Science.gov

Sample records for attenuates bone cancer-induced

  1. Inhibition of spinal UCHL1 attenuates pain facilitation in a cancer-induced bone pain model by inhibiting ubiquitin and glial activation

    PubMed Central

    Cheng, Wei; Chen, Yuan-Li; Wu, Liang; Miao, Bei; Yin, Qin; Wang, Jin-Feng; Fu, Zhi-Jian

    2016-01-01

    The present study examined alterations of spinal ubiquitin C-terminal hydrolase L1 (UCHL1), ubiquitin expression and glial activation in the cancer-induced bone pain rats. Furthermore, whether inhibition of spinal UCHL1 could alleviate cancer-induced bone pain was observed. The CIBP model was established by intrathecal Walker 256 mammary gland carcinoma cells in SD rats. The rats of CIBP developed significant pain facilitation in the Von Frey test. Double immunofluorescence analyses revealed that in the spines of CIBP rats, ubiquitin co-localized with NeuN, Iba-1 or GFAP; UCHL1 and NeuN were co-expressed and UCHL1 also co-localized with ubiquitin. The CIBP model induced up-regulation of ubiquitin and UCHL1 in the spines, as well as glial activation. Inhibition of spinal UCHL1 attenuated pain facilitation by down-regulation of ubiquitin expression and glial activation. in the CIBP rats. Our data suggests that UCHL1/ubiquitin distributed and increased in the spines of CIBP rats, that glial activation also increased in the CIBP model and that inhibition of spinal UCHL1 may be an effective method to alleviate cancer-induced bone pain. PMID:27508024

  2. Acupuncture for Cancer-Induced Bone Pain?

    PubMed Central

    Paley, Carole A.; Bennett, Michael I.; Johnson, Mark I.

    2011-01-01

    Bone pain is the most common type of pain in cancer. Bony metastases are common in advanced cancers, particularly in multiple myeloma, breast, prostate or lung cancer. Current pain-relieving strategies include the use of opioid-based analgesia, bisphosphonates and radiotherapy. Although patients experience some pain relief, these interventions may produce unacceptable side-effects which inevitably affect the quality of life. Acupuncture may represent a potentially valuable adjunct to existing strategies for pain relief and it is known to be relatively free of harmful side-effects. Although acupuncture is used in palliative care settings for all types of cancer pain the evidence-base is sparse and inconclusive and there is very little evidence to show its effectiveness in relieving cancer-induced bone pain (CIBP). The aim of this critical review is to consider the known physiological effects of acupuncture and discuss these in the context of the pathophysiology of malignant bone pain. The aim of future research should be to produce an effective protocol for treating CIBP with acupuncture based on a sound, evidence-based rationale. The physiological mechanisms presented in this review suggest that this is a realistic objective. PMID:21799687

  3. Upregulation of (C-X-C motif) Ligand 13 (CXCL13) Attenuates Morphine Analgesia in Rats with Cancer-Induced Bone Pain

    PubMed Central

    Wang, Shi-Feng; Dong, Cheng-Gong; Yang, Xue; Yin, Jian-Jun

    2016-01-01

    Background The aim of this study was to investigate the role of chemokine (C-X-C motif) ligand 13 (CXCL13) in morphine tolerance in rats with cancer-induced bone pain (CIBP). Material/Methods We established a rat CIBP model and a rat CIBP-morphine tolerance (BM) model. BM rats were intrathecally administered rmCXCL13, neutralizing anti-CXCL13, and normal saline, while the control group rats underwent a sham operation and were injected with normal saline. The morphine analgesia was assessed by measuring mechanical withdrawal threshold (MWT) and mechanical withdrawal duration (MWD) at various time points. The co-expressions of CXCL13 and NeuN were measured by immunofluorescence double-staining. CXCL13 protein and mRNA expressions were detected by Western blot and quantitative real-time polymerase chain reaction (RT-qPCR), respectively. Results Compared to the sham-operation (S) group, the BM group showed obviously decreased MWT and increased MWD on Day 9 after CIBP, but obviously increased MWT and decreased MWD on Day 3 after morphine administration; subsequently, the MWT was decreased and MWD was increased (all P<0.05). In comparison with the S+saline group, increased MWT and decreased MWD were observed in BM rats on Day 3 after anti-CXCL13 administration, and obviously decreased MWT and increased MWD were found in BM rats on Day 3 after rmCXCL13 administration (all P<0.05). Conclusions Up-regulated CXCL13 has a negative role in morphine analgesia in relief of CIBP, which may provide a new target for the management of CIBP. PMID:27892451

  4. Pain and nociception: mechanisms of cancer-induced bone pain.

    PubMed

    Falk, Sarah; Dickenson, Anthony H

    2014-06-01

    Cancer pain, especially pain caused by metastasis to bone, is a severe type of pain, and unless the cause and consequences can be resolved, the pain will become chronic. As detection and survival among patients with cancer have improved, pain has become an increasing challenge, because traditional therapies are often only partially effective. Until recently, knowledge of cancer pain mechanisms was poor compared with understanding of neuropathic and inflammatory pain states. We now view cancer-induced bone pain as a complex pain state involving components of both inflammatory and neuropathic pain but also exhibiting elements that seem unique to cancer pain. In addition, the pain state is often unpredictable, and the intensity of the pain is highly variable, making it difficult to manage. The establishment of translational animal models has started to reveal some of the molecular components involved in cancer pain. We present the essential pharmacologic and neurobiologic mechanisms involved in the generation and continuance of cancer-induced bone pain and discuss these in the context of understanding and treating patients. We discuss changes in peripheral signaling in the area of tumor growth, examine spinal cord mechanisms of sensitization, and finally address central processing. Our aim is to provide a mechanistic background for the sensory characteristics of cancer-induced bone pain as a basis for better understanding and treating this condition.

  5. Cancer-induced bone pain: Mechanisms and models.

    PubMed

    Lozano-Ondoua, A N; Symons-Liguori, A M; Vanderah, T W

    2013-12-17

    Cancerous cells can originate in a number of different tissues such as prostate, breast and lung, but often go undetected and are non-painful. Many types of cancers have a propensity to metastasize to the bone microenvironment first. Tumor burden within the bone causes excruciating breakthrough pain with properties of ongoing pain that is inadequately managed with current analgesics. Part of this failure is due to the poor understanding of the etiology of cancer pain. Animal models of cancer-induced bone pain (CIBP) have revealed that the neurochemistry of cancer has features distinctive from other chronic pain states. For example, preclinical models of metastatic cancer often result in the positive modulation of neurotrophins, such as NGF and BDNF, that can lead to nociceptive sensitization. Preclinical cancer models also demonstrate nociceptive neuronal expression of acid-sensing receptors, such as ASIC1 and TRPV1, which respond to cancer-induced acidity within the bone. CIBP is correlated with a significant increase in pro-inflammatory mediators acting peripherally and centrally, contributing to neuronal hypersensitive states. Finally, cancer cells generate high levels of oxidative molecules that are thought to increase extracellular glutamate concentrations, thus activating primary afferent neurons. Knowledge of the unique neuro-molecular profile of cancer pain will ultimately lead to the development of novel and superior therapeutics for CIBP.

  6. Monocyte chemoattractant protein-1 contributes to morphine tolerance in rats with cancer-induced bone pain

    PubMed Central

    Liu, Lei; Gao, Xiu-Juan; Ren, Chun-Guang; Hu, Ji-Hua; Liu, Xian-Wen; Zhang, Ping; Zhang, Zong-Wang; Fu, Zhi-Jian

    2017-01-01

    Cancer-induced bone pain can severely compromise the life quality of patients, while tolerance limits the use of opioids in the treatment of cancer pain. Monocyte chemoattractant protein-1 (MCP-1) is known to contribute to neuropathic pain. However, the role of spinal MCP-1 in the development of morphine tolerance in patients with cancer-induced bone pain remains unclear. The aim of the present study was to investigate the role of spinal MCP-1 in morphine tolerance in bone cancer pain rats (MTBP rats). Bone cancer pain was induced by intramedullary injection of Walker 256 cells into the tibia of the rats, while morphine tolerance was induced by continuous intrathecal injection of morphine over a period of 9 days. In addition, anti-MCP-1 antibodies were intrathecally injected to rats in various groups in order to investigate the association of MCP-1 with mechanical and heat hyperalgesia using the paw withdrawal threshold (PWT) and thermal withdrawal latency (TWL) tests, respectively. Furthermore, MCP-1 and CCR2 expression levels were measured using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis, and CCR2 expression levels were measured using RT-qPCR. The results indicated that MCP-1 and CCR2 expression levels were significantly increased in the spinal cord of MTBP rats. Intrathecal administration of anti-MCP-1 neutralizing antibodies was observed to attenuate the mechanical and thermal allodynia in MTBP rats. Therefore, the upregulation of spinal MCP-1 and CCR2 expression levels may contribute to the development of mechanical allodynia in MTBP rats. In conclusion, MCP-1/CCR2 signaling may serve a crucial role in morphine tolerance development in rats suffering from cancer-induced bone pain. PMID:28352316

  7. Monocyte chemoattractant protein-1 contributes to morphine tolerance in rats with cancer-induced bone pain.

    PubMed

    Liu, Lei; Gao, Xiu-Juan; Ren, Chun-Guang; Hu, Ji-Hua; Liu, Xian-Wen; Zhang, Ping; Zhang, Zong-Wang; Fu, Zhi-Jian

    2017-02-01

    Cancer-induced bone pain can severely compromise the life quality of patients, while tolerance limits the use of opioids in the treatment of cancer pain. Monocyte chemoattractant protein-1 (MCP-1) is known to contribute to neuropathic pain. However, the role of spinal MCP-1 in the development of morphine tolerance in patients with cancer-induced bone pain remains unclear. The aim of the present study was to investigate the role of spinal MCP-1 in morphine tolerance in bone cancer pain rats (MTBP rats). Bone cancer pain was induced by intramedullary injection of Walker 256 cells into the tibia of the rats, while morphine tolerance was induced by continuous intrathecal injection of morphine over a period of 9 days. In addition, anti-MCP-1 antibodies were intrathecally injected to rats in various groups in order to investigate the association of MCP-1 with mechanical and heat hyperalgesia using the paw withdrawal threshold (PWT) and thermal withdrawal latency (TWL) tests, respectively. Furthermore, MCP-1 and CCR2 expression levels were measured using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis, and CCR2 expression levels were measured using RT-qPCR. The results indicated that MCP-1 and CCR2 expression levels were significantly increased in the spinal cord of MTBP rats. Intrathecal administration of anti-MCP-1 neutralizing antibodies was observed to attenuate the mechanical and thermal allodynia in MTBP rats. Therefore, the upregulation of spinal MCP-1 and CCR2 expression levels may contribute to the development of mechanical allodynia in MTBP rats. In conclusion, MCP-1/CCR2 signaling may serve a crucial role in morphine tolerance development in rats suffering from cancer-induced bone pain.

  8. Angiotensin-(1-7)/Mas receptor as an antinociceptive agent in cancer-induced bone pain.

    PubMed

    Forte, Brittany L; Slosky, Lauren M; Zhang, Hong; Arnold, Moriah R; Staatz, William D; Hay, Meredith; Largent-Milnes, Tally M; Vanderah, Todd W

    2016-12-01

    Many cancerous solid tumors metastasize to the bone and induce pain (cancer-induced bone pain [CIBP]). Cancer-induced bone pain is often severe because of enhanced inflammation, rapid bone degradation, and disease progression. Opioids are prescribed to manage this pain, but they may enhance bone loss and increase tumor proliferation, further compromising patient quality of life. Angiotensin-(1-7) (Ang-(1-7)) binds and activates the Mas receptor (MasR). Angiotensin-(1-7)/MasR activation modulates inflammatory signaling after acute tissue insult, yet no studies have investigated whether Ang-(1-7)/MasR play a role in CIBP. We hypothesized that Ang-(1-7) inhibits CIBP by targeting MasR in a murine model of breast CIBP. 66.1 breast cancer cells were implanted into the femur of BALB/cAnNHsd mice as a model of CIBP. Spontaneous and evoked pain behaviors were assessed before and after acute and chronic administration of Ang-(1-7). Tissues were collected from animals for ex vivo analyses of MasR expression, tumor burden, and bone integrity. Cancer inoculation increased spontaneous pain behaviors by day 7 that were significantly reduced after a single injection of Ang-(1-7) and after sustained administration. Preadministration of A-779 a selective MasR antagonist prevented this reduction, whereas pretreatment with the AT2 antagonist had no effect; an AT1 antagonist enhanced the antinociceptive activity of Ang-(1-7) in CIBP. Repeated Ang-(1-7) administration did not significantly change tumor burden or bone remodeling. Data here suggest that Ang-(1-7)/MasR activation significantly attenuates CIBP, while lacking many side effects seen with opioids. Thus, Ang-(1-7) may be an alternative therapeutic strategy for the nearly 90% of patients with advanced-stage cancer who experience excruciating pain.

  9. Angiotensin-(1-7)/Mas receptor as an antinociceptive agent in cancer-induced bone pain

    PubMed Central

    Forte, Brittany L.; Slosky, Lauren M.; Zhang, Hong; Arnold, Moriah R.; Staatz, William D.; Hay, Meredith; Largent-Milnes, Tally M.; Vanderah, Todd W.

    2016-01-01

    Abstract Many cancerous solid tumors metastasize to the bone and induce pain (cancer-induced bone pain [CIBP]). Cancer-induced bone pain is often severe because of enhanced inflammation, rapid bone degradation, and disease progression. Opioids are prescribed to manage this pain, but they may enhance bone loss and increase tumor proliferation, further compromising patient quality of life. Angiotensin-(1-7) (Ang-(1-7)) binds and activates the Mas receptor (MasR). Angiotensin-(1-7)/MasR activation modulates inflammatory signaling after acute tissue insult, yet no studies have investigated whether Ang-(1-7)/MasR play a role in CIBP. We hypothesized that Ang-(1-7) inhibits CIBP by targeting MasR in a murine model of breast CIBP. 66.1 breast cancer cells were implanted into the femur of BALB/cAnNHsd mice as a model of CIBP. Spontaneous and evoked pain behaviors were assessed before and after acute and chronic administration of Ang-(1-7). Tissues were collected from animals for ex vivo analyses of MasR expression, tumor burden, and bone integrity. Cancer inoculation increased spontaneous pain behaviors by day 7 that were significantly reduced after a single injection of Ang-(1-7) and after sustained administration. Preadministration of A-779 a selective MasR antagonist prevented this reduction, whereas pretreatment with the AT2 antagonist had no effect; an AT1 antagonist enhanced the antinociceptive activity of Ang-(1-7) in CIBP. Repeated Ang-(1-7) administration did not significantly change tumor burden or bone remodeling. Data here suggest that Ang-(1-7)/MasR activation significantly attenuates CIBP, while lacking many side effects seen with opioids. Thus, Ang-(1-7) may be an alternative therapeutic strategy for the nearly 90% of patients with advanced-stage cancer who experience excruciating pain. PMID:27541850

  10. Extracellular signal-regulated kinase activation in spinal astrocytes and microglia contributes to cancer-induced bone pain in rats.

    PubMed

    Wang, X-W; Li, T-T; Zhao, J; Mao-Ying, Q-L; Zhang, H; Hu, S; Li, Q; Mi, W-L; Wu, G-C; Zhang, Y-Q; Wang, Y-Q

    2012-08-16

    Cancer pain, especially cancer-induced bone pain, affects the quality of life of cancer patients, and current treatments for this pain are limited. The present study demonstrates that spinal extracellular signal-regulated kinase (ERK) activation in glial cells plays a crucial role in cancer-induced bone pain. From day 4 to day 21 after the intra-tibia inoculation with Walker 256 mammary gland carcinoma cells, significant mechanical allodynia was observed as indicated by the decrease of mechanical withdrawal thresholds in the von Frey hair test. Intra-tibia inoculation with carcinoma cells induced a vast and persistent (>21 D) activation of ERK in the bilateral L2-L3 and L4-L5 spinal dorsal horn. The increased pERK1/2-immunoreactivity was observed in both Iba-1-expressing microglia and GFAP-expressing astrocytes but not in NeuN-expressing neurons. A single intrathecal injection of the selective MEK (ERK kinase) inhibitors PD98059 (10 μg) on day 12 and U0126 (1.25 and 3 μg) on day 14, attenuated the bilateral mechanical allodynia in the von Frey hair test. Altogether, our results suggest that ERK activation in spinal microglia and astrocytes is correlated with the onset of allodynia and is important for allodynia maintenance in the cancer pain model. This study indicated that inhibition of the ERK pathway may provide a new therapy for cancer-induced bone pain.

  11. Overexpression of suppressor of cytokine signaling 3 in dorsal root ganglion attenuates cancer-induced pain in rats

    PubMed Central

    Wei, Jinrong; Li, Meng; Wang, Dieyu; Zhu, Hongyan; Kong, Xiangpeng; Wang, Shusheng; Zhou, You-Lang; Ju, Zhong; Jiang, Guo-Qin

    2017-01-01

    Background Cancer-induced pain (CIP) is one of the most severe types of chronic pain with which clinical treatment remains challenging and the involved mechanisms are largely unknown. Suppressor of cytokine signaling 3 (SOCS3) is an important intracellular protein and provides a classical negative feedback loop, thus involving in a wide variety of processes including inflammation and nociception. However, the role of SOCS3 pathway in CIP is poorly understood. The present study was designed to investigate the role of SOCS3 in dorsal root ganglion (DRG) in the development of CIP. Method CIP was established by injection of Walker 256 mammary gland tumor cells into the rat tibia canal. Whole-cell patch clamping and Western blotting were performed. Results Following the development of bone cancer, SOCS3 expression was significantly downregulated in rat DRGs at L2–L5 segments. Overexpression of SOCS3, using lentiviral-mediated production of SOCS3 at spinal cord level, drastically attenuated mechanical allodynia and body weight-bearing difference, but not thermal hyperalgesia in bone cancer rats. In addition, overexpression of SOCS3 reversed the hyperexcitability of DRG neurons innervating the tibia, and reduced abnormal expression of toll-like receptors 4 in the DRGs. Conclusions These results suggest that SOCS3 might be a key molecular involved in the development of complicated cancer pain and that overexpression of SOCS3 might be an important strategy for treatment for mechanical allodynia associated with bone cancer. PMID:28326931

  12. Involvement of spinal monocyte chemoattractant protein-1 (MCP-1) in cancer-induced bone pain in rats.

    PubMed

    Hu, Ji-Hua; Zheng, Xiao-Yan; Yang, Jian-Ping; Wang, Li-Na; Ji, Fu-Hai

    2012-05-23

    In this study, we examined the involvement of chemokine monocyte chemoattractant protein-1 (MCP-1) in the spinal cord of a rat model of cancer-induced bone pain (CIBP). In this model, CIBP was established by an intramedullary injection of Walker 256 cells into the tibia of rats. We observed a significant increase in expression levels of MCP-1 and its receptor CCR2 in the spinal cord of CIBP rats. Furthermore, the intrathecal administration of an anti-MCP-1 neutralizing antibody attenuated the mechanical allodynia established in CIBP rats. Likewise, an intrathecal injection of exogenous recombinant MCP-1 induced a striking mechanical allodynia in naïve rats. These results suggest that increases in spinal MCP-1 and CCR2 expression are involved in the development of mechanical allodynia associated with bone cancer rats.

  13. Involvement of chemokine CXCL11 in the development of morphine tolerance in rats with cancer-induced bone pain.

    PubMed

    Guo, Genhua; Peng, Yawen; Xiong, Bingrui; Liu, Daiqiang; Bu, Huilian; Tian, Xuebi; Yang, Hui; Wu, Zhen; Cao, Fei; Gao, Feng

    2017-05-01

    Morphine is viewed as one of the classical treatments for intractable pain, but its role is limited by side effects, including analgesic tolerance. A few chemokines have been reported to be engaged in the mechanisms of morphine tolerance. However, the exact roles of CXC chemokine 11 (CXCL11) in chronic morphine tolerance remain unknown. In this study, Walker 256 mammary gland carcinoma cells were inoculated into the tibia of rats to provoke cancer-induced bone pain. Then, morphine was intrathecally administered twice daily for seven consecutive days to induce drug tolerance. We found that the level of CXCL11 in lumbar spinal cord was increased during the development of morphine tolerance in cancer-induced bone pain rats. Meanwhile, CXCL11 was co-localized with markers of astrocytes and neurons in the spinal cord. Inhibition of CXCL11 by neutralizing antibodies could remarkably attenuate the degree of morphine tolerance and decrease the activation of astrocytes. Moreover, blocking astrocyte activation by d, l-Fluorocitric acid could distinctly alleviate morphine tolerance and reduce the expression of CXCL11. Finally, morphine stimulation could induce the release of CXCL11 by cultured astrocytes and neurons in vitro. In summary, our results provide evidence that spinal CXCL11 plays a powerful modulatory role in the development of morphine tolerance through cross-talking between astrocytes and neurons. Read the Review series "Pain". © 2016 International Society for Neurochemistry.

  14. Effects of Src-kinase inhibition in cancer-induced bone pain

    PubMed Central

    De Felice, Milena; Lambert, Daniel; Holen, Ingunn; Escott, K Jane

    2016-01-01

    Background Bone metastases occur frequently in advanced breast, lung, and prostate cancer, with approximately 70% of patients affected. Pain is a major symptom of bone metastases, and current treatments may be inadequate or have unacceptable side effects. The mechanisms that drive cancer-induced bone pain are not fully understood; however, it is known that there is sensitization of both peripheral bone afferents and central spinal circuits. It is well established that the N-methyl-D-aspartate receptor plays a major role in the pathophysiology of pain hypersensitivity. Inhibition of the non-receptor tyrosine kinase Src controls N-methyl-D-aspartate receptor activity and inhibiting Src reduces the hypersensitivity associated with neuropathic and inflammatory pains. As Src is also implicated in osteoclastic bone resorption, we have investigated if inhibiting Src ameliorates cancer-induced bone pain. We have tested this hypothesis using an orally bioavailable Src inhibitor (saracatinib) in a rat model of cancer-induced bone pain. Results Intra-tibial injection of rat mammary cancer cells (Mammary rat metastasis tumor cells -1), but not vehicle, in rats produced hindpaw hypersensitivity to thermal and mechanical stimuli that was maximal after six days and persisted for at least 13 days postinjection. Daily oral gavage with saracatinib (20 mg/kg) beginning seven days after intra-tibial injection reversed the thermal hyperalgesia but not the mechanical allodynia. The analgesic mechanisms of saracatinib appear to be due to an effect on the nervous system as immunoblotting of L2-5 spinal segments showed that mammary rat metastasis tumor cells-1 injection induced phosphorylation of the GluN1 subunit of the N-methyl-D-aspartate receptor, indicative of receptor activation, and this was reduced by saracatinib. Additionally, histology showed no anti-tumor effect of saracatinib at any dose and no significant effect on bone preservation. Conclusions This is the first

  15. The cystine/glutamate antiporter system xc− drives breast tumor cell glutamate release and cancer-induced bone pain

    PubMed Central

    Slosky, Lauren M.; BassiriRad, Neemah M.; Symons, Ashley M.; Thompson, Michelle; Doyle, Timothy; Forte, Brittany L.; Staatz, William D.; Bui, Lynn; Neumann, William L.; Mantyh, Patrick W.; Salvemini, Daniela; Largent-Milnes, Tally M.; Vanderah, Todd W.

    2016-01-01

    Abstract Bone is one of the leading sites of metastasis for frequently diagnosed malignancies, including those arising in the breast, prostate and lung. Although these cancers develop unnoticed and are painless in their primary sites, bone metastases result in debilitating pain. Deeper investigation of this pain may reveal etiology and lead to early cancer detection. Cancer-induced bone pain (CIBP) is inadequately managed with current standard-of-care analgesics and dramatically diminishes patient quality of life. While CIBP etiology is multifaceted, elevated levels of glutamate, an excitatory neurotransmitter, in the bone-tumor microenvironment may drive maladaptive nociceptive signaling. Here, we establish a relationship between the reactive nitrogen species peroxynitrite, tumor-derived glutamate, and CIBP. In vitro and in a syngeneic in vivo model of breast CIBP, murine mammary adenocarcinoma cells significantly elevated glutamate via the cystine/glutamate antiporter system xc−. The well-known system xc− inhibitor sulfasalazine significantly reduced levels of glutamate and attenuated CIBP-associated flinching and guarding behaviors. Peroxynitrite, a highly reactive species produced in tumors, significantly increased system xc− functional expression and tumor cell glutamate release. Scavenging peroxynitrite with the iron and mangano-based porphyrins, FeTMPyP and SRI10, significantly diminished tumor cell system xc− functional expression, reduced femur glutamate levels and mitigated CIBP. In sum, we demonstrate how breast cancer bone metastases upregulate a cystine/glutamate co-transporter to elevate extracellular glutamate. Pharmacological manipulation of peroxynitrite or system xc− attenuates CIBP, supporting a role for tumor-derived glutamate in CIBP and validating the targeting of system xc− as a novel therapeutic strategy for the management of metastatic bone pain. PMID:27482630

  16. Regulation of breast cancer-induced bone lesions by β-catenin protein signaling.

    PubMed

    Chen, Yan; Shi, Heidi Y; Stock, Stuart R; Stern, Paula H; Zhang, Ming

    2011-12-09

    Breast cancer patients have an extremely high rate of bone metastases. Morphological analyses of the bones in most of the patients have revealed the mixed bone lesions, comprising both osteolytic and osteoblastic elements. β-Catenin plays a key role in both embryonic skeletogenesis and postnatal bone regeneration. Although this pathway is also involved in many bone malignancy, such as osteosarcoma and prostate cancer-induced bone metastases, its regulation of breast cancer bone metastases remains unknown. Here, we provide evidence that the β-catenin signaling pathway has a significant impact on the bone lesion phenotype. In this study, we established a novel mouse model of mixed bone lesions using intratibial injection of TM40D-MB cells, a breast cancer cell line that is highly metastatic to bone. We found that both upstream and downstream molecules of the β-catenin pathway are up-regulated in TM40D-MB cells compared with non-bone metastatic TM40D cells. TM40D-MB cells also have a higher T cell factor (TCF) reporter activity than TM40D cells. Inactivation of β-catenin in TM40D-MB cells through expression of a dominant negative TCF4 not only increases osteoclast differentiation in a tumor-bone co-culture system and enhances osteolytic bone destruction in mice, but also inhibits osteoblast differentiation. Surprisingly, although tumor cells overexpressing β-catenin did induce a slight increase of osteoblast differentiation in vitro, these cells display a minimal effect on osteoblastic bone formation in mice. These data collectively demonstrate that β-catenin acts as an important determinant in mixed bone lesions, especially in controlling osteoblastic effect within tumor-harboring bone environment.

