, we recorded intracellularly from dorsal root ganglion neurons in vivo in anesthetized animals. Neurons remained connected to their peripheral receptive terminals and were classified on the basis of action potential properties, responses to dorsal root stimulation, and to mechanical stimulation of the respective peripheral receptive fields. Neurons included C-, Aδ-, and Aβ-fibre nociceptors, identified by their expression of substance P. We suggest that bone tumour may induce phenotypic changes in peripheral nociceptors and that these could contribute to bone cancer pain. Conclusions This work represents a significant technical and conceptual advance in the study of peripheral nociceptor functions in the development of cancer-induced bone pain. This is the first study to report that changes in sensitivity and excitability of dorsal root ganglion primary afferents directly correspond to mechanical allodynia and hyperalgesia behaviours following prostate cancer cell injection into the femur of rats. Furthermore, our unique combination of techniques has allowed us to follow, in a single neuron, mechanical pain-related behaviours, electrophysiological changes in action potential properties, and dorsal root substance P expression. These data provide a more complete understanding of this unique pain state at the cellular level that may allow for future development of mechanism-based treatments for cancer-induced bone pain. PMID:27030711

  17. Bone Cell-autonomous Contribution of Type 2 Cannabinoid Receptor to Breast Cancer-induced Osteolysis.


    Sophocleous, Antonia; Marino, Silvia; Logan, John G; Mollat, Patrick; Ralston, Stuart H; Idris, Aymen I


    The cannabinoid type 2 receptor (CB2) has previously been implicated as a regulator of tumor growth, bone remodeling, and bone pain. However, very little is known about the role of the skeletal CB2 receptor in the regulation of osteoblasts and osteoclasts changes associated with breast cancer. Here we found that the CB2-selective agonists HU308 and JWH133 reduced the viability of a variety of parental and bone-tropic human and mouse breast cancer cells at high micromolar concentrations. Under conditions in which these ligands are used at the nanomolar range, HU308 and JWH133 enhanced human and mouse breast cancer cell-induced osteoclastogenesis and exacerbated osteolysis, and these effects were attenuated in cultures obtained from CB2-deficient mice or in the presence of a CB2 receptor blocker. HU308 and JWH133 had no effects on osteoblast growth or differentiation in the presence of conditioned medium from breast cancer cells, but under these circumstances both agents enhanced parathyroid hormone-induced osteoblast differentiation and the ability to support osteoclast formation. Mechanistic studies in osteoclast precursors and osteoblasts showed that JWH133 and HU308 induced PI3K/AKT activity in a CB2-dependent manner, and these effects were enhanced in the presence of osteolytic and osteoblastic factors such as RANKL (receptor activator of NFκB ligand) and parathyroid hormone. When combined with published work, these findings suggest that breast cancer and bone cells exhibit differential responses to treatment with CB2 ligands depending upon cell type and concentration used. We, therefore, conclude that both CB2-selective activation and antagonism have potential efficacy in cancer-associated bone disease, but further studies are warranted and ongoing.

  18. Bone Cell-autonomous Contribution of Type 2 Cannabinoid Receptor to Breast Cancer-induced Osteolysis*

    PubMed Central

    Sophocleous, Antonia; Marino, Silvia; Logan, John G.; Mollat, Patrick; Ralston, Stuart H.; Idris, Aymen I.


    The cannabinoid type 2 receptor (CB2) has previously been implicated as a regulator of tumor growth, bone remodeling, and bone pain. However, very little is known about the role of the skeletal CB2 receptor in the regulation of osteoblasts and osteoclasts changes associated with breast cancer. Here we found that the CB2-selective agonists HU308 and JWH133 reduced the viability of a variety of parental and bone-tropic human and mouse breast cancer cells at high micromolar concentrations. Under conditions in which these ligands are used at the nanomolar range, HU308 and JWH133 enhanced human and mouse breast cancer cell-induced osteoclastogenesis and exacerbated osteolysis, and these effects were attenuated in cultures obtained from CB2-deficient mice or in the presence of a CB2 receptor blocker. HU308 and JWH133 had no effects on osteoblast growth or differentiation in the presence of conditioned medium from breast cancer cells, but under these circumstances both agents enhanced parathyroid hormone-induced osteoblast differentiation and the ability to support osteoclast formation. Mechanistic studies in osteoclast precursors and osteoblasts showed that JWH133 and HU308 induced PI3K/AKT activity in a CB2-dependent manner, and these effects were enhanced in the presence of osteolytic and osteoblastic factors such as RANKL (receptor activator of NFκB ligand) and parathyroid hormone. When combined with published work, these findings suggest that breast cancer and bone cells exhibit differential responses to treatment with CB2 ligands depending upon cell type and concentration used. We, therefore, conclude that both CB2-selective activation and antagonism have potential efficacy in cancer-associated bone disease, but further studies are warranted and ongoing. PMID:26195631

  19. Spinal interleukin-33 and its receptor ST2 contribute to bone cancer-induced pain in mice.


    Zhao, J; Zhang, H; Liu, S-B; Han, P; Hu, S; Li, Q; Wang, Z-F; Mao-Ying, Q-L; Chen, H-M; Jiang, J-W; Wu, G-C; Mi, W-L; Wang, Y-Q


    Cancer pain, particularly bone cancer pain, affects the quality of life of cancer patients, and current treatments are limited. Interleukin (IL)-33, a new member of the IL-1 super family, has been reported to be involved in the modulation of inflammatory pain. However, studies focused on its role in the modulation of cancer pain have been rare. The present study was designed to investigate whether spinal IL-33/ST2 signaling was involved in bone cancer-induced pain in mice. Bone cancer was induced via intra-femoral inoculation of 4T1 mammary carcinoma cells. The mice inoculated with carcinoma cells showed mechanical allodynia, heat hyperalgesia and a reduction in limb use, whereas phosphate-buffered saline or heat-killed cells-injected mice showed no significant difference compared to non-treated mice. The pain hypersensitive behaviors worsened over time and with bone destruction. Both the mRNA and the protein levels of IL-33 and relative cytokines (IL-1β, IL-6, TNF-a) were significantly increased in the spinal cord after the inoculation of carcinoma cells. Intrathecal administration of ST2 antibody to block IL-33/ST2 signaling alleviated pain behaviors in a dose-dependent manner in bone cancer pain mice compared with vehicle-injected mice. Moreover, the ST2(-/-) mice showed a significant amelioration of limb use and heat hyperalgesia compared to wild-type mice. Meanwhile, concentrations of spinal IL-1β, IL-6 and TNF-a in the cancer-bearing ST2(-/-) mice had no significant changes. These data further suggested that IL-33/ST2 signaling played a vital role in cancer pain. Our results provided evidence that IL-33 and its receptor ST2 may be a potential therapeutic target for the treatment of pain in bone cancer patients.

  20. Pathobiology and management of prostate cancer-induced bone pain: recent insights and future treatments.


    Muralidharan, Arjun; Smith, Maree T


    Prostate cancer (PCa) has a high propensity for metastasis to bone. Despite the availability of multiple treatment options for relief of PCa-induced bone pain (PCIBP), satisfactory relief of intractable pain in patients with advanced bony metastases is challenging for the clinicians because currently available analgesic drugs are often limited by poor efficacy and/or dose-limiting side effects. Rodent models developed in the past decade show that the pathobiology of PCIBP comprises elements of inflammatory, neuropathic and ischemic pain arising from ectopic sprouting and sensitization of sensory nerve fibres within PCa-invaded bones. In addition, at the cellular level, PCIBP is underpinned by dynamic cross talk between metastatic PCa cells, cellular components of the bone matrix, factors associated with the bone microenvironment as well as peripheral components of the somatosensory system. These insights are aligned with the clinical management of PCIBP involving use of a multimodal treatment approach comprising analgesic agents (opioids, NSAIDs), radiotherapy, radioisotopes, cancer chemotherapy agents and bisphosphonates. However, a major drawback of most rodent models of PCIBP is their short-term applicability due to ethical concerns. Thus, it has been difficult to gain insight into the mal(adaptive) neuroplastic changes occurring at multiple levels of the somatosensory system that likely contribute to intractable pain at the advanced stages of metastatic disease. Specifically, the functional responsiveness of noxious circuitry as well as the neurochemical signature of a broad array of pro-hyperalgesic mediators in the dorsal root ganglia and spinal cord of rodent models of PCIBP is relatively poorly characterized. Hence, recent work from our laboratory to develop a protocol for an optimized rat model of PCIBP will enable these knowledge gaps to be addressed as well as identification of novel targets for drug discovery programs aimed at producing new analgesics

  1. Randomized Double-Blind Trial of Pregabalin Versus Placebo in Conjunction With Palliative Radiotherapy for Cancer-Induced Bone Pain

    PubMed Central

    Hoskin, Peter J.; Colvin, Lesley A.; Fleetwood-Walker, Susan M.; Adamson, Douglas; Byrne, Anthony; Murray, Gordon D.; Laird, Barry J.A.


    Purpose Cancer-induced bone pain (CIBP) affects one third of patients with cancer. Radiotherapy remains the gold-standard treatment; however, laboratory and clinical work suggest that pregabalin may be useful in treating CIBP. The aim of this study was to examine pregabalin in patients with CIBP receiving radiotherapy. Patients and Methods A multicenter, double-blind randomized trial of pregabalin versus placebo was conducted. Eligible patients were age ≥ 18 years, had radiologically proven bone metastases, were scheduled to receive radiotherapy, and had pain scores ≥ 4 of 10 (on 0-to-10 numeric rating scale). Before radiotherapy, baseline assessments were completed, followed by random assignment. Doses of pregabalin and placebo were increased over 4 weeks. The primary end point was treatment response, defined as a reduction of ≥ 2 points in worst pain by week 4, accompanied by a stable or reduced opioid dose, compared with baseline. Secondary end points assessed average pain, interference of pain with activity, breakthrough pain, mood, quality of life, and adverse events. Results A total of 233 patients were randomly assigned: 117 to placebo and 116 to pregabalin. The most common cancers were prostate (n = 88; 38%), breast (n = 77; 33%), and lung (n = 42; 18%). In the pregabalin arm, 45 patients (38.8%) achieved the primary end point, compared with 47 (40.2%) in the placebo arm (adjusted odds ratio, 1.07; 95% CI, 0.63 to 1.81; P = .816). There were no statistically significant differences in average pain, pain interference, or quality of life between arms. There were differences in mood (P = .031) and breakthrough pain duration (P = .037) between arms. Outcomes were compared at 4 weeks. Conclusion Our findings do not support the role of pregabalin in patients with CIBP receiving radiotherapy. The role of pregabalin in CIBP with a clinical neuropathic pain component is unknown. PMID:26644535

  2. Effect of sex in the MRMT-1 model of cancer-induced bone pain

    PubMed Central

    Falk, Sarah; Al-Dihaissy, Tamara; Mezzanotte, Laura; Heegaard, Anne-Marie


    An overwhelming amount of evidence demonstrates sex-induced variation in pain processing, and has thus increased the focus on sex as an essential parameter for optimization of in vivo models in pain research. Mammary cancer cells are often used to model metastatic bone pain in vivo, and are commonly used in both males and females. Here we demonstrate that compared to male rats, female rats have an increased capacity for recovery following inoculation of MRMT-1 mammary cells, thus potentially causing a sex-dependent bias in interpretation of the data. PMID:26834983

  3. Targeting cells of the myeloid lineage attenuates pain and disease progression in a prostate model of bone cancer.


    Thompson, Michelle L; Jimenez-Andrade, Juan M; Chartier, Stephane; Tsai, James; Burton, Elizabeth A; Habets, Gaston; Lin, Paul S; West, Brian L; Mantyh, Patrick W


    Tumor cells frequently metastasize to bone where they can generate cancer-induced bone pain (CIBP) that can be difficult to fully control using available therapies. Here, we explored whether PLX3397, a high-affinity small molecular antagonist that binds to and inhibits phosphorylation of colony-stimulating factor-1 receptor, the tyrosine-protein kinase c-Kit, and the FMS-like tyrosine kinase 3, can reduce CIBP. These 3 targets all regulate the proliferation and function of a subset of the myeloid cells including macrophages, osteoclasts, and mast cells. Preliminary experiments show that PLX3397 attenuated inflammatory pain after formalin injection into the hind paw of the rat. As there is an inflammatory component in CIBP, involving macrophages and osteoclasts, the effect of PLX3397 was explored in a prostate model of CIBP where skeletal pain, cancer cell proliferation, tumor metastasis, and bone remodeling could be monitored in the same animal. Administration of PLX3397 was initiated on day 14 after prostate cancer cell injection when the tumor was well established, and tumor-induced bone remodeling was first evident. Over the next 6 weeks, sustained administration of PLX3397 attenuated CIBP behaviors by approximately 50% and was equally efficacious in reducing tumor cell growth, formation of new tumor colonies in bone, and pathological tumor-induced bone remodeling. Developing a better understanding of potential effects that analgesic therapies have on the tumor itself may allow the development of therapies that not only better control the pain but also positively impact disease progression and overall survival in patients with bone cancer.

  4. Spinal IFN-γ-induced protein-10 (CXCL10) mediates metastatic breast cancer-induced bone pain by activation of microglia in rat models.


    Bu, Huilian; Shu, Bin; Gao, Feng; Liu, Cheng; Guan, Xuehai; Ke, Changbin; Cao, Fei; Hinton, Antentor Othrell; Xiang, Hongbing; Yang, Hui; Tian, Xuebi; Tian, Yuke


    Cancer-induced bone pain (CIBP) is a common clinical problem in breast cancer patients with bone metastasis. Recent studies shows chemokines are novel targets for treatment of CIBP. In this study, we intra-tibial inoculated with Walker 256 rat mammary gland carcinoma cells into rat bone to established metastatic breast cancer. Then we measured the expression of CXCL10 in the spinal cord of metastatic bone cancer rats, investigated the role of CXCL10 in the development of CIBP, and the underlying mechanism. Results revealed that after intra-tibial inoculation with Walker 256 cells, rats showed up-regulation of CXCL10 and its receptor CXCR3 in the spinal cord. Interestingly, intrathecally injection of recombinant CXCL10 protein induced mechanical allodynia in naïve rats. Blocking the function of CXCL10/CXCR3 pathway via anti-CXCL10 antibody or CXCR3 antagonist prevented the development of CIBP and microglial activation. Moreover, CXCL10-induced mechanical allodynia was rescued by minocycline treatment during the late-stage of CIBP, days 10-14. The regulation of CXCL10 expression involved microglial activation in a manner of autocrine positive feedback. These results suggest that CXCL10 may be a necessary algogenic molecule, especially in the development of CIBP. Its function was partly mediated via spinal microglial activation. This study provides a novel insight into the biological function of chemokine CXCL10 in the molecular mechanism underlying cancer pain. It also provides new target for clinical treatment of metastatic breast cancer-induced bone pain in future.

  5. Attenuating effect of bromocriptine on cysteamine anticarcinogenesis of stomach cancers induced by N-methyl-N'-nitro-N-nitrosoguanidine

    SciTech Connect

    Tatsuta, M.; Iishi, H.; Baba, M.; Ichii, M.; Nakaizumi, A.; Uehara, H.; Taniguchi, H. )


    The effect of bromocriptine on inhibition by cysteamine of gastric carcinogenesis induced by N-methyl-N'-nitro-N-nitrosoguanidine was investigated in inbred Wistar rats. After 25 weeks of p.o. treatment with N-methyl-N'-nitro-N-nitrosoguanidine, rats were given injections every other day: cysteamine (50 mg/kg body weight); cysteamine (50 mg/kg body weight) plus bromocriptine (0.5 or 0.25 mg/kg body weight); or bromocriptine (0.5 or 0.25 mg/kg body weight). In week 52, the group treated with cysteamine showed a significantly decreased incidence of gastric cancers. Concomitant treatment with bromocriptine at 0.5 but not at 0.25 mg/kg body weight significantly attenuated the inhibitory effect of cysteamine on gastric carcinogenesis. Administration of bromocriptine alone at either dosage had no influence on gastric carcinogenesis. The labeling index of the antral mucosa was significantly reduced in rats treated with cysteamine and significantly higher in those treated concomitantly with bromocriptine at 0.5 mg/kg body weight than in those treated with cysteamine alone. These findings indicate that cysteamine suppressed gastric carcinogenesis and that bromocriptine at high dosage attenuated this inhibition. These findings also suggest that dopamine is involved in the mechanism of inhibition of gastric carcinogenesis by cysteamine.

  6. Estimation of ultrasonic attenuation in a bone using coded excitation.


    Nowicki, A; Litniewski, J; Secomski, W; Lewin, P A; Trots, I


    This paper describes a novel approach to estimate broadband ultrasound attenuation (BUA) in a bone structure in human in vivo using coded excitation. BUA is an accepted indicator for assessment of osteoporosis. In the tested approach a coded acoustic signal is emitted and then the received echoes are compressed into brief, high amplitude pulses making use of matched filters and correlation receivers. In this way the acoustic peak pressure amplitude probing the tissue can be markedly decreased whereas the average transmitted intensity increases proportionally to the length of the code. This paper examines the properties of three different transmission schemes, based on Barker code, chirp and Golay code. The system designed is capable of generating 16 bits complementary Golay code (CGC), linear frequency modulated (LFM) chirp and 13-bit Barker code (BC) at 0.5 and 1 MHz center frequencies. Both in vivo data acquired from healthy heel bones and in vitro data obtained from human calcaneus were examined and the comparison between the results using coded excitation and two cycles sine burst is presented. It is shown that CGC system allows the effective range of frequencies employed in the measurement of broadband acoustic energy attenuation in the trabecular bone to be doubled in comparison to the standard 0.5 MHz pulse transmission. The algorithm used to calculate the pairs of Golay sequences of the different length, which provide the temporal side-lobe cancellation is also presented. Current efforts are focused on adapting the system developed for operation in pulse-echo mode; this would allow examination and diagnosis of bones with limited access such as hip bone.

  7. Mechanical Loading Attenuates Radiation-Induced Bone Loss in Bone Marrow Transplanted Mice

    PubMed Central

    Govey, Peter M.; Zhang, Yue; Donahue, Henry J.


    Exposure of bone to ionizing radiation, as occurs during radiotherapy for some localized malignancies and blood or bone marrow cancers, as well as during space travel, incites dose-dependent bone morbidity and increased fracture risk. Rapid trabecular and endosteal bone loss reflects acutely increased osteoclastic resorption as well as decreased bone formation due to depletion of osteoprogenitors. Because of this dysregulation of bone turnover, bone’s capacity to respond to a mechanical loading stimulus in the aftermath of irradiation is unknown. We employed a mouse model of total body irradiation and bone marrow transplantation simulating treatment of hematologic cancers, hypothesizing that compression loading would attenuate bone loss. Furthermore, we hypothesized that loading would upregulate donor cell presence in loaded tibias due to increased engraftment and proliferation. We lethally irradiated 16 female C57Bl/6J mice at age 16 wks with 10.75 Gy, then IV-injected 20 million GFP(+) total bone marrow cells. That same day, we initiated 3 wks compression loading (1200 cycles 5x/wk, 10 N) in the right tibia of 10 of these mice while 6 mice were irradiated, non-mechanically-loaded controls. As anticipated, before-and-after microCT scans demonstrated loss of trabecular bone (-48.2% Tb.BV/TV) and cortical thickness (-8.3%) at 3 wks following irradiation. However, loaded bones lost 31% less Tb.BV/TV and 8% less cortical thickness (both p<0.001). Loaded bones also had significant increases in trabecular thickness and tissue mineral densities from baseline. Mechanical loading did not affect donor cell engraftment. Importantly, these results demonstrate that both cortical and trabecular bone exposed to high-dose therapeutic radiation remain capable of an anabolic response to mechanical loading. These findings inform our management of bone health in cases of radiation exposure. PMID:27936104

  8. Curcumin attenuates gastric cancer induced by N-methyl-N-nitrosourea and saturated sodium chloride in rats.


    Sintara, Kawiya; Thong-Ngam, Duangporn; Patumraj, Suthiluk; Klaikeaw, Naruemon


    To determine effects of curcumin on N-methyl-N-nitrosourea (MNU) and saturated sodium chloride (s-NaCl)-induced gastric cancer in rats. Male Wistar rats were divided into 5 groups: control (CO), control supplemented with 200 mg/kg curcumin (CC), MNU + s-NaCl, MNU + s-NaCl supplemented with 200 mg/kg curcumin daily for the first 3 weeks (MNU + s-NaCl + C3W), and MNU + s-NaCl supplemented with curcumin for 20 weeks (MNU + s-NaCl + C20W). To induce stomach cancer, rats except for CO and CC were orally treated with 100 mg/kg MNU on day 0 and 14, and s-NaCl twice-a-week for the first 3 weeks. The experiment was finished and rats were sacrificed at the end of 20 weeks. Cancers were found in forestomachs of all rats in MNU + s-NaCl. The expressions of phosphorylated inhibitor kappaB alpha (phospho-IκBα), 8-hydroxy-2'-deoxyguanosine (8-OHdG), and cyclin D1 significantly increased in MNU + s-NaCl compared with CO. Curcumin treatments for 3 and 20 weeks reduced the cancer incidence resulting in a decrease of phospho-IκBα expression in benign tumor-bearing rats compared with MNU + s-NaCl. Curcumin treatment for 20 weeks also decreased 8-OHdG expression in benign tumor-bearing rats compared with MNU + s-NaCl. Curcumin can attenuate cancer via a reduction of phospho-IκBα and 8-OHdG expressions, which may play a promising role in gastric carcinogenesis.

  9. The Molecular Signature of the Stroma Response in Prostate Cancer-Induced Osteoblastic Bone Metastasis Highlights Expansion of Hematopoietic and Prostate Epithelial Stem Cell Niches

    PubMed Central

    Secondini, Chiara; Wetterwald, Antoinette; Schwaninger, Ruth; Fleischmann, Achim; Raffelsberger, Wolfgang; Poch, Olivier; Delorenzi, Mauro; Temanni, Ramzi; Mills, Ian G.; van der Pluijm, Gabri; Thalmann, George N.; Cecchini, Marco G.


    The reciprocal interaction between cancer cells and the tissue-specific stroma is critical for primary and metastatic tumor growth progression. Prostate cancer cells colonize preferentially bone (osteotropism), where they alter the physiological balance between osteoblast-mediated bone formation and osteoclast-mediated bone resorption, and elicit prevalently an osteoblastic response (osteoinduction). The molecular cues provided by osteoblasts for the survival and growth of bone metastatic prostate cancer cells are largely unknown. We exploited the sufficient divergence between human and mouse RNA sequences together with redefinition of highly species-specific gene arrays by computer-aided and experimental exclusion of cross-hybridizing oligonucleotide probes. This strategy allowed the dissection of the stroma (mouse) from the cancer cell (human) transcriptome in bone metastasis xenograft models of human osteoinductive prostate cancer cells (VCaP and C4-2B). As a result, we generated the osteoblastic bone metastasis-associated stroma transcriptome (OB-BMST). Subtraction of genes shared by inflammation, wound healing and desmoplastic responses, and by the tissue type-independent stroma responses to a variety of non-osteotropic and osteotropic primary cancers generated a curated gene signature (“Core” OB-BMST) putatively representing the bone marrow/bone-specific stroma response to prostate cancer-induced, osteoblastic bone metastasis. The expression pattern of three representative Core OB-BMST genes (PTN, EPHA3 and FSCN1) seems to confirm the bone specificity of this response. A robust induction of genes involved in osteogenesis and angiogenesis dominates both the OB-BMST and Core OB-BMST. This translates in an amplification of hematopoietic and, remarkably, prostate epithelial stem cell niche components that may function as a self-reinforcing bone metastatic niche providing a growth support specific for osteoinductive prostate cancer cells. The induction of this

  10. Measurement of the dispersion and attenuation of cylindrical ultrasonic guided waves in long bone.


    Ta, Dean; Wang, Weiqi; Wang, YuanYuan; Le, Lawrence H; Zhou, Yuqing


    Osteoporotic bones are likely to have less cortical bone than healthy bones. The velocities of guided waves propagating in a long cylindrical bone are very sensitive to bone properties and cortical thickness (CTh). This work studies the dispersion and attenuation of ultrasonic guided waves propagating in long cylindrical bone. A hollow cylinder filled with a viscous liquid was used to model the long bone and then to calculate the theoretical phase and group velocities, as well as the attenuation of the waves. The generation and selection of guided wave modes were based on theoretical dispersive curves. The phase velocity and attenuation of cylindrical guided wave modes, such as L(0,1), L(0,2) and L(0,3), were measured in bovine tibia using angled beam transducers at various propagation distances ranging from 75 to 160 mm. The results showed that the phase velocity of the L(0,2) guided wave mode decreased with an increase in CTh. The attenuation of the low cylindrical guided wave modes was a nonlinear function that increased with propagation distance and mode order. The L(0,2) mode had a different attenuation for each CTh. The experimental results were in good agreement with the predicted values. Cylindrical guided waves of low-frequency and low-order have been shown to demonstrate more dispersion and less attenuation and should, therefore, be used to evaluate long bone.

  11. Emerging therapeutic targets in cancer induced bone disease: A focus on the peripheral type 2 cannabinoid receptor.


    Marino, Silvia; Idris, Aymen I


    Skeletal complications are a common cause of morbidity in patients with primary bone cancer and bone metastases. The type 2 cannabinoid (Cnr2) receptor is implicated in cancer, bone metabolism and pain perception. Emerging data have uncovered the role of Cnr2 in the regulation of tumour-bone cell interactions and suggest that agents that target Cnr2 in the skeleton have potential efficacy in the reduction of skeletal complications associated with cancer. This review aims to provide an overview of findings relating to the role of Cnr2 receptor in the regulation of skeletal tumour growth, osteolysis and bone pain, and highlights the many unanswered questions and unmet needs. This review argues that development and testing of peripherally-acting, tumour-, Cnr2-selective ligands in preclinical models of metastatic cancer will pave the way for future research that will advance our knowledge about the basic mechanism(s) by which the endocannabinoid system regulate cancer metastasis, stimulate the development of a safer cannabis-based therapy for the treatment of cancer and provide policy makers with powerful tools to assess the science and therapeutic potential of cannabinoid-based therapy. Thus, offering the prospect of identifying selective Cnr2 ligands, as novel, alternative to cannabis herbal extracts for the treatment of advanced cancer patients.

  12. Minocycline-induced reduction of brain-derived neurotrophic factor expression in relation to cancer-induced bone pain in rats.


    Wang, Li-Na; Yang, Jian-Ping; Zhan, Ying; Ji, Fu-Hai; Wang, Xiu-Yun; Zuo, Jian-Ling; Xu, Qi-Nian


    Previous studies have suggested that the release of brain-derived neurotrophic factor (BDNF) from microglia in spinal cord is necessary for maintaining pain hypersensitivity after nerve injury. However, little is known about its role in cancer-induced bone pain (CIBP), which is in some ways unique. This study demonstrates a critical role of minocycline (a potent inhibitor of microglial activation)-modulated BDNF in the induction and maintenance of behavioral hypersensitivity in a rat model of CIBP. We assessed mechanical threshold and spontaneous pain of CIBP rats. Moreover, minocycline was administered intrathecally from day 4 to day 6 (early stage) or from day 10 to day 12 (later stage), after carcinoma cell inoculation. Real-time PCR, Western blots, and double immunofluorescence were used to detect the expression of OX-42 (marker of activated microglia), phosphorylated p38-MAPK (p-p38), and BDNF. We found that intrathecal minocycline could prevent CIBP at an early stage of tumor growth (from day 4 to day 6). However, at the late stage (from day 10 to day 12), intrathecal minocycline had no effect. Moreover, the expression of OX-42 and BDNF under CIBP, peaking on day 6, were all reduced after minocycline injection from day 4 to day 6. The ability of minocycline-induced reduction of BDNF in the induction of behavioral hypersensitivity could provide an opportunity for alleviating CIBP.

  13. P2Y12 receptor-mediated activation of spinal microglia and p38MAPK pathway contribute to cancer-induced bone pain

    PubMed Central

    Liu, Mingjuan; Yao, Ming; Wang, Hanqi; Xu, Longsheng; Zheng, Ying; Huang, Bing; Ni, Huadong; Xu, Shijie; Zhou, Xuyan; Lian, Qingquan


    Background Cancer-induced bone pain (CIBP) is one of the most challenging clinical problems due to a lack of understanding the mechanisms. Recent evidence has demonstrated that activation of microglial G-protein-coupled P2Y12 receptor (P2Y12R) and proinflammatory cytokine production play an important role in neuropathic pain generation and maintenance. However, whether P2Y12R is involved in CIBP remains unknown. Methods The purpose of this study was to investigate the role of P2Y12R in CIBP and its molecular mechanisms. Using the bone cancer model inoculated with Walker 256 tumor cells into the left tibia of Sprague Dawley rat, we blocked spinal P2Y12R through intrathecal administration of its selective antagonist MRS2395 (400 pmol/µL, 15 µL). Results We found that not only the ionized calcium-binding adapter molecule 1 (Iba-1)-positive microglia in the ipsilateral spinal cord but also mechanical allodynia was significantly inhibited. Furthermore, it decreased the phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK) and the production of proinflammatory cytokines interleukin-1β (IL-1β) and interleukin-6 (IL-6), whereas it increased tumor necrosis factor-α (TNF-α). Conclusion Taken together, our present results suggest that microglial P2Y12R in the spinal cord may contribute to CIBP by the activation of spinal microglia and p38MAPK pathway, thus identifying a potential therapeutic target for the treatment of CIBP. PMID:28243146

  14. Accuracy of CT-based attenuation correction in PET/CT bone imaging.


    Abella, Monica; Alessio, Adam M; Mankoff, David A; MacDonald, Lawrence R; Vaquero, Juan Jose; Desco, Manuel; Kinahan, Paul E


    We evaluate the accuracy of scaling CT images for attenuation correction of PET data measured for bone. While the standard tri-linear approach has been well tested for soft tissues, the impact of CT-based attenuation correction on the accuracy of tracer uptake in bone has not been reported in detail. We measured the accuracy of attenuation coefficients of bovine femur segments and patient data using a tri-linear method applied to CT images obtained at different kVp settings. Attenuation values at 511 keV obtained with a (68)Ga/(68)Ge transmission scan were used as a reference standard. The impact of inaccurate attenuation images on PET standardized uptake values (SUVs) was then evaluated using simulated emission images and emission images from five patients with elevated levels of FDG uptake in bone at disease sites. The CT-based linear attenuation images of the bovine femur segments underestimated the true values by 2.9 ± 0.3% for cancellous bone regardless of kVp. For compact bone the underestimation ranged from 1.3% at 140 kVp to 14.1% at 80 kVp. In the patient scans at 140 kVp the underestimation was approximately 2% averaged over all bony regions. The sensitivity analysis indicated that errors in PET SUVs in bone are approximately proportional to errors in the estimated attenuation coefficients for the same regions. The variability in SUV bias also increased approximately linearly with the error in linear attenuation coefficients. These results suggest that bias in bone uptake SUVs of PET tracers ranges from 2.4% to 5.9% when using CT scans at 140 and 120 kVp for attenuation correction. Lower kVp scans have the potential for considerably more error in dense bone. This bias is present in any PET tracer with bone uptake but may be clinically insignificant for many imaging tasks. However, errors from CT-based attenuation correction methods should be carefully evaluated if quantitation of tracer uptake in bone is important.

  15. Accuracy of CT-Based Attenuation Correction in PET/CT Bone Imaging

    PubMed Central

    Abella, Monica; Alessio, Adam M.; Mankoff, David A.; MacDonald, Lawrence R.; Vaquero, Juan Jose; Desco, Manuel; Kinahan, Paul E.


    We evaluate the accuracy of scaling CT images for attenuation correction of PET data measured for bone. While the standard tri-linear approach has been well-tested for soft tissues, the impact of CT-based attenuation correction on the accuracy of tracer uptake in bone has not been reported in detail. We measured the accuracy of attenuation coefficients of bovine femur segments and patient data using a tri-linear method applied to CT images obtained at different kVp settings. Attenuation values at 511 keV obtained with a 68Ga/68Ge transmission scan were used as a reference standard. The impact of inaccurate attenuation images on PET standardized uptake values (SUVs) was then evaluated using simulated emission images and emission images from five patients with elevated levels of FDG uptake in bone at disease sites. The CT-based linear attenuation images of the bovine femur segments underestimated the true values by 2.9±0.3% for cancellous bone regardless of kVp. For compact bone the underestimation ranged from 1.3% at 140 kVp to 14.1% at 80 kVp. In the patient scans at 140 kVp the underestimation was approximately 2% averaged over all bony regions. The sensitivity analysis indicated that errors in PET SUVs in bone are approximately proportional to errors in the estimated attenuation coefficients for the same regions. The variability in SUV bias also increased approximately linearly with the error in linear attenuation coefficients. These results suggest that bias in bone uptake SUVs of PET tracers range from 2.4% to 5.9% when using CT scans at 140 and 120 kVp for attenuation correction. Lower kVp scans have the potential for considerably more error in dense bone. This bias is present in any PET tracer with bone uptake but may be clinically insignificant for many imaging tasks. However, errors from CT-based attenuation correction methods should be carefully evaluated if quantitation of tracer uptake in bone is important. PMID:22481547

  16. The Extravehicular Suit Impact Load Attenuation Study for Use in Astronaut Bone Fracture Prediction

    NASA Technical Reports Server (NTRS)

    Lewandowski, Beth E.; Gilkey, Kelly M.; Sulkowski, Christina M.; Samorezov, Sergey; Myers, Jerry G.


    The NASA Integrated Medical Model (IMM) assesses the risk, including likelihood and impact of occurrence, of all credible in-flight medical conditions. Fracture of the proximal femur is a traumatic injury that would likely result in loss of mission if it were to happen during spaceflight. The low gravity exposure causes decreases in bone mineral density which heightens the concern. Researchers at the NASA Glenn Research Center have quantified bone fracture probability during spaceflight with a probabilistic model. It was assumed that a pressurized extravehicular activity (EVA) suit would attenuate load during a fall, but no supporting data was available. The suit impact load attenuation study was performed to collect analogous data. METHODS: A pressurized EVA suit analog test bed was used to study how the offset, defined as the gap between the suit and the astronaut s body, impact load magnitude and suit operating pressure affects the attenuation of impact load. The attenuation data was incorporated into the probabilistic model of bone fracture as a function of these factors, replacing a load attenuation value based on commercial hip protectors. RESULTS: Load attenuation was more dependent on offset than on pressurization or load magnitude, especially at small offsets. Load attenuation factors for offsets between 0.1 - 1.5 cm were 0.69 +/- 0.15, 0.49 +/- 0.22 and 0.35 +/- 0.18 for mean impact forces of 4827, 6400 and 8467 N, respectively. Load attenuation factors for offsets of 2.8 - 5.3 cm were 0.93 +/- 0.2, 0.94 +/- 0.1 and 0.84 +/- 0.5, for the same mean impact forces. Reductions were observed in the 95th percentile confidence interval of the bone fracture probability predictions. CONCLUSIONS: The reduction in uncertainty and improved confidence in bone fracture predictions increased the fidelity and credibility of the fracture risk model and its benefit to mission design and operational decisions.

  17. Connexin 43 deficiency attenuates loss of trabecular bone and prevents suppression of cortical bone formation during unloading.


    Lloyd, Shane A; Lewis, Gregory S; Zhang, Yue; Paul, Emmanuel M; Donahue, Henry J


    Connexin 43 (Cx43) is the most abundant gap junction protein in bone and has been demonstrated as an integral component of skeletal homeostasis. In the present study, we sought to further refine the role of Cx43 in the response to mechanical unloading by subjecting skeletally mature mice with a bone-specific deletion of Cx43 (cKO) to 3 weeks of mechanical unloading via hindlimb suspension (HLS). The HLS model was selected to recapitulate the effects of skeletal unloading due to prolonged bed rest, reduced activity associated with aging, and spaceflight microgravity. At baseline, the cortical bone of cKO mice displayed an osteopenic phenotype, with expanded cortices, decreased cortical thickness, decreased bone mineral density, and increased porosity. There was no baseline trabecular phenotype. After 3 weeks of HLS, wild-type (WT) mice experienced a substantial decline in trabecular bone volume fraction, connectivity density, trabecular thickness, and trabecular tissue mineral density. These deleterious effects were attenuated in cKO mice. Conversely, there was a similar and significant amount of cortical bone loss in both WT and cKO. Interestingly, mechanical testing revealed a greater loss of strength and rigidity for cKO during HLS. Analysis of double-label quantitative histomorphometry data demonstrated a substantial decrease in bone formation rate, mineralizing surface, and mineral apposition rate at both the periosteal and endocortical surfaces of the femur after unloading of WT mice. This suppression of bone formation was not observed in cKO mice, in which parameters were maintained at baseline levels. Taken together, the results of the present study indicate that Cx43 deficiency desensitizes bone to the effects of mechanical unloading, and that this may be due to an inability of mechanosensing osteocytes to effectively communicate the unloading state to osteoblasts to suppress bone formation. Cx43 may represent a novel therapeutic target for investigation as

  18. Numerical and experimental study on the wave attenuation in bone--FDTD simulation of ultrasound propagation in cancellous bone.


    Nagatani, Yoshiki; Mizuno, Katsunori; Saeki, Takashi; Matsukawa, Mami; Sakaguchi, Takefumi; Hosoi, Hiroshi


    In cancellous bone, longitudinal waves often separate into fast and slow waves depending on the alignment of bone trabeculae in the propagation path. This interesting phenomenon becomes an effective tool for the diagnosis of osteoporosis because wave propagation behavior depends on the bone structure. Since the fast wave mainly propagates in trabeculae, this wave is considered to reflect the structure of trabeculae. For a new diagnosis method using the information of this fast wave, therefore, it is necessary to understand the generation mechanism and propagation behavior precisely. In this study, the generation process of fast wave was examined by numerical simulations using elastic finite-difference time-domain (FDTD) method and experimental measurements. As simulation models, three-dimensional X-ray computer tomography (CT) data of actual bone samples were used. Simulation and experimental results showed that the attenuation of fast wave was always higher in the early state of propagation, and they gradually decreased as the wave propagated in bone. This phenomenon is supposed to come from the complicated propagating paths of fast waves in cancellous bone.

  19. Numerical investigation of ultrasonic attenuation through 2D trabecular bone structures reconstructed from CT scans and random realizations.


    Gilbert, Robert P; Guyenne, Philippe; Li, Jing


    In this paper, we compare ultrasound interrogations of actual CT-scanned images of trabecular bone with artificial randomly constructed bone. Even though it is known that actual bone does not have randomly distributed trabeculae, we find that the ultrasound attenuations are close enough to cast doubt on any microstructural information, such as trabeculae width and distance between trabeculae, being gleaned from such experiments. More precisely, we perform numerical simulations of ultrasound interrogation on cancellous bone to investigate the phenomenon of ultrasound attenuation as a function of excitation frequency and bone porosity. The theoretical model is based on acoustic propagation equations for a composite fluid-solid material and is solved by a staggered-grid finite-difference scheme in the time domain. Numerical experiments are performed on two-dimensional bone samples reconstructed from CT-scanned images of real human calcaneus and from random distributions of fluid-solid particles generated via the turning bands method. A detailed comparison is performed on various parameters such as the attenuation rate and speed of sound through the bone samples as well as the normalized broadband ultrasound attenuation coefficient. Comparing results from these two types of bone samples allows us to assess the role of bone microstructure in ultrasound attenuation. It is found that the random model provides suitable bone samples for ultrasound interrogation in the transverse direction of the trabecular network.

  20. Klotho preservation via histone deacetylase inhibition attenuates chronic kidney disease-associated bone injury in mice

    PubMed Central

    Lin, Wenjun; Li, Yanning; chen, Fang; Yin, Shasha; Liu, Zhihong; Cao, Wangsen


    Bone loss and increased fracture are the devastating outcomes of chronic kidney disease-mineral and bone disorder (CKD-MBD) resulting from Klotho deficit-related mineral disturbance and hyperparathyroidism. Because Klotho down-regulation after renal injury is presumably affected by aberrant histone deacetylase (HDAC) activities, here we assess whether HDAC inhibition prevents Klotho loss and attenuates the CKD-associated bone complication in a mouse model of CKD-MBD. Mice fed adenine-containing diet developed the expected renal damage, a substantial Klotho loss and the deregulated key factors causally affecting bone remodeling, which were accompanied by a marked reduction of bone mineral density. Intriguingly, administration of a potent HDAC inhibitor trichostatin A (TSA) impressively alleviated the Klotho deficit and the observed alterations of serum, kidney and bone. TSA prevented Klotho loss by increasing the promoter-associated histone acetylation, therefore increasing Klotho transcription. More importantly the mice lacking Klotho by siRNA interference largely abolished the TSA protections against the serum and renal abnormalities, and the deranged bone micro-architectures. Thus, our study identified Klotho loss as a key event linking HDAC deregulation to the renal and bone injuries in CKD-MBD mice and demonstrated the therapeutic potentials of endogenous Klotho restoration by HDAC inhibition in treating CKD and the associated extrarenal complications. PMID:28387374

  1. Determining attenuation properties of interfering fast and slow ultrasonic waves in cancellous bone.


    Nelson, Amber M; Hoffman, Joseph J; Anderson, Christian C; Holland, Mark R; Nagatani, Yoshiki; Mizuno, Katsunori; Matsukawa, Mami; Miller, James G


    Previous studies have shown that interference between fast waves and slow waves can lead to observed negative dispersion in cancellous bone. In this study, the effects of overlapping fast and slow waves on measurements of the apparent attenuation as a function of propagation distance are investigated along with methods of analysis used to determine the attenuation properties. Two methods are applied to simulated data that were generated based on experimentally acquired signals taken from a bovine specimen. The first method uses a time-domain approach that was dictated by constraints imposed by the partial overlap of fast and slow waves. The second method uses a frequency-domain log-spectral subtraction technique on the separated fast and slow waves. Applying the time-domain analysis to the broadband data yields apparent attenuation behavior that is larger in the early stages of propagation and decreases as the wave travels deeper. In contrast, performing frequency-domain analysis on the separated fast waves and slow waves results in attenuation coefficients that are independent of propagation distance. Results suggest that features arising from the analysis of overlapping two-mode data may represent an alternate explanation for the previously reported apparent dependence on propagation distance of the attenuation coefficient of cancellous bone.

  2. Treatment with resveratrol attenuates sublesional bone loss in spinal cord-injured rats

    PubMed Central

    Wang, Hua-Dong; Shi, Ya-Min; Li, Li; Guo, Ji-Dong; Zhang, Yu-Peng; Hou, Shu-Xun


    BACKGROUND AND PURPOSE Sublesional osteoporosis predisposes individuals with spinal cord injury (SCI) to an increased risk of low-trauma fracture. The aim of the present work was to investigate the effect of treatment with resveratrol (RES) on sublesional bone loss in spinal cord-injured rats. EXPERIMENTAL APPROACH Complete SCI was generated by surgical transaction of the cord at the T10–12 level. Treatment with RES (400 mg·kg−1 body mass per day−1, intragastrically) was initiated 12 h after the surgery for 10 days. Then, blood was collected and femurs and tibiae were removed for evaluation of the effects of RES on bone tissue after SCI. KEY RESULTS Treatment of SCI rats with RES prevented the reduction of bone mass including bone mineral content and bone mineral density in tibiae, preserved bone structure including trabecular bone volume fraction, trabecular number, and trabecular thickness in tibiae, and preserved mechanical strength including ultimate load, stiffness, and energy in femurs. Treatment of SCI rats with RES enhanced femoral total sulfhydryl content, reduced femoral malondialdehyde and IL-6 mRNA levels. Treatment of SCI rats with RES suppressed the up-regulation of mRNA levels of PPARγ, adipose-specific fatty-acid-binding protein and lipoprotein lipase, and restored mRNA levels of Wnt1, low-density lipoprotein-related protein 5, Axin2, ctnnb1, insulin-like growth factor 1 (IGF-1) and receptor for IGF-1 in femurs and tibiae. CONCLUSIONS AND IMPLICATIONS Treatment with RES attenuated sublesional bone loss in spinal-cord-injured rats, associated with abating oxidative stress, attenuating inflammation, depressing PPARγ signalling, and restoring Wnt/β-catenin and IGF-1 signalling. PMID:23848300

  3. Anthropometric and fitness variables associated with bone mineral density and broadband ultrasound attenuation in ambulatory children with cerebral palsy.


    Chen, Chia-ling; Ke, Jyh-yuh; Lin, Keh-chung; Wang, Chao-jan; Wu, Ching-yi; Liu, Wen-yu


    We investigated anthropometric and fitness variables associated with areal bone mineral densities and broadband ultrasound attenuation in ambulatory children with cerebral palsy. Thirty-four children with cerebral palsy, aged 4-12 years, and 33 normal development children were collected. There were significant differences in femoral bone densities and calcaneus broadband ultrasound attenuation, but not in lumbar bone densities, between cerebral palsy and normal groups. Regression analysis revealed that different anthropometric and fitness variables were linked to bone densities of different skeletal regions in children with cerebral palsy (adjusted r(2) = .41-.67). Growth variables were mainly related to femoral and lumbar bone densities, while muscular endurance was mainly related to femoral and calcaneus bone densities. These findings suggest multiple complex variables can contribute to bone density variations among different skeleton areas in these children. These data can allow clinicians to identifying early these children at risk for low bone density.

  4. Secreted frizzled-related protein 1 modulates glucocorticoid attenuation of osteogenic activities and bone mass.


    Wang, Feng-Sheng; Lin, Chun-Liang; Chen, Yeung-Jen; Wang, Ching-Jen; Yang, Kuender D; Huang, Yu-Ting; Sun, Yi-Chih; Huang, Hui-Chen


    Prolonged glucocorticoid treatment is known to cause osteoporosis or aseptic necrosis. Secreted frizzled-related proteins 1 (SFRP1) and low-density lipoprotein-related protein 5 (LRP5), a Wnt protein antagonist and a coreceptor, have been found to regulate skeletogenesis. Whereas recent studies have reported that excess glucocorticoid promotes bone loss, the biological role of SFRP1 and LRP5 in regulating glucocorticoid attenuation of bone formation is not fully understood. We showed that a supraphysiological level of glucocorticoid enhanced SFRP1 but not LRP5 expression of primary mesenchymal cell cultures in vitro and osteoblasts at metaphyseal trabecular endosteum and chondrocytes at calcified cartilage in vivo. Glucocorticoid augmentation of SFRP1 expression was transcriptionally mediated. The inhibitory action of glucocorticoid on osteogenic differentiation appeared to be regulated by SFRP1 mediation of beta-catenin destabilization because knocking down SFRP1 by RNA interference abrogated the supraphysiological level of glucocorticoid attenuation of osteogenesis. Recombinant human SFRP1 reduced the promoting effect of physiological level of glucocorticoid on cytosolic beta-catenin accumulation, runt-related transcription factor-2 activation, and osteogenic activities. Glucocorticoid and recombinant human SFRP1 significantly increased osteochondral cell apoptosis associated with reduced mineral density, biomechanical properties, trabecular bone volume, and midshaft cortical bone areas in rat femurs. These findings suggest that SFRP1 modulates glucocorticoid-induced bone loss. Regulation of Wnt/SFRP signal transduction can be used in the future as an alternative strategy for the prevention of glucocorticoid-induced osteoporosis.

  5. Impacts of anti-nerve growth factor antibody on pain-related behaviors and expressions of opioid receptor in spinal dorsal horn and dorsal root ganglia of rats with cancer-induced bone pain

    PubMed Central

    Ding, Yuanyuan; Wang, Zhibin; Ma, Jiaming; Hong, Tao; Zhu, Yongqiang; Li, Hongxi; Pan, Shinong


    Objective To investigate the impacts of anti-nerve growth factor antibody on pain-related behaviors and expressions of μ-opioid receptor in spinal dorsal horn and dorsal root ganglia of rats with cancer-induced bone pain. Methods The rats were randomly grouped and then injected with 10 μl of phosphate buffer saline or Walker256 tumor cells into the upper segment of left tibia. Thirteen days after the injection, the intrathecal catheterization was performed, followed by the injection of saline, anti-nerve growth factor, nerve growth factor, and naloxone twice a day. The pain ethological changes were measured at the set time points; the expression changes of μ-opioid receptor protein and mRNA in spinal dorsal horn and dorsal root ganglia were detected on the 18th day. Results After the tumor cells were injected into the tibia, hyperalgesia appeared and the expression of μ-opioid receptor protein and mRNA in spinal dorsal horn and dorsal root ganglia was increased, compared with the sham group; after intrathecally injected anti-nerve growth factor, the significant antinociceptive effects appeared, and the μ-opioid receptor expression was increased, compared with the cancer pain group; the μ-opioid receptor expressions in the other groups showed no statistical significance. The naloxone pretreatment could mostly inverse the antinociception effects of anti-nerve growth factor. Conclusions Anti-nerve growth factor could reduce hyperalgesia in the cancer-induced bone pain rats, and the antinociceptive effects were related with the upregulation of μ-opioid receptor. PMID:27118770

  6. Hearing protection: Surpassing the limits to attenuation imposed by the bone-conduction pathways

    NASA Astrophysics Data System (ADS)

    Berger, Elliott H.; Kieper, Ronald W.; Gauger, Dan


    With louder and louder weapon systems being developed and military personnel being exposed to steady noise levels approaching and sometimes exceeding 150 dB, a growing interest in greater amounts of hearing protection is evident. When the need for communications is included in the equation, the situation is even more extreme. New initiatives are underway to design improved hearing protection, including active noise reduction (ANR) earplugs and perhaps even active cancellation of head-borne vibration. With that in mind it may be useful to explore the limits to attenuation, and whether they can be approached with existing technology. Data on the noise reduction achievable with high-attenuation foam earplugs, as a function of insertion depth, will be reported. Previous studies will be reviewed that provide indications of the bone-conduction (BC) limits to attenuation that, in terms of mean values, range from 40 to 60 dB across the frequencies from 125 Hz to 8 kHz. Additionally, new research on the effects of a flight helmet on the BC limits, as well as the potential attenuation from deeply inserted passive foam earplugs, worn with passive earmuffs, or with active-noise reduction (ANR) earmuffs, will be examined. The data demonstrate that gains in attenuation exceeding 10 dB above the head-not-covered limits can be achieved if the head is effectively shielded from acoustical stimulation.

  7. Hearing protection: surpassing the limits to attenuation imposed by the bone-conduction pathways.


    Berger, Elliott H; Kieper, Ronald W; Gauger, Dan


    With louder and louder weapon systems being developed and military personnel being exposed to steady noise levels approaching and sometimes exceeding 150 dB, a growing interest in greater amounts of hearing protection is evident. When the need for communications is included in the equation, the situation is even more extreme. New initiatives are underway to design improved hearing protection, including active noise reduction (ANR) earplugs and perhaps even active cancellation of head-borne vibration. With that in mind it may be useful to explore the limits to attenuation, and whether they can be approached with existing technology. Data on the noise reduction achievable with high-attenuation foam earplugs, as a function of insertion depth, will be reported. Previous studies will be reviewed that provide indications of the bone-conduction (BC) limits to attenuation that, in terms of mean values, range from 40 to 60 dB across the frequencies from 125 Hz to 8 kHz. Additionally, new research on the effects of a flight helmet on the BC limits, as well as the potential attenuation from deeply inserted passive foam earplugs, worn with passive earmuffs, or with active-noise reduction (ANR) earmuffs, will be examined. The data demonstrate that gains in attenuation exceeding 10 dB above the head-not-covered limits can be achieved if the head is effectively shielded from acoustical stimulation.

  8. PPARγ antagonist attenuates mouse immune-mediated bone marrow failure by inhibition of T cell function

    PubMed Central

    Sato, Kazuya; Feng, Xingmin; Chen, Jichun; Li, Jungang; Muranski, Pawel; Desierto, Marie J.; Keyvanfar, Keyvan; Malide, Daniela; Kajigaya, Sachiko; Young, Neal S.


    Acquired aplastic anemia is an immune-mediated disease, in which T cells target hematopoietic cells; at presentation, the bone marrow is replaced by fat. It was reported that bone marrow adipocytes were negative regulators of hematopoietic microenvironment. To examine the role of adipocytes in bone marrow failure, we investigated peroxisomal proliferator-activated receptor gamma, a key transcription factor in adipogenesis, utilizing an antagonist of this factor called bisphenol-A-diglycidyl-ether. While bisphenol-A-diglycidyl-ether inhibited adipogenesis as expected, it also suppressed T cell infiltration of bone marrow, reduced plasma inflammatory cytokines, decreased expression of multiple inflammasome genes, and ameliorated marrow failure. In vitro, bisphenol-A-diglycidyl-ether suppressed activation and proliferation, and reduced phospholipase C gamma 1 and nuclear factor of activated T-cells 1 expression, as well as inhibiting calcium flux in T cells. The in vivo effect of bisphenol-A-diglycidyl-ether on T cells was confirmed in a second immune-mediated bone marrow failure model, using different strains and non-major histocompatibility antigen mismatched: bisphenol-A-diglycidyl-ether ameliorated marrow failure by inhibition of T cell infiltration of bone marrow. Our data indicate that peroxisomal proliferator-activated receptor gamma antagonists may attenuate murine immune-mediated bone marrow failure, at least in part, by suppression of T cell activation, which might hold implications in the application of peroxisomal proliferator-activated receptor gamma antagonists in immune-mediated pathophysiologies, both in the laboratory and in the clinic. Genetically “fatless” mice developed bone marrow failure with accumulation of marrow adipocytes in our model, even in the absence of body fat, suggesting different mechanisms of systematic and marrow adipogenesis and physiologic versus pathophysiologic fat accumulation. PMID:26589913

  9. PPARγ antagonist attenuates mouse immune-mediated bone marrow failure by inhibition of T cell function.


    Sato, Kazuya; Feng, Xingmin; Chen, Jichun; Li, Jungang; Muranski, Pawel; Desierto, Marie J; Keyvanfar, Keyvan; Malide, Daniela; Kajigaya, Sachiko; Young, Neal S


    Acquired aplastic anemia is an immune-mediated disease, in which T cells target hematopoietic cells; at presentation, the bone marrow is replaced by fat. It was reported that bone marrow adipocytes were negative regulators of hematopoietic microenvironment. To examine the role of adipocytes in bone marrow failure, we investigated peroxisomal proliferator-activated receptor gamma, a key transcription factor in adipogenesis, utilizing an antagonist of this factor called bisphenol-A-diglycidyl-ether. While bisphenol-A-diglycidyl-ether inhibited adipogenesis as expected, it also suppressed T cell infiltration of bone marrow, reduced plasma inflammatory cytokines, decreased expression of multiple inflammasome genes, and ameliorated marrow failure. In vitro, bisphenol-A-diglycidyl-ether suppressed activation and proliferation, and reduced phospholipase C gamma 1 and nuclear factor of activated T-cells 1 expression, as well as inhibiting calcium flux in T cells. The in vivo effect of bisphenol-A-diglycidyl-ether on T cells was confirmed in a second immune-mediated bone marrow failure model, using different strains and non-major histocompatibility antigen mismatched: bisphenol-A-diglycidyl-ether ameliorated marrow failure by inhibition of T cell infiltration of bone marrow. Our data indicate that peroxisomal proliferator-activated receptor gamma antagonists may attenuate murine immune-mediated bone marrow failure, at least in part, by suppression of T cell activation, which might hold implications in the application of peroxisomal proliferator-activated receptor gamma antagonists in immune-mediated pathophysiologies, both in the laboratory and in the clinic. Genetically "fatless" mice developed bone marrow failure with accumulation of marrow adipocytes in our model, even in the absence of body fat, suggesting different mechanisms of systematic and marrow adipogenesis and physiologic versus pathophysiologic fat accumulation.

  10. Investigation of the influence of reflection on the attenuation of cancellous bone.


    Klinge, Sandra; Hackl, Klaus; Gilbert, Robert P


    The model proposed in this paper is based on the fact that the reflection might have a significant contribution to the attenuation of the acoustic waves propagating through the cancellous bone. The numerical implementation of the mentioned effect is realized by the development of a new representative volume element that includes an infinitesimally thin 'transient' layer on the contact surface of the bone and the marrow. This layer serves to model the amplitude transformation of the incident wave by the transition through media with different acoustic impedances and to take into account the energy loss due to the reflection. The proposed representative volume element together with the multiscale finite element is used to simulate the wave propagation and to evaluate the attenuation coefficient for samples with different effective densities in the dependence of the applied excitation frequency. The obtained numerical values show a very good agreement with the experimental results. Moreover, the model enables the determination of the upper and the lower bound for the attenuation coefficient.

  11. Oncolytic virotherapy for human bone and soft tissue sarcomas using live attenuated poliovirus.


    Atsumi, Satoru; Matsumine, Akihiko; Toyoda, Hidemi; Niimi, Rui; Iino, Takahiro; Nakamura, Tomoki; Matsubara, Takao; Asanuma, Kunihiro; Komada, Yoshihiro; Uchida, Atsumasa; Sudo, Akihiro


    The poliovirus receptor CD155, is essential for poliovirus to infect and induce death in neural cells. Recently, CD155 has been shown to be selectively expressed on certain types of tumor cells originating from the neural crest, including malignant glioma and neuroblastoma. However, the expression pattern of CD155 in soft tissue sarcoma has not been examined. Therefore, we first examined CD155 expression in sarcoma cell lines, and found the expression of both CD155 mRNA and protein in 12 soft and bone tissue sarcoma cell lines. Furthermore, we examined the effect of live attenuated poliovirus (LAPV) on 6 bone and soft tissue sarcoma cell lines in vitro, and found that LAPV induced apoptosis by activating caspases 7 and 3 in all of these cell lines. Furthermore, in BALB/c nu/nu mice xenotransplanted with HT1080 fibrosarcoma cells, administration of live attenuated poliovirus caused growth suppression of the tumors. These results suggest that oncolytic therapy using a LAPV may represent a new option for the treatment of bone and soft tissue sarcomas.

  12. Attenuated Human Bone Morphogenetic Protein-2–Mediated Bone Regeneration in a Rat Model of Composite Bone and Muscle Injury

    PubMed Central

    Li, Mon-Tzu A.; Uhrig, Brent A.; Boerckel, Joel David; Huebsch, Nathaniel; Lundgren, Taran L.; Warren, Gordon L.; Guldberg, Robert E.


    Extremity injuries involving large bone defects with concomitant severe muscle damage are a significant clinical challenge often requiring multiple treatment procedures and possible amputation. Even if limb salvage is achieved, patients are typically left with severe short- and long-term disabilities. Current preclinical animal models do not adequately mimic the severity, complexity, and loss of limb function characteristic of these composite injuries. The objectives of this study were to establish a composite injury model that combines a critically sized segmental bone defect with an adjacent volumetric muscle loss injury, and then use this model to quantitatively assess human bone morphogenetic protein-2 (rhBMP-2)–mediated tissue regeneration and restoration of limb function. Surgeries were performed on rats in three experimental groups: muscle injury (8-mm-diameter full-thickness defect in the quadriceps), bone injury (8-mm nonhealing defect in the femur), or composite injury combining the bone and muscle defects. Bone defects were treated with 2 μg of rhBMP-2 delivered in the pregelled alginate injected into a cylindrical perforated nanofiber mesh. Bone regeneration was quantitatively assessed using microcomputed tomography, and limb function was assessed using gait analysis and muscle strength measurements. At 12 weeks postsurgery, treated bone defects without volumetric muscle loss were consistently bridged. In contrast, the volume and mechanical strength of regenerated bone were attenuated by 45% and 58%, respectively, in the identically treated composite injury group. At the same time point, normalized muscle strength was reduced by 51% in the composite injury group compared to either single injury group. At 2 weeks, the gait function was impaired in all injury groups compared to baseline with the composite injury group displaying the greatest functional deficit. We conclude that sustained delivery of rhBMP-2 at a dose sufficient to induce bridging of

  13. Human bone marrow mesenchymal stem cell transplantation attenuates axonal injury in stroke rats

    PubMed Central

    Xu, Yi; Du, Shiwei; Yu, Xinguang; Han, Xiao; Hou, Jincai; Guo, Hao


    Previous studies have shown that transplantation of human bone marrow mesenchymal stem cells promotes neural functional recovery after stroke, but the neurorestorative mechanisms remain largely unknown. We hypothesized that functional recovery of myelinated axons may be one of underlying mechanisms. In this study, an ischemia/reperfusion rat model was established using the middle cerebral artery occlusion method. Rats were used to test the hypothesis that intravenous transplantation of human bone marrow mesenchymal stem cells through the femoral vein could exert neuroprotective effects against cerebral ischemia via a mechanism associated with the ability to attenuate axonal injury. The results of behavioral tests, infarction volume analysis and immunohistochemistry showed that cerebral ischemia caused severe damage to the myelin sheath and axons. After rats were intravenously transplanted with human bone marrow mesenchymal stem cells, the levels of axon and myelin sheath-related proteins, including microtubule-associated protein 2, myelin basic protein, and growth-associated protein 43, were elevated, infarct volume was decreased and neural function was improved in cerebral ischemic rats. These findings suggest that intravenously transplanted human bone marrow mesenchymal stem cells promote neural function. Possible mechanisms underlying these beneficial effects include resistance to demyelination after cerebral ischemia, prevention of axonal degeneration, and promotion of axonal regeneration. PMID:25657721

  14. Treatment with recombinant lubricin attenuates osteoarthritis by positive feedback loop between articular cartilage and subchondral bone in ovariectomized rats.


    Cui, Zhuang; Xu, Changpeng; Li, Xue; Song, Jinqi; Yu, Bin


    Osteoarthritis (OA) is a most commonly multifactorial degenerative joint disease along with the aging population, particularly in postmenopausal women. During the onset of OA, articular cartilage and subchondral bone act in concert as a functional unit. This present study is to investigate the effects of early or late treatment with recombinant lubricin on the onset of osteoarthritis (OA) in ovariectomized (OVX) rats. We found that both early and late recombinant lubricin treatments attenuated the onset of OA by positive feedback loop between articular cartilage and subchondral bone, although late treatment contributed to a lesser effect compared with early treatment. Specifically, treatment with recombinant lubricin protected articular cartilage from degeneration, demonstrated by lower proteoglycan loss, lower OARSI scores, less calcification cartilage zone and reduced immunostaining for collagen X (Col X) and matrix metalloproteinase (MMP-13) but increased the expression of lubricin, in comparison with vehicle-treated OVX rat group. Further, chondroprotective effects of lubricin normalized bone remodeling in subchondral bone underneath. It's suggested that treatment with recombinant lubricin inhibited the elevation of TRAP and Osterix positive cells in OVX rats and led to the normalization of subchondral bone microarchitectures with the suppression of subsidence of bone volume ratio (BV/TV) and trabecular thickness (Tb.Th) and the increase of trabecular separation (Tb.Sp) in vehicle-treated OVX rats. What's more, the normalization of subchondral bone in turn attenuated the articular cartilage erosion by inhibiting vascular invasion from subchondral bone to calcified cartilage zone, exemplified by inhibiting the elevation of CD31 positive cells in calcified cartilage and angiography in subchondral bone. Together, these results shed light that both early and late recombinant lubricin treatments attenuate the onset of OA by balancing the interplay between articular

  15. CCR2 elimination in mice results in larger and stronger tibial bones but bone loss is not attenuated following ovariectomy or muscle denervation.


    Mader, Tara L; Novotny, Susan A; Lin, Angela S; Guldberg, Robert E; Lowe, Dawn A; Warren, Gordon L


    Bone loss due to age and disuse contributes to osteoporosis and increases fracture risk. It has been hypothesized that such bone loss can be attenuated by modulation of the C-C chemokine receptor 2 (CCR2) and/or its ligands. The objectives of this study were to examine the effects of genetic elimination of CCR2 on cortical and trabecular bones in the mouse tibia and how bone loss was impacted following disuse and estrogen loss. Female CCR2 knockout (CCR2(-/-)) and wildtype mice underwent ovariectomy (OVX) or denervation of musculature adjacent to the tibia (DEN) to induce bone loss. Cortical and trabecular structural properties as well as mechanical properties (i.e., strength) of tibial bones were measured. Compared to wildtype mice, CCR2(-/-) mice had tibiae that were up to 9% larger and stronger; these differences could be explained mainly by the 17% greater body mass (P < 0.001) of CCR2(-/-) mice. The majority of the tibia's structural and functional responses to OVX and DEN were similar regardless of the lack or presence of CCR2, indicating that CCR2 is not protective against bone loss per se. These findings indicate that while CCR2(-/-) mice do have larger and stronger bones than do wildtype mice, there is minimal evidence that CCR2 elimination provides protection against bone loss during disuse and estrogen loss.

  16. Bone Marrow Mesenchymal Stem Cells Attenuate Mitochondria Damage Induced by Hypoxia in Mouse Trophoblasts

    PubMed Central

    Wang, Lingjuan; Xu, Xiaoyan; Kang, Lina


    Objective We aimed to observe the change of mitochondrial function and structure as well as the cell function induced by hypoxia in mouse trophoblasts, and moreover, to validate the restoration of these changes after co-culture with bone marrow mesenchymal stem cells (hereinafter referred to as “MSCs”). Further, we explored the mechanism of MSCs attenuating the functional damage of trophoblasts caused by hypoxia. Methods Cells were divided into two groups, trophoblasts and MSCs+trophoblasts respectively, and the two groups of cells were incubated with normoxia or hypoxia. Chemiluminescence was used to assay the β-HCG and progesterone in cell culture supernatants quantitatively. Western blotting and PCR were applied to detect the expression of Mfn2, MMP-2, MMP-9 and integrin β1 in the two groups. The mitochondrial membrane potential of each group of cells was detected with JC-1 dye and the ATP content was measured by the phosphomolybdic acid colorimetric method. We utilized transmission electron microscopy for observing the ultrastructure of mitochondria in trophoblasts. Finally, we assessed the cell apoptosis with flow cytometry (FCM) and analyzed the expression of the apoptosis related genes—Bcl-2, Bax, Caspase3 and Caspase9 by western blotting. Results The results showed that the Mfn2 expression was reduced after 4 h in hypoxia compared with that in normoxia, but increased in the co-culture group when compared with that in the separated-culture group (p<0.05). In addition, compared with the separated-culture group, theβ-HCG and progesterone levels in the co-culture group were significantly enhanced (p<0.05), and so were the expressions of MMP-2, MMP-9 and integrin β1 (p<0.05). Moreover, it exhibited significantly higher in ATP levels and intensified about the mitochondrial membrane potential in the co-culture group. TEM revealed disorders of the mitochondrial cristae and presented short rod-like structure and spheroids in hypoxia, however, in the co

  17. Measurement of the normalized broadband ultrasound attenuation in trabecular bone by using a bidirectional transverse transmission technique

    NASA Astrophysics Data System (ADS)

    Lee, Kang Il


    A new method for measuring the normalized broadband ultrasound attenuation (nBUA) in trabecular bone by using a bidirectional transverse transmission technique was proposed and validated with measurements obtained by using the conventional transverse transmission technique. There was no significant difference between the nBUA measurements obtained for 14 bovine femoral trabecular bone samples by using the bidirectional and the conventional transverse transmission techniques. The nBUA measured by using the two transverse transmission techniques showed strong positive correlations of r = 0.87 to 0.88 with the apparent bone density, consistent with the behavior in human trabecular bone invitro. We expect that the new method can be usefully applied for improved accuracy and precision in clinical measurements.

  18. Inhibition of SDF-1α/CXCR4 Signalling in Subchondral Bone Attenuates Post-Traumatic Osteoarthritis.


    Dong, Yonghui; Liu, Hui; Zhang, Xuejun; Xu, Fei; Qin, Liang; Cheng, Peng; Huang, Hui; Guo, Fengjing; Yang, Qing; Chen, Anmin


    Previous studies showed that SDF-1α is a catabolic factor that can infiltrate cartilage, decrease proteoglycan content, and increase MMP-13 activity. Inhibiting the SDF-1α/CXCR4 signalling pathway can attenuate the pathogenesis of osteoarthritis (OA). Recent studies have also shown that SDF-1α enhances chondrocyte proliferation and maturation. These results appear to be contradictory. In the current study, we used a destabilisation OA animal model to investigate the effects of SDF-1α/CXCR4 signalling in the tibial subchondral bone and the OA pathological process. Post-traumatic osteoarthritis (PTOA) mice models were prepared by transecting the anterior cruciate ligament (ACLT), or a sham surgery was performed, in a total of 30 mice. Mice were treated with phosphate buffer saline (PBS) or AMD3100 (an inhibitor of CXCR4) and sacrificed at 30 days post ACLT or sham surgery. Tibial subchondral bone status was quantified by micro-computed tomography (μCT). Knee-joint histology was analysed to examine the articular cartilage and joint degeneration. The levels of SDF-1α and collagen type I c-telopeptidefragments (CTX-I) were quantified by ELISA. Bone marrow mononuclear cells (BMMCs) were used to clarify the effects of SDF-1α on osteoclast formation and activity in vivo. μCT analysis revealed significant loss of trabecular bone from tibial subchondral bone post-ACLT, which was effectively prevented by AMD3100. AMD3100 could partially prevent bone loss and articular cartilage degeneration. Serum biomarkers revealed an increase in SDF-1α and bone resorption, which were also reduced by AMD3100. SDF-1α can promote osteoclast formation and the expression oftartrate resistant acid phosphatase (TRAP), cathepsin K (CK), and matrix metalloproteinase (MMP)-9 in osteoclasts by activating the MAPK pathway, including ERK and p38, but not JNK. In conclusion, inhibition of SDF-1α/CXCR4signalling was able to prevent trabecular bone loss and attenuated cartilage degeneration in

  19. Propranolol, a β-adrenergic antagonist, attenuates the decrease in trabecular bone mass in high calorie diet fed growing mice.