  17. Regulation of Breast Cancer-induced Bone Lesions by β-Catenin Protein Signaling*

    PubMed Central

    Chen, Yan; Shi, Heidi Y.; Stock, Stuart R.; Stern, Paula H.; Zhang, Ming

    2011-01-01

    Breast cancer patients have an extremely high rate of bone metastases. Morphological analyses of the bones in most of the patients have revealed the mixed bone lesions, comprising both osteolytic and osteoblastic elements. β-Catenin plays a key role in both embryonic skeletogenesis and postnatal bone regeneration. Although this pathway is also involved in many bone malignancy, such as osteosarcoma and prostate cancer-induced bone metastases, its regulation of breast cancer bone metastases remains unknown. Here, we provide evidence that the β-catenin signaling pathway has a significant impact on the bone lesion phenotype. In this study, we established a novel mouse model of mixed bone lesions using intratibial injection of TM40D-MB cells, a breast cancer cell line that is highly metastatic to bone. We found that both upstream and downstream molecules of the β-catenin pathway are up-regulated in TM40D-MB cells compared with non-bone metastatic TM40D cells. TM40D-MB cells also have a higher T cell factor (TCF) reporter activity than TM40D cells. Inactivation of β-catenin in TM40D-MB cells through expression of a dominant negative TCF4 not only increases osteoclast differentiation in a tumor-bone co-culture system and enhances osteolytic bone destruction in mice, but also inhibits osteoblast differentiation. Surprisingly, although tumor cells overexpressing β-catenin did induce a slight increase of osteoblast differentiation in vitro, these cells display a minimal effect on osteoblastic bone formation in mice. These data collectively demonstrate that β-catenin acts as an important determinant in mixed bone lesions, especially in controlling osteoblastic effect within tumor-harboring bone environment. PMID:22009747

  18. Intrathecal injection of lentivirus-mediated glial cell line-derived neurotrophic factor RNA interference relieves bone cancer-induced pain in rats.

    PubMed

    Meng, Fu-Fen; Xu, Yang; Dan, Qi-Qin; Wei, La; Deng, Ying-Jie; Liu, Jia; He, Mu; Liu, Wei; Xia, Qing-Jie; Zhou, Fiona H; Wang, Ting-Hua; Wang, Xi-Yan

    2015-04-01

    Bone cancer pain is a common symptom in cancer patients with bone metastases and the underlying mechanisms are largely unknown. The aim of this study is to explore the endogenous analgesic mechanisms to develop new therapeutic strategies for bone-cancer induced pain (BCIP) as a result of metastases. MRMT-1 tumor cells were injected into bilateral tibia of rats and X-rays showed that the area suffered from bone destruction, accompanied by an increase in osteoclast numbers. In addition, rats with bone cancer showed apparent mechanical and thermal hyperalgesia at day 28 after intratibial MRMT-1 inoculation. However, intrathecal injection of morphine or lentivirus-mediated glial cell line-derived neurotrophic factor RNAi (Lvs-siGDNF) significantly attenuated mechanical and thermal hyperalgesia, as shown by increases in paw withdrawal thresholds and tail-flick latencies, respectively. Furthermore, Lvs-siGDNF interference not only substantially downregulated GDNF protein levels, but also reduced substance P immunoreactivity and downregulated the ratio of pERK/ERK, where its activation is crucial for pain signaling, in the spinal dorsal horn of this model of bone-cancer induced pain. In this study, Lvs-siGDNF gene therapy appeared to be a beneficial method for the treatment of bone cancer pain. As the effect of Lvs-siGDNF to relieve pain was similar to morphine, but it is not a narcotic, the use of GDNF RNA interference may be considered as a new therapeutic strategy for the treatment of bone cancer pain in the future.

  19. Involvement of Spinal CCR5/PKCγ Signaling Pathway in the Maintenance of Cancer-Induced Bone Pain.

    PubMed

    Hang, Li-Hua; Li, Shu-Na; Dan, Xiang; Shu, Wei-Wei; Luo, Hong; Shao, Dong-Hua

    2017-02-01

    Cancer-induced bone pain (CIBP) is a challenging medical problem that considerably influences cancer patients' quality of life. Currently, few treatments have been developed to conquer CIBP because of a poor understanding of the potential mechanisms. Our previous work has proved that spinal RANTES (a major ligand for CCR5) was involved in the maintenance of CIBP. In this study, we attempted to investigate whether spinal CCR5 and its downstream PKCγ pathway is involved in the maintenance of CIBP. Inoculation of Walker 256 cells into the tibia could induce a marked mechanical allodynia with concomitant upregulation of spinal CCR5 and p-PKCγ expression from day 6 to day 15 after inoculation. Spinal CCR5 was prominently expressed in microglia, and mechanical allodynia was attenuated by intrathecal injection of DAPTA (a specific antagonist of CCR5) with downregulation of spinal CCR5 and p-PKCγ expression levels at day 15 in inoculated rats. Pre-intrathecal injection of RANTES could reverse the anti-allodynia effects of DAPTA. Intrathecal administration of GF109203X (an inhibitor of PKC) could alleviate mechanical allodynia as well as decrease of spinal p-PKCγ expression level, but no influence on spinal CCR5 level. Our findings suggest that CCR5/PKCγ signaling pathway in microglia may contribute to the maintenance of CIBP in rats.

  20. Current studies of acupuncture in cancer-induced bone pain animal models.

    PubMed

    Ryu, Hee Kyoung; Baek, Yong-Hyeon; Park, Yeon-Cheol; Seo, Byung-Kwan

    2014-01-01

    Acupuncture is generally accepted as a safe and harmless treatment option for alleviating pain. To explore the pain mechanism, numerous animal models have been developed to simulate specific human pain conditions, including cancer-induced bone pain (CIBP). In this study, we analyzed the current research methodology of acupuncture for the treatment of CIBP. We electronically searched the PubMed database for animal studies published from 2000 onward using these search terms: (bone cancer OR cancer) AND (pain OR analgesia) AND (acupuncture OR pharmacopuncture OR bee venom). We selected articles that described cancer pain in animal models. We analyzed the methods used to induce cancer pain and the outcome measures used to assess the effects of acupuncture on CIBP in animal models. We reviewed articles that met our inclusion criteria. Injection of mammary cancer cells into the cavity of the tibia was the most frequently used method for inducing CIBP in the animal models. Among the eight selected studies, five studies demonstrated the effects of electroacupuncture on CIBP. The effects of acupuncture were assessed by measuring pain-related behavior. Future researches will be needed to ascertain the effectiveness of acupuncture for treating CIBP and to explore the specific mechanism of CIBP in animal models.

  1. Differences in electrophysiological properties of functionally identified nociceptive sensory neurons in an animal model of cancer-induced bone pain

    PubMed Central

    Zhu, Yong Fang; Ungard, Robert; Seidlitz, Eric; Zacal, Natalie; Huizinga, Jan; Henry, James L

    2016-01-01

    Background Bone cancer pain is often severe, yet little is known about mechanisms generating this type of chronic pain. While previous studies have identified functional alterations in peripheral sensory neurons that correlate with bone tumours, none has provided direct evidence correlating behavioural nociceptive responses with properties of sensory neurons in an intact bone cancer model. Results In a rat model of prostate cancer-induced bone pain, we confirmed tactile hypersensitivity using the von Frey test. Subsequently, we recorded intracellularly from dorsal root ganglion neurons in vivo in anesthetized animals. Neurons remained connected to their peripheral receptive terminals and were classified on the basis of action potential properties, responses to dorsal root stimulation, and to mechanical stimulation of the respective peripheral receptive fields. Neurons included C-, Aδ-, and Aβ-fibre nociceptors, identified by their expression of substance P. We suggest that bone tumour may induce phenotypic changes in peripheral nociceptors and that these could contribute to bone cancer pain. Conclusions This work represents a significant technical and conceptual advance in the study of peripheral nociceptor functions in the development of cancer-induced bone pain. This is the first study to report that changes in sensitivity and excitability of dorsal root ganglion primary afferents directly correspond to mechanical allodynia and hyperalgesia behaviours following prostate cancer cell injection into the femur of rats. Furthermore, our unique combination of techniques has allowed us to follow, in a single neuron, mechanical pain-related behaviours, electrophysiological changes in action potential properties, and dorsal root substance P expression. These data provide a more complete understanding of this unique pain state at the cellular level that may allow for future development of mechanism-based treatments for cancer-induced bone pain. PMID:27030711

  2. Bone Cell-autonomous Contribution of Type 2 Cannabinoid Receptor to Breast Cancer-induced Osteolysis*

    PubMed Central

    Sophocleous, Antonia; Marino, Silvia; Logan, John G.; Mollat, Patrick; Ralston, Stuart H.; Idris, Aymen I.

    2015-01-01

    The cannabinoid type 2 receptor (CB2) has previously been implicated as a regulator of tumor growth, bone remodeling, and bone pain. However, very little is known about the role of the skeletal CB2 receptor in the regulation of osteoblasts and osteoclasts changes associated with breast cancer. Here we found that the CB2-selective agonists HU308 and JWH133 reduced the viability of a variety of parental and bone-tropic human and mouse breast cancer cells at high micromolar concentrations. Under conditions in which these ligands are used at the nanomolar range, HU308 and JWH133 enhanced human and mouse breast cancer cell-induced osteoclastogenesis and exacerbated osteolysis, and these effects were attenuated in cultures obtained from CB2-deficient mice or in the presence of a CB2 receptor blocker. HU308 and JWH133 had no effects on osteoblast growth or differentiation in the presence of conditioned medium from breast cancer cells, but under these circumstances both agents enhanced parathyroid hormone-induced osteoblast differentiation and the ability to support osteoclast formation. Mechanistic studies in osteoclast precursors and osteoblasts showed that JWH133 and HU308 induced PI3K/AKT activity in a CB2-dependent manner, and these effects were enhanced in the presence of osteolytic and osteoblastic factors such as RANKL (receptor activator of NFκB ligand) and parathyroid hormone. When combined with published work, these findings suggest that breast cancer and bone cells exhibit differential responses to treatment with CB2 ligands depending upon cell type and concentration used. We, therefore, conclude that both CB2-selective activation and antagonism have potential efficacy in cancer-associated bone disease, but further studies are warranted and ongoing. PMID:26195631

  3. Bone Cell-autonomous Contribution of Type 2 Cannabinoid Receptor to Breast Cancer-induced Osteolysis.

    PubMed

    Sophocleous, Antonia; Marino, Silvia; Logan, John G; Mollat, Patrick; Ralston, Stuart H; Idris, Aymen I

    2015-09-04

    The cannabinoid type 2 receptor (CB2) has previously been implicated as a regulator of tumor growth, bone remodeling, and bone pain. However, very little is known about the role of the skeletal CB2 receptor in the regulation of osteoblasts and osteoclasts changes associated with breast cancer. Here we found that the CB2-selective agonists HU308 and JWH133 reduced the viability of a variety of parental and bone-tropic human and mouse breast cancer cells at high micromolar concentrations. Under conditions in which these ligands are used at the nanomolar range, HU308 and JWH133 enhanced human and mouse breast cancer cell-induced osteoclastogenesis and exacerbated osteolysis, and these effects were attenuated in cultures obtained from CB2-deficient mice or in the presence of a CB2 receptor blocker. HU308 and JWH133 had no effects on osteoblast growth or differentiation in the presence of conditioned medium from breast cancer cells, but under these circumstances both agents enhanced parathyroid hormone-induced osteoblast differentiation and the ability to support osteoclast formation. Mechanistic studies in osteoclast precursors and osteoblasts showed that JWH133 and HU308 induced PI3K/AKT activity in a CB2-dependent manner, and these effects were enhanced in the presence of osteolytic and osteoblastic factors such as RANKL (receptor activator of NFκB ligand) and parathyroid hormone. When combined with published work, these findings suggest that breast cancer and bone cells exhibit differential responses to treatment with CB2 ligands depending upon cell type and concentration used. We, therefore, conclude that both CB2-selective activation and antagonism have potential efficacy in cancer-associated bone disease, but further studies are warranted and ongoing. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Topical Treatment with Xiaozheng Zhitong Paste (XZP) Alleviates Bone Destruction and Bone Cancer Pain in a Rat Model of Prostate Cancer-Induced Bone Pain by Modulating the RANKL/RANK/OPG Signaling

    PubMed Central

    Bao, Yanju; Gao, Yebo; Du, Maobo; Hou, Wei; Yang, Liping; Kong, Xiangying; Zheng, Honggang; Li, Weidong; Hua, Baojin

    2015-01-01

    To explore the effects and mechanisms of Xiaozheng Zhitong Paste (XZP) on bone cancer pain, Wistar rats were inoculated with vehicle or prostate cancer PC-3 into the tibia bone and treated topically with inert paste, XZP at 15.75, 31.5, or 63 g/kg twice per day for 21 days. Their bone structural damage, nociceptive behaviors, bone osteoclast and osteoblast activity, and the levels of OPG, RANL, RNAK, PTHrP, IGF-1, M-CSF, IL-8, and TNF-α were examined. In comparison with that in the placebo group, significantly reduced numbers of invaded cancer cells, decreased levels of bone damage and mechanical threshold and paw withdrawal latency, lower levels of serum TRACP5b, ICTP, PINP, and BAP, and less levels of bone osteoblast and osteoclast activity were detected in the XZP-treated rats (P<0.05). Moreover, significantly increased levels of bone OPG but significantly decreased levels of RANL, RNAK, PTHrP, IGF-1, M-CSF, IL-8, and TNF-α were detected in the XZP-treated rats (P<0.05 for all). Together, XZP treatment significantly mitigated the cancer-induced bone damage and bone osteoclast and osteoblast activity and alleviated prostate cancer-induced bone pain by modulating the RANKL/RANK/OPG pathway and bone cancer-related inflammation in rats. PMID:25691907

  5. Spinal interleukin-33 and its receptor ST2 contribute to bone cancer-induced pain in mice.

    PubMed

    Zhao, J; Zhang, H; Liu, S-B; Han, P; Hu, S; Li, Q; Wang, Z-F; Mao-Ying, Q-L; Chen, H-M; Jiang, J-W; Wu, G-C; Mi, W-L; Wang, Y-Q

    2013-12-03

    Cancer pain, particularly bone cancer pain, affects the quality of life of cancer patients, and current treatments are limited. Interleukin (IL)-33, a new member of the IL-1 super family, has been reported to be involved in the modulation of inflammatory pain. However, studies focused on its role in the modulation of cancer pain have been rare. The present study was designed to investigate whether spinal IL-33/ST2 signaling was involved in bone cancer-induced pain in mice. Bone cancer was induced via intra-femoral inoculation of 4T1 mammary carcinoma cells. The mice inoculated with carcinoma cells showed mechanical allodynia, heat hyperalgesia and a reduction in limb use, whereas phosphate-buffered saline or heat-killed cells-injected mice showed no significant difference compared to non-treated mice. The pain hypersensitive behaviors worsened over time and with bone destruction. Both the mRNA and the protein levels of IL-33 and relative cytokines (IL-1β, IL-6, TNF-a) were significantly increased in the spinal cord after the inoculation of carcinoma cells. Intrathecal administration of ST2 antibody to block IL-33/ST2 signaling alleviated pain behaviors in a dose-dependent manner in bone cancer pain mice compared with vehicle-injected mice. Moreover, the ST2(-/-) mice showed a significant amelioration of limb use and heat hyperalgesia compared to wild-type mice. Meanwhile, concentrations of spinal IL-1β, IL-6 and TNF-a in the cancer-bearing ST2(-/-) mice had no significant changes. These data further suggested that IL-33/ST2 signaling played a vital role in cancer pain. Our results provided evidence that IL-33 and its receptor ST2 may be a potential therapeutic target for the treatment of pain in bone cancer patients.

  6. Mechanisms for attenuation in cancellous-bone-mimicking phantoms.

    PubMed

    Wear, Keith A

    2008-11-01

    Broadband ultrasound attenuation (BUA) in cancellous bone is useful for prediction of osteoporotic fracture risk, but its causes are not well understood. To investigate attenuation mechanisms, 9 cancellous-bone-mimicking phantoms containing nylon filaments (simulating bone trabeculae) embedded within soft-tissue-mimicking fluid (simulating marrow) were interrogated. The measurements of frequency-dependent attenuation coefficient had 3 separable components: 1) a linear (with frequency) component attributable to absorption in the soft-tissue-mimicking fluid, 2) a quasilinear (with frequency) component, which may include absorption in and longitudinal-shear mode conversion by the nylon filaments, and 3) a nonlinear (with frequency) component, which may be attributable to longitudinal-longitudinal scattering by the nylon filaments. The slope of total linear (with frequency) attenuation coefficient (sum of components #1 and #2) versus frequency was found to increase linearly with volume fraction, consistent with reported measurements on cancellous bone. Backscatter coefficient measurements in the 9 phantoms supported the claim that the nonlinear (with frequency) component of attenuation coefficient (component #3) was closely associated with longitudinal-longitudinal scattering. This work represents the first experimental separation of these 3 components of attenuation in cancellous bone-mimicking phantoms.

  7. Pathobiology and management of prostate cancer-induced bone pain: recent insights and future treatments.

    PubMed

    Muralidharan, Arjun; Smith, Maree T

    2013-10-01

    Prostate cancer (PCa) has a high propensity for metastasis to bone. Despite the availability of multiple treatment options for relief of PCa-induced bone pain (PCIBP), satisfactory relief of intractable pain in patients with advanced bony metastases is challenging for the clinicians because currently available analgesic drugs are often limited by poor efficacy and/or dose-limiting side effects. Rodent models developed in the past decade show that the pathobiology of PCIBP comprises elements of inflammatory, neuropathic and ischemic pain arising from ectopic sprouting and sensitization of sensory nerve fibres within PCa-invaded bones. In addition, at the cellular level, PCIBP is underpinned by dynamic cross talk between metastatic PCa cells, cellular components of the bone matrix, factors associated with the bone microenvironment as well as peripheral components of the somatosensory system. These insights are aligned with the clinical management of PCIBP involving use of a multimodal treatment approach comprising analgesic agents (opioids, NSAIDs), radiotherapy, radioisotopes, cancer chemotherapy agents and bisphosphonates. However, a major drawback of most rodent models of PCIBP is their short-term applicability due to ethical concerns. Thus, it has been difficult to gain insight into the mal(adaptive) neuroplastic changes occurring at multiple levels of the somatosensory system that likely contribute to intractable pain at the advanced stages of metastatic disease. Specifically, the functional responsiveness of noxious circuitry as well as the neurochemical signature of a broad array of pro-hyperalgesic mediators in the dorsal root ganglia and spinal cord of rodent models of PCIBP is relatively poorly characterized. Hence, recent work from our laboratory to develop a protocol for an optimized rat model of PCIBP will enable these knowledge gaps to be addressed as well as identification of novel targets for drug discovery programs aimed at producing new analgesics

  8. Randomized Double-Blind Trial of Pregabalin Versus Placebo in Conjunction With Palliative Radiotherapy for Cancer-Induced Bone Pain

    PubMed Central

    Hoskin, Peter J.; Colvin, Lesley A.; Fleetwood-Walker, Susan M.; Adamson, Douglas; Byrne, Anthony; Murray, Gordon D.; Laird, Barry J.A.

    2016-01-01

    Purpose Cancer-induced bone pain (CIBP) affects one third of patients with cancer. Radiotherapy remains the gold-standard treatment; however, laboratory and clinical work suggest that pregabalin may be useful in treating CIBP. The aim of this study was to examine pregabalin in patients with CIBP receiving radiotherapy. Patients and Methods A multicenter, double-blind randomized trial of pregabalin versus placebo was conducted. Eligible patients were age ≥ 18 years, had radiologically proven bone metastases, were scheduled to receive radiotherapy, and had pain scores ≥ 4 of 10 (on 0-to-10 numeric rating scale). Before radiotherapy, baseline assessments were completed, followed by random assignment. Doses of pregabalin and placebo were increased over 4 weeks. The primary end point was treatment response, defined as a reduction of ≥ 2 points in worst pain by week 4, accompanied by a stable or reduced opioid dose, compared with baseline. Secondary end points assessed average pain, interference of pain with activity, breakthrough pain, mood, quality of life, and adverse events. Results A total of 233 patients were randomly assigned: 117 to placebo and 116 to pregabalin. The most common cancers were prostate (n = 88; 38%), breast (n = 77; 33%), and lung (n = 42; 18%). In the pregabalin arm, 45 patients (38.8%) achieved the primary end point, compared with 47 (40.2%) in the placebo arm (adjusted odds ratio, 1.07; 95% CI, 0.63 to 1.81; P = .816). There were no statistically significant differences in average pain, pain interference, or quality of life between arms. There were differences in mood (P = .031) and breakthrough pain duration (P = .037) between arms. Outcomes were compared at 4 weeks. Conclusion Our findings do not support the role of pregabalin in patients with CIBP receiving radiotherapy. The role of pregabalin in CIBP with a clinical neuropathic pain component is unknown. PMID:26644535

  9. Randomized Double-Blind Trial of Pregabalin Versus Placebo in Conjunction With Palliative Radiotherapy for Cancer-Induced Bone Pain.

    PubMed

    Fallon, Marie; Hoskin, Peter J; Colvin, Lesley A; Fleetwood-Walker, Susan M; Adamson, Douglas; Byrne, Anthony; Murray, Gordon D; Laird, Barry J A

    2016-02-20

    Cancer-induced bone pain (CIBP) affects one third of patients with cancer. Radiotherapy remains the gold-standard treatment; however, laboratory and clinical work suggest that pregabalin may be useful in treating CIBP. The aim of this study was to examine pregabalin in patients with CIBP receiving radiotherapy. A multicenter, double-blind randomized trial of pregabalin versus placebo was conducted. Eligible patients were age ≥ 18 years, had radiologically proven bone metastases, were scheduled to receive radiotherapy, and had pain scores ≥ 4 of 10 (on 0-to-10 numeric rating scale). Before radiotherapy, baseline assessments were completed, followed by random assignment. Doses of pregabalin and placebo were increased over 4 weeks. The primary end point was treatment response, defined as a reduction of ≥ 2 points in worst pain by week 4, accompanied by a stable or reduced opioid dose, compared with baseline. Secondary end points assessed average pain, interference of pain with activity, breakthrough pain, mood, quality of life, and adverse events. A total of 233 patients were randomly assigned: 117 to placebo and 116 to pregabalin. The most common cancers were prostate (n = 88; 38%), breast (n = 77; 33%), and lung (n = 42; 18%). In the pregabalin arm, 45 patients (38.8%) achieved the primary end point, compared with 47 (40.2%) in the placebo arm (adjusted odds ratio, 1.07; 95% CI, 0.63 to 1.81; P = .816). There were no statistically significant differences in average pain, pain interference, or quality of life between arms. There were differences in mood (P = .031) and breakthrough pain duration (P = .037) between arms. Outcomes were compared at 4 weeks. Our findings do not support the role of pregabalin in patients with CIBP receiving radiotherapy. The role of pregabalin in CIBP with a clinical neuropathic pain component is unknown. © 2015 by American Society of Clinical Oncology.

  10. Effect of sex in the MRMT-1 model of cancer-induced bone pain

    PubMed Central

    Falk, Sarah; Al-Dihaissy, Tamara; Mezzanotte, Laura; Heegaard, Anne-Marie

    2015-01-01

    An overwhelming amount of evidence demonstrates sex-induced variation in pain processing, and has thus increased the focus on sex as an essential parameter for optimization of in vivo models in pain research. Mammary cancer cells are often used to model metastatic bone pain in vivo, and are commonly used in both males and females. Here we demonstrate that compared to male rats, female rats have an increased capacity for recovery following inoculation of MRMT-1 mammary cells, thus potentially causing a sex-dependent bias in interpretation of the data. PMID:26834983

  11. Targeting cells of the myeloid lineage attenuates pain and disease progression in a prostate model of bone cancer.

    PubMed

    Thompson, Michelle L; Jimenez-Andrade, Juan M; Chartier, Stephane; Tsai, James; Burton, Elizabeth A; Habets, Gaston; Lin, Paul S; West, Brian L; Mantyh, Patrick W

    2015-09-01

    Tumor cells frequently metastasize to bone where they can generate cancer-induced bone pain (CIBP) that can be difficult to fully control using available therapies. Here, we explored whether PLX3397, a high-affinity small molecular antagonist that binds to and inhibits phosphorylation of colony-stimulating factor-1 receptor, the tyrosine-protein kinase c-Kit, and the FMS-like tyrosine kinase 3, can reduce CIBP. These 3 targets all regulate the proliferation and function of a subset of the myeloid cells including macrophages, osteoclasts, and mast cells. Preliminary experiments show that PLX3397 attenuated inflammatory pain after formalin injection into the hind paw of the rat. As there is an inflammatory component in CIBP, involving macrophages and osteoclasts, the effect of PLX3397 was explored in a prostate model of CIBP where skeletal pain, cancer cell proliferation, tumor metastasis, and bone remodeling could be monitored in the same animal. Administration of PLX3397 was initiated on day 14 after prostate cancer cell injection when the tumor was well established, and tumor-induced bone remodeling was first evident. Over the next 6 weeks, sustained administration of PLX3397 attenuated CIBP behaviors by approximately 50% and was equally efficacious in reducing tumor cell growth, formation of new tumor colonies in bone, and pathological tumor-induced bone remodeling. Developing a better understanding of potential effects that analgesic therapies have on the tumor itself may allow the development of therapies that not only better control the pain but also positively impact disease progression and overall survival in patients with bone cancer.

  12. Mechanical Loading Attenuates Radiation-Induced Bone Loss in Bone Marrow Transplanted Mice.

    PubMed

    Govey, Peter M; Zhang, Yue; Donahue, Henry J

    2016-01-01

    Exposure of bone to ionizing radiation, as occurs during radiotherapy for some localized malignancies and blood or bone marrow cancers, as well as during space travel, incites dose-dependent bone morbidity and increased fracture risk. Rapid trabecular and endosteal bone loss reflects acutely increased osteoclastic resorption as well as decreased bone formation due to depletion of osteoprogenitors. Because of this dysregulation of bone turnover, bone's capacity to respond to a mechanical loading stimulus in the aftermath of irradiation is unknown. We employed a mouse model of total body irradiation and bone marrow transplantation simulating treatment of hematologic cancers, hypothesizing that compression loading would attenuate bone loss. Furthermore, we hypothesized that loading would upregulate donor cell presence in loaded tibias due to increased engraftment and proliferation. We lethally irradiated 16 female C57Bl/6J mice at age 16 wks with 10.75 Gy, then IV-injected 20 million GFP(+) total bone marrow cells. That same day, we initiated 3 wks compression loading (1200 cycles 5x/wk, 10 N) in the right tibia of 10 of these mice while 6 mice were irradiated, non-mechanically-loaded controls. As anticipated, before-and-after microCT scans demonstrated loss of trabecular bone (-48.2% Tb.BV/TV) and cortical thickness (-8.3%) at 3 wks following irradiation. However, loaded bones lost 31% less Tb.BV/TV and 8% less cortical thickness (both p<0.001). Loaded bones also had significant increases in trabecular thickness and tissue mineral densities from baseline. Mechanical loading did not affect donor cell engraftment. Importantly, these results demonstrate that both cortical and trabecular bone exposed to high-dose therapeutic radiation remain capable of an anabolic response to mechanical loading. These findings inform our management of bone health in cases of radiation exposure.

  13. Estimation of ultrasonic attenuation in a bone using coded excitation.

    PubMed

    Nowicki, A; Litniewski, J; Secomski, W; Lewin, P A; Trots, I

    2003-11-01

    This paper describes a novel approach to estimate broadband ultrasound attenuation (BUA) in a bone structure in human in vivo using coded excitation. BUA is an accepted indicator for assessment of osteoporosis. In the tested approach a coded acoustic signal is emitted and then the received echoes are compressed into brief, high amplitude pulses making use of matched filters and correlation receivers. In this way the acoustic peak pressure amplitude probing the tissue can be markedly decreased whereas the average transmitted intensity increases proportionally to the length of the code. This paper examines the properties of three different transmission schemes, based on Barker code, chirp and Golay code. The system designed is capable of generating 16 bits complementary Golay code (CGC), linear frequency modulated (LFM) chirp and 13-bit Barker code (BC) at 0.5 and 1 MHz center frequencies. Both in vivo data acquired from healthy heel bones and in vitro data obtained from human calcaneus were examined and the comparison between the results using coded excitation and two cycles sine burst is presented. It is shown that CGC system allows the effective range of frequencies employed in the measurement of broadband acoustic energy attenuation in the trabecular bone to be doubled in comparison to the standard 0.5 MHz pulse transmission. The algorithm used to calculate the pairs of Golay sequences of the different length, which provide the temporal side-lobe cancellation is also presented. Current efforts are focused on adapting the system developed for operation in pulse-echo mode; this would allow examination and diagnosis of bones with limited access such as hip bone.

  14. Mechanical Loading Attenuates Radiation-Induced Bone Loss in Bone Marrow Transplanted Mice

    PubMed Central

    Govey, Peter M.; Zhang, Yue; Donahue, Henry J.

    2016-01-01

    Exposure of bone to ionizing radiation, as occurs during radiotherapy for some localized malignancies and blood or bone marrow cancers, as well as during space travel, incites dose-dependent bone morbidity and increased fracture risk. Rapid trabecular and endosteal bone loss reflects acutely increased osteoclastic resorption as well as decreased bone formation due to depletion of osteoprogenitors. Because of this dysregulation of bone turnover, bone’s capacity to respond to a mechanical loading stimulus in the aftermath of irradiation is unknown. We employed a mouse model of total body irradiation and bone marrow transplantation simulating treatment of hematologic cancers, hypothesizing that compression loading would attenuate bone loss. Furthermore, we hypothesized that loading would upregulate donor cell presence in loaded tibias due to increased engraftment and proliferation. We lethally irradiated 16 female C57Bl/6J mice at age 16 wks with 10.75 Gy, then IV-injected 20 million GFP(+) total bone marrow cells. That same day, we initiated 3 wks compression loading (1200 cycles 5x/wk, 10 N) in the right tibia of 10 of these mice while 6 mice were irradiated, non-mechanically-loaded controls. As anticipated, before-and-after microCT scans demonstrated loss of trabecular bone (-48.2% Tb.BV/TV) and cortical thickness (-8.3%) at 3 wks following irradiation. However, loaded bones lost 31% less Tb.BV/TV and 8% less cortical thickness (both p<0.001). Loaded bones also had significant increases in trabecular thickness and tissue mineral densities from baseline. Mechanical loading did not affect donor cell engraftment. Importantly, these results demonstrate that both cortical and trabecular bone exposed to high-dose therapeutic radiation remain capable of an anabolic response to mechanical loading. These findings inform our management of bone health in cases of radiation exposure. PMID:27936104

  15. Spinal IFN-γ-induced protein-10 (CXCL10) mediates metastatic breast cancer-induced bone pain by activation of microglia in rat models.

    PubMed

    Bu, Huilian; Shu, Bin; Gao, Feng; Liu, Cheng; Guan, Xuehai; Ke, Changbin; Cao, Fei; Hinton, Antentor Othrell; Xiang, Hongbing; Yang, Hui; Tian, Xuebi; Tian, Yuke

    2014-01-01

    Cancer-induced bone pain (CIBP) is a common clinical problem in breast cancer patients with bone metastasis. Recent studies shows chemokines are novel targets for treatment of CIBP. In this study, we intra-tibial inoculated with Walker 256 rat mammary gland carcinoma cells into rat bone to established metastatic breast cancer. Then we measured the expression of CXCL10 in the spinal cord of metastatic bone cancer rats, investigated the role of CXCL10 in the development of CIBP, and the underlying mechanism. Results revealed that after intra-tibial inoculation with Walker 256 cells, rats showed up-regulation of CXCL10 and its receptor CXCR3 in the spinal cord. Interestingly, intrathecally injection of recombinant CXCL10 protein induced mechanical allodynia in naïve rats. Blocking the function of CXCL10/CXCR3 pathway via anti-CXCL10 antibody or CXCR3 antagonist prevented the development of CIBP and microglial activation. Moreover, CXCL10-induced mechanical allodynia was rescued by minocycline treatment during the late-stage of CIBP, days 10-14. The regulation of CXCL10 expression involved microglial activation in a manner of autocrine positive feedback. These results suggest that CXCL10 may be a necessary algogenic molecule, especially in the development of CIBP. Its function was partly mediated via spinal microglial activation. This study provides a novel insight into the biological function of chemokine CXCL10 in the molecular mechanism underlying cancer pain. It also provides new target for clinical treatment of metastatic breast cancer-induced bone pain in future.

  16. Attenuating effect of bromocriptine on cysteamine anticarcinogenesis of stomach cancers induced by N-methyl-N'-nitro-N-nitrosoguanidine

    SciTech Connect

    Tatsuta, M.; Iishi, H.; Baba, M.; Ichii, M.; Nakaizumi, A.; Uehara, H.; Taniguchi, H. )

    1990-09-01

    The effect of bromocriptine on inhibition by cysteamine of gastric carcinogenesis induced by N-methyl-N'-nitro-N-nitrosoguanidine was investigated in inbred Wistar rats. After 25 weeks of p.o. treatment with N-methyl-N'-nitro-N-nitrosoguanidine, rats were given injections every other day: cysteamine (50 mg/kg body weight); cysteamine (50 mg/kg body weight) plus bromocriptine (0.5 or 0.25 mg/kg body weight); or bromocriptine (0.5 or 0.25 mg/kg body weight). In week 52, the group treated with cysteamine showed a significantly decreased incidence of gastric cancers. Concomitant treatment with bromocriptine at 0.5 but not at 0.25 mg/kg body weight significantly attenuated the inhibitory effect of cysteamine on gastric carcinogenesis. Administration of bromocriptine alone at either dosage had no influence on gastric carcinogenesis. The labeling index of the antral mucosa was significantly reduced in rats treated with cysteamine and significantly higher in those treated concomitantly with bromocriptine at 0.5 mg/kg body weight than in those treated with cysteamine alone. These findings indicate that cysteamine suppressed gastric carcinogenesis and that bromocriptine at high dosage attenuated this inhibition. These findings also suggest that dopamine is involved in the mechanism of inhibition of gastric carcinogenesis by cysteamine.

  17. Curcumin attenuates gastric cancer induced by N-methyl-N-nitrosourea and saturated sodium chloride in rats.

    PubMed

    Sintara, Kawiya; Thong-Ngam, Duangporn; Patumraj, Suthiluk; Klaikeaw, Naruemon

    2012-01-01

    To determine effects of curcumin on N-methyl-N-nitrosourea (MNU) and saturated sodium chloride (s-NaCl)-induced gastric cancer in rats. Male Wistar rats were divided into 5 groups: control (CO), control supplemented with 200 mg/kg curcumin (CC), MNU + s-NaCl, MNU + s-NaCl supplemented with 200 mg/kg curcumin daily for the first 3 weeks (MNU + s-NaCl + C3W), and MNU + s-NaCl supplemented with curcumin for 20 weeks (MNU + s-NaCl + C20W). To induce stomach cancer, rats except for CO and CC were orally treated with 100 mg/kg MNU on day 0 and 14, and s-NaCl twice-a-week for the first 3 weeks. The experiment was finished and rats were sacrificed at the end of 20 weeks. Cancers were found in forestomachs of all rats in MNU + s-NaCl. The expressions of phosphorylated inhibitor kappaB alpha (phospho-IκBα), 8-hydroxy-2'-deoxyguanosine (8-OHdG), and cyclin D1 significantly increased in MNU + s-NaCl compared with CO. Curcumin treatments for 3 and 20 weeks reduced the cancer incidence resulting in a decrease of phospho-IκBα expression in benign tumor-bearing rats compared with MNU + s-NaCl. Curcumin treatment for 20 weeks also decreased 8-OHdG expression in benign tumor-bearing rats compared with MNU + s-NaCl. Curcumin can attenuate cancer via a reduction of phospho-IκBα and 8-OHdG expressions, which may play a promising role in gastric carcinogenesis.

  18. The Molecular Signature of the Stroma Response in Prostate Cancer-Induced Osteoblastic Bone Metastasis Highlights Expansion of Hematopoietic and Prostate Epithelial Stem Cell Niches

    PubMed Central

    Secondini, Chiara; Wetterwald, Antoinette; Schwaninger, Ruth; Fleischmann, Achim; Raffelsberger, Wolfgang; Poch, Olivier; Delorenzi, Mauro; Temanni, Ramzi; Mills, Ian G.; van der Pluijm, Gabri; Thalmann, George N.; Cecchini, Marco G.

    2014-01-01

    The reciprocal interaction between cancer cells and the tissue-specific stroma is critical for primary and metastatic tumor growth progression. Prostate cancer cells colonize preferentially bone (osteotropism), where they alter the physiological balance between osteoblast-mediated bone formation and osteoclast-mediated bone resorption, and elicit prevalently an osteoblastic response (osteoinduction). The molecular cues provided by osteoblasts for the survival and growth of bone metastatic prostate cancer cells are largely unknown. We exploited the sufficient divergence between human and mouse RNA sequences together with redefinition of highly species-specific gene arrays by computer-aided and experimental exclusion of cross-hybridizing oligonucleotide probes. This strategy allowed the dissection of the stroma (mouse) from the cancer cell (human) transcriptome in bone metastasis xenograft models of human osteoinductive prostate cancer cells (VCaP and C4-2B). As a result, we generated the osteoblastic bone metastasis-associated stroma transcriptome (OB-BMST). Subtraction of genes shared by inflammation, wound healing and desmoplastic responses, and by the tissue type-independent stroma responses to a variety of non-osteotropic and osteotropic primary cancers generated a curated gene signature (“Core” OB-BMST) putatively representing the bone marrow/bone-specific stroma response to prostate cancer-induced, osteoblastic bone metastasis. The expression pattern of three representative Core OB-BMST genes (PTN, EPHA3 and FSCN1) seems to confirm the bone specificity of this response. A robust induction of genes involved in osteogenesis and angiogenesis dominates both the OB-BMST and Core OB-BMST. This translates in an amplification of hematopoietic and, remarkably, prostate epithelial stem cell niche components that may function as a self-reinforcing bone metastatic niche providing a growth support specific for osteoinductive prostate cancer cells. The induction of this

  19. Measurement of the dispersion and attenuation of cylindrical ultrasonic guided waves in long bone.

    PubMed

    Ta, Dean; Wang, Weiqi; Wang, YuanYuan; Le, Lawrence H; Zhou, Yuqing

    2009-04-01

    Osteoporotic bones are likely to have less cortical bone than healthy bones. The velocities of guided waves propagating in a long cylindrical bone are very sensitive to bone properties and cortical thickness (CTh). This work studies the dispersion and attenuation of ultrasonic guided waves propagating in long cylindrical bone. A hollow cylinder filled with a viscous liquid was used to model the long bone and then to calculate the theoretical phase and group velocities, as well as the attenuation of the waves. The generation and selection of guided wave modes were based on theoretical dispersive curves. The phase velocity and attenuation of cylindrical guided wave modes, such as L(0,1), L(0,2) and L(0,3), were measured in bovine tibia using angled beam transducers at various propagation distances ranging from 75 to 160 mm. The results showed that the phase velocity of the L(0,2) guided wave mode decreased with an increase in CTh. The attenuation of the low cylindrical guided wave modes was a nonlinear function that increased with propagation distance and mode order. The L(0,2) mode had a different attenuation for each CTh. The experimental results were in good agreement with the predicted values. Cylindrical guided waves of low-frequency and low-order have been shown to demonstrate more dispersion and less attenuation and should, therefore, be used to evaluate long bone.

  20. Emerging therapeutic targets in cancer induced bone disease: A focus on the peripheral type 2 cannabinoid receptor.

    PubMed

    Marino, Silvia; Idris, Aymen I

    2017-03-05

    Skeletal complications are a common cause of morbidity in patients with primary bone cancer and bone metastases. The type 2 cannabinoid (Cnr2) receptor is implicated in cancer, bone metabolism and pain perception. Emerging data have uncovered the role of Cnr2 in the regulation of tumour-bone cell interactions and suggest that agents that target Cnr2 in the skeleton have potential efficacy in the reduction of skeletal complications associated with cancer. This review aims to provide an overview of findings relating to the role of Cnr2 receptor in the regulation of skeletal tumour growth, osteolysis and bone pain, and highlights the many unanswered questions and unmet needs. This review argues that development and testing of peripherally-acting, tumour-, Cnr2-selective ligands in preclinical models of metastatic cancer will pave the way for future research that will advance our knowledge about the basic mechanism(s) by which the endocannabinoid system regulate cancer metastasis, stimulate the development of a safer cannabis-based therapy for the treatment of cancer and provide policy makers with powerful tools to assess the science and therapeutic potential of cannabinoid-based therapy. Thus, offering the prospect of identifying selective Cnr2 ligands, as novel, alternative to cannabis herbal extracts for the treatment of advanced cancer patients.

  1. Ultrasonic attenuation in parallel-nylon-wire cancellous-bone-mimicking phantoms.

    PubMed

    Wear, Keith A

    2008-12-01

    Attenuation coefficients between 1.5 and 3.5 MHz were measured on four parallel-nylon-wire arrays (simulating cancellous bone) with four different wire diameters (150, 200, 250, and 300 microm). Interwire spacing was 800 microm for all four parallel-nylon-wire arrays. The measured frequency dependencies of attenuation were consistent with theoretical predications based on Faran's theory, which considers the component of attenuation due to scattering of longitudinal waves.

  2. Minocycline-induced reduction of brain-derived neurotrophic factor expression in relation to cancer-induced bone pain in rats.

    PubMed

    Wang, Li-Na; Yang, Jian-Ping; Zhan, Ying; Ji, Fu-Hai; Wang, Xiu-Yun; Zuo, Jian-Ling; Xu, Qi-Nian

    2012-03-01

    Previous studies have suggested that the release of brain-derived neurotrophic factor (BDNF) from microglia in spinal cord is necessary for maintaining pain hypersensitivity after nerve injury. However, little is known about its role in cancer-induced bone pain (CIBP), which is in some ways unique. This study demonstrates a critical role of minocycline (a potent inhibitor of microglial activation)-modulated BDNF in the induction and maintenance of behavioral hypersensitivity in a rat model of CIBP. We assessed mechanical threshold and spontaneous pain of CIBP rats. Moreover, minocycline was administered intrathecally from day 4 to day 6 (early stage) or from day 10 to day 12 (later stage), after carcinoma cell inoculation. Real-time PCR, Western blots, and double immunofluorescence were used to detect the expression of OX-42 (marker of activated microglia), phosphorylated p38-MAPK (p-p38), and BDNF. We found that intrathecal minocycline could prevent CIBP at an early stage of tumor growth (from day 4 to day 6). However, at the late stage (from day 10 to day 12), intrathecal minocycline had no effect. Moreover, the expression of OX-42 and BDNF under CIBP, peaking on day 6, were all reduced after minocycline injection from day 4 to day 6. The ability of minocycline-induced reduction of BDNF in the induction of behavioral hypersensitivity could provide an opportunity for alleviating CIBP.

  3. Spinal and peripheral analgesic effects of the CB2 cannabinoid receptor agonist AM1241 in two models of bone cancer-induced pain.

    PubMed

    Curto-Reyes, V; Llames, S; Hidalgo, A; Menéndez, L; Baamonde, A

    2010-06-01

    The activation of CB(2) receptors induces analgesia in experimental models of chronic pain. The present experiments were designed to study whether the activation of peripheral or spinal CB(2) receptors relieves thermal hyperalgesia and mechanical allodynia in two models of bone cancer pain. NCTC 2472 osteosarcoma or B16-F10 melanoma cells were intratibially inoculated to C3H/He and C57BL/6 mice. Thermal hyperalgesia was assessed by the unilateral hot plate test and mechanical allodynia by the von Frey test. AM1241 (CB(2) receptor agonist), AM251 (CB(1) receptor antagonist), SR144528 (CB(2) receptor antagonist) and naloxone were used. CB(2) receptor expression was measured by Western blot. AM1241 (0.3-10 mg.kg(-1)) abolished thermal hyperalgesia and mechanical allodynia in both tumour models. The antihyperalgesic effect was antagonized by subcutaneous, intrathecal or peri-tumour administration of SR144528. In contrast, the antiallodynic effect was inhibited by systemic or intrathecal, but not peri-tumour, injection of SR144528. The effects of AM1241 were unchanged by AM251 but were prevented by naloxone. No change in CB(2) receptor expression was found in spinal cord or dorsal root ganglia. Spinal CB(2) receptors are involved in the antiallodynic effect induced by AM1241 in two neoplastic models while peripheral and spinal receptors participate in the antihyperalgesic effects. Both effects were mediated by endogenous opiates. The use of drugs that activate CB(2) receptors could be a useful strategy to counteract bone cancer-induced pain symptoms.

  4. P2Y12 receptor-mediated activation of spinal microglia and p38MAPK pathway contribute to cancer-induced bone pain

    PubMed Central

    Liu, Mingjuan; Yao, Ming; Wang, Hanqi; Xu, Longsheng; Zheng, Ying; Huang, Bing; Ni, Huadong; Xu, Shijie; Zhou, Xuyan; Lian, Qingquan

    2017-01-01

    Background Cancer-induced bone pain (CIBP) is one of the most challenging clinical problems due to a lack of understanding the mechanisms. Recent evidence has demonstrated that activation of microglial G-protein-coupled P2Y12 receptor (P2Y12R) and proinflammatory cytokine production play an important role in neuropathic pain generation and maintenance. However, whether P2Y12R is involved in CIBP remains unknown. Methods The purpose of this study was to investigate the role of P2Y12R in CIBP and its molecular mechanisms. Using the bone cancer model inoculated with Walker 256 tumor cells into the left tibia of Sprague Dawley rat, we blocked spinal P2Y12R through intrathecal administration of its selective antagonist MRS2395 (400 pmol/µL, 15 µL). Results We found that not only the ionized calcium-binding adapter molecule 1 (Iba-1)-positive microglia in the ipsilateral spinal cord but also mechanical allodynia was significantly inhibited. Furthermore, it decreased the phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK) and the production of proinflammatory cytokines interleukin-1β (IL-1β) and interleukin-6 (IL-6), whereas it increased tumor necrosis factor-α (TNF-α). Conclusion Taken together, our present results suggest that microglial P2Y12R in the spinal cord may contribute to CIBP by the activation of spinal microglia and p38MAPK pathway, thus identifying a potential therapeutic target for the treatment of CIBP. PMID:28243146

  5. Spinal and peripheral analgesic effects of the CB2 cannabinoid receptor agonist AM1241 in two models of bone cancer-induced pain

    PubMed Central

    Curto-Reyes, V; Llames, S; Hidalgo, A; Menéndez, L; Baamonde, A

    2010-01-01

    Background and purpose: The activation of CB2 receptors induces analgesia in experimental models of chronic pain. The present experiments were designed to study whether the activation of peripheral or spinal CB2 receptors relieves thermal hyperalgesia and mechanical allodynia in two models of bone cancer pain. Experimental approach: NCTC 2472 osteosarcoma or B16-F10 melanoma cells were intratibially inoculated to C3H/He and C57BL/6 mice. Thermal hyperalgesia was assessed by the unilateral hot plate test and mechanical allodynia by the von Frey test. AM1241 (CB2 receptor agonist), AM251 (CB1 receptor antagonist), SR144528 (CB2 receptor antagonist) and naloxone were used. CB2 receptor expression was measured by Western blot. Key results: AM1241 (0.3–10 mg·kg−1) abolished thermal hyperalgesia and mechanical allodynia in both tumour models. The antihyperalgesic effect was antagonized by subcutaneous, intrathecal or peri-tumour administration of SR144528. In contrast, the antiallodynic effect was inhibited by systemic or intrathecal, but not peri-tumour, injection of SR144528. The effects of AM1241 were unchanged by AM251 but were prevented by naloxone. No change in CB2 receptor expression was found in spinal cord or dorsal root ganglia. Conclusions and implications: Spinal CB2 receptors are involved in the antiallodynic effect induced by AM1241 in two neoplastic models while peripheral and spinal receptors participate in the antihyperalgesic effects. Both effects were mediated by endogenous opiates. The use of drugs that activate CB2 receptors could be a useful strategy to counteract bone cancer-induced pain symptoms. PMID:20233215

  6. Accuracy of CT-based attenuation correction in PET/CT bone imaging.

    PubMed

    Abella, Monica; Alessio, Adam M; Mankoff, David A; MacDonald, Lawrence R; Vaquero, Juan Jose; Desco, Manuel; Kinahan, Paul E

    2012-05-07

    We evaluate the accuracy of scaling CT images for attenuation correction of PET data measured for bone. While the standard tri-linear approach has been well tested for soft tissues, the impact of CT-based attenuation correction on the accuracy of tracer uptake in bone has not been reported in detail. We measured the accuracy of attenuation coefficients of bovine femur segments and patient data using a tri-linear method applied to CT images obtained at different kVp settings. Attenuation values at 511 keV obtained with a (68)Ga/(68)Ge transmission scan were used as a reference standard. The impact of inaccurate attenuation images on PET standardized uptake values (SUVs) was then evaluated using simulated emission images and emission images from five patients with elevated levels of FDG uptake in bone at disease sites. The CT-based linear attenuation images of the bovine femur segments underestimated the true values by 2.9 ± 0.3% for cancellous bone regardless of kVp. For compact bone the underestimation ranged from 1.3% at 140 kVp to 14.1% at 80 kVp. In the patient scans at 140 kVp the underestimation was approximately 2% averaged over all bony regions. The sensitivity analysis indicated that errors in PET SUVs in bone are approximately proportional to errors in the estimated attenuation coefficients for the same regions. The variability in SUV bias also increased approximately linearly with the error in linear attenuation coefficients. These results suggest that bias in bone uptake SUVs of PET tracers ranges from 2.4% to 5.9% when using CT scans at 140 and 120 kVp for attenuation correction. Lower kVp scans have the potential for considerably more error in dense bone. This bias is present in any PET tracer with bone uptake but may be clinically insignificant for many imaging tasks. However, errors from CT-based attenuation correction methods should be carefully evaluated if quantitation of tracer uptake in bone is important.

  7. Accuracy of CT-Based Attenuation Correction in PET/CT Bone Imaging

    PubMed Central

    Abella, Monica; Alessio, Adam M.; Mankoff, David A.; MacDonald, Lawrence R.; Vaquero, Juan Jose; Desco, Manuel; Kinahan, Paul E.