    Baek, Kyunghwa; Hwang, Hyo Rin; Park, Hyun-Jung; Kwon, Arang; Qadir, Abdul S; Baek, Jeong-Hwa


    We investigated the effects of high calorie and low calorie diets on skeletal integrity, and whether β-adrenergic blockade (BB) attenuates bone loss induced by dietary calorie alteration. Male 6-week-old C57BL/6 mice were assigned to either an ad-lib fed control diet (CON), a high calorie diet (HIGH), or a low calorie diet (LOW) group. In each diet group, mice were treated with either vehicle (VEH) or propranolol, a β-adrenergic antagonist. Over 12-weeks, β-blockade mitigated body weight and fat mass increases induced by the high calorie diet. Femoral trabecular bone mineral density and the expression levels of osteogenic marker genes in bone marrow cells were reduced in HIGHVEH and LOWVEH mice, and BB significantly attenuated this decline only in HIGH mice. In summary, the magnitude of bone loss induced by low calorie diet was greater than that caused by high calorie diet in growing mice, and β-blockade mitigated high calorie diet-induced bone loss.

  20. Intravenous Immunoglobulin (IVIG) Attenuates TNF-induced Pathologic Bone Resorption and Suppresses Osteoclastogenesis by Inducing A20 Expression

    PubMed Central

    Mun, Sehwan; Bae, Seyeon; Murata, Koichi; Ivashkiv, Lionel B.; Park-Min, Kyung-Hyun


    Investigations on the therapeutic effects of intravenous immunoglobulin (IVIG) have focused on the suppression of autoantibody- and immune complex-mediated inflammatory pathogenesis. Inflammatory diseases such as rheumatoid arthritis are often accompanied by excessive bone erosion but the effect of IVIG on osteoclasts, bone-resorbing cells, has not been studied. Here, we investigate whether IVIG directly regulates osteoclast differentiation and has therapeutic potential for suppressing osteoclast-mediated pathologic bone resorption. IVIG or cross-linking of Fcγ receptors with plate-bound IgG suppressed receptor activator of nuclear factor-kappa B ligand (RANKL)-induced osteoclastogenesis and expression of osteoclast-related genes such as integrin β3 and cathepsin K in a dose-dependent manner. Mechanistically, IVIG or plate-bound IgG suppressed osteoclastogenesis by downregulating RANKL-induced expression of NFATC1, the master regulator of osteoclastogenesis. IVIG suppressed NFATC1 expression by attenuating RANKL-induced NF-κB signaling, explained in part by induction of the inflammatory signaling inhibitor A20. IVIG administration attenuated in vivo osteoclastogenesis and suppressed bone resorption in the tumor necrosis factor (TNF)-induced calvarial osteolysis model. Our findings show that, in addition to suppressing inflammation, IVIG directly inhibits osteoclastogenesis through a mechanism involving suppression of RANK signaling. Direct suppression of osteoclast differentiation may provide beneficial effects on preserving bone mass when IVIG is used to treat rheumatic disorders. PMID:26189496

  1. Inhibition of bone morphogenetic protein signaling attenuates anemia associated with inflammation.


    Steinbicker, Andrea U; Sachidanandan, Chetana; Vonner, Ashley J; Yusuf, Rushdia Z; Deng, Donna Y; Lai, Carol S; Rauwerdink, Kristen M; Winn, Julia C; Saez, Borja; Cook, Colleen M; Szekely, Brian A; Roy, Cindy N; Seehra, Jasbir S; Cuny, Gregory D; Scadden, David T; Peterson, Randall T; Bloch, Kenneth D; Yu, Paul B


    Anemia of inflammation develops in settings of chronic inflammatory, infectious, or neoplastic disease. In this highly prevalent form of anemia, inflammatory cytokines, including IL-6, stimulate hepatic expression of hepcidin, which negatively regulates iron bioavailability by inactivating ferroportin. Hepcidin is transcriptionally regulated by IL-6 and bone morphogenetic protein (BMP) signaling. We hypothesized that inhibiting BMP signaling can reduce hepcidin expression and ameliorate hypoferremia and anemia associated with inflammation. In human hepatoma cells, IL-6-induced hepcidin expression, an effect that was inhibited by treatment with a BMP type I receptor inhibitor, LDN-193189, or BMP ligand antagonists noggin and ALK3-Fc. In zebrafish, the induction of hepcidin expression by transgenic expression of IL-6 was also reduced by LDN-193189. In mice, treatment with IL-6 or turpentine increased hepcidin expression and reduced serum iron, effects that were inhibited by LDN-193189 or ALK3-Fc. Chronic turpentine treatment led to microcytic anemia, which was prevented by concurrent administration of LDN-193189 or attenuated when LDN-193189 was administered after anemia was established. Our studies support the concept that BMP and IL-6 act together to regulate iron homeostasis and suggest that inhibition of BMP signaling may be an effective strategy for the treatment of anemia of inflammation.

  2. Bone Marrow-Derived c-kit+ Cells Attenuate Neonatal Hyperoxia-Induced Lung Injury

    PubMed Central

    Ramachandran, Shalini; Suguihara, Cleide; Drummond, Shelley; Chatzistergos, Konstantinos; Klim, Jammie; Torres, Eneida; Huang, Jian; Hehre, Dorothy; Rodrigues, Claudia O.; McNiece, Ian K.; Hare, Joshua M.; Young, Karen C.


    Recent studies suggest that bone marrow (BM)-derived stem cells have therapeutic efficacy in neonatal hyperoxia-induced lung injury (HILI). c-kit, a tyrosine kinase receptor that regulates angiogenesis, is expressed on several populations of BM-derived cells. Preterm infants exposed to hyperoxia have decreased lung angiogenesis. Here we tested the hypothesis that administration of BM-derived c-kit+ cells would improve angiogenesis in neonatal rats with HILI. To determine whether intratracheal (IT) administration of BM-derived c-kit+ cells attenuates neonatal HILI, rat pups exposed to either normobaric normoxia (21% O2) or hyperoxia (90% O2) from postnatal day (P) 2 to P15 were randomly assigned to receive either IT BM-derived green fluorescent protein (GFP)+ c-kit− cells (PL) or BM-derived GFP+ c-kit+ cells on P8. The effect of cell therapy on lung angiogenesis, alveolarization, pulmonary hypertension, vascular remodeling, cell proliferation, and apoptosis was determined at P15. Cell engraftment was determined by GFP immunostaining. Compared to PL, the IT administration of BM-derived c-kit+ cells to neonatal rodents with HILI improved alveolarization as evidenced by increased lung septation and decreased mean linear intercept. This was accompanied by an increase in lung vascular density, a decrease in lung apoptosis, and an increase in the secretion of proangiogenic factors. There was no difference in pulmonary vascular remodeling or the degree of pulmonary hypertension. Confocal microscopy demonstrated that 1% of total lung cells were GFP+ cells. IT administration of BM-derived c-kit+ cells improves lung alveolarization and angiogenesis in neonatal HILI, and this may be secondary to an improvement in the lung angiogenic milieu. PMID:23759597

  3. Attenuated total reflection Fourier transform infrared (ATR-FTIR) spectroscopic analysis of regenerated bone

    NASA Astrophysics Data System (ADS)

    Benetti, Carolina; Kazarain, Sergei G.; Alves, Marco A. V.; Blay, Alberto; Correa, Luciana; Zezell, Denise M.


    The cutting of bone is routinely required in medical procedures, especially in dental applications. In such cases, bone regeneration and new bone quality can determine the success of the treatment. This study investigated the main spectral differences of undamaged and healed bone using the ATR-FTIR spectroscopy technique. Three rabbits were submitted to a surgical procedure; a small piece of bone (3x3 mm2) was removed from both sides of their jaws using a high speed drill. After 15 days, the rabbits were euthanized and the jaws were removed. A bone slice was cut from each side of the jaw containing regions of undamaged and newly formed bone, resulting in six samples which were polished for spectroscopic comparison. The samples were analyzed by FTIR spectroscopy using a diamond ATR accessory. Spectral characteristics were compared and particular attention was paid to the proportion of phosphate to amide I bands and the width of the phosphate band. The results show that the ratio of phosphate to amide I is smaller in new bone tissue than in the undamaged bone, indicating a higher organic content in the newly formed bone. The analysis of the width of the phosphate band suggests a crystallinity difference between both tissues, since the width was higher in the new bone than in the natural bone. These results suggest that the differences observed in bone aging processes by FTIR spectroscopic can be applied to the study of healing processes.

  4. Inhibition of SDF-1α/CXCR4 Signalling in Subchondral Bone Attenuates Post-Traumatic Osteoarthritis

    PubMed Central

    Dong, Yonghui; Liu, Hui; Zhang, Xuejun; Xu, Fei; Qin, Liang; Cheng, Peng; Huang, Hui; Guo, Fengjing; Yang, Qing; Chen, Anmin


    Previous studies showed that SDF-1α is a catabolic factor that can infiltrate cartilage, decrease proteoglycan content, and increase MMP-13 activity. Inhibiting the SDF-1α/CXCR4 signalling pathway can attenuate the pathogenesis of osteoarthritis (OA). Recent studies have also shown that SDF-1α enhances chondrocyte proliferation and maturation. These results appear to be contradictory. In the current study, we used a destabilisation OA animal model to investigate the effects of SDF-1α/CXCR4 signalling in the tibial subchondral bone and the OA pathological process. Post-traumatic osteoarthritis (PTOA) mice models were prepared by transecting the anterior cruciate ligament (ACLT), or a sham surgery was performed, in a total of 30 mice. Mice were treated with phosphate buffer saline (PBS) or AMD3100 (an inhibitor of CXCR4) and sacrificed at 30 days post ACLT or sham surgery. Tibial subchondral bone status was quantified by micro-computed tomography (μCT). Knee-joint histology was analysed to examine the articular cartilage and joint degeneration. The levels of SDF-1α and collagen type I c-telopeptidefragments (CTX-I) were quantified by ELISA. Bone marrow mononuclear cells (BMMCs) were used to clarify the effects of SDF-1α on osteoclast formation and activity in vivo. μCT analysis revealed significant loss of trabecular bone from tibial subchondral bone post-ACLT, which was effectively prevented by AMD3100. AMD3100 could partially prevent bone loss and articular cartilage degeneration. Serum biomarkers revealed an increase in SDF-1α and bone resorption, which were also reduced by AMD3100. SDF-1α can promote osteoclast formation and the expression oftartrate resistant acid phosphatase (TRAP), cathepsin K (CK), and matrix metalloproteinase (MMP)-9 in osteoclasts by activating the MAPK pathway, including ERK and p38, but not JNK. In conclusion, inhibition of SDF-1α/CXCR4signalling was able to prevent trabecular bone loss and attenuated cartilage degeneration in

  5. Adverse effects of smoking on peak bone mass may be attenuated by higher body mass index in young female smokers.


    Callréus, Mattias; McGuigan, Fiona; Akesson, Kristina


    Smoking is associated with postmenopausal bone loss and fracture, but the effect of smoking on bone in younger women is unclear. Peak bone mass is an important determinant for fracture risk; therefore, our aim was to evaluate the association between smoking and bone mass in 25-year-old women, specifically the influence of daily cigarette consumption and total exposure, duration, age at starting smoking, and time since smoking cessation on bone density and fracture risk. Smoking and bone mineral density (BMD) data were available for 1,054 women from the PEAK-25 cohort. Analyses comparing current smokers with women who never smoked were performed using number of cigarettes per day, pack-years, smoking duration, age smoking started, and, for former smokers, age at quitting. BMD did not differ between never, former, and current smokers; and the relative fracture risk in smokers was not significant (relative risk [RR] = 1.2, 95 % confidence interval 0.8-1.9). Among current smokers, BMD decreased with a dose response as cigarette consumption increased (femoral neck p = 0.037). BMD was not significantly lower in young women who had smoked for long duration or started smoking early (p = 0.07-0.64); long duration and early start were associated with higher body mass index (BMI; p = 0.038). Lower BMD persisted up to 24 months after smoking cessation (p = 0.027-0.050), becoming comparable to never-smokers after 24 months. Hip BMD was negatively associated with smoking and dose-dependent on cigarette consumption. Smoking duration was not associated with BMD, although young women with a long smoking history had higher BMI, which might attenuate the adverse effects from smoking.

  6. Impaired differentiation of macrophage lineage cells attenuates bone remodeling and inflammatory angiogenesis in Ndrg1 deficient mice.


    Watari, Kosuke; Shibata, Tomohiro; Nabeshima, Hiroshi; Shinoda, Ai; Fukunaga, Yuichi; Kawahara, Akihiko; Karasuyama, Kazuyuki; Fukushi, Jun-Ichi; Iwamoto, Yukihide; Kuwano, Michihiko; Ono, Mayumi


    N-myc downstream regulated gene 1 (NDRG1) is a responsible gene for a hereditary motor and sensory neuropathy-Lom (Charcot-Marie-Tooth disease type 4D). This is the first study aiming to assess the contribution of NDRG1 to differentiation of macrophage lineage cells, which has important implications for bone remodeling and inflammatory angiogenesis. Ndrg1 knockout (KO) mice exhibited abnormal curvature of the spine, high trabecular bone mass, and reduced number of osteoclasts. We observed that serum levels of macrophage colony-stimulating factor (M-CSF) and macrophage-related cytokines were markedly decreased in KO mice. Differentiation of bone marrow (BM) cells into osteoclasts, M1/M2-type macrophages and dendritic cells was all impaired. Furthermore, KO mice also showed reduced tumor growth and angiogenesis by cancer cells, accompanied by decreased infiltration of tumor-associated macrophages. The transfer of BM-derived macrophages from KO mice into BM-eradicated wild type (WT) mice induced much less tumor angiogenesis than observed in WT mice. Angiogenesis in corneas in response to inflammatory stimuli was also suppressed with decreased infiltration of macrophages. Taken together, these results indicate that NDRG1 deficiency attenuates the differentiation of macrophage lineage cells, suppressing bone remodeling and inflammatory angiogenesis. This study strongly suggests the crucial role of NDRG1 in differentiation process for macrophages.

  7. Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells

    PubMed Central

    Taipaleenmäki, Hanna; Farina, Nicholas H.; van Wijnen, Andre J.; Stein, Janet L.


    Wnt signaling is implicated in bone formation and activated in breast cancer cells promoting primary and metastatic tumor growth. A compelling question is whether osteogenic miRNAs that increase Wnt activity for bone formation are aberrantly expressed in breast tumor cells to support metastatic bone disease. Here we report that miR-218-5p is highly expressed in bone metastases from breast cancer patients, but is not detected in normal mammary epithelial cells. Furthermore, inhibition of miR-218-5p impaired the growth of bone metastatic MDA-MB-231 cells in the bone microenvironment in vivo. These findings indicate a positive role for miR-218-5p in bone metastasis. Bioinformatic and biochemical analyses revealed a positive correlation between aberrant miR-218-5p expression and activation of Wnt signaling in breast cancer cells. Mechanistically, miR-218-5p targets the Wnt inhibitors Sclerostin (SOST) and sFRP-2, which highly enhances Wnt signaling. In contrast, delivery of antimiR-218-5p decreased Wnt activity and the expression of metastasis-related genes, including bone sialoprotein (BSP/IBSP), osteopontin (OPN/SPP1) and CXCR-4, implicating a Wnt/miR-218-5p regulatory network in bone metastatic breast cancer. Furthermore, miR-218-5p also mediates the Wnt-dependent up-regulation of PTHrP, a key cytokine promoting cancer-induced osteolysis. Antagonizing miR-218-5p reduced the expression of PTHrP and Rankl, inhibited osteoclast differentiation in vitro and in vivo, and prevented the development of osteolytic lesions in a preclinical metastasis model. We conclude that pathological elevation of miR-218-5p in breast cancer cells activates Wnt signaling to enhance metastatic properties of breast cancer cells and cancer-induced osteolytic disease, suggesting that miR-218-5p could be an attractive therapeutic target for preventing disease progression. PMID:27738322

  8. Green tea polyphenols attenuate deterioration of bone microarchitecture in female rats with systemic chronic inflammation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: Our previous study demonstrated that green tea polyphenols (GTP) benefit bone health in female rats with chronic inflammation, because of GTP’s antioxidant capacity. The current study further evaluates whether GTP can restore bone microstructure along with related mechanism in rats wit...

  9. Correction of quantification errors in pelvic and spinal lesions caused by ignoring higher photon attenuation of bone in [{sup 18}F]NaF PET/MR

    SciTech Connect

    Schramm, Georg Maus, Jens; Hofheinz, Frank; Petr, Jan; Lougovski, Alexandr; Beuthien-Baumann, Bettina; Oehme, Liane; Platzek, Ivan; Hoff, Jörg van den


    Purpose: MR-based attenuation correction (MRAC) in routine clinical whole-body positron emission tomography and magnetic resonance imaging (PET/MRI) is based on tissue type segmentation. Due to lack of MR signal in cortical bone and the varying signal of spongeous bone, standard whole-body segmentation-based MRAC ignores the higher attenuation of bone compared to the one of soft tissue (MRAC{sub nobone}). The authors aim to quantify and reduce the bias introduced by MRAC{sub nobone} in the standard uptake value (SUV) of spinal and pelvic lesions in 20 PET/MRI examinations with [{sup 18}F]NaF. Methods: The authors reconstructed 20 PET/MR [{sup 18}F]NaF patient data sets acquired with a Philips Ingenuity TF PET/MRI. The PET raw data were reconstructed with two different attenuation images. First, the authors used the vendor-provided MRAC algorithm that ignores the higher attenuation of bone to reconstruct PET{sub nobone}. Second, the authors used a threshold-based algorithm developed in their group to automatically segment bone structures in the [{sup 18}F]NaF PET images. Subsequently, an attenuation coefficient of 0.11 cm{sup −1} was assigned to the segmented bone regions in the MRI-based attenuation image (MRAC{sub bone}) which was used to reconstruct PET{sub bone}. The automatic bone segmentation algorithm was validated in six PET/CT [{sup 18}F]NaF examinations. Relative SUV{sub mean} and SUV{sub max} differences between PET{sub bone} and PET{sub nobone} of 8 pelvic and 41 spinal lesions, and of other regions such as lung, liver, and bladder, were calculated. By varying the assigned bone attenuation coefficient from 0.11 to 0.13 cm{sup −1}, the authors investigated its influence on the reconstructed SUVs of the lesions. Results: The comparison of [{sup 18}F]NaF-based and CT-based bone segmentation in the six PET/CT patients showed a Dice similarity of 0.7 with a true positive rate of 0.72 and a false discovery rate of 0.33. The [{sup 18}F]NaF-based bone

  10. Induced Pluripotent Stem Cell Derived Mesenchymal Stem Cells for Attenuating Age-Related Bone Loss

    DTIC Science & Technology


    into anabolic therapies for osteoporosis .1 Mesenchymal stem cell (MSC) differentiation towards the bone forming osteoblastic lineage decreases as a...research into anabolic therapies for osteoporosis .1 Mesenchymal stem cell (MSC) differentiation towards the bone forming osteoblastic lineage decreases...13. SUPPLEMENTARY NOTES 14. ABSTRACT Osteoporosis , both age-related and post-menopausal, is a huge health problem in the United States and indeed

  11. Glucosamines Attenuate Bone Loss Due to Menopause by Regulating Osteoclast Function in Ovariectomized Mice.


    Asai, Hironobu; Nakatani, Sachie; Kato, Takuya; Shimizu, Tatsuo; Mano, Hiroshi; Kobata, Kenji; Wada, Masahiro


    The effect of glucosamine (GlcN) and N-acetylglucosamine (GlcNAc) on bone metabolism in ovariectomized (OVX) mice was studied. After 12 weeks of feeding with 0.2% GlcN and 0.2% GlcNAc, the femoral bone mineral density in OVX mice was significantly increased compared with that in OVX mice fed the control diet. Histomorphometric analysis of the tibia indicated that the rates of osteogenesis and bone resorption were reduced due to the GlcN diet. The erosion depth of osteoclasts on the tibia in GlcN- and GlcNAc-fed OVX mice was significantly lower than that in the control OVX mice. The number of tartrate-resistant acid phosphatase-positive osteoclasts induced from bone marrow stem cells isolated from GlcN-fed OVX mice was significantly lower than that from control OVX mice. A loss of uterine weight and higher serum calcium concentration in the GlcN- and GlcNAc-fed OVX mice were observed. The results suggest that the intake of GlcN suppresses bone loss by inhibiting osteoclast differentiation and activity in a nonestrogenic manner.

  12. Attenuated BMP1 Function Compromises Osteogenesis, Leading to Bone Fragility in Humans and Zebrafish

    PubMed Central

    Asharani, P.V.; Keupp, Katharina; Semler, Oliver; Wang, Wenshen; Li, Yun; Thiele, Holger; Yigit, Gökhan; Pohl, Esther; Becker, Jutta; Frommolt, Peter; Sonntag, Carmen; Altmüller, Janine; Zimmermann, Katharina; Greenspan, Daniel S.; Akarsu, Nurten A.; Netzer, Christian; Schönau, Eckhard; Wirth, Radu; Hammerschmidt, Matthias; Nürnberg, Peter; Wollnik, Bernd; Carney, Thomas J.


    Bone morphogenetic protein 1 (BMP1) is an astacin metalloprotease with important cellular functions and diverse substrates, including extracellular-matrix proteins and antagonists of some TGFβ superfamily members. Combining whole-exome sequencing and filtering for homozygous stretches of identified variants, we found a homozygous causative BMP1 mutation, c.34G>C, in a consanguineous family affected by increased bone mineral density and multiple recurrent fractures. The mutation is located within the BMP1 signal peptide and leads to impaired secretion and an alteration in posttranslational modification. We also characterize a zebrafish bone mutant harboring lesions in bmp1a, demonstrating conservation of BMP1 function in osteogenesis across species. Genetic, biochemical, and histological analyses of this mutant and a comparison to a second, similar locus reveal that Bmp1a is critically required for mature-collagen generation, downstream of osteoblast maturation, in bone. We thus define the molecular and cellular bases of BMP1-dependent osteogenesis and show the importance of this protein for bone formation and stability. PMID:22482805

  13. Attenuated BMP1 function compromises osteogenesis, leading to bone fragility in humans and zebrafish.


    Asharani, P V; Keupp, Katharina; Semler, Oliver; Wang, Wenshen; Li, Yun; Thiele, Holger; Yigit, Gökhan; Pohl, Esther; Becker, Jutta; Frommolt, Peter; Sonntag, Carmen; Altmüller, Janine; Zimmermann, Katharina; Greenspan, Daniel S; Akarsu, Nurten A; Netzer, Christian; Schönau, Eckhard; Wirth, Radu; Hammerschmidt, Matthias; Nürnberg, Peter; Wollnik, Bernd; Carney, Thomas J


    Bone morphogenetic protein 1 (BMP1) is an astacin metalloprotease with important cellular functions and diverse substrates, including extracellular-matrix proteins and antagonists of some TGFβ superfamily members. Combining whole-exome sequencing and filtering for homozygous stretches of identified variants, we found a homozygous causative BMP1 mutation, c.34G>C, in a consanguineous family affected by increased bone mineral density and multiple recurrent fractures. The mutation is located within the BMP1 signal peptide and leads to impaired secretion and an alteration in posttranslational modification. We also characterize a zebrafish bone mutant harboring lesions in bmp1a, demonstrating conservation of BMP1 function in osteogenesis across species. Genetic, biochemical, and histological analyses of this mutant and a comparison to a second, similar locus reveal that Bmp1a is critically required for mature-collagen generation, downstream of osteoblast maturation, in bone. We thus define the molecular and cellular bases of BMP1-dependent osteogenesis and show the importance of this protein for bone formation and stability.

  14. Induced Pluripotent Stem Cell Derived Mesenchymal Stem Cells for Attenuating Age-Related Bone Loss

    DTIC Science & Technology


    formation, are associated with gastrointestinal problems when taken orally and may cause osteonecrosis in cancer patients and bone pain in other...expression of osteoblastic phenotypic markers on iPS derived MSC cultured on nanotopographic biofilms . While we have not yet examined the effect

  15. Bone marrow fat has brown adipose tissue characteristics, which are attenuated with aging and diabetes.


    Krings, A; Rahman, S; Huang, S; Lu, Y; Czernik, P J; Lecka-Czernik, B


    Fat occupies a significant portion of bone cavity however its function is largely unknown. Marrow fat expands during aging and in conditions which affect energy metabolism, indicating that fat in bone is under similar regulatory mechanisms as other fat depots. On the other hand, its location may determine specific functions in the maintenance of the environment for bone remodeling and hematopoiesis. We have demonstrated that marrow fat has a distinctive phenotype, which resembles both, white and brown adipose tissue (WAT and BAT, respectively). Marrow adipocytes express gene markers of brown adipocytes at levels characteristic for the BAT, including transcription factor Prdm16, and regulators of thermogenesis such as deiodinase 2 (Dio2) and PGC1α. The levels of expression of BAT-specific gene markers are decreased in bone of 24 mo old C57BL/6 and in diabetic yellow agouti A(vy)/a mice implicating functional changes of marrow fat occurring with aging and diabetes. Administration of antidiabetic TZD rosiglitazone, which sensitizes cells to insulin and increases adipocyte metabolic functions, significantly increased both, BAT (UCP1, PGC1α, Dio2, β3AR, Prdm16, and FoxC2) and WAT (adiponectin and leptin) gene expression in marrow of normoglycemic C57BL/6 mice, but failed to increase the expression of BAT, but not WAT, gene markers in diabetic mice. In conclusion, the metabolic phenotype of marrow fat combines both BAT and WAT characteristics. Decrease in BAT-like characteristics with aging and diabetes may contribute to the negative changes in the marrow environment supporting bone remodeling and hematopoiesis.

  16. Plumbagin attenuates cancer cell growth and osteoclast formation in the bone microenvironment of mice

    PubMed Central

    Yan, Wei; Wang, Ting-yu; Fan, Qi-ming; Du, Lin; Xu, Jia-ke; Zhai, Zan-jing; Li, Hao-wei; Tang, Ting-ting


    Aim: To investigate the effects of plumbagin, a naphthoquinone derived from the medicinal plant Plumbago zeylanica, on human breast cancer cell growth and the cancer cell-induced osteolysis in the bone microenvironment of mice. Methods: Human breast cancer cell subline MDA-MB-231SA with the ability to spread and grow in the bone was tested. The cell proliferation was determined using the CCK-8 assay. Apoptosis was detected with Annexin V/PI double-labeled flow cytometry. Red fluorescent protein-labeled MDA-MB-231SArfp cells were injected into the right tibia of female BALB/c-nu/nu mice. Three days after the inoculation, the mice were injected with plumbagin (2, 4, or 6 mg/kg, ip) 5 times per week for 7 weeks. The growth of the tumor cells was monitored using an in vivo imaging system. After the mice were sacrificed, the hind limbs were removed for radiographic and histological analyses. Results: Plumbagin (2.5–20 μmol/L) concentration-dependently inhibited the cell viability and induced apoptosis of MDA-MB-231SA cells in vitro (the IC50 value of inhibition of cell viability was 14.7 μmol/L). Administration of plumbagin to breast cancer bearing mice delayed the tumor growth by 2–3 weeks and reduced the tumor volume by 44%–74%. The in vivo imaging study showed that plumbagin dose-dependently inhibited MDA-MB-231SArfp cell growth in bone microenvironment. Furthermore, X-ray images and micro-CT study demonstrated that plumbagin reduced bone erosion area and prevented a decrease in bone tissue volume. Histological studies showed that plumbagin dose-dependently inhibited the breast cancer cell growth, enhanced the cell apoptosis and reduced the number of TRAcP-positive osteoclasts. Conclusion: Plumbagin inhibits the cell growth and induces apoptosis in human breast cancer cells in mice bone microenvironment, leading to significant reduction in osteolytic lesions caused by the tumor cells. PMID:24384612

  17. Attenuation of bone morphogenetic protein signaling during amphibian limb development results in the generation of stage-specific defects

    PubMed Central

    Jones, Tamsin E M; Day, Robert C; Beck, Caroline W


    The vertebrate limb is one of the most intensively studied organs in the field of developmental biology. Limb development in tetrapod vertebrates is highly conserved and dependent on the interaction of several important molecular pathways. The bone morphogenetic protein (BMP) signaling cascade is one of these pathways and has been shown to be crucial for several aspects of limb development. Here, we have used a Xenopus laevis transgenic line, in which expression of the inhibitor Noggin is under the control of the heat-shock promoter hsp70 to examine the effects of attenuation of BMP signaling at different stages of limb development. Remarkably different phenotypes were produced at different stages, illustrating the varied roles of BMP in development of the limb. Very early limb buds appeared to be refractory to the effects of BMP attenuation, developing normally in most cases. Ectopic limbs were produced by overexpression of Noggin corresponding to a brief window of limb development at about stage 49/50, as recently described by Christen et al. (2012). Attenuation of BMP signaling in stage 51 or 52 tadpoles lead to a reduction in the number of digits formed, resulting in hypodactyly or ectrodactyly, as well as occasional defects in the more proximal tibia-fibula. Finally, inhibition at stage 54 (paddle stage) led to the formation of dramatically shortened digits resulting from loss of distal phalanges. Transcriptome analysis has revealed the possibility that more Noggin-sensitive members of the BMP family could be involved in limb development than previously suspected. Our analysis demonstrates the usefulness of heat-shock-driven gene expression as an effective method for inhibiting a developmental pathway at different times during limb development. PMID:23981117

  18. Intrathecal injection of selected peptide Myr-RC-13 attenuates bone cancer pain by inhibiting KIF17 and NR2B expression.


    Ni, Kun; Zhou, Yu; Sun, Yu-e; Liu, Yue; Gu, Xiao-ping; Ma, Zheng-liang


    Although bone cancer pain is a common intractable clinical symptom, its underlying mechanisms are still elusive. Accumulating evidence reveals that the N-methyl-D-aspartate (NMDA) receptor containing a 2B subunit (NR2B) in the spinal cord contributes to bone cancer pain. Our preliminary study demonstrated that intrathecal injection of fusion peptide Myr-RC-13 could disrupt spinal KIF17/mLin10 interaction, which is an essential component of KIF17-mediated NR2B transport. Here we report a means by infusion of the selected peptide Myr-RC-13 intrathecally to attenuate bone cancer pain. The results showed that inoculation of fibrosarcoma NCTC 2472 cells into the femur cavity of C3H/HeJ mice induced progressive bone cancer pain and resulted in up-regulation of KIF17 and NR2B in the spinal cord. In addition, repetitive spinal delivery of Myr-RC-13 relieved bone cancer-related mechanical allodynia and spontaneous pain behaviors, and down-regulated expression of spinal KIF17 and NR2B. Finally, our results demonstrated that selected peptide Myr-RC-13 was able to attenuate bone cancer pain via decreasing spinal KIF17 and NR2B expressions. Therefore, selected peptide Myr-RC-13 might be a potential analgesic strategy for bone cancer pain.

  19. Mas-related G-protein-coupled receptor c agonist bovine adrenal medulla 8-22 attenuates bone cancer pain in mice

    PubMed Central

    Sun, Yu-E; Lu, Cui-E; Lei, Yishan; Liu, Yue; Ma, Zhengliang; Gu, Xiaoping


    Objectives: The aim of this study is to investigate the effects of Mas-related G-protein-coupled receptor C (MrgC) agonist bovine adrenal medulla 8-22 (BAM8-22) on bone cancer pain and mirror-image pain. Methods: Bone cancer pain was induced by intramedullary injection of NC2472 fibrosarcoma cells in the mice. BAM8-22 and/or anti-MrgC antibody were injected intrathecally at day 14 after bone cancer induction and their effects on pain behaviors were detected. The pain behaviours were assessed by the number of spontaneous foot lifts and paw withdrawal mechanical threshold (PWMT) tests. MrgC expression was detected using western blot analysis and immunofluorescence assay. Results: There were increased bone cancer pain and mirror-image pain in the tumor-bearing mice while not in the sham-treated mice. BAM8-22 attenuated bone cancer pain in mice dose dependently with the highest effects at 2 hr after BAM8-22 administration, and anti-MrgC antibody reversed the effects of BAM8-22. However, intrathecal administration of BAM8-22 did not affect the mirror-image pain. Furthermore, BAM8-22 stimulated the expression of MrgC in the spinal dorsal horn. Conclusions: MrgC agonist BAM8-22 could attenuate bone cancer pain in mice. This study may provide a novel strategy for the treatment of bone cancer pain. PMID:26884930

  20. High-Dose Vitamin D and Calcium Attenuates Bone Loss with Antiretroviral Therapy Initiation

    PubMed Central

    Overton, Edgar Turner; Chan, Ellen S.; Brown, Todd T.; Tebas, Pablo; McComsey, Grace A.; Melbourne, Kathleen M.; Napoli, Andrew; Hardin, William Royce; Ribaudo, Heather J.; Yin, Michael T.


    Background Antiretroviral therapy (ART) initiation for HIV-1 infection is associated with 2-6% loss in bone mineral density (BMD). Objective To evaluate vitamin D3 (4000 IU daily) plus calcium (1000 mg calcium carbonate daily) supplementation on bone loss associated with ART initiation. Design 48-week prospective, randomized, double-blind, placebo-controlled study. Setting Thirty nine AIDS Clinical Trials Network research units. Participants ART-naïve HIV-infected adults. Measurements BMD by dual-energy X-ray absorptiometry (DXA); 25-hydroxy vitamin D (25(OH)D) levels, parathyroid hormone (PTH), phosphate metabolism, markers of bone turnover and systemic inflammation. Results 165 eligible subjects were randomized (79 Vitamin D/calcium (VitD/Cal); 86 placebo); 142 subjects with evaluable DXA data were included in the primary analysis. The study arms were well-balanced at baseline: median age 33 years; 90% male; 33% non-Hispanic black; median CD4 count 341 cells/mm3; and median 25(OH)D 23 ng/mL (57 nmol/L). At 48 weeks, subjects receiving placebo had greater decline in total hip BMD than VitD/Cal: −3.19% median change (1st-3rd quartile (Q1, Q3) −5.12%, −1.02%) vs. (−1.46% −3.16%,−0.40%). respectively (p=0.001). Lumbar spine BMD loss for the two groups was similar: −2.91% (−4.84%, −1.06%) vs. −1.41% (−3.78%, 0.00%), (p=0.085). At week 48, 90% of participants achieved HIV-1 RNA <50 copies/mL. Levels of 25(OH)D3 increased in the VitD/Cal but not the placebo group: median change of 24.5 (14.6, 37.8) vs. 0.7 (−5.3, 4.3) ng/mL, respectively (p<0.001). Additionally, increases in markers of bone turnover were blunted in the VitD/Cal group. Limitations No international sites were included; only 48 weeks of follow up Conclusion Vitamin D/calcium supplementation mitigates the loss of BMD seen with initiation of efavirenz/emtricitabine/tenofovir, particularly at the total hip, which is the site of greatest concern for fragility fracture. Primary Funding

  1. Bone marrow mesenchymal stem cells attenuate silica-induced pulmonary fibrosis via paracrine mechanisms.


    Li, Xiaoli; Wang, Yan; An, Guoliang; Liang, Di; Zhu, Zhonghui; Lian, Ximeng; Niu, Piye; Guo, Caixia; Tian, Lin


    The purpose of this study was to investigate the anti-fibrotic effect and possible mechanism of bone marrow mesenchymal stem cells (BMSCs) in silica-induced lung injury and fibrosis in vivo and in vitro. In vivo, rats were exposed to 50mg/ml silica intratracheally. The rats were sacrificed on day 15 or day 30 after intravenous injection of BMSCs. Histopathological examination demonstrated that BMSCs decreased the blue areas of collagen fibers and the number of nodules. Alveolar epithelium was damaged by silica, but it was restored by BMSCs. In vitro, BMSCs co-cultured with RLE-6TN cells in 6-Transwell plates were evaluated to determine the possible mechanism. The results demonstrated that BMSCs downregulated the expression of collagen I and III. BMSCs reversed morphological abnormalities and reduced the proliferation of RLE-6TN cells. These data showed that BMSCs did not give rise to alveolar epithelial cells directly, while the levels of hepatocyte growth factor, keratinocyte growth factor and bone morphogenetic protein -7 increased and expression of tumor necrosis factor-α and transforming growth factor-β1 decreased in the 6TN+Silica+BMSCs group compared with the 6TN+Silica group. Our results revealed that BMSCs exerted anti-fibrotic effects on silica-induced pulmonary fibrosis, which might be associated with paracrine mechanisms rather than differentiation.

  2. Minocycline attenuates bone cancer pain in rats by inhibiting NF-κB in spinal astrocytes

    PubMed Central

    Song, Zhen-peng; Xiong, Bing-rui; Guan, Xue-hai; Cao, Fei; Manyande, Anne; Zhou, Ya-qun; Zheng, Hua; Tian, Yu-ke


    Aim: To investigate the mechanisms underlying the anti-nociceptive effect of minocycline on bone cancer pain (BCP) in rats. Methods: A rat model of BCP was established by inoculating Walker 256 mammary carcinoma cells into tibial medullary canal. Two weeks later, the rats were injected with minocycline (50, 100 μg, intrathecally; or 40, 80 mg/kg, ip) twice daily for 3 consecutive days. Mechanical paw withdrawal threshold (PWT) was used to assess pain behavior. After the rats were euthanized, spinal cords were harvested for immunoblotting analyses. The effects of minocycline on NF-κB activation were also examined in primary rat astrocytes stimulated with IL-1β in vitro. Results: BCP rats had marked bone destruction, and showed mechanical tactile allodynia on d 7 and d 14 after the operation. Intrathecal injection of minocycline (100 μg) or intraperitoneal injection of minocycline (80 mg/kg) reversed BCP-induced mechanical tactile allodynia. Furthermore, intraperitoneal injection of minocycline (80 mg/kg) reversed BCP-induced upregulation of GFAP (astrocyte marker) and PSD95 in spinal cord. Moreover, intraperitoneal injection of minocycline (80 mg/kg) reversed BCP-induced upregulation of NF-κB, p-IKKα and IκBα in spinal cord. In IL-1β-stimulated primary rat astrocytes, pretreatment with minocycline (75, 100 μmol/L) significantly inhibited the translocation of NF-κB to nucleus. Conclusion: Minocycline effectively alleviates BCP by inhibiting the NF-κB signaling pathway in spinal astrocytes. PMID:27157092

  3. FGFR1 signaling in hypertrophic chondrocytes is attenuated by the Ras-GAP neurofibromin during endochondral bone formation

    PubMed Central

    Karolak, Matthew R.; Yang, Xiangli; Elefteriou, Florent


    Aberrant fibroblast growth factor receptor 3 (FGFR3) signaling disrupts chondrocyte proliferation and growth plate size and architecture, leading to various chondrodysplasias or bone overgrowth. These observations suggest that the duration, intensity and cellular context of FGFR signaling during growth plate chondrocyte maturation require tight, regulated control for proper bone elongation. However, the machinery fine-tuning FGFR signaling in chondrocytes is incompletely defined. We report here that neurofibromin, a Ras-GAP encoded by Nf1, has an overlapping expression pattern with FGFR1 and FGFR3 in prehypertrophic chondrocytes, and with FGFR1 in hypertrophic chondrocytes during endochondral ossification. Based on previous evidence that neurofibromin inhibits Ras-ERK signaling in chondrocytes and phenotypic analogies between mice with constitutive FGFR1 activation and Nf1 deficiency in Col2a1-positive chondrocytes, we asked whether neurofibromin is required to control FGFR1-Ras-ERK signaling in maturing chondrocytes in vivo. Genetic Nf1 ablation in Fgfr1-deficient chondrocytes reactivated Ras-ERK1/2 signaling in hypertrophic chondrocytes and reversed the expansion of the hypertrophic zone observed in mice lacking Fgfr1 in Col2a1-positive chondrocytes. Histomorphometric and gene expression analyses suggested that neurofibromin, by inhibiting Rankl expression, attenuates pro-osteoclastogenic FGFR1 signaling in hypertrophic chondrocytes. We also provide evidence suggesting that neurofibromin in prehypertrophic chondrocytes, downstream of FGFRs and via an indirect mechanism, is required for normal extension and organization of proliferative columns. Collectively, this study indicates that FGFR signaling provides an important input into the Ras-Raf-MEK-ERK1/2 signaling axis in chondrocytes, and that this input is differentially regulated during chondrocyte maturation by a complex intracellular machinery, of which neurofibromin is a critical component. PMID:25616962

  4. Infusion of Bone Marrow Mesenchymal Stem Cells Attenuates Experimental Severe Acute Pancreatitis in Rats

    PubMed Central

    Huang, Dandan; Gao, Jun; Gong, Yanfang; Wu, Hongyu; Xu, Aifang


    Background & Aims. Severe acute pancreatitis (SAP) remains a high-mortality disease. Bone marrow (BM) mesenchymal stem cells (MSCs) have been demonstrated to have plasticity of transdifferentiation and to have immunomodulatory functions. In the present study, we assessed the roles of MSCs in SAP and the therapeutic effects of MSC on SAP after transplantation. Methods. A pancreatitis rat model was induced by the injection of taurocholic acid (TCA) into the pancreatic duct. After isolation and characterization of MSC from BM, MSC transplantation was conducted 24 hrs after SAP induction by tail vein injection. The survival rate was observed and MSCs were traced after transplantation. The expression of TNF-α and IL-1β mRNA in the transplantation group was also analyzed. Results. The survival rate of the transplantation group was significantly higher compared to the control group (p < 0.05). Infused MSCs were detected in the pancreas and BM 3 days after transplantation. The expression of TNF-α and IL-1β mRNA in the transplantation group was significantly lower than in the control group in both the pancreas and the lungs (p < 0.05). Conclusions. MSC transplantation could improve the prognosis of SAP rats. Engrafted MSCs have the capacity of homing, migration, and planting during the treatment of SAP. PMID:27721836

  5. Bone Marrow Stem/Progenitor Cells Attenuate the Inflammatory Milieu Following Substitution Urethroplasty

    PubMed Central

    Liu, Joceline S.; Bury, Matthew I.; Fuller, Natalie J.; Sturm, Renea M.; Ahmad, Nida; Sharma, Arun K.


    Substitution urethroplasty for the treatment of male stricture disease is often accompanied by subsequent tissue fibrosis and secondary stricture formation. Patients with pre-existing morbidities are often at increased risk of urethral stricture recurrence brought upon in-part by delayed vascularization accompanied by overactive inflammatory responses following surgery. Within the context of this study, we demonstrate the functional utility of a cell/scaffold composite graft comprised of human bone marrow-derived mesenchymal stem cells (MSC) combined with CD34+ hematopoietic stem/progenitor cells (HSPC) to modulate inflammation and wound healing in a rodent model of substitution urethroplasty. Composite grafts demonstrated potent anti-inflammatory effects with regards to tissue macrophage and neutrophil density following urethral tissue analyses. This was accompanied by a significant reduction in pro-inflammatory cytokines TNFα and IL-1β and further resulted in an earlier transition to tissue remodeling and maturation with a shift in collagen type III to I. Grafted animals demonstrated a progressive maturation and increase in vessel size compared to control animals. Overall, MSC/CD34+ HSPC composite grafts reduce inflammation, enhance an earlier transition to wound remodeling and maturation concurrently increasing neovascularization in the periurethral tissue. We demonstrate the feasibility and efficacy of a stem cell-seeded synthetic graft in a rodent substitution urethroplasty model. PMID:27762304

  6. Exercise training in obese older adults prevents increase in bone turnover and attenuates decrease in hip bone mineral density induced by weight loss despite decline in bone-active hormones.


    Shah, Krupa; Armamento-Villareal, Reina; Parimi, Nehu; Chode, Suresh; Sinacore, David R; Hilton, Tiffany N; Napoli, Nicola; Qualls, Clifford; Villareal, Dennis T


    0.05). In conclusion, the addition of ET to weight loss therapy among obese older adults prevents weight loss-induced increase in bone turnover and attenuates weight loss-induced reduction in hip BMD despite weight loss-induced decrease in bone-active hormones.

  7. Unfractionated bone marrow cells attenuate paraquat-induced glomerular injury and acute renal failure by modulating the inflammatory response

    PubMed Central

    Gu, Sing-Yi; Yeh, Ti-Yen; Lin, Shih-Yi; Peng, Fu-Chuo


    The aim of this study was to evaluate the efficacy of unfractionated bone marrow cells (BMCs) in attenuating acute kidney injury (AKI) induced by paraquat (PQ) in a mouse model. PQ (55 mg/kg BW) was intraperitoneally injected into C57BL/6 female mice to induce AKI, including renal function failure, glomerular damage and renal tubule injury. Glomerular podocytes were the first target damaged by PQ, which led to glomerular injury. Upon immunofluorescence staining, podocytes depletion was validated and accompanied by increased urinary podocin levels, measured on days 1 and 6. A total of 5.4 × 106 BMCs obtained from the same strain of male mice were injected into AKI mice through the tail vein at 3, 24, and 48 hours after PQ administration. As a result, renal function increased, tubular and glomerular injury were ameliorated, podocytes loss improved, and recipient mortality decreased. In addition, BMCs co-treatment decreased the extent of neutrophil infiltration and modulated the inflammatory response by shifting from pro-inflammatory Th1 to an anti-inflammatory Th2 profile, where IL-1β, TNF-α, IL-6 and IFN-γ levels declined and IL-10 and IL-4 levels increased. The present study provides a platform to investigate PQ-induced AKI and repeated BMCs injection represents an efficient therapeutic strategy. PMID:26988026

  8. Attenuation of Hepatic Graft-versus-host Disease in Allogeneic Recipients of MyD88-deficient Donor Bone Marrow.


    Lim, Ji-Young; Lee, Young-Kwan; Lee, Sung-Eun; Ju, Ji-Min; Park, Gyeongsin; Choi, Eun Young; Min, Chang-Ki


    Acute graft-versus-host-disease (GVHD) is characterized by selective damage to the liver, the skin, and the gastrointestinal tract. Following allogeneic hematopoietic stem cell transplantation, donor bone marrow (BM) cells repopulate the immune system of the recipient. We previously demonstrated that the acute intestinal GVHD (iGVHD) mortality rate was higher in MyD88-deficient BM recipients than that in the control BM recipients. In the present study, the role of MyD88 (expressed by donor BM) in the pathophysiology of hepatic GVHD (hGVHD) was examined. Unlike iGVHD, transplantation with MyD88-deficient T-cell depleted (TCD) BM attenuated hGVHD severity and was associated with low infiltration of T cells into the liver of the recipients. Moreover, GVHD hosts, transplanted with MyD88-deficient TCD BM, exhibited markedly reduced expansion of CD11b(+)Gr-1(+) myeloid-derived suppressor cells (MDSC) in the liver. Adoptive injection of the MDSC from wild type mice, but not MyD88-deficient mice, enhanced hepatic T cell infiltration in the MyD88-deficient TCD BM recipients. Pre-treatment of BM donors with LPS increased MDSC levels in the liver of allogeneic wild type BM recipients. In conclusion, hGVHD and iGVHD may occur through various mechanisms based on the presence of MyD88 in the non-T cell compartment of the allograft.

  9. k-space sampling optimization for ultrashort TE imaging of cortical bone: Applications in radiation therapy planning and MR-based PET attenuation correction

    PubMed Central

    Hu, Lingzhi; Su, Kuan-Hao; Pereira, Gisele C.; Grover, Anu; Traughber, Bryan; Traughber, Melanie; Muzic, Raymond F.


    Purpose: The ultrashort echo-time (UTE) sequence is a promising MR pulse sequence for imaging cortical bone which is otherwise difficult to image using conventional MR sequences and also poses strong attenuation for photons in radiation therapy and PET imaging. The authors report here a systematic characterization of cortical bone signal decay and a scanning time optimization strategy for the UTE sequence through k-space undersampling, which can result in up to a 75% reduction in acquisition time. Using the undersampled UTE imaging sequence, the authors also attempted to quantitatively investigate the MR properties of cortical bone in healthy volunteers, thus demonstrating the feasibility of using such a technique for generating bone-enhanced images which can be used for radiation therapy planning and attenuation correction with PET/MR. Methods: An angularly undersampled, radially encoded UTE sequence was used for scanning the brains of healthy volunteers. Quantitative MR characterization of tissue properties, including water fraction and R2∗ = 1/T2∗, was performed by analyzing the UTE images acquired at multiple echo times. The impact of different sampling rates was evaluated through systematic comparison of the MR image quality, bone-enhanced image quality, image noise, water fraction, and R2∗ of cortical bone. Results: A reduced angular sampling rate of the UTE trajectory achieves acquisition durations in proportion to the sampling rate and in as short as 25% of the time required for full sampling using a standard Cartesian acquisition, while preserving unique MR contrast within the skull at the cost of a minimal increase in noise level. The R2∗ of human skull was measured as 0.2–0.3 ms−1 depending on the specific region, which is more than ten times greater than the R2∗ of soft tissue. The water fraction in human skull was measured to be 60%–80%, which is significantly less than the >90% water fraction in brain. High-quality, bone

  10. k-space sampling optimization for ultrashort TE imaging of cortical bone: Applications in radiation therapy planning and MR-based PET attenuation correction

    SciTech Connect

    Hu, Lingzhi E-mail:; Traughber, Melanie; Su, Kuan-Hao; Pereira, Gisele C.; Grover, Anu; Traughber, Bryan; Muzic, Raymond F. Jr. E-mail:


    Purpose: The ultrashort echo-time (UTE) sequence is a promising MR pulse sequence for imaging cortical bone which is otherwise difficult to image using conventional MR sequences and also poses strong attenuation for photons in radiation therapy and PET imaging. The authors report here a systematic characterization of cortical bone signal decay and a scanning time optimization strategy for the UTE sequence through k-space undersampling, which can result in up to a 75% reduction in acquisition time. Using the undersampled UTE imaging sequence, the authors also attempted to quantitatively investigate the MR properties of cortical bone in healthy volunteers, thus demonstrating the feasibility of using such a technique for generating bone-enhanced images which can be used for radiation therapy planning and attenuation correction with PET/MR. Methods: An angularly undersampled, radially encoded UTE sequence was used for scanning the brains of healthy volunteers. Quantitative MR characterization of tissue properties, including water fraction and R2{sup ∗} = 1/T2{sup ∗}, was performed by analyzing the UTE images acquired at multiple echo times. The impact of different sampling rates was evaluated through systematic comparison of the MR image quality, bone-enhanced image quality, image noise, water fraction, and R2{sup ∗} of cortical bone. Results: A reduced angular sampling rate of the UTE trajectory achieves acquisition durations in proportion to the sampling rate and in as short as 25% of the time required for full sampling using a standard Cartesian acquisition, while preserving unique MR contrast within the skull at the cost of a minimal increase in noise level. The R2{sup ∗} of human skull was measured as 0.2–0.3 ms{sup −1} depending on the specific region, which is more than ten times greater than the R2{sup ∗} of soft tissue. The water fraction in human skull was measured to be 60%–80%, which is significantly less than the >90% water fraction in

  11. The blocking of uPAR suppresses lipopolysaccharide‐induced inflammatory osteoclastogenesis and the resultant bone loss through attenuation of integrin β3/Akt pathway

    PubMed Central

    Ishisaki, Akira; Miyashita, Mei; Matsuo, Osamu


    Abstract Introduction Chronic inflammatory diseases, such as rheumatoid arthritis and periodontitis, cause the bone destruction by promotion of the differentiation of monocyte/macrophage lineage cells into mature osteoclasts (OCs) with active bone‐resorbing character. However, the detailed mechanisms underlying this disorder remain unclear. We herein investigated the role of urokinase plasminogen activator receptor (uPAR) in the bone destruction caused by chronic inflammation. Methods We investigated that the effect of uPAR on inflammatory OC formation induced by lipopolysaccharide (LPS) in inflammatory diseases. Results We found that the LPS more weakly induced OC formation and the resultant bone loss in uPAR‐deficient mice than in wild‐type mice. Additionally, we demonstrated that uPAR significantly potentiated LPS‐induced OC formation of RAW264.7 mouse monocyte/macrophage linage cells in integrin β3/Akt‐dependent manner. Moreover, we showed that the blocking of uPAR function by the administration of anti‐uPAR neutralizing antibody significantly attenuated the LPS‐induced OC formation and the resultant bone loss in mice. Conclusions These results strongly suggest that uPAR negatively regulates the LPS‐induced inflammatory OC formation and the resultant bone loss mediated through the integrin β3/Akt pathway. Our findings partly clarify the molecular mechanisms underlying bone destruction caused by chronic inflammatory diseases, and would benefit research on identifying antibody therapy for the treatment of these diseases. PMID:27621816

  12. Mas-Related Gene (Mrg) C Activation Attenuates Bone Cancer Pain via Modulating Gi and NR2B

    PubMed Central

    Lu, Cui’e; Lei, Yishan; Ma, Zhengliang; Gu, Xiaoping


    Objective This study is to investigate the role of Mas-related gene (Mrg) C in the pathogenesis and treatment of bone cancer pain (BCP). Methods BCP mouse model was established by osteosarcoma cell inoculation. Pain-related behaviors were assessed with the spontaneous lifting behavior test and mechanical allodynia test. Expression levels of MrgC, Gi, and NR2B in the spinal cord were detected with Western blot analysis and immunohistochemistry. Results Pain-related behavior tests showed significantly increased spontaneous flinches (NSF) and decreased paw withdrawal mechanical threshold (PWMT) in mouse models of BCP. Western blot analysis showed that, compared with the control group and before modeling, all the expression levels of MrgC, Gi, and NR2B in the spinal cord of BCP mice were dramatically elevated, which were especially increased at day 7 after operation and thereafter, in a time-dependent manner. Moreover, the treatment of MrgC agonist BAM8-22 significantly up-regulated Gi and down-regulated NR2B expression levels, in the spinal cord of BCP mice, in a time-dependent manner. On the other hand, anti-MrgC significantly down-regulated Gi expression, while dramatically up-regulated NR2B expression, in the BCP mice. Similar results were obtained from the immunohistochemical detection. Importantly, BAM8-22 significantly attenuated the nociceptive behaviors in the BCP mice. Conclusion Our results indicated the MrgC-mediated Gi and NR2B expression alterations in the BCP mice, which might contribute to the pain hypersensitivity. These findings may provide a novel strategy for the treatment of BCP in clinic. PMID:27152740

  13. MO-G-17A-03: MR-Based Cortical Bone Segmentation for PET Attenuation Correction with a Non-UTE 3D Fast GRE Sequence

    SciTech Connect

    Ai, H; Pan, T; Hwang, K


    Purpose: To determine the feasibility of identifying cortical bone on MR images with a short-TE 3D fast-GRE sequence for attenuation correction of PET data in PET/MR. Methods: A water-fat-bone phantom was constructed with two pieces of beef shank. MR scans were performed on a 3T MR scanner (GE Discovery™ MR750). A 3D GRE sequence was first employed to measure the level of residual signal in cortical bone (TE{sub 1}/TE{sub 2}/TE{sub 3}=2.2/4.4/6.6ms, TR=20ms, flip angle=25°). For cortical bone segmentation, a 3D fast-GRE sequence (TE/TR=0.7/1.9ms, acquisition voxel size=2.5×2.5×3mm{sup 3}) was implemented along with a 3D Dixon sequence (TE{sub 1}/TE{sub 2}/TR=1.2/2.3/4.0ms, acquisition voxel size=1.25×1.25×3mm{sup 3}) for water/fat imaging. Flip angle (10°), acquisition bandwidth (250kHz), FOV (480×480×144mm{sup 3}) and reconstructed voxel size (0.94×0.94×1.5mm{sup 3}) were kept the same for both sequences. Soft tissue and fat tissue were first segmented on the reconstructed water/fat image. A tissue mask was created by combining the segmented water/fat masks, which was then applied on the fast-GRE image (MRFGRE). A second mask was created to remove the Gibbs artifacts present in regions in close vicinity to the phantom. MRFGRE data was smoothed with a 3D anisotropic diffusion filter for noise reduction, after which cortical bone and air was separated using a threshold determined from the histogram. Results: There is signal in the cortical bone region in the 3D GRE images, indicating the possibility of separating cortical bone and air based on signal intensity from short-TE MR image. The acquisition time for the 3D fast-GRE sequence was 17s, which can be reduced to less than 10s with parallel imaging. The attenuation image created from water-fat-bone segmentation is visually similar compared to reference CT. Conclusion: Cortical bone and air can be separated based on intensity in MR image with a short-TE 3D fast-GRE sequence. Further research is required

  14. Synergistic attenuation of ovariectomy-induced bone loss by combined use of fish oil and 17β-oestradiol.


    Jin, Youri; Lee, Myoungsook; Park, Yongsoon


    Oestrogen and n-3 PUFA, especially EPA and DHA, have been reported to have beneficial effects on bone loss. Thus, the purpose of the present study was to investigate the synergistic bone-protective mechanism of combined treatments of EPA+DHA supplementation and oestrogen injection in ovariectomised rats. Rats were fed a modified American Institute of Nutrition-93G diet with 0 %, 1 % or 2 % n-3 PUFA (EPA+DHA) relative to the total energy intake for 12 weeks. Rats were surgically ovariectomised at week 8, and after a 1-week recovery period rats were injected with either 17β-oestradiol-3-benzoate (E2) or maize oil for the last 3 weeks. Combined use of n-3 PUFA and E2 synergistically increased femoral cortical bone volume, bone mineral content and the bone expression of runt-related transcription factor 2 (RUNX2), but decreased the bone expression of IL-1β. Both n-3 PUFA and E2 decreased the bone expressions of IL-7, TNF-α and PPAR-γ, and increased the bone expression of oestrogen receptor-α. n-3 PUFA in the presence of E2 and E2 alone significantly decreased the bone expressions of IL-1β and IL-6 and increased the bone expression of RUNX2. E2 significantly decreased the serum levels of bone turnover markers and the bone expression of receptor activator of NF-κB ligand, but decreased the bone expression of osteoprotegerin. The combined use of n-3 PUFA and E2 exerted synergistic bone-protective efficacy through up-regulation of RUNX2, an essential transcription factor for bone formation, as well as the suppression of bone-resorbing cytokine IL-1β.

  15. Bone

    NASA Astrophysics Data System (ADS)

    Helmberger, Thomas K.; Hoffmann, Ralf-Thorsten

    The typical clinical signs in bone tumours are pain, destruction and destabilization, immobilization, neurologic deficits, and finally functional impairment. Primary malignant bone tumours are a rare entity, accounting for about 0.2% of all malignancies. Also benign primary bone tumours are in total rare and mostly asymptomatic. The most common symptomatic benign bone tumour is osteoid osteoma with an incidence of 1:2000.

  16. High-fat diet enhances and plasminogen activator inhibitor-1 deficiency attenuates bone loss in mice with Lewis Lung carcinoma

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study determined the effects of a high-fat diet and plasminogen activator inhibitor-1 deficiency (PAI-1-/-) on bone structure in mice bearing Lewis lung carcinoma (LLC) in lungs. Reduction in bone volume fraction (BV/TV) by 22% and 21%, trabecular number (Tb.N) by 8% and 4% and bone mineral de...

  17. Is calcaneal broadband ultrasound attenuation a valid index of dual-energy x-ray absorptiometry-derived bone mass in children?

    PubMed Central

    Hirsch, R.; Nogueira, R. C.; Beck, B. R.


    Objectives The aim of the current study was to assess whether calcaneal broadband ultrasound attenuation (BUA) can predict whole body and regional dual-energy x-ray absorptiometry (DXA)-derived bone mass in healthy, Australian children and adolescents at different stages of maturity. Methods A total of 389 boys and girls across a wide age range (four to 18 years) volunteered to participate. The estimated age of peak height velocity (APHV) was used to classify children into pre-, peri-, and post-APHV groups. BUA was measured at the non-dominant heel with quantitative ultrasonometry (QUS) (Lunar Achilles Insight, GE), while bone mineral density (BMD) and bone mineral content (BMC) were examined at the femoral neck, lumbar spine and whole body (DXA, XR-800, Norland). Associations between BUA and DXA-derived measures were examined with Pearson correlations and linear regression. Participants were additionally ranked in quartiles for QUS and DXA measures in order to determine agreement in rankings. Results For the whole sample, BUA predicted 29% of the study population variance in whole body BMC and BMD, 23% to 24% of the study population variance in lumbar spine BMC and BMD, and 21% to 24% of the variance in femoral neck BMC and BMD (p < 0.001). BUA predictions were strongest for the most mature participants (pre-APHV R2 = 0.03 to 0.19; peri-APHV R2 = 0.05 to 0.17; post-APHV R2 = 0.18 to 0.28) and marginally stronger for girls (R2 = 0.25-0.32, p < 0.001) than for boys (R2 = 0.21-0.27, p < 0.001). Agreement in quartile rankings between QUS and DXA measures of bone mass was generally poor (27.3% to 38.2%). Conclusion Calcaneal BUA has a weak to moderate relationship with DXA measurements of bone mass in children, and has a tendency to misclassify children on the basis of quartile rankings. Cite this article: B. K. Weeks, R. Hirsch, R. C. Nogueira, B. R. Beck. Is calcaneal broadband ultrasound attenuation a valid index of dual-energy x-ray absorptiometry-derived bone mass

  18. The inhibitor of calcium/calmodulin-dependent protein kinase II KN93 attenuates bone cancer pain via inhibition of KIF17/NR2B trafficking in mice.


    Liu, Yue; Liang, Ying; Hou, Bailing; Liu, Ming; Yang, Xuli; Liu, Chenglong; Zhang, Juan; Zhang, Wei; Ma, Zhengliang; Gu, Xiaoping


    The N-methyl-d-aspartate receptor (NMDAR) containing subunit 2B (NR2B) is critical for the regulation of nociception in bone cancer pain, although the precise molecular mechanisms remain unclear. KIF17, a kinesin motor, plays a key role in the dendritic transport of NR2B. The up-regulation of NR2B and KIF17 transcription results from an increase in phosphorylated cAMP-response element-binding protein (CREB), which is activated by calcium/calmodulin-dependent protein kinase II (CaMKII). In this study, we hypothesized that CaMKII-mediated KIF17/NR2B trafficking may contribute to bone cancer pain. Osteosarcoma cells were implanted into the intramedullary space of the right femurs of C3H/HeJ mice to induce progressive bone cancer-related pain behaviors. The expression of spinal t-CaMKII, p-CaMKII, NR2B and KIF17 after inoculation was also evaluated. These results showed that inoculation of osteosarcoma cells induced progressive bone cancer pain and resulted in a significant up-regulation of p-CaMKII, NR2B and KIF17 expression after inoculation. Intrathecal administration of KN93, a CaMKII inhibitor, down-regulated these three proteins and attenuated bone cancer pain in a dose- and time-dependent manner. These findings indicated that CaMKII-mediated KIF17/NR2B trafficking may contribute to bone cancer pain, and inhibition of CaMKII may be a useful alternative or adjunct therapy for relieving cancer pain.

  19. Dihydroartemisinin prevents breast cancer-induced osteolysis via inhibiting both breast caner cells and osteoclasts.


    Feng, Ming-Xuan; Hong, Jian-Xin; Wang, Qiang; Fan, Yong-Yong; Yuan, Chi-Ting; Lei, Xin-Huan; Zhu, Min; Qin, An; Chen, Hai-Xiao; Hong, Dun


    Bone is the most common site of distant relapse in breast cancer, leading to severe complications which dramatically affect the patients' quality of life. It is believed that the crosstalk between metastatic breast cancer cells and osteoclasts is critical for breast cancer-induced osteolysis. In this study, the effects of dihydroartemisinin (DHA) on osteoclast formation, bone resorption, osteoblast differentiation and mineralization were initially assessed in vitro, followed by further investigation in a titanium-particle-induced osteolysis model in vivo. Based on the proved inhibitory effect of DHA on osteolysis, DHA was further applied to MDA-MB-231 breast cancer-induced mouse osteolysis model, with the underlying molecular mechanisms further investigated. Here, we verified for the first time that DHA suppressed osteoclast differentiation, F-actin ring formation and bone resorption through suppressing AKT/SRC pathways, leading to the preventive effect of DHA on titanium-particle-induced osteolysis without affecting osteoblast function. More importantly, we demonstrated that DHA inhibited breast tumor-induced osteolysis through inhibiting the proliferation, migration and invasion of MDA-MB-231 cells via modulating AKT signaling pathway. In conclusion, DHA effectively inhibited osteoclastogenesis and prevented breast cancer-induced osteolysis.

  20. Increased circulating estradiol in mice fed a high-fat diet does not attenuate ovariectomy-induced bone structural deterioration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ovariectomy-induced estrogen deficiency increases adiposity and induces substantial bone loss by increasing osteoclast activity. This study investigated whether obesity induced by a high-fat diet alter circulating estradiol levels, mitigates or exacerbates bone structure deterioration, and changes m...

  1. Dried Plum Protects From Radiation-Induced Bone Loss by Attenuating Pro-Osteoclastic and Oxidative Stress Responses

    NASA Technical Reports Server (NTRS)

    Globus, Ruth


    Future space explorations beyond the earths magnetosphere will increase human exposure to space radiation and associated risks to skeletal health. We hypothesize that oxidative stress resulting from radiation exposure plays a major role in progressive bone loss and dysfunction in associated tissue. In animal studies, increased free radical formation is associated with pathological changes in bone structure, enhanced bone resorption, reduced bone formation and decreased bone mineral density, which can lead to skeletal fragility. Our long-term goals are to define the mechanisms and risk of bone loss in the spaceflight environment and to facilitate the development of effective countermeasures. We had previously reported that exposure to low or high-LET radiation correlates with an acute increase in the expression of pro-osteoclastic and oxidative stress genes in bone during the early response to radiation followed by pathological changes in skeletal structure. We then conducted systematic screening for potential countermeasures against bone loss where we tested the ability of various antioxidants to mitigate the radiation-induced increase in expression of these markers. For the screen, 16-week old C57Bl6J mice were treated with a dietary antioxidant cocktail, injectable DHLA or a dried plum-enriched diet (DP). Mice were then exposed to 2Gy 137Cs radiation and one day later, marrow cells were collected and the relevant genes analyzed for expression levels. Among the candidate countermeasures tested, DP was most effective in reducing the expression of genes associated with bone loss. Furthermore, analysis of skeletal structure by microcomputed tomography (microCT) revealed that DP also prevents the radiation-induced deterioration in skeletal microarchitecture as indicated by parameters such as percent bone volume (BVTV), trabecular spacing and trabecular number. We also found that DP has similar protective effects on skeletal structure in a follow-up study using 1 Gy of

  2. Attenuated Wnt/β-catenin signalling mediates methotrexate chemotherapy-induced bone loss and marrow adiposity in rats.


    Georgiou, Kristen R; King, Tristan J; Scherer, Michaela A; Zhou, Hong; Foster, Bruce K; Xian, Cory J


    Cancer chemotherapy often causes significant bone loss, marrow adiposity and haematopoietic defects, yet the underlying mechanisms and recovery potential remain unclear. Wnt/β-catenin signalling is integral to the regulation of osteogenesis, adipogenesis and haematopoiesis; using a rat model, the current study investigated roles of this signalling pathway in changes to bone marrow stromal and haematopoietic cell differentiation after chemotherapy with methotrexate (MTX), a commonly used antimetabolite. MTX treatment in rats (5 daily administrations at 0.75 mg/kg) has previously been found to decrease bone volume and increase marrow fat, which was associated with increased osteoclastogenesis in haematopoietic cells and with an osteogenesis to adipogenesis switch in bone marrow stromal cells of treated rats. In the current study, on day 6 after the first MTX dose we found that accompanying these changes as well as a suppressed haematopoietic cellularity but increased granulocyte/macrophage differentiation potential, there was an increase in mRNA expression of Wnt antagonists sFRP-1 and Dkk-1 in bone, a reduction in nuclear β-catenin protein in bone marrow stromal cells, and decreased mRNA levels of β-catenin target genes lef-1, cyclin D1 and survivin, suggesting reduced activation of Wnt/β-catenin signalling in the bone during MTX-induced damage. Concurrent administration of BIO, a GSK-3β inhibitor that stabilises β-catenin, partially abrogated the MTX-induced transient changes in osteogenic/adipogenic commitment, granulocyte/macrophage lineage differentiation and osteoclast number. These findings demonstrate a potentially important role of Wnt/β-catenin signalling in MTX chemotherapy-induced cellular changes to the bone marrow microenvironment.