    2012-01-01

    We evaluate the accuracy of scaling CT images for attenuation correction of PET data measured for bone. While the standard tri-linear approach has been well-tested for soft tissues, the impact of CT-based attenuation correction on the accuracy of tracer uptake in bone has not been reported in detail. We measured the accuracy of attenuation coefficients of bovine femur segments and patient data using a tri-linear method applied to CT images obtained at different kVp settings. Attenuation values at 511 keV obtained with a 68Ga/68Ge transmission scan were used as a reference standard. The impact of inaccurate attenuation images on PET standardized uptake values (SUVs) was then evaluated using simulated emission images and emission images from five patients with elevated levels of FDG uptake in bone at disease sites. The CT-based linear attenuation images of the bovine femur segments underestimated the true values by 2.9±0.3% for cancellous bone regardless of kVp. For compact bone the underestimation ranged from 1.3% at 140 kVp to 14.1% at 80 kVp. In the patient scans at 140 kVp the underestimation was approximately 2% averaged over all bony regions. The sensitivity analysis indicated that errors in PET SUVs in bone are approximately proportional to errors in the estimated attenuation coefficients for the same regions. The variability in SUV bias also increased approximately linearly with the error in linear attenuation coefficients. These results suggest that bias in bone uptake SUVs of PET tracers range from 2.4% to 5.9% when using CT scans at 140 and 120 kVp for attenuation correction. Lower kVp scans have the potential for considerably more error in dense bone. This bias is present in any PET tracer with bone uptake but may be clinically insignificant for many imaging tasks. However, errors from CT-based attenuation correction methods should be carefully evaluated if quantitation of tracer uptake in bone is important. PMID:22481547

  8. Accuracy of CT-based attenuation correction in PET/CT bone imaging

    NASA Astrophysics Data System (ADS)

    Abella, Monica; Alessio, Adam M.; Mankoff, David A.; MacDonald, Lawrence R.; Vaquero, Juan Jose; Desco, Manuel; Kinahan, Paul E.

    2012-05-01

    We evaluate the accuracy of scaling CT images for attenuation correction of PET data measured for bone. While the standard tri-linear approach has been well tested for soft tissues, the impact of CT-based attenuation correction on the accuracy of tracer uptake in bone has not been reported in detail. We measured the accuracy of attenuation coefficients of bovine femur segments and patient data using a tri-linear method applied to CT images obtained at different kVp settings. Attenuation values at 511 keV obtained with a 68Ga/68Ge transmission scan were used as a reference standard. The impact of inaccurate attenuation images on PET standardized uptake values (SUVs) was then evaluated using simulated emission images and emission images from five patients with elevated levels of FDG uptake in bone at disease sites. The CT-based linear attenuation images of the bovine femur segments underestimated the true values by 2.9 ± 0.3% for cancellous bone regardless of kVp. For compact bone the underestimation ranged from 1.3% at 140 kVp to 14.1% at 80 kVp. In the patient scans at 140 kVp the underestimation was approximately 2% averaged over all bony regions. The sensitivity analysis indicated that errors in PET SUVs in bone are approximately proportional to errors in the estimated attenuation coefficients for the same regions. The variability in SUV bias also increased approximately linearly with the error in linear attenuation coefficients. These results suggest that bias in bone uptake SUVs of PET tracers ranges from 2.4% to 5.9% when using CT scans at 140 and 120 kVp for attenuation correction. Lower kVp scans have the potential for considerably more error in dense bone. This bias is present in any PET tracer with bone uptake but may be clinically insignificant for many imaging tasks. However, errors from CT-based attenuation correction methods should be carefully evaluated if quantitation of tracer uptake in bone is important.

  9. The Extravehicular Suit Impact Load Attenuation Study for Use in Astronaut Bone Fracture Prediction

    NASA Technical Reports Server (NTRS)

    Lewandowski, Beth E.; Gilkey, Kelly M.; Sulkowski, Christina M.; Samorezov, Sergey; Myers, Jerry G.

    2011-01-01

    The NASA Integrated Medical Model (IMM) assesses the risk, including likelihood and impact of occurrence, of all credible in-flight medical conditions. Fracture of the proximal femur is a traumatic injury that would likely result in loss of mission if it were to happen during spaceflight. The low gravity exposure causes decreases in bone mineral density which heightens the concern. Researchers at the NASA Glenn Research Center have quantified bone fracture probability during spaceflight with a probabilistic model. It was assumed that a pressurized extravehicular activity (EVA) suit would attenuate load during a fall, but no supporting data was available. The suit impact load attenuation study was performed to collect analogous data. METHODS: A pressurized EVA suit analog test bed was used to study how the offset, defined as the gap between the suit and the astronaut s body, impact load magnitude and suit operating pressure affects the attenuation of impact load. The attenuation data was incorporated into the probabilistic model of bone fracture as a function of these factors, replacing a load attenuation value based on commercial hip protectors. RESULTS: Load attenuation was more dependent on offset than on pressurization or load magnitude, especially at small offsets. Load attenuation factors for offsets between 0.1 - 1.5 cm were 0.69 +/- 0.15, 0.49 +/- 0.22 and 0.35 +/- 0.18 for mean impact forces of 4827, 6400 and 8467 N, respectively. Load attenuation factors for offsets of 2.8 - 5.3 cm were 0.93 +/- 0.2, 0.94 +/- 0.1 and 0.84 +/- 0.5, for the same mean impact forces. Reductions were observed in the 95th percentile confidence interval of the bone fracture probability predictions. CONCLUSIONS: The reduction in uncertainty and improved confidence in bone fracture predictions increased the fidelity and credibility of the fracture risk model and its benefit to mission design and operational decisions.

  10. Frequency Specific Ultrasound Attenuation Is Sensitive to Trabecular Bone Structure

    PubMed Central

    Lin, Wei; Serra-Hsu, Frederick; Chen, Jiqi; Qin, Yi-Xian

    2012-01-01

    This study investigated the efficacy of frequency modulated ultrasound attenuation in the assessment of the trabecular structural properties. Four frequency modulated signals were created to represent four frequency bands centered at 500 kHz, 900 kHz, 1.3 MHz and 1.7 MHz with the bandwidth of 400 kHz. Five one-centimeter trabecular cubes were harvested from fresh bovine distal femur. The cubes underwent four steps of demineralization process to expand the sample size to twenty five with the greater variations of the structural properties for the better correlation study. Pearson correlation study was performed between the ultrasound attenuation in four frequency bands and the trabecular structural properties. The results showed that correlations of frequency modulated ultrasound attenuation to the trabecular structural properties are dependent on frequency bands. The attenuation in proximal-distal orientation had the highest correlation to BV/TV (R2=0.73, p<0.001) and trabecular thickness (R2=0.50, p<0.001) at the frequency band centered at 1.7 MHz. It was equivalent in the four frequency bands in correlation to the trabecular number (average R2=0.80, p<0.001) and to the trabecular separation (average R2 =0.83, p<0.001). The attenuation in anterio-posterial orientation had the highest correlation to BV/TV (R2=0.80, p<0.001) and trabecular thickness (R2=0.71, p<0.001) at the frequency band centered at 1.3 MHz. The attenuation in the first frequency band was the most sensitive to the trabecular number (R2=0.71, p<0.001) and trabecular separation (R2=0.80, p<0.001). No significant correlation was observed for the attenuation in medial-lateral orientation across the four frequency bands. PMID:22975035

  11. Visceral adiposity is negatively associated with bone density and muscle attenuation.

    PubMed

    Zhang, Peng; Peterson, Mark; Su, Grace L; Wang, Stewart C

    2015-02-01

    The storage of adipose tissue in ectopic compartments is a hallmark attribute linking greater body mass index (BMI) with cardiometabolic diseases. Despite ample evidence to confirm that increased visceral adipose tissue (VAT) deposition occurs with obesity, the interrelations between altered fat partitioning and regional muscle and bone quality are less well understood. We examined the association between adiposity and spinal muscle and bone quality across a large, heterogeneous cohort of adults. We identified 8833 thoracic or abdominal computed tomography scans from patients in the University of Michigan Health System who were aged 18-64.9 y. We measured trabecular bone densities, cortical bone densities, VAT areas, and subcutaneous adipose tissue (SAT) areas at vertebral levels T7 to L5. Psoas muscle attenuation (an indicator of fat infiltration in muscle) was measured at the L4 level. Muscle attenuation as well as trabecular and cortical bone densities revealed negative correlations with BMI, SAT, and VAT. The correlation between BMI and psoas attenuation was -0.321, between BMI and the density of cortical bone was -0.250, and between BMI and trabecular bone was -0.143 (all P < 0.001). However, correlations between VAT and lower muscle attenuation were stronger as were those between VAT and lower bone densities. Inverse correlations between VAT and densities of psoas muscle and cortical and trabecular bone were -0.460, -0.407, and -0.434, respectively (P < 0.001). Even after adjustment for age, sex, and BMI, partial correlations between VAT, muscle attenuation, and bone densities remained significant at -0.250, -0.119, and -0.216, respectively (P < 0.001). Contrary to previous reports that high body mass is associated with increased bone quality, our data show a significant negative association between BMI and muscle and bone densities, suggesting fat infiltration into these tissues. More importantly, correlations between VAT and decreased bone and muscle

  12. Coadministration of puerarin (low dose) and zinc attenuates bone loss and suppresses bone marrow adiposity in ovariectomized rats.

    PubMed

    Liu, Hao; Li, Wei; Ge, Xiyuan; Jia, Shengnan; Li, Binbin

    2016-12-01

    Puerarin is a phytoestrogen that shows osteogenic effects. Meanwhile, zinc stimulates bone formation and inhibits bone resorption. The study aims to investigate the effects of coadministration of puerarin (low dose) and zinc on bone formation in ovariectomized rats. Co-administration or use alone of puerarin (low dose) and/or zinc were gavaged in OVX rats. The estrogen-like effects were detected by the uterus weight, the histologic observation and the IGF-1 protein expression. The osteogenic effects were determined by bone histomorphometric and mechanical parameters, osteogenic and adipogenic blood markers, and so on. The results showed that oral administration of puerarin (low dose) plus zinc didn't significantly increase uterus weight. The glandular epithelial of endometrium had no proliferation and no protein expression of IGF-1. Moreover, co-administration attenuated bone loss and biomechanical decrease more than single use of puerarin or zinc (p<0.05). Next, combined administration of puerarin and zinc promoted the serological level of osteocalcin, bone marrow stromal cell (BMSC) proliferation, and the expression of alkaline phosphatase (ALP), and suppressed the serological level of adiponectin and adiposity in bone marrow (BM). In conclusion, co-administrated puerarin (low dose) and zinc can partially reverse OVX-induced bone loss and suppress the adiposity of BM in rats, which shed light on the potential use of puerarin and zinc in the treatment of osteoporosis. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. An extravehicular suit impact load attenuation study to improve astronaut bone fracture prediction.

    PubMed

    Sulkowski, Christina M; Gilkey, Kelly M; Lewandowski, Beth E; Samorezov, Sergey; Myers, Jerry G

    2011-04-01

    Understanding the contributions to the risk of bone fracture during spaceflight is essential for mission success. A pressurized extravehicular activity (EVA) suit analogue test bed was developed, impact load attenuation data were obtained, and the load at the hip of an astronaut who falls to the side during an EVA was characterized. Offset (representing the gap between the EVA suit and the astronaut's body), impact load magnitude, and EVA suit operating pressure were factors varied in the study. The attenuation data were incorporated into a probabilistic model of bone fracture risk during spaceflight, replacing the previous load attenuation value that was based on commercial hip protector data. Load attenuation was more dependent on offset than on pressurization or load magnitude, especially at small offset values. Load attenuation factors for offsets between 0.1-1.5 cm were 0.69 +/- 0.15, 0.49 +/- 0.22, and 0.35 +/- 0.18 for mean impact forces of 4827, 6400, and 8467 N, respectively. Load attenuation factors for offsets of 2.8-5.3 cm were 0.93 +/- 0.2, 0.94 +/- 0.1, and 0.84 +/- 0.5 for the same mean impact forces. The mean and 95th percentile bone fracture risk index predictions were each reduced by 65-83%. The mean and 95th percentile bone fracture probability predictions were both reduced approximately 20-50%. The reduction in uncertainty and improved confidence in bone fracture predictions increased the fidelity and credibility of the fracture risk model and its benefit to mission design and in-flight operational decisions.

  14. Connexin 43 deficiency attenuates loss of trabecular bone and prevents suppression of cortical bone formation during unloading.

    PubMed

    Lloyd, Shane A; Lewis, Gregory S; Zhang, Yue; Paul, Emmanuel M; Donahue, Henry J

    2012-11-01

    Connexin 43 (Cx43) is the most abundant gap junction protein in bone and has been demonstrated as an integral component of skeletal homeostasis. In the present study, we sought to further refine the role of Cx43 in the response to mechanical unloading by subjecting skeletally mature mice with a bone-specific deletion of Cx43 (cKO) to 3 weeks of mechanical unloading via hindlimb suspension (HLS). The HLS model was selected to recapitulate the effects of skeletal unloading due to prolonged bed rest, reduced activity associated with aging, and spaceflight microgravity. At baseline, the cortical bone of cKO mice displayed an osteopenic phenotype, with expanded cortices, decreased cortical thickness, decreased bone mineral density, and increased porosity. There was no baseline trabecular phenotype. After 3 weeks of HLS, wild-type (WT) mice experienced a substantial decline in trabecular bone volume fraction, connectivity density, trabecular thickness, and trabecular tissue mineral density. These deleterious effects were attenuated in cKO mice. Conversely, there was a similar and significant amount of cortical bone loss in both WT and cKO. Interestingly, mechanical testing revealed a greater loss of strength and rigidity for cKO during HLS. Analysis of double-label quantitative histomorphometry data demonstrated a substantial decrease in bone formation rate, mineralizing surface, and mineral apposition rate at both the periosteal and endocortical surfaces of the femur after unloading of WT mice. This suppression of bone formation was not observed in cKO mice, in which parameters were maintained at baseline levels. Taken together, the results of the present study indicate that Cx43 deficiency desensitizes bone to the effects of mechanical unloading, and that this may be due to an inability of mechanosensing osteocytes to effectively communicate the unloading state to osteoblasts to suppress bone formation. Cx43 may represent a novel therapeutic target for investigation as

  15. Numerical and experimental study on the wave attenuation in bone--FDTD simulation of ultrasound propagation in cancellous bone.

    PubMed

    Nagatani, Yoshiki; Mizuno, Katsunori; Saeki, Takashi; Matsukawa, Mami; Sakaguchi, Takefumi; Hosoi, Hiroshi

    2008-11-01

    In cancellous bone, longitudinal waves often separate into fast and slow waves depending on the alignment of bone trabeculae in the propagation path. This interesting phenomenon becomes an effective tool for the diagnosis of osteoporosis because wave propagation behavior depends on the bone structure. Since the fast wave mainly propagates in trabeculae, this wave is considered to reflect the structure of trabeculae. For a new diagnosis method using the information of this fast wave, therefore, it is necessary to understand the generation mechanism and propagation behavior precisely. In this study, the generation process of fast wave was examined by numerical simulations using elastic finite-difference time-domain (FDTD) method and experimental measurements. As simulation models, three-dimensional X-ray computer tomography (CT) data of actual bone samples were used. Simulation and experimental results showed that the attenuation of fast wave was always higher in the early state of propagation, and they gradually decreased as the wave propagated in bone. This phenomenon is supposed to come from the complicated propagating paths of fast waves in cancellous bone.

  16. Protein malnutrition attenuates bone anabolic response to PTH in female rats.

    PubMed

    Ammann, P; Zacchetti, G; Gasser, J A; Lavet, C; Rizzoli, R

    2015-02-01

    PTH is indicated for the treatment of severe osteoporosis. Elderly osteoporotic patients frequently suffer from protein malnutrition, which may contribute to bone loss. It is unknown whether this malnutrition may affect the response to PTH. Therefore, the aim of the present study was to assess whether an isocaloric low-protein (LP) diet may influence the bone anabolic response to intermittent PTH in 6-month-old female rats. Six-month-old female rats were either pair fed an isocaloric LP diet (2.5% casein) or a normal-protein (NP) diet (15% casein) for 2 weeks. The rats continued on their respective diet while being treated with 5- or 40-μg/kg recombinant human PTH amino-terminal fragment 1-34 (PTH-[1-34]) daily, or with vehicle for 4 weeks. At the end of this period, areal bone mineral density, bone mineral content, microstructure, and bone strength in axial compression of proximal tibia or 3-point bending for midshaft tibia tests were measured. Blood was collected for the determination of IGF-I and osteocalcin. After 4 weeks of PTH-(1-34), the dose-dependent increase of proximal tibia bone mineral density, trabecular microstructure variables, and bone strength was attenuated in rats fed a LP diet as compared with rats on a NP intake. At the level of midshaft tibia cortical bone, PTH-(1-34) exerted an anabolic effect only in the NP but not in the LP diet group. Protein malnutrition was associated with lower IGF-I levels. Protein malnutrition attenuates the bone anabolic effects of PTH-(1-34) in rats. These results suggest that a sufficient protein intake should be recommended for osteoporotic patients undergoing PTH therapy.

  17. Numerical investigation of ultrasonic attenuation through 2D trabecular bone structures reconstructed from CT scans and random realizations.

    PubMed

    Gilbert, Robert P; Guyenne, Philippe; Li, Jing

    2014-02-01

    In this paper, we compare ultrasound interrogations of actual CT-scanned images of trabecular bone with artificial randomly constructed bone. Even though it is known that actual bone does not have randomly distributed trabeculae, we find that the ultrasound attenuations are close enough to cast doubt on any microstructural information, such as trabeculae width and distance between trabeculae, being gleaned from such experiments. More precisely, we perform numerical simulations of ultrasound interrogation on cancellous bone to investigate the phenomenon of ultrasound attenuation as a function of excitation frequency and bone porosity. The theoretical model is based on acoustic propagation equations for a composite fluid-solid material and is solved by a staggered-grid finite-difference scheme in the time domain. Numerical experiments are performed on two-dimensional bone samples reconstructed from CT-scanned images of real human calcaneus and from random distributions of fluid-solid particles generated via the turning bands method. A detailed comparison is performed on various parameters such as the attenuation rate and speed of sound through the bone samples as well as the normalized broadband ultrasound attenuation coefficient. Comparing results from these two types of bone samples allows us to assess the role of bone microstructure in ultrasound attenuation. It is found that the random model provides suitable bone samples for ultrasound interrogation in the transverse direction of the trabecular network.

  18. Klotho preservation via histone deacetylase inhibition attenuates chronic kidney disease-associated bone injury in mice

    PubMed Central

    Lin, Wenjun; Li, Yanning; chen, Fang; Yin, Shasha; Liu, Zhihong; Cao, Wangsen

    2017-01-01

    Bone loss and increased fracture are the devastating outcomes of chronic kidney disease-mineral and bone disorder (CKD-MBD) resulting from Klotho deficit-related mineral disturbance and hyperparathyroidism. Because Klotho down-regulation after renal injury is presumably affected by aberrant histone deacetylase (HDAC) activities, here we assess whether HDAC inhibition prevents Klotho loss and attenuates the CKD-associated bone complication in a mouse model of CKD-MBD. Mice fed adenine-containing diet developed the expected renal damage, a substantial Klotho loss and the deregulated key factors causally affecting bone remodeling, which were accompanied by a marked reduction of bone mineral density. Intriguingly, administration of a potent HDAC inhibitor trichostatin A (TSA) impressively alleviated the Klotho deficit and the observed alterations of serum, kidney and bone. TSA prevented Klotho loss by increasing the promoter-associated histone acetylation, therefore increasing Klotho transcription. More importantly the mice lacking Klotho by siRNA interference largely abolished the TSA protections against the serum and renal abnormalities, and the deranged bone micro-architectures. Thus, our study identified Klotho loss as a key event linking HDAC deregulation to the renal and bone injuries in CKD-MBD mice and demonstrated the therapeutic potentials of endogenous Klotho restoration by HDAC inhibition in treating CKD and the associated extrarenal complications. PMID:28387374

  19. Determining attenuation properties of interfering fast and slow ultrasonic waves in cancellous bone

    PubMed Central

    Nelson, Amber M.; Hoffman, Joseph J.; Anderson, Christian C.; Holland, Mark R.; Nagatani, Yoshiki; Mizuno, Katsunori; Matsukawa, Mami; Miller, James G.

    2011-01-01

    Previous studies have shown that interference between fast waves and slow waves can lead to observed negative dispersion in cancellous bone. In this study, the effects of overlapping fast and slow waves on measurements of the apparent attenuation as a function of propagation distance are investigated along with methods of analysis used to determine the attenuation properties. Two methods are applied to simulated data that were generated based on experimentally acquired signals taken from a bovine specimen. The first method uses a time-domain approach that was dictated by constraints imposed by the partial overlap of fast and slow waves. The second method uses a frequency-domain log-spectral subtraction technique on the separated fast and slow waves. Applying the time-domain analysis to the broadband data yields apparent attenuation behavior that is larger in the early stages of propagation and decreases as the wave travels deeper. In contrast, performing frequency-domain analysis on the separated fast waves and slow waves results in attenuation coefficients that are independent of propagation distance. Results suggest that features arising from the analysis of overlapping two-mode data may represent an alternate explanation for the previously reported apparent dependence on propagation distance of the attenuation coefficient of cancellous bone. PMID:21973378

  20. Determining attenuation properties of interfering fast and slow ultrasonic waves in cancellous bone.

    PubMed

    Nelson, Amber M; Hoffman, Joseph J; Anderson, Christian C; Holland, Mark R; Nagatani, Yoshiki; Mizuno, Katsunori; Matsukawa, Mami; Miller, James G

    2011-10-01

    Previous studies have shown that interference between fast waves and slow waves can lead to observed negative dispersion in cancellous bone. In this study, the effects of overlapping fast and slow waves on measurements of the apparent attenuation as a function of propagation distance are investigated along with methods of analysis used to determine the attenuation properties. Two methods are applied to simulated data that were generated based on experimentally acquired signals taken from a bovine specimen. The first method uses a time-domain approach that was dictated by constraints imposed by the partial overlap of fast and slow waves. The second method uses a frequency-domain log-spectral subtraction technique on the separated fast and slow waves. Applying the time-domain analysis to the broadband data yields apparent attenuation behavior that is larger in the early stages of propagation and decreases as the wave travels deeper. In contrast, performing frequency-domain analysis on the separated fast waves and slow waves results in attenuation coefficients that are independent of propagation distance. Results suggest that features arising from the analysis of overlapping two-mode data may represent an alternate explanation for the previously reported apparent dependence on propagation distance of the attenuation coefficient of cancellous bone.

  1. Treatment with resveratrol attenuates sublesional bone loss in spinal cord-injured rats

    PubMed Central

    Wang, Hua-Dong; Shi, Ya-Min; Li, Li; Guo, Ji-Dong; Zhang, Yu-Peng; Hou, Shu-Xun

    2013-01-01

    BACKGROUND AND PURPOSE Sublesional osteoporosis predisposes individuals with spinal cord injury (SCI) to an increased risk of low-trauma fracture. The aim of the present work was to investigate the effect of treatment with resveratrol (RES) on sublesional bone loss in spinal cord-injured rats. EXPERIMENTAL APPROACH Complete SCI was generated by surgical transaction of the cord at the T10–12 level. Treatment with RES (400 mg·kg−1 body mass per day−1, intragastrically) was initiated 12 h after the surgery for 10 days. Then, blood was collected and femurs and tibiae were removed for evaluation of the effects of RES on bone tissue after SCI. KEY RESULTS Treatment of SCI rats with RES prevented the reduction of bone mass including bone mineral content and bone mineral density in tibiae, preserved bone structure including trabecular bone volume fraction, trabecular number, and trabecular thickness in tibiae, and preserved mechanical strength including ultimate load, stiffness, and energy in femurs. Treatment of SCI rats with RES enhanced femoral total sulfhydryl content, reduced femoral malondialdehyde and IL-6 mRNA levels. Treatment of SCI rats with RES suppressed the up-regulation of mRNA levels of PPARγ, adipose-specific fatty-acid-binding protein and lipoprotein lipase, and restored mRNA levels of Wnt1, low-density lipoprotein-related protein 5, Axin2, ctnnb1, insulin-like growth factor 1 (IGF-1) and receptor for IGF-1 in femurs and tibiae. CONCLUSIONS AND IMPLICATIONS Treatment with RES attenuated sublesional bone loss in spinal-cord-injured rats, associated with abating oxidative stress, attenuating inflammation, depressing PPARγ signalling, and restoring Wnt/β-catenin and IGF-1 signalling. PMID:23848300

  2. Anthropometric and fitness variables associated with bone mineral density and broadband ultrasound attenuation in ambulatory children with cerebral palsy.

    PubMed

    Chen, Chia-ling; Ke, Jyh-yuh; Lin, Keh-chung; Wang, Chao-jan; Wu, Ching-yi; Liu, Wen-yu

    2011-05-01

    We investigated anthropometric and fitness variables associated with areal bone mineral densities and broadband ultrasound attenuation in ambulatory children with cerebral palsy. Thirty-four children with cerebral palsy, aged 4-12 years, and 33 normal development children were collected. There were significant differences in femoral bone densities and calcaneus broadband ultrasound attenuation, but not in lumbar bone densities, between cerebral palsy and normal groups. Regression analysis revealed that different anthropometric and fitness variables were linked to bone densities of different skeletal regions in children with cerebral palsy (adjusted r(2) = .41-.67). Growth variables were mainly related to femoral and lumbar bone densities, while muscular endurance was mainly related to femoral and calcaneus bone densities. These findings suggest multiple complex variables can contribute to bone density variations among different skeleton areas in these children. These data can allow clinicians to identifying early these children at risk for low bone density.

  3. Secreted frizzled-related protein 1 modulates glucocorticoid attenuation of osteogenic activities and bone mass.

    PubMed

    Wang, Feng-Sheng; Lin, Chun-Liang; Chen, Yeung-Jen; Wang, Ching-Jen; Yang, Kuender D; Huang, Yu-Ting; Sun, Yi-Chih; Huang, Hui-Chen

    2005-05-01

    Prolonged glucocorticoid treatment is known to cause osteoporosis or aseptic necrosis. Secreted frizzled-related proteins 1 (SFRP1) and low-density lipoprotein-related protein 5 (LRP5), a Wnt protein antagonist and a coreceptor, have been found to regulate skeletogenesis. Whereas recent studies have reported that excess glucocorticoid promotes bone loss, the biological role of SFRP1 and LRP5 in regulating glucocorticoid attenuation of bone formation is not fully understood. We showed that a supraphysiological level of glucocorticoid enhanced SFRP1 but not LRP5 expression of primary mesenchymal cell cultures in vitro and osteoblasts at metaphyseal trabecular endosteum and chondrocytes at calcified cartilage in vivo. Glucocorticoid augmentation of SFRP1 expression was transcriptionally mediated. The inhibitory action of glucocorticoid on osteogenic differentiation appeared to be regulated by SFRP1 mediation of beta-catenin destabilization because knocking down SFRP1 by RNA interference abrogated the supraphysiological level of glucocorticoid attenuation of osteogenesis. Recombinant human SFRP1 reduced the promoting effect of physiological level of glucocorticoid on cytosolic beta-catenin accumulation, runt-related transcription factor-2 activation, and osteogenic activities. Glucocorticoid and recombinant human SFRP1 significantly increased osteochondral cell apoptosis associated with reduced mineral density, biomechanical properties, trabecular bone volume, and midshaft cortical bone areas in rat femurs. These findings suggest that SFRP1 modulates glucocorticoid-induced bone loss. Regulation of Wnt/SFRP signal transduction can be used in the future as an alternative strategy for the prevention of glucocorticoid-induced osteoporosis.

  4. Hearing protection: Surpassing the limits to attenuation imposed by the bone-conduction pathways

    NASA Astrophysics Data System (ADS)

    Berger, Elliott H.; Kieper, Ronald W.; Gauger, Dan

    2003-10-01

    With louder and louder weapon systems being developed and military personnel being exposed to steady noise levels approaching and sometimes exceeding 150 dB, a growing interest in greater amounts of hearing protection is evident. When the need for communications is included in the equation, the situation is even more extreme. New initiatives are underway to design improved hearing protection, including active noise reduction (ANR) earplugs and perhaps even active cancellation of head-borne vibration. With that in mind it may be useful to explore the limits to attenuation, and whether they can be approached with existing technology. Data on the noise reduction achievable with high-attenuation foam earplugs, as a function of insertion depth, will be reported. Previous studies will be reviewed that provide indications of the bone-conduction (BC) limits to attenuation that, in terms of mean values, range from 40 to 60 dB across the frequencies from 125 Hz to 8 kHz. Additionally, new research on the effects of a flight helmet on the BC limits, as well as the potential attenuation from deeply inserted passive foam earplugs, worn with passive earmuffs, or with active-noise reduction (ANR) earmuffs, will be examined. The data demonstrate that gains in attenuation exceeding 10 dB above the head-not-covered limits can be achieved if the head is effectively shielded from acoustical stimulation.

  5. Hearing protection: surpassing the limits to attenuation imposed by the bone-conduction pathways.

    PubMed

    Berger, Elliott H; Kieper, Ronald W; Gauger, Dan

    2003-10-01

    With louder and louder weapon systems being developed and military personnel being exposed to steady noise levels approaching and sometimes exceeding 150 dB, a growing interest in greater amounts of hearing protection is evident. When the need for communications is included in the equation, the situation is even more extreme. New initiatives are underway to design improved hearing protection, including active noise reduction (ANR) earplugs and perhaps even active cancellation of head-borne vibration. With that in mind it may be useful to explore the limits to attenuation, and whether they can be approached with existing technology. Data on the noise reduction achievable with high-attenuation foam earplugs, as a function of insertion depth, will be reported. Previous studies will be reviewed that provide indications of the bone-conduction (BC) limits to attenuation that, in terms of mean values, range from 40 to 60 dB across the frequencies from 125 Hz to 8 kHz. Additionally, new research on the effects of a flight helmet on the BC limits, as well as the potential attenuation from deeply inserted passive foam earplugs, worn with passive earmuffs, or with active-noise reduction (ANR) earmuffs, will be examined. The data demonstrate that gains in attenuation exceeding 10 dB above the head-not-covered limits can be achieved if the head is effectively shielded from acoustical stimulation.

  6. PPARγ antagonist attenuates mouse immune-mediated bone marrow failure by inhibition of T cell function

    PubMed Central

    Sato, Kazuya; Feng, Xingmin; Chen, Jichun; Li, Jungang; Muranski, Pawel; Desierto, Marie J.; Keyvanfar, Keyvan; Malide, Daniela; Kajigaya, Sachiko; Young, Neal S.

    2016-01-01

    Acquired aplastic anemia is an immune-mediated disease, in which T cells target hematopoietic cells; at presentation, the bone marrow is replaced by fat. It was reported that bone marrow adipocytes were negative regulators of hematopoietic microenvironment. To examine the role of adipocytes in bone marrow failure, we investigated peroxisomal proliferator-activated receptor gamma, a key transcription factor in adipogenesis, utilizing an antagonist of this factor called bisphenol-A-diglycidyl-ether. While bisphenol-A-diglycidyl-ether inhibited adipogenesis as expected, it also suppressed T cell infiltration of bone marrow, reduced plasma inflammatory cytokines, decreased expression of multiple inflammasome genes, and ameliorated marrow failure. In vitro, bisphenol-A-diglycidyl-ether suppressed activation and proliferation, and reduced phospholipase C gamma 1 and nuclear factor of activated T-cells 1 expression, as well as inhibiting calcium flux in T cells. The in vivo effect of bisphenol-A-diglycidyl-ether on T cells was confirmed in a second immune-mediated bone marrow failure model, using different strains and non-major histocompatibility antigen mismatched: bisphenol-A-diglycidyl-ether ameliorated marrow failure by inhibition of T cell infiltration of bone marrow. Our data indicate that peroxisomal proliferator-activated receptor gamma antagonists may attenuate murine immune-mediated bone marrow failure, at least in part, by suppression of T cell activation, which might hold implications in the application of peroxisomal proliferator-activated receptor gamma antagonists in immune-mediated pathophysiologies, both in the laboratory and in the clinic. Genetically “fatless” mice developed bone marrow failure with accumulation of marrow adipocytes in our model, even in the absence of body fat, suggesting different mechanisms of systematic and marrow adipogenesis and physiologic versus pathophysiologic fat accumulation. PMID:26589913

  7. PPARγ antagonist attenuates mouse immune-mediated bone marrow failure by inhibition of T cell function.

    PubMed

    Sato, Kazuya; Feng, Xingmin; Chen, Jichun; Li, Jungang; Muranski, Pawel; Desierto, Marie J; Keyvanfar, Keyvan; Malide, Daniela; Kajigaya, Sachiko; Young, Neal S

    2016-01-01

    Acquired aplastic anemia is an immune-mediated disease, in which T cells target hematopoietic cells; at presentation, the bone marrow is replaced by fat. It was reported that bone marrow adipocytes were negative regulators of hematopoietic microenvironment. To examine the role of adipocytes in bone marrow failure, we investigated peroxisomal proliferator-activated receptor gamma, a key transcription factor in adipogenesis, utilizing an antagonist of this factor called bisphenol-A-diglycidyl-ether. While bisphenol-A-diglycidyl-ether inhibited adipogenesis as expected, it also suppressed T cell infiltration of bone marrow, reduced plasma inflammatory cytokines, decreased expression of multiple inflammasome genes, and ameliorated marrow failure. In vitro, bisphenol-A-diglycidyl-ether suppressed activation and proliferation, and reduced phospholipase C gamma 1 and nuclear factor of activated T-cells 1 expression, as well as inhibiting calcium flux in T cells. The in vivo effect of bisphenol-A-diglycidyl-ether on T cells was confirmed in a second immune-mediated bone marrow failure model, using different strains and non-major histocompatibility antigen mismatched: bisphenol-A-diglycidyl-ether ameliorated marrow failure by inhibition of T cell infiltration of bone marrow. Our data indicate that peroxisomal proliferator-activated receptor gamma antagonists may attenuate murine immune-mediated bone marrow failure, at least in part, by suppression of T cell activation, which might hold implications in the application of peroxisomal proliferator-activated receptor gamma antagonists in immune-mediated pathophysiologies, both in the laboratory and in the clinic. Genetically "fatless" mice developed bone marrow failure with accumulation of marrow adipocytes in our model, even in the absence of body fat, suggesting different mechanisms of systematic and marrow adipogenesis and physiologic versus pathophysiologic fat accumulation.

  8. Impacts of anti-nerve growth factor antibody on pain-related behaviors and expressions of opioid receptor in spinal dorsal horn and dorsal root ganglia of rats with cancer-induced bone pain

    PubMed Central

    Ding, Yuanyuan; Wang, Zhibin; Ma, Jiaming; Hong, Tao; Zhu, Yongqiang; Li, Hongxi; Pan, Shinong

    2016-01-01

    Objective To investigate the impacts of anti-nerve growth factor antibody on pain-related behaviors and expressions of μ-opioid receptor in spinal dorsal horn and dorsal root ganglia of rats with cancer-induced bone pain. Methods The rats were randomly grouped and then injected with 10 μl of phosphate buffer saline or Walker256 tumor cells into the upper segment of left tibia. Thirteen days after the injection, the intrathecal catheterization was performed, followed by the injection of saline, anti-nerve growth factor, nerve growth factor, and naloxone twice a day. The pain ethological changes were measured at the set time points; the expression changes of μ-opioid receptor protein and mRNA in spinal dorsal horn and dorsal root ganglia were detected on the 18th day. Results After the tumor cells were injected into the tibia, hyperalgesia appeared and the expression of μ-opioid receptor protein and mRNA in spinal dorsal horn and dorsal root ganglia was increased, compared with the sham group; after intrathecally injected anti-nerve growth factor, the significant antinociceptive effects appeared, and the μ-opioid receptor expression was increased, compared with the cancer pain group; the μ-opioid receptor expressions in the other groups showed no statistical significance. The naloxone pretreatment could mostly inverse the antinociception effects of anti-nerve growth factor. Conclusions Anti-nerve growth factor could reduce hyperalgesia in the cancer-induced bone pain rats, and the antinociceptive effects were related with the upregulation of μ-opioid receptor. PMID:27118770

  9. Inhibition of TGF–β signaling in subchondral bone mesenchymal stem cells attenuates osteoarthritis

    PubMed Central

    Zhen, Gehua; Wen, Chunyi; Jia, Xiaofeng; Li, Yu; Crane, Janet L.; Mears, Simon C.; Askin, Frederic B.; Frassica, Frank J.; Chang, Weizhong; Yao, Jie; Nayfeh, Tariq; Johnson, Carl; Artemov, Dmitri; Chen, Qianming; Zhao, Zhihe; Zhou, Xuedong; Cosgarea, Andrew; Carrino, John; Riley, Lee; Sponseller, Paul; Wan, Mei; Lu, William Weijia; Cao, Xu

    2013-01-01

    Osteoarthritis is a highly prevalent and debilitating joint disorder. There is no effective medical therapy for osteoarthritis due to limited understanding of osteoarthritis pathogenesis. We show that TGF–β1 is activated in the subchondral bone in response to altered mechanical loading in an anterior cruciate ligament transection (ACLT) osteoarthritis mouse model. TGF–β1 concentrations also increased in human osteoarthritis subchondral bone. High concentrations of TGF–β1 induced formation of nestin+ mesenchymal stem cell (MSC) clusters leading to aberrant bone formation accompanied by increased angiogenesis. Transgenic expression of active TGF–β1 in osteoblastic cells induced osteoarthritis. Inhibition of TGF–β activity in subchondral bone attenuated degeneration of osteoarthritis articular cartilage. Notably, knockout of the TGF–β type II receptor (TβRII) in nestin+ MSCs reduced development of osteoarthritis in ACLT mice. Thus, high concentrations of active TGF–β1 in the subchondral bone initiated the pathological changes of osteoarthritis, inhibition of which could be a potential therapeutic approach. PMID:23685840

  10. Investigation of the influence of reflection on the attenuation of cancellous bone.

    PubMed

    Klinge, Sandra; Hackl, Klaus; Gilbert, Robert P

    2013-01-01

    The model proposed in this paper is based on the fact that the reflection might have a significant contribution to the attenuation of the acoustic waves propagating through the cancellous bone. The numerical implementation of the mentioned effect is realized by the development of a new representative volume element that includes an infinitesimally thin 'transient' layer on the contact surface of the bone and the marrow. This layer serves to model the amplitude transformation of the incident wave by the transition through media with different acoustic impedances and to take into account the energy loss due to the reflection. The proposed representative volume element together with the multiscale finite element is used to simulate the wave propagation and to evaluate the attenuation coefficient for samples with different effective densities in the dependence of the applied excitation frequency. The obtained numerical values show a very good agreement with the experimental results. Moreover, the model enables the determination of the upper and the lower bound for the attenuation coefficient.

  11. Oncolytic virotherapy for human bone and soft tissue sarcomas using live attenuated poliovirus.

    PubMed

    Atsumi, Satoru; Matsumine, Akihiko; Toyoda, Hidemi; Niimi, Rui; Iino, Takahiro; Nakamura, Tomoki; Matsubara, Takao; Asanuma, Kunihiro; Komada, Yoshihiro; Uchida, Atsumasa; Sudo, Akihiro

    2012-09-01

    The poliovirus receptor CD155, is essential for poliovirus to infect and induce death in neural cells. Recently, CD155 has been shown to be selectively expressed on certain types of tumor cells originating from the neural crest, including malignant glioma and neuroblastoma. However, the expression pattern of CD155 in soft tissue sarcoma has not been examined. Therefore, we first examined CD155 expression in sarcoma cell lines, and found the expression of both CD155 mRNA and protein in 12 soft and bone tissue sarcoma cell lines. Furthermore, we examined the effect of live attenuated poliovirus (LAPV) on 6 bone and soft tissue sarcoma cell lines in vitro, and found that LAPV induced apoptosis by activating caspases 7 and 3 in all of these cell lines. Furthermore, in BALB/c nu/nu mice xenotransplanted with HT1080 fibrosarcoma cells, administration of live attenuated poliovirus caused growth suppression of the tumors. These results suggest that oncolytic therapy using a LAPV may represent a new option for the treatment of bone and soft tissue sarcomas.

  12. Attenuated Human Bone Morphogenetic Protein-2–Mediated Bone Regeneration in a Rat Model of Composite Bone and Muscle Injury

    PubMed Central

    Li, Mon-Tzu A.; Uhrig, Brent A.; Boerckel, Joel David; Huebsch, Nathaniel; Lundgren, Taran L.; Warren, Gordon L.; Guldberg, Robert E.

    2013-01-01

    Extremity injuries involving large bone defects with concomitant severe muscle damage are a significant clinical challenge often requiring multiple treatment procedures and possible amputation. Even if limb salvage is achieved, patients are typically left with severe short- and long-term disabilities. Current preclinical animal models do not adequately mimic the severity, complexity, and loss of limb function characteristic of these composite injuries. The objectives of this study were to establish a composite injury model that combines a critically sized segmental bone defect with an adjacent volumetric muscle loss injury, and then use this model to quantitatively assess human bone morphogenetic protein-2 (rhBMP-2)–mediated tissue regeneration and restoration of limb function. Surgeries were performed on rats in three experimental groups: muscle injury (8-mm-diameter full-thickness defect in the quadriceps), bone injury (8-mm nonhealing defect in the femur), or composite injury combining the bone and muscle defects. Bone defects were treated with 2 μg of rhBMP-2 delivered in the pregelled alginate injected into a cylindrical perforated nanofiber mesh. Bone regeneration was quantitatively assessed using microcomputed tomography, and limb function was assessed using gait analysis and muscle strength measurements. At 12 weeks postsurgery, treated bone defects without volumetric muscle loss were consistently bridged. In contrast, the volume and mechanical strength of regenerated bone were attenuated by 45% and 58%, respectively, in the identically treated composite injury group. At the same time point, normalized muscle strength was reduced by 51% in the composite injury group compared to either single injury group. At 2 weeks, the gait function was impaired in all injury groups compared to baseline with the composite injury group displaying the greatest functional deficit. We conclude that sustained delivery of rhBMP-2 at a dose sufficient to induce bridging of

  13. Human bone marrow mesenchymal stem cell transplantation attenuates axonal injury in stroke rats

    PubMed Central

    Xu, Yi; Du, Shiwei; Yu, Xinguang; Han, Xiao; Hou, Jincai; Guo, Hao

    2014-01-01

    Previous studies have shown that transplantation of human bone marrow mesenchymal stem cells promotes neural functional recovery after stroke, but the neurorestorative mechanisms remain largely unknown. We hypothesized that functional recovery of myelinated axons may be one of underlying mechanisms. In this study, an ischemia/reperfusion rat model was established using the middle cerebral artery occlusion method. Rats were used to test the hypothesis that intravenous transplantation of human bone marrow mesenchymal stem cells through the femoral vein could exert neuroprotective effects against cerebral ischemia via a mechanism associated with the ability to attenuate axonal injury. The results of behavioral tests, infarction volume analysis and immunohistochemistry showed that cerebral ischemia caused severe damage to the myelin sheath and axons. After rats were intravenously transplanted with human bone marrow mesenchymal stem cells, the levels of axon and myelin sheath-related proteins, including microtubule-associated protein 2, myelin basic protein, and growth-associated protein 43, were elevated, infarct volume was decreased and neural function was improved in cerebral ischemic rats. These findings suggest that intravenously transplanted human bone marrow mesenchymal stem cells promote neural function. Possible mechanisms underlying these beneficial effects include resistance to demyelination after cerebral ischemia, prevention of axonal degeneration, and promotion of axonal regeneration. PMID:25657721

  14. Administration of bone marrow stromal cells in sepsis attenuates sepsis-related coagulopathy.

    PubMed

    Tan, Lifei; Huang, Yueyue; Pan, Xiaojun; Quan, Shichao; Xu, Shunyao; Li, Dequan; Song, Lijun; Zhang, Xiaomin; Chen, Wanzhou; Pan, Jingye

    2016-01-01

    Coagulopathy plays an important role in sepsis. The aim of this study was to determine whether bone marrow stromal cell (BMSC) administration could attenuate coagulopathy in sepsis. In vitro: endothelial cells were cultured with/without BMSCs for 6 h following LPS stimulation and were collected for thrombomodulin (TM) and endothelial protein C receptor (EPCR) measurements. In vivo: Thirty-six mice were randomized into sham, sepsis, and sepsis + BMSC groups (n = 12 each group). Sepsis was induced through cecal ligation and puncture (CLP). BMSC infusion was started at 6 h after CLP. Lung tissues and plasma samples were collected at 24 h after CLP for enzyme-linked immunosorbent assay (ELISA), quantitative real-time RT-PCR, western blot, and immunohistochemistry analysis. In vitro: BMSCs attenuated the decrease in TM and EPCR mRNA and protein expression levels in LPS-stimulated endothelial cells. In vivo: BMSC treatment decreased lung injury and mesenteric perfusion impairment, and ameliorated coagulopathy, as suggested by the reduction in elevated TF, vWF, and TAT circulation levels. BMSC infusion decreased TF mRNA transcription and protein expression levels in lung tissues, and increased TM and EPCR mRNA transcription and expression levels. BMSC administration attenuated coagulopathy, and decreased lung injury and mesenteric perfusion impairment in sepsis. Key messages BMSCs increased the expression of TM and EPCR from endothelium cells exposed to LPS in vitro. BMSC treatment attenuated lung injury and coagulopathy in the mice cecal ligation and puncture (CLP) model. BMSC administration-attenuated coagulopathy is related to the reduced expression of TF and increased expression of TM and EPCR.

  15. Bone sonometry: Reducing phase aberration to improve estimates of broadband ultrasonic attenuation

    PubMed Central

    Bauer, Adam Q.; Anderson, Christian C.; Holland, Mark R.; Miller, James G.

    2009-01-01

    Previous studies suggest that phase cancellation at the receiving transducer can result in the overestimation of the frequency dependent ultrasonic attenuation of bone, a quantity that has been shown to correlate with bone mineral density and ultimately with osteoporotic fracture risk. Evidence supporting this interpretation is provided by phase insensitive processing of the data, which appear to reduce the apparent overestimates of attenuation. The present study was designed to clarify the components underlying phase aberration artifacts in such through-transmission measurements by conducting systematic studies of the simplest possible test objects capable of introducing phase aberration. Experimental results are presented for a Lexan phantom over the frequency range 300–700 kHz and a Plexiglas phantom over the 3–7 MHz range. Both phantoms were flat and parallel plates featuring a step discontinuity milled into one of their initially flat sides. The through-transmitted signals were received by a 0.6 mm diameter membrane hydrophone that was raster scanned over a grid coaxial with the transmitting transducer. Signals received by the pseudoarray were processed offline to emulate phase sensitive and phase insensitive receivers with different aperture diameters. The data processed phase sensitively were focused to demonstrate the results of planar, geometrical, and correlation-based aberration correction methods. Results are presented illustrating the relative roles of interference in the ultrasonic field and phase cancellation at the receiving transducer in producing phase aberration artifacts. It was found that artifacts due to phase cancellation or interference can only be minimized with phase insensitive summation techniques by choosing an appropriately large receiving aperture. Data also suggest the potentially confounding role of time-and frequency-domain artifacts on ultrasonic measurements and illustrate the advantages of two-dimensional receiving arrays in

  16. Attenuation of postmenopausal bone loss in patients with transient hypoparathyroidism after total thyroidectomy.

    PubMed

    Takamura, Yuuki; Miyauchi, Akira; Yabuta, Tomonori; Kihara, Minoru; Ito, Yasuhiro; Miya, Akihiro

    2013-12-01

    Increased bone mineral density (BMD) has been reported in patients with postsurgical permanent hypoparathyroidism. Hypoparathyroidism may attenuate the high-turnover bone loss in postmenopausal women. We reported previously that patients who had transient hypoparathyroidism postoperatively were at subclinical hypoparathyroid (hP) status even 5 years after surgery. We hypothesized that patients with transient hypoparathyroidism (ThP) may have altered BMD. A total of 140 women who underwent total thyroidectomy had BMD measurements of the lumbar spine, femoral neck, and radius 3 years after surgery. At surgery, 99 patients were ≥50 years and 41 were <50 years. They were divided into three groups according to their postoperative parathyroid function: There were 80 patients in the no hP (NhP) group, 54 in the ThP group, and 6 in the permanent hP (PhP) group. Among the 99 patients aged ≥50 years, 36 ThP patients had median Z scores of the BMD in all three areas (lumbar spine, femoral neck, radius) that were significantly higher (by 1.083, 0.533, and 1.047, respectively) than those in the 60 NhP patients aged ≥50 years. The BMDs in the three PhP patients ≥50 years were higher than those in the NhP and ThP patients, but the difference did not reach significance except for in the femoral neck. Multivariate logistic regression analyses showed that Z scores > 0 were significantly associated only with the presence of ThP postoperatively. In the patients <50 years, the BMD values were not significantly different among the three groups except at the radius in PhP patients, which was significantly lower than those of the other patients. We found that ThP was associated with increased BMD in postmenopausal women. This may be due to attenuation of the high-turnover bone loss in postmenopausal women.

  17. Treatment with recombinant lubricin attenuates osteoarthritis by positive feedback loop between articular cartilage and subchondral bone in ovariectomized rats.

    PubMed

    Cui, Zhuang; Xu, Changpeng; Li, Xue; Song, Jinqi; Yu, Bin

    2015-05-01

    Osteoarthritis (OA) is a most commonly multifactorial degenerative joint disease along with the aging population, particularly in postmenopausal women. During the onset of OA, articular cartilage and subchondral bone act in concert as a functional unit. This present study is to investigate the effects of early or late treatment with recombinant lubricin on the onset of osteoarthritis (OA) in ovariectomized (OVX) rats. We found that both early and late recombinant lubricin treatments attenuated the onset of OA by positive feedback loop between articular cartilage and subchondral bone, although late treatment contributed to a lesser effect compared with early treatment. Specifically, treatment with recombinant lubricin protected articular cartilage from degeneration, demonstrated by lower proteoglycan loss, lower OARSI scores, less calcification cartilage zone and reduced immunostaining for collagen X (Col X) and matrix metalloproteinase (MMP-13) but increased the expression of lubricin, in comparison with vehicle-treated OVX rat group. Further, chondroprotective effects of lubricin normalized bone remodeling in subchondral bone underneath. It's suggested that treatment with recombinant lubricin inhibited the elevation of TRAP and Osterix positive cells in OVX rats and led to the normalization of subchondral bone microarchitectures with the suppression of subsidence of bone volume ratio (BV/TV) and trabecular thickness (Tb.Th) and the increase of trabecular separation (Tb.Sp) in vehicle-treated OVX rats. What's more, the normalization of subchondral bone in turn attenuated the articular cartilage erosion by inhibiting vascular invasion from subchondral bone to calcified cartilage zone, exemplified by inhibiting the elevation of CD31 positive cells in calcified cartilage and angiography in subchondral bone. Together, these results shed light that both early and late recombinant lubricin treatments attenuate the onset of OA by balancing the interplay between articular

  18. CT-measured bone attenuation in patients with chronic obstructive pulmonary disease: relation to clinical features and outcomes.

    PubMed

    Romme, Elisabeth A P M; Murchison, John T; Edwards, Lisa D; van Beek, Edwin; Murchison, David M; Rutten, Erica P A; Smeenk, Frank W J M; Williams, Michelle C; Wouters, Emiel F M; MacNee, William

    2013-06-01

    Osteoporosis is highly prevalent in chronic obstructive pulmonary disease (COPD) patients and has been related to several clinical features. However, most studies have been in relatively small COPD cohorts. Therefore, the objectives of this study were to compare bone attenuation measured on low-dose chest computed tomography (CT) between COPD subjects and smoker and nonsmoker controls, and to relate bone attenuation to clinical parameters, inflammatory biomarkers, and outcomes in a large, well-characterized COPD cohort. We studied 1634 COPD subjects, 259 smoker controls, and 186 nonsmoker controls who participated in a large longitudinal study (ECLIPSE). We measured bone attenuation, extent of emphysema, and coronary artery calcification (Agatston score) on baseline CT scans, and clinical parameters, inflammatory biomarkers, and outcomes. Bone attenuation was lower in COPD subjects compared with smoker and nonsmoker controls (164.9 ± 49.5 Hounsfield units [HU] versus 183.8 ± 46.1 HU versus 212.1 ± 54.4 HU, p < 0.001). Bone attenuation was not significantly different between COPD subjects and smoker controls after adjustment for age, sex, and pack-years of smoking. In the COPD subjects, bone attenuation correlated positively with forced expiratory volume in 1 second (FEV₁, r = 0.062, p = 0.014), FEV₁/forced vital capacity (FVC) ratio (r = 0.102, p < 0.001), body mass index (r = 0.243, p < 0.001), fat-free mass index (FFMI, r = 0.265, p < 0.001), and C-reactive protein (r = 0.104, p < 0.001), and correlated negatively with extent of emphysema (r = -0.090, p < 0.001), Agatston score (r = -0.177, p < 0.001), and interleukin-8 (r = -0.054, p = 0.035). In a multiple regression model, older age, lower FFMI and higher Agatston score were associated with lower bone attenuation. Lower bone attenuation was associated with higher exacerbation (r = -0.057, p = 0.022) and

  19. CCR2 elimination in mice results in larger and stronger tibial bones but bone loss is not attenuated following ovariectomy or muscle denervation.