  3. Isopsoralen-mediated suppression of bone marrow adiposity and attenuation of the adipogenic commitment of bone marrow-derived mesenchymal stem cells

    PubMed Central

    Wang, Jian; Li, Sheng-Fa; Wang, Ting; Sun, Chun-Han; Wang, Liang; Huang, Min-Jun; Chen, Jian; Zheng, Shao-Wei; Wang, Nan; Zhang, Ying-Jun; Chen, Tian-Yu


    Osteoporosis (OP) increases the risk of bone fractures and other complications, and is thus a major clinical problem. In this study, we examined the effect of isopsoralen on the differentiation of bone-derived marrow mesenchymal stem cells (BMSCs) into osteoblasts and adipocytes, as well as bone formation under osteoporotic conditions. Primary femoral BMSCs isolated from C57BL/6 mice were used to evaluate the isopsoralen-mediated regulation of the expression of alkaline phosphatase (ALP), osteocalcin (OCN) and runt-related transcription factor 2 (RUNX2) during osteogenesis 2 weeks. We also examined the expression of peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein β (C/EBPβ) under adipogenic conditions for 1 and 2 weeks. In addition, ovariectomized (OVX) mice were used to examine the effects of isopsoralen on bone formation for 2 months. Finally, mammalian target of rapamycin complex 1 (mTORC1) signaling was examined under osteogenic and adipogenic conditions. We found that following treatment with isopsoralen, the expression levels of ALP, OCN and RUNX2 were upregulated, whereas those of PPARγ and C/EBPβ were downregulated. mTORC1 signaling was also inhibited in vitro and in vivo. In the OVX mice that were intragastrically administered isopsoralen, bone parameters (trabecular thickness, bone volume/total volume and trabecular number) in the distal femoral metaphysis were significantly increased and the adipocyte number was decreased. On the whole, our findings demonstrate that isopsoralen promoted BMSC differentiation into osteoblasts and suppressed differentiation into adipocytes. PMID:28204811

  4. Isopsoralen-mediated suppression of bone marrow adiposity and attenuation of the adipogenic commitment of bone marrow-derived mesenchymal stem cells.


    Wang, Jian; Li, Sheng-Fa; Wang, Ting; Sun, Chun-Han; Wang, Liang; Huang, Min-Jun; Chen, Jian; Zheng, Shao-Wei; Wang, Nan; Zhang, Ying-Jun; Chen, Tian-Yu


    Osteoporosis (OP) increases the risk of bone fractures and other complications, and is thus a major clinical problem. In this study, we examined the effect of isopsoralen on the differentiation of bone-derived marrow mesenchymal stem cells (BMSCs) into osteoblasts and adipocytes, as well as bone formation under osteoporotic conditions. Primary femoral BMSCs isolated from C57BL/6 mice were used to evaluate the isopsoralen-mediated regulation of the expression of alkaline phosphatase (ALP), osteocalcin (OCN) and runt-related transcription factor 2 (RUNX2) during osteogenesis 2 weeks. We also examined the expression of peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein β (C/EBPβ) under adipogenic conditions for 1 and 2 weeks. In addition, ovariectomized (OVX) mice were used to examine the effects of isopsoralen on bone formation for 2 months. Finally, mammalian target of rapamycin complex 1 (mTORC1) signaling was examined under osteogenic and adipogenic conditions. We found that following treatment with isopsoralen, the expression levels of ALP, OCN and RUNX2 were upregulated, whereas those of PPARγ and C/EBPβ were downregulated. mTORC1 signaling was also inhibited in vitro and in vivo. In the OVX mice that were intragastrically administered isopsoralen, bone parameters (trabecular thickness, bone volume/total volume and trabecular number) in the distal femoral metaphysis were significantly increased and the adipocyte number was decreased. On the whole, our findings demonstrate that isopsoralen promoted BMSC differentiation into osteoblasts and suppressed differentiation into adipocytes.

  5. Anti-Osteoclastic Activity of Artemisia capillaris Thunb. Extract Depends upon Attenuation of Osteoclast Differentiation and Bone Resorption-Associated Acidification Due to Chlorogenic Acid, Hyperoside, and Scoparone

    PubMed Central

    Lee, Sang-Hyun; Lee, Jung-Yun; Kwon, Young-In; Jang, Hae-Dong


    The present study attempts to elucidate the anti-osteoporotic activity of Artemisia capillaris Thunb. in the form of anti-osteoclastic effect and responsible bioactive compounds. The contents of chlorogenic acid, caffeic acid, hyperoside, isoquercitrin, isochlorogenic acid A, and scoparone in Artemisia capillaris hydroethanolic extract (ACHE) were 38.53, 0.52, 4.07, 3.03, 13.90, and 6.59 mg/g, respectively. ACHE diminished osteoclast differentiation and bone resorption due to chlorogenic acid, hyperoside, and scoparone. In addition, ACHE attenuated acidification as well as reducing tumor necrosis factor receptor-associated factor 6 (TRAF6) expression and its association with vacuolar H+-adenosine triphosphatase (V-ATPase). Furthermore, chlorogenic acid, hyperoside, and scoparone from A. capillaris abrogated the association of V-ATPase with TRAF6, suggesting that the blockage of bone resorption by A. capillaris was partially mediated by reducing acidification through down-regulating interaction of V-ATPase with TRAF6 due to scoparone as well as chlorogenic acid and hyperoside. These results imply that the anti-osteoclastic effect of A. capillaris through down-regulating osteoclast differentiation and bone resorption may contribute to its anti-osteoporotic effect. PMID:28165389

  6. Heme oxygenase-1 attenuates acute pulmonary inflammation by decreasing the release of segmented neutrophils from the bone marrow.


    Konrad, Franziska M; Braun, Stefan; Ngamsri, Kristian-Christos; Vollmer, Irene; Reutershan, Jörg


    Recruiting polymorphonuclear neutrophil granulocytes (PMNs) from circulation and bone marrow to the site of inflammation is one of the pivotal mechanisms of the innate immune system. During inflammation, the enzyme heme oxygenase 1 (HO-1) has been shown to reduce PMN migration. Although these effects have been described in various models, underlying mechanisms remain elusive. Recent studies revealed an influence of HO-1 on different cells of the bone marrow. We investigated the particular role of the bone marrow in terms of HO-1-dependent pulmonary inflammation. In a murine model of LPS inhalation, stimulation of HO-1 by cobalt (III) protoporphyrin-IX-chloride (CoPP) resulted in reduced segmented PMN migration into the alveolar space. In the CoPP group, segmented PMNs were also decreased intravascularly, and concordantly, mature and immature PMN populations were higher in the bone marrow. Inhibition of the enzyme by tin protoporphyrin-IX increased segmented and banded PMN migration into the bronchoalveolar lavage fluid with enhanced PMN release from the bone marrow and aggravated parameters of tissue inflammation. Oxidative burst activity was significantly higher in immature compared with mature PMNs. The chemokine stromal-derived factor-1 (SDF-1), which mediates homing of leukocytes into the bone marrow and is decreased in inflammation, was increased by CoPP. When SDF-1 was blocked by the specific antagonist AMD3100, HO-1 activation was no longer effective in curbing PMN trafficking to the inflamed lungs. In conclusion, we show evidence that the anti-inflammatory effects of HO-1 are largely mediated by inhibiting the release of segmented PMNs from the bone marrow rather than direct effects within the lung.

  7. A calcium-collagen chelate dietary supplement attenuates bone loss in postmenopausal women with osteopenia: a randomized controlled trial.


    Elam, Marcus L; Johnson, Sarah A; Hooshmand, Shirin; Feresin, Rafaela G; Payton, Mark E; Gu, Jennifer; Arjmandi, Bahram H


    Menopause leads to an increased risk for osteoporosis in women. Although drug therapies exist, increasing numbers of people prefer alternative therapies such as dietary supplements, for example, calcium, vitamin D, and collagen hydrolysates for the prevention and treatment of osteoporosis. We have previously shown that a 3-month intervention using a calcium-collagen chelate (CC) dietary supplement was efficacious in improving bone mineral density (BMD) and blood biomarkers of bone turnover in osteopenic postmenopausal women. This study reports the long-term efficacy of CC in reducing bone loss in postmenopausal women with osteopenia. Thirty-nine women were randomly assigned to one of two groups: 5 g of CC containing 500 mg of elemental calcium and 200 IU vitamin D (1,25-dihydroxyvitamin D3) or control (500 mg of calcium and 200 IU vitamin D) daily for 12 months. Total body, lumbar, and hip BMD were evaluated at baseline, 6 and 12 months using dual-energy X-ray absorptiometry. Blood was collected at baseline, 6 and 12 months to assess levels of blood biomarkers of bone turnover. Intent-to-treat (ITT) analysis was performed using repeated measures analysis of variance pairwise comparisons and multivariate analysis to assess time and group interactions. The loss of whole body BMD in women taking CC was substantially lower than that of the control group at 12 months in those who completed the study and the ITT analysis, respectively (CC: -1.33% and -0.33% vs. control: -3.75% and -2.17%; P=.026, P=.035). The CC group had significantly reduced levels of sclerostin and tartrate-resistant acid phosphatase isoform 5b (TRAP5b) (P<.05), and higher bone-specific alkaline phosphatase/TRAP5b ratio (P<.05) than control at 6 months. These results support the use of CC in reducing bone loss in osteopenic postmenopausal women.

  8. Norisoboldine, an Anti-Arthritis Alkaloid Isolated from Radix Linderae, Attenuates Osteoclast Differentiation and Inflammatory Bone Erosion in an Aryl Hydrocarbon Receptor-Dependent Manner.


    Wei, Zhi-feng; Lv, Qi; Xia, Ying; Yue, Meng-fan; Shi, Can; Xia, Yu-feng; Chou, Gui-xin; Wang, Zheng-tao; Dai, Yue


    Norisoboldine (NOR), the primary isoquinoline alkaloid constituent of the root of Lindera aggregata, has previously been demonstrated to attenuate osteoclast (OC) differentiation. Accumulative evidence has shown that aryl hydrocarbon receptor (AhR) plays an important role in regulating the differentiation of various cells, and multiple isoquinoline alkaloids can modulate AhR. In the present study, we explored the role of NOR in the AhR signaling pathway. These data showed that the combination of AhR antagonist resveratrol (Res) or α-naphthoflavone (α-NF) nearly reversed the inhibition of OC differentiation through NOR. NOR could stably bind to AhR, up-regulate the nuclear translocation of AhR, and enhance the accumulation of the AhR-ARNT complex, AhR-mediated reporter gene activity and CYP1A1 expression in RAW 264.7 cells, suggesting that NOR might be an agonist of AhR. Moreover, NOR inhibited the nuclear translocation of NF-κB-p65, resulting in the evident accumulation of the AhR-NF-κB-p65 complex, which could be markedly inhibited through either Res or α-NF. Although NOR only slightly affected the expression of HIF-1α, NOR markedly reduced VEGF mRNA expression and ARNT-HIF-1α complex accumulation. In vivo studies indicated that NOR decreased the number of OCs and ameliorated the bone erosion in the joints of rats with collagen-induced arthritis, accompanied by the up-regulation of CYP1A1 and the down-regulation of VEGF mRNA expression in the synovium of rats. A combination of α-NF nearly completely reversed the effects of NOR. In conclusion, NOR attenuated OC differentiation and bone erosion through the activation of AhR and the subsequent inhibition of both NF-κB and HIF pathways.

  9. Bone marrow mesenchymal stem cells attenuate 2,5-hexanedione-induced neuronal apoptosis through a NGF/AKT-dependent pathway

    PubMed Central

    Wang, Qingshan; Sun, Guohua; Gao, Chenxue; Feng, Lina; Zhang, Yan; Hao, Jie; Zuo, Enjun; Zhang, Cong; Li, Shuangyue; Piao, Fengyuan


    Growing evidence suggests that the increased neuronal apoptosis is involved in n-hexane-induced neuropathy. We have recently reported that bone marrow-mesenchymal stem cells-derived conditioned medium (BMSC-CM) attenuated 2,5-hexanedione (HD, the active metabolite of n-hexane)-induced apoptosis in PC12 cells. Here, we explored the anti-apoptotic efficacy of BMSC in vivo. HD-treated rats received BMSC by tail vein injection 5 weeks after HD intoxication. We found that in grafted rats, BMSC significantly attenuated HD-induced neuronal apoptosis in the spinal cord, which was associated with elevation of nerve growth factor (NGF). Neutralization of NGF in BMSC-CM blocked the protection against HD-induced apoptosis in VSC4.1 cells, suggesting that NGF is essential for BMSC-afforded anti-apoptosis. Mechanistically, we found that the decreased activation of Akt induced by HD was significantly recovered in the spinal cord by BMSC and in VSC4.1 cells by BMSC-CM in a TrkA-dependent manner, leading to dissociation of Bad/Bcl-xL complex in mitochondria and release of anti-apoptotic Bcl-xL. The importance of Akt was further corroborated by showing the reduced anti-apoptotic potency of BMSC in HD-intoxicated VSC4.1 cells in the presence of Akt inhibitor, MK-2206. Thus, our findings show that BMSC attenuated HD-induced neuronal apoptosis in vivo through a NGF/Akt-dependent manner, providing a novel solution against n-hexane-induced neurotoxicity. PMID:27703213

  10. Simultaneous screening for osteoporosis at CT colonography: bone mineral density assessment using MDCT attenuation techniques compared with the DXA reference standard.


    Pickhardt, Perry J; Lee, Lawrence J; del Rio, Alejandro Muñoz; Lauder, Travis; Bruce, Richard J; Summers, Ron M; Pooler, B Dustin; Binkley, Neil


    The purpose of this study was to evaluate the utility of lumbar spine attenuation measurement for bone mineral density (BMD) assessment at screening computed tomographic colonography (CTC) using central dual-energy X-ray absorptiometry (DXA) as the reference standard. Two-hundred and fifty-two adults (240 women and 12 men; mean age 58.9 years) underwent CTC screening and central DXA BMD measurement within 2 months (mean interval 25.0 days). The lowest DXA T-score between the spine and hip served as the reference standard, with low BMD defined per World Health Organization as osteoporosis (DXA T-score ≤ -2.5) or osteopenia (DXA T-score between -1.0 and -2.4). Both phantomless quantitative computed tomography (QCT) and simple nonangled region-of-interest (ROI) multi-detector CT (MDCT) attenuation measurements were applied to the T(12) -L(5) levels. The ability to predict osteoporosis and low BMD (osteoporosis or osteopenia) by DXA was assessed. A BMD cut-off of 90 mg/mL at phantomless QCT yielded 100% sensitivity for osteoporosis (29 of 29) and a specificity of 63.8% (143 of 224); 87.2% (96 of 110) below this threshold had low BMD and 49.6% (69 of 139) above this threshold had normal BMD at DXA. At L(1) , a trabecular ROI attenuation cut-off of 160 HU was 100% sensitive for osteoporosis (29 of 29), with a specificity of 46.4% (104 of 224); 83.9% (125 of 149) below this threshold had low BMD and 57.5% (59/103) above had normal BMD at DXA. ROI performance was similar at all individual T(12) -L(5) levels. At ROC analysis, AUC for osteoporosis was 0.888 for phantomless QCT [95% confidence interval (CI) 0.780-0.946] and ranged from 0.825 to 0.853 using trabecular ROIs at single lumbar levels (0.864; 95% CI 0.752-0.930 at multivariate analysis). Supine-prone reproducibility was better with the simple ROI method compared with QCT. It is concluded that both phantomless QCT and simple ROI attenuation measurements of the lumbar spine are effective for BMD screening at CTC

  11. β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease.


    Silva, Viviam de Oliveira; Lobato, Raquel Vieira; Andrade, Eric Francelino; de Macedo, Cristina Gomes; Napimoga, Juliana Trindade Clemente; Napimoga, Marcelo Henrique; Messora, Michel Reis; Murata, Ramiro Mendonça; Pereira, Luciano José


    The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p < 0.05). β-glucans reduced blood glucose, cholesterol and triacylglycerol levels in diabetic animals, both with and without periodontal disease (p < 0.05). Furthermore, treatment with β-glucans reduced the expression of cyclooxygenase-2 and receptor activator of nuclear factor kappa-B ligand and increased osteoprotegerin expression in animals with diabetes and periodontal disease (p < 0.05). It was concluded that treatment with β-glucans has beneficial metabolic and periodontal effects in diabetic rats with periodontal disease.

  12. Evaluation of imaging technologies to correct for photon attenuation in the overlying tissue for in vivo bone strontium measurements

    NASA Astrophysics Data System (ADS)

    Heirwegh, C. M.; Chettle, D. R.; Pejović-Milić, A.


    The interpretation of measurements of bone strontium in vivo using energy dispersive x-ray fluorescence spectroscopy is presently hindered by overlying skin and soft-tissue absorption of the strontium x-rays. The use of imaging technologies to measure the overlying soft-tissue thickness at the index finger measuring site might allow correction of the strontium reading to estimate its concentration in bone. An examination of magnetic resonance (MR), computed tomography (CT) and high-frequency ultrasound (US) imaging technologies revealed that 55 MHz US had the smallest range of measurement uncertainty at 3.2% followed by 1 Tesla MR, 25 MHz US, 8 MHz US and CT at 4.3, 5.4, 6.6 and 7.1% uncertainty, respectively. Of these, only CT imaging appeared to underestimate total thickness (p < 0.05). Furthermore, an inter-study comparison on the accuracy of US measurements of the overlying tissue thickness at finger and ankle in nine subjects was investigated. The 8 MHz US system used in prior in vivo experiments was found to perform satisfactorily in a repeat study of ankle measurements, but indicated that finger thickness measurements may have been misread in previous studies by up to 17.7% (p < 0.025). Repeat ankle measurements were not significantly different from initial measurements at 2.2% difference.

  13. Suppression of Wnt signaling by Dkk1 attenuates PTH-mediated stromal cell response and new bone formation.


    Guo, Jun; Liu, Minlin; Yang, Dehong; Bouxsein, Mary L; Saito, Hiroaki; Galvin, R J Sells; Kuhstoss, Stuart A; Thomas, Clare C; Schipani, Ernestina; Baron, Roland; Bringhurst, F Richard; Kronenberg, Henry M


    Parathyroid hormone (PTH) suppresses Dickkopf 1 (Dkk1) expression in osteoblasts. To determine whether this suppression is essential for PTH-mediated Wnt signaling and bone formation, we examined mice that overexpress Dkk1 in osteoblasts (Dkk1 mice). Dkk1 mice were osteopenic due to abnormal osteoblast and osteoclast activity. When fed a low-calcium diet, and in two other models of hyperparathyroidism, these mice failed to develop the peritrabecular stromal cell response ("osteitis fibrosis") and new bone formation seen in wild-type mice. Despite these effects of Dkk1 overexpression, PTH still activated Wnt signaling in Dkk1 mice and in osteoblastic cells cultured from these mice. In cultured MC3T3E1 preosteoblastic cells, PTH dramatically suppressed Dkk1 expression, induced PKA-mediated phosphorylation of beta-catenin, and significantly enhanced Lef1 expression. Our findings indicate that the full actions of PTH require intact Wnt signaling but that PTH can activate the Wnt pathway despite overexpression of Dkk1.

  14. β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

    PubMed Central


    The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p < 0.05). β-glucans reduced blood glucose, cholesterol and triacylglycerol levels in diabetic animals, both with and without periodontal disease (p < 0.05). Furthermore, treatment with β-glucans reduced the expression of cyclooxygenase-2 and receptor activator of nuclear factor kappa-B ligand and increased osteoprotegerin expression in animals with diabetes and periodontal disease (p < 0.05). It was concluded that treatment with β-glucans has beneficial metabolic and periodontal effects in diabetic rats with periodontal disease. PMID:26291983

  15. Mitochondrial calcium uniporter inhibition attenuates mouse bone marrow-derived mast cell degranulation induced by beta-1,3-glucan

    PubMed Central

    Cuong, Dang Van; Kim, Hyoung Kyu; Marquez, Jubert; Kim, Nari; Ko, Kyung Soo; Rhee, Byoung Doo


    Mast cells are primary mediators of allergic inflammation. Beta-1,3-glucan (BG) protects against infection and shock by activating immune cells. Activation of the BG receptor induces an increase in intracellular Ca2+, which may induce exocytosis. However, little is known about the precise mechanisms underlying BG activation of immune cells and the possible role of mitochondria in this process. The present study examined whether BG induced mast cell degranulation, and evaluated the role of calcium transients during mast cell activation. Our investigation focused on the role of the mitochondrial calcium uniporter (MCU) in BG-induced degranulation. Black mouse (C57) bone marrow-derived mast cells were stimulated with 0.5 µg/ml BG, 100 µg/ml peptidoglycan (PGN), or 10 µM A23187 (calcium ionophore), and dynamic changes in cytosolic and mitochondrial calcium and membrane potential were monitored. BG-induced mast cell degranulation occurred in a time-dependent manner, and was significantly reduced under calcium-free conditions. Ruthenium red, a mitochondrial Ca2+ uniporter blocker, significantly reduced mast cell degranulation induced by BG, PGN, and A23187. These results suggest that the mitochondrial Ca2+ uniporter has an important regulatory role in BG-induced mast cell degranulation. PMID:26937218

  16. Lymphocytes with Aberrant Expression of Fas or Fas-ligand Attenuate Immune Bone Marrow Failure in a Mouse Model

    PubMed Central

    Omokaro, Stephanie O.; Desierto, Marie J.; Eckhaus, Michael A.; Ellison, Felicia M.; Chen, Jichun; Young, Neal S.


    Bone marrow (BM) and lymphocyte samples from aplastic anemia patients show up-regulated Fas and Fas-ligand (FasL) expression respectively, supporting a relationship between immune-mediated BM destruction and the Fas apoptotic pathway. Mice with spontaneous lymphoproliferation (lpr) and generalized lymphoproliferative disease (gld) mutations exhibit abnormal expression of Fas and FasL; serving as potential models to elucidate underlying mechanisms of BM failure. We examined cellular and functional characteristics of lpr and gld mutants on the C57BL/6 (B6) background. Lymph node (LN) cells from lpr and gld mice produced less apoptosis when co-incubated with C.B10-H2b/LilMcd (C.B10) BM cells in vitro. This functional difference was confirmed by infusing lpr, gld, and B6 LN cells into sub-lethally irradiated CB10 mice; all donor LN cells showed significant T cell expansion and activation but only B6 LN cells caused severe BM destruction. Mice infused with gld LN cells developed mild to moderate BM failure, despite receiving FasL-deficient effectors, thus suggesting the existence of alternative pathways or incomplete penetrance of the mutation. Paradoxically, mice that received Fas-deficient lpr LN cells also had reduced BM failure, likely due to down-regulation of pro-apoptotic genes, an effect that can be overcome by higher doses of lpr LN cells. Our model demonstrates that abnormal Fas or FasL expression interferes with the development of pancytopenia and marrow hypoplasia, validating a major role for the Fas/FasL cytotoxic pathway in immune-mediated BM failure, although disruption of this pathway does not completely abolish marrow destruction. PMID:19265119

  17. Lymphocytes with aberrant expression of Fas or Fas ligand attenuate immune bone marrow failure in a mouse model.


    Omokaro, Stephanie O; Desierto, Marie J; Eckhaus, Michael A; Ellison, Felicia M; Chen, Jichun; Young, Neal S


    Bone marrow (BM) and lymphocyte samples from aplastic anemia patients show up-regulated Fas and Fas-ligand (FasL) expression, respectively, supporting a relationship between immune-mediated BM destruction and the Fas apoptotic pathway. Mice with spontaneous lymphoproliferation (lpr) and generalized lymphoproliferative disease (gld) mutations exhibit abnormal expression of Fas and FasL, serving as potential models to elucidate underlying mechanisms of BM failure. We examined cellular and functional characteristics of lpr and gld mutants on the C57BL/6 (B6) background. Lymph node (LN) cells from lpr and gld mice produced less apoptosis when coincubated with C.B10-H2(b)/LilMcd (C.B10) BM cells in vitro. This functional difference was confirmed by infusing lpr, gld, and B6 LN cells into sublethally irradiated CB10 mice. All donor LN cells showed significant T cell expansion and activation, but only B6 LN cells caused severe BM destruction. Mice infused with gld LN cells developed mild to moderate BM failure despite receiving FasL-deficient effectors, thus suggesting the existence of alternative pathways or incomplete penetrance of the mutation. Paradoxically, mice that received Fas-deficient lpr LN cells also had reduced BM failure, likely due to down-regulation of proapoptotic genes, an effect that can be overcome by higher doses of lpr LN cells. Our model demonstrates that abnormal Fas or FasL expression interferes with the development of pancytopenia and marrow hypoplasia, validating a major role for the Fas/FasL cytotoxic pathway in immune-mediated BM failure, although disruption of this pathway does not completely abolish marrow destruction.

  18. CD147 deficiency blocks IL-8 secretion and inhibits lung cancer-induced osteoclastogenesis.


    Wang, Hongkai; Zhuo, Yunyun; Hu, Xu; Shen, Weiwei; Zhang, Ying; Chu, Tongwei


    Bone is a frequent target of lung cancer metastasis, which is associated with significant morbidity and poor prognosis; however, the molecular basis of this process is still unknown. This study investigated the role of extracellular matrix metalloproteinase inducer (also known as cluster of differentiation (CD)147) in osteoclastogenesis resulting from bone metastasis, based on the enrichment of this glycoprotein on the surface of many malignant bone tumors. RNA interference was used to silence CD147 expression in A549 human lung cancer cells. Compared with conditioned medium (CM) from control cells (A549-CM), CM from CD147-deficient cells (A549-si-CM) suppressed receptor activator of nuclear factor κB ligand-stimulated osteoclastogenesis in RAW 264.7 cells and bone marrow-derived macrophages. The mRNA levels of osteoclast-specific genes such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K were also reduced in the presence of A549-si-CM. CD147 knockdown in A549 cells decreased interleukin (IL)-8mRNA and protein expression. IL-8 is present in large amounts in A549-CM and mimicked its inductive effect on osteoclastogenesis; this was reversed by depletion of IL-8 from the medium. Taken together, these results indicate that CD147 promotes lung cancer-induced osteoclastogenesis by modulating IL-8 secretion, and suggest that CD147 is a potential therapeutic target for cancer-associated bone resorption in lung cancer patients.

  19. Citrus unshiu peel extract alleviates cancer-induced weight loss in mice bearing CT-26 adenocarcinoma

    PubMed Central

    Kim, Aeyung; Im, Minju; Gu, Min Jung; Ma, Jin Yeul


    Skeletal muscle atrophy is a critical feature of cancer-induced cachexia, caused by pro-cachectic factors secreted by host cells and tumor cells. Therefore, blockade of these factors has considered a reasonable target for pharmacological and nutritional interventions to prevent skeletal muscle loss under cancer-induced cachexia. Citrus unshiu peel (CUP) has been used for treating the common cold, dyspepsia, and bronchial discomfort and reported to have pharmacological activities against inflammation, allergy, diabetes, and viral infection. In the present study, we observed that daily oral administration of water extract of CUP (WCUP) to male BALB/c mice bearing CT-26 adenocarcinoma remarkably reduced the losses in final body weight, carcass weight, gastrocnemius muscle, epididymal adipose tissue, and hemoglobin (Hb), compared with saline treatment. The levels of serum IL-6 and muscle-specific E3 ligases elevated by tumor burden were also considerably reduced by WCUP administration. In an in vitro experiment, WCUP efficiently suppressed the production of pro-cachectic cytokines in immune cells as well as cancer cells. In addition, WCUP treatment attenuated C2C12 skeletal muscle cell atrophy caused by cancer cells. These findings collectively suggest that WCUP is beneficial as a nutritional supplement for the management of cancer patients with severe weight loss. PMID:27064118

  20. Citrus unshiu peel extract alleviates cancer-induced weight loss in mice bearing CT-26 adenocarcinoma.


    Kim, Aeyung; Im, Minju; Gu, Min Jung; Ma, Jin Yeul


    Skeletal muscle atrophy is a critical feature of cancer-induced cachexia, caused by pro-cachectic factors secreted by host cells and tumor cells. Therefore, blockade of these factors has considered a reasonable target for pharmacological and nutritional interventions to prevent skeletal muscle loss under cancer-induced cachexia. Citrus unshiu peel (CUP) has been used for treating the common cold, dyspepsia, and bronchial discomfort and reported to have pharmacological activities against inflammation, allergy, diabetes, and viral infection. In the present study, we observed that daily oral administration of water extract of CUP (WCUP) to male BALB/c mice bearing CT-26 adenocarcinoma remarkably reduced the losses in final body weight, carcass weight, gastrocnemius muscle, epididymal adipose tissue, and hemoglobin (Hb), compared with saline treatment. The levels of serum IL-6 and muscle-specific E3 ligases elevated by tumor burden were also considerably reduced by WCUP administration. In an in vitro experiment, WCUP efficiently suppressed the production of pro-cachectic cytokines in immune cells as well as cancer cells. In addition, WCUP treatment attenuated C2C12 skeletal muscle cell atrophy caused by cancer cells. These findings collectively suggest that WCUP is beneficial as a nutritional supplement for the management of cancer patients with severe weight loss.

  1. CD147 deficiency blocks IL-8 secretion and inhibits lung cancer-induced osteoclastogenesis

    SciTech Connect

    Wang, Hongkai; Zhuo, Yunyun; Hu, Xu; Shen, Weiwei; Zhang, Ying; Chu, Tongwei


    Bone is a frequent target of lung cancer metastasis, which is associated with significant morbidity and poor prognosis; however, the molecular basis of this process is still unknown. This study investigated the role of extracellular matrix metalloproteinase inducer (also known as cluster of differentiation (CD)147) in osteoclastogenesis resulting from bone metastasis, based on the enrichment of this glycoprotein on the surface of many malignant bone tumors. RNA interference was used to silence CD147 expression in A549 human lung cancer cells. Compared with conditioned medium (CM) from control cells (A549-CM), CM from CD147-deficient cells (A549-si-CM) suppressed receptor activator of nuclear factor κB ligand-stimulated osteoclastogenesis in RAW 264.7 cells and bone marrow-derived macrophages. The mRNA levels of osteoclast-specific genes such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K were also reduced in the presence of A549-si-CM. CD147 knockdown in A549 cells decreased interleukin (IL)-8mRNA and protein expression. IL-8 is present in large amounts in A549-CM and mimicked its inductive effect on osteoclastogenesis; this was reversed by depletion of IL-8 from the medium. Taken together, these results indicate that CD147 promotes lung cancer-induced osteoclastogenesis by modulating IL-8 secretion, and suggest that CD147 is a potential therapeutic target for cancer-associated bone resorption in lung cancer patients. - Highlights: • Bone loss frequently results from lung cancer metastasis. • Cluster of differentiation (CD)147 was depleted in A549 lung adenocarcinoma cells. • RAW 264.7 cell osteoclastogenesis was blocked by medium from CD147-deficient cells. • Interleukin (IL)-8 level was reduced in the conditioned medium. • Osteoclastogenesis induced by lung tumor cells requires CD147-mediated IL-8 release.

  2. Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment (Final Report)

    EPA Science Inventory

    EPA announced the release of the final report, Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment . This report provides an overview of the types of mechanisms underlying the lymphohematopoietic cancers induc...

  3. Monocyte chemotactic protein-1 attenuates and high-fat diet exacerbates bone loss in mice with pulmonary metastasis of Lewis lung carcinoma

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bone can be adversely affected by obesity and cancer-associated complications including wasting. The objective of this study was to determine whether a high-fat diet and a deficiency in monocyte chemotactic protein-1 (MCP-1) altered bone structural defects found in male C57BL/6 mice with Lewis lung...

  4. Dietary Supplement Attenuates Radiation-Induced Osteoclastogenic and Oxidative Stress-Related Responses and Protects Adult Mice from Radiation-Induced Bone Loss

    NASA Technical Reports Server (NTRS)

    Globus, Ruth; Schreurs, Ann-Sofie; Tahimic, Candice; Shirazi-Fard, Yasaman; Alwood, Joshua; Shahnazari, Mohammed; Halloran, Bernard


    Our central hypothesis is that oxidative stress plays a key role in cell dysfunction and progressive bone loss caused by radiation exposure during spaceflight. In animal studies, excess free radical formation is associated with pathological changes in bone structure, enhanced bone resorption, reduced bone formation and decreased bone mineral density, which can lead to skeletal fragility. We previously reported that exposure to low or high-LET radiation rapidly increases expression levels of pro-osteoclastogenic and oxidative stress-related genes in bone and marrow, followed by pathological changes in skeletal structure. To screen various antioxidants for radioprotective effects on bone, 4 month old, male C57Bl6/J mice were treated with a dietary antioxidant cocktail, injectable alpha-lipoic acid, or a dried plum-enriched diet (DP). Mice were then exposed to 2Gy 137Cs total body radiation and one day later marrow cells were collected and the relevant genes analyzed for expression levels. Of the candidates tested, DP was most effective in reducing bone resorption-related gene expression. Microcomputed tomography revealed that DP also prevented the radiation-induced deterioration of skeletal microarchitecture, as indicated by percent bone volume, trabecular spacing and trabecular number. DP had similar protective effects on skeletal structure after sequential exposure to protons (0.5 Gy, 150MeV/n) and 56Fe 0.5Gy, 600 MeV/n). When cultured ex vivo under osteogenic conditions, bone marrow-derived cells from DP-fed animals exhibited increased colony numbers compared to control diet-fed animals. These findings suggest that DP exerted pro-osteogenic effects apart from previously identified anti-resorptive actions, which may contribute to radioprotection of skeletal tissue. In conclusion, a diet enriched in certain types of antioxidants and polyphenols such as DP may be useful as an intervention to protect tissues from degenerative effects of ionizing radiation.

  5. A two-year history of high bone loading physical activity attenuates ethnic differences in bone strength and geometry in pre-/early pubertal children from a low-middle income country.


    Meiring, Rebecca M; Avidon, Ingrid; Norris, Shane A; McVeigh, Joanne A


    We examined the interplay between ethnicity and weight-bearing physical activity on the content and volumetric properties of bone in a pre- to early pubertal South African Black and White population. Sixty six children [Black boys, 10.4 (1.4)yrs, n=15; Black girls, 10.1 (1.2)yrs, n=27; White boys, 10.1 (1.1)yrs, n=7; White girls, 9.6 (1.3)yrs, n=17] reported on all their physical activities over the past two years in an interviewer administered physical activity questionnaire (PAQ). All participants underwent a whole body and site-specific DXA scan and we also assessed bone structure and estimated bone strength with pQCT. Children were classified as being either high or low bone loaders based on the cohort's median peak bone strain score estimated from the PAQ. In the low bone loading group, Black children had greater femoral neck bone mineral content (BMC) (2.9 (0.08)g) than White children (2.4 (0.11)g; p=0.05). There were no ethnic differences in the high bone loaders for femoral neck BMC. At the cortical site, the Black low bone loaders had a greater radius area (97.3 (1.3) vs 88.8 (2.6)mm(2); p=0.05) and a greater tibia total area (475.5 (8.7) vs. 397.3 (14.0)mm(2); p=0.001) and strength (1633.7 (60.1) vs. 1271.8 (98.6)mm(3); p=0.04) compared to the White low bone loaders. These measures were not different between the Black low and high bone loaders or between the Black and White high bone loaders. In conclusion, the present study shows that there may be ethnic and physical activity associations in the bone health of Black and White pre-pubertal children and further prospective studies are required to determine the possible ethnic specific response to mechanical loading.

  6. Consumption of onion juice modulates oxidative stress and attenuates the risk of bone disorders in middle-aged and post-menopausal healthy subjects.


    Law, Yat-Yin; Chiu, Hui-Fang; Lee, Hui-Hsin; Shen, You-Cheng; Venkatakrishnan, Kamesh; Wang, Chin-Kun


    Osteoporosis is a chronic inflammatory condition that is characterized by the loss of bone mineral density (BMD). The current study was undertaken to evaluate the impact of onion juice intake on the bone mineral density (BMD) and bone loss in corroboration with antioxidant effects in human (in vivo) as well as inhibitory effects on the differentiation of osteoclasts in the cell line (in vitro). For in vitro studies, the RAW 264.7 (osteoclast progenitor) cells were used to examine the anti-osteoclastogenic effect of onion. In the case of in vivo studies, twenty-four subjects were divided into two groups and advised to intake 100 mL of onion juice or placebo for 8 weeks. Anthropometric measurements and blood samples were collected at the initial, 2(nd), 6(th), 8(th) and 10(th) week. The result of in vitro studies indicated that onion extract would effectively inhibit the osteoclastogenesis and its differentiation. Significant changes in the levels of alkaline phosphatase (ALP), free radicals, total antioxidant capacity (TEAC) and various antioxidants were observed in onion administered subjects. The BMD of three postmenopausal women was also found to be mildly improved on supplementation with onion juice. Onion juice consumption showed a positive modulatory effect on the bone loss and BMD by improving antioxidant activities and thus can be recommended for treating various bone-related disorders, especially osteoporosis.

  7. Silibinin-mediated metabolic reprogramming attenuates pancreatic cancer-induced cachexia and tumor growth.


    Shukla, Surendra K; Dasgupta, Aneesha; Mehla, Kamiya; Gunda, Venugopal; Vernucci, Enza; Souchek, Joshua; Goode, Gennifer; King, Ryan; Mishra, Anusha; Rai, Ibha; Nagarajan, Sangeetha; Chaika, Nina V; Yu, Fang; Singh, Pankaj K


    Pancreatic ductal adenocarcinoma (PDAC) is the fourth leading cause of cancer-related deaths in the US. Cancer-associated cachexia is present in up to 80% of PDAC patients and is associated with aggressive disease and poor prognosis. In the present studies we evaluated an anti-cancer natural product silibinin for its effectiveness in targeting pancreatic cancer aggressiveness and the cachectic properties of pancreatic cancer cells and tumors. Our results demonstrate that silibinin inhibits pancreatic cancer cell growth in a dose-dependent manner and reduces glycolytic activity of cancer cells. Our LC-MS/MS based metabolomics data demonstrates that silibinin treatment induces global metabolic reprogramming in pancreatic cancer cells. Silibinin treatment diminishes c-MYC expression, a key regulator of cancer metabolism. Furthermore, we observed reduced STAT3 signaling in silibinin-treated cancer cells. Overexpression of constitutively active STAT3 was sufficient to substantially revert the silibinin-induced downregulation of c-MYC and the metabolic phenotype. Our in vivo investigations demonstrate that silibinin reduces tumor growth and proliferation in an orthotopic mouse model of pancreatic cancer and prevents the loss of body weight and muscle. It also improves physical activity including grip strength and latency to fall in tumor-bearing mice. In conclusion, silibinin-induced metabolic reprogramming diminishes cell growth and cachectic properties of pancreatic cancer cells and animal models.

  8. Silibinin-mediated metabolic reprogramming attenuates pancreatic cancer-induced cachexia and tumor growth

    PubMed Central

    Shukla, Surendra K.; Dasgupta, Aneesha; Mehla, Kamiya; Gunda, Venugopal; Vernucci, Enza; Souchek, Joshua; Goode, Gennifer; King, Ryan; Mishra, Anusha; Rai, Ibha; Nagarajan, Sangeetha; Chaika, Nina V.; Yu, Fang; Singh, Pankaj K.


    Pancreatic ductal adenocarcinoma (PDAC) is the fourth leading cause of cancer-related deaths in the US. Cancer-associated cachexia is present in up to 80% of PDAC patients and is associated with aggressive disease and poor prognosis. In the present studies we evaluated an anti-cancer natural product silibinin for its effectiveness in targeting pancreatic cancer aggressiveness and the cachectic properties of pancreatic cancer cells and tumors. Our results demonstrate that silibinin inhibits pancreatic cancer cell growth in a dose-dependent manner and reduces glycolytic activity of cancer cells. Our LC-MS/MS based metabolomics data demonstrates that silibinin treatment induces global metabolic reprogramming in pancreatic cancer cells. Silibinin treatment diminishes c-MYC expression, a key regulator of cancer metabolism. Furthermore, we observed reduced STAT3 signaling in silibinin-treated cancer cells. Overexpression of constitutively active STAT3 was sufficient to substantially revert the silibinin-induced downregulation of c-MYC and the metabolic phenotype. Our in vivo investigations demonstrate that silibinin reduces tumor growth and proliferation in an orthotopic mouse model of pancreatic cancer and prevents the loss of body weight and muscle. It also improves physical activity including grip strength and latency to fall in tumor-bearing mice. In conclusion, silibinin-induced metabolic reprogramming diminishes cell growth and cachectic properties of pancreatic cancer cells and animal models. PMID:26510913

  9. Celastrol attenuates bone erosion in collagen-Induced arthritis mice and inhibits osteoclast differentiation and function in RANKL-induced RAW264.7.


    Gan, Ke; Xu, Lingxiao; Feng, Xiaoke; Zhang, Qiande; Wang, Fang; Zhang, Miaojia; Tan, Wenfeng


    Recently, the traditional Chinese medicine Tripterygium wilfordii Hook f (TwHF) of the Celastraceae family has attracted increasing attention for its potential therapeutic application in patients with rheumatoid arthritis (RA). It is well accepted that TwHF exerts the antirheumatic activity and mainly depends on its potent anti-inflammatory property. To further explore the therapeutic potential of the well-defined TwHF-derived single compound - celastrol in RA, we study the therapeutic efficacy of celastrol on bone erosion in collagen-induced arthritis (CIA) mice and delineate its effects on osteoclast differentiation and functions in RANKL-induced osteoclast precursors RAW264.7 cell line. In CIA mice, daily injection of celastrol (beginning on day 28 after arthritis induction) markedly suppressed arthritis, and reduced bone damage in the joints as demonstrated by histology and bone micro-computed tomography (CT). The effects were accompanied by reductions of osteoclast cells in joints, serum tartrate-resistant acid phosphatase (TRAP) 5b, and expression of osteoclastic genes (Trap, Ctsk, Ctr, Mmp-9) and transcriptional factors (c-Fos, c-Jun and NFATc1). When RAW264.7 cells were treated with RANKL, celastrol inhibited the formation of TRAP+ multinucleated cells and the bone-resorbing activity in dose-dependent manners. Furthermore, celastrol reduced the RANKL-induced expression of osteoclastic genes and transcriptional factors, as well as phosphorylation of NF-kB and mitogen-activated protein kinases (MAPK). These findings show that celastrol could directly inhibit osteoclast formation and function, suggesting a novel therapeutic strategy of celastrol for managing RA, especially in preventing bone destruction.

  10. Bone graft


    Autograft - bone; Allograft - bone; Fracture - bone graft; Surgery - bone graft; Autologous bone graft ... Fuse joints to prevent movement Repair broken bones (fractures) that have bone loss Repair injured bone that ...

  11. Bone tumor


    Tumor - bone; Bone cancer; Primary bone tumor; Secondary bone tumor; Bone tumor - benign ... The cause of bone tumors is unknown. They often occur in areas of the bone that grow rapidly. Possible causes include: Genetic defects ...

  12. Early-outgrowth bone marrow cells attenuate renal injury and dysfunction via an antioxidant effect in a mouse model of type 2 diabetes.


    Zhang, Yanling; Yuen, Darren A; Advani, Andrew; Thai, Kerri; Advani, Suzanne L; Kepecs, David; Kabir, M Golam; Connelly, Kim A; Gilbert, Richard E


    Cell therapy has been extensively investigated in heart disease but less so in the kidney. We considered whether cell therapy also might be useful in diabetic kidney disease. Cognizant of the likely need for autologous cell therapy in humans, we sought to assess the efficacy of donor cells derived from both healthy and diabetic animals. Eight-week-old db/db mice were randomized to receive a single intravenous injection of PBS or 0.5 × 10(6) early-outgrowth cells (EOCs) from db/m or db/db mice. Effects were assessed 4 weeks after cell infusion. Untreated db/db mice developed mesangial matrix expansion and tubular epithelial cell apoptosis in association with increased reactive oxygen species (ROS) and overexpression of thioredoxin interacting protein (TxnIP). Without affecting blood glucose or blood pressure, EOCs not only attenuated mesangial and peritubular matrix expansion, as well as tubular apoptosis, but also diminished ROS and TxnIP overexpression in the kidney of db/db mice. EOCs derived from both diabetic db/db and nondiabetic db/m mice were equally effective in ameliorating kidney injury and oxidative stress. The similarly beneficial effects of cells from healthy and diabetic donors highlight the potential of autologous cell therapy in the related clinical setting.

  13. Pharmacological strategies in lung cancer-induced cachexia: effects on muscle proteolysis, autophagy, structure, and weakness.


    Chacon-Cabrera, Alba; Fermoselle, Clara; Urtreger, Alejandro J; Mateu-Jimenez, Mercè; Diament, Miriam J; de Kier Joffé, Elisa D Bal; Sandri, Marco; Barreiro, Esther


    Cachexia is a relevant comorbid condition of chronic diseases including cancer. Inflammation, oxidative stress, autophagy, ubiquitin-proteasome system, nuclear factor (NF)-κB, and mitogen-activated protein kinases (MAPK) are involved in the pathophysiology of cancer cachexia. Currently available treatment is limited and data demonstrating effectiveness in in vivo models are lacking. Our objectives were to explore in respiratory and limb muscles of lung cancer (LC) cachectic mice whether proteasome, NF-κB, and MAPK inhibitors improve muscle mass and function loss through several molecular mechanisms. Body and muscle weights, limb muscle force, protein degradation and the ubiquitin-proteasome system, signaling pathways, oxidative stress and inflammation, autophagy, contractile and functional proteins, myostatin and myogenin, and muscle structure were evaluated in the diaphragm and gastrocnemius of LC (LP07 adenocarcinoma) bearing cachectic mice (BALB/c), with and without concomitant treatment with NF-κB (sulfasalazine), MAPK (U0126), and proteasome (bortezomib) inhibitors. Compared to control animals, in both respiratory and limb muscles of LC cachectic mice: muscle proteolysis, ubiquitinated proteins, autophagy, myostatin, protein oxidation, FoxO-1, NF-κB and MAPK signaling pathways, and muscle abnormalities were increased, while myosin, creatine kinase, myogenin, and slow- and fast-twitch muscle fiber size were decreased. Pharmacological inhibition of NF-κB and MAPK, but not the proteasome system, induced in cancer cachectic animals, a substantial restoration of muscle mass and force through a decrease in muscle protein oxidation and catabolism, myostatin, and autophagy, together with a greater content of myogenin, and contractile and functional proteins. Attenuation of MAPK and NF-κB signaling pathway effects on muscles is beneficial in cancer-induced cachexia.

  14. Role of Parp Activity in Lung Cancer-induced Cachexia: Effects on Muscle Oxidative Stress, Proteolysis, Anabolic Markers and Phenotype.


    Chacon-Cabrera, Alba; Mateu-Jimenez, Mercè; Langohr, Klaus; Fermoselle, Clara; García-Arumí, Elena; Andreu, Antoni L; Yelamos, Jose; Barreiro, Esther


    Strategies to treat cachexia are still at its infancy. Enhanced muscle protein breakdown and ubiquitin-proteasome system are common features of cachexia associated with chronic conditions including lung cancer (LC). Poly(ADP-ribose) polymerases (PARP), which play a major role in chromatin structure regulation, also underlie maintenance of muscle metabolism and body composition. We hypothesized that protein catabolism, proteolytic markers, muscle fiber phenotype, and muscle anabolism may improve in respiratory and limb muscles of LC-cachectic Parp-1-deficient (Parp-1(-/-) ) and Parp-2(-/-) mice. In diaphragm and gastrocnemius of LC (LP07 adenocarcinoma) bearing mice (wild type, Parp-1(-/-) and Parp-2(-/-) ), PARP activity (ADP-ribose polymers, pADPr), redox balance, muscle fiber phenotype, apoptotic nuclei, tyrosine release, protein ubiquitination, muscle-specific E3 ligases, NFkB signaling pathway, markers of muscle anabolism (Akt, mTOR, p70S6K, and mitochondrial DNA) were evaluated along with body and muscle weights and limb muscle force. Compared to wild type cachectic animals, in both respiratory and limb muscles of Parp-1(-/-) and Parp-2(-/-) cachectic mice: cancer induced-muscle wasting characterized by increased PARP activity, protein oxidation, tyrosine release, and ubiquitin-proteasome system (total protein ubiquitination, atrogin-1, and 20S proteasome C8 subunit) were blunted, the reduction in contractile myosin and atrophy of the fibers was attenuated, while no effects were seen in other structural features (inflammatory cells, internal or apoptotic nuclei), and markers of muscle anabolism partly improved. Activation of either PARP-1 or -2 is likely to play a role in muscle protein catabolism via oxidative stress, NF-kB signaling, and enhanced proteasomal degradation in cancer-induced cachexia. Therapeutic potential of PARP activity inhibition deserves attention. This article is protected by copyright. All rights reserved.

  15. Bone metastasis risk factors in breast cancer

    PubMed Central

    Pulido, Catarina; Vendrell, Inês; Ferreira, Arlindo R; Casimiro, Sandra; Mansinho, André; Alho, Irina; Costa, Luís


    Bone is the single most frequent site for bone metastasis in breast cancer patients. Patients with bone-only metastasis have a fairly good prognosis when compared with patients with visceral disease. Nevertheless, cancer-induced bone disease carries an important risk of developing skeletal related events that impact quality of life (QoL). It is therefore particularly important to stratify patients according to their risk of developing bone metastasis. In this context, several risk factors have been studied, including demographic, clinicopathological, genetic, and metabolic factors. Most of them show conflicting or non-definitive associations and are not validated for clinical use. Nonetheless, tumour intrinsic subtype is widely accepted as a major risk factor for bone metastasis development and luminal breast cancer carries an increased risk for bone disease. Other factors such as gene signatures, expression of specific cytokines (such as bone sialoprotein and bone morphogenetic protein 7) or components of the extracellular matrix (like bone crosslinked C-telopeptide) might also influence the development of bone metastasis. Knowledge of risk factors related with bone disease is of paramount importance as it might be a prediction tool for triggering the use of targeted agents and allow for better patient selection for future clinical trials. PMID:28194227

  16. Bone Biopsy


    ... Physician Resources Professions Site Index A-Z Bone Biopsy Bone biopsy uses a needle and imaging guidance ... limitations of Bone Biopsy? What is a Bone Biopsy? A bone biopsy is an image-guided procedure ...

  17. Wnt signaling pathway: implications for therapy in lung cancer and bone metastasis.


    Xi, Yongming; Chen, Yan


    Lung cancer remains a major worldwide health problem and patients have high rate of metastasis including bone. Although pathologic characteristics of this disease are clear and well established, much remains to be understood about this tumor, particularly at the molecular signaling level. Secreted signaling molecules of the Wnt family have been widely investigated and found to play a prominent role to induce human malignant diseases, such as breast and prostate cancer. A variety of studies have also demonstrated that the Wnt signaling pathway is closely associated with bone malignancies including osteosarcoma, multiple myeloma, and breast or prostate cancer induced bone metastasis. The aim of this review is to provide a summary regarding the role of the Wnt signaling pathway in lung cancer and bone metastasis, highlighting the aberrant activation of Wnt in this malignancy. We also discuss the potential therapeutic applications for the treatment of lung cancer and cancer induced bone metastasis targeting the Wnt pathway.

  18. Osteolytica: An automated image analysis software package that rapidly measures cancer-induced osteolytic lesions in in vivo models with greater reproducibility compared to other commonly used methods☆

    PubMed Central

    Evans, H.R.; Karmakharm, T.; Lawson, M.A.; Walker, R.E.; Harris, W.; Fellows, C.; Huggins, I.D.; Richmond, P.; Chantry, A.D.


    Methods currently used to analyse osteolytic lesions caused by malignancies such as multiple myeloma and metastatic breast cancer vary from basic 2-D X-ray analysis to 2-D images of micro-CT datasets analysed with non-specialised image software such as ImageJ. However, these methods have significant limitations. They do not capture 3-D data, they are time-consuming and they often suffer from inter-user variability. We therefore sought to develop a rapid and reproducible method to analyse 3-D osteolytic lesions in mice with cancer-induced bone disease. To this end, we have developed Osteolytica, an image analysis software method featuring an easy to use, step-by-step interface to measure lytic bone lesions. Osteolytica utilises novel graphics card acceleration (parallel computing) and 3-D rendering to provide rapid reconstruction and analysis of osteolytic lesions. To evaluate the use of Osteolytica we analysed tibial micro-CT datasets from murine models of cancer-induced bone disease and compared the results to those obtained using a standard ImageJ analysis method. Firstly, to assess inter-user variability we deployed four independent researchers to analyse tibial datasets from the U266-NSG murine model of myeloma. Using ImageJ, inter-user variability between the bones was substantial (± 19.6%), in contrast to using Osteolytica, which demonstrated minimal variability (± 0.5%). Secondly, tibial datasets from U266-bearing NSG mice or BALB/c mice injected with the metastatic breast cancer cell line 4T1 were compared to tibial datasets from aged and sex-matched non-tumour control mice. Analyses by both Osteolytica and ImageJ showed significant increases in bone lesion area in tumour-bearing mice compared to control mice. These results confirm that Osteolytica performs as well as the current 2-D ImageJ osteolytic lesion analysis method. However, Osteolytica is advantageous in that it analyses over the entirety of the bone volume (as opposed to selected 2-D images

  19. JNK in spinal cord facilitates bone cancer pain in rats through modulation of CXCL1.


    Wang, Zhong-liang; Du, Ting-ting; Zhang, Rui-guang


    In patients with advanced cancer, cancer-induced bone pain (CIBP) is a severe and common problem that is difficult to manage and explain. As c-Jun N-terminal kinase (JNK) and chemokine (C-X-C motif) ligand 1 (CXCL1) have been shown to participate in several chronic pain processes, we investigated the role of JNK and CXCL1 in CIBP and the relationship between them. A rat bone cancer pain model was established by intramedullary injection of Walker 256 rat gland mammary carcinoma cells into the left tibia of Sprague-Dawley rats. As a result, intramedullary injection of Walker 256 carcinoma cells induced significant bone destruction and persistent pain. Both phosphorylated JNK1 (pJNK1) and pJNK2 showed time-dependent increases in the ipsilateral spinal cord from day 7 to day 18 after tumor injection. Inhibition of JNK activation by intrathecal administration of SP600125, a selective pJNK inhibitor, attenuated mechanical allodynia and heat hyperalgesia caused by tumor inoculation. Tumor cell inoculation also induced robust CXCL1 upregulation in the ipsilateral spinal cord on day 18 after tumor injection. Inhibition of CXCL1 by intrathecal administration of CXCL1 neutralizing antibody showed a stable analgesic effect. Intrathecal administration of SP600125 reduced CXCL1 increase in the spinal cord, whereas inhibition of CXCL1 in the spinal cord showed no influence on JNK activation. Taken together, these results suggested that JNK activation in spinal cord contributed to the maintenance of CIBP, which may act through modulation of CXCL1. Inhibition of the pJNK/CXCL1 pathway may provide a new choice for treatment of CIBP.

  20. DC attenuation meter


    Hargrove, Douglas L.


    A portable, hand-held meter used to measure direct current (DC) attenuation in low impedance electrical signal cables and signal attenuators. A DC voltage is applied to the signal input of the cable and feedback to the control circuit through the signal cable and attenuators. The control circuit adjusts the applied voltage to the cable until the feedback voltage equals the reference voltage. The "units" of applied voltage required at the cable input is the system attenuation value of the cable and attenuators, which makes this meter unique. The meter may be used to calibrate data signal cables, attenuators, and cable-attenuator assemblies.

  1. The Walker 256 Breast Cancer Cell- Induced Bone Pain Model in Rats.


    Shenoy, Priyank A; Kuo, Andy; Vetter, Irina; Smith, Maree T


    The majority of patients with terminal breast cancer show signs of bone metastasis, the most common cause of pain in cancer. Clinically available drug treatment options for the relief of cancer-associated bone pain are limited due to either inadequate pain relief and/or dose-limiting side-effects. One of the major hurdles in understanding the mechanism by which breast cancer causes pain after metastasis to the bones is the lack of suitable preclinical models. Until the late twentieth century, all animal models of cancer induced bone pain involved systemic injection of cancer cells into animals, which caused severe deterioration of animal health due to widespread metastasis. In this mini-review we have discussed details of a recently developed and highly efficient preclinical model of breast cancer induced bone pain: Walker 256 cancer cell- induced bone pain in rats. The model involves direct localized injection of cancer cells into a single tibia in rats, which avoids widespread metastasis of cancer cells and hence animals maintain good health throughout the experimental period. This model closely mimics the human pathophysiology of breast cancer induced bone pain and has great potential to aid in the process of drug discovery for treating this intractable pain condition.

  2. The Walker 256 Breast Cancer Cell- Induced Bone Pain Model in Rats

    PubMed Central

    Shenoy, Priyank A.; Kuo, Andy; Vetter, Irina; Smith, Maree T.


    The majority of patients with terminal breast cancer show signs of bone metastasis, the most common cause of pain in cancer. Clinically available drug treatment options for the relief of cancer-associated bone pain are limited due to either inadequate pain relief and/or dose-limiting side-effects. One of the major hurdles in understanding the mechanism by which breast cancer causes pain after metastasis to the bones is the lack of suitable preclinical models. Until the late twentieth century, all animal models of cancer induced bone pain involved systemic injection of cancer cells into animals, which caused severe deterioration of animal health due to widespread metastasis. In this mini-review we have discussed details of a recently developed and highly efficient preclinical model of breast cancer induced bone pain: Walker 256 cancer cell- induced bone pain in rats. The model involves direct localized injection of cancer cells into a single tibia in rats, which avoids widespread metastasis of cancer cells and hence animals maintain good health throughout the experimental period. This model closely mimics the human pathophysiology of breast cancer induced bone pain and has great potential to aid in the process of drug discovery for treating this intractable pain condition. PMID:27630567

  3. Heptamethoxyflavone, a citrus flavonoid, suppresses inflammatory osteoclastogenesis and alveolar bone resorption.


    Matsumoto, Chiho; Inoue, Hiroki; Tominari, Tsukasa; Watanabe, Kenta; Hirata, Michiko; Miyaura, Chisato; Inada, Masaki


    We examined the effects of heptamethoxyflavone (HMF), a citrus flavonoid on inflammatory bone resorption. HMF suppressed the osteoclast formation and PGE2 production induced by IL-1. In mouse calvarial organ cultures, HMF attenuated the bone resorption elicited by LPS. HMF suppressed bone resorption in the mandibular alveolar bone. HMF may protect against inflammatory bone loss such as periodontal disease.

  4. Living Bones, Strong Bones

    NASA Video Gallery

    In this classroom activity, engineering, nutrition, and physical activity collide when students design and build a healthy bone model of a space explorer which is strong enough to withstand increas...

  5. Pressure surge attenuator


    Christie, Alan M.; Snyder, Kurt I.


    A pressure surge attenuation system for pipes having a fluted region opposite crushable metal foam. As adapted for nuclear reactor vessels and heads, crushable metal foam is disposed to attenuate pressure surges.

  6. Bone Cancer


    Cancer that starts in a bone is uncommon. Cancer that has spread to the bone from another ... more common. There are three types of bone cancer: Osteosarcoma - occurs most often between ages 10 and ...

  7. Bone Diseases


    Your bones help you move, give you shape and support your body. They are living tissues that rebuild constantly ... childhood and your teens, your body adds new bone faster than it removes old bone. After about ...

  8. Bone Metastasis


    ... metastasis, surgeons can stabilize the bone using metal plates, screws and nails (orthopedic fixation). Orthopedic fixation can ... that can't be easily reinforced with metal plates or screws, such as pelvic bones and bones ...

  9. Tracer attenuation in groundwater

    NASA Astrophysics Data System (ADS)

    Cvetkovic, Vladimir


    The self-purifying capacity of aquifers strongly depends on the attenuation of waterborne contaminants, i.e., irreversible loss of contaminant mass on a given scale as a result of coupled transport and transformation processes. A general formulation of tracer attenuation in groundwater is presented. Basic sensitivities of attenuation to macrodispersion and retention are illustrated for a few typical retention mechanisms. Tracer recovery is suggested as an experimental proxy for attenuation. Unique experimental data of tracer recovery in crystalline rock compare favorably with the theoretical model that is based on diffusion-controlled retention. Non-Fickian hydrodynamic transport has potentially a large impact on field-scale attenuation of dissolved contaminants.

  10. Bone and bone turnover.


    Crofton, Patricia M


    Children with cancer are exposed to multiple influences that may adversely affect bone health. Some treatments have direct deleterious effects on bone whilst others may have indirect effects mediated through various endocrine abnormalities. Most clinical outcome studies have concentrated on survivors of acute lymphoblastic leukaemia (ALL). There is now good evidence that earlier treatment protocols that included cranial irradiation with doses of 24 Gy or greater may result in growth hormone deficiency and low bone mineral density (BMD) in the lumbar spine and femoral neck. Under current protocols, BMD decreases during intensive chemotherapy and fracture risk increases. Although total body BMD may eventually return to normal after completion of chemotherapy, lumbar spine trabecular BMD may remain low for many years. The implications for long-term fracture risk are unknown. Risk factors for low BMD include high dose methotrexate, higher cumulative doses of glucocorticoids, male gender and low physical activity. BMD outcome in non-ALL childhood cancers has been less well studied but there is evidence that survivors of childhood brain or bone tumours, and survivors of bone marrow transplants for childhood malignancy, all have a high risk of long-term osteopenia. Long-term follow-up is required, with appropriate treatment of any endocrine abnormalities identified.

  11. Ultrasonic Evaluation of Deeply Located Trabecular Bones - Preliminary Results

    NASA Astrophysics Data System (ADS)

    Cieślik, Lucyna; Litniewski, Jerzy

    The analysis of ultrasonic signals scattered by soft tissues have been successfully applied for their characterization. Similarly, the trabecular bone backscattered signal contains information about the properties of the bone structure. Therefore scattering-based ultrasonic technique potentially enables the assessment of microstructure characteristics of a bone. The femoral neck fracture often occurs in the course of osteoporosis and can lead to severe complications. Therefore assessment of femoral bone microstructure and condition is important and essential for the diagnosis and treatment monitoring. As far most of the trabecular bone investigations have been performed in vitro. The only in vivo measurements were carried out in transmission and mostly concerned estimation of the attenuation in heel bone. We have built the ultrasonic scanner that could be useful in acquiring the RF (Radio Frequency) echoes backscattered by the trabecular bone in vivo. Moreover, the bone scanner provides data not only from heel bone but from deeply located bones as well (e.g. femoral bone). It can be also used for easily accessible bones like heel bone or breastbone. In this case a gel-pad is applied to assure focusing of ultrasound in trabecular bone (approximately 10 mm beneath the cortical bone). This study presents preliminary results of the attenuating properties evaluation of trabecular bone from the ultrasonic echoes backscattered by heel bone and femoral neck.

  12. Using Micro-CT Derived Bone Microarchitecture to Analyze Bone Stiffness – A Case Study on Osteoporosis Rat Bone

    PubMed Central

    Wu, Yuchin; Adeeb, Samer; Doschak, Michael R.


    Micro-computed tomography (Micro-CT) images can be used to quantitatively represent bone geometry through a range of computed attenuation-based parameters. Nonetheless, those parameters remain indirect indices of bone microarchitectural strength and require further computational tools to interpret bone structural stiffness and potential for mechanical failure. Finite element analysis (FEA) can be applied to measure trabecular bone stiffness and potentially predict the location of structural failure in preclinical animal models of osteoporosis, although that procedure from image segmentation of Micro-CT derived bone geometry to FEA is often challenging and computationally expensive, resulting in failure of the model to build. Notably, the selection of resolution and threshold for bone segmentation are key steps that greatly affect computational complexity and validity. In the following study, we evaluated an approach whereby Micro-CT derived grayscale attenuation and segmentation data guided the selection of trabecular bone for analysis by FEA. We further correlated those FEA results to both two- and three-dimensional bone microarchitecture from sham and ovariectomized (OVX) rats (n = 10/group). A virtual cylinder of vertebral trabecular bone 40% in length from the caudal side was selected for FEA, because Micro-CT based image analysis indicated the largest differences in microarchitecture between the two groups resided there. Bone stiffness was calculated using FEA and statistically correlated with the three-dimensional values of bone volume/tissue volume, bone mineral density, fractal dimension, trabecular separation, and trabecular bone pattern factor. Our method simplified the process for the assessment of trabecular bone stiffness by FEA from Micro-CT images and highlighted the importance of bone microarchitecture in conferring significantly increased bone quality capable of resisting failure due to increased mechanical loading. PMID:26042089

  13. BRMS1 Suppresses Breast Cancer Metastasis to Bone via its Regulation of microRNA-125b and Downstream Attenuation of TNF-alpha and HER2 Signaling Pathways

    DTIC Science & Technology


    Stat3 translocated into nucleus of both vector and BRMS1- expressing cells at a similar rate (Fig. 3d ), suggesting that there may be another method of...capabilities to metastasize to ovaries, liver, lungs, kidneys, and bones following intravenous injection. We also observed skull -restricted bioluminescent... printing ” preformed by the institutional core facility confirmed that cell lines used exhibit properties of MDA- MB-231 cells consistent with ATCC profile

  14. Variable laser attenuator


    Foltyn, Stephen R.


    The disclosure relates to low loss, high power variable attenuators comprng one or more transmissive and/or reflective multilayer dielectric filters. The attenuator is particularly suitable to use with unpolarized lasers such as excimer lasers. Beam attenuation is a function of beam polarization and the angle of incidence between the beam and the filter and is controlled by adjusting the angle of incidence the beam makes to the filter or filters. Filters are selected in accordance with beam wavelength.

  15. Variable laser attenuator


    Foltyn, S.R.


    The disclosure relates to low loss, high power variable attenuators comprising one or more transmissive and/or reflective multilayer dielectric filters. The attenuator is particularly suitable to use with unpolarized lasers such as excimer lasers. Beam attenuation is a function of beam polarization and the angle of incidence between the beam and the filter and is controlled by adjusting the angle of incidence the beam makes to the filter or filters. Filters are selected in accordance with beam wavelength. 9 figs.

  16. Bone marrow aspiration


    Iliac crest tap; Sternal tap; Leukemia - bone marrow aspiration; Aplastic anemia - bone marrow aspiration; Myelodysplastic syndrome - bone marrow aspiration; Thrombocytopenia - bone marrow aspiration; Myelofibrosis - bone marrow aspiration

  17. Bone Fracture Exacerbates Murine Ischemic Cerebral Injury

    PubMed Central

    Degos, Vincent; Maze, Mervyn; Vacas, Susana; Hirsch, Jan; Guo, Yi; Shen, Fanxia; Jun, Kristine; van Rooijen, Nico; Gressens, Pierre; Young, William L.; Su, Hua


    Background Bone fracture increases alarmins and pro-inflammatory cytokines in the blood, and provokes macrophage infiltration and pro-inflammatory cytokine expression in the hippocampus. We recently reported that stroke is an independent risk factor after bone surgery for adverse outcome, the impact of bone fracture on stroke outcome is unknown. We tested the hypothesis that bone fracture, shortly after ischemic stroke, enhances stroke-related injuries by augmenting the neuroinflammatory response. Methods Tibia fracture (bone fracture) was induced in mice one day after permanent occlusion of the distal middle cerebral artery (stroke). High-mobility-group box chromosomal protein-1 (HMGB1) was tested to mimic the bone fracture effects. HMGB1 neutralizing antibody and clodrolip (macrophage depletion) were tested to attenuate the bone fracture effects. Neurobehavioral function (n=10), infarct volume, neuronal death, and macrophages/microglia-infiltration (n=6–7) were analyzed three days after. Results We found that mice with both stroke and bone fracture had larger infarct volumes (mean percentage of ipsilateral hemisphere±SD: 30±7% vs. 12±3%, n=6, P<0.001) more severe neurobehavioral dysfunction, and more macrophages/microglia in the peri-infarct region than mice with stroke only. Intraperitoneal injection of HMGB1 mimicked, whereas neutralizing HMGB1 attenuated, the bone fracture effects and the macrophage/microglia infiltration. Depleting macrophages with clodrolip also attenuated the aggravating effects of bone fracture on stroke lesion and behavioral dysfunction. Conclusions These novel findings suggest that bone fracture shortly after stroke enhances stroke injury via augmented inflammation through HMGB1 and macrophage/microglia infiltration. Interventions to modulate early macrophage/microglia activation could be therapeutic goals to limit the adverse consequences of bone fracture after stroke. PMID:23438676

  18. Activation of spinal MrgC-Gi-NR2B-nNOS signaling pathway by Mas oncogene-related gene C receptor agonist bovine adrenal medulla 8-22 attenuates bone cancer pain in mice

    PubMed Central

    Sun, Yu’e; Zhang, Juan; Lei, Yishan; Lu, Cui’e; Hou, Bailing; Ma, Zhengliang; Gu, Xiaoping


    Objectives: In the present study, we investigate the effects of Mas oncogene-related gene (Mrg) C receptors (MrgC) on the expression and activation of spinal Gi protein, N-methyl-D-aspartate receptor subunit 2B (NR2B), and neuronal nitric oxide synthase (nNOS) in mouse model of bone cancer pain. Methods: The number of spontaneous foot lift (NSF) and paw withdrawal mechanical threshold (PWMT) were measured after inoculation of tumor cells and intrathecal injection of MrgC agonist bovine adrenal medulla 8-22 (BAM8-22) or MrgC antagonist anti-MrgC for 14 days after operation. Expression of spinal MrgC, Gi protein, NR2B and nNOS and their phosphorylated forms after inoculation was examined by immunohistochemistry and Western blotting. Double labeling was used to identify the co-localization of NR2B or nNOS with MrgC in spinal cord dorsal horn (SCDH) neurons. The effects of intrathecal injection of BAM8-22 or anti-MrgC on nociceptive behaviors and the corresponding expression of spinal MrgC, Gi protein, NR2B and nNOS were also investigated. Results: The expression of spinal MrgC, Gi protein, NR2B, and nNOS was higher in tumor-bearing mice in comparison to sham mice or normal mice. Intrathecal injection of MrgC agonist BAM8-22 significantly alleviated bone cancer pain, up-regulated MrgC and Gi protein expression, and down-regulated the expression of spinal p-NR2B, t-nNOS and p-nNOS in SCDH on day 14 after operation, whereas administration of anti-MrgC produced the opposite effect. Meanwhile, MrgC-like immunoreactivity (IR) co-localizes with NR2B-IR or nNOS-IR in SCDH neurons. Conclusions: The present study demonstrates that MrgC-activated spinal Gi-NR2B-nNOS signaling pathway plays important roles in the development of bone cancer pain. These findings may provide a novel strategy for the treatment of bone cancer pain. PMID:27158400

  19. Transient Receptor Potential Channel and Interleukin-17A Involvement in LTTL Gel Inhibition of Bone Cancer Pain in a Rat Model.


    Wang, Juyong; Zhang, Ruixin; Dong, Changsheng; Jiao, Lijing; Xu, Ling; Liu, Jiyong; Wang, Zhengtao; Lao, Lixing


    Cancer pain management is a challenge for which Chinese herbal medicine might be useful. To study the spinal mechanisms of the Chinese medicated gel Long-Teng-Tong-Luo (LTTL), a 7-herb compound, on bone cancer pain, a bone cancer pain model was made by inoculating the tibias of female rats with Walker 256 cells. LTTL gel or inert gel, 0.5 g/cm(2)/d, was applied to the skin of tumor-bearing tibias for 21 days beginning a day after the inoculation. Mechanical threshold and paw withdrawal latency to thermal stimulation was measured. Transient receptor potential (TRP) cation channels in lumbar dorsal root ganglia (DRG) were immunostained and counted, and lumbar spinal cord interleukin-17A (IL-17A) was measured with real-time polymerase chain reaction and enzyme-linked immunosorbent assay. TRP antagonists and interleukin (IL)-17A antibodies were intrathecally administered to determine their effects on bone cancer pain. The gel significantly (P < .05) alleviated cancer-induced mechanical allodynia and thermal hyperalgesia and inhibited cancer-enhanced expression of IL-17A in spinal astrocytes and the TRP subfamily members V1, A1, and V4 in lumbar DRG. Intrathecal TRP antagonists at 10 µg significantly (P < .05) attenuated mechanical allodynia, thermal hyperalgesia, and IL-17A expression, indicating that TRP channels facilitate spinal IL-17 expression and cancer pain. IL-17A antibodies inhibited cancer pain, suggesting that IL-17A promotes such pain. The data show that LTTL gel inhibits cancer pain, and this might be accounted for by the decrease in expression of DRG TRP channels and spinal astrocyte IL-17A.

  20. Bone Scan


    ... Mayo Clinic Staff A bone scan is a nuclear imaging test that helps diagnose and track several ... you're nursing. A bone scan is a nuclear imaging procedure. In nuclear imaging, tiny amounts of ...

  1. Bone grafts.


    Hubble, Matthew J W


    Bone grafts are used in musculoskeletal surgery to restore structural integrity and enhance osteogenic potential. The demand for bone graft for skeletal reconstruction in bone tumor, revision arthroplasty, and trauma surgery, couple with recent advances in understanding and application of the biology of bone transplantation, has resulted in an exponential increase in the number of bone-grafting procedures performed over the last decade. It is estimated that 1.5 million bone-grafting procedures are currently performed worldwide each year, compared to a fraction of that number 20 years ago. Major developments also have resulted in the harvesting, storage, and use of bone grafts and production of graft derivatives, substitutes, and bone-inducing agents.

  2. [Bone disease in Gaucher's disease].


    Roca Espiau, Mercedes


    The exposition aims, is to review the pathophysiological mechanisms of bone marrow involvement and the patterns of marrow infiltration by Gaucher cells. We have reviewed the different methods of assessment of bone marrow infiltration and its temporal development. Qualitative methods include simple radiography, magnetic resonance imaging (MRI), computed tomography (CT) and radioisotope. The simple radiography is the basic element, but its sensitivity is limited and only allows for assessing changes and trabecular bone remodeling MRI allows us to appreciate the bone marrow infiltration, detection of complications and response to therapy. Radioisotopes can contribute to the differential diagnosis of osteomyelitis and bone crises. Among the quantitative methods are the QCSI (quantitative chemical shift imaging) and the dual-energy X-ray absorptiometry (DEXA), as well as new quantitative techniques of CT, MRI and ultrasound densitometry. The QCSI performed an assessment of fat content of bone marrow in the spine. DEXA quantifies bone density by measuring the attenuation coefficient. The semiquantitative methods have various "scores" to establish criteria for generalized bone disease endpoints of disease progression and response to therapy.

  3. Bone cement

    PubMed Central

    Vaishya, Raju; Chauhan, Mayank; Vaish, Abhishek


    The knowledge about the bone cement is of paramount importance to all Orthopaedic surgeons. Although the bone cement had been the gold standard in the field of joint replacement surgery, its use has somewhat decreased because of the advent of press-fit implants which encourages bone in growth. The shortcomings, side effects and toxicity of the bone cement are being addressed recently. More research is needed and continues in the field of nanoparticle additives, enhanced bone–cement interface etc. PMID:26403875

  4. Bone Analyzer

    NASA Technical Reports Server (NTRS)


    The danger of disuse osteoporosis under weightless condition in space led to extensive research into measurements of bone stiffness and mass by the Biomedical Research Division of Ames and Stanford University. Through its Technology Utilization Program, NASA funded an advanced SOBSA, a microprocessor-controlled bone probe system. SOBSA determines bone stiffness by measuring responses to an electromagnetic shaker. With this information, a physician can identify bone disease, measure deterioration and prescribe necessary therapy. The system is now undergoing further testing.

  5. Bone Infections


    ... bloodstream. People who are at risk for bone infections include those with diabetes, poor circulation, or recent injury to the bone. You may also be at risk if you are having hemodialysis. Symptoms of bone infections include Pain in the infected area Chills and ...

  6. Correlations of linear and nonlinear ultrasound parameters with density and microarchitectural parameters in trabecular bone.


    Lee, Kang Il


    In the present study, correlations of linear and nonlinear ultrasound parameters (speed of sound, normalized broadband ultrasound attenuation, and nonlinear parameter B/A) with bone mineral density and microarchitectural parameters were investigated in 28 bovine femoral trabecular bone samples in vitro. All three ultrasound parameters exhibited relatively high correlation coefficients with the indexes of bone quantity (bone mineral density and bone volume fraction) and lower correlation coefficients with the remaining microarchitectural parameters. These results suggest that B/A, in addition to speed of sound and attenuation, may have potential as an index for the assessment of bone status and osteoporosis.

  7. Compensation for non-uniform attenuation in SPECT brain imaging

    SciTech Connect

    Glick, S.J.; King, M.A.; Pan, T.S.


    Photon attenuation is a major limitation in performing quantitative SPECT brain imaging. A number of methods have been proposed for compensation of attenuation in regions of the body that can be modelled as a uniform attenuator. The magnitude of the errors introduced into reconstructed brain images by assuming the head to be a uniform attenuator are uncertain (the skull, sinus cavities and head holder all have different attenuation properties than brain tissue). Brain imaging is unique in that the radioisotope, for the most part, is taken up within a uniform attenuation medium (i.e., brain tissue) which is surrounded by bone (i.e., the skull) of a different density. Using this observation, Bellini`s method for attenuation compensation (which is an exact solution to the exponential Radon transform) has been modified to account for the different attenuation properties of the skull. To test this modified Bellini method, a simple mathematical phantom was designed to model the brain and a skull of varying thickness less than 7.5 mm. To model brain imaging with Tc-99m HMPAO, the attenuation coefficient of the brain tissue and skull were set to 0.15 cm{sup -1} and 0.22 cm{sup -1} respectively. A ray-driven projector which accounted for non-uniform attenuation was used to simulate projection data from 128 views. The detector response and scatter were not simulated. It was observed that reconstructions processed with uniform attenuation compensation (i.e., where it was assumed that the brain tissue and the skull had the same attenuation coefficient) provided errors of 6-20%, whereas those processed with the non-uniform Bellini algorithm were biased by only 0-5%.



    Giordano, S.


    A high peak power level r-f attenuator that is readily and easily insertable along a coaxial cable having an inner conductor and an outer annular conductor without breaking the ends thereof is presented. Spaced first and second flares in the outer conductor face each other with a slidable cylindrical outer conductor portion therebetween. Dielectric means, such as water, contact the cable between the flares to attenuate the radio-frequency energy received thereby. The cylindrical outer conductor portion is slidable to adjust the voltage standing wave ratio to a low level, and one of the flares is slidable to adjust the attenuation level. An integral dielectric container is also provided. (AFC)

  9. Landing gear noise attenuation

    NASA Technical Reports Server (NTRS)

    Moe, Jeffrey W. (Inventor); Whitmire, Julia (Inventor); Kwan, Hwa-Wan (Inventor); Abeysinghe, Amal (Inventor)


    A landing gear noise attenuator mitigates noise generated by airframe deployable landing gear. The noise attenuator can have a first position when the landing gear is in its deployed or down position, and a second position when the landing gear is in its up or stowed position. The noise attenuator may be an inflatable fairing that does not compromise limited space constraints associated with landing gear retraction and stowage. A truck fairing mounted under a truck beam can have a compliant edge to allow for non-destructive impingement of a deflected fire during certain conditions.

  10. Bone poroelasticity.


    Cowin, S C


    Poroelasticity is a well-developed theory for the interaction of fluid and solid phases of a fluid-saturated porous medium. It is widely used in geomechanics and has been applied to bone by many authors in the last 30 years. The purpose of this work is, first, to review the literature related to the application of poroelasticity to the interstitial bone fluid and, second, to describe the specific physical and modeling considerations that establish poroelasticity as an effective and useful model for deformation-driven bone fluid movement in bone tissue. The application of poroelasticity to bone differs from its application to soft tissues in two important ways. First, the deformations of bone are small while those of soft tissues are generally large. Second, the bulk modulus of the mineralized bone matrix is about six times stiffer than that of the fluid in the pores while the bulk moduli of the soft tissue matrix and the pore water are almost the same. Poroelasticity and electrokinetics can be used to explain strain-generated potentials in wet bone. It is noted that strain-generated potentials can be used as an effective tool in the experimental study of local bone fluid flow, and that the knowledge of this technique will contribute to the answers of a number of questions concerning bone mineralization, osteocyte nutrition and the bone mechanosensory system.

  11. Analgesia targeting IB4-positive neurons in cancer-induced mechanical hypersensitivity

    PubMed Central

    Ye, Yi; Dang, Dongmin; Viet, Chi T.; Dolan, John C.; Schmidt, Brian L.


    Cancer patients often suffer from pain and most will be prescribed μ-opioids. μ-opioids are not satisfactory in treating cancer pain and are associated with multiple debilitating side effects. Recent studies show that μ and δ opioid receptors are separately expressed on IB4 (−) and IB4 (+) neurons which control thermal and mechanical pain, respectively. In this study we investigated IB4 (+) and IB4 (−) neurons in mechanical and thermal hypersensitivity in an orthotopic mouse oral cancer model. We used a δ opioid receptor agonist and a P2X3 antagonist to target IB4 (+) neurons and to demonstrate that this subset plays a key role in cancer-induced mechanical allodynia, but not in thermal hyperalgesia. Moreover, selective removal of IB4 (+) neurons using IB4-SAP impacts cancer-induced mechanical but not thermal hypersensitivity. Our results demonstrate that peripherally administered pharmacological agents targeting IB4 (+) neurons, such as a selective δ-opioid receptor agonist or P2X3 antagonist, might be useful in treating oral cancer pain. Perspective To clarify the mechanisms of oral cancer pain, we examined the differential role of IB4 (+) and IB4 (−) neurons. Characterization of these two subsets of putative nociceptors is important for further development of effective clinical cancer pain relief. PMID:22483679

  12. Attenuator And Conditioner


    Anderson, Gene R.; Armendariz, Marcelino G.; Carson, Richard F.; Bryan, Robert P.; Duckett, III, Edwin B.; Kemme, Shanalyn Adair; McCormick, Frederick B.; Peterson, David W.


    An apparatus and method of attenuating and/or conditioning optical energy for an optical transmitter, receiver or transceiver module is disclosed. An apparatus for attenuating the optical output of an optoelectronic connector including: a mounting surface; an array of optoelectronic devices having at least a first end; an array of optical elements having at least a first end; the first end of the array of optical elements optically aligned with the first end of the array of optoelectronic devices; an optical path extending from the first end of the array of optoelectronic devices and ending at a second end of the array of optical elements; and an attenuator in the optical path for attenuating the optical energy emitted from the array of optoelectronic devices. Alternatively, a conditioner may be adapted in the optical path for conditioning the optical energy emitted from the array of optoelectronic devices.

  13. Inhibition on Breast Cancer Induced Bone Pain, Metastasis and Osteolysis in Nude Mice by LOVAZA and DHA Fattty Acids

    DTIC Science & Technology


    GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007

  14. Numerical simulation of wave propagation in cancellous bone.


    Padilla, F; Bossy, E; Haiat, G; Jenson, F; Laugier, P


    Numerical simulation of wave propagation is performed through 31 3D volumes of trabecular bone. These volumes were reconstructed from high synchrotron microtomography experiments and are used as the input geometry in a simulation software developed in our laboratory. The simulation algorithm accounts for propagation into both the saturating fluid and bone but absorption is not taken into account. We show that 3D simulation predicts phenomena observed experimentally in trabecular bones : linear frequency dependence of attenuation, increase of attenuation and speed of sound with the bone volume fraction, negative phase velocity dispersion in most of the specimens, propagation of fast and slow wave depending on the orientation of the trabecular network compared to the direction of propagation of the ultrasound. Moreover, the predicted attenuation is in very close agreement with the experimental one measured on the same specimens. Coupling numerical simulation with real bone architecture therefore provides a powerful tool to investigate the physics of ultrasound propagation in trabecular structures.

  15. dAcsl, the Drosophila ortholog of acyl-CoA synthetase long-chain family member 3 and 4, inhibits synapse growth by attenuating bone morphogenetic protein signaling via endocytic recycling.


    Liu, Zhihua; Huang, Yan; Hu, Wen; Huang, Sheng; Wang, Qifu; Han, Junhai; Zhang, Yong Q


    Fatty acid metabolism plays an important role in brain development and function. Mutations in acyl-CoA synthetase long-chain family member 4 (ACSL4), which converts long-chain fatty acids to acyl-CoAs, result in nonsyndromic X-linked mental retardation. ACSL4 is highly expressed in the hippocampus, a structure critical for learning and memory. However, the underlying mechanism by which mutations of ACSL4 lead to mental retardation remains poorly understood. We report here that dAcsl, the Drosophila ortholog of ACSL4 and ACSL3, inhibits synaptic growth by attenuating BMP signaling, a major growth-promoting pathway at neuromuscular junction (NMJ) synapses. Specifically, dAcsl mutants exhibited NMJ overgrowth that was suppressed by reducing the doses of the BMP pathway components, accompanied by increased levels of activated BMP receptor Thickveins (Tkv) and phosphorylated mothers against decapentaplegic (Mad), the effector of the BMP signaling at NMJ terminals. In addition, Rab11, a small GTPase involved in endosomal recycling, was mislocalized in dAcsl mutant NMJs, and the membrane association of Rab11 was reduced in dAcsl mutant brains. Consistently, the BMP receptor Tkv accumulated in early endosomes but reduced in recycling endosomes in dAcsl mutant NMJs. dAcsl was also required for the recycling of photoreceptor rhodopsin in the eyes, implying a general role for dAcsl in regulating endocytic recycling of membrane receptors. Importantly, expression of human ACSL4 rescued the endocytic trafficking and NMJ phenotypes of dAcsl mutants. Together, our results reveal a novel mechanism whereby dAcsl facilitates Rab11-dependent receptor recycling and provide insights into the pathogenesis of ACSL4-related mental retardation.

  16. Sex steroids and bone.


    Manolagas, S C; Kousteni, S; Jilka, R L


    The adult skeleton is periodically remodeled by temporary anatomic structures that comprise juxtaposed osteoclast and osteoblast teams and replace old bone with new. Estrogens and androgens slow the rate of bone remodeling and protect against bone loss. Conversely, loss of estrogen leads to increased rate of remodeling and tilts the balance between bone resorption and formation in favor of the former. Studies from our group during the last 10 years have elucidated that estrogens and androgens decrease the number of remodeling cycles by attenuating the birth rate of osteoclasts and osteoblasts from their respective progenitors. These effects result, in part, from the transcriptional regulation of genes responsible for osteoclastogenesis and mesenchymal cell replication and/or differentiation and are exerted through interactions of the ligand-activated receptors with other transcription factors. However, increased remodeling alone cannot explain why loss of sex steroids tilts the balance of resorption and formation in favor of the former. Estrogens and androgens also exert effects on the lifespan of mature bone cells: pro-apoptotic effects on osteoclasts but anti-apoptotic effects on osteoblasts and osteocytes. These latter effects stem from a heretofore unexpected function of the classical "nuclear" sex steroid receptors outside the nucleus and result from activation of a Src/Shc/extracellular signal-regulated kinase signal transduction pathway probably within preassembled scaffolds called caveolae. Strikingly, estrogen receptor (ER) alpha or beta or the androgen receptor can transmit anti-apoptotic signals with similar efficiency, irrespective of whether the ligand is an estrogen or an androgen. More importantly, these nongenotropic, sex-nonspecific actions are mediated by the ligand-binding domain of the receptor and can be functionally dissociated from transcriptional activity with synthetic ligands. Taken together, these lines of evidence strongly suggest that

  17. [Bone diseases].


    Uebelhart, Brigitte; Rizzoli, René


    Calcium intake shows a small impact on bone mineral density and fracture risk. Denosumab is a more potent inhibitor of bone resorption than zoledronate. Abaloparatide, PTHrP analog, increases bone mineral density and decreases fracture incidence. Teriparatide could be delivered via a transdermic device. Romosozumab and odanacatib improve calculated bone strength. Sequential or combined treatments with denosumab and teriparatide could be of interest, but not denosumab followed by teriparatide. Fibrous dysplasia, Paget disease and hypophosphatasia are updated, as well as atypical femoral fracture and osteonecrosis of the jaw.

  18. Bone cutting.


    Giraud, J Y; Villemin, S; Darmana, R; Cahuzac, J P; Autefage, A; Morucci, J P


    Bone cutting has always been a problem for surgeons because bone is a hard living material, and many osteotomes are still very crude tools. Technical improvement of these surgical tools has first been their motorization. Studies of the bone cutting process have indicated better features for conventional tools. Several non-conventional osteotomes, particularly ultrasonic osteotomes are described. Some studies on the possible use of lasers for bone cutting are also reported. Use of a pressurised water jet is also briefly examined. Despite their advantages, non-conventional tools still require improvement if they are to be used by surgeons.

  19. Lithium chloride attenuates the abnormal osteogenic/adipogenic differentiation of bone marrow-derived mesenchymal stem cells obtained from rats with steroid-related osteonecrosis by activating the β-catenin pathway.


    Yu, Zefeng; Fan, Lihong; Li, Jia; Ge, Zhaogang; Dang, Xiaoqian; Wang, Kunzheng


    Steroid-related osteonecrosis of the femoral head (ONFH) may be a disease that results from the abnormal osteogenic/adipogenic differentiation of bone marrow-derived mesenchymal stem cells (BMMSCs). In the present study, we examined the possible use of lithium in an aim to reverse the abnormal osteogenic/adipogenic differentiation of BMMSCs isolated from rats with steroid-related ONFH (termed ONFH-BMMSCs). BMMSCs obtained from steroid‑related ONFH rat femurs were cultured with or without lithium chloride (LiCl). BMMSCs obtained from normal rat femurs were cultured as controls. LiCl significantly increased the expression of osteocalcin and Runx2 in the ONFH-BMMSCs during osteogenic induction. The mineralization of ONFH-BMMSCs following osteogenic induction was also enhanced. Furthermore, LiCl exerted anti-adipogenic effects on the ONFH-BMMSCs by inhibiting the expression of peroxisome proliferator-activated receptor γ (PPARγ) and fatty acid binding protein 4 (Fabp4) during adipogenic induction, and decreasing lipid droplet formation at the end of adipogenic induction. These effects of LiCl on the ONFH-BMMSCs were associated with an increased expression of β-catenin and a decreased expression of phosphorylated GSK-3β at Tyr-216, and these effects were abolished by treatment with quercetin, an antagonist of the β-catenin pathway. The normal osteogenic/adipogenic activity of BMMSCs may be impaired in steroid-related ONFH. However, as demonstrated by our findings, LiCl reduces abnormal adipogenic activity and simultaneously increases the osteogenic differentiation of ONFH-BMMSCs by activating the β-catenin pathway.

  20. Generation of attenuation map for MR-based attenuation correction of PET data in the head area employing 3D short echo time MR imaging

    NASA Astrophysics Data System (ADS)

    Khateri, Parisa; Salighe Rad, Hamidreza; Fathi, Anahita; Ay, Mohammad Reza


    Attenuation correction is a crucial step to get accurate quantification of Positron Emission Tomography (PET) data. An attenuation map to provide attenuation coefficients at 511 keV can be generated using Magnetic Resonance Images (MRI). One of the main steps involved in MR-based attenuation correction (MRAC) of PET data is to separate bone from air. Low signal intensity of bone in conventional MRI makes it difficult to separate bone from air in the head area, while their attenuation coefficients are very different. In literature, several groups proposed ultrashort echo-time (UTE) sequences to differentiate bone from air [4,5,7], because these sequences are capable of imaging tissues with short T2* relaxation time, such as cortical bone; however, they are difficult to use, expensive and time-consuming. Employing short echo-time (STE) MRI in combination with long echo-time (LTE) MRI, and along with high performance image processing algorithms is a good substitute for UTE-based PET attenuation correction; they are widely available, easy to use, inexpensive and much faster than UTE pulse sequences. In this work, we propose the use of STE sequences along with LTE ones, as well as a dedicated image processing method to differentiate bone from air cavities in the head area by creating contrast between the tissues. Attenuation coefficients at 511 kev, relying on literature [5], will then be assigned to the voxels. Acquisition was performed on a clinical 3T Tim Trio scanner (Siemens Medical Solution, Erlangen, Germany), employing a dual echo sequence. To achieve an optimized protocol with the best result for discrimination of bone and air, two types of acquisitions were performed, with and without fat suppression; the acquisition parameters were as follows: TE=1.21/5 ms, TR=5/17, FA=30, and TE=1.12/3.16 ms, TR=5/5, FA=12 for non-fat-suppressed and fat-suppressed protocol, respectively. Contrast enhancement and tissue segmentation were applied as processing steps, to

  1. Seismic attenuation in Florida

    SciTech Connect

    Bellini, J.J.; Bartolini, T.J.; Lord, K.M.; Smith, D.L. . Dept. of Geology)


    Seismic signals recorded by the expanded distribution of earthquake seismograph stations throughout Florida and data from a comprehensive review of record archives from stations GAI contribute to an initial seismic attenuation model for the Florida Plateau. Based on calculations of surface particle velocity, a pattern of attenuation exists that appears to deviate from that established for the remainder of the southeastern US. Most values suggest greater seismic attenuation within the Florida Plateau. However, a separate pattern may exist for those signals arising from the Gulf of Mexico. These results have important implications for seismic hazard assessments in Florida and may be indicative of the unique lithospheric identity of the Florida basement as an exotic terrane.

  2. Radiofrequency attenuator and method


    Warner, Benjamin P.; McCleskey, T. Mark; Burrell, Anthony K.; Agrawal, Anoop; Hall, Simon B.


    Radiofrequency attenuator and method. The attenuator includes a pair of transparent windows. A chamber between the windows is filled with molten salt. Preferred molten salts include quarternary ammonium cations and fluorine-containing anions such as tetrafluoroborate (BF.sub.4.sup.-), hexafluorophosphate (PF.sub.6.sup.-), hexafluoroarsenate (AsF.sub.6.sup.-), trifluoromethylsulfonate (CF.sub.3SO.sub.3.sup.-), bis(trifluoromethylsulfonyl)imide ((CF.sub.3SO.sub.2).sub.2N.sup.-), bis(perfluoroethylsulfonyl)imide ((CF.sub.3CF.sub.2SO.sub.2).sub.2N.sup.-) and tris(trifluoromethylsulfonyl)methide ((CF.sub.3SO.sub.2).sub.3 C.sup.-). Radicals or radical cations may be added to or electrochemically generated in the molten salt to enhance the RF attenuation.

  3. Radiofrequency attenuator and method


    Warner, Benjamin P.; McCleskey, T. Mark; Burrell, Anthony K.; Agrawal, Anoop; Hall, Simon B.


    Radiofrequency attenuator and method. The attenuator includes a pair of transparent windows. A chamber between the windows is filled with molten salt. Preferred molten salts include quarternary ammonium cations and fluorine-containing anions such as tetrafluoroborate (BF.sub.4.sup.-), hexafluorophosphate (PF.sub.6.sup.-), hexafluoroarsenate (AsF.sub.6.sup.-), trifluoromethylsulfonate (CF.sub.3SO.sub.3.sup.-), bis(trifluoromethylsulfonyl)imide ((CF.sub.3SO.sub.2).sub.2N.sup.-), bis(perfluoroethylsulfonyl)imide ((CF.sub.3CF.sub.2SO.sub.2).sub.2N.sup.-) and tris(trifluoromethylsulfonyl)methide ((CF.sub.3SO.sub.2).sub.3C.sup.-). Radicals or radical cations may be added to or electrochemically generated in the molten salt to enhance the RF attenuation.

  4. Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment (External Review Draft)

    EPA Science Inventory

    This draft report provides an overview of the types of mechanisms underlying the lymphohematopoietic cancers induced by chemical agents and radiation in humans, with a primary emphasis on leukemia and leukemia-inducing agents. It focuses on how mechanistic information on human l...

  5. Lymphohematopoietic cancers induced by chemicals and other agents and their implications for risk evaluation: An overview.


    Eastmond, David A; Keshava, Nagalakshmi; Sonawane, Babasaheb


    Lymphohematopoietic neoplasia are one of the most common types of cancer induced by therapeutic and environmental agents. Of the more than 100 human carcinogens identified by the International Agency for Research on Cancer, approximately 25% induce leukemias or lymphomas. The objective of this review is to provide an introduction into the origins and mechanisms underlying lymphohematopoietic cancers induced by xenobiotics in humans with an emphasis on acute myeloid leukemia, and discuss the implications of this information for risk assessment. Among the agents causing lymphohematopoietic cancers, a number of patterns were observed. Most physical and chemical leukemia-inducing agents such as the therapeutic alkylating agents, topoisomerase II inhibitors, and ionizing radiation induce mainly acute myeloid leukemia through DNA-damaging mechanisms that result in either gene or chromosomal mutations. In contrast, biological agents and a few immunosuppressive chemicals induce primarily lymphoid neoplasms through mechanisms that involve alterations in immune response. Among the environmental agents examined, benzene was clearly associated with acute myeloid leukemia in humans, with increasing but still limited evidence for an association with lymphoid neoplasms. Ethylene oxide and 1,3-butadiene were linked primarily to lymphoid cancers. Although the association between formaldehyde and leukemia remains controversial, several recent evaluations have indicated a potential link between formaldehyde and acute myeloid leukemia. The four environmental agents examined in detail were all genotoxic, inducing gene mutations, chromosomal alterations, and/or micronuclei in vivo. Although it is clear that rapid progress has been made in recent years in our understanding of leukemogenesis, many questions remain for future research regarding chemically induced leukemias and lymphomas, including the mechanisms by which the environmental agents reviewed here induce these diseases and the

  6. Your Bones


    ... shoulder blade or scapula (say: SKA-pyuh-luh), a large triangular bone on the upper back corner of each side of the ribcage. The arm is made up of three bones: the humerus (say: HYOO-muh-rus), which is above your elbow, and the radius (say: RAY-dee-us) and ulna (say: UL- ...

  7. Talking Bones.

    ERIC Educational Resources Information Center

    Johnson, Jaclyn; Kassing, Sharon


    Describes cooperation with the Saint Louis Zoo to provide opportunities for elementary school students to learn about bones, how animals move, what they eat, and how much they grow. Uses biofacts which include bones, skulls, and other parts to make the laboratory a hands-on experience for students. (YDS)

  8. CT scanning phantom for normalization of infant brain attenuation.


    Thompson, J R; Triolo, P J; Moore, R J; Hinshaw, D B; Hasso, A N


    The x-ray attenuation values of brain studied with computed tomography (CT) are strikingly affected by the ages of the subjects. Premature neonates, for example, may have brain attenuation values 20-30 H below adult values. These lower attenuation values for developing compared with adult brain can be ascribed partly to machine-related effects (beam-hardening, adult algorithms, scanning geometry, etc.). A scanning phantom made from aluminum was developed that can be used to develop a nomogram for any particular scanner from which normalized brain attenuation may be derived for any small head size. Using this nomogram, predicted neonatal attenuations are still 10-15 H higher than those actually observed in scanning neonates. The model predicts that, at the most, 3-4 H of this discrepancy can be accounted for by less beam-hardening from the lower bone attenuation of the thinner developing skull. Presumably, the rest is from a lower brain density in neonates (higher water content). By normalizing to cerebrospinal fluid (water) with special care to avoid partial-volume artifacts, one can predict attenuation values for developing brain more accurately.

  9. [Increased efficacy of allogenic bone marrow transplantation].


    Fedotenkov, A G; Danilova, L A; Ignasheva, L P


    Experiments made in vivo and vitro have demonstrated that conservation of allogeneic hemopoietic tissue with glycerin brings about a decrease in transplatation, homologous activity of T lymphocytes. Allogeneic bone marrow conserved with glycerin compares very favourably with freshly prepared allogeneic bone marrow since the transplant-versus-host reaction is attenuated under the effect of glycerin. Moreover, it shows a higher proliferative activity. The glycerin-induced reduction of the inactivating effect of lymphocytes against non-syngeneic colony-forming units enables the conserved bone marrow to be transplanted from several donors.

  10. Paget's Disease of Bone


    ... page please turn Javascript on. Paget's Disease of Bone What is Paget's Disease of Bone? Click for more information Enlarged and Misshapen Bones Paget's disease of bone causes affected bones to ...

  11. Tritium Attenuation by Distillation

    SciTech Connect

    Wittman, N.E.


    The objective of this study was to determine how a 100 Area distillation system could be used to reduce to a satisfactory low value the tritium content of the dilute moderator produced in the 100 Area stills, and whether such a tritium attenuator would have sufficient capacity to process all this material before it is sent to the 400 Area for reprocessing.

  12. In vitro attenuation of impact shock in equine digits.


    Lanovaz, J L; Clayton, H M; Watson, L G


    This study was designed to test the impact characteristics of the equine digit in vitro with the objective of providing a better understanding of the role of the digital structures in the attenuation of impact shock. Uni-axial accelerometers were mounted on cadaver digits on the distolateral hoof wall, the proximolateral hoof wall, the dorsal surface of the second phalanx, and the mid-lateral first phalanx. The hoof-mounted accelerometers were aligned with the hoof tubules while the bone-mounted accelerometers were oriented along the longitudinal axis of the bone. Each digit was mounted in a test apparatus designed to simulate impact of the hoof with the ground during locomotion. The digits were subjected to 3 impact trials against a barrier at each of 3 vertical impact velocities that simulated a forward trotting velocity in the range of 2.67 to 4.46 m/s. The impact deceleration tended to increase with impact velocity. Attenuation of the impact shock by the digital tissues resulted in a reduction in impact decleration in the more proximal measuring locations. The interphalangeal joints appeared to play a larger role in amplitude attenuation than the hoof wall or the soft tissue structures within the hoof wall. The signal frequency data showed that the soft tissues within the hoof acted as a 'lowpass' filter, attenuating the higher deceleration frequencies. The hoof wall and the interphalangeal joints showed little frequency attenuation.

  13. Regulation of vitamin C transporter in the type 1 diabetic mouse bone and bone marrow.


    Sangani, Rajnikumar; Naime, Mohammad; Zakhary, Ibrahim; Ahmad, Saif; Chutkan, Norman; Zhu, Andy; Ha, Yonju; Hamrick, Mark; Isales, Carlos; Elsalanty, Mohammed; Smith, Sylvia; Liou, Gregory I; Fulzele, Sadanand


    A number of studies have revealed that Type I diabetes (T1D) is associated with bone loss and an increased risk of fractures. T1D induces oxidative stress in various tissues and organs. Vitamin C plays an important role in the attenuation of oxidative stress; however, little is known about the effect of T1D induced oxidative stress on the regulation of vitamin C transporter in bone and bone marrow cells. To investigate this, T1D was induced in mice by multiple low dose injections of streptozotocin. We have demonstrated that endogenous antioxidants, glutathione peroxidase (GPx) and superoxide dismutase (SOD) are down-regulated in the bone and bone marrow of T1D. The vitamin C transporter isoform SVCT2, the only known transporter expressed in bone and bone marrow stromal cells (BMSCs), is negatively regulated in the bone and bone marrow of T1D. The μCT imaging of the bone showed significantly lower bone quality in the 8 week T1D mouse. The in-vitro study in BMSCS showed that the knockdown of SVCT2 transporter decreases ascorbic acid (AA) uptake, and increases oxidative stress. The significant reversing effect of antioxidant vitamin C is only possible in control cells, not in knockdown cells. This study suggested that T1D induces oxidative stress and decreases SVCT2 expression in the bone and bone marrow environment. Furthermore, this study confirms that T1D increases bone resorption, decreases bone formation and changes the microstructure of bones. This study has provided evidence that the regulation of the SVCT2 transporter plays an important role not only in T1D osteoporosis but also in other oxidative stress-related musculoskeletal complications.

  14. Soft Tissue Conduction as a Possible Contributor to the Limited Attenuation Provided by Hearing Protection Devices

    PubMed Central

    Chordekar, Shai; Adelman, Cahtia; Sohmer, Haim; Kishon-Rabin, Liat


    Context: Damage to the auditory system by loud sounds can be avoided by hearing protection devices (HPDs) such as earmuffs, earplugs, or both for maximum attenuation. However, the attenuation can be limited by air conduction (AC) leakage around the earplugs and earmuffs by the occlusion effect (OE) and by skull vibrations initiating bone conduction (BC). Aims: To assess maximum attenuation by HPDs and possible flanking pathways to the inner ear. Subjects and Methods: AC attenuation and resulting thresholds were assessed using the real ear attenuation at threshold (REAT) procedure on 15 normal-hearing participants in four free-field conditions: (a) unprotected ears, (b) ears covered with earmuffs, (c) ears blocked with deeply inserted customized earplugs, and (d) ears blocked with both earplugs and earmuffs. BC thresholds were assessed with and without earplugs to assess the OE. Results: Addition of earmuffs to earplugs did not cause significantly greater attenuation than earplugs alone, confirming minimal AC leakage through the external meatus and the absence of the OE. Maximum REATs ranged between 40 and 46 dB, leading to thresholds of 46–54 dB HL. Furthermore, calculation of the acoustic impedance mismatch between air and bone predicted at least 60 dB attenuation of BC. Conclusion: Results do not support the notion that skull vibrations (BC) contributed to the limited attenuation provided by traditional HPDs. An alternative explanation, supported by experimental evidence, suggests transmission of sound to inner ear via non-osseous pathways such as skin, soft tissues, and fluid. Because the acoustic impedance mismatch between air and soft tissues is smaller than that between air and bone, air-borne sounds would be transmitted to soft tissues more effectively than to bone, and therefore less attenuation is expected through soft tissue sound conduction. This can contribute to the limited attenuation provided by traditional HPDs. The present study has practical

  15. Bone densitometry.


    Chun, Kwang J


    Conventional radiographic methods allow physicians to visualize bone structure. However, they do not offer information on the bone mineral density (BMD), which can facilitate early diagnosis and treatment of osteoporosis. Bone densitometry, by contrast, helps to detect bone mineral loss at an early stage because it provides accurate quantitative measurement of BMD. With an emphasis on quantification, shorter scanning time and precision, scientists have been developing BMD measurement devices that use absorption technique. They first developed single-energy absorptiometry (single-photon absorptiometry) by using I-125, which could measure BMD of peripheral bones. Single-photon absorptiometry was replaced by dual-energy absorptiometry (dual photon absorptiometry [DPA]) that used gadolinium-153. DPA had greater accuracy in measuring the BMD of central skeletal bones. Single-energy x-ray absorptiometry was also developed but it had limitations in measuring central skeletal BMD. In the mid-1980s, dual-energy x-ray absorptiometry (DXA) was introduced and widely accepted for the early detection, treatment, and follow-up study of osteoporosis. There are several reasons for the popularity. DXA can measure BMD of posteroanterior spine and hip in a much shorter time than DPA while being capable of measuring BMD of peripheral bones. Other advantages include very low radiation doses to the patients, high image resolution, precision, and stable calibration of the instruments. In recent years, DXA has also been applied to lateral spine for the density of trabecular bone, to the whole body for the measurement of total body bone density and for the body composition, and to the spine for the vertebral fracture assessment. Still, posteroanterior spine and hip scans remain the most common applications of DXA because data on the normal range of BMD of the skeletal sites for different age, sex, and ethnic groups are compiled and made available with the devices, which gives the physician

  16. Interpreting Bones.

    ERIC Educational Resources Information Center

    Weymouth, Patricia P.


    Describes an activity which introduces students to the nature and challenges of paleoanthropology. In the exercise, students identify diagrammed bones and make interpretations about the creature. Presents questions and tasks employed in the lesson. (ML)

  17. Bone and bone marrow: the same organ.


    Del Fattore, Andrea; Capannolo, Marta; Rucci, Nadia


    Interplays between bone and bone marrow are not limited to merely anatomic and histological connections, but include a tight functional correlation. Bone marrow resides within the medullary cavity of the bones and the process of hematopoiesis is regulated, at least in part, by bone cells. Moreover, osteoclasts and osteoblasts derive from precursors of hematopoietic and mesenchymal origin, respectively, both residing within the bone marrow. Alterations in one of these components typically cause impairment in the other, so diseases of the bone marrow compartment often affect the bone and vice versa. All these findings could make us to speculate that bone and bone marrow are not two separate districts, but can be considered as the two elements of the same unique functional unit, the bone-bone marrow organ. Here we will describe histological and functional interplays between bone and bone marrow, and will illustrate some diseases in which this tight correlation is evident.

  18. Bone Densitometry (Bone Density Scan)


    ... and display the bone density measurements on a computer monitor. top of page How is the procedure performed? ... passed over the area, generating images on a computer monitor. You must hold very still and may be ...

  19. Control algorithms for dynamic attenuators

    SciTech Connect

    Hsieh, Scott S.; Pelc, Norbert J.


    Purpose: The authors describe algorithms to control dynamic attenuators in CT and compare their performance using simulated scans. Dynamic attenuators are prepatient beam shaping filters that modulate the distribution of x-ray fluence incident on the patient on a view-by-view basis. These attenuators can reduce dose while improving key image quality metrics such as peak or mean variance. In each view, the attenuator presents several degrees of freedom which may be individually adjusted. The total number of degrees of freedom across all views is very large, making many optimization techniques impractical. The authors develop a theory for optimally controlling these attenuators. Special attention is paid to a theoretically perfect attenuator which controls the fluence for each ray individually, but the authors also investigate and compare three other, practical attenuator designs which have been previously proposed: the piecewise-linear attenuator, the translating attenuator, and the double wedge attenuator. Methods: The authors pose and solve the optimization problems of minimizing the mean and peak variance subject to a fixed dose limit. For a perfect attenuator and mean variance minimization, this problem can be solved in simple, closed form. For other attenuator designs, the problem can be decomposed into separate problems for each view to greatly reduce the computational complexity. Peak variance minimization can be approximately solved using iterated, weighted mean variance (WMV) minimization. Also, the authors develop heuristics for the perfect and piecewise-linear attenuators which do not requirea priori knowledge of the patient anatomy. The authors compare these control algorithms on different types of dynamic attenuators using simulated raw data from forward projected DICOM files of a thorax and an abdomen. Results: The translating and double wedge attenuators reduce dose by an average of 30% relative to current techniques (bowtie filter with tube current

  20. Distinct innate responses are induced by attenuated Salmonella enterica serovar Typhimurium mutants.


    Powell, Daniel A; Roberts, Lydia M; Ledvina, Hannah E; Sempowski, Gregory D; Curtiss, Roy; Frelinger, Jeffrey A


    Upon bacterial infection the host cells generate a wide variety of cytokines. Genetic attenuation of bacterial physiological pathogens can be accomplished not only by disruption of normal bacterial processes, but also by the loss of the ability to redirect the host immune system. We examined nine attenuated Salmonella Typhimurium mutants for their ability to replicate as well as the cytokines produced after infection of Bone Marrow Derived Macrophages (BMDM). Infection of BMDM with attenuated Salmonella mutants led to host cytokine patterns distinct from those that followed WT infection. Surprisingly, each bacterial mutant had a unique cytokine signature. Because some of the mutants induced an IL-10 response not seen in WT, we examined the role of IL-10 on Salmonella replication. Surprisingly, addition of IL-10 before or concurrent with infection restricted growth of WT Salmonella in BMDM. Bacterial attenuation is not a single process and results in attenuated host responses, which result in unique patterns for each attenuated mutants.

  1. Distinct Innate Responses are Induced by Attenuated Salmonella enterica serovar Typhimurium Mutants

    PubMed Central

    Powell, Daniel A.; Roberts, Lydia M.; Ledvina, Hannah E.; Sempowski, Gregory D.; Curtiss, Roy; Frelinger, Jeffrey A.


    Upon bacterial infection the host cells generate a wide variety of cytokines. Genetic attenuation of bacterial physiological pathogens can be accomplished not only by disruption of normal bacterial processes, but also by the loss of the ability to redirect the host immune system. We examined nine attenuated Salmonella Typhimurium mutants for their ability to replicate as well as the cytokines produced after infection of Bone Marrow Derived Macrophages (BMDM). Infection of BMDM with attenuated Salmonella mutants led to host cytokine patterns distinct from those that followed WT infection. Surprisingly, each bacterial mutant had a unique cytokine signature. Because some of the mutants induced an IL-10 response not seen in WT, we examined the role of IL-10 on Salmonella replication. Surprisingly, addition of IL-10 before or concurrent with infection restricted growth of WT Salmonella in BMDM. Bacterial attenuation is not a single process and results in attenuated host responses, which result in unique patterns for each attenuated mutants. PMID:26546408

  2. Bone marrow transplant


    Transplant - bone marrow; Stem cell transplant; Hematopoietic stem cell transplant; Reduced intensity nonmyeloablative transplant; Mini transplant; Allogenic bone marrow transplant; Autologous bone marrow transplant; ...

  3. 4-1BB protects dendritic cells from prostate cancer-induced apoptosis.


    Youlin, Kuang; Jianwei, Zhang; Xin, Gou; Li, Zhang; Xiaodong, Weng; Xiuheng, Liu; Hengchen, Zhu; Zhiyuan, Chen


    It has been shown that human prostate cancer (PCa) cells induced apoptotic death of the most potent antigen-presenting cells, dendritic cells (DCs), which are responsible for the induction of specific antitumor immune responses. Here, we investigated the function of 4-1BB on protecting DCs from prostate cancer-induced apoptosis with an agonistic mAb to 4-1BB. RM-1 cells and DCs were co-incubated for 48 h and DC apoptosis was assessed by Annexin Vassay. TNF-α and IL-12 production were assessed by enzyme-linked immunosorbent assay (ELISA) and Bcl-2 and Bcl-xL on DCs were analyzed by Western blot. We have shown that co-incubation of RM-1 cells with DCs is accompanied by an increased level of DCs apoptosis. Triggering 4-1BB on DCs resulted in increased resistance of DCs to RM-1 cells-induced apoptosis, which was owing to the up-regulated expression of Bcl-2 and Bcl-xL, and increased secretion of TNF-αand IL-12. These results demonstrate that triggering 4-1BB on DCs could increased resistance of DCs to PCa-induced apoptosis.

  4. Ultrasonic attenuation in pearlitic steel.


    Du, Hualong; Turner, Joseph A


    Expressions for the attenuation coefficients of longitudinal and transverse ultrasonic waves are developed for steel with pearlitic microstructure. This type of lamellar duplex microstructure influences attenuation because of the lamellar spacing. In addition, longitudinal attenuation measurements were conducted using an unfocused transducer with 10 MHz central frequency on the cross section of a quenched railroad wheel sample. The dependence of longitudinal attenuation on the pearlite microstructure is observed from the changes of longitudinal attenuation from the quenched tread surface to deeper locations. The results show that the attenuation value is lowest and relatively constant within the quench depth, then increases linearly. The experimental results demonstrate a reasonable agreement with results from the theoretical model. Ultrasonic attenuation provides an important non-destructive method to evaluate duplex microstructure within grains which can be implemented for quality control in conjunction with other manufacturing processes.

  5. Rapid ex vivo imaging of PAIII prostate to bone tumor with SWIFT-MRI

    PubMed Central

    Luhach, Ihor; Idiyatullin, Djaudat; Lynch, Conor C.; Corum, Curt; Martinez, Gary V.; Garwood, Michael; Gillies, Robert J.


    Introduction The limiting factor for MRI of skeletal/mineralized tissue is fast transverse relaxation. A recent advancement in MRI technology, SWIFT (Sweep Imaging with Fourier Transform), is emerging as a new approach to overcome this difficulty. Among other techniques like UTE, ZTE and WASPI, the application of SWIFT technology has the strong potential to impact preclinical and clinical imaging, particularly in the context of primary or metastatic bone cancers since it has the added advantage of imaging water in mineralized tissues of bone allowing MRI images to be obtained of tissues previously visible only with modalities such as CT. The goal of the current study is to examine the feasibility of SWIFT for the assessment of the prostate cancer induced changes in bone formation (osteogenesis) and destruction (osteolysis) in ex vivo specimens. Methods A luciferase expressing prostate cancer cell line (PAIII) or saline control was inoculated directly into the tibia of 6-week old immunocompromised male mice. Tumor growth was assessed weekly for three weeks prior to euthanasia and dissection of the tumor bearing and sham tibias. The ex vivo mouse tibia specimens were imaged with a 9.4T and 7T MRI systems. SWIFT images are compared with traditional gradient-echo and spin-echo MRI images as well as CT and histological sections. Results SWIFT images with nominal resolution of 78 μm are obtained with the tumor and different bone structures identified. Prostate cancer induced changes in the bone microstructure are visible in SWIFT images, which is supported by spin-echo, high resolution CT and histological analysis. Conclusions SWIFT MRI is capable of high-quality high-resolution ex vivo imaging of bone tumor and surrounding bone and soft tissues. Furthermore, SWIFT MRI shows promise for in vivo bone tumor imaging, with the added benefits of non-exposure to ionizing radiation, quietness and speed. PMID:24155275

  6. Broken Bones (For Parents)


    ... Feeding Your 1- to 2-Year-Old Broken Bones KidsHealth > For Parents > Broken Bones Print A A ... bone fragments in place. When Will a Broken Bone Heal? Fractures heal at different rates, depending upon ...

  7. Bone lesion biopsy


    Bone biopsy; Biopsy - bone ... the cut, then pushed and twisted into the bone. Once the sample is obtained, the needle is ... sample is sent to a lab for examination. Bone biopsy may also be done under general anesthesia ...

  8. Bone biopsy (image)


    A bone biopsy is performed by making a small incision into the skin. A biopsy needle retrieves a sample of bone and it ... examination. The most common reasons for bone lesion biopsy are to distinguish between benign and malignant bone ...

  9. Surgery for Bone Cancer


    ... amputation. This is called limb-salvage or limb-sparing surgery . In going over treatment options, it is ... 2016 Treating Bone Cancer Surgery for Bone Cancer Radiation Therapy for Bone Cancer Chemotherapy for Bone Cancer Targeted ...

  10. Facts about Broken Bones


    ... Room? What Happens in the Operating Room? Broken Bones KidsHealth > For Kids > Broken Bones Print A A ... sticking through the skin . What Happens When a Bone Breaks? It hurts to break a bone! It's ...

  11. RNA-sequencing profiles hippocampal gene expression in a validated model of cancer-induced depression.


    Nashed, M G; Linher-Melville, K; Frey, B N; Singh, G


    To investigate the pathophysiology of cancer-induced depression (CID), we have recently developed a validated CID mouse model. Given that the efficacy of antidepressants in cancer patients is controversial, it remains unclear whether CID is a biologically distinct form of depression. We used RNA-sequencing (RNA-seq) to investigate differentially expressed genes (DEGs) in hippocampi of animals from our CID model relative a positive control model of depressive-like behavior induced with chronic corticosterone (CORT). To validate RNA-seq results, we performed quantitative real-time RT-PCR (qRT-PCR) on a subset of DEGs. Enrichment analysis using DAVID was performed on DEGs to identify enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and biological process gene ontologies (GO:BP). qRT-PCR results significantly predicted RNA-seq results. RNA-seq revealed that most DEGs identified in the CORT model overlapped with the CID model. Enrichment analyses identified KEGG pathways and GO:BP terms associated with ion homeostasis and neuronal communication for both the CORT and CID model. In addition, CID DEGs were enriched in pathways and terms relating to neuronal development, intracellular signaling, learning and memory. This study is the first to investigate CID at the mRNA level. We have shown that most hippocampal mRNA changes that are associated with a depressive-like state are also associated with cancer. Several other changes occur at the mRNA level in cancer, suggesting that the CID model may represent a biologically distinct form of a depressive-like state.

  12. Ultrasonic Attenuation in Zircaloy-4

    SciTech Connect

    Gomez, M.P.; Banchik, A.D.; Lopez Pumarega, M.I.; Ruzzante, J.E.


    In this work the relationship between Zircaloy-4 grain size and ultrasonic attenuation behavior was studied for longitudinal waves in the frequency range of 10-90 MHz. The attenuation was analyzed as a function of frequency for samples with different mechanical and heat treatments having recrystallized and Widmanstatten structures with different grain size. The attenuation behavior was analyzed by different scattering models, depending on grain size, wavelength and frequency.

  13. Attenuation of Cavity Bay Noise

    DTIC Science & Technology


    amplification, known as peaking. Overall, the palliative devices based on resonant arrays have demonstrated high levels of attenuation which are...when the resonant frequency condition is met. The attenuation from a Helmholtz type resonator is achieved through frictional losses, vortex shedding...3 the λ/4 condition can be fulfilled and therefore porous mesh devices may not be able to provide a high level of attenuation . Resonant arrays



    Wilds, R.B.; Ames, J.R.


    The line-above-ground attenuator provides a continuously variable microwave attenuator for a coaxial line that is capable of high attenuation and low insertion loss. The device consists of a short section of the line-above- ground plane type transmission lime, a pair of identical rectangular slabs of lossy material like polytron, whose longitudinal axes are parallel to and indentically spaced away from either side of the line, and a geared mechanism to adjust amd maintain this spaced relationship. This device permits optimum fineness and accuracy of attenuator control which heretofore has been difficult to achieve.

  15. Nutrition, physical activity, and bone health in women.


    Lewis, R D; Modlesky, C M


    Calcium and vitamin D can significantly impact bone mineral and fracture risk in women. Unfortunately, calcium intakes in women are low and many elderly have poor vitamin D status. Supplementation with calcium (approximately 1000 mg) can reduce bone loss in premenopausal and late postmenopausal women, especially at sites that have a high cortical bone composition. Vitamin D supplementation slows bone loss and reduces fracture rates in late postmenopausal women. While an excess of nutrients such as sodium and protein potentially affect bone mineral through increased calcium excretion, phytoestrogens in soy foods may attenuate bone loss through estrogenlike activity. Weight-bearing physical activity may reduce the risk of osteoporosis in women by augmenting bone mineral during the early adult years and reducing the loss of bone following menopause. High-load activities, such as resistance training, appear to provide the best stimulus for enhancing bone mineral; however, repetitive activities, such as walking, may have a positive impact on bone mineral when performed at higher intensities. Irrespective of changes in bone mineral, physical activities that improve muscular strength, endurance, and balance may reduce fracture risk by reducing the risk of falling. The combined effect of physical activity and calcium supplementation on bone mineral needs further investigation.

  16. Prostate cancer metastases alter bone mineral and matrix composition independent of effects on bone architecture in mice--a quantitative study using microCT and Raman spectroscopy.


    Bi, Xiaohong; Sterling, Julie A; Merkel, Alyssa R; Perrien, Daniel S; Nyman, Jeffry S; Mahadevan-Jansen, Anita


    Prostate cancer is the most common primary tumor and the second leading cause of cancer-related deaths in men in the United States. Prostate cancer bone metastases are characterized by abnormal bone remodeling processes and result in a variety of skeletal morbidities. Prevention of skeletal complications is a crucial element in prostate cancer management. This study investigated prostate cancer-induced alterations in the molecular composition and morphological structure of metastasis-bearing bones in a mouse model of prostate cancer using Raman spectroscopy and micro-computed tomography (microCT). LNCaP C4-2B prostate cancer cells were injected into the right tibiae of 5-week old male SCID mice. Upon sacrifice at 8weeks post tumor inoculation, two out of the ten tumor-bearing tibiae showed only osteoblastic lesions in the radiographs, 4 osteolytic lesions only and 4 mixed with osteoblastic and osteolytic lesions. Carbonate substitution was significantly increased while there was a marked reduction in the level of collagen mineralization, mineral crystallinity, and carbonate:matrix ratio in the cortex of the intact tumor-bearing tibiae compared to contralateral controls. MicroCT analysis revealed a significant reduction in bone volume/total volume, trabecular number and trabecular thickness, as well as significant increase in bone surface/volume ratio in tibiae with osteolytic lesions, suggesting active bone remodeling and bone loss. None of the changes in bone compositional properties were correlated with lesion area from radiographs or the changes in bone architecture from microCT. This study indicates that LNCaP C4-2B prostate cancer metastases alter bone tissue composition independent of changes in architecture, and altered bone quality may be an important contributor to fracture risk in these patients. Raman spectroscopy may provide a new avenue of investigation into interactions between tumor and bone microenvironment.

  17. Bone image segmentation.


    Liu, Z Q; Liew, H L; Clement, J G; Thomas, C D


    Characteristics of microscopic structures in bone cross sections carry essential clues in age determination in forensic science and in the study of age-related bone developments and bone diseases. Analysis of bone cross sections represents a major area of research in bone biology. However, traditional approaches in bone biology have relied primarily on manual processes with very limited number of bone samples. As a consequence, it is difficult to reach reliable and consistent conclusions. In this paper we present an image processing system that uses microstructural and relational knowledge present in the bone cross section for bone image segmentation. This system automates the bone image analysis process and is able to produce reliable results based on quantitative measurements from a large number of bone images. As a result, using large databases of bone images to study the correlation between bone structural features and age-related bone developments becomes feasible.

  18. Mesenchymal Dental Pulp Cells Attenuate Dentin Resorption in Homeostasis

    PubMed Central

    Zheng, Y.; Chen, M.; He, L.; Marão, H.F.; Sun, D.M.; Zhou, J.; Kim, S.G.; Song, S.; Wang, S.L.


    Dentin in permanent teeth rarely undergoes resorption in development, homeostasis, or aging, in contrast to bone that undergoes periodic resorption/remodeling. The authors hypothesized that cells in the mesenchymal compartment of dental pulp attenuate osteoclastogenesis. Mononucleated and adherent cells from donor-matched rat dental pulp (dental pulp cells [DPCs]) and alveolar bone (alveolar bone cells [ABCs]) were isolated and separately cocultured with primary rat splenocytes. Primary splenocytes readily aggregated and formed osteoclast-like cells in chemically defined osteoclastogenesis medium with 20 ng/mL of macrophage colony-stimulating factor (M-CSF) and 50 ng/mL of receptor activator of nuclear factor κB ligand (RANKL). Strikingly, DPCs attenuated osteoclastogenesis when cocultured with primary splenocytes, whereas ABCs slightly but significantly promoted osteoclastogenesis. DPCs yielded ~20-fold lower RANKL expression but >2-fold higher osteoprotegerin (OPG) expression than donor-matched ABCs, yielding a RANKL/OPG ratio of 41:1 (ABCs:DPCs). Vitamin D3 significantly promoted RANKL expression in ABCs and OPG in DPCs. In vivo, rat maxillary incisors were atraumatically extracted (without any tooth fractures), followed by retrograde pulpectomy to remove DPCs and immediate replantation into the extraction sockets to allow repopulation of the surgically treated root canal with periodontal and alveolar bone–derived cells. After 8 wk, multiple dentin/root resorption lacunae were present in root dentin with robust RANKL and OPG expression. There were areas of dentin resoprtion alternating with areas of osteodentin formation in root dentin surface in the observed 8 wk. These findings suggest that DPCs of the mesenchymal compartment have an innate ability to attenuate osteoclastogenesis and that this innate ability may be responsible for the absence of dentin resorption in homeostasis. Mesenchymal attenuation of dentin resorption may have implications in internal

  19. Suicide Risk: Amplifiers and Attenuators.

    ERIC Educational Resources Information Center

    Plutchik, Robert; Van Praag, Herman M.


    Attempts to integrate findings on correlates of suicide and violent risk in terms of a theory called a two-stage model of countervailing forces, which assumes that the strength of aggressive impulses is modified by amplifiers and attenuators. The vectorial interaction of amplifiers and attenuators creates an unstable equilibrium making prediction…

  20. Adjustable Optical-Fiber Attenuator

    NASA Technical Reports Server (NTRS)

    Buzzetti, Mike F.


    Adjustable fiber-optic attenuator utilizes bending loss to reduce strength of light transmitted along it. Attenuator functions without introducing measurable back-reflection or insertion loss. Relatively insensitive to vibration and changes in temperature. Potential applications include cable television, telephone networks, other signal-distribution networks, and laboratory instrumentation.

  1. Cadmium content of human cancellous bone

    SciTech Connect

    Knuuttila, M.; Lappalainen, R.; Olkkonen, H.; Lammi, S.; Albava, E.M.


    The cadmium content of human cancellous bone was related to age, sex, bone loss, physical properties, and elemental composition. Bone specimens from the anterior iliac crest were collected from 88 cadavers with a normal mineral status, and from 50 cadavers which had bone loss from chronic diseases and immobilization. The element concentrations were analyzed using atomic absorption spectrophotometry. Bone fluoride levels were determined with the ion specific electrode, the mineral density with the gamma ray attenuation method, and the compressive strength with a strain transducer. The data were analyzed using multiple linear regression analysis. The mean cadmium content of 0.22 +/- 0.16 dry weight (+/- SD) in the samples did not change with age and its content was slightly greater in males than in females. Furthermore, no statistically significant relationship was found in cadmium content to bone loss changes or to the calcium content of bone. The cadmium content had a high statistically significant positive correlation with the strontium and nickel content.

  2. Bone growth and turnover in progesterone receptor knockout mice.

    SciTech Connect

    Rickard, David J.; Iwaniec, Urszula T.; Evans, Glenda; Hefferan, Theresa E.; Hunter, Jaime C.; Waters, Katrina M.; Lydon, John P.; O'Malley, Bert W.; Khosla, Sundeep; Spelsberg, Thomas C.; Turner, Russell T.


    The role of progesterone receptor (PR) signaling in skeletal metabolism is controversial. To address whether signaling through the PR is necessary for normal bone growth and turnover, we performed histomorphometric and mCT analyses of bone from homozygous female PR knockout (PRKO) mice at 6, 12, and 26 weeks of age. These mice possess a null mutation of the PR locus, which blocks the gene expression of A and B isoforms of PR. Body weight gain, uterine weight gain and tibia longitudinal bone growth was normal in PRKO mice. In contrast, total and cortical bone mass were increased in long bones of post-pubertal (12 and 26-week-old) PRKO mice, whereas cancellous bone mass was normal in the tibia but increased in the humerus. The striking 57% decrease in cancellous bone from the proximal tibia metaphysis which occurred between 6 and 26 weeks in WT mice was abolished in PRKO mice. The improved bone balance in aging PRKO mice was associated with elevated bone formation and a tendency toward reduced osteoclast perimeter. Taken together, these findings suggest that PR signaling in mice attenuates the accumulation of cortical bone mass during adolescence and is required for early age-related loss of cancellous bone.

  3. Bisphosphonates as a Countermeasure to Space Flight Induced Bone Loss

    NASA Technical Reports Server (NTRS)

    LeBlanc, A.; Matsumoto, T.; Jones, J.; Shapiro, J.; Lang, T.; Shackelford, L.; Smith, S.; Evans, H.; Spector, E.; Ploutz-Snyder, R.; Sibonga, J.; Nakamura, T.; Kohri, K.; Ohshima, H.


    This poster reviews the possibility of using Bisphosphonates to counter the bone loss that is experienced during space flight. The Hypothesis that is tested in this experiment is that the combined effect of anti-resorptive drugs plus in-flight exercise regimen will attenuate space flight induced loss in bone mass and strength and reduce renal stone risk. The experiment design, the status and the results are described.

  4. Bone Density Test


    Tests and Procedures Bone density test By Mayo Clinic Staff A bone density test determines if you have osteoporosis — a disease that causes bones to ... your bones could be quite weak. A bone density test enhances the accuracy of calculating your risk ...

  5. Proximal Tibial Bone Graft


    ... All Site Content AOFAS / FootCareMD / Treatments Proximal Tibial Bone Graft Page Content What is a bone graft? Bone grafts may be needed for various ... the proximal tibia. What is a proximal tibial bone graft? Proximal tibial bone graft (PTBG) is a ...

  6. Bone scan in metabolic bone diseases. Review.


    Abdelrazek, Saeid; Szumowski, Piotr; Rogowski, Franciszek; Kociura-Sawicka, Agnieszka; Mojsak, Małgorzata; Szorc, Małgorzata


    Metabolic bone disease encompasses a number of disorders that tend to present a generalized involvement of the whole skeleton. The disorders are mostly related to increased bone turnover and increased uptake of radiolabelled diphosphonate. Skeletal uptake of 99mTc-labelled diphosphonate depends primarily upon osteoblastic activity, and to a lesser extent, skeletal vascularity. A bone scan image therefore presents a functional display of total skeletal metabolism and has valuable role to play in the assessment of patients with metabolic bone disorders. However, the bone scan appearances in metabolic bone disease are often non-specific, and their recognition depends on increased tracer uptake throughout the whole skeleton. It is the presence of local lesions, as in metastatic disease, that makes a bone scan appearance obviously abnormal. In the early stages, there will be difficulty in evaluating the bone scans from many patients with metabolic bone disease. However, in the more severe cases scan appearances can be quite striking and virtually diagnostic.

  7. Bone scan appearances following bone and bone marrow biopsy

    SciTech Connect

    McKillop, J.H.; Maharaj, D.; Boyce, B.F.; Fogelman, I.


    Bone marrow and bone biopsies are performed not infrequently in patients referred for bone scans and represent a potential cause of a ''false positive'' focal abnormality on the bone scan. The authors have therefore examined the scan appearances in a series of patients who had undergone either sternal marrow biopsy, (Salah needle, diameter 1.2 mm) trephine iliac crest marrow biopsy (Jamshidi 11 gauge needle, diameter 3.5 mm) or a transiliac bone biopsy (needle diameter 8 mm). Of 18 patients studied 1 to 45 days after sternal marrow 17 had normal scan appearances at the biopsy site and 1 had a possible abnormality. None of 9 patients studied 4 to 19 days after trephine iliac crest marrow biopsy had a hot spot at the biopsy site. A focal scan abnormality was present at the biopsy site in 9/11 patients studied 5 to 59 days after a trans iliac bone biopsy. No resultant scan abnormality was seen in 4 patients imaged within 3 days of the bone biopsy or in 3 patients imaged 79 to 138 days after the procedure. Bone marrow biopsy of the sternum or iliac crest does not usually cause bone scan abnormalities. A focal abnormality at the biopsy site is common in patients imaged 5 days to 2 months after bone biopsy. The gauge of the needle employed in the biopsy and thus the degree of bone trauma inflicted, is likely to be main factor determining the appearance of bone scan abnormalities at the biopsy site.

  8. Bone development

    PubMed Central

    Berendsen, Agnes D.; Olsen, Bjorn R.


    The development of the vertebrate skeleton reflects its evolutionary history. Cartilage formation came before biomineralization and a head skeleton evolved before the formation of axial and appendicular skeletal structures. This review describes the processes that result in endochondral and intramembranous ossification, the important roles of growth and transcription factors, and the consequences of mutations in some of the genes involved. Following a summary of the origin of cartilage, muscle, and tendon cell lineages in the axial skeleton, we discuss the role of muscle forces in the formation of skeletal architecture and assembly of musculoskeletal functional units. Finally, ontogenetic patterning of bones in response to mechanical loading is reviewed. PMID:26453494

  9. Menopause and Bone Loss


    ... You reach your highest bone mass (size and density) at about age 30. Then, sometime between age ... your bones, your doctor may do a bone density test (DEXA scan). This test gives exact measurements ...

  10. Bone density scan (image)


    ... bone the higher the risk of fractures. A bone scan, along with a patient's medical history, is a ... and whether any preventative treatment is needed. A bone density scan has the advantage of being painless and exposing ...

  11. Green tea polyphenols supplementation improves bone microstructure in orchidectomized middle-Aged rats

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our recent study shows that green tea polyphenols (GTP) attenuate trabecular bone loss in ovariectomized middle-aged female rats. To investigate whether GTP prevents bone loss in male rats, 40 rats with and without oriectomy (ORX) were assigned to 4 groups in a 2 (sham vs. ORX)× 2 (no GTP and 0.5% G...

  12. Dietary restrictions, bone density, and bone quality.


    Huang, Tsang-hai; Ables, Gene P


    Caloric restriction (CR), protein restriction (PR), and specific amino acid restriction (e.g., methionine restriction (MR)) are different dietary interventions that have been confirmed with regard to their comprehensive benefits to metabolism and health. Based on bone densitometric measurements, weight loss induced by dietary restriction is known to be accompanied by reduced areal bone mineral density, bone mass, and/or bone size, and it is considered harmful to bone health. However, because of technological advancements in bone densitometric instruments (e.g., high-resolution X-ray tomography), dietary restrictions have been found to cause a reduction in bone mass/size rather than volumetric bone mineral density. Furthermore, when considering bone quality, bone health consists of diverse indices that cannot be fully represented by densitometric measurements alone. Indeed, there is evidence that moderate dietary restrictions do not impair intrinsic bone material properties, despite the reduction in whole-bone strength because of a smaller bone size. In the present review, we integrate research evidence from traditional densitometric measurements, metabolic status assays (e.g., energy metabolism, oxidative stresses, and inflammatory responses), and biomaterial analyses to provide revised conclusions regarding the effects of CR, PR, and MR on the skeleton.

  13. Technical aspects of bone scintigraphy.


    Brown, M L; O'Connor, M K; Hung, J C; Hayostek, R J


    Optimal bone scintigraphy is obtained by using a current generation gamma camera with a high-resolution collimator, minimizing the patient-to-collimator distance, using scatter reduction techniques where possible, and obtaining a 500,000 to 1 million count image for 40-cm field of view camera. Hard copy images from an analog or digital formatter should be optimized to display all intensities either on the same images or, when necessary, to display the low count information on one image and the high count information on another. Additional images using different collimators, such as converging or pinhole collimators, and oblique and lateral views should be obtained when necessary to demonstrate or define the pathologic area. To optimize SPECT imaging, the following parameters should be used: a high-resolution collimator, a 128 x 128 acquisition matrix, and minimum separation between the patient and the collimator, which may require the use of an elliptic orbit. Between 64 and 128 views should be obtained, and depending on preference, the planar data should be prefiltered with a Butterworth, order 8-12 and a cutoff at 0.5 Nyquist. The data should then be reconstructed using a simple ramp filter. This method provides a good technique when one is first beginning to perform bone SPECT. Attenuation correction is not generally beneficial for SPECT bone studies, although sometimes weighted backprojection may improve image contrast and resolution. Finally, the use of volume rendering may help clarify the location of suspect lesions.

  14. Bone marrow transplant - discharge


    Transplant - bone marrow - discharge; Stem cell transplant - discharge; Hematopoietic stem cell transplant - discharge; Reduced intensity; Non-myeloablative transplant - discharge; Mini transplant - discharge; Allogenic bone marrow transplant - ...