    PubMed

    Mader, Tara L; Novotny, Susan A; Lin, Angela S; Guldberg, Robert E; Lowe, Dawn A; Warren, Gordon L

    2014-11-01

    Bone loss due to age and disuse contributes to osteoporosis and increases fracture risk. It has been hypothesized that such bone loss can be attenuated by modulation of the C-C chemokine receptor 2 (CCR2) and/or its ligands. The objectives of this study were to examine the effects of genetic elimination of CCR2 on cortical and trabecular bones in the mouse tibia and how bone loss was impacted following disuse and estrogen loss. Female CCR2 knockout (CCR2(-/-)) and wildtype mice underwent ovariectomy (OVX) or denervation of musculature adjacent to the tibia (DEN) to induce bone loss. Cortical and trabecular structural properties as well as mechanical properties (i.e., strength) of tibial bones were measured. Compared to wildtype mice, CCR2(-/-) mice had tibiae that were up to 9% larger and stronger; these differences could be explained mainly by the 17% greater body mass (P < 0.001) of CCR2(-/-) mice. The majority of the tibia's structural and functional responses to OVX and DEN were similar regardless of the lack or presence of CCR2, indicating that CCR2 is not protective against bone loss per se. These findings indicate that while CCR2(-/-) mice do have larger and stronger bones than do wildtype mice, there is minimal evidence that CCR2 elimination provides protection against bone loss during disuse and estrogen loss.

  20. Monocyte chemotactic protein-1 deficiency attenuates and high-fat diet exacerbates bone loss in mice with Lewis lung carcinoma.

    PubMed

    Yan, Lin; Nielsen, Forrest H; Sundaram, Sneha; Cao, Jay

    2017-04-04

    Bone loss occurs in obesity and cancer-associated complications including wasting. This study determined whether a high-fat diet and a deficiency in monocyte chemotactic protein-1 (MCP-1) altered bone structural defects in male C57BL/6 mice with Lewis lung carcinoma (LLC) metastases in lungs. Compared to non-tumor-bearing mice, LLC reduced bone volume fraction, connectivity density, trabecular number, trabecular thickness and bone mineral density and increased trabecular separation in femurs. Similar changes occurred in vertebrae. The high-fat diet compared to the AIN93G diet exacerbated LLC-induced detrimental structural changes; the exacerbation was greater in femurs than in vertebrae. Mice deficient in MCP-1 compared to wild-type mice exhibited increases in bone volume fraction, connectivity density, trabecular number and decreases in trabecular separation in both femurs and vertebrae, and increases in trabecular thickness and bone mineral density and a decrease in structure model index in vertebrae. Lewis lung carcinoma significantly decreased osteocalcin but increased tartrate-resistant acid phosphatase 5b (TRAP 5b) in plasma. In LLC-bearing mice, the high-fat diet increased and MCP-1 deficiency decreased plasma TRAP 5b; neither the high-fat diet nor MCP-1 deficiency resulted in significant changes in plasma concentration of osteocalcin. In conclusion, pulmonary metastasis of LLC is accompanied by detrimental bone structural changes; MCP-1 deficiency attenuates and high-fat diet exacerbates the metastasis-associated bone wasting.

  1. Bone marrow-derived mesenchymal stem cell attenuates skin fibrosis development in mice.

    PubMed

    Wu, Yan; Huang, Sha; Enhe, Jirigala; Ma, Kui; Yang, Siming; Sun, Tongzhu; Fu, Xiaobing

    2014-12-01

    Recent studies showed that mesenchymal stem cell (MSC) transplantation significantly alleviated tissue fibrosis; however, little is known about the efficacy on attenuating cutaneous scar formation. In this study, we established a dermal fibrosis model induced by bleomycin and evaluated the benefit of bone marrow-derived mesenchymal stem cells (BM-MSCs) on skin fibrosis development. Tracing assay of green fluorescent protein (GFP(+) )BM-MSCs showed that the cells disappeared gradually within 24 hours upon administration, which hinted the action of BM-MSCs in vivo was exerted in the initial phase of repair in this model. Therefore, we repeatedly transplanted syngeneic BM-MSCs in the process of skin fibrosis formation. After 3 weeks, it was found that BM-MSC-treated lesional skin demonstrated a unanimous basket-weave organisation of collagen arrangement similar to normal skin, with few inflammatory cells. In addition, lesional skin with BM-MSC treatment exhibited a significant down-regulation of transforming growth factor-β1 (TGF-β1), type I collagen and heat-shock protein 47 (HSP47), with higher expression of matrix metalloproteinases (MMPs)-2, -9 and -13. Further experiments showed that α-smooth muscle actin (α-SMA) positive cells, the most reliable marker of myofibroblasts, apparently decreased after BM-MSC transplantation, which revealed that BM-MSCs could attenuate myofibroblast proliferation and differentiation as well as matrix production. Taken together, these findings suggested that BM-MSCs can inhibit the formation process of bleomycin-induced skin fibrosis, alleviate inflammation and favour the remodelling of extracellular matrix. © 2013 The Authors. International Wound Journal © 2013 Medicalhelplines.com Inc and John Wiley & Sons Ltd.

  2. Intrathecal injection of bone marrow stromal cells attenuates neurologic injury after spinal cord ischemia.

    PubMed

    Shi, Enyi; Kazui, Teruhisa; Jiang, Xiaojing; Washiyama, Naoki; Yamashita, Katsushi; Terada, Hitoshi; Bashar, Abul Hasan Muhammad

    2006-06-01

    It has been shown that transplantation of bone marrow stromal cells (MSCs) into the ischemic brain improves functional outcome. We sought to investigate whether intrathecal injection of MSCs can attenuate neurologic injury of spinal cord ischemia. Rabbit MSCs were expanded in vitro and were pre-labeled with bromodeoxyuridine. Spinal cord ischemia was induced in rabbits by infrarenal aortic occlusion. Group A and control A were subjected to a 20-minute ischemia and the ischemic duration was extended to 30 minutes in group B and control B. Two days before spinal cord ischemia, 1 x 10(8) MSCs were intrathecally injected into groups A and B, whereas vehicle alone was injected into the control groups. Hind-limb motor function was assessed during a 14-day recovery period with Tarlov criteria, and then histologic examination was performed. Marrow stromal cells survived and engrafted into the spinal cord 2 days after transplantation, and more MSCs were found in the lumbar spinal cord (ischemic segment) than in the thoracic spinal cord (nonischemic segment) at 14 days. Compared with their respective control groups, Tarlov scores were significantly higher in both groups A and B (p < 0.05, group A vs control A, at 2, 7, and 14 days; p < 0.05, group B vs control B, at 1, 2, 7, and 14 days, respectively). The number of intact motor neurons was much higher in the two experimental groups (p < 0.01 vs the corresponding control groups, respectively). Intrathecal injection of MSCs attenuates ischemic injury of spinal cord.

  3. Bone Marrow Mesenchymal Stem Cells Attenuate Mitochondria Damage Induced by Hypoxia in Mouse Trophoblasts

    PubMed Central

    Wang, Lingjuan; Xu, Xiaoyan; Kang, Lina

    2016-01-01

    Objective We aimed to observe the change of mitochondrial function and structure as well as the cell function induced by hypoxia in mouse trophoblasts, and moreover, to validate the restoration of these changes after co-culture with bone marrow mesenchymal stem cells (hereinafter referred to as “MSCs”). Further, we explored the mechanism of MSCs attenuating the functional damage of trophoblasts caused by hypoxia. Methods Cells were divided into two groups, trophoblasts and MSCs+trophoblasts respectively, and the two groups of cells were incubated with normoxia or hypoxia. Chemiluminescence was used to assay the β-HCG and progesterone in cell culture supernatants quantitatively. Western blotting and PCR were applied to detect the expression of Mfn2, MMP-2, MMP-9 and integrin β1 in the two groups. The mitochondrial membrane potential of each group of cells was detected with JC-1 dye and the ATP content was measured by the phosphomolybdic acid colorimetric method. We utilized transmission electron microscopy for observing the ultrastructure of mitochondria in trophoblasts. Finally, we assessed the cell apoptosis with flow cytometry (FCM) and analyzed the expression of the apoptosis related genes—Bcl-2, Bax, Caspase3 and Caspase9 by western blotting. Results The results showed that the Mfn2 expression was reduced after 4 h in hypoxia compared with that in normoxia, but increased in the co-culture group when compared with that in the separated-culture group (p<0.05). In addition, compared with the separated-culture group, theβ-HCG and progesterone levels in the co-culture group were significantly enhanced (p<0.05), and so were the expressions of MMP-2, MMP-9 and integrin β1 (p<0.05). Moreover, it exhibited significantly higher in ATP levels and intensified about the mitochondrial membrane potential in the co-culture group. TEM revealed disorders of the mitochondrial cristae and presented short rod-like structure and spheroids in hypoxia, however, in the co

  4. Subject-specific bone attenuation correction for brain PET/MR: can ZTE-MRI substitute CT scan accurately?

    PubMed

    Khalifé, Maya; Fernandez, Brice; Jaubert, Olivier; Soussan, Michael; Brulon, Vincent; Buvat, Irene; Comtat, Claude

    2017-08-24

    In brain PET/MR applications, accurate attenuation maps are required for accurate PET image quantification. An implemented attenuation correction (AC) method for brain imaging is the single-atlas approach which estimates an AC map from an averaged CT template. As an alternative, we propose to use a Zero Echo Time (ZTE) pulse sequence to segment bone, air and soft tissue. A linear relationship between histogram normalized ZTE intensity and measured CT density in Hounsfield Units (HU) in bone has been established thanks to a CT-MR database of 16 patients. Continuous AC maps were computed based on the segmented ZTE by setting a fixed linear attenuation coefficient (LAC) for air and soft tissue and by using the linear relationship to generate a continuous LAC map for the bone. Additionally, for comparison purpose, four other AC maps were generated: a ZTE derived AC map with a fixed LAC for the bone, an AC map based on the single-atlas approach as provided by the PET/MR manufacturer, a soft-tissue only AC map where the bone is ignored and, finally, the CT derived attenuation map used as the gold standard (CTAC). All these AC maps were used with different levels of smoothing for PET image reconstruction with and without time-of-flight (TOF). The subject-specific AC map gen- erated by combining ZTE-based segmentation and linear scaling of the normalized ZTE signal into HU was found to be a good substitute for the measured CTAC map in brain PET/MR when used with a Gaussian smoothing kernel of 4 mm corresponding to the PET scanner intrinsic resolution. As expected TOF reduces AC error regardless of the AC method. The continuous ZTE-AC performed better than the other alternative MR derived AC methods, reducing the quantification error between the MRAC corrected PET image and the reference CTAC corrected PET image. © 2017 Institute of Physics and Engineering in Medicine.

  5. Measurement of the normalized broadband ultrasound attenuation in trabecular bone by using a bidirectional transverse transmission technique

    NASA Astrophysics Data System (ADS)

    Lee, Kang Il

    2015-01-01

    A new method for measuring the normalized broadband ultrasound attenuation (nBUA) in trabecular bone by using a bidirectional transverse transmission technique was proposed and validated with measurements obtained by using the conventional transverse transmission technique. There was no significant difference between the nBUA measurements obtained for 14 bovine femoral trabecular bone samples by using the bidirectional and the conventional transverse transmission techniques. The nBUA measured by using the two transverse transmission techniques showed strong positive correlations of r = 0.87 to 0.88 with the apparent bone density, consistent with the behavior in human trabecular bone invitro. We expect that the new method can be usefully applied for improved accuracy and precision in clinical measurements.

  6. Synergistic combinations of the dual enkephalinase inhibitor PL265 given orally with various analgesic compounds acting on different targets, in a murine model of cancer-induced bone pain.

    PubMed

    González-Rodríguez, Sara; Poras, Hervé; Menéndez, Luis; Lastra, Ana; Ouimet, Tanja; Fournié-Zaluski, Marie-Claude; Roques, Bernard P; Baamonde, Ana

    2017-01-01

    The first line pharmacological treatment of cancer pain is morphine and surrogates but a significant pain relief and a reduction of the side-effects of these compounds makes it necessary to combine them with other drugs acting on different targets. The aim of this study was to measure the antinociceptive effect on cancer-induced bone pain resulting from the association of the endogenous opioids enkephalin and non-opioid analgesic drugs. For this purpose, PL265 a new orally active single dual inhibitor of the two degrading enkephalins enzymes, neprilysin (NEP) and aminopeptidase N (APN) was used. It strictly increased the levels of enkephalin at their sites of releases. The selected non-opioid compounds are: gabapentin, A-317491 (P2X3 receptor antagonist), ACEA (CB1 receptor antagonist), AM1241 (CB2 receptor antagonist), JWH-133 (CB2 receptor antagonist), URB937 (FAAH inhibitor), and NAV26 (Nav1.7 channel blocker). Experiments. Experiments were performed in 5-6 weeks old (26-33g weight) C57BL/6 mice. Cell culture and cell inoculation. B16-F10 melanoma cells were cultured and when preconfluent, treated and detached. Finally related cells were resuspended to obtain a concentration of 2×10(6) cells/100μL. Then 10(5) cells were injected into the right tibial medullar cavity. Control mice were treated by killed cells by freezing. Behavioural studies. Thermal withdrawal latencies were measured on a unilatered hot plate (UHP) maintained at 49±0.2°C. Mechanical threshold values were obtained by performing the von Frey test using the "up and down" method. To evaluate the nature (additive or synergistic) of the interactions between PL265 and different drugs, an isobolographic analysis following the method described by Tallarida was performed. The results demonstrate the ability of PL265, a DENKI that prevents the degradation of endogenous ENKs, to counteract cancer-induced bone thermal hyperalgesia in mice, by exclusively stimulating peripheral opioid receptors as

  7. Fractal dimension of bone texture in radiographs correlates to ultrasound broadband attenuation T-score.

    PubMed

    Bianciardi, Giorgio; Bisogno, Stefania; Bertoldi, Ilaria; Laurini, Lorella; Coviello, Giuseppe; Frediani, Bruno

    2013-01-01

    We aimed to measure the fractal dimension on x-ray images and ultrasonographic parameters of the os calcis of bone from 4 districts in osteoporotic patients and in control subjects, in order to test the hypothesis that ultrasonographic parameters correlate to the fractal dimension obtained on x-ray images. Fractal analysis on radiological images from 4 bone districts (proximal femur, calcaneus, metacarpus and 3rd phalanx) was performed in a study comparing ultrasonographic evaluation of the os calcis in severe osteoporotic patients and in control cases. We studied 86 x-ray-views from patients with severe reduction of ultrasound Stiffness Index and in healthy women. Ultrasound measurements of left os calcis were performed using the Lunar Achilles-Plus instrument. Fractal analysis was performed using the box-counting method. In healthy subjects, fractal dimension, D, measure of structural complexity, resulted close to the topological dimension (no fractal structure), TD, in femur (1.99±0.03)and phalanx (1.96±0.03), D differed significantly from TD in calcaneus (D=1.90±0.02; p<0.001) and metacarpus (D=1.89±0.03, p<0.001). In osteoporotic subjects, in calcaneus and metacarpus, D was higher (1.94±0.03, 1.93±0.03, respectively) than in healthy subjects (1.90±0.02, 1.89±0.02, respectively, p<0.01). In all the subjects, fractal dimension and ultrasound broadband attenuation T-score correlated significantly in calcaneus and metacarpus (p<0.03 and p<0.02, respectively). Parameters based on a combination of ultrasonic examination and fractal analysis on radiographic images may add useful structural information regarding the patients' skeleton using non invasive procedures.

  8. Inhibition of SDF-1α/CXCR4 Signalling in Subchondral Bone Attenuates Post-Traumatic Osteoarthritis.

    PubMed

    Dong, Yonghui; Liu, Hui; Zhang, Xuejun; Xu, Fei; Qin, Liang; Cheng, Peng; Huang, Hui; Guo, Fengjing; Yang, Qing; Chen, Anmin

    2016-06-16

    Previous studies showed that SDF-1α is a catabolic factor that can infiltrate cartilage, decrease proteoglycan content, and increase MMP-13 activity. Inhibiting the SDF-1α/CXCR4 signalling pathway can attenuate the pathogenesis of osteoarthritis (OA). Recent studies have also shown that SDF-1α enhances chondrocyte proliferation and maturation. These results appear to be contradictory. In the current study, we used a destabilisation OA animal model to investigate the effects of SDF-1α/CXCR4 signalling in the tibial subchondral bone and the OA pathological process. Post-traumatic osteoarthritis (PTOA) mice models were prepared by transecting the anterior cruciate ligament (ACLT), or a sham surgery was performed, in a total of 30 mice. Mice were treated with phosphate buffer saline (PBS) or AMD3100 (an inhibitor of CXCR4) and sacrificed at 30 days post ACLT or sham surgery. Tibial subchondral bone status was quantified by micro-computed tomography (μCT). Knee-joint histology was analysed to examine the articular cartilage and joint degeneration. The levels of SDF-1α and collagen type I c-telopeptidefragments (CTX-I) were quantified by ELISA. Bone marrow mononuclear cells (BMMCs) were used to clarify the effects of SDF-1α on osteoclast formation and activity in vivo. μCT analysis revealed significant loss of trabecular bone from tibial subchondral bone post-ACLT, which was effectively prevented by AMD3100. AMD3100 could partially prevent bone loss and articular cartilage degeneration. Serum biomarkers revealed an increase in SDF-1α and bone resorption, which were also reduced by AMD3100. SDF-1α can promote osteoclast formation and the expression oftartrate resistant acid phosphatase (TRAP), cathepsin K (CK), and matrix metalloproteinase (MMP)-9 in osteoclasts by activating the MAPK pathway, including ERK and p38, but not JNK. In conclusion, inhibition of SDF-1α/CXCR4signalling was able to prevent trabecular bone loss and attenuated cartilage degeneration in

  9. Propranolol, a β-adrenergic antagonist, attenuates the decrease in trabecular bone mass in high calorie diet fed growing mice

    PubMed Central

    Baek, Kyunghwa; Hwang, Hyo Rin; Park, Hyun-Jung; Kwon, Arang; Qadir, Abdul S.; Baek, Jeong-Hwa

    2014-01-01

    We investigated the effects of high calorie and low calorie diets on skeletal integrity, and whether β-adrenergic blockade (BB) attenuates bone loss induced by dietary calorie alteration. Male 6-week-old C57BL/6 mice were assigned to either an ad-lib fed control diet (CON), a high calorie diet (HIGH), or a low calorie diet (LOW) group. In each diet group, mice were treated with either vehicle (VEH) or propranolol, a β-adrenergic antagonist. Over 12-weeks, β-blockade mitigated body weight and fat mass increases induced by the high calorie diet. Femoral trabecular bone mineral density and the expression levels of osteogenic marker genes in bone marrow cells were reduced in HIGHVEH and LOWVEH mice, and BB significantly attenuated this decline only in HIGH mice. In summary, the magnitude of bone loss induced by low calorie diet was greater than that caused by high calorie diet in growing mice, and β-blockade mitigated high calorie diet-induced bone loss. [BMB Reports 2014; 47(9): 506-511] PMID:24393528

  10. Propranolol, a β-adrenergic antagonist, attenuates the decrease in trabecular bone mass in high calorie diet fed growing mice.

    PubMed

    Baek, Kyunghwa; Hwang, Hyo Rin; Park, Hyun-Jung; Kwon, Arang; Qadir, Abdul S; Baek, Jeong-Hwa

    2014-09-01

    We investigated the effects of high calorie and low calorie diets on skeletal integrity, and whether β-adrenergic blockade (BB) attenuates bone loss induced by dietary calorie alteration. Male 6-week-old C57BL/6 mice were assigned to either an ad-lib fed control diet (CON), a high calorie diet (HIGH), or a low calorie diet (LOW) group. In each diet group, mice were treated with either vehicle (VEH) or propranolol, a β-adrenergic antagonist. Over 12-weeks, β-blockade mitigated body weight and fat mass increases induced by the high calorie diet. Femoral trabecular bone mineral density and the expression levels of osteogenic marker genes in bone marrow cells were reduced in HIGHVEH and LOWVEH mice, and BB significantly attenuated this decline only in HIGH mice. In summary, the magnitude of bone loss induced by low calorie diet was greater than that caused by high calorie diet in growing mice, and β-blockade mitigated high calorie diet-induced bone loss.

  11. Intravenous Immunoglobulin (IVIG) Attenuates TNF-induced Pathologic Bone Resorption and Suppresses Osteoclastogenesis by Inducing A20 Expression

    PubMed Central

    Mun, Sehwan; Bae, Seyeon; Murata, Koichi; Ivashkiv, Lionel B.; Park-Min, Kyung-Hyun

    2016-01-01

    Investigations on the therapeutic effects of intravenous immunoglobulin (IVIG) have focused on the suppression of autoantibody- and immune complex-mediated inflammatory pathogenesis. Inflammatory diseases such as rheumatoid arthritis are often accompanied by excessive bone erosion but the effect of IVIG on osteoclasts, bone-resorbing cells, has not been studied. Here, we investigate whether IVIG directly regulates osteoclast differentiation and has therapeutic potential for suppressing osteoclast-mediated pathologic bone resorption. IVIG or cross-linking of Fcγ receptors with plate-bound IgG suppressed receptor activator of nuclear factor-kappa B ligand (RANKL)-induced osteoclastogenesis and expression of osteoclast-related genes such as integrin β3 and cathepsin K in a dose-dependent manner. Mechanistically, IVIG or plate-bound IgG suppressed osteoclastogenesis by downregulating RANKL-induced expression of NFATC1, the master regulator of osteoclastogenesis. IVIG suppressed NFATC1 expression by attenuating RANKL-induced NF-κB signaling, explained in part by induction of the inflammatory signaling inhibitor A20. IVIG administration attenuated in vivo osteoclastogenesis and suppressed bone resorption in the tumor necrosis factor (TNF)-induced calvarial osteolysis model. Our findings show that, in addition to suppressing inflammation, IVIG directly inhibits osteoclastogenesis through a mechanism involving suppression of RANK signaling. Direct suppression of osteoclast differentiation may provide beneficial effects on preserving bone mass when IVIG is used to treat rheumatic disorders. PMID:26189496

  12. Inhibition of bone morphogenetic protein signaling attenuates anemia associated with inflammation.

    PubMed

    Steinbicker, Andrea U; Sachidanandan, Chetana; Vonner, Ashley J; Yusuf, Rushdia Z; Deng, Donna Y; Lai, Carol S; Rauwerdink, Kristen M; Winn, Julia C; Saez, Borja; Cook, Colleen M; Szekely, Brian A; Roy, Cindy N; Seehra, Jasbir S; Cuny, Gregory D; Scadden, David T; Peterson, Randall T; Bloch, Kenneth D; Yu, Paul B

    2011-05-05

    Anemia of inflammation develops in settings of chronic inflammatory, infectious, or neoplastic disease. In this highly prevalent form of anemia, inflammatory cytokines, including IL-6, stimulate hepatic expression of hepcidin, which negatively regulates iron bioavailability by inactivating ferroportin. Hepcidin is transcriptionally regulated by IL-6 and bone morphogenetic protein (BMP) signaling. We hypothesized that inhibiting BMP signaling can reduce hepcidin expression and ameliorate hypoferremia and anemia associated with inflammation. In human hepatoma cells, IL-6-induced hepcidin expression, an effect that was inhibited by treatment with a BMP type I receptor inhibitor, LDN-193189, or BMP ligand antagonists noggin and ALK3-Fc. In zebrafish, the induction of hepcidin expression by transgenic expression of IL-6 was also reduced by LDN-193189. In mice, treatment with IL-6 or turpentine increased hepcidin expression and reduced serum iron, effects that were inhibited by LDN-193189 or ALK3-Fc. Chronic turpentine treatment led to microcytic anemia, which was prevented by concurrent administration of LDN-193189 or attenuated when LDN-193189 was administered after anemia was established. Our studies support the concept that BMP and IL-6 act together to regulate iron homeostasis and suggest that inhibition of BMP signaling may be an effective strategy for the treatment of anemia of inflammation.

  13. Subject-specific bone attenuation correction for brain PET/MR: can ZTE-MRI substitute CT scan accurately?

    NASA Astrophysics Data System (ADS)

    Khalifé, Maya; Fernandez, Brice; Jaubert, Olivier; Soussan, Michael; Brulon, Vincent; Buvat, Irène; Comtat, Claude

    2017-10-01

    In brain PET/MR applications, accurate attenuation maps are required for accurate PET image quantification. An implemented attenuation correction (AC) method for brain imaging is the single-atlas approach that estimates an AC map from an averaged CT template. As an alternative, we propose to use a zero echo time (ZTE) pulse sequence to segment bone, air and soft tissue. A linear relationship between histogram normalized ZTE intensity and measured CT density in Hounsfield units (HU ) in bone has been established thanks to a CT-MR database of 16 patients. Continuous AC maps were computed based on the segmented ZTE by setting a fixed linear attenuation coefficient (LAC) to air and soft tissue and by using the linear relationship to generate continuous μ values for the bone. Additionally, for the purpose of comparison, four other AC maps were generated: a ZTE derived AC map with a fixed LAC for the bone, an AC map based on the single-atlas approach as provided by the PET/MR manufacturer, a soft-tissue only AC map and, finally, the CT derived attenuation map used as the gold standard (CTAC). All these AC maps were used with different levels of smoothing for PET image reconstruction with and without time-of-flight (TOF). The subject-specific AC map generated by combining ZTE-based segmentation and linear scaling of the normalized ZTE signal into HU was found to be a good substitute for the measured CTAC map in brain PET/MR when used with a Gaussian smoothing kernel of 4~mm corresponding to the PET scanner intrinsic resolution. As expected TOF reduces AC error regardless of the AC method. The continuous ZTE-AC performed better than the other alternative MR derived AC methods, reducing the quantification error between the MRAC corrected PET image and the reference CTAC corrected PET image.