  15. Classification of bones from MR images in torso PET-MR imaging using a statistical shape model

    NASA Astrophysics Data System (ADS)

    Reza Ay, Mohammad; Akbarzadeh, Afshin; Ahmadian, Alireza; Zaidi, Habib


    There have been exclusive features for hybrid PET/MRI systems in comparison with its PET/CT counterpart in terms of reduction of radiation exposure, improved soft-tissue contrast and truly simultaneous and multi-parametric imaging capabilities. However, quantitative imaging on PET/MR is challenged by attenuation of annihilation photons through their pathway. The correction for photon attenuation requires the availability of patient-specific attenuation map, which accounts for the spatial distribution of attenuation coefficients of biological tissues. However, the lack of information on electron density in the MR signal poses an inherent difficulty to the derivation of the attenuation map from MR images. In other words, the MR signal correlates with proton densities and tissue relaxation properties, rather than with electron density and, as such, it is not directly related to attenuation coefficients. In order to derive the attenuation map from MR images at 511 keV, various strategies have been proposed and implemented on prototype and commercial PET/MR systems. Segmentation-based methods generate an attenuation map by classification of T1-weighted or high resolution Dixon MR sequences followed by assignment of predefined attenuation coefficients to various tissue types. Intensity-based segmentation approaches fail to include bones in the attenuation map since the segmentation of bones from conventional MR sequences is a difficult task. Most MR-guided attenuation correction techniques ignore bones owing to the inherent difficulties associated with bone segmentation unless specialized MR sequences such as ultra-short echo (UTE) sequence are utilized. In this work, we introduce a new technique based on statistical shape modeling to segment bones and generate a four-class attenuation map. Our segmentation approach requires a torso bone shape model based on principle component analysis (PCA). A CT-based training set including clearly segmented bones of the torso region

  16. miR-142-3p prevents macrophage differentiation during cancer-induced myelopoiesis.


    Sonda, Nada; Simonato, Francesca; Peranzoni, Elisa; Calì, Bianca; Bortoluzzi, Stefania; Bisognin, Andrea; Wang, Ena; Marincola, Francesco M; Naldini, Luigi; Gentner, Bernhard; Trautwein, Christian; Sackett, Sara Dutton; Zanovello, Paola; Molon, Barbara; Bronte, Vincenzo


    Tumor progression is accompanied by an altered myelopoiesis causing the accumulation of immunosuppressive cells. Here, we showed that miR-142-3p downregulation promoted macrophage differentiation and determined the acquisition of their immunosuppressive function in tumor. Tumor-released cytokines signaling through gp130, the common subunit of the interleukin-6 cytokine receptor family, induced the LAP∗ isoform of C/EBPβ transcription factor, promoting macrophage generation. miR-142-3p downregulated gp130 by canonical binding to its messenger RNA (mRNA) 3' UTR and repressed C/EBPβ LAP∗ by noncanonical binding to its 5' mRNA coding sequence. Enforced miR expression impaired macrophage differentiation both in vitro and in vivo. Mice constitutively expressing miR-142-3p in the bone marrow showed a marked increase in survival following immunotherapy with tumor-specific T lymphocytes. By modulating a specific miR in bone marrow precursors, we thus demonstrated the feasibility of altering tumor-induced macrophage differentiation as a potent tool to improve the efficacy of cancer immunotherapy.

  17. Method and system for in vivo measurement of bone tissue using a two level energy source

    NASA Technical Reports Server (NTRS)

    Cameron, J. R.; Judy, P. F. (Inventor)


    Methods and apparatus are provided for radiologically determining the bone mineral content of living human bone tissue independently of the concurrent presence of adipose and other soft tissues. A target section of the body of the subject is irradiated with a beam of penetrative radiations of preselected energy to determine the attenuation of such beam with respect to the intensity of each of two radiations of different predetermined energy levels. The resulting measurements are then employed to determine bone mineral content.

  18. Factors affecting bone growth.


    Gkiatas, Ioannis; Lykissas, Marios; Kostas-Agnantis, Ioannis; Korompilias, Anastasios; Batistatou, Anna; Beris, Alexandros


    Bone growth and development are products of the complex interactions of genetic and environmental factors. Longitudinal bone growth depends on the growth plate. The growth plate has 5 different zones-each with a different functional role-and is the final target organ for longitudinal growth. Bone length is affected by several systemic, local, and mechanical factors. All these regulation systems control the final length of bones in a complicated way. Despite its significance to bone stability, bone growth in width has not been studied as extensively as longitudinal bone growth. Bone growth in width is also controlled by genetic factors, but mechanical loading regulates periosteal apposition. In this article, we review the most recent data regarding bone growth from the embryonic age and analyze the factors that control bone growth. An understanding of this complex system is important in identifying metabolic and developmental bone diseases and fracture risk.

  19. A structural approach in the study of bones: fossil and burnt bones at nanosize scale

    NASA Astrophysics Data System (ADS)

    Piga, Giampaolo; Baró, Maria Dolors; Escobal, Irati Golvano; Gonçalves, David; Makhoul, Calil; Amarante, Ana; Malgosa, Assumpció; Enzo, Stefano; Garroni, Sebastiano


    We review the different factors affecting significantly mineral structure and composition of bones. Particularly, it is assessed that micro-nanostructural and chemical properties of skeleton bones change drastically during burning; the micro- and nanostructural changes attending those phases manifest themselves, amongst others, in observable alterations to the bones colour, morphology, microstructure, mechanical strength and crystallinity. Intense changes involving the structure and chemical composition of bones also occur during the fossilization process. Bioapatite material is contaminated by an heavy fluorination process which, on a long-time scale reduces sensibly the volume of the original unit cell, mainly the a-axis of the hexagonal P63/m space group. Moreover, the bioapatite suffers to a varying degree of extent by phase contamination from the nearby environment, to the point that rarely a fluorapatite single phase may be found in fossil bones here examined. TEM images supply precise and localized information, on apatite crystal shape and dimension, and on different processes that occur during thermal processes or fossilization of ancient bone, complementary to that given by X-ray diffraction and Attenuated Total Reflection Infrared spectroscopy. We are presenting a synthesis of XRD, ATR-IR and TEM results on the nanostructure of various modern, burned and palaeontological bones.

  20. Soy Isoflavones and Osteoporotic Bone Loss: A Review with an Emphasis on Modulation of Bone Remodeling

    PubMed Central

    Zheng, Xi; Lee, Sun-Kyeong


    Abstract Osteoporosis is an age-related disorder that affects both women and men, although estrogen deficiency induced by menopause accelerates bone loss in older women. As the demographic shifts to a more aged population, a growing number of men and women will be afflicted with osteoporosis. Since the current drug therapies available have multiple side effects, including increased risk of developing certain types of cancer or complications, a search for potential nonpharmacologic alternative therapies for osteoporosis is of prime interest. Soy isoflavones (SI) have demonstrated potential bone-specific effects in a number of studies. This article provides a systematic review of studies on osteoporotic bone loss in relation to SI intake from diet or supplements to comprehensively explain how SI affect the modulation of bone remodeling. Evidence from epidemiologic studies supports that dietary SI attenuate menopause-induced osteoporotic bone loss by decreasing bone resorption and stimulating bone formation. Other studies have also illustrated that bone site-specific trophic and synergistic effects combined with exercise intervention might contribute to improve the bioavailability of SI or strengthen the bone-specific effects. To date, however, the effects of dietary SI on osteoporotic bone loss remain inconclusive, and study results vary from study to study. The current review will discuss the potential factors that result in the conflicting outcomes of these studies, including dosages, intervention materials, study duration, race, and genetic differences. Further well-designed studies are needed to fully understand the underlying mechanism and evaluate the effects of SI on osteoporosis in humans. PMID:26670451

  1. Interaural attenuation in the cat, measured with single fibre data.


    Caird, D; Göttl, K H; Klinke, R


    Acoustic crosstalk was measured in the pentobarbital anesthetized cat using the responses of single units in the auditory nerve to ipsilateral and contralateral sound stimuli. The mean interaural attenuation (IATT) was found to be 76 dB between 350 and 18,000 Hz. No systematic variation of IATT with frequency was found although a large variation between different units with similar characteristic frequencies could be seen. We suggest that this scatter is due to the complex fine structure of the bone conduction pathways (Tonndorf (1966) Bone conduction. Acta Otolaryngol. Suppl. 213, 1-132). There are large discrepancies between these data and values obtained using cochlear microphonic potentials as an indicator. We suggest that cochlear microphonic crosstalk data in the literature should be treated with caution as it is extremely difficult to exclude the effect or direct electrical crosstalk on these analog signals.

  2. Noninvasive Ultrasound Imaging for Bone Quality Assessment Using Scanning Confocal Acoustic Diagnosis, μCT, DXA Measurements, and Mechanical Testing

    NASA Astrophysics Data System (ADS)

    Qin, Yi-Xian; Xia, Yi; Lin, Wei; Mittra, Erik; Rubin, Clint; Gruber, Barry

    Osteoporosis is a disease characterized by decreased bone mass and progressive deterioration of the microstructure, affecting both mineral density and bone's fragility. Current diagnoses are only measuring apparent bone mineral density (AppBMD). Using our newly developed scanning confocal acoustic diagnostic (SCAD) system, we evaluated the ability of quantitative ultrasound in noninvasively predicting bone's quantity and quality on 19 human cadaver calcanei. Results show that ultrasound attenuation image on intact calcaneus represents bone mass distribution. High correlation (R=0.82) exists between SCAD determined broadband ultrasound attenuation (BUA) and DXA determined AppBMD at the calcaneus, as well as in the AppBMD result at femoral neck (R=0.81). SCAD determined BUA and ultrasound velocity (UV) are highly correlated with the micro-CT and mechanical testing determined bone quantity and quality parameters. These results suggest that image-based quantitative ultrasound is able to identify ROI and predict both bone mass and strength.

  3. Bone scan appearances following biopsy of bone and bone marrow

    SciTech Connect

    McKillop, J.H.; Maharaj, D.; Boyce, B.F.; Fogelman, I.


    The influence of sternal marrow aspiration, iliac crest marrow aspiration, and iliac crest bone biopsy on bone scan appearances was examined. Eighteen patients were scanned a mean of 9.9 days after sternal marrow aspiration with a Salah needle. Bone scans obtained in 9 patients a mean of 10 days aftr iliac crest trephine marrow biopsy with a Jamshidi needle showed no abnormality at the biopsy site. In 18 patients with metabolic bone disease who had undergone iliac crest bone biopsy with an 8 mm needle, a scan abnormality due to the biopsy was usually present when the interval between the biopsy and the scan was 5 days to 2 months. Patients who were scanned within 3 days of iliac crest bone biopsy or more than 2 months after biopsy had normal scan appearance at the biopsy site.

  4. Bone Marrow Diseases


    Bone marrow is the spongy tissue inside some of your bones, such as your hip and thigh bones. It contains stem cells. The stem cells can ... the platelets that help with blood clotting. With bone marrow disease, there are problems with the stem ...

  5. Metastatic Bone Disease


    ... secrete factors that interact with the naturally occurring cells in the bone and cause bone destruction, new bone formation, or both. Effects Because MBD weakens the affected bones, people with the disease are prone to fractures. Broken ...

  6. Ultrasonic characterization of human trabecular bone microstructure.


    Hakulinen, Mikko A; Day, Judd S; Töyräs, Juha; Weinans, Harrie; Jurvelin, Jukka S


    New quantitative ultrasound (QUS) techniques involving ultrasound backscattering have been introduced for the assessment of bone quality. QUS parameters are affected by the transducer characteristics, e.g. frequency range, wave and pulse length. Although frequency-dependent backscattering has been studied extensively, understanding of the ultrasound scattering phenomenon in trabecular bone is still limited. In the present study, the relationships between QUS parameters and the microstructure of human trabecular bone were investigated experimentally and by using numerical simulations. Speed of sound (SOS), normalized broadband ultrasound attenuation (nBUA), average attenuation, integrated reflection coefficient (IRC) and broadband ultrasound backscatter (BUB) were measured for 26 human trabecular bone cylinders. Subsequently, a high-resolution microCT system was used to determine the microstructural parameters. Moreover, based on the sample-specific microCT data, a numerical model for ultrasound propagation was developed for the simulation of experimental measurements. Experimentally, significant relationships between the QUS parameters and microstructural parameters were demonstrated. The relationships were dependent on the frequency, and the strongest association (r = 0.88) between SOS and structural parameters was observed at a centre frequency of 5 MHz. nBUA, average attenuation, IRC and BUB showed somewhat lower linear correlations with the structural properties at a centre frequency of 5 MHz, as compared to those determined at lower frequencies. Multiple regression analyses revealed that the variation of acoustic parameters could best be explained by parameters reflecting the amount of mineralized tissue. A principal component analysis demonstrated that the strongest determinants of BUB and IRC were related to the trabecular structure. However, other structural characteristics contributed significantly to the prediction of the acoustic parameters as well. The

  7. Bone Health and Osteoporosis.


    Lupsa, Beatrice C; Insogna, Karl


    Osteoporosis is characterized by low bone mass and microarchitectural deterioration of bone tissue leading to decreased bone strength and an increased risk of low-energy fractures. Central dual-energy X-ray absorptiometry measurements are the gold standard for determining bone mineral density. Bone loss is an inevitable consequence of the decrease in estrogen levels during and following menopause, but additional risk factors for bone loss can also contribute to osteoporosis in older women. A well-balanced diet, exercise, and smoking cessation are key to maintaining bone health as women age. Pharmacologic agents should be recommended in patients at high risk for fracture.

  8. Levels of miRNA and Hormones in Thoracic Duct Lymph in Rats with Experimental Breast Cancer Induced by N-Methyl-N-Nitrosourea.


    Lykov, A P; Kabakov, A V; Kazakov, O V; Bondarenko, N A; Poveshchenko, O V; Raiter, T V; Poveshchenko, A F; Strunkin, D N; Konenkov, V I


    We studied hormone levels in the thoracic duct lymph and expression of miRNA involved in the pathogenesis of breast cancer induced in rats by intramammary injection of N-methyl-Nnitrosourea. The correlations between miRNA expression and hormone levels depended on the type of treatment.

  9. [Imaging of bone metastases].


    Amoretti, Nicolas; Thariat, Juliette; Nouri, Yasir; Foti, Pauline; Hericord, Olivier; Stolear, Sandy; Coco, Lucia; Hauger, Olivier; Huwart, Laurent; Boileau, Pascal


    Bone metastases are detected at initial diagnosis of cancer in 25% of cases and bone metastases are common in the course of a majority of cancer types. The spine and proximal long bones are the most affected sites. Knowledge of the basic radiological semiology is important to make the proper diagnosis of metastasis(s) bone(s), especially in situations in which the clinical context is not suggestive of metastases (such as cases where bone metastases are inaugural or cases of peripheral solitary metastasis). Tumor aggressiveness can be assessed at the level of the cortical bone and periosteum. Lodwick criteria are useful for the diagnosis of malignancy and tumor aggressiveness at initial diagnosis on plain radiographs, which are very important in the context of bone metastases. A CT scanner is required to confirm the malignancy of a bone lesion. MRI is complementary to the scanner including for the assessment of bone marrow involvement and tumor extensions.

  10. Detection of Pancreatic Cancer-induced Cachexia using a Fluorescent Myoblast Reporter System and Analysis of Metabolite Abundance

    PubMed Central

    Winnard, Paul T.; Bharti, Santosh; Penet, Marie-France; Marik, Radharani; Mironchik, Yelena; Wildes, Flonne; Maitra, Anirban; Bhujwalla, Zaver M.


    The dire effects of cancer-induced cachexia undermine treatment and contribute to decreased survival rates. Therapeutic options for this syndrome are limited, and therefore efforts to identify signs of precachexia in cancer patients are necessary for early intervention. The applications of molecular and functional imaging that would enable a whole-body “holistic” approach to this problem may lead to new insights and advances for diagnosis and treatment of this syndrome. Here we have developed a myoblast optical reporter system with the purpose of identifying early cachectic events. We generated a myoblast cell line expressing a dual tdTomato:GFP construct that was grafted onto the muscle of mice bearing human pancreatic cancer xenografts to provide noninvasive live imaging of events associated with cancer-induced cachexia (i.e., weight loss). Real time optical imaging detected a strong tdTomato fluorescent signal from skeletal muscle grafts in mice with weight loses of only 1.2 to 2.7% and tumor burdens of only ~79 to ~170 mm3. Weight loss in cachectic animals was also associated with a depletion of lipid, cholesterol, valine, and alanine levels, which may provide informative biomarkers of cachexia. Taken together, our findings demonstrate the utility of a reporter system that is capable of tracking tumor-induced weight loss, an early marker of cachexia. Future studies incorporating resected tissue from human pancreatic ductal adenocarcinoma (PDAC) into a reporter-carrying mouse may be able to provide a risk assessment of cachexia with possible implications for therapeutic development. PMID:26719527

  11. Observation and analysis on skin cancer induced by UVB irradiation using optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Wang, Yunxia; Wu, Shulian; Li, Hui; Zheng, Xiaoxiao


    Basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) are the prevalent skin cancers, which have a quite high incidence in the white race. In recent years, however, their incidences have been increasing in the yellow race, resulting in a great threat to the public health. According to researches, chronics UVB irradiation (280nm~320nm) is the major culprit of skin cancer in humans. In our study, the model of UVB induced skin cancer was established firstly. Optical coherence tomography (OCT) combined with the histopathology was exploited to monitor the morphologic and histological changes of the process of UVB induced skin cancer. Meanwhile, this canceration process was systematically studied and analyzed from the perspective of tissue optics. The attenuation coefficient (μt) has a rising trend in the epidermis, but which shows a downward trend in the dermis. The results are conducive to understand the process of UVB-induced skin cancer and further be able to provide a reference for medical researchers.

  12. Norathyriol Suppresses Skin Cancers Induced by Solar Ultraviolet Radiation by Targeting ERK Kinases

    SciTech Connect

    Li, Jixia; Malakhova, Margarita; Mottamal, Madhusoodanan; Reddy, Kanamata; Kurinov, Igor; Carper, Andria; Langfald, Alyssa; Oi, Naomi; Kim, Myoung Ok; Zhu, Feng; Sosa, Carlos P.; Zhou, Keyuan; Bode, Ann M.; Dong, Zigang


    Ultraviolet (UV) irradiation is the leading factor in the development of skin cancer, prompting great interest in chemopreventive agents for this disease. In this study, we report the discovery of norathyriol, a plant-derived chemopreventive compound identified through an in silico virtual screening of the Chinese Medicine Library. Norathyriol is a metabolite of mangiferin found in mango, Hypericum elegans, and Tripterospermum lanceolatum and is known to have anticancer activity. Mechanistic investigations determined that norathyriol acted as an inhibitor of extracellular signal-regulated kinase (ERK)1/2 activity to attenuate UVB-induced phosphorylation in mitogen-activated protein kinases signaling cascades. We confirmed the direct and specific binding of norathyriol with ERK2 through a cocrystal structural analysis. The xanthone moiety in norathyriol acted as an adenine mimetic to anchor the compound by hydrogen bonds to the hinge region of the protein ATP-binding site on ERK2. Norathyriol inhibited in vitro cell growth in mouse skin epidermal JB6 P+ cells at the level of G{sub 2}-M phase arrest. In mouse skin tumorigenesis assays, norathyriol significantly suppressed solar UV-induced skin carcinogenesis. Further analysis indicated that norathyriol mediates its chemopreventive activity by inhibiting the ERK-dependent activity of transcriptional factors AP-1 and NF-{kappa}B during UV-induced skin carcinogenesis. Taken together, our results identify norathyriol as a safe new chemopreventive agent that is highly effective against development of UV-induced skin cancer.

  13. Bone health in HIV and hepatitis B or C infections

    PubMed Central

    Biver, Emmanuel; Calmy, Alexandra; Rizzoli, René


    Chronic infections with human immunodeficiency virus (HIV), hepatitis B virus (HBV) or hepatitis C virus (HCV) add to age-dependent bone loss and may contribute to lower bone strength in the elderly. In this review, we report recent highlights on the epidemiology of bone fragility in chronic viral infections with HIV, HCV and HBV, its physiopathology and discuss the interference of antiviral therapies with bone metabolism. Chronic infections influence bone through the interactions between risk factors for bone fragility and falls (which are highly prevalent in infected patients), virus activity and antiviral drugs. HIV-infected patients are at increased risk of fracture and the risk is higher in cases of co-infection with HIV and untreated chronic viral hepatitis. In HIV patients, the majority of bone loss occurs during virus activity and at initiation of antiretroviral therapy (ART). However, long-term elderly HIV-infected patients on successful ART display bone microstructure alterations only partially captured by dual energy X-ray absorptiometry (DXA). Bone loss is associated with an increase of bone resorption, reflecting the upregulation of the receptor activator of nuclear factor-kappaB ligand (RANKL) and osteoprotegerin (OPG) pathways via a crosstalk between virus activity, inflammation and the immune system. The use of some antiviral drugs, such as tenofovir (controlling both HBV and HIV infections) or protease inhibitors, may be associated with higher bone toxicity. The reduction of tenofovir plasma concentrations with the implementation of tenofovir alafenamide (TAF) attenuates bone mineral density (BMD) loss but it remains unknown whether it will contribute to reducing fracture risk in long-term HIV-treated patients. Moreover, to what extent the new direct-acting agents for treatment of HCV, including nucleotide inhibitors and protease inhibitors, may affect bone health similarly as ART in HIV should be investigated. PMID:28101146

  14. Probiotics protect mice from ovariectomy-induced cortical bone loss.


    Ohlsson, Claes; Engdahl, Cecilia; Fåk, Frida; Andersson, Annica; Windahl, Sara H; Farman, Helen H; Movérare-Skrtic, Sofia; Islander, Ulrika; Sjögren, Klara


    The gut microbiota (GM) modulates the hosts metabolism and immune system. Probiotic bacteria are defined as live microorganisms which when administered in adequate amounts confer a health benefit on the host and can alter the composition of the GM. Germ-free mice have increased bone mass associated with reduced bone resorption indicating that the GM also regulates bone mass. Ovariectomy (ovx) results in bone loss associated with altered immune status. The purpose of this study was to determine if probiotic treatment protects mice from ovx-induced bone loss. Mice were treated with either a single Lactobacillus (L) strain, L. paracasei DSM13434 (L. para) or a mixture of three strains, L. paracasei DSM13434, L. plantarum DSM 15312 and DSM 15313 (L. mix) given in the drinking water during 6 weeks, starting two weeks before ovx. Both the L. para and the L. mix treatment protected mice from ovx-induced cortical bone loss and bone resorption. Cortical bone mineral content was higher in both L. para and L. mix treated ovx mice compared to vehicle (veh) treated ovx mice. Serum levels of the resorption marker C-terminal telopeptides and the urinary fractional excretion of calcium were increased by ovx in the veh treated but not in the L. para or the L. mix treated mice. Probiotic treatment reduced the expression of the two inflammatory cytokines, TNFα and IL-1β, and increased the expression of OPG, a potent inhibitor of osteoclastogenesis, in cortical bone of ovx mice. In addition, ovx decreased the frequency of regulatory T cells in bone marrow of veh treated but not probiotic treated mice. In conclusion, treatment with L. para or the L. mix prevents ovx-induced cortical bone loss. Our findings indicate that these probiotic treatments alter the immune status in bone resulting in attenuated bone resorption in ovx mice.

  15. Adverse effects of hyperlipidemia on bone regeneration and strength.


    Pirih, Flavia; Lu, Jinxiu; Ye, Fei; Bezouglaia, Olga; Atti, Elisa; Ascenzi, Maria-Grazia; Tetradis, Sotirios; Demer, Linda; Aghaloo, Tara; Tintut, Yin


    Hyperlipidemia increases the risk for generation of lipid oxidation products, which accumulate in the subendothelial spaces of vasculature and bone. Atherogenic high-fat diets increase serum levels of oxidized lipids, which are known to attenuate osteogenesis in culture and to promote bone loss in mice. In this study, we investigated whether oxidized lipids affect bone regeneration and mechanical strength. Wild-type (WT) and hyperlipidemic (Ldlr(-/-)) mice were placed on a high-fat (HF) diet for 13 weeks. Bilateral cranial defects were introduced on each side of the sagittal suture, and 5 weeks postsurgery on the respective diets, the repair/regeneration of cranial bones and mechanical properties of femoral bones were assessed. MicroCT and histological analyses demonstrated that bone regeneration was significantly impaired by the HF diet in WT and Ldlr(-/-) mice. In femoral bone, cortical bone volume fraction (bone volume [BV]/tissue volume [TV]) was significantly reduced, whereas cortical porosity was increased by the HF diet in Ldlr(-/-) but not in WT mice. Femoral bone strength and stiffness, measured by three-point bending analysis, were significantly reduced by the HF diet in Ldlr(-/-), but not in WT mice. Serum analysis showed that the HF diet significantly increased levels of parathyroid hormone, tumor necrosis factor (TNF)-α, calcium, and phosphorus, whereas it reduced procollagen type I N-terminal propeptide, a serum marker of bone formation, in Ldlr(-/-), but not in WT mice. The serum level of carboxyl-terminal collagen crosslinks, a marker for bone resorption, was also 1.7-fold greater in Ldlr(-/-) mice. These findings suggest that hyperlipidemia induces secondary hyperparathyroidism and impairs bone regeneration and mechanical strength.

  16. [Bone involvement in endocrinopathies].


    Ribot, C; Trémollières, F; Pouillès, J M


    Progress in bone densitometry, particularly biphotonic absoptiometry, has made it possible to better identify the effects of endocrinopathies on bone. Both cortical and trabecular bone structures can be evaluated quantitatively and topographically revealing important information on the pathophysiology of bone loss. Sex hormones play a major role in the regulation of bone mineralization and hypogonadism, whatever the origin, can lead to deleterious effects. Bone loss is known to be significative in high performance female athletes with amenorrhoea; long-term consequences are not yet determined, but stress fractures have been reported in up to 50%. Other hypogonadisms leading to bone demineralization include anorexia nervosa, chronic intake of gonadotrophin releasing hormone analogues and anti-oestrogens, and hyperprolactinism. Hyperthyroidism leads to a negative calcium balance and demineralization with remodelling, predominantly in cortical bone. In hypothyroid states a 10% bone loss is observed in vertebrae. In both cases, bone densitometry should be performed in order to evaluate the effect of treatment. The deleterious effect of spontaneous or iatrogenic hypercortisism is well known, leading to spontaneous wedge fractures of the vertebrae due to predominating trabecular bone loss. The mechanism of action of corticosteroids on bone metabolism is complex, but the major effect is an inhibition of osteoblast maturation. Recovery may be possible, but no large long-term series have yet been reported. Hyperparathyroidism and acromegaly also affect bone mineralization. The information provided by bone densitometry is essential to properly manage patients with endocrinopathies affecting bone mineralization.


    SciTech Connect

    Joel Walls; M.T. Taner; Naum Derzhi; Gary Mavko; Jack Dvorkin


    In this report we will show results of seismic and well log derived attenuation attributes from a deep water Gulf of Mexico data set. This data was contributed by Burlington Resources and Seitel Inc. The data consists of ten square kilometers of 3D seismic data and three well penetrations. We have computed anomalous seismic absorption attributes on the seismic data and have computed Q from the well log curves. The results show a good correlation between the anomalous absorption (attenuation) attributes and the presence of gas as indicated by well logs.

  18. Cancer-induced anorexia in tumor-bearing mice is dependent on cyclooxygenase-1.


    Ruud, Johan; Nilsson, Anna; Engström Ruud, Linda; Wang, Wenhua; Nilsberth, Camilla; Iresjö, Britt-Marie; Lundholm, Kent; Engblom, David; Blomqvist, Anders


    It is well-established that prostaglandins (PGs) affect tumorigenesis, and evidence indicates that PGs also are important for the reduced food intake and body weight loss, the anorexia-cachexia syndrome, in malignant cancer. However, the identity of the PGs and the PG producing cyclooxygenase (COX) species responsible for cancer anorexia-cachexia is unknown. Here, we addressed this issue by transplanting mice with a tumor that elicits anorexia. Meal pattern analysis revealed that the anorexia in the tumor-bearing mice was due to decreased meal frequency. Treatment with a non-selective COX inhibitor attenuated the anorexia, and also tumor growth. When given at manifest anorexia, non-selective COX-inhibitors restored appetite and prevented body weight loss without affecting tumor size. Despite COX-2 induction in the cerebral blood vessels of tumor-bearing mice, a selective COX-2 inhibitor had no effect on the anorexia, whereas selective COX-1 inhibition delayed its onset. Tumor growth was associated with robust increase of PGE(2) levels in plasma - a response blocked both by non-selective COX-inhibition and by selective COX-1 inhibition, but not by COX-2 inhibition. However, there was no increase in PGE(2)-levels in the cerebrospinal fluid. Neutralization of plasma PGE(2) with specific antibodies did not ameliorate the anorexia, and genetic deletion of microsomal PGE synthase-1 (mPGES-1) affected neither anorexia nor tumor growth. Furthermore, tumor-bearing mice lacking EP(4) receptors selectively in the nervous system developed anorexia. These observations suggest that COX-enzymes, most likely COX-1, are involved in cancer-elicited anorexia and weight loss, but that these phenomena occur independently of host mPGES-1, PGE(2) and neuronal EP(4) signaling.

  19. RB1 deficiency in triple-negative breast cancer induces mitochondrial protein translation

    PubMed Central

    Jones, Robert A.; Robinson, Tyler J.; Liu, Jeff C.; Shrestha, Mariusz; Voisin, Veronique; Ju, YoungJun; Chung, Philip E.D.; Pellecchia, Giovanna; Fell, Victoria L.; Bae, SooIn; Muthuswamy, Lakshmi; Egan, Sean E.; Jiang, Zhe; Leone, Gustavo; Bader, Gary D.; Schimmer, Aaron


    Triple-negative breast cancer (TNBC) includes basal-like and claudin-low subtypes for which no specific treatment is currently available. Although the retinoblastoma tumor-suppressor gene (RB1) is frequently lost together with TP53 in TNBC, it is not directly targetable. There is thus great interest in identifying vulnerabilities downstream of RB1 that can be therapeutically exploited. Here, we determined that combined inactivation of murine Rb and p53 in diverse mammary epithelial cells induced claudin-low–like TNBC with Met, Birc2/3-Mmp13-Yap1, and Pvt1-Myc amplifications. Gene set enrichment analysis revealed that Rb/p53-deficient tumors showed elevated expression of the mitochondrial protein translation (MPT) gene pathway relative to tumors harboring p53 deletion alone. Accordingly, bioinformatic, functional, and biochemical analyses showed that RB1-E2F complexes bind to MPT gene promoters to regulate transcription and control MPT. Additionally, a screen of US Food and Drug Administration–approved (FDA-approved) drugs identified the MPT antagonist tigecycline (TIG) as a potent inhibitor of Rb/p53-deficient tumor cell proliferation. TIG preferentially suppressed RB1-deficient TNBC cell proliferation, targeted both the bulk and cancer stem cell fraction, and strongly attenuated xenograft growth. It also cooperated with sulfasalazine, an FDA-approved inhibitor of cystine xCT antiporter, in culture and xenograft assays. Our results suggest that RB1 deficiency promotes cancer cell proliferation in part by enhancing mitochondrial function and identify TIG as a clinically approved drug for RB1-deficient TNBC. PMID:27571409

  20. Heating of fetal bone by diagnostic ultrasound

    NASA Astrophysics Data System (ADS)

    Doody, Claire

    Most pregnant women in the Western world undergo an ultrasound examination and so it is important to ensure that exposure of the embryo or fetus does not produce unwanted effects. It is known that ultrasound can heat tissue, especially bone, and so this thesis explores the degree to which fetal bone might be heated during a pulsed Doppler examination. This is done both by carrying out measurements and by developing computer models. Thermal measurements on human fetal thoracic vertebrae of gestational age ranging from 14 to 39 weeks are reported. The bone samples were insonated in vitro with an ultrasound beam which had power and intensity values typical of those from a clinical scanner operating in pulsed Doppler mode. Temperature rises ranging from 0.6°C to 1.8°C were observed after five minutes, with approximately 75% of the temperature rise occurring in the first minute. Two approaches to computer modelling are described. These are the heated disc technique, which is commonly used to model the temperature rise generated by an ultrasound beam, and finite element modelling, a more general approach used to obtain solutions to differential equations. The degree to which our limited knowledge of the properties of fetal tissue affect our ability to make accurate predictions of in vivo heating is explored. It is shown that the present uncertainty in the value of the thermal conductivity and attenuation coefficient of fetal bone can lead to significant uncertainty in predictions of heating. The degree to which the simplifications inherent in the heated disc model affect the results will also be discussed. The results from the models are compared with the experimental measurements in order to estimate the attenuation coefficient of the bone.

  1. Factors stimulating bone formation.


    Lind, M; Bünger, C


    The aim of this review is to describe major approaches for stimulating bone healing and to review other factors affecting bone healing. Spinal bone fusion after surgery is a demanding process requiring optimal conditions for clinical success. Bone formation and healing can be enhanced through various methods. Experimental studies have revealed an array of stimulative measures. These include biochemical stimulation by use of hormones and growth factors, physical stimulation through mechanical and electromagnetic measures, and bone grafting by use of bone tissue or bone substitutes. Newer biological techniques such as stem cell transplantation and gene therapy can also be used to stimulate bone healing. Apart from bone transplantation, clinical experience with the many stimulation modalities is limited. Possible areas for clinical use of these novel methods are discussed.

  2. Regulation of Bone Metabolism

    PubMed Central

    Shahi, Maryam; Peymani, Amir; Sahmani, Mehdi


    Bone is formed through the processes of endochondral and intramembranous ossification. In endochondral ossification primary mesenchymal cells differentiate to chondrocytes and then are progressively substituted by bone, while in intramembranous ossification mesenchymal stem cells (MSCs) differentiate directly into osteoblasts to form bone. The steps of osteogenic proliferation, differentiation, and bone homeostasis are controlled by various markers and signaling pathways. Bone needs to be remodeled to maintain integrity with osteoblasts, which are bone-forming cells, and osteoclasts, which are bone-degrading cells.In this review we considered the major factors and signaling pathways in bone formation; these include fibroblast growth factors (FGFs), bone morphogenetic proteins (BMPs), wingless-type (Wnt) genes, runt-related transcription factor 2 (RUNX2) and osteoblast-specific transcription factor (osterix or OSX). PMID:28367467

  3. Bisphosphonates and bone quality

    PubMed Central

    Pazianas, Michael; van der Geest, Stefan; Miller, Paul


    Bisphosphonates (BPs) are bone-avid compounds used as first-line medications for the prevention and treatment of osteoporosis. They are also used in other skeletal pathologies such as Paget's and metastatic bone disease. They effectively reduce osteoclast viability and also activity in the resorptive phase of bone remodelling and help preserve bone micro-architecture, both major determinants of bone strength and ultimately of the susceptibility to fractures. The chemically distinctive structure of each BP used in the clinic determines their unique affinity, distribution/penetration throughout the bone and their individual effects on bone geometry, micro-architecture and composition or what we call ‘bone quality'. BPs have no clinically significant anabolic effects. This review will touch upon some of the components of bone quality that could be affected by the administration of BPs. PMID:24876930

  4. [Microdestruction of the bone].


    Iankovskiĭ, V É


    The objective of the present study was the detection of microcracks in the compact bone tissue surrounding the fracture and in deformed bone undergoing subcritical loading. The portions of deformed bone tissue and terminal fragments of broken bones were obtained in the form of blocks longitudinally sawcut from the regions of primary and secondary bone rupture. A total of 300 such blocks were available for the examination. All portions of the deformed bone tissue and terminal fragments of broken bones showed up microcracks commensurate with the bone structures. They were actually hardened traces of deformation that preceded the fracture and reflected the volume of the destroyed bone tissue; moreover, in certain cases they allowed to identify the kind of the object that exerted the external action (either a blow or slow bending).

  5. Regulation of Bone Metabolism.


    Shahi, Maryam; Peymani, Amir; Sahmani, Mehdi


    Bone is formed through the processes of endochondral and intramembranous ossification. In endochondral ossification primary mesenchymal cells differentiate to chondrocytes and then are progressively substituted by bone, while in intramembranous ossification mesenchymal stem cells (MSCs) differentiate directly into osteoblasts to form bone. The steps of osteogenic proliferation, differentiation, and bone homeostasis are controlled by various markers and signaling pathways. Bone needs to be remodeled to maintain integrity with osteoblasts, which are bone-forming cells, and osteoclasts, which are bone-degrading cells.In this review we considered the major factors and signaling pathways in bone formation; these include fibroblast growth factors (FGFs), bone morphogenetic proteins (BMPs), wingless-type (Wnt) genes, runt-related transcription factor 2 (RUNX2) and osteoblast-specific transcription factor (osterix or OSX).

  6. Feasibility of bone assessment by using the nonlinear parameter in trabecular bone

    NASA Astrophysics Data System (ADS)

    Lee, Kang Il


    The purpose of the present study is to investigate the feasibility of assessing bone status and osteoporosis by using the nonlinear parameter B/A in bovine trabecular bone in vitro. The B/A values measured in 18 bovine femoral trabecular bone samples by using a finite-amplitude through-transmission method ranged from 63.3 to 122.6. The apparent bone density was highly correlated with the B/A and with the existing quantitative ultrasound parameters of the speed of sound (SOS) and the normalized broadband ultrasound attenuation (nBUA), with Pearson's correlation coefficients of r = 0.83 to 0.96. The best univariate predictor of the apparent bone density was the B/A, with an adjusted squared correlation coefficient of r 2 = 0.91. These results suggest that the B/A, in addition to the SOS and the nBUA, may have potential as an index for the assessment of bone status and osteoporosis.


    SciTech Connect

    Joel Walls; M.T. Taner; Gary Mavko; Jack Dvorkin


    In fully-saturated rock and at ultrasonic frequencies, the microscopic squirt flow induced between the stiff and soft parts of the pore space by an elastic wave is responsible for velocity-frequency dispersion and attenuation. In the seismic frequency range, it is the macroscopic cross-flow between the stiffer and softer parts of the rock. We use the latter hypothesis to introduce simple approximate equations for velocity-frequency dispersion and attenuation in a fully water saturated reservoir. The equations are based on the assumption that in heterogeneous rock and at a very low frequency, the effective elastic modulus of the fully-saturated rock can be estimated by applying a fluid substitution procedure to the averaged (upscaled) dry frame whose effective porosity is the mean porosity and the effective elastic modulus is the Backus-average (geometric mean) of the individual dry-frame elastic moduli of parts of the rock. At a higher frequency, the effective elastic modulus of the saturated rock is the Backus-average of the individual fully-saturated-rock elastic moduli of parts of the rock. The difference between the effective elastic modulus calculated separately by these two methods determines the velocity-frequency dispersion. The corresponding attenuation is calculated from this dispersion by using (e.g.) the standard linear solid attenuation model.

  8. Bone-immune cell crosstalk: bone diseases.


    Mori, Giorgio; D'Amelio, Patrizia; Faccio, Roberta; Brunetti, Giacomina


    Bone diseases are associated with great morbidity; thus, the understanding of the mechanisms leading to their development represents a great challenge to improve bone health. Recent reports suggest that a large number of molecules produced by immune cells affect bone cell activity. However, the mechanisms are incompletely understood. This review aims to shed new lights into the mechanisms of bone diseases involving immune cells. In particular, we focused our attention on the major pathogenic mechanism underlying periodontal disease, psoriatic arthritis, postmenopausal osteoporosis, glucocorticoid-induced osteoporosis, metastatic solid tumors, and multiple myeloma.

  9. Stormwater Attenuation by Green Roofs

    NASA Astrophysics Data System (ADS)

    Sims, A.; O'Carroll, D. M.; Robinson, C. E.; Smart, C. C.


    Innovative municipal stormwater management technologies are urgently required in urban centers. Inadequate stormwater management can lead to excessive flooding, channel erosion, decreased stream baseflows, and degraded water quality. A major source of urban stormwater is unused roof space. Green roofs can be used as a stormwater management tool to reduce roof generated stormwater and generally improve the quality of runoff. With recent legislation in some North American cities, including Toronto, requiring the installation of green roofs on large buildings, research on the effectiveness of green roofs for stormwater management is important. This study aims to assess the hydrologic response of an extensive sedum green roof in London, Ontario, with emphasis on the response to large precipitation events that stress municipal stormwater infrastructure. A green roof rapidly reaches field capacity during large storm events and can show significantly different behavior before and after field capacity. At field capacity a green roof has no capillary storage left for retention of stormwater, but may still be an effective tool to attenuate peak runoff rates by transport through the green roof substrate. The attenuation of green roofs after field capacity is linked to gravity storage, where gravity storage is the water that is temporarily stored and can drain freely over time after field capacity has been established. Stormwater attenuation of a modular experimental green roof is determined from water balance calculations at 1-minute intervals. Data is used to evaluate green roof attenuation and the impact of field capacity on peak flow rates and gravity storage. In addition, a numerical model is used to simulate event based stormwater attenuation. This model is based off of the Richards equation and supporting theory of multiphase flow through porous media.

  10. Factors that characterize bone health with aging in healthy postmenopausal women.


    Ikegami, Shota; Uchiyama, Shigeharu; Nakamura, Yukio; Mukaiyama, Keijiro; Hirabayashi, Hiroki; Kamimura, Mikio; Nonaka, Kiichi; Kato, Hiroyuki


    The exponential increase in the incidence of fragility fractures in older people is attributed to attenuation of both bone strength and neuromuscular function. Decrease in bone mineral density (BMD) does not entirely explain this increase. The objective of this study is to investigate the effect of age on various parameters related to bone health with aging, and to identify combinations of factors that collectively express the bone metabolic state in healthy postmenopausal women. Height, weight, and grip strength were measured in 135 healthy postmenopausal volunteer women. Hip BMD, biomechanical indices derived from quantitative computed tomography (QCT), cross-sectional areas of muscle and fat of the proximal thigh, and various biochemical markers of bone metabolism were measured. A smaller group of factors explanatory for bone health was identified using factor analysis and each was newly named. As a result, the factors bone mass, bone turnover, bone structure, and muscle strength had the greatest explanatory power for assessing the bone health of healthy postmenopausal women. Whereas dual X-ray absorptiometry parameters only loaded on the factor bone mass, QCT parameters loaded on both the factors bone mass and bone structure. Most bone turnover markers loaded on the factor bone turnover, but deoxypyridinoline loaded on both bone turnover and muscle strength. Age was negatively correlated with bone mass (r = -0.49, p < 0.001) and muscle strength (r = -0.67, p < 0.001). We conclude that aging is associated as much with muscle weakening as with low BMD. More attention should be paid to the effects of muscle weakening during aging in assessments of bone health.

  11. Ferrite attenuator modulation improves antenna performance

    NASA Technical Reports Server (NTRS)

    Hooks, J. C.; Larson, S. G.; Shorkley, F. H.; Williams, B. T.


    Ferrite attenuator inserted into appropriate waveguide reduces the gain of the antenna element which is causing interference. Modulating the ferrite attenuator to change the antenna gain at the receive frequency permits ground tracking until the antenna is no longer needed.

  12. Denosumab, a RANK ligand inhibitor, for the management of bone loss in cancer patients.


    Yee, Andrew J; Raje, Noopur S


    Bone loss is a common side effect of cancer treatments, especially antihormonal treatments used in the treatment of breast and prostate cancer. Denosumab is a monoclonal antibody given subcutaneously that inhibits osteoclast activity by targeting the RANK ligand. It is effective in settings ranging from preventing skeletal-related complications in cancer patients with metastatic disease to increasing bone mineral density in patients with osteoporosis. In cancer patients with early stage disease, denosumab can attenuate bone loss from antihormonal treatments, and in prostate cancer, may reduce disease progression. Here, we will discuss the important role denosumab may play in the management of bone loss in patients with cancer.

  13. Bone marrow culture


    ... There may be some bleeding at the puncture site. More serious risks, such as serious bleeding or infection, are very rare. Alternative Names Culture - bone marrow Images Bone marrow aspiration References ...

  14. Bone fracture repair - slideshow


    ... page: // Bone fracture repair - series—Indications To use the sharing features ... Go to slide 4 out of 4 Overview Fractures of the bones are classified in a number ...

  15. Smoking and Bone Health


    ... Management Strategies Resources For Your Information Facts About Osteoporosis Osteoporosis is a condition in which bones weaken ... adopt new habits for healthy bones. Smoking and Osteoporosis Cigarette smoking was first identified as a risk ...

  16. [Development of a Novel Body Phantom with Bone Equivalent Density for Evaluation of Bone SPECT].


    Ichikawa, Hajime; Miwa, Kenta; Matsutomo, Norikazu; Watanabe, Yoichi; Kato, Toyohiro; Shimada, Hideki


    We developed a custom-designed phantom for bone single photon emission computed tomography (SPECT)-specific radioactivity distribution and linear attenuation coefficient. The aim of this study was to evaluate the accuracy of the phantom. The lumbar phantom consisted of the trunk of a body phantom (background) containing a cylinder (vertebral body), a sphere (tumor), and a T-shaped container (processus). The vertebral body, tumor, and processus phantoms contained a K(2)HPO(4) solution of bone equivalent density and 50, 300 and 50 kBq/mL of (99m)Tc, respectively. The body phantom contained 8 kBq/mL of (99m)Tc solution. SPECT images were acquired using low-energy high-resolution collimation, a 128 × 128 matrix and 120 projections over 360° with a dwell time of 15 sec/view × 4 times. Thereafter, CT images were acquired at 130 kV and 70 ref mAs using adaptive dose modulation. The SPECT data were reconstructed with ordered subset expectation maximization with three-dimensional, scatter, and CT-based attenuation correction. Count ratio, linear attenuation coefficient (LAC), and full-width at half-maximum (FWHM) were measured. Count ratios between the background, the vertebral body, and the tumor in SPECT images were 463.8: 2888.0: 15150.3 (1: 6.23: 32.7). The LAC of the background and vertebral body in the CT-derived attenuation map were 0.155 cm⁻¹ and 0.284 cm⁻¹, respectively, and the FWHM measured from the processus was 15.27 mm. The precise counts and LAC indicated that the phantom was accurate and could serve as a tool for evaluating acquisition, reconstruction parameters, and quantitation in bone SPECT images.

  17. Dynamic skeletal muscle stimulation and its potential in bone adaptation

    PubMed Central

    Qin, Y-X.; Lam, H.; Ferreri, S.; Rubin, C.


    To identify mechanotransductive signals for combating musculoskeletal deterioration, it is essential to determine the components and mechanisms critical to the anabolic processes of musculoskeletal tissues. It is hypothesized that the interaction between bone and muscle may depend on fluid exchange in these tissues by mechanical loading. It has been shown that intramedullary pressure (ImP) and low-level bone strain induced by muscle stimulation (MS) has the potential to mitigate bone loss induced by disuse osteopenia. Optimized MS signals, i.e., low-intensity and high frequency, may be critical in maintaining bone mass and mitigating muscle atrophy. The objectives for this review are to discuss the potential for MS to induce ImP and strains on bone, to regulate bone adaptation, and to identify optimized stimulation frequency in the loading regimen. The potential for MS to regulate blood and fluid flow will also be discussed. The results suggest that oscillatory MS regulates fluid dynamics with minimal mechanical strain in bone. The response was shown to be dependent on loading frequency, serving as a critical mediator in mitigating bone loss. A specific regimen of dynamic MS may be optimized in vivo to attenuate disuse osteopenia and serve as a biomechanical intervention in the clinical setting. PMID:20190376

  18. A bone composition model for Monte Carlo x-ray transport simulations

    SciTech Connect

    Zhou Hu; Keall, Paul J.; Graves, Edward E.


    In the megavoltage energy range although the mass attenuation coefficients of different bones do not vary by more than 10%, it has been estimated that a simple tissue model containing a single-bone composition could cause errors of up to 10% in the calculated dose distribution. In the kilovoltage energy range, the variation in mass attenuation coefficients of the bones is several times greater, and the expected error from applying this type of model could be as high as several hundred percent. Based on the observation that the calcium and phosphorus compositions of bones are strongly correlated with the bone density, the authors propose an analytical formulation of bone composition for Monte Carlo computations. Elemental compositions and densities of homogeneous adult human bones from the literature were used as references, from which the calcium and phosphorus compositions were fitted as polynomial functions of bone density and assigned to model bones together with the averaged compositions of other elements. To test this model using the Monte Carlo package DOSXYZnrc, a series of discrete model bones was generated from this formula and the radiation-tissue interaction cross-section data were calculated. The total energy released per unit mass of primary photons (terma) and Monte Carlo calculations performed using this model and the single-bone model were compared, which demonstrated that at kilovoltage energies the discrepancy could be more than 100% in bony dose and 30% in soft tissue dose. Percentage terma computed with the model agrees with that calculated on the published compositions to within 2.2% for kV spectra and 1.5% for MV spectra studied. This new bone model for Monte Carlo dose calculation may be of particular importance for dosimetry of kilovoltage radiation beams as well as for dosimetry of pediatric or animal subjects whose bone composition may differ substantially from that of adult human bones.


    SciTech Connect

    Vangelas, K; W. H. Albright, W; E. S. Becvar, E; C. H. Benson, C; T. O. Early, T; E. Hood, E; P. M. Jardine, P; M. Lorah, M; E. Majche, E; D. Major, D; W. J. Waugh, W; G. Wein, G; O. R. West, O


    In 2003 the US Department of Energy (DOE) embarked on a project to explore an innovative approach to remediation of subsurface contaminant plumes that focused on introducing mechanisms for augmenting natural attenuation to achieve site closure. Termed enhanced attenuation (EA), this approach has drawn its inspiration from the concept of monitored natural attenuation (MNA).

  20. Medicines and Bone Loss


    ... studies also show that drinking a lot of alcohol might weaken bones. Questions to ask your doctor • Do any of my medicines cause bone loss? • Are there different medicines I can take? • Do I need a bone density test? • What should I do to protect my ...

  1. Temporal bone meningiomas.


    Hooper, R; Siu, K; Cousins, V


    Meningiomas should be considered in the differential diagnosis of space-occupying lesions of the temporal bone. Five cases of meningiomas of the temporal bone are described and the literature reviewed. These tumours may stimulate Schwannomas and glomus tumours in their presentation and radiological findings. The tumours were managed by combining standard neurosurgical approaches with temporal bone and skull base techniques.

  2. Chlorine signal attenuation in concrete.


    Naqvi, A A; Maslehuddin, M; ur-Rehman, Khateeb; Al-Amoudi, O S B


    The intensity of prompt gamma-ray was measured at various depths from chlorine-contaminated silica fume (SF) concrete slab concrete specimens using portable neutron generator-based prompt gamma-ray setup. The intensity of 6.11MeV chloride gamma-rays was measured from the chloride contaminated slab at distance of 15.25, 20.25, 25.25, 30.25 and 35.25cm from neutron target in a SF cement concrete slab specimens. Due to attenuation of thermal neutron flux and emitted gamma-ray intensity in SF cement concrete at various depths, the measured intensity of chlorine gamma-rays decreases non-linearly with increasing depth in concrete. A good agreement was noted between the experimental results and the results of Monte Carlo simulation. This study has provided useful experimental data for evaluating the chloride contamination in the SF concrete utilizing gamma-ray attenuation method.

  3. Ultrasound fields in attenuating media.


    Lerch, R; Friedrich, W


    For medical ultrasonic imaging and for nondestructive testing, the attenuation of pressure waves and the resulting shift in wave velocity are important features in commonly used transmission media such as biological tissue. An algorithm for the numerical evaluation of pressure field distributions generated by ultrasonic transducers is presented. The attenuation and dispersion of the sound transmission medium are taken into consideration. The sound fields are computed numerically for continuous wave as well as pulse excitation. The transducer has plane or gently curved geometry and is embedded in a plane rigid baffle. The numerically determined pressure fields are presented as 3D plots, as gray-scale images for a fixed time stamp (like a snapshot), or as isobars regarding the maximum values over time for each local point in the area under investigation. The algorithm described here can be utilized as a tool for design of ultrasound transducers, especially array antennas.

  4. Biomechanics of North Atlantic Right Whale Bone: Mandibular Fracture as a Fatal Endpoint for Blunt Vessel-Whale Collision Modeling

    DTIC Science & Technology


    collision mortality using a multi- scale finite element model. Complete, transverse fracture of the right whale mandible, an injury seen only in right...bone cortex and at the ends of long bones. Generally, the change from compact to cortical bone occurs over rapidly over a small spatial scale and the...values contained within the corresponding voxel. This number is compared to the attenuation value of water and displayed on a scale of arbitrary units

  5. Dual energy CT for attenuation correction with PET/CT

    SciTech Connect

    Xia, Ting; Alessio, Adam M.; Kinahan, Paul E.


    Purpose: The authors evaluate the energy dependent noise and bias properties of monoenergetic images synthesized from dual-energy CT (DECT) acquisitions. These monoenergetic images can be used to estimate attenuation coefficients at energies suitable for positron emission tomography (PET) and single-photon emission computed tomography (SPECT) imaging. This is becoming more relevant with the increased use of quantitative imaging by PET/CT and SPECT/CT scanners. There are, however, potential variations in the noise and bias of synthesized monoenergetic images as a function of energy. Methods: The authors used analytic approximations and simulations to estimate the noise and bias of synthesized monoenergetic images of water-filled cylinders with different shapes and the NURBS-based cardiac-torso (NCAT) phantom from 40 to 520 keV, the range of SPECT and PET energies. The dual-kVp spectra were based on the GE Lightspeed VCT scanner at 80 and 140 kVp with added filtration of 0.5 mm Cu. The authors evaluated strategies of noise suppression with sinogram smoothing and dose minimization with reduction of tube currents at the two kVp settings. The authors compared the impact of DECT-based attenuation correction with single-kVp CT-based attenuation correction on PET quantitation for the NCAT phantom for soft tissue and high-Z materials of bone and iodine contrast enhancement. Results: Both analytic calculations and simulations displayed the expected minimum noise value for a synthesized monoenergetic image at an energy between the mean energies of the two spectra. In addition the authors found that the normalized coefficient of variation in the synthesized attenuation map increased with energy but reached a plateau near 160 keV, and then remained constant with increasing energy up to 511 keV and beyond. The bias was minimal, as the linear attenuation coefficients of the synthesized monoenergetic images were within 2.4% of the known true values across the entire energy range

  6. Mapping Lateral Pn Attenuation Variation in Asia

    NASA Astrophysics Data System (ADS)

    Yang, X.; Phillips, W. S.; Randall, G. E.


    Pn travels most of its path in the uppermost mantle. Mapping of the lateral variation of Pn amplitude attenuation may shed light on the physical and chemical state, and dynamics of the upper mantle. In addition to material attenuation, Pn amplitudes are affected by other factors including the spherical shape of the Earth and Moho topography. In order to derive reliable Pn attenuation, we adopt a frequency-dependent Pn geometric-spreading model, which was designed to account for the effect of the Earth’s sphericity, to correct Pn amplitudes in preparation for attenuation estimation. We obtain physically reasonable attenuation estimates from Pn amplitudes corrected using the new spreading model. Pn amplitudes corrected using the traditional frequency-independent power-law spreading model, on the other hand, yield attenuation estimates that are either too large or negative. Using properly geometric-spreading corrected Pn amplitudes, we conducted attenuation tomography and developed 2D Pn attenuation models at multiple frequencies from 0.5 Hz to 8 Hz for Asia. Overall Pn attenuation patterns correlate, to some degree, with our current knowledge of the state of the upper mantle of the region. We see consistent low attenuation in cratonic regions and high attenuation along the western Pacific Ocean. The attenuation pattern in the Tibetan Plateau region seems to be frequency dependent with high attenuation around 1 Hz and low attenuation at 8 Hz. Application of the attenuation model to the nuclear-explosion discrimination problem leads to appreciable improvements of the discriminant compared with currently adopted method.

  7. Effect of Sipjeondaebo-tang on cancer-induced anorexia and cachexia in CT-26 tumor-bearing mice.


    Choi, Youn Kyung; Jung, Ki Yong; Woo, Sang-Mi; Yun, Yee Jin; Jun, Chan-Yong; Park, Jong Hyeong; Shin, Yong Cheol; Cho, Sung-Gook; Ko, Seong-Gyu


    Cancer-associated anorexia and cachexia are a multifactorial condition described by a loss of body weight and muscle with anorexia, asthenia, and anemia. Moreover, they correlate with a high mortality rate, poor response to chemotherapy, poor performance status, and poor quality of life. Cancer cachexia is regulated by proinflammatory cytokines such as interleukin-6 (IL-6), monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor- α (TNF- α). In addition, glucagon like peptide-1 (GIP-1), peptide YY (PYY), ghrelin, and leptin plays a crucial role in food intake. In this study, we investigated the therapeutic effects of one of the traditional herbal medicines, Sipjeondaebo-tang (Juzen-taiho-to in Japanese; SJDBT), on cancer anorexia and cachexia in a fundamental mouse cancer anorexia/cachexia model, CT-26 tumor-bearing mice. SJDBT was more significantly effective in a treatment model where it was treated after anorexia and cachexia than in a prevention model where it was treated before anorexia and cachexia on the basis of parameters such as weights of muscles and whole body and food intakes. Moreover, SJDBT inhibited a production of IL-6, MCP-1, PYY, and GLP-1 and ameliorated cancer-induced anemia. Therefore, our in vivo studies provide evidence on the role of SJDBT in cancer-associated anorexia and cachexia, thereby suggesting that SJDBT may be useful for treating cancer-associated anorexia and cachexia.

  8. Behavioural Effects of Using Sulfasalazine to Inhibit Glutamate Released by Cancer Cells: A Novel target for Cancer-Induced Depression

    PubMed Central

    Nashed, Mina G.; Ungard, Robert G.; Young, Kimberly; Zacal, Natalie J.; Seidlitz, Eric P.; Fazzari, Jennifer; Frey, Benicio N.; Singh, Gurmit


    Despite the lack of robust evidence of effectiveness, current treatment options for cancer-induced depression (CID) are limited to those developed for non-cancer related depression. Here, anhedonia-like and coping behaviours were assessed in female BALB/c mice inoculated with 4T1 mammary carcinoma cells. The behavioural effects of orally administered sulfasalazine (SSZ), a system xc− inhibitor, were compared with fluoxetine (FLX). FLX and SSZ prevented the development of anhedonia-like behaviour on the sucrose preference test (SPT) and passive coping behaviour on the forced swim test (FST). The SSZ metabolites 5-aminosalicylic acid (5-ASA) and sulfapyridine (SP) exerted an effect on the SPT but not on the FST. Although 5-ASA is a known anti-inflammatory agent, neither treatment with SSZ nor 5-ASA/SP prevented tumour-induced increases in serum levels of interleukin-1β (IL-1β) and IL-6, which are indicated in depressive disorders. Thus, the observed antidepressant-like effect of SSZ may primarily be attributable to the intact form of the drug, which inhibits system xc−. This study represents the first attempt at targeting cancer cells as a therapeutic strategy for CID, rather than targeting downstream effects of tumour burden on the central nervous system. In doing so, we have also begun to characterize the molecular pathways of CID. PMID:28120908

  9. Method for fusing bone


    Mourant, Judith R.; Anderson, Gerhard D.; Bigio, Irving J.; Johnson, Tamara M.


    Method for fusing bone. The present invention is a method for joining hard tissue which includes chemically removing the mineral matrix from a thin layer of the surfaces to be joined, placing the two bones together, and heating the joint using electromagnetic radiation. The goal of the method is not to produce a full-strength weld of, for example, a cortical bone of the tibia, but rather to produce a weld of sufficient strength to hold the bone halves in registration while either external fixative devices are applied to stabilize the bone segments, or normal healing processes restore full strength to the tibia.

  10. Anti-IL-20 monoclonal antibody promotes bone fracture healing through regulating IL-20-mediated osteoblastogenesis

    PubMed Central

    Hsu, Yu-Hsiang; Chiu, Yi-Shu; Chen, Wei-Yu; Huang, Kuo-Yuan; Jou, I-Ming; Wu, Po-Tin; Wu, Chih-Hsing; Chang, Ming-Shi


    Bone loss and skeletal fragility in bone fracture are caused by an imbalance in bone remodeling. The current challenge in bone fracture healing is to promote osteoblastogenesis and bone formation. We aimed to explore the role of IL-20 in osteoblastogenesis, osteoblast differentiation and bone fracture. Serum IL-20 was significantly correlated with serum sclerostin in patients with bone fracture. In a mouse model, anti-IL-20 monoclonal antibody (mAb) 7E increased bone formation during fracture healing. In vitro, IL-20 inhibited osteoblastogenesis by upregulating sclerostin, and downregulating osterix (OSX), RUNX2, and osteoprotegerin (OPG). IL-20R1 deficiency attenuated IL-20-mediated inhibition of osteoblast differentiation and maturation and reduced the healing time after a bone fracture. We conclude that IL-20 affects bone formation and downregulates osteoblastogenesis by modulating sclerostin, OSX, RUNX2, and OPG on osteoblasts. Our results demonstrated that IL-20 is involved in osteoregulation and anti-IL-20 mAb is a potential therapeutic for treating bone fracture or metabolic bone diseases. PMID:27075747

  11. Tanshinol Rescues the Impaired Bone Formation Elicited by Glucocorticoid Involved in KLF15 Pathway

    PubMed Central

    Yang, Yajun; Su, Yanjie; Wang, Dongtao; Chen, Yahui; Liu, Yuyu; Luo, Shiying; Wu, Tie


    Decreased bone formation is responsible for the pathogenesis of glucocorticoid- (GC-) induced osteoporosis (GIO), while the mechanism remains to be elucidated. The aim was to investigate how natural antioxidant tanshinol attenuates oxidative stress and rescues impaired bone formation elicited by GC in Sprague-Dawley rats and in C2C12 cells and/or MC3T3-E1 cells. The results showed that tanshinol prevented bone loss and decreased biomechanical characteristics and suppressed reduction of biomarkers related to osteogenesis in GIO rats. Further study revealed that tanshinol reversed decrease of transcription activity of Osterix-luc and rescued impairment of osteoblastic differentiation and bone formation involved in induction of KLF15 mRNA. Meanwhile, tanshinol diminished inhibition of protein expression of β-catenin and Tcf4 and transcription activity of Tcf4-luc induced by GC, especially under conditions of KLF siRNA in vitro. Additionally, tanshinol attenuated increase of reactive oxygen species (ROS) generation, phosphorylation of p66Shc expression, TUNEL-positive cells, and caspase-3 activity elicited by KLF15 under conditions of GC. Taken together, the present findings suggest that tanshinol attenuated the decrease of bone formation and bone mass and bone quality elicited by GC involved in KLF15/Wnt signaling transduction and counteracted GC-evoked oxidative stress and subsequent cell apoptosis involved in KLF15/p66Shc pathway cascade. PMID:27051474

  12. Three-dimensional simulation of ultrasound propagation through trabecular bone structures measured by synchrotron microtomography.


    Bossy, Emmanuel; Padilla, Frédéric; Peyrin, Françoise; Laugier, Pascal


    Three-dimensional numerical simulations of ultrasound transmission were performed through 31 trabecular bone samples measured by synchrotron microtomography. The synchrotron microtomography provided high resolution 3D mappings of bone structures, which were used as the input geometry in the simulation software developed in our laboratory. While absorption (i.e. the absorption of ultrasound through dissipative mechanisms) was not taken into account in the algorithm, the simulations reproduced major phenomena observed in real through-transmission experiments in trabecular bone. The simulated attenuation (i.e. the decrease of the transmitted ultrasonic energy) varies linearly with frequency in the MHz frequency range. Both the speed of sound (SOS) and the slope of the normalized frequency-dependent attenuation (nBUA) increase with the bone volume fraction. Twenty-five out of the thirty-one samples exhibited negative velocity dispersion. One sample was rotated to align the main orientation of the trabecular structure with the direction of ultrasonic propagation, leading to the observation of a fast and a slow wave. Coupling numerical simulation with real bone architecture therefore provides a powerful tool to investigate the physics of ultrasound propagation in trabecular structures. As an illustration, comparison between results obtained on bone modelled either as a fluid or a solid structure suggested the major role of mode conversion of the incident acoustic wave to shear waves in bone to explain the large contribution of scattering to the overall attenuation.

  13. Three-dimensional simulation of ultrasound propagation through trabecular bone structures measured by synchrotron microtomography

    NASA Astrophysics Data System (ADS)

    Bossy, Emmanuel; Padilla, Frédéric; Peyrin, Françoise; Laugier, Pascal


    Three-dimensional numerical simulations of ultrasound transmission were performed through 31 trabecular bone samples measured by synchrotron microtomography. The synchrotron microtomography provided high resolution 3D mappings of bone structures, which were used as the input geometry in the simulation software developed in our laboratory. While absorption (i.e. the absorption of ultrasound through dissipative mechanisms) was not taken into account in the algorithm, the simulations reproduced major phenomena observed in real through-transmission experiments in trabecular bone. The simulated attenuation (i.e. the decrease of the transmitted ultrasonic energy) varies linearly with frequency in the MHz frequency range. Both the speed of sound (SOS) and the slope of the normalized frequency-dependent attenuation (nBUA) increase with the bone volume fraction. Twenty-five out of the thirty-one samples exhibited negative velocity dispersion. One sample was rotated to align the main orientation of the trabecular structure with the direction of ultrasonic propagation, leading to the observation of a fast and a slow wave. Coupling numerical simulation with real bone architecture therefore provides a powerful tool to investigate the physics of ultrasound propagation in trabecular structures. As an illustration, comparison between results obtained on bone modelled either as a fluid or a solid structure suggested the major role of mode conversion of the incident acoustic wave to shear waves in bone to explain the large contribution of scattering to the overall attenuation.

  14. Bone regeneration in dentistry

    PubMed Central

    Tonelli, Paolo; Duvina, Marco; Barbato, Luigi; Biondi, Eleonora; Nuti, Niccolò; Brancato, Leila; Rose, Giovanna Delle


    Summary The edentulism of the jaws and the periodontal disease represent conditions that frequently leads to disruption of the alveolar bone. The loss of the tooth and of its bone of support lead to the creation of crestal defects or situation of maxillary atrophy. The restoration of a functional condition involves the use of endosseous implants who require adequate bone volume, to deal with the masticatory load. In such situations the bone need to be regenerated, taking advantage of the biological principles of osteogenesis, osteoinduction and osteoconduction. Several techniques combine these principles with different results, due to the condition of the bone base on which we operate changes, the surgical technique that we use, and finally for the bone metabolic conditions of the patient who can be in a state of systemic osteopenia or osteoporosis; these can also affect the result of jaw bone reconstruction. PMID:22461825

  15. Nanomaterials and bone regeneration

    PubMed Central

    Gong, Tao; Xie, Jing; Liao, Jinfeng; Zhang, Tao; Lin, Shiyu; Lin, Yunfeng


    The worldwide incidence of bone disorders and conditions has been increasing. Bone is a nanomaterials composed of organic (mainly collagen) and inorganic (mainly nano-hydroxyapatite) components, with a hierarchical structure ranging from nanoscale to macroscale. In consideration of the serious limitation in traditional therapies, nanomaterials provide some new strategy in bone regeneration. Nanostructured scaffolds provide a closer structural support approximation to native bone architecture for the cells and regulate cell proliferation, differentiation, and migration, which results in the formation of functional tissues. In this article, we focused on reviewing the classification and design of nanostructured materials and nanocarrier materials for bone regeneration, their cell interaction properties, and their application in bone tissue engineering and regeneration. Furthermore, some new challenges about the future research on the application of nanomaterials for bone regeneration are described in the conclusion and perspectives part. PMID:26558141

  16. Bone scintiscanning updated.


    Lentle, B C; Russell, A S; Percy, J S; Scott, J R; Jackson, F I


    Use of modern materials and methods has given bone scintiscanning a larger role in clinical medicine, The safety and ready availability of newer agents have led to its greater use in investigating both benign and malignant disease of bone and joint. Present evidence suggests that abnormal accumulation of 99mTc-polyphosphate and its analogues results from ionic deposition at crystal surfaces in immature bone, this process being facilitated by an increase in bone vascularity. There is, also, a component of matrix localization. These factors are in keeping with the concept that abnormal scintiscan sites represent areas of increased osteoblastic activity, although this may be an oversimplification. Increasing evidence shows that the bone scintiscan is more sensitive than conventional radiography in detecting focal disease of bone, and its ability to reflect the immediate status of bone further complements radiographic findings. The main limitation of this method relates to nonspecificity of the results obtained.