  14. A comparison between the patella and the calcaneus using ultrasound velocity and attenuation as predictors of bone mineral density

    NASA Astrophysics Data System (ADS)

    Han, S. M.; Davis, J.

    1997-10-01

    The bone mineral density (BMD), ultrasound velocity (UV) and attenuation were examined in sixteen matched sets of human patellae and calcanei. For the sixteen calcanei, BMD was strongly correlated with all ultrasound parameters. Calcaneal UV appeared to be inferior to attenuation in the ability to predict BMD. For the sixteen patellae, the average UV was found to be greater in the superior/inferior direction than in the anterior/posterior and medial/lateral directions. It was found that patella BMD was significantly correlated with each of three directional ultrasound velocities. The relationship between BMD and ultrasound attenuation parameters was not significant in the patella. A comparative study of the two different bone sets demonstrated that the BMDs of the patella and calcaneus were significantly correlated with each other. Ultrasound velocity of calcaneus, measured in the medial/lateral direction, was not significantly associated with any of three directional ultrasound velocities in the patella. Similarly, ultrasound attenuation parameters of calcaneus were not significantly correlated with those of patella. The present study also demonstrated evidence that when predicting BMDs at their respective sites using ultrasound, the calcaneus appeared to be superior to the patella.

  15. Orthopedic surgery and bone fracture pain are both significantly attenuated by sustained blockade of nerve growth factor

    PubMed Central

    Majuta, Lisa A.; Longo, Geraldine; Fealk, Michelle N.; McCaffrey, Gwen; Mantyh, Patrick W.

    2015-01-01

    The number of patients suffering from postoperative pain due to orthopedic surgery and bone fracture is projected to dramatically increase because the human life span, weight, and involvement in high-activity sports continue to rise worldwide. Joint replacement or bone fracture frequently results in skeletal pain that needs to be adequately controlled for the patient to fully participate in needed physical rehabilitation. Currently, the 2 major therapies used to control skeletal pain are nonsteroidal anti-inflammatory drugs and opiates, both of which have significant unwanted side effects. To assess the efficacy of novel therapies, mouse models of orthopedic and fracture pain were developed and evaluated here. These models, orthopedic surgery pain and bone fracture pain, resulted in skeletal pain–related behaviors that lasted 3 weeks and 8 to 10 weeks, respectively. These skeletal pain behaviors included spontaneous and palpation-induced nocifensive behaviors, dynamic weight bearing, limb use, and voluntary mechanical loading of the injured hind limb. Administration of anti–nerve growth factor before orthopedic surgery or after bone fracture attenuated skeletal pain behaviors by 40% to 70% depending on the end point being assessed. These data suggest that nerve growth factor is involved in driving pain due to orthopedic surgery or bone fracture. These animal models may be useful in developing an understanding of the mechanisms that drive postoperative orthopedic and bone fracture pain and the development of novel therapies to treat these skeletal pains. PMID:25599311

  16. Orthopedic surgery and bone fracture pain are both significantly attenuated by sustained blockade of nerve growth factor.

    PubMed

    Majuta, Lisa A; Longo, Geraldine; Fealk, Michelle N; McCaffrey, Gwen; Mantyh, Patrick W

    2015-01-01

    The number of patients suffering from postoperative pain due to orthopedic surgery and bone fracture is projected to dramatically increase because the human life span, weight, and involvement in high-activity sports continue to rise worldwide. Joint replacement or bone fracture frequently results in skeletal pain that needs to be adequately controlled for the patient to fully participate in needed physical rehabilitation. Currently, the 2 major therapies used to control skeletal pain are nonsteroidal anti-inflammatory drugs and opiates, both of which have significant unwanted side effects. To assess the efficacy of novel therapies, mouse models of orthopedic and fracture pain were developed and evaluated here. These models, orthopedic surgery pain and bone fracture pain, resulted in skeletal pain-related behaviors that lasted 3 weeks and 8 to 10 weeks, respectively. These skeletal pain behaviors included spontaneous and palpation-induced nocifensive behaviors, dynamic weight bearing, limb use, and voluntary mechanical loading of the injured hind limb. Administration of anti-nerve growth factor before orthopedic surgery or after bone fracture attenuated skeletal pain behaviors by 40% to 70% depending on the end point being assessed. These data suggest that nerve growth factor is involved in driving pain due to orthopedic surgery or bone fracture. These animal models may be useful in developing an understanding of the mechanisms that drive postoperative orthopedic and bone fracture pain and the development of novel therapies to treat these skeletal pains.

  17. Bone Marrow-Derived c-kit+ Cells Attenuate Neonatal Hyperoxia-Induced Lung Injury

    PubMed Central

    Ramachandran, Shalini; Suguihara, Cleide; Drummond, Shelley; Chatzistergos, Konstantinos; Klim, Jammie; Torres, Eneida; Huang, Jian; Hehre, Dorothy; Rodrigues, Claudia O.; McNiece, Ian K.; Hare, Joshua M.; Young, Karen C.

    2016-01-01

    Recent studies suggest that bone marrow (BM)-derived stem cells have therapeutic efficacy in neonatal hyperoxia-induced lung injury (HILI). c-kit, a tyrosine kinase receptor that regulates angiogenesis, is expressed on several populations of BM-derived cells. Preterm infants exposed to hyperoxia have decreased lung angiogenesis. Here we tested the hypothesis that administration of BM-derived c-kit+ cells would improve angiogenesis in neonatal rats with HILI. To determine whether intratracheal (IT) administration of BM-derived c-kit+ cells attenuates neonatal HILI, rat pups exposed to either normobaric normoxia (21% O2) or hyperoxia (90% O2) from postnatal day (P) 2 to P15 were randomly assigned to receive either IT BM-derived green fluorescent protein (GFP)+ c-kit− cells (PL) or BM-derived GFP+ c-kit+ cells on P8. The effect of cell therapy on lung angiogenesis, alveolarization, pulmonary hypertension, vascular remodeling, cell proliferation, and apoptosis was determined at P15. Cell engraftment was determined by GFP immunostaining. Compared to PL, the IT administration of BM-derived c-kit+ cells to neonatal rodents with HILI improved alveolarization as evidenced by increased lung septation and decreased mean linear intercept. This was accompanied by an increase in lung vascular density, a decrease in lung apoptosis, and an increase in the secretion of proangiogenic factors. There was no difference in pulmonary vascular remodeling or the degree of pulmonary hypertension. Confocal microscopy demonstrated that 1% of total lung cells were GFP+ cells. IT administration of BM-derived c-kit+ cells improves lung alveolarization and angiogenesis in neonatal HILI, and this may be secondary to an improvement in the lung angiogenic milieu. PMID:23759597

  18. Attenuated total reflection Fourier transform infrared (ATR-FTIR) spectroscopic analysis of regenerated bone

    NASA Astrophysics Data System (ADS)

    Benetti, Carolina; Kazarain, Sergei G.; Alves, Marco A. V.; Blay, Alberto; Correa, Luciana; Zezell, Denise M.

    2014-03-01

    The cutting of bone is routinely required in medical procedures, especially in dental applications. In such cases, bone regeneration and new bone quality can determine the success of the treatment. This study investigated the main spectral differences of undamaged and healed bone using the ATR-FTIR spectroscopy technique. Three rabbits were submitted to a surgical procedure; a small piece of bone (3x3 mm2) was removed from both sides of their jaws using a high speed drill. After 15 days, the rabbits were euthanized and the jaws were removed. A bone slice was cut from each side of the jaw containing regions of undamaged and newly formed bone, resulting in six samples which were polished for spectroscopic comparison. The samples were analyzed by FTIR spectroscopy using a diamond ATR accessory. Spectral characteristics were compared and particular attention was paid to the proportion of phosphate to amide I bands and the width of the phosphate band. The results show that the ratio of phosphate to amide I is smaller in new bone tissue than in the undamaged bone, indicating a higher organic content in the newly formed bone. The analysis of the width of the phosphate band suggests a crystallinity difference between both tissues, since the width was higher in the new bone than in the natural bone. These results suggest that the differences observed in bone aging processes by FTIR spectroscopic can be applied to the study of healing processes.

  19. Inhibition of SDF-1α/CXCR4 Signalling in Subchondral Bone Attenuates Post-Traumatic Osteoarthritis

    PubMed Central

    Dong, Yonghui; Liu, Hui; Zhang, Xuejun; Xu, Fei; Qin, Liang; Cheng, Peng; Huang, Hui; Guo, Fengjing; Yang, Qing; Chen, Anmin

    2016-01-01

    Previous studies showed that SDF-1α is a catabolic factor that can infiltrate cartilage, decrease proteoglycan content, and increase MMP-13 activity. Inhibiting the SDF-1α/CXCR4 signalling pathway can attenuate the pathogenesis of osteoarthritis (OA). Recent studies have also shown that SDF-1α enhances chondrocyte proliferation and maturation. These results appear to be contradictory. In the current study, we used a destabilisation OA animal model to investigate the effects of SDF-1α/CXCR4 signalling in the tibial subchondral bone and the OA pathological process. Post-traumatic osteoarthritis (PTOA) mice models were prepared by transecting the anterior cruciate ligament (ACLT), or a sham surgery was performed, in a total of 30 mice. Mice were treated with phosphate buffer saline (PBS) or AMD3100 (an inhibitor of CXCR4) and sacrificed at 30 days post ACLT or sham surgery. Tibial subchondral bone status was quantified by micro-computed tomography (μCT). Knee-joint histology was analysed to examine the articular cartilage and joint degeneration. The levels of SDF-1α and collagen type I c-telopeptidefragments (CTX-I) were quantified by ELISA. Bone marrow mononuclear cells (BMMCs) were used to clarify the effects of SDF-1α on osteoclast formation and activity in vivo. μCT analysis revealed significant loss of trabecular bone from tibial subchondral bone post-ACLT, which was effectively prevented by AMD3100. AMD3100 could partially prevent bone loss and articular cartilage degeneration. Serum biomarkers revealed an increase in SDF-1α and bone resorption, which were also reduced by AMD3100. SDF-1α can promote osteoclast formation and the expression oftartrate resistant acid phosphatase (TRAP), cathepsin K (CK), and matrix metalloproteinase (MMP)-9 in osteoclasts by activating the MAPK pathway, including ERK and p38, but not JNK. In conclusion, inhibition of SDF-1α/CXCR4signalling was able to prevent trabecular bone loss and attenuated cartilage degeneration in

  20. Propranolol Attenuates Risperidone-Induced Trabecular Bone Loss in Female Mice.

    PubMed

    Motyl, Katherine J; DeMambro, Victoria E; Barlow, Deborah; Olshan, David; Nagano, Kenichi; Baron, Roland; Rosen, Clifford J; Houseknecht, Karen L

    2015-07-01

    Atypical antipsychotic (AA) drugs cause significant metabolic side effects, and clinical data are emerging that demonstrate increased fracture risk and bone loss after treatment with the AA, risperidone (RIS). The pharmacology underlying the adverse effects on bone is unknown. However, RIS action in the central nervous system could be responsible because the sympathetic nervous system (SNS) is known to uncouple bone remodeling. RIS treatment in mice significantly lowered trabecular bone volume fraction (bone volume/total volume), owing to increased osteoclast-mediated erosion and reduced osteoblast-mediated bone formation. Daytime energy expenditure was also increased and was temporally associated with the plasma concentration of RIS. Even a single dose of RIS transiently elevated expression of brown adipose tissue markers of SNS activity and thermogenesis, Pgc1a and Ucp1. Rankl, an osteoclast recruitment factor regulated by the SNS, was also increased 1 hour after a single dose of RIS. Thus, we inferred that bone loss from RIS was regulated, at least in part, by the SNS. To test this, we administered RIS or vehicle to mice that were also receiving the nonselective β-blocker propranolol. Strikingly, RIS did not cause any changes in trabecular bone volume/total volume, erosion, or formation while propranolol was present. Furthermore, β2-adrenergic receptor null (Adrb2(-/-)) mice were also protected from RIS-induced bone loss. This is the first report to demonstrate SNS-mediated bone loss from any AA. Because AA medications are widely prescribed, especially to young adults, clinical studies are needed to assess whether β-blockers will prevent bone loss in this vulnerable population.

  1. Adverse effects of smoking on peak bone mass may be attenuated by higher body mass index in young female smokers.

    PubMed

    Callréus, Mattias; McGuigan, Fiona; Akesson, Kristina

    2013-12-01

    Smoking is associated with postmenopausal bone loss and fracture, but the effect of smoking on bone in younger women is unclear. Peak bone mass is an important determinant for fracture risk; therefore, our aim was to evaluate the association between smoking and bone mass in 25-year-old women, specifically the influence of daily cigarette consumption and total exposure, duration, age at starting smoking, and time since smoking cessation on bone density and fracture risk. Smoking and bone mineral density (BMD) data were available for 1,054 women from the PEAK-25 cohort. Analyses comparing current smokers with women who never smoked were performed using number of cigarettes per day, pack-years, smoking duration, age smoking started, and, for former smokers, age at quitting. BMD did not differ between never, former, and current smokers; and the relative fracture risk in smokers was not significant (relative risk [RR] = 1.2, 95 % confidence interval 0.8-1.9). Among current smokers, BMD decreased with a dose response as cigarette consumption increased (femoral neck p = 0.037). BMD was not significantly lower in young women who had smoked for long duration or started smoking early (p = 0.07-0.64); long duration and early start were associated with higher body mass index (BMI; p = 0.038). Lower BMD persisted up to 24 months after smoking cessation (p = 0.027-0.050), becoming comparable to never-smokers after 24 months. Hip BMD was negatively associated with smoking and dose-dependent on cigarette consumption. Smoking duration was not associated with BMD, although young women with a long smoking history had higher BMI, which might attenuate the adverse effects from smoking.

  2. Impaired differentiation of macrophage lineage cells attenuates bone remodeling and inflammatory angiogenesis in Ndrg1 deficient mice.

    PubMed

    Watari, Kosuke; Shibata, Tomohiro; Nabeshima, Hiroshi; Shinoda, Ai; Fukunaga, Yuichi; Kawahara, Akihiko; Karasuyama, Kazuyuki; Fukushi, Jun-Ichi; Iwamoto, Yukihide; Kuwano, Michihiko; Ono, Mayumi

    2016-01-18

    N-myc downstream regulated gene 1 (NDRG1) is a responsible gene for a hereditary motor and sensory neuropathy-Lom (Charcot-Marie-Tooth disease type 4D). This is the first study aiming to assess the contribution of NDRG1 to differentiation of macrophage lineage cells, which has important implications for bone remodeling and inflammatory angiogenesis. Ndrg1 knockout (KO) mice exhibited abnormal curvature of the spine, high trabecular bone mass, and reduced number of osteoclasts. We observed that serum levels of macrophage colony-stimulating factor (M-CSF) and macrophage-related cytokines were markedly decreased in KO mice. Differentiation of bone marrow (BM) cells into osteoclasts, M1/M2-type macrophages and dendritic cells was all impaired. Furthermore, KO mice also showed reduced tumor growth and angiogenesis by cancer cells, accompanied by decreased infiltration of tumor-associated macrophages. The transfer of BM-derived macrophages from KO mice into BM-eradicated wild type (WT) mice induced much less tumor angiogenesis than observed in WT mice. Angiogenesis in corneas in response to inflammatory stimuli was also suppressed with decreased infiltration of macrophages. Taken together, these results indicate that NDRG1 deficiency attenuates the differentiation of macrophage lineage cells, suppressing bone remodeling and inflammatory angiogenesis. This study strongly suggests the crucial role of NDRG1 in differentiation process for macrophages.

  3. Green tea polyphenols attenuate deterioration of bone microarchitecture in female rats with systemic chronic inflammation

    USDA-ARS?s Scientific Manuscript database

    Introduction: Our previous study demonstrated that green tea polyphenols (GTP) benefit bone health in female rats with chronic inflammation, because of GTP’s antioxidant capacity. The current study further evaluates whether GTP can restore bone microstructure along with related mechanism in rats wit...

  4. Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells

    PubMed Central

    Taipaleenmäki, Hanna; Farina, Nicholas H.; van Wijnen, Andre J.; Stein, Janet L.

    2016-01-01

    Wnt signaling is implicated in bone formation and activated in breast cancer cells promoting primary and metastatic tumor growth. A compelling question is whether osteogenic miRNAs that increase Wnt activity for bone formation are aberrantly expressed in breast tumor cells to support metastatic bone disease. Here we report that miR-218-5p is highly expressed in bone metastases from breast cancer patients, but is not detected in normal mammary epithelial cells. Furthermore, inhibition of miR-218-5p impaired the growth of bone metastatic MDA-MB-231 cells in the bone microenvironment in vivo. These findings indicate a positive role for miR-218-5p in bone metastasis. Bioinformatic and biochemical analyses revealed a positive correlation between aberrant miR-218-5p expression and activation of Wnt signaling in breast cancer cells. Mechanistically, miR-218-5p targets the Wnt inhibitors Sclerostin (SOST) and sFRP-2, which highly enhances Wnt signaling. In contrast, delivery of antimiR-218-5p decreased Wnt activity and the expression of metastasis-related genes, including bone sialoprotein (BSP/IBSP), osteopontin (OPN/SPP1) and CXCR-4, implicating a Wnt/miR-218-5p regulatory network in bone metastatic breast cancer. Furthermore, miR-218-5p also mediates the Wnt-dependent up-regulation of PTHrP, a key cytokine promoting cancer-induced osteolysis. Antagonizing miR-218-5p reduced the expression of PTHrP and Rankl, inhibited osteoclast differentiation in vitro and in vivo, and prevented the development of osteolytic lesions in a preclinical metastasis model. We conclude that pathological elevation of miR-218-5p in breast cancer cells activates Wnt signaling to enhance metastatic properties of breast cancer cells and cancer-induced osteolytic disease, suggesting that miR-218-5p could be an attractive therapeutic target for preventing disease progression. PMID:27738322

  5. Inter-observer and inter-examination variability of manual vertebral bone attenuation measurements on computed tomography.

    PubMed

    Pompe, Esther; de Jong, Pim A; de Jong, Werner U; Takx, Richard A P; Eikendal, Anouk L M; Willemink, Martin J; Oudkerk, Matthijs; Budde, Ricardo P J; Lammers, Jan-Willem J; Mohamed Hoesein, Firdaus A A

    2016-09-01

    To determine inter-observer and inter-examination variability of manual attenuation measurements of the vertebrae in low-dose unenhanced chest computed tomography (CT). Three hundred and sixty-seven lung cancer screening trial participants who underwent baseline and repeat unenhanced low-dose CT after 3 months because of an indeterminate lung nodule were included. The CT attenuation value of the first lumbar vertebrae (L1) was measured in all CTs by one observer to obtain inter-examination reliability. Six observers performed measurements in 100 randomly selected CTs to determine agreement with limits of agreement and Bland-Altman plots and reliability with intraclass correlation coefficients (ICCs). Reclassification analyses were performed using a threshold of 110 HU to define osteoporosis. Inter-examination reliability was excellent with an ICC of 0.92 (p < 0.001). Inter-examination limits of agreement ranged from -26 to 28 HU with a mean difference of 1 ± 14 HU. Inter-observer reliability ICCs ranged from 0.70 to 0.91. Inter-examination variability led to 11.2 % reclassification of participants and inter-observer variability led to 22.1 % reclassification. Vertebral attenuation values can be manually quantified with good to excellent inter-examination and inter-observer reliability on unenhanced low-dose chest CT. This information is valuable for early detection of osteoporosis on low-dose chest CT. • Vertebral attenuation values can be manually quantified on low-dose unenhanced CT reliably. • Vertebral attenuation measurements may be helpful in detecting subclinical low bone density. • This could become of importance in the detection of osteoporosis.

  6. Correction of quantification errors in pelvic and spinal lesions caused by ignoring higher photon attenuation of bone in [{sup 18}F]NaF PET/MR

    SciTech Connect

    Schramm, Georg Maus, Jens; Hofheinz, Frank; Petr, Jan; Lougovski, Alexandr; Beuthien-Baumann, Bettina; Oehme, Liane; Platzek, Ivan; Hoff, Jörg van den

    2015-11-15

    Purpose: MR-based attenuation correction (MRAC) in routine clinical whole-body positron emission tomography and magnetic resonance imaging (PET/MRI) is based on tissue type segmentation. Due to lack of MR signal in cortical bone and the varying signal of spongeous bone, standard whole-body segmentation-based MRAC ignores the higher attenuation of bone compared to the one of soft tissue (MRAC{sub nobone}). The authors aim to quantify and reduce the bias introduced by MRAC{sub nobone} in the standard uptake value (SUV) of spinal and pelvic lesions in 20 PET/MRI examinations with [{sup 18}F]NaF. Methods: The authors reconstructed 20 PET/MR [{sup 18}F]NaF patient data sets acquired with a Philips Ingenuity TF PET/MRI. The PET raw data were reconstructed with two different attenuation images. First, the authors used the vendor-provided MRAC algorithm that ignores the higher attenuation of bone to reconstruct PET{sub nobone}. Second, the authors used a threshold-based algorithm developed in their group to automatically segment bone structures in the [{sup 18}F]NaF PET images. Subsequently, an attenuation coefficient of 0.11 cm{sup −1} was assigned to the segmented bone regions in the MRI-based attenuation image (MRAC{sub bone}) which was used to reconstruct PET{sub bone}. The automatic bone segmentation algorithm was validated in six PET/CT [{sup 18}F]NaF examinations. Relative SUV{sub mean} and SUV{sub max} differences between PET{sub bone} and PET{sub nobone} of 8 pelvic and 41 spinal lesions, and of other regions such as lung, liver, and bladder, were calculated. By varying the assigned bone attenuation coefficient from 0.11 to 0.13 cm{sup −1}, the authors investigated its influence on the reconstructed SUVs of the lesions. Results: The comparison of [{sup 18}F]NaF-based and CT-based bone segmentation in the six PET/CT patients showed a Dice similarity of 0.7 with a true positive rate of 0.72 and a false discovery rate of 0.33. The [{sup 18}F]NaF-based bone

  7. Nardosinone Suppresses RANKL-Induced Osteoclastogenesis and Attenuates Lipopolysaccharide-Induced Alveolar Bone Resorption

    PubMed Central

    Niu, Chenguang; Xiao, Fei; Yuan, Keyong; Hu, XuChen; Lin, Wenzhen; Ma, Rui; Zhang, Xiaoling; Huang, Zhengwei

    2017-01-01

    Periodontitis is a chronic inflammatory disease that damages the integrity of the tooth-supporting tissues, known as the periodontium, and comprising the gingiva, periodontal ligament and alveolar bone. In this study, the effects of nardosinone (Nd) on bone were tested in a model of lipopolysaccharide (LPS)-induced alveolar bone loss, and the associated mechanisms were elucidated. Nd effectively suppressed LPS-induced alveolar bone loss and reduced osteoclast (OC) numbers in vivo. Nd suppressed receptor activator of nuclear factor-κB ligand (RANKL)-mediated OC differentiation, bone resorption, and F-actin ring formation in a dose-dependent manner. Further investigation revealed that Nd suppressed osteoclastogenesis by suppressing the ERK and JNK signaling pathways, scavenging reactive oxygen species, and suppressing the activation of PLCγ2 that consequently affects the expression and/or activity of the OC-specific transcription factors, c-Fos and nuclear factor of activated T-cells cytoplasmic 1 (NFATc1). In addition, Nd significantly reduced the expression of OC-specific markers in mouse bone marrow-derived pre-OCs, including c-Fos, cathepsin K (Ctsk), VATPase d2, and Nfatc1. Collectively, these findings suggest that Nd has beneficial effects on bone, and the suppression of OC number implies that the effect is exerted directly on osteoclastogenesis. PMID:28955231

  8. Exercise training in obese older adults prevents increase in bone turnover and attenuates decrease in hip BMD induced by weight loss despite decline in bone-active hormones*

    PubMed Central

    Shah, Krupa; Armamento-Villareal, Reina; Parimi, Nehu; Chode, Suresh; Sinacore, David R.; Hilton, Tiffany N.; Napoli, Nicola; Qualls, Clifford; Villareal, Dennis T.

    2011-01-01

    Weight-loss therapy to improve health in obese older adults is controversial because it causes further bone loss. Therefore, it is recommended that weight-loss therapy should include an intervention to minimize bone loss such as exercise training (ET). The purpose of this study was to determine the independent and combined effects of weight loss and ET on bone metabolism in relation to bone mineral density (BMD) in obese older adults. One-hundred-seven older (age >65 yrs) obese (BMI ≥30 kg/m2) adults were randomly assigned to a control group, diet group, exercise group, and diet-exercise group for 1 year. Body weight decreased in the diet (−9.6%) and diet-exercise (−9.4%) groups, not in the exercise (−1%) and control (−0.2%) groups (between-group P<.001). However, despite comparable weight loss, bone loss at the total hip was relatively less in the diet-exercise group (−1.1%) than in the diet group (−2.6%), whereas BMD increased in the exercise group (1.5%) (between-group P<.001) Serum C-terminal telopeptide (CTX) and osteocalcin concentrations increased in the diet group (31% and 24%) while they decreased in the exercise group (−13% and −15%) (between-group P<.001). In contrast, similar to the control group, serum CTX and osteocalcin concentrations did not change in the diet-exercise group. Serum procollagen propeptide concentrations decreased in the exercise group (−15%) compared with the diet group (9%) (P=.04). Serum leptin and estradiol concentrations decreased in the diet (−25% and −15%) and diet-exercise (−38% and −13%) groups, not in the exercise and control groups (between-group P=.001). Multivariate analyses revealed that changes in lean body mass (β=.33), serum osteocalcin (β= −.24), and 1-RM strength (β=.23) were independent predictors of changes in hip BMD (all P<.05). In conclusion, the addition of ET to weight-loss therapy among obese older adults prevents weight-loss-induced increase in bone turnover and attenuates

  9. High-fat Diet Enhances and Plasminogen Activator Inhibitor-1 Deficiency Attenuates Bone Loss in Mice with Lewis Lung Carcinoma.