  17. Calcium and bone disease

    PubMed Central

    Blair, Harry C.; Robinson, Lisa J.; Huang, Christopher L.-H.; Sun, Li; Friedman, Peter A.; Schlesinger, Paul H.; Zaidi, Mone


    Calcium transport and calcium signaling are of basic importance in bone cells. Bone is the major store of calcium and a key regulatory organ for calcium homeostasis. Bone, in major part, responds to calcium-dependent signals from the parathyroids and via vitamin D metabolites, although bone retains direct response to extracellular calcium if parathyroid regulation is lost. Improved understanding of calcium transporters and calcium-regulated cellular processes has resulted from analysis of genetic defects, including several defects with low or high bone mass. Osteoblasts deposit calcium by mechanisms including phosphate and calcium transport with alkalinization to absorb acid created by mineral deposition; cartilage calcium mineralization occurs by passive diffusion and phosphate production. Calcium mobilization by osteoclasts is mediated by acid secretion. Both bone forming and bone resorbing cells use calcium signals as regulators of differentiation and activity. This has been studied in more detail in osteoclasts, where both osteoclast differentiation and motility are regulated by calcium. PMID:21674636

  18. Marble Bone Disease: A Rare Bone Disorder

    PubMed Central

    Harinathbabu, Maheswari; Thillaigovindan, Ranjani; Prabhu, Geetha


    Osteopetrosis, or marble bone disease, is a rare skeletal disorder due to a defective function of the osteoclasts. This defect renders bones more susceptible to osteomyelitis due to decreased vascularity. This disorder is inherited as autosomal dominant and autosomal recessive. Healthcare professionals should urge these patients to maintain their oral health as well as general health, as this condition makes these patients more susceptible to frequent infections and fractures. This case report emphasizes the signs and symptoms of marble bone disease and presents clinical and radiographic findings.  PMID:26594603

  19. Assessing Bone Mineral Density Following Acute Hip Fractures

    PubMed Central

    Wiggin, Molly; Hemmati, Pouya; Switzer, Julie


    Objectives: In older patients, bone mineral density (BMD) diminishes with age, increasing susceptibility to femoral neck fractures. Evidence has emerged that patients who should have dual x-ray absorptiometry scans to evaluate their bone health are not doing so. Because computed tomography (CT) attenuation has now been correlated with BMD thresholds relating to osteoporosis, virtually any existing CT scan that includes the L1 vertebra can be used to assess BMD. This study evaluates the utility of CT attenuation in characterizing BMD in patients after femoral neck fractures. Methods: The electronic medical records of adults who presented to a level I trauma center with hip fractures were evaluated for eligibility. Those with a CT scan of the abdomen or other CT scan with a complete view of the L1 vertebra were included. To measure attenuation, a region of interest was selected to include the body of the L1 vertebra in the axial plane and exclude the cortices and posterior venous complex. Results: Of the 589 patients reviewed, 217 met inclusion criteria; 112 were aged 18 to 64, while 105 were ≥65. Eight (7.1%) patients in the younger cohort had a mean CT attenuation below the 110-HU threshold set for 90% specificity, whereas 31 (29.5%) patients in the older cohort had a mean CT attenuation below this threshold. Using the 160-HU threshold set for 90% sensitivity, 39 (34.8%) patients of the younger cohort and 74 (70%) patients of the older cohort were osteoporotic; all differences in CT attenuation by age were strongly significant (P < .0001). Conclusions: A significantly larger proportion of older patients with hip fractures had osteoporosis, helping validate the utility of CT attenuation in this context. In addition, a large proportion of these patients already had these images available, thus potentially helping limit cost and unnecessary medical investigations. PMID:26246948

  20. Parameter Estimation in Ultrasonic Measurements on Trabecular Bone

    NASA Astrophysics Data System (ADS)

    Marutyan, Karen R.; Anderson, Christian C.; Wear, Keith A.; Holland, Mark R.; Miller, James G.; Bretthorst, G. Larry


    Ultrasonic tissue characterization has shown promise for clinical diagnosis of diseased bone (e.g., osteoporosis) by establishing correlations between bone ultrasonic characteristics and the state of disease. Porous (trabecular) bone supports propagation of two compressional modes, a fast wave and a slow wave, each of which is characterized by an approximately linear-with-frequency attenuation coefficient and monotonically increasing with frequency phase velocity. Only a single wave, however, is generally apparent in the received signals. The ultrasonic parameters that govern propagation of this single wave appear to be causally inconsistent [1]. Specifically, the attenuation coefficient rises approximately linearly with frequency, but the phase velocity exhibits a decrease with frequency. These inconsistent results are obtained when the data are analyzed under the assumption that the received signal is composed of one wave. The inconsistency disappears if the data are analyzed under the assumption that the signal is composed of superposed fast and slow waves. In the current investigation, Bayesian probability theory is applied to estimate the ultrasonic characteristics underlying the propagation of the fast and slow wave from computer simulations. Our motivation is the assumption that identifying the intrinsic material properties of bone will provide more reliable estimates of bone quality and fracture risk than the apparent properties derived by analyzing the data using a one-mode model.

  1. Spinal high-mobility group box 1 contributes to mechanical allodynia in a rat model of bone cancer pain

    SciTech Connect

    Tong, Wei; Wang, Wei; Huang, Jing; Ren, Ning; Wu, Sheng-Xi; Li, Yong-Qi


    Mechanisms underlying bone cancer-induced pain are largely unknown. Previous studies indicate that neuroinflammation in the spinal dorsal horn is especially involved. Being first reported as a nonhistone chromosomal protein, high-mobility group box 1 (HMGB1) is now implicated as a mediator of inflammation. We hypothesized that HMGB1 could trigger the release of cytokines in the spinal dorsal horn and contribute to bone cancer pain. To test this hypothesis, we first built a bone cancer pain model induced by intratibal injection of Walker 256 mammary gland carcinoma cells. The structural damage to the tibia was monitored by radiological analysis. The mechanical allodynia was measured and the expression of spinal HMGB1 and IL-1{beta} was evaluated. We observed that inoculation of cancer cells, but not heat-killed cells, induced progressive bone destruction from 9 d to 21 d post inoculation. Behavioral tests demonstrated that the significant nociceptive response in the cancer cells-injected rats emerged on day 9 and this kind of mechanical allodynia lasted at least 21 d following inoculation. Tumor cells inoculation significantly increased HMGB1 expression in the spinal dorsal horn, while intrathecal injecting a neutralizing antibody against HMGB1 showed an effective and reliable anti-allodynia effect with a dose-dependent manner. IL-1{beta} was significantly increased in caner pain rats while intrathecally administration of anti-HMGB1 could decrease IL-1{beta}. Together with previous reports, we predict that bone cancer induces HMGB1 production, enhancing spinal IL-1{beta} expression and thus modulating spinal excitatory synaptic transmission and pain response.

  2. Delayed activation of spinal microglia contributes to the maintenance of bone cancer pain in female Wistar rats via P2X7 receptor and IL-18.


    Yang, Yan; Li, Hui; Li, Ting-Ting; Luo, Hao; Gu, Xi-Yao; Lü, Ning; Ji, Ru-Rong; Zhang, Yu-Qiu


    Accumulating evidence suggests that activation of spinal microglia contributes to the development of inflammatory and neuropathic pain. However, the role of spinal microglia in the maintenance of chronic pain remains controversial. Bone cancer pain shares features of inflammatory and neuropathic pain, but the temporal activation of microglia and astrocytes in this model is not well defined. Here, we report an unconventional role of spinal microglia in the maintenance of advanced-phase bone cancer pain in a female rat model. Bone cancer elicited delayed and persistent microglial activation in the spinal dorsal horn on days 14 and 21, but not on day 7. In contrast, bone cancer induced rapid and persistent astrocytic activation on days 7-21. Spinal inhibition of microglia by minocycline at 14 d effectively reduced bone cancer-induced allodynia and hyperalgesia. However, pretreatment of minocycline in the first week did not affect the development of cancer pain. Bone cancer increased ATP levels in CSF, and upregulated P2X7 receptor, phosphorylated p38, and IL-18 in spinal microglia. Spinal inhibition of P2X7/p-38/IL-18 pathway reduced advanced-phase bone cancer pain and suppressed hyperactivity of spinal wide dynamic range (WDR) neurons. IL-18 induced allodynia and hyperalgesia after intrathecal injection, elicited mechanical hyperactivity of WDR neurons in vivo, and increased the frequency of mEPSCs in spinal lamina IIo nociceptive synapses in spinal cord slices. Together, our findings demonstrate a novel role of microglia in maintaining advanced phase cancer pain in females via producing the proinflammatory cytokine IL-18 to enhance synaptic transmission of spinal cord nociceptive neurons.

  3. Biological Regulation of Bone Quality

    PubMed Central

    Alliston, Tamara


    The ability of bone to resist fracture is determined by the combination of bone mass and bone quality. Like bone mass, bone quality is carefully regulated. Of the many aspects of bone quality, this review focuses on biological mechanisms that control the material quality of the bone extracellular matrix (ECM). Bone ECM quality depends upon ECM composition and organization. Proteins and signaling pathways that affect the mineral or organic constituents of bone ECM impact bone ECM material properties, such as elastic modulus and hardness. These properties are also sensitive to pathways that regulate bone remodeling by osteoblasts, osteoclasts, and osteocytes. Several extracellular proteins, signaling pathways, intracellular effectors, and transcription regulatory networks have been implicated in the control of bone ECM quality. A molecular understanding of these mechanisms will elucidate the biological control of bone quality and suggest new targets for the development of therapies to prevent bone fragility. PMID:24894149

  4. The Use of Computed Tomography Attenuation to Evaluate Osteoporosis Following Acute Fractures of the Thoracic and Lumbar Vertebra

    PubMed Central

    Cagan, Amanda; Morgan, Robert; Davis, Rick; Asis, Martin; Switzer, Julie; Polly, David W.


    Background: Relatively few patients have dual-energy x-ray absorptiometry to quantify the magnitude of bone loss as they age. Recent work correlates mean computed tomography (CT) attenuation in the level I (L1) vertebra with bone mineral density (BMD), making it possible to objectively evaluate the magnitude of bone loss in osteoporosis by this method. The aims of this study were to evaluate the utility of using CT scans in patients with acute thoracic and lumbar spine fractures to diagnose osteoporosis and using CT attenuation to evaluate the association between age and BMD. Methods: We performed a retrospective study of patients with acute fractures of the thoracic or lumbar spine who had also undergone an abdominal (or L1) CT scan and compared mean CT attenuation in L1 against threshold values. We also compared differences in CT attenuation between younger (<65 years) and older (≥65 years) and older patients. Results: A total of 124 patients were evaluated (74 thoracic and 50 lumbar fractures). Overall, there was a strong correlation between age and bone density as measured by CT attenuation (r = −.76). Among those with thoracic fractures (<65 years), mean CT attenuation was 196.51 HU. Forty-one patients were ≥65 years and had mean CT attenuation of 105.90 HU (P < .001). In patients with lumbar fractures, 27 patients were <65 years and had a mean CT attenuation of 192.26 HU and 23 patients were ≥65 years and had mean CT attenuation of 114.31 HU (P < .001). At the threshold of 110 HU, set for specificity, the magnitude of difference between the age-stratified cohorts was greater in the thoracic spine (P < .0001 vs P = .003). Discussion: Using opportunistic CT, we demonstrate the relative frequency of osteoporosis in patients with acute fractures of the thoracic and lumbar spine and confirm that the association increases with age. The CT attenuation may provide a cheap and convenient method to help confirm a clinical diagnosis of osteoporosis in patients

  5. [Bone and Nutrition. Sclerostin and bone metabolism].


    Tatsumi, Sawako; Nagamoto, Kenta; Ogata, Mao; Miyamoto, Ken-ichi


    Osteocytes orchestrate bone resorption and bone formation by controlling osteoclast and osteoblast activity. On the other hand, osteocytes secret FGF23 (fibroblast growth factor 23), FGF23 acts on the kidney to control phosphate homeostasis. Sclerostin is also released from osteocytes and it regulated osteoblast activity through Wnt/β-catenin pathway. Therefore, an antibody that targets sclerostin is currently in phase- III clinical trials for the treatment of osteoporosis and it is expected as new therapeutics.

  6. Effects of salvianolate on bone metabolism in glucocorticoid-treated lupus-prone B6.MRL-Faslpr/J mice

    PubMed Central

    Liu, Yanzhi; Cui, Yang; Zhang, Xiao; Gao, Xiang; Su, Yanjie; Xu, Bilian; Wu, Tie; Chen, Wenshuang; Cui, Liao


    Aim To investigate the bone-protective effects of salvianolate (Sal), a total polyphenol from Radix Salviae miltiorrhizae, on bone tissue in the spontaneous lupus-prone mouse model, B6.MRL-Faslpr/J, undergoing glucocorticoid (GC) treatment. Methods Fifteen-week-old female B6.MRL-Faslpr/J mice were administered either a daily dose of saline (lupus group), prednisone 6 mg/kg (GC group), Sal 60 mg/kg (Sal group); or GC plus Sal (GC + Sal group) for a duration of 12 weeks. Age-matched female C57BL/6J wild-type (WT) mice were used for control. Micro-computed tomography assessments, bone histomorphometry analysis, bone biomechanical test, immunohistochemistry and immunoblotting analysis for bone markers, and renal histology analysis were performed to support our research endeavor. Results Lupus mice developed a marked bone loss and deterioration of mechanical properties of bone due to an increase in bone resorption rather than suppression of bone formation. GC treatment strongly inhibited bone formation in lupus mice. Sal treatment significantly attenuated osteogenic inhibition, and also suppressed hyperactive bone resorption, which recovered the bone mass and mechanical properties of bone in both the untreated and GC-treated lupus mice. Conclusion The data support further preclinical investigation of Sal as a potential therapeutic strategy for the treatment of systemic lupus erythematosus-related bone loss. PMID:27563234

  7. [Fibrous dysplasia of bone].


    Orcel, Philippe; Chapurlat, Roland


    Fibrous dysplasia of bone is a congenital non hereditary benign bone disease, where normal bone is replaced by a fibrous-like tissue with immature osteogenesis. Prevalence is difficult to estimate, due to frequent asymptomatic lesions. Bone lesions are mono- or polyostotic and may be associated with bone pain and fragility, leading to fractures. In some patients or bone sites, they are hypertrophic, responsible for neurological complications. Imaging and, when necessary, histology are the cornerstones of the diagnosis. A common molecular defect, i.e. activating mutations of the GNAS gene, encoding the a subunit of the Gs protein in target cells, is responsible for bone cell alterations as well as for the involvement of other cells/tissues bearing the same molecular defect (melanocytes, endocrine cells). These mutations affect only somatic cells and are therefore not hereditary: antenatal diagnosis is not appropriate for this disease and genetic counselling is not very useful, except for reassuring the patients. The conventional therapeutic approach is essentially symptomatic (pain killers) and orthopaedic (prevention and treatment of bone complications). Recent publications have focused attention on pamidronate, which rapidly relieves bone pain in most patients, and progressively increases bone mineralization in osteolytic areas in about half of the patients. Tubular phosphate wasting is common and should be treated with phosphate supplement and calcitriol. The prognosis should improve with therapeutic advances, but this remains to be properly evaluated.


    SciTech Connect

    Joel Walls; M.T. Taner; Naum Derzhi; Gary Mavko; Jack Dvorkin


    In this report we will show some new Q related seismic attributes on the Burlington-Seitel data set. One example will be called Energy Absorption Attribute (EAA) and is based on a spectral analysis. The EAA algorithm is designed to detect a sudden increase in the rate of exponential decay in the relatively higher frequency portion of the spectrum. In addition we will show results from a hybrid attribute that combines attenuation with relative acoustic impedance to give a better indication of commercial gas saturation.

  9. Imaging Rayleigh wave attenuation with USArray

    NASA Astrophysics Data System (ADS)

    Bao, Xueyang; Dalton, Colleen A.; Jin, Ge; Gaherty, James B.; Shen, Yang


    The EarthScope USArray provides an opportunity to obtain detailed images of the continental upper mantle at an unprecedented scale. The majority of mantle models derived from USArray data to date contain spatial variations in seismic-wave speed; however, in many cases these data sets do not by themselves allow a non-unique interpretation. Joint interpretation of seismic attenuation and velocity models can improve upon the interpretations based only on velocity and provide important constraints on the temperature, composition, melt content, and volatile content of the mantle. The surface wave amplitudes that constrain upper-mantle attenuation are sensitive to factors in addition to attenuation, including the earthquake source excitation, focusing and defocusing by elastic structure, and local site amplification. Because of the difficulty of isolating attenuation from these other factors, little is known about the attenuation structure of the North American upper mantle. In this study, Rayleigh wave traveltime and amplitude in the period range 25-100 s are measured using an interstation cross-correlation technique, which takes advantage of waveform similarity at nearby stations. Several estimates of Rayleigh wave attenuation and site amplification are generated at each period, using different approaches to separate the effects of attenuation and local site amplification on amplitude. It is assumed that focusing and defocusing effects can be described by the Laplacian of the traveltime field. All approaches identify the same large-scale patterns in attenuation, including areas where the attenuation values are likely contaminated by unmodelled focusing and defocusing effects. Regionally averaged attenuation maps are constructed after removal of the contaminated attenuation values, and the variations in intrinsic shear attenuation that are suggested by these Rayleigh wave attenuation maps are explored.

  10. Assessment of Long Bone Flexural Properties from Bone Densitometry

    NASA Technical Reports Server (NTRS)

    Whalen, Robert; Cleek, Tammy; Katz, BethAnn


    While bone densitometry is the accepted non-invasive method of quantifying bone mineral content in bones, its assessment of bone structural properties is less well understood. The objective of our current work is to compare cross-section shape or areal properties of long bones computed from densitometry data with cross-section flexural properties obtained from surface strain measurements.

  11. Genetic regulation of bone mass: from bone density to bone strength.


    Langman, Craig B


    Osteoporosis is a common disease characterized in adults by diminished bone density. Bone is an organ that evolves and grows throughout life, and establishing optimal bone density in childhood and adolescence serves to buffer bone loss later in life. Bone density, a measurable entity, is the clinical substitute for bone strength, or the ability to defend against fracture. Chronic diseases may adversely affect optimal peak bone density. Bone density is under genetic control, as revealed by three lines of investigations. These include (1) the finding of quantitative trait loci for bone density, (2) the finding that specific mutations in genes that are important in the development of osteoblast or osteoclast lineages alter bone density, and (3) the linkeage of known polymorphisms for genes involved in mineral homeostasis to bone density and/or fracture. Future therapeutics for improving peak bone density or delaying bone loss later in life may take advantage of the genetic nature of bone density development.

  12. AST-induced bone loss in men with prostate cancer: exercise as a potential countermeasure.


    Bolam, K A; Galvão, D A; Spry, N; Newton, R U; Taaffe, D R


    Androgen suppression treatment (AST) for men with prostate cancer is associated with a number of treatment-related side effects including an accelerated rate of bone loss. This loss of bone is greatest within the first year of AST and increases the risk for fracture. Pharmaceutical treatment in the form of bisphosphonates is currently used to counter the effects of hormone suppression on bone but is costly and associated with potential adverse effects. Recently, exercise has been shown to be an important adjuvant therapy to manage a range of treatment-related toxicities and enhance aspects of quality of life for men receiving AST. We propose that physical exercise may also have an important role in not only attenuating the bone loss associated with AST but in improving bone health and reducing fracture risk. In this review, the rationale underlying exercise as a countermeasure to AST-induced bone loss is provided.

  13. Diet-induced weight loss: the effect of dietary protein on bone.


    Tang, Minghua; O'Connor, Lauren E; Campbell, Wayne W


    High-protein (>30% of energy from protein or >1.2 g/kg/day) and moderately high-protein (22% to 29% of energy from protein or 1.0 to 1.2 g/kg/day) diets are popular for weight loss, but the effect of dietary protein on bone during weight loss is not well understood. Protein may help preserve bone mass during weight loss by stimulating insulin-like growth factor 1, a potent bone anabolism stimulator, and increasing intestinal calcium absorption. Protein-induced acidity is considered to have minimal effect on bone resorption in adults with normal kidney function. Both the quantity and predominant source of protein influence changes in bone with diet-induced weight loss. Higher-protein, high-dairy diets may help attenuate bone loss during weight loss.

  14. Improved accuracy of cortical bone mineralization measured by polychromatic microcomputed tomography using a novel high mineral density composite calibration phantom

    SciTech Connect

    Deuerling, Justin M.; Rudy, David J.; Niebur, Glen L.; Roeder, Ryan K.


    Purpose: Microcomputed tomography (micro-CT) is increasingly used as a nondestructive alternative to ashing for measuring bone mineral content. Phantoms are utilized to calibrate the measured x-ray attenuation to discrete levels of mineral density, typically including levels up to 1000 mg HA/cm{sup 3}, which encompasses levels of bone mineral density (BMD) observed in trabecular bone. However, levels of BMD observed in cortical bone and levels of tissue mineral density (TMD) in both cortical and trabecular bone typically exceed 1000 mg HA/cm{sup 3}, requiring extrapolation of the calibration regression, which may result in error. Therefore, the objectives of this study were to investigate (1) the relationship between x-ray attenuation and an expanded range of hydroxyapatite (HA) density in a less attenuating polymer matrix and (2) the effects of the calibration on the accuracy of subsequent measurements of mineralization in human cortical bone specimens. Methods: A novel HA-polymer composite phantom was prepared comprising a less attenuating polymer phase (polyethylene) and an expanded range of HA density (0-1860 mg HA/cm{sup 3}) inclusive of characteristic levels of BMD in cortical bone or TMD in cortical and trabecular bone. The BMD and TMD of cortical bone specimens measured using the new HA-polymer calibration phantom were compared to measurements using a conventional HA-polymer phantom comprising 0-800 mg HA/cm{sup 3} and the corresponding ash density measurements on the same specimens. Results: The HA-polymer composite phantom exhibited a nonlinear relationship between x-ray attenuation and HA density, rather than the linear relationship typically employed a priori, and obviated the need for extrapolation, when calibrating the measured x-ray attenuation to high levels of mineral density. The BMD and TMD of cortical bone specimens measured using the conventional phantom was significantly lower than the measured ash density by 19% (p<0.001, ANCOVA) and 33% (p<0

  15. Biomaterials and bone mechanotransduction

    NASA Technical Reports Server (NTRS)

    Sikavitsas, V. I.; Temenoff, J. S.; Mikos, A. G.; McIntire, L. V. (Principal Investigator)


    Bone is an extremely complex tissue that provides many essential functions in the body. Bone tissue engineering holds great promise in providing strategies that will result in complete regeneration of bone and restoration of its function. Currently, such strategies include the transplantation of highly porous scaffolds seeded with cells. Prior to transplantation the seeded cells are cultured in vitro in order for the cells to proliferate, differentiate and generate extracellular matrix. Factors that can affect cellular function include the cell-biomaterial interaction, as well as the biochemical and the mechanical environment. To optimize culture conditions, good understanding of these parameters is necessary. The new developments in bone biology, bone cell mechanotransduction, and cell-surface interactions are reviewed here to demonstrate that bone mechanotransduction is strongly influenced by the biomaterial properties.

  16. Bone Surface Mapping Method

    PubMed Central

    Fan, Yifang; Fan, Yubo; Li, Zhiyu; Lv, Changsheng; Zhang, Bo


    Bone shape is an important factor to determine the bone's structural function. For the asymmetrically shaped and anisotropically distributed bone in vivo, a surface mapping method is proposed on the bases of its geometric transformation invariance and its uniqueness of the principal axes of inertia. Using spiral CT scanning, we can make precise measurements to bone in vivo. The coordinate transformations lead to the principal axes of inertia, with which the prime meridian and the contour can be set. Methods such as tomographic reconstruction and boundary development are employed so that the surface of bone in vivo can be mapped. Experimental results show that the surface mapping method can reflect the shape features and help study the surface changes of bone in vivo. This method can be applied to research into the surface characteristics and changes of organ, tissue or cell whenever its digitalized surface is obtained. PMID:22412952

  17. Biophotonics and Bone Biology

    NASA Technical Reports Server (NTRS)

    Zimmerli, Gregory; Fischer, David; Asipauskas, Marius; Chauhan, Chirag; Compitello, Nicole; Burke, Jamie; Tate, Melissa Knothe


    One of the more-serious side effects of extended space flight is an accelerated bone loss [Bioastronautics Critical Path Roadmap,]. Rates of bone loss are highest in the weight-bearing bones of the hip and spine regions, and the average rate of bone loss as measured by bone mineral density measurements is around 1.2% per month for persons in a microgravity environment. It shows that an extrapolation of the microgravity induced bone loss rates to longer time scales, such as a 2.5 year round-trip to Mars (6 months out at 0 g, 1.5 year stay on Mars at 0.38 g, 6 months back at 0 g), could severely compromise the skeletal system of such a person.

  18. Biomaterials and bone mechanotransduction.


    Sikavitsas, V I; Temenoff, J S; Mikos, A G


    Bone is an extremely complex tissue that provides many essential functions in the body. Bone tissue engineering holds great promise in providing strategies that will result in complete regeneration of bone and restoration of its function. Currently, such strategies include the transplantation of highly porous scaffolds seeded with cells. Prior to transplantation the seeded cells are cultured in vitro in order for the cells to proliferate, differentiate and generate extracellular matrix. Factors that can affect cellular function include the cell-biomaterial interaction, as well as the biochemical and the mechanical environment. To optimize culture conditions, good understanding of these parameters is necessary. The new developments in bone biology, bone cell mechanotransduction, and cell-surface interactions are reviewed here to demonstrate that bone mechanotransduction is strongly influenced by the biomaterial properties.


    SciTech Connect

    Joel Walls; M.T. Taner; Naum Derzhi; Gary Mavko; Jack Dvorkin


    We have developed and tested technology for a new type of direct hydrocarbon detection. The method uses inelastic rock properties to greatly enhance the sensitivity of surface seismic methods to the presence of oil and gas saturation. These methods include use of energy absorption, dispersion, and attenuation (Q) along with traditional seismic attributes like velocity, impedance, and AVO. Our approach is to combine three elements: (1) a synthesis of the latest rock physics understanding of how rock inelasticity is related to rock type, pore fluid types, and pore microstructure, (2) synthetic seismic modeling that will help identify the relative contributions of scattering and intrinsic inelasticity to apparent Q attributes, and (3) robust algorithms that extract relative wave attenuation attributes from seismic data. This project provides: (1) Additional petrophysical insight from acquired data; (2) Increased understanding of rock and fluid properties; (3) New techniques to measure reservoir properties that are not currently available; and (4) Provide tools to more accurately describe the reservoir and predict oil location and volumes. These methodologies will improve the industry's ability to predict and quantify oil and gas saturation distribution, and to apply this information through geologic models to enhance reservoir simulation. We have applied for two separate patents relating to work that was completed as part of this project.

  20. Adrenal gland and bone.


    Hardy, Rowan; Cooper, Mark S


    The adrenal gland synthesizes steroid hormones from the adrenal cortex and catecholamines from the adrenal medulla. Both cortisol and adrenal androgens can have powerful effects on bone. The overproduction of cortisol in Cushing's disease leads to a dramatic reduction in bone density and an increase risk of fracture. Overproduction of adrenal androgens in congenital adrenal hyperplasia (CAH) leads to marked changes in bone growth and development with early growth acceleration but ultimately a significant reduction in final adult height. The role of more physiological levels of glucocorticoids and androgens on bone metabolism is less clear. Cortisol levels measured in elderly individuals show a weak correlation with measures of bone density and change in bone density over time with a high cortisol level associated with lower bone density and more rapid bone loss. Cortisol levels and the dynamics of cortisol secretion change with age which could also explain some age related changes in bone physiology. It is also now clear that adrenal steroids can be metabolized within bone tissue itself. Local synthesis of cortisol within bone from its inactive precursor cortisone has been demonstrated and the amount of cortisol produced within osteoblasts appears to increase with age. With regard to adrenal androgens there is a dramatic reduction in levels with aging and several studies have examined the impact that restoration of these levels back to those seen in younger individuals has on bone health. Most of these studies show small positive effects in women, not men, but the skeletal sites where benefits are seen varies from study to study.

  1. Nanocomposites and bone regeneration

    NASA Astrophysics Data System (ADS)

    James, Roshan; Deng, Meng; Laurencin, Cato T.; Kumbar, Sangamesh G.


    This manuscript focuses on bone repair/regeneration using tissue engineering strategies, and highlights nanobiotechnology developments leading to novel nanocomposite systems. About 6.5 million fractures occur annually in USA, and about 550,000 of these individual cases required the application of a bone graft. Autogenous and allogenous bone have been most widely used for bone graft based therapies; however, there are significant problems such as donor shortage and risk of infection. Alternatives using synthetic and natural biomaterials have been developed, and some are commercially available for clinical applications requiring bone grafts. However, it remains a great challenge to design an ideal synthetic graft that very closely mimics the bone tissue structurally, and can modulate the desired function in osteoblast and progenitor cell populations. Nanobiomaterials, specifically nanocomposites composed of hydroxyapatite (HA) and/or collagen are extremely promising graft substitutes. The biocomposites can be fabricated to mimic the material composition of native bone tissue, and additionally, when using nano-HA (reduced grain size), one mimics the structural arrangement of native bone. A good understanding of bone biology and structure is critical to development of bone mimicking graft substitutes. HA and collagen exhibit excellent osteoconductive properties which can further modulate the regenerative/healing process following fracture injury. Combining with other polymeric biomaterials will reinforce the mechanical properties thus making the novel nano-HA based composites comparable to human bone. We report on recent studies using nanocomposites that have been fabricated as particles and nanofibers for regeneration of segmental bone defects. The research in nanocomposites, highlight a pivotal role in the future development of an ideal orthopaedic implant device, however further significant advancements are necessary to achieve clinical use.

  2. Bone scanning in otolaryngology.


    Noyek, A M


    Modern radionuclide bone scanning has introduced a new concept in physiologic and anatomic diagnostic imaging to general medicine. As otolaryngologists must diagnose and treat disease in relation to the bony and/or cartilaginous supporting structures of the neurocranium and upper airway, this modality should be included in the otolaryngologist's diagnostic armamentarium. It is the purpose of this manuscript to study the specific applications of bone scanning to our specialty at this time, based on clinical experience over the past three years. This thesis describes the development of bone scanning in general (history of nuclear medicine and nuclear physics; history of bone scanning in particular). General concepts in nuclear medicine are then presented; these include a discussion of nuclear semantics, principles of radioactive emmissions, the properties 99mTc as a radionuclide, and the tracer principle. On the basis of these general concepts, specific concepts in bone scanning are then brought forth. The physiology of bone and the action of the bone scan agents is presented. Further discussion considers the availability and production of the bone scan agent, patient factors, the gamma camera, the triphasic bone scan and the ultimate diagnostic principle of the bone scan. Clinical applications of bone scanning in otolaryngology are then presented in three sections. Proven areas of application include the evaluation of malignant tumors of the head and neck, the diagnosis of temporomandibular joint disorders, the diagnosis of facial fractures, the evaluation of osteomyelitis, nuclear medicine imaging of the larynx, and the assessment of systemic disease. Areas of adjunctive or supplementary value are also noted, such as diagnostic imaging of meningioma. Finally, areas of marginal value in the application of bone scanning are described.

  3. Radionuclide bone imaging and densitometry

    SciTech Connect

    Mettler, F.A.


    This book contains 13 selections. Some of the titles are: Radionuclides and the Normal Bone Scan; The Radionuclide Bone Scan in Malignant Disease; Pediatric Applications of Radionuclide Bone Imaging; The Radionuclide Bone Scan in Arthritis and Metabolic and Miscellaneous Disorders; and Soft Tissue Activity on the Radionuclide Bone Scan.

  4. Bone scanning in clinical practice

    SciTech Connect

    Fogelman, I. )


    The topics covered in this book include the history of bone scanning, mechanisms of uptake of diphosphonate in bone, the normal bone scan, and the role of bone scanning in clinical practice. The aim of this book is to provide a source of reference relating to bone scan imaging for all those who are interested in the skeleton.

  5. Aging and Bone

    PubMed Central

    Boskey, A.L.; Coleman, R.


    Bones provide mechanical and protective function, while also serving as housing for marrow and a site for regulation of calcium ion homeostasis. The properties of bones do not remain constant with age; rather, they change throughout life, in some cases improving in function, but in others, function deteriorates. Here we review the modifications in the mechanical function and shape of bones, the bone cells, the matrix they produce, and the mineral that is deposited on this matrix, while presenting recent theories about the factors leading to these changes. PMID:20924069

  6. Biophotonics and Bone Biology

    NASA Technical Reports Server (NTRS)

    Zimmerli, Gregory; Fischer, David; Asipauskas, Marius; Chauhan, Chirag; Compitello, Nicole; Burke, Jamie; Tate, Melissa Knothe


    One of the more serious side effects of extended space flight is an accelerated bone loss. Rates of bone loss are highest in the weight-bearing bones of the hip and spine regions, and the average rate of bone loss as measured by bone mineral density measurements is around 1.2% per month for persons in a microgravity environment. It is well known that bone remodeling responds to mechanical forces. We are developing two-photon microscopy techniques to study bone tissue and bone cell cultures to better understand the fundamental response mechanism in bone remodeling. Osteoblast and osteoclast cell cultures are being studied, and the goal is to use molecular biology techniques in conjunction with Fluorescence Lifetime Imaging Microscopy (FLIM) to study the physiology of in-vitro cell cultures in response to various stimuli, such as fluid flow induced shear stress and mechanical stress. We have constructed a two-photon fluorescence microscope for these studies, and are currently incorporating FLIM detection. Current progress will be reviewed. This work is supported by the NASA John Glenn Biomedical Engineering Consortium.

  7. Autoinflammatory bone diseases.


    Stern, Sara M; Ferguson, Polly J


    Autoinflammatory bone disease is a new branch of autoinflammatory diseases caused by seemingly unprovoked activation of the innate immune system leading to an osseous inflammatory process. The inflammatory bone lesions in these disorders are characterized by chronic inflammation that is typically culture negative with no demonstrable organism on histopathology. The most common autoinflammatory bone diseases in childhood include chronic nonbacterial osteomyelitis (CNO), synovitis, acne, pustulosis, hyperostosis, osteitis syndrome, Majeed syndrome, deficiency of interleukin-1 receptor antagonist, and cherubism. In this article, the authors focus on CNO and summarize the distinct genetic autoinflammatory bone syndromes.

  8. Hypercalciuric Bone Disease

    NASA Astrophysics Data System (ADS)

    Favus, Murray J.


    Hypercalciuria plays an important causal role in many patients with calcium oxalate (CaOx) stones. The source of the hypercalciuria includes increased intestinal Ca absorption and decreased renal tubule Ca reabsorption. In CaOx stone formers with idiopathic hypercalciuria (IH), Ca metabolic balance studies have revealed negative Ca balance and persistent hypercalciuria in the fasting state and during low dietary Ca intake. Bone resorption may also contribute to the high urine Ca excretion and increase the risk of bone loss. Indeed, low bone mass by DEXA scanning has been discovered in many IH patients. Thiazide diuretic agents reduce urine Ca excretion and may increase bone mineral density (BMD), thereby reducing fracture risk. Dietary Ca restriction that has been used unsuccessfully in the treatment of CaOx nephrolithiasis in the past may enhance negative Ca balance and accelerate bone loss. DEXA scans may demonstrate low BMD at the spine, hip, or forearm, with no predictable pattern. The unique pattern of bone histologic changes in IH differs from other causes of low DEXA bone density including postmenopausal osteoporosis, male hypogonadal osteoporosis, and glucocorticoid-induced osteoporosis. Hypercalciuria appears to play an important pathologic role in the development of low bone mass, and therefore correction of urine Ca losses should be a primary target for treatment of the bone disease accompanying IH.

  9. Method for fusing bone


    Mourant, J.R.; Anderson, G.D.; Bigio, I.J.; Johnson, T.M.


    The present invention is a method for joining hard tissue which includes chemically removing the mineral matrix from a thin layer of the surfaces to be joined, placing the two bones together, and heating the joint using electromagnetic radiation. The goal of the method is not to produce a full-strength weld of, for example, a cortical bone of the tibia, but rather to produce a weld of sufficient strength to hold the bone halves in registration while either external fixative devices are applied to stabilize the bone segments, or normal healing processes restore full strength to the tibia.

  10. Bone fractal analysis.


    Feltrin, Gian Pietro; Stramare, Roberto; Miotto, Diego; Giacomini, Dario; Saccavini, Claudio


    Fractal analysis is a quantitative method used to evaluate complex anatomic findings in their elementary component. Its application to biologic images, particularly to cancellous bones, has been well practiced within the past few years. The aims of these applications are to assess changes in bone and the loss of spongious architecture, indicate bone fragility, and to show the increased risk for fracture in primary or secondary osteoporosis. The applications are very promising to help complete the studies that can define bone density (bone mineral density by dual energy x-ray absorptiometry or quantitative computed tomography), and also have the capacity to distinguish the patients with a high or low risk for fracture. Their extension to the clinical fields, to define a test for fracture risk, is still limited by difficult application to the medical quantitative imaging of bones, between correct application at superficial bones and unreliable application to deep bones. The future evolution and validity do not depend upon fractal methods but upon well-detailed imaging of the bones in clinical conditions.

  11. Calculation Of Pneumatic Attenuation In Pressure Sensors

    NASA Technical Reports Server (NTRS)

    Whitmore, Stephen A.


    Errors caused by attenuation of air-pressure waves in narrow tubes calculated by method based on fundamental equations of flow. Changes in ambient pressure transmitted along narrow tube to sensor. Attenuation of high-frequency components of pressure wave calculated from wave equation derived from Navier-Stokes equations of viscous flow in tube. Developed to understand and compensate for frictional attenuation in narrow tubes used to connect aircraft pressure sensors with pressure taps on affected surfaces.

  12. Global Attenuation Model of the Upper Mantle

    NASA Astrophysics Data System (ADS)

    Adenis, A.; Debayle, E.; Ricard, Y. R.


    We present a three-dimensional shear attenuation model based on a massive surface wave data-set (372,629 Rayleigh waveforms analysed in the period range 50-300s by Debayle and Ricard, 2012). For each seismogram, this approach yields depth-dependent path average models of shear velocity and quality factor, and a set of fundamental and higher-mode dispersion and attenuation curves. We combine these attenuation measurements in a tomographic inversion after a careful rejection of the noisy data. We first remove data likely to be biased by a poor knowledge of the source. Then we assume that waves corresponding to events having close epicenters and recorded at the same station sample the same elastic and anelastic structure, we cluster the corresponding rays and average the attenuation measurements. Logarithms of the attenuations are regionalized using the non-linear east square formalism of Tarantola and Valette (1982), resulting in attenuation tomographic maps between 50s and 300s. After a first inversion, outlyers are rejected and a second inversion yields a moderate variance reduction of about 20%. We correct the attenuation curves for focusing effect using the linearized ray theory of Woodhouse and Wong (1986). Accounting for focussing effects allows building tomographic maps with variance reductions reaching 40%. In the period range 120-200s, the root mean square of the model perturbations increases from about 5% to 20%. Our 3-D attenuation models present strong agreement with surface tectonics at period lower than 200s. Areas of low attenuation are located under continents and areas of high attenuation are associated with oceans. Surprisingly, although mid oceanic ridges are located in attenuating regions, their signature, even if enhanced by focusing corrections, remains weaker than in the shear velocity models. Synthetic tests suggests that regularisation contributes to damp the attenuation signature of ridges, which could therefore be underestimated.

  13. General relationships between ultrasonic attenuation and dispersion

    NASA Technical Reports Server (NTRS)

    Odonnell, M.; Jaynes, E. T.; Miller, J. G.


    General relationships between the ultrasonic attenuation and dispersion are presented. The validity of these nonlocal relationships hinges only on the properties of causality and linearity, and does not depend upon details of the mechanism responsible for the attenuation and dispersion. Approximate, nearly local relationships are presented and are demonstrated to predict accurately the ultrasonic dispersion in solutions of hemoglobin from the results of attenuation measurements.

  14. Dependences of ultrasonic properties on frequency and trabecular spacing in trabecular-bone-mimicking phantoms.


    Lee, Kang Il


    The dependences of ultrasonic properties on the frequency and the trabecular spacing were investigated in 20 trabecular-bone-mimicking phantoms consisting of cellular copper foams. The strong slow waves were consistently observed in the signals transmitted through all of the phantoms. The frequency-dependent phase velocity and attenuation coefficient of the slow wave were measured at frequencies from 0.7 to 1.3 MHz. The phase velocity decreased approximately linearly with increasing frequency while the attenuation coefficients increased with increasing frequency. The phase velocity increased monotonically with increasing trabecular spacing from 1337 to 2931 μm while the attenuation coefficient decreased with increasing spacing.

  15. Cardiac Fibroblasts Adopt Osteogenic Fates and Can Be Targeted to Attenuate Pathological Heart Calcification.


    Pillai, Indulekha C L; Li, Shen; Romay, Milagros; Lam, Larry; Lu, Yan; Huang, Jie; Dillard, Nathaniel; Zemanova, Marketa; Rubbi, Liudmilla; Wang, Yibin; Lee, Jason; Xia, Ming; Liang, Owen; Xie, Ya-Hong; Pellegrini, Matteo; Lusis, Aldons J; Deb, Arjun


    Mammalian tissues calcify with age and injury. Analogous to bone formation, osteogenic cells are thought to be recruited to the affected tissue and induce mineralization. In the heart, calcification of cardiac muscle leads to conduction system disturbances and is one of the most common pathologies underlying heart blocks. However the cell identity and mechanisms contributing to pathological heart muscle calcification remain unknown. Using lineage tracing, murine models of heart calcification and in vivo transplantation assays, we show that cardiac fibroblasts (CFs) adopt an osteoblast cell-like fate and contribute directly to heart muscle calcification. Small-molecule inhibition of ENPP1, an enzyme that is induced upon injury and regulates bone mineralization, significantly attenuated cardiac calcification. Inhibitors of bone mineralization completely prevented ectopic cardiac calcification and improved post injury heart function. Taken together, these findings highlight the plasticity of fibroblasts in contributing to ectopic calcification and identify pharmacological targets for therapeutic development.

  16. Optimal ultrasonic array focusing in attenuative media.


    Ganguli, A; Gao, R X; Liang, K; Jundt, J


    This paper presents a parametric study on the efficiency of ultrasound focusing in an attenuative medium, using phased arrays. Specifically, an analytical model of ultrasound wave focusing in a homogeneous, isotropic and attenuative fluid with point sources is presented. Calculations based on the model have shown that in an attenuative medium, an optimum frequency exists for the best focusing performance for a particular size of aperture and focal distance. The effect of different f numbers on the focusing performance in the attenuative medium is further investigated. The information obtained from the analytical model provides insights into the design and installation of a phased transducer array for energy efficient wave focusing.

  17. Differential dust attenuation in CALIFA galaxies

    NASA Astrophysics Data System (ADS)

    Vale Asari, N.; Cid Fernandes, R.; Amorim, A. L.; Lacerda, E. A. D.; Schlickmann, M.; Wild, V.; Kennicutt, R. C.


    Dust attenuation has long been treated as a simple parameter in SED fitting. Real galaxies are, however, much more complicated: The measured dust attenuation is not a simple function of the dust optical depth, but depends strongly on galaxy inclination and the relative distribution of stars and dust. We study the nebular and stellar dust attenuation in CALIFA galaxies, and propose some empirical recipes to make the dust treatment more realistic in spectral synthesis codes. By adding optical recombination emission lines, we find better constraints for differential attenuation. Those recipes can be applied to unresolved galaxy spectra, and lead to better recovered star formation rates.

  18. uPA Attenuated LPS-induced Inflammatory Osteoclastogenesis through the Plasmin/PAR-1/Ca2+/CaMKK/AMPK Axis

    PubMed Central

    Kanno, Yosuke; Ishisaki, Akira; Kawashita, Eri; Kuretake, Hiromi; Ikeda, Kanako; Matsuo, Osamu


    Chronic inflammatory diseases, such as rheumatoid arthritis and periodontitis-caused bone destruction, results from an increase of bone-resorbing osteoclasts (OCs) induced by inflammation. However, the detailed mechanisms underlying this disorder remain unclear. We herein investigated that the effect of urokinase-type plasminogen activator (uPA) on inflammatory osteoclastogenesis induced by lipopolysaccharide (LPS), which is a potent stimulator of bone resorption in inflammatory diseases. We found that the uPA deficiency promoted inflammatory osteoclastogenesis and bone loss induced by LPS. We also showed that LPS induced the expression of uPA, and the uPA treatment attenuated the LPS-induced inflammatory osteoclastogenesis of RAW264.7 mouse monocyte/macrophage lineage cells. Additionally, we showed that the uPA-attenuated inflammatory osteoclastgenesis is associated with the activation of plasmin/protease-activated receptor (PAR)-1 axis by uPA. Moreover, we examined the mechanism underlying the effect of uPA on inflammatory osteoclastogenesis, and found that uPA/plasmin/PAR-1 activated the adenosine monophosphate-activated protein kinase (AMPK) pathway through Ca2+/calmodulin dependent protein kinase kinase (CaMKK) activation, and attenuated inflammatory osteoclastogenesis by inactivation of NF-κB in RAW264.7 cells. These data suggest that uPA attenuated inflammatory osteoclastogenesis through the plasmin/PAR-1/Ca2+/CaMKK/AMPK axis. Our findings may provide a novel therapeutic approach to bone loss caused by inflammatory diseases. PMID:26722218

  19. Robust spinal neuroinflammation mediates mechanical allodynia in Walker 256 induced bone cancer rats.


    Mao-Ying, Qi-Liang; Wang, Xiao-Wei; Yang, Chang-Jiang; Li, Xiu; Mi, Wen-Li; Wu, Gen-Cheng; Wang, Yan-Qing


    It has been reported that remarkable and sustained activation of astrocytes and/or microglia occurs in cancer induced pain (CIP), which is different from neuropathic and inflammatory pain. The present study was designed to investigate the role of spinal Toll-like receptor 4 (TLR4) induced glial neuroinflammation in cancer induced pain using a modified rat model of bone cancer. The rat model of CIP consisted of unilateral intra-tibial injection with Walker 256 mammary gland carcinoma. Nine days after Walker 256 inoculation, a robust activation of both astrocytes and microglia in bilateral spinal dorsal horn was observed together with significant bilateral mechanical allodynia. This neuroinflammation was characterized by enhanced immunostaining of both glial fibrillary acidic protein (GFAP, astrocyte marker) and OX-42 (microglia marker), and an elevated level of IL-1β, IL-6 and TNF-α mRNA. I.t. administration of fluorocitrate (an inhibitor of glial metabolism, 1 nmol) or minocycline (an inhibitor of microglia, 100 μg) has significant anti-allodynic effects on day 12 after Walker 256 inoculation. Naloxone (a nonstereoselective TLR4 signaling blocker, 60 μg, i.t.) also significantly alleviated mechanical allodynia and simultaneously blocked the increased inflammatory cytokine mRNA. The results suggested that spinal TLR4 might play an important role in the sustained glial activation that critically contributed to the robust and sustained spinal neuroinflammation in CIP. This result could potentially help clinicians and researchers to better understand the mechanism of complicated cancer pain.

  20. Horizontal bone augmentation by means of guided bone regeneration.


    Benic, Goran I; Hämmerle, Christoph H F


    The development of bone augmentation procedures has allowed placement of dental implants into jaw bone areas lacking an amount of bone sufficient for standard implant placement. Thus, the indications for implants have broadened to include jaw regions with bone defects and those with a bone anatomy that is unfavorable for implant anchorage. Of the different techniques, the best documented and the most widely used method to augment bone in localized alveolar defects is guided bone regeneration. A large body of evidence has demonstrated the successful use of guided bone regeneration to regenerate missing bone at implant sites with insufficient bone volume and the long-term success of implants placed simultaneously with, or after, guided bone regeneration. However, the influence of guided bone regeneration on implant survival and success rates, and the long-term stability of the augmented bone, remain unknown. Many of the materials and techniques currently available for bone regeneration of alveolar ridge defects were developed many years ago. Recently, various new materials and techniques have been introduced. Many of them have, however, not been sufficiently documented in clinical studies. The aim of this review was to present the scientific basis of guided bone regeneration and the accepted clinical procedures. A classification of bone defects has been presented, aiming at simplifying the decision-making process regarding the choice of strategy for bone augmentation. Finally, an outlook into actual research and the possible future options related to bone augmentation has been provided.

  1. Exercise, lifestyle, and your bones


    Osteoporosis - exercise; Low bone density - exercise; Osteopenia - exercise ... To build up bone density, the exercise must make your muscles pull on your bones. These are called weight-bearing exercises. Some of them are: ...

  2. Children's Bone Health and Calcium


    ... Research Information Clinical Trials Resources and Publications Children's Bone Health and Calcium: Condition Information Skip sharing on ... media links Share this: Page Content What is bone health and how do you build strong bones? ...

  3. Exercise for Your Bone Health


    ... supported by your browser. Home Bone Basics Lifestyle Exercise for Your Bone Health Publication available in: PDF ( ... A Complete Osteoporosis Program For Your Information Why Exercise? Like muscle, bone is living tissue that responds ...

  4. Ultrasonic attenuation in molecular crystals

    NASA Astrophysics Data System (ADS)

    Perrin, Bernard


    It is now well established from an experimental point of view that, concerning the ultrasonic attenuation, molecular crystals exhibit a specific behavior among dielectric crystals. This fact suggests the presence of a relaxation process. Liebermann, who has introduced this field, has proposed a way to analyze this problem and in particular has given an expression for the ultrasonic absorption coefficient in terms of a relaxation time and some thermodynamic quantities. In contrast to Liebermann's approach, a solid-state viewpoint is presented here, and it is shown that this ultrasonic relaxation can be taken into account in the framework of Akhieser's theory. A general expression of the ultrasonic absorption coefficient is calculated in terms of the phonon collision operator using the Boltzmann-equation approach of Woodruff and Ehrenreich. The collision-time approximation widely used in dielectric crystals fails in molecular crystals for which the presence of slow relaxation times in the collision operator prevents the thermalization of the whole set of phonons and gives rise to an ultrasonic relaxation. Thus a more suitable approximation is suggested here, which leads to a new expression of the ultrasonic attenuation valid in molecular crystals. Different forms of this expression are discussed, and comparison with Liebermann's expression used in most of the previous papers shows that the present treatment takes better account of the anisotropy of the solid state. The fit of experimental results obtained for some ionic-molecular crystals also shows that the expression derived here gives better agreement than does Liebermann's. Finally, it is shown that in the framework of the present treatment and under rather general conditions, the anisotropy affects primarily the magnitude of the ultrasonic absorption due to the molecular relaxation, but it does not affect its frequency dependence.

  5. Vision 20/20: Magnetic resonance imaging-guided attenuation correction in PET/MRI: Challenges, solutions, and opportunities

    SciTech Connect

    Mehranian, Abolfazl; Arabi, Hossein; Zaidi, Habib


    Attenuation correction is an essential component of the long chain of data correction techniques required to achieve the full potential of quantitative positron emission tomography (PET) imaging. The development of combined PET/magnetic resonance imaging (MRI) systems mandated the widespread interest in developing novel strategies for deriving accurate attenuation maps with the aim to improve the quantitative accuracy of these emerging hybrid imaging systems. The attenuation map in PET/MRI should ideally be derived from anatomical MR images; however, MRI intensities reflect proton density and relaxation time properties of biological tissues rather than their electron density and photon attenuation properties. Therefore, in contrast to PET/computed tomography, there is a lack of standardized global mapping between the intensities of MRI signal and linear attenuation coefficients at 511 keV. Moreover, in standard MRI sequences, bones and lung tissues do not produce measurable signals owing to their low proton density and short transverse relaxation times. MR images are also inevitably subject to artifacts that degrade their quality, thus compromising their applicability for the task of attenuation correction in PET/MRI. MRI-guided attenuation correction strategies can be classified in three broad categories: (i) segmentation-based approaches, (ii) atlas-registration and machine learning methods, and (iii) emission/transmission-based approaches. This paper summarizes past and current state-of-the-art developments and latest advances in PET/MRI attenuation correction. The advantages and drawbacks of each approach for addressing the challenges of MR-based attenuation correction are comprehensively described. The opportunities brought by both MRI and PET imaging modalities for deriving accurate attenuation maps and improving PET quantification will be elaborated. Future prospects and potential clinical applications of these techniques and their integration in commercial

  6. Vision 20/20: Magnetic resonance imaging-guided attenuation correction in PET/MRI: Challenges, solutions, and opportunities.


    Mehranian, Abolfazl; Arabi, Hossein; Zaidi, Habib


    Attenuation correction is an essential component of the long chain of data correction techniques required to achieve the full potential of quantitative positron emission tomography (PET) imaging. The development of combined PET/magnetic resonance imaging (MRI) systems mandated the widespread interest in developing novel strategies for deriving accurate attenuation maps with the aim to improve the quantitative accuracy of these emerging hybrid imaging systems. The attenuation map in PET/MRI should ideally be derived from anatomical MR images; however, MRI intensities reflect proton density and relaxation time properties of biological tissues rather than their electron density and photon attenuation properties. Therefore, in contrast to PET/computed tomography, there is a lack of standardized global mapping between the intensities of MRI signal and linear attenuation coefficients at 511 keV. Moreover, in standard MRI sequences, bones and lung tissues do not produce measurable signals owing to their low proton density and short transverse relaxation times. MR images are also inevitably subject to artifacts that degrade their quality, thus compromising their applicability for the task of attenuation correction in PET/MRI. MRI-guided attenuation correction strategies can be classified in three broad categories: (i) segmentation-based approaches, (ii) atlas-registration and machine learning methods, and (iii) emission/transmission-based approaches. This paper summarizes past and current state-of-the-art developments and latest advances in PET/MRI attenuation correction. The advantages and drawbacks of each approach for addressing the challenges of MR-based attenuation correction are comprehensively described. The opportunities brought by both MRI and PET imaging modalities for deriving accurate attenuation maps and improving PET quantification will be elaborated. Future prospects and potential clinical applications of these techniques and their integration in commercial

  7. Trabecular bone volume fraction mapping by low-resolution MRI.


    Fernández-Seara, M A; Song, H K; Wehrli, F W


    Trabecular bone volume fraction (TBVF) is highly associated with the mechanical competence of trabecular bone. TBVF is ordinarily measured by histomorphometry from bone biopsies or, noninvasively, by means of high-resolution microcomputed tomography and, more recently, by micro-MRI. The latter methods require spatial resolution sufficient to resolve trabeculae, along with segmentation techniques that allow unambiguous assignment of the signal to bone or bone marrow. In this article it is shown that TBVF can be measured under low-resolution conditions by exploiting the attenuation of the MR signal resulting from fractional occupancy of the imaging voxel by bone and bone marrow, provided that a reference signal is available from a marrow volume devoid of trabeculation. The method requires accurate measurement of apparent proton density, which entails correction for various sources of error. Key among these are the spatial nonuniformity in the RF field amplitude and effects of the slice profile, which are determined by B(1) field mapping and numerical integration of the Bloch equations, respectively. By contrast, errors from variations in bone marrow composition (hematopoietic vs. fatty) between trabecular and reference site are predicted to be small and usually negligible. The method was evaluated in phantoms and in vivo in the distal radius and found to be accurate to 1% in marrow volume fraction. Finally, in a group of 12 patients of varying skeletal status, TBVF in the calcaneus was found to strongly correlate with integral bone mineral density of the lumbar vertebrae (r(2) = 0.83, p < 0.0001). The method may fail in large imaging objects such as the human trunk at high magnetic field where standing wave and RF penetration effects cause intensity variations that cannot be corrected. Magn Reson Med 46:103-113, 2001.

  8. Interleukin-6-mediated functional upregulation of TRPV1 receptors in dorsal root ganglion neurons through the activation of JAK/PI3K signaling pathway: roles in the development of bone cancer pain in a rat model.


    Fang, Dong; Kong, Ling-Yu; Cai, Jie; Li, Song; Liu, Xiao-Dan; Han, Ji-Sheng; Xing, Guo-Gang


    Primary and metastatic cancers that affect bone are frequently associated with severe and intractable pain. The mechanisms underlying the pathogenesis of bone cancer pain still remain largely unknown. Previously, we have reported that sensitization of primary sensory dorsal root ganglion (DRG) neurons contributes to the pathogenesis of bone cancer pain in rats. In addition, numerous preclinical and clinical studies have revealed the pathological roles of interleukin-6 (IL-6) in inflammatory and neuropathic hyperalgesia. In this study, we investigated the role and the underlying mechanisms of IL-6 in the development of bone cancer pain using in vitro and in vivo approaches. We first demonstrated that elevated IL-6 in DRG neurons plays a vital role in the development of nociceptor sensitization and bone cancer-induced pain in a rat model through IL-6/soluble IL-6 receptor (sIL-6R) trans-signaling. Moreover, we revealed that functional upregulation of transient receptor potential vanilloid channel type 1 (TRPV1) in DRG neurons through the activation of Janus kinase (JAK)/phosphatidylinositol 3-kinase (PI3K) signaling pathway contributes to the effects of IL-6 on the pathogenesis of bone cancer pain. Therefore, suppression of functional upregulation of TRPV1 in DRG neurons by the inhibition of JAK/PI3K pathway, either before surgery or after surgery, reduces the hyperexcitability of DRG neurons and pain hyperalgesia in bone cancer rats. We here disclose a novel intracellular pathway, the IL-6/JAK/PI3K/TRPV1 signaling cascade, which may underlie the development of peripheral sensitization and bone cancer-induced pain.

  9. Biodegradable synthetic bone composites

    SciTech Connect

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.


    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  10. Automated trabecular bone histomorphometry

    NASA Technical Reports Server (NTRS)

    Polig, E.; Jee, W. S. S.


    The toxicity of alpha-emitting bone-seeking radionuclides and the relationship between bone tumor incidence and the local dosimetry of radionuclides in bone are investigated. The microdistributions of alpha-emitting radionuclides in the trabecular bone from the proximal humerus, distal humerus, proximal ulna, proximal femur, and distal femur of six young adult beagles injected with Am-241 (three with 2.8 micro-Ci/kg and three with 0.9 micro-Ci/kg) are estimated using a computer-controlled microscope photometer system; the components of the University of Utah Optical Track Scanner are described. The morphometric parameters for the beagles are calculated and analyzed. It is observed that the beagles injected with 0.9 micro-Ci of Am-241/kg showed an increase in the percentage of bone and trabecular bone thickness, and a reduction in the width of the bone marrow space and surface/volume ratio. The data reveal that radiation damage causes abnormal bone structure.


    ERIC Educational Resources Information Center

    Elementary Science Study, Newton, MA.


  12. Osteocyte and bone structure.


    Klein-Nulend, Jenneke; Nijweide, Peter J; Burger, Elisabeth H


    The osteocyte is the most abundant cell type of bone. There are approximately 10 times as many osteocytes as osteoblasts in adult human bone, and the number of osteoclasts is only a fraction of the number of osteoblasts. Our current knowledge of the role of osteocytes in bone metabolism is far behind our insight into the properties and functions of the osteoblasts and osteoclasts. However, the striking structural design of bone predicts an important role for osteocytes in determining bone structure. Over the past several years, the role of osteocytes as the professional mechanosensory cells of bone, and the lacunocanalicular porosity as the structure that mediates mechanosensing have become clear. Strain-derived flow of interstitial fluid through this porosity seems to mechanically activate the osteocytes, as well as ensure transport of cell signaling molecules, nutrients, and waste products. This concept explains local bone gain and loss--as well as remodeling in response to fatigue damage--as processes supervised by mechanosensitive osteocytes. Alignment during remodeling seems to occur as a result of the osteocyte's sensing different canalicular flow patterns around the cutting cone and reversal zone during loading, therefore determining the bone's structure.

  13. The influence of cortical end-plate on broadband ultrasound attenuation measurements at the human calcaneus using scanning confocal ultrasound

    NASA Astrophysics Data System (ADS)

    Xia, Yi; Lin, Wei; Qin, Yi-Xian


    Quantitative ultrasound (QUS) assessment, including broadband ultrasound attenuation (BUA), is an efficient technique for assessing bone quality in various statuses, e.g., osteoporosis. While assessing trabecular bone loss is essential to bone quality, the existence of cortical bone can substantially reduce the accuracy of BUA measurement. In this study, we developed an approach to quantify the influence of the cortical end-plate in the QUS on 18 cadaver calcanei using both analytical and experimental analyses. A simplified cortical-trabecular-cortical sandwich model has been developed for simulation of wave propagations. Results show that the cortical end-plate has a significant effect on BUA (yielding 8.5+/-3.6 dB/MHz in cortical bone alone), approximately 15% of the BUA value over the whole bone BUA measurement (54.1+/-20.1 dB/MHz). The phenomenon has been predicted by the developed analytical model with a high correlation (r2=0.63,p<0.0001). The data have suggested that the mechanism of the BUA attributed to the cortical end-plate is primarily due to the ultrasonic wave transmission and reflection within the cortical layers. Therefore, the influence of the cortical end-plate in BUA can be quantified and incorporated into the QUS assessment for bone quality, which may provide insight into BUA measurement for accurate diagnosis of bone diseases.

  14. Aromatase inhibitor-induced bone loss increases the progression of estrogen receptor-negative breast cancer in bone and exacerbates muscle weakness in vivo.


    Wright, Laura E; Harhash, Ahmed A; Kozlow, Wende M; Waning, David L; Regan, Jenna N; She, Yun; John, Sutha K; Murthy, Sreemala; Niewolna, Maryla; Marks, Andrew R; Mohammad, Khalid S; Guise, Theresa A


    Aromatase inhibitors (AIs) cause muscle weakness, bone loss, and joint pain in up to half of cancer patients. Preclinical studies have demonstrated that increased osteoclastic bone resorption can impair muscle contractility and prime the bone microenvironment to accelerate metastatic growth. We hypothesized that AI-induced bone loss could increase breast cancer progression in bone and exacerbate muscle weakness associated with bone metastases. Female athymic nude mice underwent ovariectomy (OVX) or sham surgery and were treated with vehicle or AI (letrozole; Let). An OVX-Let group was then further treated with bisphosphonate (zoledronic acid; Zol). At week three, trabecular bone volume was measured and mice were inoculated with MDA-MB-231 cells into the cardiac ventricle and followed for progression of bone metastases. Five weeks after tumor cell inoculation, tumor-induced osteolytic lesion area was increased in OVX-Let mice and reduced in OVX-Let-Zol mice compared to sham-vehicle. Tumor burden in bone was increased in OVX-Let mice relative to sham-vehicle and OVX-Let-Zol mice. At the termination of the study, muscle-specific force of the extensor digitorum longus muscle was reduced in OVX-Let mice compared to sham-vehicle mice, however, the addition of Zol improved muscle function. In summary, AI treatment induced bone loss and skeletal muscle weakness, recapitulating effects observed in cancer patients. Prevention of AI-induced osteoclastic bone resorption using a bisphosphonate attenuated the development of breast cancer bone metastases and improved muscle function in mice. These findings highlight the bone microenvironment as a modulator of tumor growth locally and muscle function systemically.

  15. [Metabolic bone diseases].


    Jakob, F


    Osteomalacia is caused by impaired vitamin D receptor (VDR) signaling, calcium deficiency, and altered bone mineralization. This can be due to insufficient sunlight exposure, malabsorption, reduced D hormone activation in chronic kidney disease, and rare alterations of VDR signaling and phosphate metabolism. Leading symptoms are bone pain, muscular cramps, and increased incidence of falls in the elderly. The adequate respective countermeasures are to optimize the daily intake of calcium and vitamin D3 and to replace active D hormone and phosphate if deficient. Osteoporosis is characterized by bone fragility fractures upon minor physical impact. Indications for diagnosis and treatment can be established by estimating the absolute fracture risk, taking into account bone mineral density, age, gender, and individual risk factors. Exercise, intervention programs to avoid falls, and specific drugs are capable of substantially reducing fracture risk even in the elderly. Secondary osteoporosis primarily requires both bone-altering medications and effective treatment of underlying diseases.

  16. Bone and Celiac Disease.


    Zanchetta, María Belén; Longobardi, Vanesa; Bai, Julio César


    More than 50% of untreated patients with celiac disease (CD) have bone loss detected by bone densitometry (dual-energy X-ray absorptiometry:DXA). Moreover, patients with CD are more likely to have osteoporosis and fragility fractures, especially of the distal radius. Although still controversial, we recommend DXA screening in all celiac disease patients, particularly in those with symptomatic CD at diagnosis and in those who present risk factors for fracture such as older age, menopausal status, previous fracture history, and familial hip fracture history. Bone microarchitecture, especially the trabecular network, may be deteriorated, explaining the higher fracture risk in these patients. Adequate calcium and vitamin D supplementation are also recommended to optimize bone recovery, especially during the first years of gluten free diet (GFD). If higher fracture risk persists after 1 or 2 years of GFD, specific osteoactive treatment may be necessary to improve bone health.

  17. Ultrasonic bone densitometer

    NASA Technical Reports Server (NTRS)

    Hoop, J. M. (Inventor)


    A device, for measuring the density of a bone structure so as to monitor the calcium content, is described. A pair of opposed spaced ultrasonic transducers are held within a clamping apparatus closely adjacent the bone being analyzed. These ultrasonic transducers incude piezoelectric crystals shaped to direct signals through the bone encompassed in the heel and finger of the subject being tested. A pulse generator is coupled to one of the transducers and generates an electric pulse for causing the transducers to generate an ultrasonic sound wave which is directed through the bone structure to the other transducer. An electric circuit, including an amplifier and a bandpass filter couples the signals from the receiver transducer back to the pulse generator for retriggering the pulse generator at a frequency proportional to the duration that the ultrasonic wave takes to travel through the bone structure being examined.

  18. The effect of lead in bone densitometry

    NASA Astrophysics Data System (ADS)

    Popovic, Marija; McNeill, Fiona E.; Webber, Colin E.; Chettle, David R.


    Dual energy X-ray absorptiometry (DXA) is presently considered the standard technique for diagnosis of osteoporosis. It has been suggested that the presence of lead interferes with the accurate measurement of bone mineral density (BMD) by DXA because of the increased attenuation and that an accurate measurement of BMD cannot be determined unless the patient's bone lead content of patients is known. We performed DXA measurements on plaster of Paris phantoms and a Hologic Spine phantom in combination with polyester resin doped with various concentrations of lead. At lead levels which correspond to bone concentrations in occupationally exposed individuals, the suggested increase in densitometric BMD was not detected. Numerical calculations show that the effect of the lead depends upon the two energies of the X-ray beam of a particular device. The discrepancy between the actual and the densitometric BMD increases linearly and is about 0.3% at 100 ppm. Such change cannot be detected by the Hologic QDR 4500A, the device used for this experiment.

  19. Segmentation of bone CT images and assessment of bone structure using measures of complexity.


    Saparin, Peter; Thomsen, Jesper Skovhus; Kurths, Jürgen; Beller, Gisela; Gowin, Wolfgang


    A nondestructive and noninvasive method for numeric characterization (quantification) of the structural composition of human bone tissue has been developed and tested. In order to quantify and to compare the structural composition of bones from 2D computed tomography (CT) images acquired at different skeletal locations, a series of robust, versatile, and adjustable image segmentation and structure assessment algorithms were developed. The segmentation technique facilitates separation from cortical bone and standardizes the region of interest. The segmented images were symbol-encoded and different aspects of the bone structural composition were quantified using six different measures of complexity. These structural examinations were performed on CT images of bone specimens obtained at the distal radius, humeral mid-diaphysis, vertebral body, femoral head, femoral neck, proximal tibia, and calcaneus. In addition, the ability of the noninvasive and nondestructive measures of complexity to quantify trabecular bone structure was verified by comparing them to conventional static histomorphometry performed on human fourth lumbar vertebral bodies. Strong correlations were established between the measures of complexity and the histomorphometric parameters except for measures expressing trabecular thickness. Furthermore, the ability of the measures of complexity to predict vertebral bone strength was investigated by comparing the outcome of the complexity analysis of the CT images with the results of a biomechanical compression test of the third lumbar vertebral bodies from the same population as used for histomorphometry. A multiple regression analysis using the proposed measures including structure complexity index, structure disorder index, trabecular network index, index of a global ensemble, maximal L-block, and entropy of x-ray attenuation distribution revealed an excellent relationship (r=0.959, r2=0.92) between the measures of complexity and compressive bone strength

  20. Segmentation of bone CT images and assessment of bone structure using measures of complexity

    SciTech Connect

    Saparin, Peter; Thomsen, Jesper Skovhus; Kurths, Juergen; Beller, Gisela; Gowin, Wolfgang


    A nondestructive and noninvasive method for numeric characterization (quantification) of the structural composition of human bone tissue has been developed and tested. In order to quantify and to compare the structural composition of bones from 2D computed tomography (CT) images acquired at different skeletal locations, a series of robust, versatile, and adjustable image segmentation and structure assessment algorithms were developed. The segmentation technique facilitates separation of trabecular from cortical bone and standardizes the region of interest. The segmented images were symbol-encoded and different aspects of the bone structural composition were quantified using six different measures of complexity. These structural examinations were performed on CT images of bone specimens obtained at the distal radius, humeral mid-diaphysis, vertebral body, femoral head, femoral neck, proximal tibia, and calcaneus. In addition, the ability of the noninvasive and nondestructive measures of complexity to quantify trabecular bone structure was verified by comparing them to conventional static histomorphometry performed on human fourth lumbar vertebral bodies. Strong correlations were established between the measures of complexity and the histomorphometric parameters except for measures expressing trabecular thickness. Furthermore, the ability of the measures of complexity to predict vertebral bone strength was investigated by comparing the outcome of the complexity analysis of the CT images with the results of a biomechanical compression test of the third lumbar vertebral bodies from the same population as used for histomorphometry. A multiple regression analysis using the proposed measures including structure complexity index, structure disorder index, trabecular network index, index of a global ensemble, maximal L-block, and entropy of x-ray attenuation distribution revealed an excellent relationship (r=0.959, r{sup 2}=0.92) between the measures of complexity and

  1. Juxtaphyseal aneurysmal bone cysts.


    Rizzo, M; Dellaero, D T; Harrelson, J M; Scully, S P


    Aneurysmal bone cysts are benign primary or secondary lesions that commonly arise in long bones and often before skeletal maturity. Little has been written about aneurysmal bone cysts that abut the physeal plate. The records of 15 patients with juxtaphyseal aneurysmal bone cysts were reviewed. Fourteen of the patients were referred with abnormal radiographs after evaluation for pain in the affected limb. One patient presented with abnormal radiographs after fracture about the aneurysmal bone cyst. None of the patients had evidence of growth plate disruption. The children's ages ranged from 2 to 14 years, with a mean of 9.8 years. There were 10 boys and five girls. Lesion locations included: six in the proximal tibia, three in the distal fibula, two in the distal tibia, two in the proximal femur, one in the distal femur, and one in the distal radius. All of the lesions abutted the physeal plate and fell into one of the types in Campanacci's classification of juxtaphyseal aneurysmal bone cysts. Three lesions were classified as Type 1, eight were Type 2, and four were Type 3. This study included no cases of Type 4 or 5 lesions. Treatment of all lesions consisted of excision, curettage, and bone grafting with care taken to preserve the growth plate. Adjunctive cauterization was performed in two cases. There were no incidences of postoperative physeal plate arrest. Overgrowth of the fibula occurred in one patient. Three patients experienced recurrent lesions. One of the children underwent repeat curettage and bone grafting with no additional recurrence. In the other two children with recurrence, the lesion had grown away from the physeal plate while remaining static in size and asymptomatic. Based on this study, juxtaphyseal aneurysmal bone cysts may be treated satisfactorily with intralesional surgery and bone grafting with expectation of normal physeal growth.


    EPA Science Inventory

    We have good statistical methods to: (1) determine whether concentrations of a contaminant are attenuating over time, (2) determine the rate of attenuation and confidence interval on the rate, and (3) determine whether concentrations have met a particular clean up goal. We do no...

  3. Adaptive bone formation in acellular vertebrae of sea bass (Dicentrarchus labrax L.).


    Kranenbarg, Sander; van Cleynenbreugel, Tim; Schipper, Henk; van Leeuwen, Johan


    Mammalian bone is an active tissue in which osteoblasts and osteoclasts balance bone mass. This process of adaptive modelling and remodelling is probably regulated by strain-sensing osteocytes. Bone of advanced teleosts is acellular yet, despite the lack of osteocytes, it is capable of an adaptive response to physical stimuli. Strenuous exercise is known to induce lordosis. Lordosis is a ventrad curvature of the vertebral column, and the affected vertebrae show an increase in bone formation. The effects of lordosis on the strain distribution in sea bass (Dicentrarchus labrax L.) vertebrae are assessed using finite element modelling. The response of the local tissue is analyzed spatially and ontogenetically in terms of bone volume. Lordotic vertebrae show a significantly increased strain energy due to the increased load compared with normal vertebrae when loaded in compression. High strain regions are found in the vertebral centrum and parasagittal ridges. The increase in strain energy is attenuated by a change in architecture due to the increased bone formation. The increased bone formation is seen mainly at the articular surfaces of the vertebrae, although some extra bone is formed in the vertebral centrum. Regions in which the highest strains are found do not spatially correlate with regions in which the most extensive bone apposition occurs in lordotic vertebrae of sea bass. Mammalian-like strain-regulated bone modelling is probably not the guiding mechanism in adaptive bone modelling of acellular sea bass vertebrae. Chondroidal ossification is found at the articular surfaces where it mediates a rapid adaptive response, potentially attenuating high stresses on the dorsal zygapophyses.

  4. Asymmetric adaptive modeling of central tarsal bones in racing greyhounds.


    Johnson, K A; Muir, P; Nicoll, R G; Roush, J K


    Fatigue fracture of the cuboidal bones of the foot, especially the navicular tarsal bone, is common in athletes and dancers. The racing greyhound is a naturally occurring animal model of this injury because both microcracking and complete fracture occur in the right central (navicular) tarsal bone (CTB). The right limb is on the outside when racing in a counter-clockwise direction on circular tracks, and is subjected to asymmetric cyclic compressive loading. We wished to study in more detail adaptive modeling in the right CTB in racing greyhounds. We hypothesized that cyclic asymmetric loading of a cuboidal bone induced by racing on a circular track would induce site-specific bone adaptation. We also hypothesized that such an adaptive response would be attenuated in greyhounds that were retired from racing and no longer subjected to cyclic asymmetric loading. Central tarsal bones from racing greyhounds (racing group, n = 6) and retired greyhounds being used for breeding (nonracing group, n = 4) were examined using quantitative computed tomography (CT). Bone mineral density (BMD) was determined in a 3-mm diameter region-of-interest (ROI) in six contiguous 1-mm-thick sagittal CT slices of each CTB. Bones were subsequently examined histomorphometrically and percentage bone area (B.Ar./T.Ar., %) was determined in 10 ROI from dorsal to plantar in a transverse plane, mid-way between the proximal and distal articular surfaces. The BMD of the right CTB was greater than the left in all greyhounds (p < 0. 001). In comparing ipsilateral limbs between groups, BMD of the racing group was greater than the nonracing group for each side (p < 0.005). In sagittal plane histologic sections, bone in the dorsal region of the right CTB had undergone adaptive modeling, through thickening and compaction of trabeculae. B.Ar./T.Ar., % in the right CTB of the racing group was greater than in the contralateral CTB (p < 0.001), and the ipsilateral CTB of the nonracing group (p < 0.001). In the

  5. Coupling multiscale X-ray physics and micromechanics for bone tissue composition and elasticity determination from micro-CT data, by example of femora from OVX and sham rats

    NASA Astrophysics Data System (ADS)

    Hasslinger, Patricia; Vass, Viktoria; Dejaco, Alexander; Blanchard, Romane; Örlygsson, Gissur; Gargiulo, Paolo; Hellmich, Christian


    Due to its high resolution, micro-CT (Computed Tomograph) scanning is the key to assess bone quality of sham and OVX (ovariectomized) rats. Combination of basic X-ray physics, such as the energy- and chemistry-dependence of attenuation coefficients, with results from ashing tests on rat bones, delivers mineral, organic, and water volume fractions within the voxels. Additional use of a microelastic model for bone provides voxel-specific elastic properties. The new method delivers realistic bone mass densities, and reveals that OVX protocols may indeed induce some bone mass loss, while the average composition of the bone tissue remains largely unaltered.

  6. Malignant lymphoma of bone.


    Dürr, Hans Roland; Müller, Peter Ernst; Hiller, Erhard; Maier, Markus; Baur, Andrea; Jansson, Volkmar; Refior, Hans Jürgen


    Malignant lymphoma of bone is rare. In many cases, its diagnosis is delayed because of unspecific clinical signs and equivocal radiographs. Therapy in general is multimodal, including surgery and radio- and chemotherapy. Our objective was to demonstrate the clinical and radiological aspects of the lesion to optimize diagnostic approaches and to evaluate treatment and prognostic factors. Thirty-six patients with malignant lymphoma of bone who were surgically treated over a 15-year-period were retrospectively reviewed. Seventeen of them showed a singular bone non-Hodgkin's lymphoma (NHL) which was classified as primary lymphoma of the bone (PLB). In 13 cases, dissemination of the disease with multiple bone or visceral involvement was apparent (dNHL). Six patients suffered from bone involvement due to Hodgkin's disease (HD). Surgical treatment was indicated for diagnostic reasons or complications due to the disease. Radiation and chemotherapy were part of the oncological treatment. The patients' mean age was 57 years. The main symptom in malignant bone lymphoma in 33 patients was pain, with an average duration of 8 months. In the secondary cases, bone involvement appeared on average 57 months after the initial diagnosis. An osteolytic pattern was seen in 58% of the lesions. Soft-tissue involvement was seen in 71% of cases (PLB 80%, dNHL 73%, HD 40%) and was the primary diagnostic sign associated with this disease. The 5-year survival rate was 61% (PLB 88%, dNHL 38%, HD 50%). Multiple vs solitary bone involvement was the most significant factor in the prognosis. Extraskeletal involvement significantly decreased survival. No correlation was found between gender, age, location, or histological subtypes and survival. Bone involvement in NHL appears late in the extraskeletal disease. The clinical appearance is nonspecific, and the delay between the onset of symptoms and diagnosis is often long. One of the major radiologic signs is the existence of a soft-tissue tumor

  7. Artesunate Inhibits RANKL-induced Osteoclastogenesis and Bone Resorption In Vitro and Prevents LPS-induced Bone Loss In Vivo.


    Wei, Cheng-Ming; Liu, Qian; Song, Fang-Ming; Lin, Xi-Xi; Su, Yi-Ji; Xu, Jiake; Huang, Lin; Zong, Shao-Hui; Zhao, Jin-Min


    Osteoclasts are multinuclear giant cells responsible for bone resorption in lytic bone diseases such as osteoporosis, arthritis, periodontitis, and bone tumors. Due to the severe side-effects caused by the currently available drugs, a continuous search for novel bone-protective therapies is essential. Artesunate (Art), the water-soluble derivative of artemisinin has been investigated owing to its anti-malarial properties. However, its effects in osteoclastogenesis have not yet been reported. In this study, Art was shown to inhibit the nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis, the mRNA expression of osteoclastic-specific genes, and resorption pit formation in a dose-dependent manner in primary bone marrow-derived macrophages cells (BMMs). Furthermore, Art markedly blocked the RANKL-induced osteoclastogenesis by attenuating the degradation of IκB and phosphorylation of NF-κB p65. Consistent with the in vitro results, Art inhibited lipopolysaccharide (LPS)-induced bone resorption by suppressing the osteoclastogenesis. Together our data demonstrated that Art inhibits RANKL-induced osteoclastogenesis by suppressing the NF-κB signaling pathway and that it is a promising agent for the treatment of osteolytic diseases. This article is protected by copyright. All rights reserved.

  8. Parathyroid hormone attenuates radiation-induced increases in collagen crosslink ratio at periosteal surfaces of mouse tibia.


    Oest, Megan E; Gong, Bo; Esmonde-White, Karen; Mann, Kenneth A; Zimmerman, Nicholas D; Damron, Timothy A; Morris, Michael D


    As part of our ongoing efforts to understand underlying mechanisms contributing to radiation-associated bone fragility and to identify possible treatments, we evaluated the longitudinal effects of parathyroid hormone (PTH) treatment on bone quality in a murine model of limited field irradiation. We hypothesized PTH would mitigate radiation-induced changes in the chemical composition and structure of bone, as measured by microscope-based Raman spectroscopy. We further hypothesized that collagen crosslinking would be especially responsive to PTH treatment. Raman spectroscopy was performed on retrieved tibiae (6-7/group/time point) to quantify metrics associated with bone quality, including: mineral-to-matrix ratio, carbonate-to-phosphate ratio, mineral crystallinity, collagen crosslink (trivalent:divalent) ratio, and the mineral and matrix depolarization ratios. Irradiation disrupted the molecular structure and orientation of bone collagen, as evidenced by a higher collagen crosslink ratio and lower matrix depolarization ratio (vs. non-irradiated control bones), persisting until 12weeks post-irradiation. Radiation transiently affected the mineral phase, as evidenced by increased mineral crystallinity and mineral-to-matrix ratio at 4weeks compared to controls. Radiation decreased bone mineral depolarization ratios through 12weeks, indicating increased mineral alignment. PTH treatment partially attenuated radiation-induced increases in collagen crosslink ratio, but did not restore collagen or mineral alignment. These post-radiation matrix changes are consistent with our previous studies of radiation damage to bone, and suggest that the initial radiation damage to bone matrix has extensive effects on the quality of tissue deposited thereafter. In addition to maintaining bone quality, preventing initial radiation damage to the bone matrix (i.e. crosslink ratio, matrix orientation) may be critical to preventing late-onset fragility fractures.

  9. What Happens After Treatment for Bone Cancer?


    ... Cancer After Treatment What Happens After Treatment for Bone Cancer? For some people with bone cancer, treatment ... Treatment for Bone Cancer Stops Working More In Bone Cancer About Bone Cancer Causes, Risk Factors, and ...

  10. The Transcriptional Modulator Interferon-Related Developmental Regulator 1 in Osteoblasts Suppresses Bone Formation and Promotes Bone Resorption.


    Iezaki, Takashi; Onishi, Yuki; Ozaki, Kakeru; Fukasawa, Kazuya; Takahata, Yoshifumi; Nakamura, Yukari; Fujikawa, Koichi; Takarada, Takeshi; Yoneda, Yukio; Yamashita, Yui; Shioi, Go; Hinoi, Eiichi


    Bone homeostasis is maintained by the synergistic actions of bone-resorbing osteoclasts and bone-forming osteoblasts. Although interferon-related developmental regulator 1 (Ifrd1) has been identified as a transcriptional coactivator/repressor in various cells, little attention has been paid to its role in osteoblastogenesis and bone homeostasis thus far. Here, we show that Ifrd1 is a critical mediator of both the cell-autonomous regulation of osteoblastogenesis and osteoblast-dependent regulation of osteoclastogenesis. Osteoblast-specific deletion of murine Ifrd1 increased bone formation and decreased bone resorption, causing high bone mass. Ifrd1 deficiency enhanced osteoblast differentiation and maturation along with increased expression of Runx2 and osterix (Osx). Mechanistically, Ifrd1 deficiency increased the acetylation status of p65, a component of NF-κB, at residues K122 and K123 via the attenuation of the interaction between p65 and histone deacetylase (HDAC). This led to the nuclear export of p65 and a decrease in NF-κB-dependent Smad7 expression and the subsequent enhancement of Smad1/Smad5/Smad8-dependent transcription. Moreover, a high bone mass phenotype in the osteoblast-specific deletion of Ifrd1 was markedly rescued by the introduction of one Osx-floxed allele but not of Runx2-floxed allele. Coculture experiments revealed that Ifrd1-deficient osteoblasts have a higher osteoprotegerin (OPG) expression and a lower ability to support osteoclastogenesis. Ifrd1 deficiency attenuated the interaction between β-catenin and HDAC, subsequently increasing the acetylation of β-catenin at K49, leading to its nuclear accumulation and the activation of the β-catenin-dependent transcription of OPG. Collectively, the expression of Ifrd1 in osteoblasts repressed osteoblastogenesis and activated osteoclastogenesis through modulating the NF-κB/Smad/Osx and β-catenin/OPG pathways, respectively. These findings suggest that Ifrd1 has a pivotal role in bone

  11. Supplementation with green tea polyphenols improves bone microstructure and quality in aged, orchidectomized rats

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent studies show that green tea polyphenols (GTP) attenuate bone loss and microstructure deterioration in ovariectomized aged female rats, a model of postmenopausal osteoporosis. However, it is not known if such an osteo-protective role of GTP is demonstrable in androgen-deficient aged rats, a mo...

  12. Acoustic wave propagation in bovine cancellous bone: Application of the Modified Biot-Attenborough model

    NASA Astrophysics Data System (ADS)

    Lee, Kang Il; Roh, Heui-Seol; Yoon, Suk Wang


    Acoustic wave propagation in bovine cancellous bone is experimentally and theoretically investigated in the frequency range of 0.5-1 MHz. The phase velocity, attenuation coefficient, and broadband ultrasonic attenuation (BUA) of bovine cancellous bone are measured as functions of frequency and porosity. For theoretical estimation, the Modified Biot-Attenborough (MBA) model is employed with three new phenomenological parameters: the boundary condition, phase velocity, and impedance parameters. The MBA model is based on the idealization of cancellous bone as a nonrigid porous medium with circular cylindrical pores oriented normal to the surface. It is experimentally observed that the phase velocity is approximately nondispersive and the attenuation coefficient linearly increases with frequency. The MBA model predicts a slightly negative dispersion of phase velocity linearly with frequency and the nonlinear relationships of attenuation and BUA with porosity. The experimental results are in good agreement with the theoretical results estimated with the MBA model. It is expected that the MBA model can be usefully employed in the field of clinical bone assessment for the diagnosis of osteoporosis.

  13. Gallium scintigraphy in bone infarction. Correlation with bone imaging

    SciTech Connect

    Armas, R.R.; Goldsmith, S.J.


    The appearance of gallium-67 images in bone infarction was studied in nine patients with sickle cell disease and correlated with the bone scan findings. Gallium uptake in acute infarction was decreased or absent with a variable bone scan uptake, and normal in healing infarcts, which showed increased uptake on bone scan. The significance of these findings is discussed.


    PubMed Central



    Low bone mass (osteoporosis) is a silent epidemic of the 21st century, which presently in the UK results in over 200,000 fractures annually at a cost of over one billion pounds. Figures are set to increase worldwide. Understanding the factors which affect bone metabolism is thus of primary importance in order to establish preventative measures or treatments for this condition. Nutrition is an important determinant of bone health, but the effects of the individual nutrients and minerals, other than calcium, is little understood. Accumulating evidence over the last 30 years strongly suggest that dietary silicon is beneficial to bone and connective tissue health and we recently reported strong positive associations between dietary Si intake and bone mineral density in US and UK cohorts. The exact biological role(s) of silicon in bone health is still not clear, although a number of possible mechanisms have been suggested, including the synthesis of collagen and/or its stabilization, and matrix mineralization. This review gives an overview of this naturally occurring dietary element, its metabolism and the evidence of its potential role in bone health. PMID:17435952

  15. Silicon and bone health.


    Jugdaohsingh, R


    Low bone mass (osteoporosis) is a silent epidemic of the 21st century, which presently in the UK results in over 200,000 fractures annually at a cost of over one billion pounds. Figures are set to increase worldwide. Understanding the factors which affect bone metabolism is thus of primary importance in order to establish preventative measures or treatments for this condition. Nutrition is an important determinant of bone health, but the effects of the individual nutrients and minerals, other than calcium, is little understood. Accumulating evidence over the last 30 years strongly suggest that dietary silicon is beneficial to bone and connective tissue health and we recently reported strong positive associations between dietary Si intake and bone mineral density in US and UK cohorts. The exact biological role(s) of silicon in bone health is still not clear, although a number of possible mechanisms have been suggested, including the synthesis of collagen and/or its stabilization, and matrix mineralization. This review gives an overview of this naturally occurring dietary element, its metabolism and the evidence of its potential role in bone health.

  16. Representation of bone heterogeneity in subject-specific finite element models for knee.


    Au, Anthony G; Liggins, Adrian B; Raso, V James; Carey, Jason; Amirfazli, A


    Properly representing the heterogeneous distribution of bone tissue material properties is a key step in constructing subject-specific finite element (FE) bone models from computed tomography (CT) data. Conventional methods represent heterogeneity by subjectively grouping bone of similar attenuation together. A new technique characterizing the level of heterogeneity with an objective metric is presented. This technique identifies the minimal level of heterogeneity needed for an accurate FE model. Subject-specific models of the distal femur and proximal tibia were used in this study. An innovative application of an image processing technique in the context of material properties modeling was introduced to facilitate an objective grouping strategy, which gathered together bone based not only on density but also on location thus capturing the natural variation of bone density seen in CT images. A fully heterogeneous model containing unique material properties for each finite element was not necessary to generate an appropriate solution. Von Mises stress, strain energy density, and nodal displacements were predicted within 5% accuracy using a simplified FE femur model containing less than half the number of bone groups of the fully heterogeneous model. Each group contained attenuations varying less than 20% from the group mean. A substantial computational time savings of 60% was gained with the application of the new technique to assign bone mechanical properties.

  17. Ultrasonic wave propagation in trabecular bone predicted by the stratified model

    NASA Technical Reports Server (NTRS)

    Lin, W.; Qin, Y. X.; Rubin, C.


    The objective of this study was to investigate ultrasound propagation in trabecular bone by considering the wave reflection and transmission in a multilayered medium. The use of ultrasound to identify those at risk of osteoporosis is a promising diagnostic method providing a measure of bone mineral density (BMD). A stratified model was proposed to study the effect of transmission and reflection of ultrasound wave within the trabecular architecture on the relationship between ultrasound and BMD. The results demonstrated that ultrasound velocity in trabecular bone was highly correlated with the bone apparent density (r=0.97). Moreover, a consistent pattern of the frequency dependence of ultrasound attenuation coefficient has been observed between simulation using this model and experimental measurement of trabecular bone. The normalized broadband ultrasound attenuation (nBUA) derived from the simulation results revealed that nBUA was nonlinear with respect to trabecular porosity and BMD. The curve of the relationship between nBUA and BMD was parabolic in shape, and the peak magnitude of nBUA was observed at approximately 60% of bone porosity. These results agreed with the published experimental data and demonstrated that according to the stratified model, reflection and transmission were important factors in the ultrasonic propagation through the trabecular bone.

  18. Growth and bone development.


    Cooper, Cyrus; Harvey, Nicholas; Javaid, Kassim; Hanson, Mark; Dennison, Elaine


    Osteoporosis is a major cause of morbidity and mortality through its association with age-related fractures. Although most effort in fracture prevention has been directed at retarding the rate of age-related bone loss, and reducing the frequency and severity of trauma among elderly people, evidence is growing that peak bone mass is an important contributor to bone strength during later life. The normal patterns of skeletal growth have been well characterized in cross-sectional and longitudinal studies. It has been confirmed that boys have higher bone mineral content, but not volumetric bone density, than girls. Furthermore, there is a dissociation between the peak velocities for height gain and bone mineral accrual, in both genders. Puberty is the period during which volumetric density appears to increase in both axial and appendicular sites. Many factors influence the accumulation of bone mineral during childhood and adolescence, including heredity, gender, diet, physical activity, endocrine status, and sporadic risk factors such as cigarette smoking. In addition to these modifiable factors during childhood, evidence has also accrued that fracture risk might be programmed during intrauterine life. Epidemiological studies have demonstrated a relationship between birthweight, weight in infancy, and adult bone mass. This appears to be mediated through modulation of the set-point for basal activity of pituitary-dependent endocrine systems such as the hypothalamicpituitary-adrenal and growth hormone/insulin-like growth factor-1 axes. Maternal smoking, diet (particularly vitamin D deficiency), and physical activity also appear to modulate bone mineral acquisition during intrauterine life; furthermore, both low birth size and poor childhood growth are directly linked to the later risk of hip fracture. The optimization of maternal nutrition and intrauterine growth should also be included within preventive strategies against osteoporotic fracture, albeit for future

  19. Craniofacial bone tissue engineering.


    Wan, Derrick C; Nacamuli, Randall P; Longaker, Michael T


    Repair and reconstruction of the craniofacial skeleton represents a significant biomedical burden, with thousands of procedures per-formed annually secondary to injuries and congenital malformations. Given the multitude of current approaches, the need for more effective strategies to repair these bone deficits is apparent. This article explores two major modalities for craniofacial bone tissue engineering: distraction osteogenesis and cellular based therapies. Current understanding of the guiding principles for each of these modalities is elaborated on along with the knowledge gained from clinical and investigative studies. By laying this foundation, future directions for craniofacial distraction and cell-based bone engineering have emerged with great promise for the advancement of clinical practice.

  20. Bone graft substitutes.


    Bhatt, Reena A; Rozental, Tamara D


    Replacement of missing bone stock is a reconstructive challenge to upper extremity surgeons and decision-making with regards to available choices remains difficult. Preference is often given to autograft in the form of cancellous, cortical, or corticocancellous grafts from donor sites. However, the available volume from such donor sites is limited and fraught with potential complications. Advances in surgical management and medical research have produced a wide array of potential substances that can be used for bone graft substitute. Considerations in selecting bone grafts and substitutes include characteristic capabilities, availability, patient morbidity, immunogenicity, potential disease transmission, and cost variability.

  1. Paget Disease of Bone.


    Al-Rashid, Mamun; Ramkumar, Dipak B; Raskin, Kevin; Schwab, Joseph; Hornicek, Francis J; Lozano-Calderón, Santiago A


    The current understanding of Paget disease of bone (PDB) has vastly changed since Paget described the first case in 1877. Medical management of this condition remains the mainstay of treatment. Surgical intervention is usually only used in fractures through pagetic bone, need for realignment to correct deformity in major long bones, prophylactic treatment of impending fractures, joint arthroplasty in severe arthritis, or spinal decompression in cases of bony compression of neural elements. Advances in surgical technique have allowed early return to function and mobilization. Despite medical and surgical intervention, a small subset of patients with PDB develops Paget sarcoma.

  2. Hypothermic anesthesia attenuates postoperative proteolysis.

    PubMed Central

    Johnson, D J; Brooks, D C; Pressler, V M; Hulton, N R; Colpoys, M F; Smith, R J; Wilmore, D W


    The catabolic response that commonly occurs after major operation is characterized by net skeletal muscle proteolysis and accelerated nitrogen excretion. This response was absent in patients undergoing cardiac surgical procedures associated with the combination of cardiopulmonary bypass, narcotic anesthesia, neuromuscular blockade, and hypothermia. Forearm nitrogen release was 422 +/- 492 nmol/100 ml X min on the first postoperative day, approximately 25% of preoperative values (1677 +/- 411, p less than 0.05). Nitrogen excretion and the degree of negative nitrogen balance were comparable to levels observed in nonstressed, fasting subjects. The potential role of hypothermia, high-dose fentanyl anesthesia, and neuromuscular blockade in modifying the catabolic response to laparotomy and retroperitoneal dissection was further evaluated in animal studies. Six hours after operation, amino acid nitrogen release from the hindquarter was 84% less than control values (p less than 0.05). Nitrogen excretion and urea production were also reduced compared to normothermic controls. It is concluded that the combination of hypothermia, narcotic anesthesia, and neuromuscular blockade attenuates the catabolic response to injury and thus may be useful in the care of critically ill surgical patients. PMID:3767477

  3. Nitrogen narcosis attenuates shivering thermogenesis.


    Mekjavić, I B; Savić, S A; Eiken, O


    Thermoregulatory responses of eight healthy subjects (six men and two women) were compared when they were head-out immersed in 15 degrees C water at both 1 and 6 ATA. Both trials were conducted in a hyperbaric chamber. During the immersions, esophageal temperature (T(es)) and skin temperature at two sites (chest and calf) were recorded at minute intervals. Oxygen uptake was determined at 5-min intervals with the Douglas bag method. The order of the two trials was alternated. The rate of T(es) cooling was greater during the 6-ATA trial [2.1 +/- 0.5 degrees C/h (SE)] than during the 1-ATA trial (1.3 +/- 0.5 degrees C/h; P < 0.01). Despite the greater rate of core cooling, and presumably a greater thermal drive for shivering, the oxygen uptake response for a similar decrement in T(es) was lower during exposure to 6 than to 1 ATA (P < 0.05). Also, for similar displacement in T(es), the subjects perceived the immersions at 6 ATA to be less cold than those at 1 ATA (P < 0.05). It is concluded that the development of hypothermia in compressed-air divers may be due, in large part, to the attenuation of heat production and cold perception. Most likely, the observed effects on the autonomic responses and thermal perception are due to an inhibitory action of hyperbaric nitrogen on central neural structures involved in temperature regulation.

  4. Investigation of a dual modal method for bone pathologies using quantitative ultrasound and photoacoustics

    NASA Astrophysics Data System (ADS)

    Steinberg, Idan; Gannot, Israel; Eyal, Avishay


    Osteoporosis is a widespread disease that has a catastrophic impact on patient's lives and overwhelming related healthcare costs. In recent works, we have developed a multi-spectral, frequency domain photoacoustic method for the evaluation of bone pathologies. This method has great advantages over pure ultrasonic or optical methods as it provides both molecular information from the bone absorption spectrum and bone mechanical status from the characteristics of the ultrasound propagation. These characteristics include both the Speed of Sound (SOS) and Broadband Ultrasonic Attenuation (BUA). To test the method's quantitative predictions, we have constructed a combined ultrasound and photoacoustic setup. Here, we experimentally present a dual modality system, and compares between the methods on bone samples in-vitro. The differences between the two modalities are shown to provide valuable insight into the bone structure and functional status.

  5. Dependence of Long Bone Flexural Properties on Bone Mineral Distribution

    NASA Technical Reports Server (NTRS)

    Katz, BethAnn; Cleek, Tammy M.; Whalen, Robert T.; Connolly, James P. (Technical Monitor)


    The objective of this study is to assess whether a non-invasive determination of long bone cross-sectional areal properties using bone densitometry accurately estimates true long bone flexural properties. In this study, section properties of two pairs of human female embalmed tibiae were compared using two methods: special analysis of bone densitometry data, and experimental determination of flexural regidities from bone surface strain measurements during controlled loading.

  6. Bone Grafts in Craniofacial Surgery

    PubMed Central

    Elsalanty, Mohammed E.; Genecov, David G.


    Reconstruction of cranial and maxillofacial defects is a challenging task. The standard reconstruction method has been bone grafting. In this review, we shall describe the biological principles of bone graft healing, as pertinent to craniofacial reconstruction. Different types and sources of bone grafts will be discussed, as well as new methods of bone defect reconstruction. PMID:22110806

  7. Aspiration and Biopsy: Bone Marrow


    ... Your 1- to 2-Year-Old Aspiration and Biopsy: Bone Marrow KidsHealth > For Parents > Aspiration and Biopsy: Bone Marrow A A A What's in this ... ósea What It Is Bone marrow aspirations and biopsies are performed to examine bone marrow, the spongy ...

  8. Aspiration and Biopsy: Bone Marrow


    ... A Week of Healthy Breakfasts Shyness Aspiration and Biopsy: Bone Marrow KidsHealth > For Teens > Aspiration and Biopsy: Bone Marrow A A A What's in this ... Questions What It Is Bone marrow aspirations and biopsies are performed to examine bone marrow, the spongy ...

  9. Paget disease of the bone


    ... that may indicate Paget disease include: Bone scan Bone x-ray Elevated markers of bone breakdown (for example, N-telopeptide) This disease may ... of Paget disease. Alternative Names Osteitis deformans Images ... X-ray References Ralston SH. Paget disease of bone. In: Goldman L, Schafer AI, eds. Goldman's Cecil ...

  10. Instrumentation for bone density measurement

    NASA Technical Reports Server (NTRS)

    Meharg, L. S.


    Measurement system evaluates the integrated bone density over a specific cross section of bone. A digital computer converts stored bone scan data to equivalent aluminum calibration wedge thickness, and bone density is then integrated along the scan by using the trapezoidal approximation integration formula.

  11. Bone Cancer: Questions and Answers


    ... Are there different types of primary bone cancer? Yes. Cancer can begin in any type of bone tissue. Bones are made up ... follow-up treatment necessary? What does it involve? Yes. Bone cancer ... and should report any unusual symptoms right away. Follow-up varies for ...

  12. Prediction of trabecular bone qualitative properties using scanning quantitative ultrasound

    NASA Astrophysics Data System (ADS)

    Qin, Yi-Xian; Lin, Wei; Mittra, Erik; Xia, Yi; Cheng, Jiqi; Judex, Stefan; Rubin, Clint; Müller, Ralph


    Microgravity induced bone loss represents a critical health problem in astronauts, particularly occurred in weight-supporting skeleton, which leads to osteopenia and increase of fracture risk. Lack of suitable evaluation modality makes it difficult for monitoring skeletal status in long term space mission and increases potential risk of complication. Such disuse osteopenia and osteoporosis compromise trabecular bone density, and architectural and mechanical properties. While X-ray based imaging would not be practical in space, quantitative ultrasound may provide advantages to characterize bone density and strength through wave propagation in complex trabecular structure. This study used a scanning confocal acoustic diagnostic and navigation system (SCAN) to evaluate trabecular bone quality in 60 cubic trabecular samples harvested from adult sheep. Ultrasound image based SCAN measurements in structural and strength properties were validated by μCT and compressive mechanical testing. This result indicated a moderately strong negative correlations observed between broadband ultrasonic attenuation (BUA) and μCT-determined bone volume fraction (BV/TV, R2=0.53). Strong correlations were observed between ultrasound velocity (UV) and bone's mechanical strength and structural parameters, i.e., bulk Young's modulus (R2=0.67) and BV/TV (R2=0.85). The predictions for bone density and mechanical strength were significantly improved by using a linear combination of both BUA and UV, yielding R2=0.92 for BV/TV and R2=0.71 for bulk Young's modulus. These results imply that quantitative ultrasound can characterize trabecular structural and mechanical properties through measurements of particular ultrasound parameters, and potentially provide an excellent estimation for bone's structural integrity.

  13. Prediction of trabecular bone qualitative properties using scanning quantitative ultrasound.


    Qin, Yi-Xian; Lin, Wei; Mittra, Erik; Xia, Yi; Cheng, Jiqi; Judex, Stefan; Rubin, Clint; Müller, Ralph


    Microgravity induced bone loss represents a critical health problem in astronauts, particularly occurred in weight-supporting skeleton, which leads to osteopenia and increase of fracture risk. Lack of suitable evaluation modality makes it difficult for monitoring skeletal status in long term space mission and increases potential risk of complication. Such disuse osteopenia and osteoporosis compromise trabecular bone density, and architectural and mechanical properties. While X-ray based imaging would not be practical in space, quantitative ultrasound may provide advantages to characterize bone density and strength through wave propagation in complex trabecular structure. This study used a scanning confocal acoustic diagnostic and navigation system (SCAN) to evaluate trabecular bone quality in 60 cubic trabecular samples harvested from adult sheep. Ultrasound image based SCAN measurements in structural and strength properties were validated by μCT and compressive mechanical testing. This result indicated a moderately strong negative correlations observed between broadband ultrasonic attenuation (BUA) and μCT-determined bone volume fraction (BV/TV, R(2)=0.53). Strong correlations were observed between ultrasound velocity (UV) and bone's mechanical strength and structural parameters, i.e., bulk Young's modulus (R(2)=0.67) and BV/TV (R(2)=0.85). The predictions for bone density and mechanical strength were significantly improved by using a linear combination of both BUA and UV, yielding R(2)=0.92 for BV/TV and R(2)=0.71 for bulk Young's modulus. These results imply that quantitative ultrasound can characterize trabecular structural and mechanical properties through measurements of particular ultrasound parameters, and potentially provide an excellent estimation for bone's structural integrity.

  14. Strontium ranelate reduces cartilage degeneration and subchondral bone remodeling in rat osteoarthritis model

    PubMed Central

    Yu, De-gang; Ding, Hui-feng; Mao, Yuan-qing; Liu, Ming; Yu, Bo; Zhao, Xin; Wang, Xiao-qing; Li, Yang; Liu, Guang-wang; Nie, Shao-bo; Liu, Shen; Zhu, Zhen-an


    Aim: To investigate whether strontium ranelate (SR), a new antiosteoporotic agent, could attenuate cartilage degeneration and subchondral bone remodeling in osteoarthritis (OA). Methods: Medial meniscal tear (MMT) operation was performed in adult SD rats to induce OA. SR (625 or 1800 mg·kg−1·d−1) was administered via gavage for 3 or 6 weeks. After the animals were sacrificed, articular cartilage degeneration was evaluated using toluidine blue O staining, SOX9 immunohistochemistry and TUNEL assay. The changes in microarchitecture indices and tissue mineral density (TMD), chemical composition (mineral-to-collagen ratio), and intrinsic mechanical properties of the subchondral bones were measured using micro-CT scanning, confocal Raman microspectroscopy and nanoindentation testing, respectively. Results: The high-dose SR significantly attenuated cartilage matrix and chondrocyte loss at 6 weeks, and decreased chondrocyte apoptosis, improved the expression of SOX9, a critical transcription factor responsible for the expression of anabolic genes type II collagen and aggrecan, at both 3 and 6 weeks. Meanwhile, the high-dose SR also significantly attenuated the subchondral bone remodeling at both 3 and 6 weeks, as shown by the improved microarchitecture indices, TMD, mineral-to-collagen ratio and intrinsic mechanical properties. In contrast, the low-dose SR did not significantly change all the detection indices of cartilage and bone at both 3 and 6 weeks. Conclusion: The high-dose SR treatment can reduce articular cartilage degeneration and subchondral bone remodeling in the rat MMT model of OA. PMID:23334238

  15. Natural attenuation general data guide. Final report

    SciTech Connect

    Kram, M.L.; Goetz, F.


    This guide is a decision-making tool to help remedial project managers (RPMs) determine whether natural attenuation can be used as a remedial option at contaminant release sites. Data requirements and methodology to evaluate the potential for using natural attenuation are presented. For sites where the natural attenuation remedial option is implemented, tables of commonly measured parameters, general data collection rationale, and interpretation guidance are included. This format allows the RPM to recognize data gaps, interpret data, construct a conceptual site model, and develop a sampling and analysis plan for evaluation and monitoring purposes.

  16. What Is Bone Cancer?


    ... in parts of the face. The trachea (windpipe), larynx (voice box), and the outer part of the ... bone. Occasionally, chondrosarcoma will develop in the trachea, larynx, and chest wall. Other sites are the scapula ( ...

  17. Healthy Bones Matter


    ... keep my bones more healthy? Definitions What can go wrong? Reprinted from The Surgeon General’s Report on ... women who don’t smoke, and they often go through menopause earlier. Smokers also may absorb less ...

  18. Bone marrow biopsy


    ... myelodysplastic syndrome; MDS) A nerve tissue tumor called neuroblastoma Bone marrow disease that leads to an abnormal ... Hairy cell leukemia Hodgkin lymphoma Multiple myeloma Myelofibrosis Neuroblastoma Non-Hodgkin lymphoma Platelet count Polycythemia vera Primary ...

  19. Bone mineral density test


    ... density test; Bone densitometry; DEXA scan; DXA; Dual-energy x-ray absorptiometry; p-DEXA; Osteoporosis-BMD ... most common and accurate way uses a dual-energy x-ray absorptiometry (DEXA) scan. DEXA uses low- ...

  20. Bone pain or tenderness


    ... 13. Weber TJ. Osteoporosis. In: Goldman L, Schafer AI, eds. Goldman's Cecil Medicine . 25th ed. Philadelphia, PA: ... other disorders of bone. In: Goldman L, Schafer AI, eds. Goldman's Cecil Medicine . 25th ed. Philadelphia, PA: ...

  1. Bone Densitometry in Children.


    Adams, Judith E


    Maximizing peak bone mass in childhood is relevant to optimizing bone health in later life, so the study of the skeleton in children in health and disease is important. Dual-energy X-ray absorptiometry (DXA) is the most widely used clinical tool for the assessment of bone status in children. Technological developments in DXA enable vertebral fracture assessment at much lower ionizing radiation doses than spinal radiographs. Quantitative computed tomography remains predominantly a research tool but has some advantages over DXA in not being size dependent. High-resolution peripheral computed tomography measures trabecular and cortical bone microstructure but is technically challenging, particularly in children, and not widely available, so it is unlikely to be used in clinical practice. Other quantitative techniques (quantitative magnetic resonance imaging, digital X-ray absorptiometry, quantitative ultrasound) have been applied in children but remain research applications, and they are only covered briefly in this review.

  2. Bone Loss in IBD


    ... individuals who have used corticosteroids for some time. VITAMIN D DEFICIENCY Vitamin D is necessary for the absorption of calcium. ... small bowel involvement—are at increased risk for vitamin D deficiency. This, in turn, may result in bone loss ...

  3. Alcohol and bone.


    Mikosch, Peter


    Alcohol is widely consumed across the world in different cultural and social settings. Types of alcohol consumption differ between (a) light, only occasional consumption, (b) heavy chronic alcohol consumption, and (c) binge drinking as seen as a new pattern of alcohol consumption among teenagers and young adults. Heavy alcohol consumption is detrimental to many organs and tissues, including bones. Osteoporosis is regularly mentioned as a secondary consequence of alcoholism, and chronic alcohol abuse is established as an independent risk factor for osteoporosis. The review will present the different mechanisms and effects of alcohol intake on bone mass, bone metabolism, and bone strength, including alcoholism-related "life-style factors" such as malnutrition, lack of exercise, and hormonal changes as additional causative factors, which also contribute to the development of osteoporosis due to alcohol abuse.

  4. Bone x-ray


    ... not being scanned. Alternative Names X-ray - bone Images Skeleton Skeletal spine Osteogenic sarcoma - x-ray References ... URAC's accreditation program is an independent audit to verify that A.D.A.M. follows ...

  5. Bone Loss in IBD


    ... individuals who have used corticosteroids for some time. VITAMIN D DEFICIENCY Vitamin D is necessary for the absorption of calcium. ... are critical for building healthy bone. Because this vitamin is absorbed in the small intestine, people with ...

  6. Children with Brittle Bones.

    ERIC Educational Resources Information Center

    Alston, Jean


    Special help given to children with Osteogenesis Imperfecta (brittle bone disease) is described, including adapted equipment to allow for writing and use of a classroom assistant to aid participation in a regular classroom. (CL)

  7. What causes bone loss?


    ... Any treatment or condition that causes calcium or vitamin D to be poorly absorbed can also lead to weak bones. Some of these are: Gastric bypass (weight-loss surgery) Cystic fibrosis Other conditions that ...

  8. What Is Bone?


    ... during your bone-building years. Women, Men, and Osteoporosis Women are more likely than men to develop ... loss and a greater risk of developing osteoporosis. Osteoporosis Prevention Osteoporosis is preventable for many people. Prevention ...

  9. Reduction of bone strength

    NASA Technical Reports Server (NTRS)

    Bingham, Cindy


    Viewgraphs on reduction of bone strength are presented. WEHI 231 B growth rates, experimental chambers used to apply the electric field to the cell cultures, and a mouse suspended by rotating cuff in electromagnetic field are shown.

  10. Small Animal Bone Biomechanics

    PubMed Central

    Vashishth, Deepak


    Animal models, in particular mice, offer the possibility of naturally achieving or genetically engineering a skeletal phenotype associated with disease and conducting destructive fracture tests on bone to determine the resulting change in bone’s mechanical properties. Several recent developments, including nano- and micro- indentation testing, microtensile and microcompressive testing, and bending tests on notched whole bone specimens, offer the possibility to mechanically probe small animal bone and investigate the effects of aging, therapeutic treatments, disease, and genetic variation. In contrast to traditional strength tests on small animal bones, fracture mechanics tests display smaller variation and therefore offer the possibility of reducing sample sizes. This article provides an analysis of what such tests measure and proposes methods to reduce errors associated with testing smaller than ideal specimens. PMID:18672104

  11. [Incretin and bone].


    Yamada, Yuichiro


    Gastrointestinal hormones including gastric inhibitory polypeptide (GIP) and glucagon-like peptide (GLP) -1 are incretin, which are secreted immediately after meal ingestion and stimulate insulin secretion from pancreatic beta-cells. Characterization of extra-pancreatic GIP and GLP-1 receptors has revealed that these hormones regulate bone turnover. GIP intermittently stimulates osteoblasts and GLP-1 suppresses osteoclasts through a calcitonin-dependent pathway to increase the bone volume.

  12. Bone morphogenetic protein

    SciTech Connect

    Xiao Yongtao; Xiang Lixin; Shao Jianzhong


    Bone morphogenetic proteins (BMPs) are multi-functional growth factors belonging to the transforming growth factor-beta superfamily. It has been demonstrated that BMPs had been involved in the regulation of cell proliferation, survival, differentiation and apoptosis. However, their hallmark ability is that play a pivotal role in inducing bone, cartilage, ligament, and tendon formation at both heterotopic and orthotopic sites. In this review, we mainly concentrate on BMP structure, function, molecular signaling and potential medical application.

  13. Short-term pyrrolidine dithiocarbamate administration attenuates cachexia-induced alterations to muscle and liver in ApcMin/+ mice

    PubMed Central

    VanderVeen, Brandon N.; Enos, Reilly T.; Murphy, E. Angela; Carson, James A.


    Cancer cachexia is a complex wasting condition characterized by chronic inflammation, disrupted energy metabolism, and severe muscle wasting. While evidence in pre-clinical cancer cachexia models have determined that different systemic inflammatory inhibitors can attenuate several characteristics of cachexia, there is a limited understanding of their effects after cachexia has developed, and whether short-term administration is sufficient to reverse cachexia-induced signaling in distinctive target tissues. Pyrrolidine dithiocarbamate (PDTC) is a thiol compound having anti-inflammatory and antioxidant properties which can inhibit STAT3 and nuclear factor κB (NF-κB) signaling in mice. This study examined the effect of short-term PDTC administration to ApcMin/+ mice on cachexia-induced disruption of skeletal muscle protein turnover and liver metabolic function. At 16 weeks of age ApcMin/+ mice initiating cachexia (7% BW loss) were administered PDTC (10mg/kg bw/d) for 2 weeks. Control ApcMin/+ mice continued to lose body weight during the treatment period, while mice receiving PDTC had no further body weight decrease. PDTC had no effect on either intestinal tumor burden or circulating IL-6. In muscle, PDTC rescued signaling disrupting protein turnover regulation. PDTC suppressed the cachexia induction of STAT3, increased mTORC1 signaling and protein synthesis, and suppressed the induction of Atrogin-1 protein expression. Related to cachectic liver metabolic function, PDTC treatment attenuated glycogen and lipid content depletion independent to the activation of STAT3 and mTORC1 signaling. Overall, these results demonstrate short-term PDTC treatment to cachectic mice attenuated cancer-induced disruptions to muscle and liver signaling, and these changes were independent to altered tumor burden and circulating IL-6. PMID:27449092

  14. Magnetic resonance imaging-guided attenuation correction in whole-body PET/MRI using a sorted atlas approach.


    Arabi, Hossein; Zaidi, Habib


    Quantitative whole-body PET/MR imaging is challenged by the lack of accurate and robust strategies for attenuation correction. In this work, a new pseudo-CT generation approach, referred to as sorted atlas pseudo-CT (SAP), is proposed for accurate extraction of bones and estimation of lung attenuation properties. This approach improves the Gaussian process regression (GPR) kernel proposed by Hofmann et al. which relies on the information provided by a co-registered atlas (CT and MRI) using a GPR kernel to predict the distribution of attenuation coefficients. Our approach uses two separate GPR kernels for lung and non-lung tissues. For non-lung tissues, the co-registered atlas dataset was sorted on the basis of local normalized cross-correlation similarity to the target MR image to select the most similar image in the atlas for each voxel. For lung tissue, the lung volume was incorporated in the GPR kernel taking advantage of the correlation between lung volume and corresponding attenuation properties to predict the attenuation coefficients of the lung. In the presence of pathological tissues in the lungs, the lesions are segmented on PET images corrected for attenuation using MRI-derived three-class attenuation map followed by assignment of soft-tissue attenuation coefficient. The proposed algorithm was compared to other techniques reported in the literature including Hofmann's approach and the three-class attenuation correction technique implemented on the Philips Ingenuity TF PET/MR where CT-based attenuation correction served as reference. Fourteen patients with head and neck cancer undergoing PET/CT and PET/MR examinations were used for quantitative analysis. SUV measurements were performed on 12 normal uptake regions as well as high uptake malignant regions. Moreover, a number of similarity measures were used to evaluate the accuracy of extracted bones. The Dice similarity metric revealed that the extracted bone improved from 0.58 ± 0.09 to 0.65 ± 0.07 when


    PubMed Central

    Midura, Ronald J.; Midura, Sharon B.; Su, Xiaowei; Gorski, Jeffrey P.


    In long bone diaphyses, woven bone forms first and then transitions into a more mineralized compact bone tissue. Prior evidence suggests that the non-collagenous protein composition of woven bone may be distinct from that of more mature bone tissue, particularly with respect to a diverse group of phosphorylated, extracellular matrix proteins. To critically test this hypothesis, we developed an in situ approach to isolate newly formed bone from more mature bone within the same long bone, and combine this anatomical approach with Western blotting to make relative comparisons of 7 phosphorylated matrix proteins important for bone physiology and biomineralization. Interestingly, 75 kDa bone sialoprotein (BSP), 63 kDa osteopontin, and the 75 kDa form of bone acidic glycoprotein-75 (BAG-75) were enriched in primary bone as opposed to more mature cortical bone, while osteonectin, fetuin A, matrix extracellular phosphoglycoprotein (MEPE) and dentin matrix protein-1 (DMP-1) appeared to be equally distributed between these two bone tissue compartments. Analyses also revealed the presence of larger sized forms of osteopontin (and to a lesser degree BSP) mostly in newly formed bone, while larger forms of BAG-75 were mostly detected in more mature cortical bone. Smaller sized forms of DMP-1 and BAG-75 were detected in both newly formed and more mature bone tissue extracts, and they are likely the result of proteolytic processing in vivo. Intact DMP-1 (97 kDa) was only detected in unmineralized matrix extracts. These findings indicate that newly formed bone exhibits a non-collagenous matrix protein composition distinct from that of more mature compact bone even within the same long bone, and suggest that the temporal fate of individual non-collagenous proteins is variable in growing bone. PMID:21958842

  16. PTH prevents the adverse effects of focal radiation on bone architecture in young rats

    PubMed Central

    Chandra, Abhishek; Lan, Shenghui; Zhu, Ji; Lin, Tiao; Zhang, Xianrong; Siclari, Valerie A.; Altman, Allison R.; Cengel, Keith A.; Liu, X. Sherry; Qin, Ling


    Radiation therapy is a common treatment regimen for cancer patients. However, its adverse effects on the neighboring bone could lead to fractures with a great impact on quality of life. The underlying mechanism is still elusive and there is no preventive or curative solution for this bone loss. Parathyroid hormone (PTH) is a current therapy for osteoporosis that has potent anabolic effects on bone. In this study, we found that focal radiation from frequent scans of the right tibiae in 1-month-old rats by micro-computed tomography severely decreased trabecular bone mass and deteriorated bone structure. Interestingly, PTH daily injections remarkably improved trabecular bone in the radiated tibiae with increases in trabecular number, thickness, connectivity, structure model index and stiffness, and a decrease in trabecular separation. Histomorphometric analysis revealed that radiation mainly decreased the number of osteoblasts and impaired their mineralization activity but had little effects on osteoclasts. PTH reversed these adverse effects and greatly increased bone formation to a similar level in both radiated and non-radiated bones. Furthermore, PTH protects bone marrow mesenchymal stem cells from radiation-induced damage, including a decrease in number and an increase in adipogenic differentiation. While radiation generated the same amount of free radicals in the bone marrow of vehicle-treated and PTH-treated animals, the percentage of apoptotic bone marrow cells was significantly attenuated in the PTH group. Taken together, our data demonstrate a radioprotective effect of PTH on bone structure and bone marrow and shed new light on a possible clinical application of anabolic treatment in radiotherapy. PMID:23466454

  17. Effects of pioglitazone and fenofibrate co-administration on bone biomechanics and histomorphometry in ovariectomized rats.


    Smith, Susan Y; Samadfam, Rana; Chouinard, Luc; Awori, Malaika; Bénardeau, Agnes; Bauss, Frieder; Guldberg, Robert E; Sebokova, Elena; Wright, Matthew B


    Pioglitazone, the peroxisome proliferator-activated receptor-gamma (PPAR-γ) agonist is an effective therapy for type 2 diabetes, but has been associated with increased risk for bone fracture. Preclinical studies suggest that PPAR-α agonists (e.g., fenofibrate) increase bone mineral density/content, although clinical data on bone effects of fibrates are lacking. We investigated the effects of pioglitazone (10 mg/kg/day) and fenofibrate (25 mg/kg/day) on bone strength and bone histomorphometric parameters in osteopenic ovariectomized (OVX) rats. An additional group of rats received a combination of pioglitazone + fenofibrate to mimic the effects of a dual PPAR-α/γ agonist. The study consisted of a 13-week treatment phase followed by a 6-week treatment-free recovery period. Pioglitazone significantly reduced biomechanical strength at the lumbar spine and femoral neck compared with rats administered fenofibrate. Co-treatment with pioglitazone + fenofibrate had no significant effect on bone strength in comparison with OVX vehicle controls. Histomorphometric analysis of the proximal tibia revealed that pioglitazone suppressed bone formation and increased bone resorption at both cancellous and cortical bone sites relative to OVX vehicle controls. In contrast, fenofibrate did not affect bone resorption and only slightly suppressed bone formation. Discontinuation of pioglitazone treatment, both in the monotherapy and in the combination therapy arms, resulted in restoration of bone formation and resorption rates, demonstrating reversibility of effects. The above data support the concept that dual activation of PPAR-γ and PPAR-α attenuates the negative effects of PPAR-γ agonism on bone strength.

  18. Systems analysis of bone.


    Jepsen, Karl J


    The genetic variants contributing to variability in skeletal traits has been well studied, and several hundred QTLs have been mapped and several genes contributing to trait variation have been identified. However, many questions remain unanswered. In particular, it is unclear whether variation in a single gene leads to alterations in function. Bone is a highly adaptive system and genetic variants affecting one trait are often accompanied by compensatory changes in other traits. The functional interactions among traits, which is known as phenotypic integration, has been observed in many biological systems, including bone. Phenotypic integration is a property of bone that is critically important for establishing a mechanically functional structure that is capable of supporting the forces imparted during daily activities. In this paper, bone is reviewed as a system and primarily in the context of functionality. A better understanding of the system properties of bone will lead to novel targets for future genetic analyses and the identification of genes that are directly responsible for regulating bone strength. This systems analysis has the added benefit of leaving a trail of valuable information about how the skeletal system works. This information will provide novel approaches to assessing skeletal health during growth and aging and for developing novel treatment strategies to reduce the morbidity and mortality associated with fragility fractures.

  19. Bone nutrients for vegetarians.


    Mangels, Ann Reed


    The process of bone mineralization and resorption is complex and is affected by numerous factors, including dietary constituents. Although some dietary factors involved in bone health, such as calcium and vitamin D, are typically associated with dairy products, plant-based sources of these nutrients also supply other key nutrients involved in bone maintenance. Some research suggests that vegetarian diets, especially vegan diets, are associated with lower bone mineral density (BMD), but this does not appear to be clinically significant. Vegan diets are not associated with an increased fracture risk if calcium intake is adequate. Dietary factors in plant-based diets that support the development and maintenance of bone mass include calcium, vitamin D, protein, potassium, and soy isoflavones. Other factors present in plant-based diets such as oxalic acid and phytic acid can potentially interfere with absorption and retention of calcium and thereby have a negative effect on BMD. Impaired vitamin B-12 status also negatively affects BMD. The role of protein in calcium balance is multifaceted. Overall, calcium and protein intakes in accord with Dietary Reference Intakes are recommended for vegetarians, including vegans. Fortified foods are often helpful in meeting recommendations for calcium and vitamin D. Plant-based diets can provide adequate amounts of key nutrients for bone health.

  20. Boning up on autophagy

    PubMed Central

    Shapiro, Irving M; Layfield, Robert; Lotz, Martin; Settembre, Carmine; Whitehouse, Caroline


    From an evolutionary perspective, the major function of bone is to provide stable sites for muscle attachment and affording protection of vital organs, especially the heart and lungs (ribs) and spinal cord (vertebrae and intervertebral discs). However, bone has a considerable number of other functions: serving as a store for mineral ions, providing a site for blood cell synthesis and participating in a complex system-wide endocrine system. Not surprisingly, bone and cartilage cell homeostasis is tightly controlled, as is the maintenance of tissue structure and mass. While a great deal of new information is accruing concerning skeletal cell homeostasis, one relatively new observation is that the cells of bone (osteoclasts osteoblasts and osteocytes) and cartilage (chondrocytes) exhibit autophagy. The focus of this review is to examine the significance of this process in terms of the functional demands of the skeleton in health and during growth and to provide evidence that dysregulation of the autophagic response is involved in the pathogenesis of diseases of bone (Paget disease of bone) and cartilage (osteoarthritis and the mucopolysaccharidoses). Delineation of molecular changes in the autophagic process is uncovering new approaches for the treatment of diseases that affect the axial and appendicular skeleton. PMID:24225636

  1. Bone Remodeling Monitor

    NASA Technical Reports Server (NTRS)

    Foucar, Charlie; Goldberg, Leslie; Hon, Bodin; Moore, Shannon; Williams, Evan


    The impact of bone loss due to different mechanical loadings in microgravity is a major concern for astronauts upon reintroduction to gravitational forces in exploration missions to the Moon and Mars. it has been shown that astronauts not only lose bone at differing rates, with levels up to 2% per month, but each astronaut will respond to bone loss treatments differently. Pre- and post-flight imaging techniques and frozen urine samples for post-flight laboratory immunoassays To develop a novel, non-invasive, highly . sensitive, portable, intuitive, and low-powered device to measure bone resorption levels in 'real time' to provide rapid and Individualized feedback to maximize the efficacy of bone loss countermeasures 1. Collect urine specimen and analyze the level of bone resorption marker, DPD (deoxypridinoline) excreted. 2. Antibodies specific to DPD conjugated with nanoshells and mixed with specimen, the change in absorbance from agglutination is measured by an optical device. 3. The concentration of DPD is displayed and recorded on a PDA

  2. Endochondral bone growth, bone calcium accretion, and bone mineral density: how are they related?


    Wongdee, Kannikar; Krishnamra, Nateetip; Charoenphandhu, Narattaphol


    Endochondral bone growth in young growing mammals or adult mammals with persistent growth plates progresses from proliferation, maturation and hypertrophy of growth plate chondrocytes to mineralization of cartilaginous matrix to form an osseous tissue. This complex process is tightly regulated by a number of factors with different impacts, such as genetics, endocrine/paracrine factors [e.g., PTHrP, 1,25(OH)(2)D(3), IGF-1, FGFs, and prolactin], and nutritional status (e.g., dietary calcium and vitamin D). Despite a strong link between growth plate function and elongation of the long bone, little is known whether endochondral bone growth indeed determines bone calcium accretion, bone mineral density (BMD), and/or peak bone mass. Since the process ends with cartilaginous matrix calcification, an increase in endochondral bone growth typically leads to more calcium accretion in the primary spongiosa and thus higher BMD. However, in lactating rats with enhanced trabecular bone resorption, bone elongation is inversely correlated with BMD. Although BMD can be increased by factors that enhance endochondral bone growth, the endochondral bone growth itself is unlikely to be an important determinant of peak bone mass since it is strongly determined by genetics. Therefore, endochondral bone growth and bone elongation are associated with calcium accretion only in a particular subregion of the long bone, but do not necessarily predict BMD and peak bone mass.

  3. [Applicability of laser-based geological techniques in bone research: analysis of calcium oxide distribution in thin-cut animal bones].


    Andrássy, László; Maros, Gyula; Kovács, István János; Horváth, Ágnes; Gulyás, Katalin; Bertalan, Éva; Besnyi, Anikó; Füri, Judit; Fancsik, Tamás; Szekanecz, Zoltán; Bhattoa, Harjit Pal


    The structural similarities between the inorganic component of bone tissue and geological formations make it possible that mathematic models may be used to determine weight percentage composition of different mineral element oxides constituting the inorganic component of bone tissue. The determined weight percentage composition can be verified with the determination of element oxide concentration values by laser induced plasma spectroscopy and inductively coupled plasma optical emission spectrometry. It can be concluded from calculated weight percentage composition of the inorganic component of bone tissue and laboratory analyses that the properties of bone tissue are determined primarily by hydroxylapatite. The inorganic bone structure can be studied well by determining the calcium oxide concentration distribution using the laser induced plasma spectroscopy technique. In the present study, thin polished bone slides prepared from male bovine tibia were examined with laser induced plasma spectroscopy in a regular network and combined sampling system to derive the calculated calcium oxide concentration distribution. The superficial calcium oxide concentration distribution, as supported by "frequency distribution" curves, can be categorized into a number of groups. This, as such, helps in clearly demarcating the cortical and trabecular bone structures. Following analyses of bovine tibial bone, the authors found a positive association between the attenuation value, as determined by quantitative computer tomography and the "ρ" density, as used in geology. Furthermore, the calculated "ρ" density and the measured average calcium oxide concentration values showed inverse correlation.

  4. The finite element method for micro-scale modeling of ultrasound propagation in cancellous bone.


    Vafaeian, B; El-Rich, M; El-Bialy, T; Adeeb, S


    Quantitative ultrasound for bone assessment is based on the correlations between ultrasonic parameters and the properties (mechanical and physical) of cancellous bone. To elucidate the correlations, understanding the physics of ultrasound in cancellous bone is demanded. Micro-scale modeling of ultrasound propagation in cancellous bone using the finite-difference time-domain (FDTD) method has been so far utilized as one of the approaches in this regard. However, the FDTD method accompanies two disadvantages: staircase sampling of cancellous bone by finite difference grids leads to generation of wave artifacts at the solid-fluid interface inside the bone; additionally, this method cannot explicitly satisfy the needed perfect-slip conditions at the interface. To overcome these disadvantages, the finite element method (FEM) is proposed in this study. Three-dimensional finite element models of six water-saturated cancellous bone samples with different bone volume were created. The values of speed of sound (SOS) and broadband ultrasound attenuation (BUA) were calculated through the finite element simulations of ultrasound propagation in each sample. Comparing the results with other experimental and simulation studies demonstrated the capabilities of the FEM for micro-scale modeling of ultrasound in water-saturated cancellous bone.

  5. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    SciTech Connect

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil Lee, Zang Hee


    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  6. Inhibition of CaMKK2 Reverses Age-Associated Decline in Bone Mass

    PubMed Central

    Pritchard, Zachary J.; Cary, Rachel L.; Yang, Chang; Novack, Deborah V.; Voor, Michael J.; Sankar, Uma


    Decline in bone formation is a major contributing factor to the loss of bone mass associated with aging. We previously showed that the genetic ablation of the tissue-restricted and multifunctional Ca2+/calmodulin (CaM)-dependent protein kinase kinase 2 (CaMKK2) stimulates trabecular bone mass accrual, mainly by promoting anabolic pathways and inhibiting catabolic pathways of bone remodeling. In this study, we investigated whether inhibition of this kinase using its selective cell-permeable inhibitor STO-609 will stimulate bone formation in 32 week old male WT mice and reverse age-associated of decline in bone volume and strength. Tri-weekly intraperitoneal injections of saline or STO-609 (10 μM) were performed for six weeks followed by metabolic labeling with calcein and alizarin red. New bone formation was assessed by dynamic histomorphometry whereas micro-computed tomography was employed to measure trabecular bone volume, microarchitecture and femoral mid-shaft geometry. Cortical and trabecular bone biomechanical properties were assessed using three-point bending and punch compression methods respectively. Our results reveal that as they progress from 12 to 32 weeks of age, WT mice sustain a significant decline in trabecular bone volume, microarchitecture and strength as well as cortical bone strength. However, treatment of the 32 week old WT mice with STO-609 stimulated apposition of new bone and completely reversed the age-associated decrease in bone volume, quality, as well as trabecular and cortical bone strength. We also observed that regardless of age, male Camkk2−/− mice possessed significantly elevated trabecular bone volume, microarchitecture and compressive strength as well as cortical bone strength compared to age-matched WT mice, implying that the chronic loss of this kinase attenuates age-associated decline in bone mass. Further, whereas STO-609 treatment and/or the absence of CaMKK2 significantly enhanced the femoral midshaft geometry, the

  7. Attenuation of external Bremsstrahlung in metallic absorbers

    SciTech Connect

    Dhaliwal, A.S.; Powar, M.S.; Singh, M. )


    In this paper attenuation of bremsstrahlung from {sup 147}Pm and {sup 170}Tm beta emitters has been studied in aluminum, copper, tin, and lead metallic absorbers. Bremsstrahlung spectra and mass attenuation coefficients for monoenergetic gamma rays are used to calculate theoretical attenuation curves. Magnetic deflection and beta stopping techniques are used to measure the integral bremsstrahlung intensities above 30 keV in different target thicknesses. Comparison of measured and calculated attenuation curves shows a good agreement for various absorbers, thus providing a test of this technique, which may be useful in understanding bremsstrahlung intensity buildup and in the design of optimum shielding for bremsstrahlung sources. It is found that the absorption of bremsstrahlung in metallic absorbers does not obey an exponential law and that absorbers act as energy filters.

  8. Evolution of Natural Attenuation Evaluation Protocols

    EPA Science Inventory

    Traditionally the evaluation of the efficacy of natural attenuation was based on changes in contaminant concentrations and mass reduction. Statistical tools and models such as Bioscreen provided evaluation protocols which now are being approached via other vehicles including m...

  9. Attenuated retroreflectors for electronic distance measurement

    NASA Astrophysics Data System (ADS)

    Parker, David H.; Goldman, Michael A.; Radcliff, Bill; Shelton, John W.

    Methods are described for attenuating solid glass and hollow retroreflectors, without introducing optical path length modifications, for electronic distance measurement. Construction of a prototype novel-design hollow retroreflector is described.

  10. [Is bone biopsy necessary for the diagnosis of metabolic bone diseases? Necessity of bone biopsy].


    Ito, Akemi; Yajima, Aiji


    Histological analysis of undecalcified bone biopsy specimens is a valuable clinical and research tool for studying the etiology, pathogenesis and treatment of metabolic bone diseases. In case of osteoporosis, bone biopsy is not usually required for the diagnosis ; however, bone histomorphometry may be useful in rare cases with unusual skeletal fragility. Bone histomorphometry also provides valuable information on the mechanism of action, safety and efficacy of new anti-osteoporosis drugs. Bone histomorphometry is useful for the diagnosis and the assessment of treatment response in rickets/osteomalacia and in CKD-MBD (chronic kidney disease-mineral and bone disorders) . In Japan, bone biopsy is often performed to establish the diagnosis of Paget's disease of bone, especially to differentiate it from metastatic bone disease.

  11. Bone formation: roles of genistein and daidzein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bone remodeling consists of a balance between bone formation by osteoblasts and bone resorption by osteoclasts. Osteoporosis is the result of increased bone resorption and decreased bone formation causing a decreased bone mass density, loss of bone microarchitecture, and an increased risk of fractu...

  12. DHA is a more potent inhibitor of breast cancer metastasis to bone and related osteolysis than EPA.


    Rahman, Md Mizanur; Veigas, Jyothi Maria; Williams, Paul J; Fernandes, Gabriel


    Breast cancer patients often develop bone metastasis evidenced by osteolytic lesions, leading to severe pain and bone fracture. Attenuation of breast cancer metastasis to bone and associated osteolysis by fish oil, rich in EPA and DHA, has been demonstrated previously. However, it was not known whether EPA and DHA differentially or similarly affect breast cancer bone metastasis and associated osteolysis. In vitro culture of parental and luciferase gene encoded MDA-MB-231 human breast cancer cell lines treated with EPA and DHA revealed that DHA inhibits proliferation and invasion of breast cancer cells more potently than EPA. Intra-cardiac injection of parental and luciferase gene encoded MDA-MB-231 cells to athymic NCr nu/nu mice demonstrated that DHA-treated mice had significantly less breast cancer cell burden in bone, and also significantly less osteolytic lesions than EPA-treated mice. In vivo cell migration assay as measured by luciferase intensity revealed that DHA attenuated cell migration specifically to the bone. Moreover, the DHA-treated group showed reduced levels of CD44 and TRAP positive area in bone compared to EPA-treated group. Breast cancer cell burden and osteolytic lesions were also examined in intra-tibially breast cancer cell injected mice and found less breast cancer cell growth and associated osteolysis in DHA-treated mice as compared to EPA-treated mice. Finally, doxorubicin-resistant MCF-7 (MCF-7dox) human breast cancer cell line was used to examine if DHA can improve sensitization of MCF-7dox cells to doxorubicin. DHA improved the inhibitory effect of doxorubicin on proliferation and invasion of MCF-7dox cells. Interestingly, drug resistance gene P-gp was also down-regulated in DHA plus doxorubicin-treated cells. In conclusion, DHA attenuates breast cancer bone metastasis and associated osteolysis more potently than EPA, possibly by inhibiting migration of breast cancer cell to the bone as well as by inhibiting osteoclastic bone resorption.

  13. Bone Marrow-Derived Cells May Not Be the Original Cells for Carcinogen-Induced Mouse Gastrointestinal Carcinomas

    PubMed Central

    Yang, Chen; Gu, Liankun; Deng, Dajun


    Aim It has been reported that bone marrow-derived cells (BMDC) can be original cells of mouse gastric cancers induced by Helicobacter felis (H. felis) infection. However, it is unknown whether BMDCs are also the original cells of mouse gastrointestinal cancers induced by gastric carcinogens N-nitroso-N-methylurea (NMU) and H. felis infection. Methods C57BL/6 recipient mice were initially irradiated with 10Gy X-ray, reconstituted with bone marrow cells from the C57BL/6-Tg (CAG-EGFP) donor mice to label BMDCs with green fluorescence protein (GFP). After 4 weeks of recovery, the bone marrow-transplanted mice were given NMU in drinking water (240 ppm) and subsequently infected with H. felis by gavage. Eighty weeks later, all mice were euthanized for pathological examination. The BMDCs expressing GFP were detected in tissues using direct GFP fluorescence confocal microscopy analysis and immunohistochemistry staining (IHC) assays. Results Neoplastic lesions were induced by NMU treatment and/or H. felis infection at the antrum of the glandular stomach and small intestine. In the direct GFP fluorescence confocal assay, GFP(+) epithelial cell cluster or glands were not observed in these gastrointestinal tumors, however, most GFP(+) BMDCs sporadically located in the tumor stromal tissues. Some of these GFP(+) stromal BMDCs co-expressed the hematopoietic marker CD45 or myofibroblasts markers αSMA and SRF. In the indirect GFP IHC assay, similar results were observed among 11 gastric intraepithelial neoplasia lesions and 2 small intestine tumors. Conclusion These results demonstrated that BMDCs might not be the source of gastrointestinal tumor cells induced by NMU and/or H. felis infection. PMID:24260263

  14. Electron Effective-Attenuation-Length Database

    National Institute of Standards and Technology Data Gateway

    SRD 82 NIST Electron Effective-Attenuation-Length Database (PC database, no charge)   This database provides values of electron effective attenuation lengths (EALs) in solid elements and compounds at selected electron energies between 50 eV and 2,000 eV. The database was designed mainly to provide EALs (to account for effects of elastic-eletron scattering) for applications in surface analysis by Auger-electron spectroscopy (AES) and X-ray photoelectron spectroscopy (XPS).

  15. Ultrasonic Attenuation in Normal and Superconducting Indium.

    DTIC Science & Technology


    Bardeen et al, Phys. Rev. 108, 1175), there is an additional source of attenuation. This DD I° 7 1473 EDITION OF NOV S E UNCLASSIFIED SECURITY...electronic attenuation described quantitatively by the BCS theory of super- conductivity ( Bardeen et al., Phys. Rev. 108, 1175), there is an additional source...single crystal of C lead at 26.5 MHz is shown in Figure 1. This phenomenon was first explained quantitatively by Bardeen ,Cooper, and Schrieffer (1957

  16. Porous Surface Modified Bioactive Bone Cement for Enhanced Bone Bonding

    PubMed Central

    Huang, Li; Dong, Jingjing; Guo, Dagang; Mao, Mengmeng; Kong, Liang; Li, Yang; Wu, Zixiang; Lei, Wei


    Background Polymethylmethacrylate bone cement cannot provide an adhesive chemical bonding to form a stable cement-bone interface. Bioactive bone cements show bone bonding ability, but their clinical application is limited because bone resorption is observed after implantation. Porous polymethylmethacrylate can be achieved with the addition of carboxymethylcellulose, alginate and gelatin microparticles to promote bone ingrowth, but the mechanical properties are too low to be used in orthopedic applications. Bone ingrowth into cement could decrease the possibility of bone resorption and promote the formation of a stable interface. However, scarce literature is reported on bioactive bone cements that allow bone ingrowth. In this paper, we reported a porous surface modified bioactive bone cement with desired mechanical properties, which could allow for bone ingrowth. Materials and Methods The porous surface modified bioactive bone cement was evaluated to determine its handling characteristics, mechanical properties and behavior in a simulated body fluid. The in vitro cellular responses of the samples were also investigated in terms of cell attachment, proliferation, and osteoblastic differentiation. Furthermore, bone ingrowth was examined in a rabbit femoral condyle defect model by using micro-CT imaging and histological analysis. The strength of the implant–bone interface was also investigated by push-out tests. Results The modified bone cement with a low content of bioactive fillers resulted in proper handling characteristics and adequate mechanical properties, but slightly affected its bioactivity. Moreover, the degree of attachment, proliferation and osteogenic differentiation of preosteoblast cells was also increased. The results of the push-out test revealed that higher interfacial bonding strength was achieved with the modified bone cement because of the formation of the apatite layer and the osseointegration after implantation in the bony defect. Conclusions

  17. Osteocyte density in woven bone.


    Hernandez, C J; Majeska, R J; Schaffler, M B


    Woven bone forms rapidly during tissue growth, following injury and in response to certain anabolic stimuli. Functional differences between woven and lamellar bone may be due, in part, to differences in osteocyte density (cells per unit tissue). Woven bone has been estimated to contain four to eight times more osteocytes than lamellar bone, although primary data to support this assertion are limited. Given recent findings implicating osteocytes as regulators of bone remodeling, bone formation and bone volume, such large differences in osteocyte density between woven and lamellar bone may have important consequences. In this study, we compared the density of osteocyte lacunae (lacunae/mm(2) tissue) in rat lamellar bone with that in woven bone formed under several different circumstances. We found that the lacunar density of lamellar cortical bone in the rat (834+/-83 cells/mm2, mean+/-SD) did not differ significantly from that of periosteal woven bone formed via intramembranous osteogenesis, either in response to mechanical loading (921+/-204 cells/mm2) or in the periosteal buttressing region of the fracture callus (1138+/-168 cells/mm2). In contrast, lacunar density of endochondrally derived woven bone in the center (gap) region of fracture callus was nearly 100% greater (1875+/-270 cells/mm2) than in lamellar cortical bone while lacunar density of primary spongiosa of the growth plate was 40% greater (1674+/-228 cells/mm2) than that in lamellar cancellous bone (1189+/-164). These findings demonstrate that lacunar density in woven bone varies depending on skeletal site and developmental history and appears to be elevated in endochondrally derived woven bone adjacent to marrow space. Given the considerable evidence supporting osteocytes as local initiators of bone remodeling, we suggest that woven bone with increased lacunar density may undergo remodeling at an accelerated rate.

  18. Role of bone marrow macrophages in controlling homeostasis and repair in bone and bone marrow niches.


    Kaur, Simranpreet; Raggatt, Liza Jane; Batoon, Lena; Hume, David Arthur; Levesque, Jean-Pierre; Pettit, Allison Robyn


    Macrophages, named for their phagocytic ability, participate in homeostasis, tissue regeneration and inflammatory responses. Bone and adjacent marrow contain multiple functionally unique resident tissue macrophage subsets which maintain and regulate anatomically distinct niche environments within these interconnected tissues. Three subsets of bone-bone marrow resident tissue macrophages have been characterised; erythroblastic island macrophages, haematopoietic stem cell niche macrophages and osteal macrophages. The role of these macrophages in controlling homeostasis and repair in bone and bone marrow niches is reviewed in detail.

  19. Cells derived from young bone marrow alleviate renal aging.


    Yang, Hai-Chun; Rossini, Michele; Ma, Li-Jun; Zuo, Yiqin; Ma, Ji; Fogo, Agnes B


    Bone marrow-derived stem cells may modulate renal injury, but the effects may depend on the age of the stem cells. Here we investigated whether bone marrow from young mice attenuates renal aging in old mice. We radiated female 12-mo-old 129SvJ mice and reconstituted them with bone marrow cells (BMC) from either 8-wk-old (young-to-old) or 12-mo-old (old-to-old) male mice. Transfer of young BMC resulted in markedly decreased deposition of collagen IV in the mesangium and less β-galactosidase staining, an indicator of cell senescence. These changes paralleled reduced expression of plasminogen activator inhibitor-1 (PAI-1), PDGF-B (PDGF-B), the transdifferentiation marker fibroblast-specific protein-1 (FSP-1), and senescence-associated p16 and p21. Tubulointerstitial and glomerular cells derived from the transplanted BMC did not show β-galactosidase activity, but after 6 mo, there were more FSP-1-expressing bone marrow-derived cells in old-to-old mice compared with young-to-old mice. Young-to-old mice also exhibited higher expression of the anti-aging gene Klotho and less phosphorylation of IGF-1 receptor β. Taken together, these data suggest that young bone marrow-derived cells can alleviate renal aging in old mice. Direct parenchymal reconstitution by stem cells, paracrine effects from adjacent cells, and circulating anti-aging molecules may mediate the aging of the kidney.

  20. Alendronate as an Effective Countermeasure to Disuse Induced Bone loss

    NASA Technical Reports Server (NTRS)

    LeBlanc, Adrian D.; Driscol, Theda B.; Shackelford, Linda C.; Evans, Harlan J.; Rianon, Nahid J.; Smith, Scott M.; Lai, Dejian


    Microgravity, similar to diuse immobilization on earth, causes rapid bone loss. This loss is believed to be an adaptive response to the reduced musculoskelatal forces in space and occurs gradually enough that changes occurring during short duration space flight are not a concern. Bone loss, however, will be a major impediment for long duration missions if effective countermeasures are not developed and implemented. Bed rest is used to simulate the reduced mechanical forces in humans and was used to test the hypothesis that oral alendronate would reduce the effects of long duration (17 weeks) inactivity on bone. Eight male subjects were given daily oral doses of alendronate during 17 weeks of horizontal bed rest and compared with 13 male control subjects not given the drug. Efficacy was evaluated based on measurements of bone markers, calcium balance and bone density performed before, during and after the bed rest. The results show that oral alendronate attenuates most of the characteristic changes associated with long duration bed rest and presumably space flight.

  1. Sensory Attenuation for Jointly Produced Action Effects

    PubMed Central

    Loehr, Janeen D.


    Successful joint action often requires people to distinguish between their own and others’ contributions to a shared goal. One mechanism that is thought to underlie a self-other distinction is sensory attenuation, whereby the sensory consequences of one’s own actions are reduced compared to other sensory events. Previous research has shown that the auditory N1 event-related potential (ERP) response is reduced for self-generated compared to externally generated tones. The current study examined whether attenuation also occurs for jointly generated tones, which require two people to coordinate their actions to produce a single tone. ERP responses were measured when participants generated tones alone (tone onset immediately followed the participant’s button press) or with a partner (tone onset immediately followed the participant’s or the partner’s button press, whichever occurred second). N1 attenuation was smaller for jointly generated tones compared to self-generated tones. For jointly generated tones, greater delays between the participant’s and the partner’s button presses were associated with reduced attenuation; moreover, only trials in which there was no delay between the participant’s press and tone onset showed attenuation, whereas trials in which there were delays did not show attenuation. These findings indicate that people differentiate between their own and another person’s contributions to a joint action at the sensorimotor level, even when they must act together to produce a single, shared effect. PMID:23596429

  2. Vibration characteristics of bone conducted sound in vitro.


    Stenfelt, S; Håkansson, B; Tjellström, A


    A dry skull added with damping material was used to investigate the vibratory pattern of bone conducted sound. Three orthogonal vibration responses of the cochleae were measured, by means of miniature accelerometers, in the frequency range 0.1-10 kHz. The exciter was attached to the temporal, parietal, and frontal bones, one at the time. In the transmission response to the ipsilateral cochlea, a profound low frequency antiresonance (attenuation) was found, verified psycho-acoustically, and shown to yield a distinct lateralization effect. It was also shown that, for the ipsilateral side, the direction of excitation coincides with that of maximum response. At the contralateral cochlea, no such dominating response direction was found for frequencies above the first skull resonance. An overall higher response level was achieved, for the total energy transmission in general and specifically for the direction of excitation, at the ipsilateral cochlea when the transducer was attached to the excitation point closest to the cochlea. The transranial attenuation was found to be frequency dependent, with values from -5 to 10 dB for the energy transmission and -30 to 40 dB for measurements in a single direction, with a tendency toward higher attenuation at the higher frequencies.

  3. Exercise to Counteract Loss of Bone and Muscle During Androgen Deprivation Therapy in Men With Prostate Cancer

    DTIC Science & Technology


    androgen deprivation therapy (ADT). It is postulated that, in men on ADT for the treatment of locally advanced prostate cancer: 1) RT will attenuate the...hormones; physical functional performance; and quality of life. Local project support will enable assessment of risk factors for cardiovascular disease...blood lipids, glucose tolerance, arterial stiffness). 14. SUBJECT TERMS 15. NUMBER OF PA GES Bone mineral density, osteoporosis, sarcopenia , bone

  4. Temporal Bone Meningiomas

    PubMed Central

    Vrionis, Fotios D.; Robertson, Jon H.; Gardner, Gale; Heilman, Carl B.


    Meningiomas involving the temporal bone may originate from arachnoid cell nests present within the temporal bone (intratemporal), but more frequently originate from arachnoid cell nests of the posterior or middle cranial fossa with secondary invasion of the TB (extratemporal). In this study, we retrospectively reviewed the charts of 13 patients with meningiomas involving the temporal bone who underwent surgery. Tumors of the posterior fossa with only temporal bone hyperostosis, but without invasion, were excluded. Patients presented primarily with otologic symptoms and signs. The tumors originated in the temporal bone (5/13), jugular foramen (4/13), petroclival region (2/13), the asterion (1/13) or the internal auditory meatus (1/13). All of the intratemporal meningiomas had the radiological appearance of en-plaque menigiomas. The tumor extended into the middle ear (11/13), eustachian tube (5/13), and/or the labyrinth (3/13). A gross total resection was achieved in 11 patients and a subtotal resection in 2 patients. The lower cranial nerves were infiltrated by tumor in 4 patients, and were sacrificed. At a mean follow-up of approximately 6 years, 12 patients are currently alive and doing well and 1 died from tumor progression. Six patients showed tumor recurrence and were reoperated on (5/6) or followed conservatively (1/6). Surgical treatment of temporal bone meningiomas is associated with high recurrence rate due to indiscreet tumor margins. Combined surgical approaches (temporal craniotomy and mastoidectomy) by neurosurgical and otological teams are recommended for meningiomas originating in the temporal bone. ImagesFigure 1Figure 2Figure 3p134-aFigure 4Figure 5Figure 6 PMID:17171128

  5. Bone Graft Substitution and Augmentation.


    Nauth, Aaron; Lane, Joseph; Watson, J Tracy; Giannoudis, Peter


    Selection of appropriate bone graft or bone graft substitute requires careful recognition of the bone healing needs of the patient's specific clinical problem and a thorough understanding of the different properties possessed by the available bone grafts and substitutes. Although autogenous iliac crest bone graft remains the gold standard of treatment for delayed unions, nonunions, and bone defects, there are a number of promising alternatives available, and emerging evidence suggests that they can be very effective when used in the proper setting. Among these, reamer-irrigator-aspirator bone graft, bone marrow concentrate, bone morphogenetic proteins, and calcium phosphate cements have received a great deal of attention in the literature. This review describes these grafts in detail along with the evidence for their use. In addition, a framework is provided for selecting the appropriate graft or substitute based on their provided properties.

  6. Bone health in eating disorders.


    Zuckerman-Levin, N; Hochberg, Z; Latzer, Y


    Eating disorders (EDs) put adolescents and young adults at risk for impaired bone health. Low bone mineral density (BMD) with ED is caused by failure to accrue peak bone mass in adolescence and bone loss in young adulthood. Although ED patients diagnosed with bone loss may be asymptomatic, some suffer bone pains and have increased incidence of fractures. Adolescents with ED are prone to increased prevalence of stress fractures, kyphoscoliosis and height loss. The clinical picture of the various EDs involves endocrinopathies that contribute to impaired bone health. Anorexia nervosa (AN) is characterized by low bone turnover, with relatively higher osteoclastic (bone resorptive) than osteoblastic (bone formation) activity. Bone loss in AN occurs in both the trabecular and cortical bones, although the former is more vulnerable. Bone loss in AN has been shown to be influenced by malnutrition and low weight, reduced fat mass, oestrogen and androgen deficiency, glucocorticoid excess, impaired growth hormone-insulin-like growth factor 1 axis, and more. Bone loss in AN may not be completely reversible despite recovery from the illness. Treatment modalities involving hormonal therapies have limited effectiveness, whereas increased caloric intake, weight gain and resumption of menses are essential to improved BMD.

  7. Transforming growth factor-β synthesized by stromal cells and cancer cells participates in bone resorption induced by oral squamous cell carcinoma

    SciTech Connect

    Nakamura, Ryosuke; Kayamori, Kou; Oue, Erika; Sakamoto, Kei; Harada, Kiyoshi; Yamaguchi, Akira


    Transforming growth factor beta (TGF-β) plays a significant role in the regulation of the tumor microenvironment. To explore the role of TGF-β in oral cancer-induced bone destruction, we investigated the immunohistochemical localization of TGF-β and phosphorylated Smad2 (p-Smad2) in 12 surgical specimens of oral squamous cell carcinoma (OSCC). These studies revealed TGF-β and p-Smad2 expression in cancer cells in all tested cases. Several fibroblasts located between cancer nests and resorbing bone expressed TGF-β in 10 out of 12 cases and p-Smad2 in 11 out of 12 cases. Some osteoclasts also exhibited p ∼ Smad2 expression. The OSCC cell line, HSC3, and the bone marrow-derived fibroblastic cell line, ST2, synthesized substantial levels of TGF-β. Culture media derived from HSC3 cells could stimulate Tgf-β1 mRNA expression in ST2 cells. Recombinant TGF-β1 could stimulate osteoclast formation induced by receptor activator of nuclear factor kappa-B ligand (RANKL) in RAW264 cells. TGF-β1 could upregulate the expression of p-Smad2 in RAW264 cells, and this action was suppressed by the addition of a neutralizing antibody against TGF-β or by SB431542. Transplantation of HSC3 cells onto the calvarial region of athymic mice caused bone destruction, associated with the expression of TGF-β and p-Smad2 in both cancer cells and stromal cells. The bone destruction was substantially inhibited by the administration of SB431542. The present study demonstrated that TGF-β synthesized by both cancer cells and stromal cells participates in the OSCC-induced bone destruction. - Highlights: • Cancer cell, fibroblastic cells, and osteoclasts at bone resorbing area by oral cancer exhibited TGF-β and p-Smad2. • TGF-β1 stimulated osteoclastogenesis induced by RAKL in RAW264 cell. • Xenograft model of oral cancer-induced bone resorption was substantially inhibited by SB431542. • TGF-β synthesized by both cancer cells and stromal cells participates in the OSCC

  8. Bone impairment in oxalosis: An ultrastructural bone analysis.


    Bacchetta, Justine; Farlay, Delphine; Abelin-Genevois, Kariman; Lebourg, Ludivine; Cochat, Pierre; Boivin, Georges


    Deposition of calcium oxalate crystals in the kidney and bone is a hallmark of systemic oxalosis. Since the bone compartment can store massive amounts of oxalate, patients present with recurrent low-trauma fractures, bone deformations, severe bone pains and specific oxalate osteopathy on plain X-ray. Bone biopsy from the iliac crest displays specific features such as oxalate crystals surrounded by a granulomatous reaction due to an invasion of bone surface by macrophages. We present data obtained in 10 samples from 8 patients with oxalosis (16-68 years) who underwent iliac crest bone biopsy and bone quality analysis using modern methods (microradiography, microindentation, Fourier Transform InfraRed Microspectroscopy, transmission electron microscopy) in addition to histomorphometry. Disseminated calcium oxalate deposits (whewellite) were found in the bone marrow space (with a granulomatous reaction) but not in the bone matrix. Calcium oxalate deposits were totally surrounded by macrophages and multinucleated giant cells, and a phagocytosis activity was sometimes observed. Very few calcium oxalate crystals were directly in close contact with the mineral substance of the bone. Bone mineralization was not modified by the presence of calcium oxalate even in close vicinity. Bone quality analysis also revealed a harder bone than normal, perhaps in relationship with decreased carbonate content in the mineral. This increase in bone hardness could explain a more "brittle" bone. In patients with oxalosis, the formation and growth of calcium oxalate crystals in the bone appeared independent of apatite. The mechanisms leading to nucleation and growth of oxalate deposits are still unclear and deserve further studies.

  9. Diabetes, biochemical markers of bone turnover, diabetes control, and bone.


    Starup-Linde, Jakob


    Diabetes mellitus is known to have late complications including micro vascular and macro vascular disease. This review focuses on another possible area of complication regarding diabetes; bone. Diabetes may affect bone via bone structure, bone density, and biochemical markers of bone turnover. The aim of the present review is to examine in vivo from humans on biochemical markers of bone turnover in diabetics compared to non-diabetics. Furthermore, the effect of glycemic control on bone markers and the similarities and differences of type 1- and type 2-diabetics regarding bone markers will be evaluated. A systematic literature search was conducted using PubMed, Embase, Cinahl, and SveMed+ with the search terms: "Diabetes mellitus," "Diabetes mellitus type 1," "Insulin dependent diabetes mellitus," "Diabetes mellitus type 2," "Non-insulin dependent diabetes mellitus," "Bone," "Bone and Bones," "Bone diseases," "Bone turnover," "Hemoglobin A Glycosylated," and "HbA1C." After removing duplicates from this search 1,188 records were screened by title and abstract and 75 records were assessed by full text for inclusion in the review. In the end 43 records were chosen. Bone formation and resorption markers are investigated as well as bone regulating systems. T1D is found to have lower osteocalcin and CTX, while osteocalcin and tartrate-resistant acid are found to be lower in T2D, and sclerostin is increased and collagen turnover markers altered. Other bone turnover markers do not seem to be altered in T1D or T2D. A major problem is the lack of histomorphometric studies in humans linking changes in turnover markers to actual changes in bone turnover and further research is needed to strengthen this link.

  10. Microarchitecture of irradiated bone: comparison with healthy bone

    NASA Astrophysics Data System (ADS)

    Bléry, Pauline; Amouriq, Yves; Guédon, Jeanpierre; Pilet, Paul; Normand, Nicolas; Durand, Nicolas; Espitalier, Florent; Arlicot, Aurore; Malard, Olivier; Weiss, Pierre


    The squamous cell carcinomas of the upper aero-digestive tract represent about ten percent of cancers. External radiation therapy leads to esthetic and functional consequences, and to a decrease of the bone mechanical abilities. For these patients, the oral prosthetic rehabilitation, including possibilities of dental implant placement, is difficult. The effects of radiotherapy on bone microarchitecture parameters are not well known. Thus, the purpose of this study is to assess the effects of external radiation on bone micro architecture in an experimental model of 25 rats using micro CT. 15 rats were irradiated on the hind limbs by a single dose of 20 Grays, and 10 rats were non irradiated. Images of irradiated and healthy bone were compared. Bone microarchitecture parameters (including trabecular thickness, trabecular number, trabecular separation, connectivity density and tissue and bone volume) between irradiated and non-irradiated bones were calculated and compared using a Mann and Whitney test. After 7 and 12 weeks, images of irradiated and healthy bone are different. Differences on the irradiated and the healthy bone populations exhibit a statistical significance. Trabecular number, connectivity density and closed porosity are less important on irradiated bone. Trabecular thickness and separation increase for irradiated bone. These parameters indicate a decrease of irradiated bone properties. Finally, the external irradiation induces changes on the bone micro architecture. This knowledge is of prime importance for better oral prosthetic rehabilitation, including implant placement.

  11. Ultrasound speed and attenuation in progressive trypsin digested articular cartilage.


    Niu, HaiJun; Li, LiFeng; Sun, Feng; Yan, Yan; Wang, YueXiang; Li, DeYu; Fan, YuBo


    Subtle changes of articular cartilage (AC) can lead to tissue degeneration and even osteoarthritis (OA). The early degeneration of AC is closely related to a change in proteoglycans (PG) content. The observation of PG is therefore an appropriate way of studying OA and evaluating the degree of AC degeneration. In this study, 20 cartilage-bone samples were prepared from normal porcine femoral condyle cartilage and 10 samples were digested over 2 h using 0.25% trypsin solution. The dynamic process of PG-digestion was explored using a conventional A-mode ultrasound (US) experimental system with a 10 MHz center frequency. Quantitative acoustic parameters were calculated from ultrasonic radio-frequency echo signals and included US speed (USS), US amplitude attenuation coefficient (UAA) and broadband US attenuation coefficient (BUA). The experimental results showed that the conventional A-mode ultrasound is valuable for tracking the degree of PG-digestion. Histology also confirmed the validity of the ultrasound observations. For every AC sample, the degree of PG-digestion within a given time was different and was affected by individual differences. After two hours of degeneration, USS showed a mean decrease of 0.4% (P<0.05). UAA was significantly lower after a two-hour PG depletion period (from (2.45±0.23) to (2.28±0.41) dB mm⁻¹). BUA showed no significant differences during this process. In conclusion, conventional ultrasound can provide useful information about trypsin-induced progressive PG depletion in AC and can reflect variations of PG content via the quantitative acoustic parameters USS and UAA. The results of this study may be used to identify an indirect indicator of cartilage matrix integrity and OA disease progression.

  12. Calcar bone graft

    SciTech Connect

    Bargar, W.L.; Paul, H.A.; Merritt, K.; Sharkey, N.


    A canine model was developed to investigate the use of an autogeneic iliac bone graft to treat the calcar deficiency commonly found at the time of revision surgery for femoral component loosening. Five large male mixed-breed dogs had bilateral total hip arthroplasty staged at three-month intervals, and were sacrificed at six months. Prior to cementing the femoral component, an experimental calcar defect was made, and a bicortical iliac bone graft was fashioned to fill the defect. Serial roentgenograms showed the grafts had united with no resorption. Technetium-99 bone scans showed more uptake at three months than at six months in the graft region. Disulfine blue injection indicated all grafts were perfused at both three and six months. Thin section histology, fluorochromes, and microradiographs confirmed graft viability in all dogs. Semiquantitative grading of the fluorochromes indicated new bone deposition in 20%-50% of each graft at three months and 50%-80% at six months. Although the calcar bone graft was uniformly successful in this canine study, the clinical application of this technique should be evaluated by long-term results in humans.

  13. Discrete tomography in an in vivo small animal bone study.


    Van de Casteele, Elke; Perilli, Egon; Van Aarle, Wim; Reynolds, Karen J; Sijbers, Jan


    This study aimed at assessing the feasibility of a discrete algebraic reconstruction technique (DART) to be used in in vivo small animal bone studies. The advantage of discrete tomography is the possibility to reduce the amount of X-ray projection images, which makes scans faster and implies also a significant reduction of radiation dose, without compromising the reconstruction results. Bone studies are ideal for being performed with discrete tomography, due to the relatively small number of attenuation coefficients contained in the image [namely three: background (air), soft tissue and bone]. In this paper, a validation is made by comparing trabecular bone morphometric parameters calculated from images obtained by using DART and the commonly used standard filtered back-projection (FBP). Female rats were divided into an ovariectomized (OVX) and a sham-operated group. In vivo micro-CT scanning of the tibia was done at baseline and at 2, 4, 8 and 12 weeks after surgery. The cross-section images were reconstructed using first the full set of projection images and afterwards reducing them in number to a quarter and one-sixth (248, 62, 42 projection images, respectively). For both reconstruction methods, similar changes in morphometric parameters were observed over time: bone loss for OVX and bone growth for sham-operated rats, although for DART the actual values were systematically higher (bone volume fraction) or lower (structure model index) compared to FBP, depending on the morphometric parameter. The DART algorithm was, however, more robust when using fewer projection images, where the standard FBP reconstruction was more prone to noise, showing a significantly bigger deviation from the morphometric parameters obtained using all projection images. This study supports the use of DART as a potential alternative method to FBP in X-ray micro-CT animal studies, in particular, when the number of projections has to be drastically minimized, which directly reduces

  14. Region specific optimization of continuous linear attenuation coefficients based on UTE (RESOLUTE): application to PET/MR brain imaging.


    Ladefoged, Claes N; Benoit, Didier; Law, Ian; Holm, Søren; Kjær, Andreas; Højgaard, Liselotte; Hansen, Adam E; Andersen, Flemming L


    The reconstruction of PET brain data in a PET/MR hybrid scanner is challenging in the absence of transmission sources, where MR images are used for MR-based attenuation correction (MR-AC). The main challenge of MR-AC is to separate bone and air, as neither have a signal in traditional MR images, and to assign the correct linear attenuation coefficient to bone. The ultra-short echo time (UTE) MR sequence was proposed as a basis for MR-AC as this sequence shows a small signal in bone. The purpose of this study was to develop a new clinically feasible MR-AC method with patient specific continuous-valued linear attenuation coefficients in bone that provides accurate reconstructed PET image data. A total of 164 [(18)F]FDG PET/MR patients were included in this study, of which 10 were used for training. MR-AC was based on either standard CT (reference), UTE or our method (RESOLUTE). The reconstructed PET images were evaluated in the whole brain, as well as regionally in the brain using a ROI-based analysis. Our method segments air, brain, cerebral spinal fluid, and soft tissue voxels on the unprocessed UTE TE images, and uses a mapping of R(*)2 values to CT Hounsfield Units (HU) to measure the density in bone voxels. The average error of our method in the brain was 0.1% and less than 1.2% in any region of the brain. On average 95% of the brain was within  ±10% of PETCT, compared to 72% when using UTE. The proposed method is clinically feasible, reducing both the global and local errors on the reconstructed PET images, as well as limiting the number and extent of the outliers.

  15. Region specific optimization of continuous linear attenuation coefficients based on UTE (RESOLUTE): application to PET/MR brain imaging

    NASA Astrophysics Data System (ADS)

    Ladefoged, Claes N.; Benoit, Didier; Law, Ian; Holm, Søren; Kjær, Andreas; Højgaard, Liselotte; Hansen, Adam E.; Andersen, Flemming L.


    The reconstruction of PET brain data in a PET/MR hybrid scanner is challenging in the absence of transmission sources, where MR images are used for MR-based attenuation correction (MR-AC). The main challenge of MR-AC is to separate bone and air, as neither have a signal in traditional MR images, and to assign the correct linear attenuation coefficient to bone. The ultra-short echo time (UTE) MR sequence was proposed as a basis for MR-AC as this sequence shows a small signal in bone. The purpose of this study was to develop a new clinically feasible MR-AC method with patient specific continuous-valued linear attenuation coefficients in bone that provides accurate reconstructed PET image data. A total of 164 [18F]FDG PET/MR patients were included in this study, of which 10 were used for training. MR-AC was based on either standard CT (reference), UTE or our method (RESOLUTE). The reconstructed PET images were evaluated in the whole brain, as well as regionally in the brain using a ROI-based analysis. Our method segments air, brain, cerebral spinal fluid, and soft tissue voxels on the unprocessed UTE TE images, and uses a mapping of R2* values to CT Hounsfield Units (HU) to measure the density in bone voxels. The average error of our method in the brain was 0.1% and less than 1.2% in any region of the brain. On average 95% of the brain was within  ±10% of PETCT, compared to 72% when using UTE. The proposed method is clinically feasible, reducing both the global and local errors on the reconstructed PET images, as well as limiting the number and extent of the outliers.

  16. Spatial variation of acoustic properties is related with mechanical properties of trabecular bone

    NASA Astrophysics Data System (ADS)

    Riekkinen, O.; Hakulinen, M. A.; Töyräs, J.; Jurvelin, J. S.


    In clinical applications, ultrasound parameters are measured as an average value over a region of interest (ROI) or as a value at a single measurement point. Due to natural adaptation to loading conditions, trabecular bone is structurally, compositionally and mechanically heterogeneous and anisotropic. Thus, spatial variation of ultrasound parameters within ROI may contain valuable information on the mechanical integrity of trabecular bone. However, this issue has not been thoroughly investigated. In the present study, we aimed at investigating the significance of the spatial variation of ultrasound parameters for the prediction of mechanical properties of human trabecular bone. For this aim, parametric maps of apparent integrated backscattering (AIB), integrated reflection coefficient (IRC), speed of sound (SOS), average attenuation (AA) and normalized broadband ultrasound attenuation (nBUA) were calculated for femoral and tibial bone cylinders (n = 19-20). Further, the effect of time window length on the AIB, variation of AIB within ROI and association between AIB and bone mechanical properties were characterized. Based on linear correlation analysis, spatial variation of AIB, assessed as standard deviation of measurements within ROI, was a strong predictor of bone ultimate strength (r = -0.82, n = 19, p < 0.01). Further, the time window length affected absolute values of AIB and strength of correlation between AIB and bone ultimate strength. Interestingly, linear combination of mean IRC and spatial variation of AIB within ROI was the strongest predictor of bone ultimate strength (r = 0.92, n = 19, p < 0.01). In conclusion, our findings suggest that the measurement of two-dimensional parametric maps of ultrasound parameters could yield information on bone status not extractable from single point measurements. This highlights the potential of parametric imaging in osteoporosis diagnostics.

  17. Seismic Attenuation beneath Tateyama Volcano, Central Japan

    NASA Astrophysics Data System (ADS)

    Iwata, K.; Kawakata, H.; Doi, I.


    Subsurface structures beneath active volcanoes have frequently been investigated (e.g., Oikawa et al., 1994: Sudo et al., 1996), and seismic attenuation beneath some active volcanoes are reported to be strong. On the other hand, few local subsurface structures beneath volcanoes whose volcanic activities are low have been investigated in detail, though it is important to study them to understand the potential of volcanic activity of these volcanoes. Then, we analyzed the seismic attenuation beneath Tateyama volcano (Midagahara volcano) located in central Japan, whose volcanic activity is quite low. We used seismograms obtained by Hi-net deployed by NIED (National Research Institute for Earth Science and Disaster Prevention). Hi-net is one of the densest seismic station networks in the world, and the spatial interval of their seismographs is about 20 km, which is suitable for investigating local structure beneath an individual volcano. We estimated S-wave attenuation using seismograms at five stations near Tateyama volcano for nineteen small, local, shallow earthquakes (M 2.7-4.0) that occurred from January 2012 to December 2013. We divided these earthquakes into six groups according to their hypocenter locations. We used twofold spectral ratios around the first S-arrivals to investigate the S-wave attenuation when S-waves passed through the region beneath Tateyama volcano. We focused on station pairs located on opposite sides of Tateyama volcano to each other, and earthquake pairs whose epicenters were located almost along the line connecting Tateyama volcano and the two stations, so that the spectral ratios reflect a local structure beneath Tateyama volcano. Twofold spectral ratios of all seismograms for S waves having northwestern or southeastern sources show strong attenuation beneath Tateyama volcano. On the other hand, those of seismograms having northeastern or southwestern sources show much weaker attenuation, which suggested that the region of strong

  18. [Osteostimulating effect of bone xenograft on bone tissue regeneration].


    Balin, V N; Balin, D V; Iordanishvili, A K; Musikin, M I


    The aim of experimental case-control study performed in 28 dogs divided in 2 groups was to assess local tissue reactions on bone xenograft transplantation; dynamics of bone remodeling and formation at the site of bone defect wall contacting with bone xenograft; dynamics and mechanisms of xenograft remodeling. Transplantation of xenograft in conventional bone defects did not cause inflammatory of destructive reactions because of high biocompatibility of the material. At transplantation site active fibrous bone trabeculae formation filling the spaces between xenograft participles was observed. On the 90th day newly formed bone showed lammelar structure. Simultaneously from the 42d day the invasion of cell elements from recipient bed into the material was seen leading to xenograft resorption. The observed dynamics may be assessed as gradual substitution of xenograft with newly formed host bone structures.

  19. Bone cells and bone turnover in diabetes mellitus.


    Rubin, Mishaela R


    Substantial evidence exists that in addition to the well-known complications of diabetes, increased fracture risk is an important morbidity. This risk is probably due, at least in part, to altered bone remodeling and bone cell function in diabetes. Circulating biochemical markers of bone formation, including P1NP, osteocalcin and bone-specific alkaline phosphatase have been found to be decreased in type 2 diabetes (T2D) and may be predictive of fractures independently of bone mineral density (BMD). These findings have been corroborated by preliminary histomorphometric data. Reductions in the bone resorption marker serum CTx in T2D have also been reported. Serum sclerostin levels have been found to be increased in T2D and appear to be predictive of fracture risk independent of BMD. Other factors such as bone marrow fat saturation, advanced glycation endproduct (AGE) accumulation, and microarchitectural changes might also relate to bone cell function and fracture risk in diabetes.

  20. Intermittent parathyroid hormone administration counteracts the adverse effects of glucocorticoids on osteoblast and osteocyte viability, bone formation, and strength in mice.


    Weinstein, Robert S; Jilka, Robert L; Almeida, Maria; Roberson, Paula K; Manolagas, Stavros C


    Glucocorticoids act directly on bone cells to decrease production of osteoblasts and osteoclasts, increase osteoblast and osteocyte apoptosis, and prolong osteoclast life span. Conversely, daily injections of PTH decrease osteoblast and osteocyte apoptosis and increase bone formation and strength. Using a mouse model, we investigated whether the recently demonstrated efficacy of PTH in glucocorticoid-induced bone disease results from the ability of this therapeutic modality to counteract at least some of the direct effects of glucocorticoids on bone cells. Glucocorticoid administration to 5- to 6-month-old Swiss-Webster mice for 28 d increased the prevalence of osteoblast and osteocyte apoptosis and decreased osteoblast number, activation frequency, and bone formation rate, resulting in reduced osteoid, wall and trabecular width, bone mineral density, and bone strength. In contrast, daily injections of PTH caused a decrease in osteoblast and osteocyte apoptosis and an increase in osteoblast number, activation frequency, bone formation rate, bone mineral density, and bone strength. The decreased osteocyte apoptosis was associated with increased bone strength. When the two agents were combined, all the adverse effects of glucocorticoid excess on bone were prevented. Likewise, in cultured osteoblastic cells, PTH attenuated the adverse effects of glucocorticoids on osteoblast survival and Wnt signaling via an Akt phosphorylation-dependent mechanism. We conclude that intermittent PTH administration directly counteracts the key pathogenetic mechanisms of glucocorticoid excess on bone, thus providing a mechanistic explanation of its efficacy against glucocorticoid-induced osteoporosis.

  1. Periodontitis and bone metabolism

    PubMed Central

    Barbato, Luigi; Francioni, Edoardo; Bianchi, Massimiliano; Mascitelli, Eleonora; Marco, Leila Brancato; Tonelli, Duvina Paolo


    Summary Periodontitis is a plaque induced disease characterized by tissue destruction. The extent of the alveolar bone loss depends on the host response stimulated by bacterial infection. Recently researchers have focused on the role of the immune system, of RANK/RANKL/OPG pathway and of cytokines network. Another recent field of interest is osteoimmunology that try to explain the relationship between immune and bone cells in activating bone resorption. Advances in the understanding of the pathogenic mechanisms allowed a better understanding of the relationship with other diseases like osteoporosis and also to hypothesize new therapies based on modulation of host response (host modulatory therapy - HMT). The purpose of this mini-review is to briefly discuss these topics. PMID:26604945

  2. Bone healing in 2016

    PubMed Central

    Buza, John A.; Einhorn, Thomas


    Summary Delayed fracture healing and nonunion occurs in up to 5–10% of all fractures, and can present a challenging clinical scenario for the treating physician. Methods for the enhancement of skeletal repair may benefit patients that are at risk of, or have experienced, delayed healing or nonunion. These methods can be categorized into either physical stimulation therapies or biological therapies. Physical stimulation therapies include electrical stimulation, low-intensity pulsed ultrasonography, or extracorporeal shock wave therapy. Biological therapies can be further classified into local or systemic therapy based on the method of delivery. Local methods include autologous bone marrow, autologous bone graft, fibroblast growth factor-2, platelet-rich plasma, platelet-derived growth factor, and bone morphogenetic proteins. Systemic therapies include parathyroid hormone and bisphosphonates. This article reviews the current applications and supporting evidence for the use of these therapies in the enhancement of fracture healing. PMID:27920804

  3. Diabetes and bone health.


    Antonopoulou, Marianna; Bahtiyar, Gül; Banerji, Mary Ann; Sacerdote, Alan S


    The increasing prevalence of diabetes especially type 2 diabetes worldwide is indisputable. Diabetics suffer increased morbidity and mortality, compared to their non-diabetic counterparts, not only because of vascular complications, but also because of an increased fracture incidence. Both types 1 and 2 diabetes and some medications used to treat it are associated with osteoporotic fractures. The responsible mechanisms remain incompletely elucidated. In this review, we evaluate the role of glycemic control in bone health, and the effect of anti-diabetic medications such as thiazolidinediones, sulfonylureas, DPP-4 inhibitors, and GLP-1 agonists. In addition, we examine the possible role of insulin and metformin as anabolic agents for bone. Lastly, we identify the current and future screening tools that help evaluate bone health in diabetics and their limitations. In this way we can offer individualized treatment, to the at-risk diabetic population.

  4. [Infectious bone diseases].


    Tiemann, A H; Krenn, V; Krukemeyer, M G; Seyfert, C; Jakobs, M; Baumhoer, D; Hofmann, G O


    Bacterial infection of the bone is a severe disease with complications, potentially including long-term physical disability. The diagnosis and therapy of osteomyelitis include several elements: histopathology, microbiology, radiologic imagining, as well as antibiotic and surgical therapy. Histopathologists differentiate between acute osteomyelitis (infiltration of cancellous bone with neutrophil granulocytes); specific osteomyelitis (epithelioid-like granulomatous inflammation, tuberculosis, mycotic infections); primary/secondary chronic osteomyelitis (lymphocytic infiltration); and special forms of chronic osteomyelitis (varying histomorphology, Brodie abscess, SAPHO syndrome). Another important task in the histopathological diagnosis of inflammatory bone diseases is to differentiate osteomyelitis from malignant entities (sarcoma, lymphoma). Therefore, biopsy samples should be of sufficient size for safe diagnosis. Clinical information and imaging as well as interdisciplinary teamwork between radiologists, microbiologists, orthopedic surgeons and pathologists is mandatory to verify these diagnoses.

  5. Analysis of bone biopsies.


    Goodrich, J A; Difiore, R J; Tippens, J K


    The orthopedic surgeon is frequently confronted with the decision of when to perform a bone biopsy and whether to do a needle biopsy or an open biopsy. Frequently consultations are received from other services requesting bone biopsies with questionable indications. The indications and contraindications for performing bone biopsies are discussed as well as advantages and disadvantages of either closed or open technique. Four selective cases are discussed with illustrations. The challenge of undiagnosed osseous lesions is best met by rational evaluation of each individual case and coordinated with the team effort of the primary care physician, surgeon, pathologist, and radiologist. The decision for either an open or closed biopsy technique must be based on the experience and skills of the surgeon and pathologist.

  6. CXCR4 Antagonism Attenuates the Development of Diabetic Cardiac Fibrosis.


    Chu, Po-Yin; Walder, Ken; Horlock, Duncan; Williams, David; Nelson, Erin; Byrne, Melissa; Jandeleit-Dahm, Karin; Zimmet, Paul; Kaye, David M


    Heart failure (HF) is an increasingly recognized complication of diabetes. Cardiac fibrosis is an important causative mechanism of HF associated with diabetes. Recent data indicate that inflammation may be particularly important in the pathogenesis of cardiovascular fibrosis. We sought to determine the mechanism by which cardiac fibrosis develops and to specifically investigate the role of the CXCR4 axis in this process. Animals with type I diabetes (streptozotocin treated mice) or type II diabetes (Israeli Sand-rats) and controls were randomized to treatment with a CXCR4 antagonist, candesartan or vehicle control. Additional groups of mice also underwent bone marrow transplantation (GFP+ donor marrow) to investigate the potential role of bone marrow derived cell mobilization in the pathogenesis of cardiac fibrosis. Both type I and II models of diabetes were accompanied by the development of significant cardiac fibrosis. CXCR4 antagonism markedly reduced cardiac fibrosis in both models of diabetes, similar in magnitude to that seen with candesartan. In contrast to candesartan, the anti-fibrotic actions of CXCR4 antagonism occurred in a blood pressure independent manner. Whilst the induction of diabetes did not increase the overall myocardial burden of GFP+ cells, it was accompanied by an increase in GFP+ cells expressing the fibroblast marker alpha-smooth muscle actin and this was attenuated by CXCR4 antagonism. CXCR4 antagonism was also accompanied by increased levels of circulating regulatory T cells. Taken together the current data indicate that pharmacological inhibition of CXCR4 significantly reduces diabetes induced cardiac fibrosis, providing a potentially important therapeutic approach.

  7. Hematopoietic Akt2 deficiency attenuates the progression of atherosclerosis

    PubMed Central

    Rotllan, Noemi; Chamorro-Jorganes, Aránzazu; Araldi, Elisa; Wanschel, Amarylis C.; Aryal, Binod; Aranda, Juan F.; Goedeke, Leigh; Salerno, Alessandro G.; Ramírez, Cristina M.; Sessa, William C.; Suárez, Yajaira; Fernández-Hernando, Carlos


    Atherosclerosis is the major cause of death and disability in diabetic and obese subjects with insulin resistance. Akt2, a phosphoinositide-dependent serine-threonine protein kinase, is highly express in insulin-responsive tissues; however, its role during the progression of atherosclerosis remains unknown. Thus, we aimed to investigate the contribution of Akt2 during the progression of atherosclerosis. We found that germ-line Akt2-deficient mice develop similar atherosclerotic plaques as wild-type mice despite higher plasma lipids and glucose levels. It is noteworthy that transplantation of bone marrow cells isolated from Akt2−/− mice to Ldlr−/− mice results in marked reduction of the progression of atherosclerosis compared with Ldlr−/− mice transplanted with wild-type bone marrow cells. In vitro studies indicate that Akt2 is required for macrophage migration in response to proatherogenic cytokines (monocyte chemotactic protein-1 and macrophage colony-stimulating factor). Moreover, Akt2−/− macrophages accumulate less cholesterol and have an alternative activated or M2-type phenotype when stimulated with proinflammatory cytokines. Together, these results provide evidence that macrophage Akt2 regulates migration, the inflammatory response and cholesterol metabolism and suggest that targeting Akt2 in macrophages might be beneficial for treating atherosclerosis.—Rotllan, N., Chamorro-Jorganes, A., Araldi, E., Wanschel, A. C., Aryal, B., Aranda, J. F., Goedeke, L., Salerno, A. G., Ramírez, C. M., Sessa,W. C., Suárez, Y., Fernández-Hernando, C. Hematopoietic Akt2 deficiency attenuates the progression of atherosclerosis. PMID:25392271

  8. Accurate Measurement of Bone Density with QCT

    NASA Technical Reports Server (NTRS)

    Cleek, Tammy M.; Beaupre, Gary S.; Matsubara, Miki; Whalen, Robert T.; Dalton, Bonnie P. (Technical Monitor)


    The objective of this study was to determine the accuracy of bone density measurement with a new OCT technology. A phantom was fabricated using two materials, a water-equivalent compound and hydroxyapatite (HA), combined in precise proportions (QRM GrnbH, Germany). The phantom was designed to have the approximate physical size and range in bone density as a human calcaneus, with regions of 0, 50, 100, 200, 400, and 800 mg/cc HA. The phantom was scanned at 80, 120 and 140 KVp with a GE CT/i HiSpeed Advantage scanner. A ring of highly attenuating material (polyvinyl chloride or teflon) was slipped over the phantom to alter the image by introducing non-axi-symmetric beam hardening. Images were corrected with a new OCT technology using an estimate of the effective X-ray beam spectrum to eliminate beam hardening artifacts. The algorithm computes the volume fraction of HA and water-equivalent matrix in each voxel. We found excellent agreement between expected and computed HA volume fractions. Results were insensitive to beam hardening ring material, HA concentration, and scan voltage settings. Data from all 3 voltages with a best fit linear regression are displays.

  9. E-selectin ligand 1 regulates bone remodeling by limiting bioactive TGF-β in the bone microenvironment.


    Yang, Tao; Grafe, Ingo; Bae, Yangjin; Chen, Shan; Chen, Yuqing; Bertin, Terry K; Jiang, Ming-Ming; Ambrose, Catherine G; Lee, Brendan


    TGF-β is abundantly produced in the skeletal system and plays a crucial role in skeletal homeostasis. E-selectin ligand-1 (ESL-1), a Golgi apparatus-localized protein, acts as a negative regulator of TGF-β bioavailability by attenuating maturation of pro-TGF-β during cartilage homeostasis. However, whether regulation of intracellular TGF-β maturation by ESL-1 is also crucial during bone homeostasis has not been well defined. Here, we show that Esl-1(-/-) mice exhibit a severe osteopenia with elevated bone resorption and decreased bone mineralization. In primary culture, Esl-1(-/-) osteoclast progenitors show no difference in osteoclastogenesis. However, Esl-1(-/-) osteoblasts show delayed differentiation and mineralization and stimulate osteoclastogenesis more potently in the osteoblast-osteoclast coculture, suggesting that ESL-1 primarily acts in osteoblasts to regulate bone homeostasis. In addition, Esl-1(-/-) calvaria exhibit an elevated mature TGF-β/pro-TGF-β ratio, with increased expression of TGF-β downstream targets (plasminogen activator inhibitor-1, parathyroid hormone-related peptide, connective tissue growth factor, and matrix metallopeptidase 13, etc.) and a key regulator of osteoclastogenesis (receptor activator of nuclear factor κB ligand). Moreover, in vivo treatment with 1D11, a pan-TGF-β antibody, significantly improved the low bone mass of Esl-1(-/-) mice, suggesting that elevated TGF-β signaling is the major cause of osteopenia in Esl-1(-/-) mice. In summary, our study identifies ESL-1 as an important regulator of bone remodeling and demonstrates that the modulation of TGF-β maturation is pivotal in the maintenance of a homeostatic bone microenvironment and for proper osteoblast-osteoclast coupling.

  10. Increased expression of acid-sensing ion channel 3 within dorsal root ganglia in a rat model of bone cancer pain.


    Qiu, Fang; Wei, Xiaoli; Zhang, Shuzhuo; Yuan, Weixiu; Mi, Weidong


    In an attempt to investigate the underlying mechanisms of cancer-induced bone pain, we investigated the presence of acid-sensing ion channel 3 (ASIC3) in dorsal root ganglia (DRG) neurons in an animal model of bone cancer pain. Forty-five female Sprague-Dawley rats were randomized into three groups: sham-operation group (sham), cancer-bearing animals killed after 7 days (C7), and cancer-bearing animals killed after 14 days (C14). After establishment of the bone cancer pain model, pain-related behavioral tests were performed to determine the paw withdrawal threshold of mechanical allodynia and thermal hyperalgesia, respectively. Reverse transcription-PCR, western blot, and immunofluorescence were used to determine mRNA and protein expression of ASIC3 in ipsilateral and contralateral lumbar 4-5 DRG neurons. Compared with the sham group, paw withdrawal threshold of mechanical allodynia and thermal hyperalgesia in the C14 group showed a significant decrease (P<0.01) from postoperation day 7 to the termination of the experiment. Compared with the sham group, the ipsilateral but not contralateral mRNA of ASIC3 was upregulated in the C14 group. Meanwhile, the ipsilateral protein expression of ASIC3 was increased in the C7 and C14 group compared with the sham group. Double-labeled immunofluorescence showed that ASIC3 and isolectin-B4 (IB4)-colocalized small DRG neurons in the C14 group were more than that in the sham group. Furthermore, we also found that there were more ASIC3 and neurofilament 200 (NF200)-colocalized DRG neurons in the C14 group than in the sham group. The upregulation of mRNA and protein levels of ASIC3 suggested its potential involvement in the development and maintenance of cancer-induced bone pain.

  11. Miscellaneous indications in bone scintigraphy: metabolic bone diseases and malignant bone tumors.


    Cook, Gary J R; Gnanasegaran, Gopinath; Chua, Sue


    The diphosphonate bone scan is ideally suited to assess many global, focal or multifocal metabolic bone disorders and there remains a role for conventional bone scintigraphy in metabolic bone disorders at diagnosis, investigation of complications, and treatment response assessment. In contrast, the role of bone scintigraphy in the evaluation of primary malignant bone tumors has reduced with the improvement of morphologic imaging, such as computed tomography and magnetic resonance imaging. However, an increasing role for (18)F-fluorodeoxyglucose positron emission tomography and positron emission tomography/computed tomography is emerging as a functional assessment at diagnosis, staging, and neoadjuvant treatment response assessment.

  12. Vascularized bone grafts for the treatment of carpal bone pathology.


    Derby, Brian M; Murray, Peter M; Shin, Alexander Y; Bueno, Reuben A; Mathoulin, Christophe L; Ade, Tim; Neumeister, Michael W


    Primary bone healing fails to occur in 5-15 % of scaphoid bones that undergo fracture fixation. Untreated, occult fractures result in nonunion up to 12 % of the time. Conventional bone grafting is the accepted management in the treatment algorithm of scaphoid nonunion if the proximal pole is vascularized. Osteonecrosis of the proximal scaphoid pole intuitively suggests a need for transfer of the vascularized bone to the nonunion site. Scaphoid nonunion treatment aims to prevent biological and mechanical subsidence of the involved bone, destabilization of the carpus, and early degenerative changes associated with scaphoid nonunion advanced collapse. Pedicled distal radius and free vascularized bone grafts (VBGs) offer hand surgeons an alternative treatment option in the management of carpal bone nonunion. VBGs are also indicated in the treatment of avascular necrosis of the scaphoid (Preiser's disease), lunate (Kienböck's disease), and capitate. Relative contraindications to pedicled dorsal radius vascularized bone grafting include humpback deformity, carpal instability, or collapse. The free medial femoral condyle bone graft has offered a novel treatment option for the humpback deformity to restore geometry of the carpus, otherwise not provided by pedicled grafts. In general, VBGs are contraindicated in the setting of a carpal bone without an intact cartilaginous shell, in advanced carpal collapse with degenerative changes, and in attempts to salvage small or collapsed bone fragments. Wrist salvage procedures are generally accepted as the more definitive treatment option under such circumstances. This manuscript offers a current review of the techniques and outcomes of VBGs to the carpal bones.

  13. MODIS Solar Diffuser Attenuation Screen Modeling Results

    NASA Technical Reports Server (NTRS)

    Waluschka, Eugene; Xuong, Xiaoxiong; Guenther, Bruce; Barnes, William


    On-orbit calibration of the reflected solar bands on the EOS Moderate Resolution Imaging Spectroradiometer (MODIS) is accomplished by have the instrument view a high reflectance diffuse surface illuminated by the sun. For some of the spectral bands this proves to be much too bright a signal that results in the saturation of detectors designed for measuring low reflectance (ocean) surfaces signals. A mechanical attenuation device in the form of a pin hole screen is used to reduce the signals to calibrate these bands. The sensor response to solar illumination of the SD with and without the attenuation screen in place will be presented. The MODIS detector response to the solar diffuser is smooth when the attenuation screen is absent, but has structures up to a few percent when the attenuation screen is present. This structure corresponds to non-uniform illumination from the solar diffuser. Each pin hole produces a pin-hole image of the sun on the solar diffuser, and there are very many pin hole images of the sun on the solar diffuser for each MODIS detector. Even though there are very many pin-hole images of the sun on the solar diffuser, it is no longer perfectly uniformly illuminated. This non-uniformly illuminated solar diffuser produces intensity variation on the focal planes. The results of a very detailed simulation will be discussed which show how the illumination of the focal plane changes as a result of the attenuation, and the impacts on the calibration will be discussed.

  14. Yellowstone Attenuation Tomography from Ambient Seismic Noise

    NASA Astrophysics Data System (ADS)

    Doungkaew, N.; Seats, K.; Lawrence, J. F.


    The goal of this study is to create a tomographic attenuation image for the Yellowstone region by analyzing ambient seismic noise. An attenuation image generated from ambient noise should provide more information about the structure and properties beneath Yellowstone, especially the caldera, which is known to be active. I applied the method of Lawrence & Prieto [2011] to examine lateral variations in the attenuation structure of Yellowstone. Ambient noise data were collected from broadband seismic stations located around Yellowstone National Park from 1999-2013. Noise correlation functions derived from cross correlations of the ambient noise at two stations were used to calculate a distance dependent decay (an attenuation coefficient) at each period and distance. An inversion was then performed to isolate and localize the spatial attenuation coefficients within the study area. I observe high amplitude decay of the ambient noise at the Yellowstone caldera, most likely due to elevated temperature and crustal melts caused by volcanism, geothermal heat flow, and hydrothermal activity such as geysers.

  15. Enabling photon counting detectors with dynamic attenuators

    NASA Astrophysics Data System (ADS)

    Hsieh, Scott S.; Pelc, Norbert J.


    Photon-counting x-ray detectors (PCXDs) are being investigated as a replacement for conventional x-ray detectors because they promise several advantages, including better dose efficiency, higher resolution and spectral imaging. However, many of these advantages disappear when the x-ray flux incident on the detector is too high. We recently proposed a dynamic, piecewise-linear attenuator (or beam shaping filter) that can control the flux incident on the detector. This can restrict the operating range of the PCXD to keep the incident count rate below a given limit. We simulated a system with the piecewise-linear attenuator and a PCXD using raw data generated from forward projected DICOM files. We investigated the classic paralyzable and nonparalyzable PCXD as well as a weighted average of the two, with the weights chosen to mimic an existing PCXD (Taguchi et al, Med Phys 2011). The dynamic attenuator has small synergistic benefits with the nonparalyzable detector and large synergistic benefits with the paralyzable detector. Real PCXDs operate somewhere between these models, and the weighted average model still shows large benefits from the dynamic attenuator. We conclude that dynamic attenuators can reduce the count rate performance necessary for adopting PCXDs.

  16. Attenuation tomography in West Bohemia/Vogtland

    NASA Astrophysics Data System (ADS)

    Mousavi, Sima; Haberland, Christian; Bauer, Klaus; Hejrani, Babak; Korn, Michael


    We present a three-dimensional (3-D) P-wave attenuation (Qp) model for the geodynamically active swarm earthquake area of West Bohemia/Vogtland in the Czech/German border region. Path-averaged attenuation t* is calculated from amplitude spectra of time windows around the P-wave arrivals of local earthquakes. Average t/t* value or Qp for stations close to Nový Kostel are very low (< 150) compared to that of stations located further away from the focal zone (increases up to 500 within 80 km distance). The SIMUL2000 tomography scheme is used to invert the t* for P-wave attenuation perturbation. Analysis of resolution shows that our model is well-resolved in the vicinity of earthquake swarm hypocenters. The prominent features of the model are located around Nový Kostel focal zone and its northern vicinity. Beneath Nový Kostel a vertically stretched (down to depth of 11 km) and a highly attenuating body is observed. We believe that this is due to fracturing and high density of cracks inside the weak earthquake swarm zone in conjunction with presence of free gas/fluid. Further north of Nový Kostel two highly attenuating bodies are imaged which could represent fluid channels toward the surface. The eastern anomaly shows a good correlation with the fluid accumulation area which was suggested in 9HR seismic profile.

  17. Genetics Home Reference: Paget disease of bone


    ... Conditions Paget disease of bone Paget disease of bone Enable Javascript to view the expand/collapse boxes. ... Open All Close All Description Paget disease of bone is a disorder that causes bones to grow ...

  18. Bones, Muscles, and Joints: The Musculoskeletal System


    ... are where two bones meet. They make the skeleton flexible — without them, movement would be impossible. Muscles ... Bones and What Do They Do? The human skeleton has 206 bones. Our bones begin to develop ...

  19. Vitamin D, Calcium, and Bone Health


    ... in Balance › Vitamin D, Calcium, and Bone Health Vitamin D, Calcium, and Bone Health March 2012 Download ... also helps keep your bones strong. Why are vitamin D and calcium important to bone health? Vitamin ...

  20. GATA4 negatively regulates bone sialoprotein expression in osteoblasts

    PubMed Central

    Song, Insun; Jeong, Byung-chul; Choi, Yong Jun; Chung, Yoon-Sok; Kim, Nacksung


    GATA4 has been reported to act as a negative regulator in osteoblast differentiation by inhibiting the Dlx5 transactivation of Runx2 via the attenuation of the binding ability of Dlx5 to the Runx2 promoter region. Here, we determine the role of GATA4 in the regulation of bone sialoprotein (Bsp) in osteoblasts. We observed that the overexpression of Runx2 or Sox9 induced the Bsp expression in osteoblastic cells. Silencing GATA4 further enhanced the Runx2- and Sox9-mediated Bsp promoter activity, whereas GATA4 overexpression down-regulated Bsp promoter activity mediated by Runx2 and Sox9. GATA4 also interacted with Runx2 and Sox9, by attenuating the binding ability of Runx2 and Sox9 to the Bsp promoter region. Our data suggest that GATA4 acts as a negative regulator of Bsp expression in osteoblasts. [BMB Reports 2016; 49(6): 343-348] PMID:26973342

  1. Altered bone turnover during spaceflight

    NASA Technical Reports Server (NTRS)

    Turner, R. T.; Morey, E. R.; Liu, C.; Baylink, D. J.


    Modifications in calcium metabolism during spaceflight were studied, using parameters that reflect bone turnover. Bone formation rate, medullary area, bone length, bone density, pore size distribution, and differential bone cell number were evaluated in growing rate both immediately after and 25 days after orbital spaceflights aboard the Soviet biological satellites Cosmos 782 and 936. The primary effect of space flight on bone turnover was a reversible inhibition of bone formation at the periosteal surface. A simultaneous increase in the length of the periosteal arrest line suggests that bone formation ceased along corresponding portions of that surface. Possible reasons include increased secretion of glucocorticoids and mechanical unloading of the skeleton due to near-weightlessness, while starvation and immobilization are excluded as causes.

  2. How Is Bone Cancer Diagnosed?


    ... solid. The cancer can also appear as a hole in the bone. Sometimes doctors can see a ... the bone scan image as dense, gray to black areas, called “hot spots.” These areas suggest metastatic ...

  3. Bone regeneration during distraction osteogenesis.


    Amir, Lisa R; Everts, Vincent; Bronckers, Antonius L J J


    Bone has the capacity to regenerate in response to injury. During distraction osteogenesis, the renewal of bone is enhanced by gradual stretching of the soft connective tissues in the gap area between two separated bone segments. This procedure has received much clinical attention as a way to correct congenital growth retardation of bone tissue or to generate bone to fill skeletal defects. The process of bone regeneration involves a complex system of biological changes whereby mechanical stress is converted into a cascade of signals that activate cellular behavior resulting in (enhanced) formation of bone. Over the last decade, significant progress has been made in understanding the bone regeneration process during distraction osteogenesis. The mechanical and biological factors that are important for the success of the distraction treatment have been partially characterized and are discussed in this review.

  4. Pregnancy, Breastfeeding, and Bone Health


    ... supported by your browser. Home Osteoporosis Women Pregnancy, Breastfeeding, and Bone Health Publication available in: PDF (63 ... to get enough calcium during pregnancy and breastfeeding. Breastfeeding and Bone Health Breastfeeding also affects a mother’s ...

  5. Graphite-reinforced bone cement

    NASA Technical Reports Server (NTRS)

    Knoell, A. C.


    Chopped graphite fibers added to surgical bone cement form bonding agent with mechanical properties closely matched to those of bone. Curing reaction produces less heat, resulting in reduced traumatization of body tissues. Stiffness is increased without affecting flexural strength.

  6. Cutting thin sections of bone

    NASA Technical Reports Server (NTRS)

    Ashley, W. W.


    Medical equipment for obtaining repetitive planoparallel sections of bone to study healing of bone structure under high gravity stress is described. Device consists of modified saw with diamond cutting edges. Construction of device and manner of use are explained.

  7. Bone and cancer: the osteoncology

    PubMed Central

    Ibrahim, Toni; Mercatali, Laura; Amadori, Dino


    Summary In recent years clinicians have witnessed a radical change in the relationship between bone and cancer, with in particular an increase in bone metastases incidence due to an improvement of patients survival. Bone metastases are responsible for the high morbidity in cancer patients with a strong clinical impact. For all these reasons, efforts have been directed to this important field with the foundation of the osteoncology, a new scientific and clinical branch involved in the management of patients with bone cancer disease, including primary bone tumors and bone metastases. Another innovative and important osteoncology topic is the Cancer Treatment Induced Bone Loss (CTIBL) that is mainly caused by antitumoral treatment with bone resorption induction. The diagnostic and therapeutic options are described briefly in order to highlight the importance of the multidisciplinary approach in this new field. PMID:24133529

  8. Bone-marrow transplant - slideshow


    ... this page: // Bone-marrow transplant - series—Normal anatomy To use the sharing ... Go to slide 4 out of 4 Overview Bone-marrow is a soft, fatty tissue found inside of ...

  9. Precision of Four Acoustic Bone Measurement Devices

    NASA Technical Reports Server (NTRS)

    Miller, Christopher; Rianon, Nahid; Feiveson, Alan; Shackelford, Linda; LeBlanc, Adrian


    Though many studies have quantified the precision of various acoustic bone measurement devices, it is difficult to directly compare the results among the studies, because they used disparate subject pools, did not specify the estimation methodology, or did not use consistent definitions for various precision characteristics. In this study, we used a repeated measures design protocol to directly determine the precision characteristics of four acoustic bone measurement devices: the Mechanical Response Tissue Analyzer (MRTA), the UBA-575+, the SoundScan 2000 (S2000), and the Sahara Ultrasound Bone Analyzer. Ten men and ten women were scanned on all four devices by two different operators at five discrete time points: Week 1, Week 2, Week 3, Month 3 and Month 6. The percent coefficient of variation (%CV) and standardized coefficient of variation were computed for the following precision characteristics: interoperator effect, operator-subject interaction, short-term error variance, and long-term drift. The MRTA had high interoperator errors for its ulnar and tibial stiffness measures and a large long-term drift in its tibial stiffness measurement. The UBA-575+ exhibited large short-term error variances and long-term drift for all three of its measurements. The S2000's tibial speed of sound measurement showed a high short-term error variance and a significant operator-subject interaction but very good values (less than 1%) for the other precision characteristics. The Sahara seemed to have the best overall performance, but was hampered by a large %CV for short-term error variance in its broadband ultrasound attenuation measure.

  10. Mechanisms of PDGF siRNA-mediated inhibition of bone cancer pain in the spinal cord

    PubMed Central

    Xu, Yang; Liu, Jia; He, Mu; Liu, Ran; Belegu, Visar; Dai, Ping; Liu, Wei; Wang, Wei; Xia, Qing-Jie; Shang, Fei-Fei; Luo, Chao-Zhi; Zhou, Xue; Liu, Su; McDonald, JohnW.; Liu, Jin; Zuo, Yun-Xia; Liu, Fei; Wang, Ting-Hua


    Patients with tumors that metastasize to bone frequently suffer from debilitating pain, and effective therapies for treating bone cancer are lacking. This study employed a novel strategy in which herpes simplex virus (HSV) carrying a small interfering RNA (siRNA) targeting platelet-derived growth factor (PDGF) was used to alleviate bone cancer pain. HSV carrying PDGF siRNA was established and intrathecally injected into the cavum subarachnoidale of animals suffering from bone cancer pain and animals in the negative group. Sensory function was assessed by measuring thermal and mechanical hyperalgesia. The mechanism by which PDGF regulates pain was also investigated by comparing the differential expression of pPDGFRα/β and phosphorylated ERK and AKT. Thermal and mechanical hyperalgesia developed in the rats with bone cancer pain, and these effects were accompanied by bone destruction in the tibia. Intrathecal injection of PDGF siRNA and morphine reversed thermal and mechanical hyperalgesia in rats with bone cancer pain. In addition, we observed attenuated astrocyte hypertrophy, down-regulated pPDGFRα/β levels, reduced levels of the neurochemical SP, a reduction in CGRP fibers and changes in pERK/ERK and pAKT/AKT ratios. These results demonstrate that PDGF siRNA can effectively treat pain induced by bone cancer by blocking the AKT-ERK signaling pathway. PMID:27282805

  11. The Biological Effects of Dickkopf1 on Small Cell Lung Cancer Cells and Bone Metastasis.


    Pang, Hailin; Ma, Ningqiang; Jiao, Mi; Shen, Weiwei; Xin, Bo; Wang, Tongfei; Zhang, Feng; Liu, Lili; Zhang, Helong


    The bone is among the most common sites of metastasis in patients with lung cancer. Over 30%-40% of lung cancers can develop bone metastasis, and no effective therapeutic methods exist in clinic cases. Wnt/β-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferentially metastasizes to the skeleton. However, the role of DKK1 in osteotropism of small cell lung cancer (SCLC) remains to be elucidated. This study aimed to define the role of DKK1 in SCLC bone metastasis and investigate the underlying mechanisms. Our results demonstrated that the expression level of DKK1 was dramatically higher in bone metastatic SCLC cells (SBC-5 cell line) compared with that in cells without bone metastatic ability (SBC-3 cell line). Therefore, we hypothesized that DKK1 was involved in the bone metastasis of SCLC. We then suppressed the DKK1 expression in SBC-5 cells by RNAi and found that downregulation of DKK1 can inhibit cell proliferation, colony formation, cell migration, and invasion, but increase the apoptosis rate. Downregulation of DKK1 did not affect the cell cycle progression of SBC-5 cells in vitro. In vivo, downregulated DKK1 in SBC-5 cells resulted in attenuated bone metastasis. These results indicated that DKK1 may be an important regulator in bone metastases of SCLC, and targeting DKK1 may be an effective method to prevent and treat skeleton metastases in SCLC cases.

  12. AQP9: a novel target for bone loss induced by microgravity.


    Bu, Guoyun; Shuang, Feng; Wu, Ye; Ren, Dongfeng; Hou, Shuxun


    The aim of current study was to elucidate whether aquaporin-9 (AQP9) expression was involved in the progression of bone loss induced by microgravity. We used the hind-limb suspension (HLS) mice model to simulate microgravity and induce bone loss. It was found that HLS exposure decreased femur bone mineral density (BMD), and enhanced femur AQP9 mRNA and protein levels. Then, the relationship between AQP9 mRNA expression and BMD was studied and it was showed that femur AQP9 mRNA level was negatively related to femur BMD in mice exposed to HLS. We sought to exam the function of AQP9 in the femur using the AQP9-null mice. It was found that AQP9 knockout attenuated bone loss and inhibited osteoclastogenesis under the condition of HLS exposure, but had no similar effect on bone under normal physiological conditions. In addition, it was found that exposure to simulated hypergravity or exercise training, main countermeasures against microgravity, reduced AQP9 mRNA and protein levels in femur of mice. Moreover, it was found that both aging and estrogen deprivation, another two risk factors of bone loss, had no significant effect on femur AQP9 expression. In conclusion, AQP9 plays an important role in the development of microgravity-induced bone loss, and may be a potential target for the prevention or management of microgravity-induced bone loss.

  13. Dietary protein: an essential nutrient for bone health.


    Bonjour, Jean-Philippe


    Nutrition plays a major role in the development and maintenance of bone structures resistant to usual mechanical loadings. In addition to calcium in the presence of an adequate vitamin D supply, proteins represent a key nutrient for bone health, and thereby in the prevention of osteoporosis. In sharp opposition to experimental and clinical evidence, it has been alleged that proteins, particularly those from animal sources, might be deleterious for bone health by inducing chronic metabolic acidosis which in turn would be responsible for increased calciuria and accelerated mineral dissolution. This claim is based on an hypothesis that artificially assembles various notions, including in vitro observations on the physical-chemical property of apatite crystal, short term human studies on the calciuric response to increased protein intakes, as well as retrospective inter-ethnic comparisons on the prevalence of hip fractures. The main purpose of this review is to analyze the evidence that refutes a relation of causality between the elements of this putative patho-physiol