    PubMed

    Yan, Lin; Nielsen, Forrest H; Sundaram, Sneha; Cao, Jay

    2015-07-01

    This study determined the effects of a high-fat diet and plasminogen activator inhibitor-1 deficiency (Pai1(-/-)) on the bone structure in male C57BL/6 mice bearing Lewis lung carcinoma (LLC) in lungs. Significant reduction in bone volume fraction (BV/TV), trabecular number (Tb.N) and bone mineral density (BMD) in femurs and vertebrae were found in LLC-bearing mice compared to non-tumor-bearing mice. In LLC-bearing mice, the high-fat diet compared to the AIN93G control diet significantly reduced BV/TV, Tb.N and BMD in femurs and BV/TV in vertebrae. The high-fat diet significantly reduced BMD in vertebrae in wild-type mice but not in Pai1(-/-) mice. Compared to wild-type mice, PAI1 deficiency significantly increased BV/TV and Tb.N in femurs. The plasma concentration of osteocalcin was significantly lower and that of tartrate-resistant acid phosphatase 5b (TRAP5b) was significantly higher in LLC-bearing mice. The high-fat diet significantly reduced plasma osteocalcin and increased TRAP5b. Deficiency in PAI1 prevented the high-fat diet-induced increases in plasma TRAP5b. These findings demonstrate that a high-fat diet enhances, whereas PAI1 deficiency, attenuates metastasis-associated bone loss, indicating that a high-fat diet and PAI1 contribute to metastasis-associated bone deterioration. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  10. Whole-body bone segmentation from MRI for PET/MRI attenuation correction using shape-based averaging.

    PubMed

    Arabi, Hossein; Zaidi, Habib

    2016-11-01

    The authors evaluate the performance of shape-based averaging (SBA) technique for whole-body bone segmentation from MRI in the context of MRI-guided attenuation correction (MRAC) in hybrid PET/MRI. To enhance the performance of the SBA scheme, the authors propose to combine it with statistical atlas fusion techniques. Moreover, a fast and efficient shape comparison-based atlas selection scheme was developed and incorporated into the SBA method. Clinical studies consisting of PET/CT and MR images of 21 patients were used to assess the performance of the SBA method. In addition, the authors assessed the performance of simultaneous truth and performance level estimation (STAPLE) and the selective and iterative method for performance level estimation (SIMPLE) combined with SBA. In addition, a local shape comparison scheme (L-Shp) was proposed to improve the performance of SBA. The SIMPLE method was applied globally (G-SIMPLE) while STAPLE method was employed at both global (G-STAPLE) and local (L-STAPLE) levels. The evaluation was performed based on the accuracy of extracted whole-body bones, fragmentation, and computation time achieved by the different methods. The majority voting (MV) atlas fusion scheme was also evaluated as a conventional and commonly used method. MRI-guided attenuation maps were generated using the different segmentation methods. Thereafter, quantitative analysis of PET attenuation correction was performed using CT-based attenuation correction as reference. The SBA and MV methods resulted in considerable underestimation of bone identification (Dice ≈ 0.62) and high factious fragmentation error of contiguous structures. Applying global atlas selection or regularization (G-STAPLE and G-SIMPLE) to the SBA method enhanced bone segmentation accuracy up to a Dice = 0.66. The best results were achieved when applying the L-STAPLE method with a Dice of 0.76 and the L-Shp method with a Dice of 0.75. However, L-STAPLE required up to five-fold increased

  11. Administration of ON 01210.Na after exposure to ionizing radiation protects bone marrow cells by attenuating DNA damage response.

    PubMed

    Suman, Shubhankar; Maniar, Manoj; Fornace, Albert J; Datta, Kamal

    2012-01-20

    Ionizing radiation-induced hematopoietic injury could occur either due to accidental exposure or due to diagnostic and therapeutic interventions. Currently there is no approved drug to mitigate radiation toxicity in hematopoietic cells. This study investigates the potential of ON 01210.Na, a chlorobenzylsulfone derivative, in ameliorating radiation-induced hematopoietic toxicity when administered after exposure to radiation. We also investigate the molecular mechanisms underlying this activity. Male C3H/HeN mice (n = 5 mice per group; 6-8 weeks old) were exposed to a sub-lethal dose (5 Gy) of γ radiation using a ¹³⁷Cs source at a dose rate of 0.77 Gy/min. Two doses of ON 01210.Na (500 mg/kg body weight) were administered subcutaneously at 24 h and 36 h after radiation exposure. Mitigation of hematopoietic toxicity by ON 01210.Na was investigated by peripheral white blood cell (WBC) and platelet counts at 3, 7, 21, and 28 d after radiation exposure. Granulocyte macrophage colony forming unit (GM-CFU) assay was done using isolated bone marrow cells, and terminal deoxynucleotidyl transferase dUTP nick end-labeling (TUNEL) was performed on bone marrow sections at 7 d post-exposure. The DNA damage response pathway involving ataxia telangiectasia mutated (ATM) and p53 was investigated by Western blot in bone marrow cells at 7 d post-exposure. Compared to the vehicle, ON 01210.Na treated mice showed accelerated recovery of peripheral WBC and platelet counts. Post-irradiation treatment of mice with ON 01210.Na also resulted in higher GM-CFU counts. The mitigation effects were accompanied by attenuation of ATM-p53-dependent DNA damage response in the bone marrow cells of ON 01210.Na treated mice. Both phospho-ATM and phospho-p53 were significantly lower in the bone marrow cells of ON 01210.Na treated than in vehicle treated mice. Furthermore, the Bcl2:Bax ratio was higher in the drug treated mice than the vehicle treated groups. ON 01210.Na treatment significantly

  12. Omentin-1 attenuates arterial calcification and bone loss in osteoprotegerin-deficient mice by inhibition of RANKL expression.

    PubMed

    Xie, Hui; Xie, Ping-Li; Wu, Xian-Ping; Chen, San-Mei; Zhou, Hou-De; Yuan, Ling-Qing; Sheng, Zhi-Feng; Tang, Si-Yuan; Luo, Xiang-Hang; Liao, Er-Yuan

    2011-11-01

    Omentin-1 (also known as intelectin-1) is a recently identified visceral adipose tissue-derived cytokine that is inversely related to obesity. Our previous study showed that omentin-1 inhibits osteoblastic differentiation of calcifying vascular smooth muscle cells (CVSMCs) in vitro. This study was undertaken to investigate the effects of omentin-1 on arterial calcification and bone metabolism in vivo. In vitro, omentin-1 stimulated production of osteoprotegerin (OPG) and inhibited production of receptor activator for nuclear factor κB ligand (RANKL) in both CVSMCs and osteoblasts. In vivo, adenovirus-mediated over-expression of omentin-1 attenuated arterial calcification and bone loss in OPG(-/-) mice. All these in vitro and in vivo actions were abrogated by blockade of the PI3K-Akt signalling pathway. Furthermore, omentin-1 reduced serum levels of RANKL, tartarate-resistant acid phosphatase-5b and osteocalcin, all of which are increased dramatically in OPG(-/-) mice. These data suggest that omentin-1 ameliorates arterial calcification and bone loss in vivo through the regulation of the RANK signalling pathway.

  13. Attenuated BMP1 Function Compromises Osteogenesis, Leading to Bone Fragility in Humans and Zebrafish

    PubMed Central

    Asharani, P.V.; Keupp, Katharina; Semler, Oliver; Wang, Wenshen; Li, Yun; Thiele, Holger; Yigit, Gökhan; Pohl, Esther; Becker, Jutta; Frommolt, Peter; Sonntag, Carmen; Altmüller, Janine; Zimmermann, Katharina; Greenspan, Daniel S.; Akarsu, Nurten A.; Netzer, Christian; Schönau, Eckhard; Wirth, Radu; Hammerschmidt, Matthias; Nürnberg, Peter; Wollnik, Bernd; Carney, Thomas J.

    2012-01-01

    Bone morphogenetic protein 1 (BMP1) is an astacin metalloprotease with important cellular functions and diverse substrates, including extracellular-matrix proteins and antagonists of some TGFβ superfamily members. Combining whole-exome sequencing and filtering for homozygous stretches of identified variants, we found a homozygous causative BMP1 mutation, c.34G>C, in a consanguineous family affected by increased bone mineral density and multiple recurrent fractures. The mutation is located within the BMP1 signal peptide and leads to impaired secretion and an alteration in posttranslational modification. We also characterize a zebrafish bone mutant harboring lesions in bmp1a, demonstrating conservation of BMP1 function in osteogenesis across species. Genetic, biochemical, and histological analyses of this mutant and a comparison to a second, similar locus reveal that Bmp1a is critically required for mature-collagen generation, downstream of osteoblast maturation, in bone. We thus define the molecular and cellular bases of BMP1-dependent osteogenesis and show the importance of this protein for bone formation and stability. PMID:22482805

  14. Attenuated BMP1 function compromises osteogenesis, leading to bone fragility in humans and zebrafish.

    PubMed

    Asharani, P V; Keupp, Katharina; Semler, Oliver; Wang, Wenshen; Li, Yun; Thiele, Holger; Yigit, Gökhan; Pohl, Esther; Becker, Jutta; Frommolt, Peter; Sonntag, Carmen; Altmüller, Janine; Zimmermann, Katharina; Greenspan, Daniel S; Akarsu, Nurten A; Netzer, Christian; Schönau, Eckhard; Wirth, Radu; Hammerschmidt, Matthias; Nürnberg, Peter; Wollnik, Bernd; Carney, Thomas J

    2012-04-06

    Bone morphogenetic protein 1 (BMP1) is an astacin metalloprotease with important cellular functions and diverse substrates, including extracellular-matrix proteins and antagonists of some TGFβ superfamily members. Combining whole-exome sequencing and filtering for homozygous stretches of identified variants, we found a homozygous causative BMP1 mutation, c.34G>C, in a consanguineous family affected by increased bone mineral density and multiple recurrent fractures. The mutation is located within the BMP1 signal peptide and leads to impaired secretion and an alteration in posttranslational modification. We also characterize a zebrafish bone mutant harboring lesions in bmp1a, demonstrating conservation of BMP1 function in osteogenesis across species. Genetic, biochemical, and histological analyses of this mutant and a comparison to a second, similar locus reveal that Bmp1a is critically required for mature-collagen generation, downstream of osteoblast maturation, in bone. We thus define the molecular and cellular bases of BMP1-dependent osteogenesis and show the importance of this protein for bone formation and stability.

  15. Glucosamines Attenuate Bone Loss Due to Menopause by Regulating Osteoclast Function in Ovariectomized Mice.

    PubMed

    Asai, Hironobu; Nakatani, Sachie; Kato, Takuya; Shimizu, Tatsuo; Mano, Hiroshi; Kobata, Kenji; Wada, Masahiro

    2016-01-01

    The effect of glucosamine (GlcN) and N-acetylglucosamine (GlcNAc) on bone metabolism in ovariectomized (OVX) mice was studied. After 12 weeks of feeding with 0.2% GlcN and 0.2% GlcNAc, the femoral bone mineral density in OVX mice was significantly increased compared with that in OVX mice fed the control diet. Histomorphometric analysis of the tibia indicated that the rates of osteogenesis and bone resorption were reduced due to the GlcN diet. The erosion depth of osteoclasts on the tibia in GlcN- and GlcNAc-fed OVX mice was significantly lower than that in the control OVX mice. The number of tartrate-resistant acid phosphatase-positive osteoclasts induced from bone marrow stem cells isolated from GlcN-fed OVX mice was significantly lower than that from control OVX mice. A loss of uterine weight and higher serum calcium concentration in the GlcN- and GlcNAc-fed OVX mice were observed. The results suggest that the intake of GlcN suppresses bone loss by inhibiting osteoclast differentiation and activity in a nonestrogenic manner.

  16. Attenuation of subchondral bone abnormal changes in osteoarthritis by inhibition of SDF-1 signaling.

    PubMed

    Chen, Y; Lin, S; Sun, Y; Guo, J; Lu, Y; Suen, C W; Zhang, J; Zha, Z; Ho, K W; Pan, X; Li, G

    2017-06-01

    Current conservative treatments for osteoarthritis (OA) are largely symptoms control therapies. Further understanding on the pathological mechanisms of OA is crucial for new pharmacological intervention. In this study, we investigated the role of Stromal cell-derived factor-1(SDF-1) in regulating subchondral bone changes during the progression of OA. Clinical samples of different stages of OA severity were analyzed by histology staining, micro-CT, enzyme-linked immunosorbent assay (ELISA) and western blotting, to compare SDF-1 level in subchondral bone. The effects of SDF-1 on human mesenchymal stem cells (MSCs) osteogenic differentiation were evaluated. In vivo assessment was performed in an anterior cruciate ligament transaction plus medial meniscus resection in the SD rats. The OA rats received continuous infusion of AMD3100 (SDF-1 receptor blocker) in osmotic mini-pump implanted subcutaneously for 6 weeks. These rats were then terminated and subjected to the same in vitro assessments as human OA samples. SDF-1 level was significantly elevated in the subchondral bone of human OA samples. In the cell studies, the results showed SDF-1 plays an important role in osteogenic differentiation of MSCs. In the OA animal studies, there were less cartilage damage in the AMD3100-treated group; microCT results showed that the subchondral bone formation was significantly reduced and so did the number of positive Nestin or Osterix cells in the subchondral bone region. Higher level of SDF-1 may induce the subchondral bone abnormal changes in OA and inhibition of SDF-1 signaling could be a potential therapeutic approach for OA. Copyright © 2017 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  17. Correction of quantification errors in pelvic and spinal lesions caused by ignoring higher photon attenuation of bone in [18F]NaF PET/MR.

    PubMed

    Schramm, Georg; Maus, Jens; Hofheinz, Frank; Petr, Jan; Lougovski, Alexandr; Beuthien-Baumann, Bettina; Oehme, Liane; Platzek, Ivan; van den Hoff, Jörg

    2015-11-01

    MR-based attenuation correction (MRAC) in routine clinical whole-body positron emission tomography and magnetic resonance imaging (PET/MRI) is based on tissue type segmentation. Due to lack of MR signal in cortical bone and the varying signal of spongeous bone, standard whole-body segmentation-based MRAC ignores the higher attenuation of bone compared to the one of soft tissue (MRACnobone). The authors aim to quantify and reduce the bias introduced by MRACnobone in the standard uptake value (SUV) of spinal and pelvic lesions in 20 PET/MRI examinations with [18F]NaF. The authors reconstructed 20 PET/MR [18F]NaF patient data sets acquired with a Philips Ingenuity TF PET/MRI. The PET raw data were reconstructed with two different attenuation images. First, the authors used the vendor-provided MRAC algorithm that ignores the higher attenuation of bone to reconstruct PETnobone. Second, the authors used a threshold-based algorithm developed in their group to automatically segment bone structures in the [18F]NaF PET images. Subsequently, an attenuation coefficient of 0.11 cm(-1) was assigned to the segmented bone regions in the MRI-based attenuation image (MRACbone) which was used to reconstruct PETbone. The automatic bone segmentation algorithm was validated in six PET/CT [18F]NaF examinations. Relative SUVmean and SUVmax differences between PETbone and PETnobone of 8 pelvic and 41 spinal lesions, and of other regions such as lung, liver, and bladder, were calculated. By varying the assigned bone attenuation coefficient from 0.11 to 0.13 cm(-1), the authors investigated its influence on the reconstructed SUVs of the lesions. The comparison of [18F]NaF-based and CT-based bone segmentation in the six PET/CT patients showed a Dice similarity of 0.7 with a true positive rate of 0.72 and a false discovery rate of 0.33. The [18F]NaF-based bone segmentation worked well in the pelvis and spine. However, it showed artifacts in the skull and in the extremities. The analysis of the

  18. Induced Pluripotent Stem Cell Derived Mesenchymal Stem Cells for Attenuating Age-Related Bone Loss

    DTIC Science & Technology

    2013-09-01

    formation, are associated with gastrointestinal problems when taken orally and may cause osteonecrosis in cancer patients and bone pain in other...expression of osteoblastic phenotypic markers on iPS derived MSC cultured on nanotopographic biofilms . While we have not yet examined the effect

  19. Bone marrow fat has brown adipose tissue characteristics, which are attenuated with aging and diabetes.

    PubMed

    Krings, A; Rahman, S; Huang, S; Lu, Y; Czernik, P J; Lecka-Czernik, B

    2012-02-01

    Fat occupies a significant portion of bone cavity however its function is largely unknown. Marrow fat expands during aging and in conditions which affect energy metabolism, indicating that fat in bone is under similar regulatory mechanisms as other fat depots. On the other hand, its location may determine specific functions in the maintenance of the environment for bone remodeling and hematopoiesis. We have demonstrated that marrow fat has a distinctive phenotype, which resembles both, white and brown adipose tissue (WAT and BAT, respectively). Marrow adipocytes express gene markers of brown adipocytes at levels characteristic for the BAT, including transcription factor Prdm16, and regulators of thermogenesis such as deiodinase 2 (Dio2) and PGC1α. The levels of expression of BAT-specific gene markers are decreased in bone of 24 mo old C57BL/6 and in diabetic yellow agouti A(vy)/a mice implicating functional changes of marrow fat occurring with aging and diabetes. Administration of antidiabetic TZD rosiglitazone, which sensitizes cells to insulin and increases adipocyte metabolic functions, significantly increased both, BAT (UCP1, PGC1α, Dio2, β3AR, Prdm16, and FoxC2) and WAT (adiponectin and leptin) gene expression in marrow of normoglycemic C57BL/6 mice, but failed to increase the expression of BAT, but not WAT, gene markers in diabetic mice. In conclusion, the metabolic phenotype of marrow fat combines both BAT and WAT characteristics. Decrease in BAT-like characteristics with aging and diabetes may contribute to the negative changes in the marrow environment supporting bone remodeling and hematopoiesis.

  20. Plumbagin attenuates cancer cell growth and osteoclast formation in the bone microenvironment of mice

    PubMed Central

    Yan, Wei; Wang, Ting-yu; Fan, Qi-ming; Du, Lin; Xu, Jia-ke; Zhai, Zan-jing; Li, Hao-wei; Tang, Ting-ting

    2014-01-01

    Aim: To investigate the effects of plumbagin, a naphthoquinone derived from the medicinal plant Plumbago zeylanica, on human breast cancer cell growth and the cancer cell-induced osteolysis in the bone microenvironment of mice. Methods: Human breast cancer cell subline MDA-MB-231SA with the ability to spread and grow in the bone was tested. The cell proliferation was determined using the CCK-8 assay. Apoptosis was detected with Annexin V/PI double-labeled flow cytometry. Red fluorescent protein-labeled MDA-MB-231SArfp cells were injected into the right tibia of female BALB/c-nu/nu mice. Three days after the inoculation, the mice were injected with plumbagin (2, 4, or 6 mg/kg, ip) 5 times per week for 7 weeks. The growth of the tumor cells was monitored using an in vivo imaging system. After the mice were sacrificed, the hind limbs were removed for radiographic and histological analyses. Results: Plumbagin (2.5–20 μmol/L) concentration-dependently inhibited the cell viability and induced apoptosis of MDA-MB-231SA cells in vitro (the IC50 value of inhibition of cell viability was 14.7 μmol/L). Administration of plumbagin to breast cancer bearing mice delayed the tumor growth by 2–3 weeks and reduced the tumor volume by 44%–74%. The in vivo imaging study showed that plumbagin dose-dependently inhibited MDA-MB-231SArfp cell growth in bone microenvironment. Furthermore, X-ray images and micro-CT study demonstrated that plumbagin reduced bone erosion area and prevented a decrease in bone tissue volume. Histological studies showed that plumbagin dose-dependently inhibited the breast cancer cell growth, enhanced the cell apoptosis and reduced the number of TRAcP-positive osteoclasts. Conclusion: Plumbagin inhibits the cell growth and induces apoptosis in human breast cancer cells in mice bone microenvironment, leading to significant reduction in osteolytic lesions caused by the tumor cells. PMID:24384612

  1. Description and assessment of a registration-based approach to include bones for attenuation correction of whole-body PET/MRI.

    PubMed

    Marshall, Harry R; Patrick, John; Laidley, David; Prato, Frank S; Butler, John; Théberge, Jean; Thompson, R Terry; Stodilka, Robert Z

    2013-08-01

    Attenuation correction for whole-body PET/MRI is challenging. Most commercial systems compute the attenuation map from MRI using a four-tissue segmentation approach. Bones, the most electron-dense tissue, are neglected because they are difficult to segment. In this work, the authors build on this segmentation approach by adding bones using a registration technique and assessing its performance on human PET images. Twelve oncology patients were imaged with FDG PET/CT and MRI using a Turbo-FLASH pulse sequence. A database of 121 attenuation correction quality CT scans was also collected. Each patient MRI was compared to the CT database via weighted heuristic measures to find the "most similar" CT in terms of body geometry. The similar CT was aligned to the MRI with a deformable registration method. Two MRI-based attenuation maps were computed. One was a standard four-tissue segmentation (air, lung, fat, and lean tissue) using basic image processing techniques. The other was identical, except the bones from the aligned CT were added. The PET data were reconstructed with the patient's CT-based attenuation map (the silver standard) and both MRI-based attenuation maps. The relative errors of the MRI-based attenuation corrections were computed in 14 standardized volumes of interest, in lesions, and over whole tissues. The squared Pearson correlation coefficient was also calculated over whole tissues. Statistical testing was done with ANOVAs and paired t-tests. The MRI-based attenuation correction ignoring bone had relative errors ranging from -37% to -8% in volumes of interest containing bone. By including bone, the magnitude of the relative error was reduced in all cases (p<0.001), ranging from -3% to 4%. Further, the relative error in volumes of interest adjacent to bone was improved from a mean of -7.5% to 2% (p<0.001). In the other seven volumes of interest, including bone reduced the magnitude of relative error in three cases (p<0.001), had no effect in three cases

  2. Attenuation of bone morphogenetic protein signaling during amphibian limb development results in the generation of stage-specific defects

    PubMed Central

    Jones, Tamsin E M; Day, Robert C; Beck, Caroline W

    2013-01-01

    The vertebrate limb is one of the most intensively studied organs in the field of developmental biology. Limb development in tetrapod vertebrates is highly conserved and dependent on the interaction of several important molecular pathways. The bone morphogenetic protein (BMP) signaling cascade is one of these pathways and has been shown to be crucial for several aspects of limb development. Here, we have used a Xenopus laevis transgenic line, in which expression of the inhibitor Noggin is under the control of the heat-shock promoter hsp70 to examine the effects of attenuation of BMP signaling at different stages of limb development. Remarkably different phenotypes were produced at different stages, illustrating the varied roles of BMP in development of the limb. Very early limb buds appeared to be refractory to the effects of BMP attenuation, developing normally in most cases. Ectopic limbs were produced by overexpression of Noggin corresponding to a brief window of limb development at about stage 49/50, as recently described by Christen et al. (2012). Attenuation of BMP signaling in stage 51 or 52 tadpoles lead to a reduction in the number of digits formed, resulting in hypodactyly or ectrodactyly, as well as occasional defects in the more proximal tibia-fibula. Finally, inhibition at stage 54 (paddle stage) led to the formation of dramatically shortened digits resulting from loss of distal phalanges. Transcriptome analysis has revealed the possibility that more Noggin-sensitive members of the BMP family could be involved in limb development than previously suspected. Our analysis demonstrates the usefulness of heat-shock-driven gene expression as an effective method for inhibiting a developmental pathway at different times during limb development. PMID:23981117

  3. Intrathecal injection of selected peptide Myr-RC-13 attenuates bone cancer pain by inhibiting KIF17 and NR2B expression.

    PubMed

    Ni, Kun; Zhou, Yu; Sun, Yu-e; Liu, Yue; Gu, Xiao-ping; Ma, Zheng-liang

    2014-07-01

    Although bone cancer pain is a common intractable clinical symptom, its underlying mechanisms are still elusive. Accumulating evidence reveals that the N-methyl-D-aspartate (NMDA) receptor containing a 2B subunit (NR2B) in the spinal cord contributes to bone cancer pain. Our preliminary study demonstrated that intrathecal injection of fusion peptide Myr-RC-13 could disrupt spinal KIF17/mLin10 interaction, which is an essential component of KIF17-mediated NR2B transport. Here we report a means by infusion of the selected peptide Myr-RC-13 intrathecally to attenuate bone cancer pain. The results showed that inoculation of fibrosarcoma NCTC 2472 cells into the femur cavity of C3H/HeJ mice induced progressive bone cancer pain and resulted in up-regulation of KIF17 and NR2B in the spinal cord. In addition, repetitive spinal delivery of Myr-RC-13 relieved bone cancer-related mechanical allodynia and spontaneous pain behaviors, and down-regulated expression of spinal KIF17 and NR2B. Finally, our results demonstrated that selected peptide Myr-RC-13 was able to attenuate bone cancer pain via decreasing spinal KIF17 and NR2B expressions. Therefore, selected peptide Myr-RC-13 might be a potential analgesic strategy for bone cancer pain.

  4. Mas-related G-protein-coupled receptor c agonist bovine adrenal medulla 8-22 attenuates bone cancer pain in mice

    PubMed Central

    Sun, Yu-E; Lu, Cui-E; Lei, Yishan; Liu, Yue; Ma, Zhengliang; Gu, Xiaoping

    2015-01-01

    Objectives: The aim of this study is to investigate the effects of Mas-related G-protein-coupled receptor C (MrgC) agonist bovine adrenal medulla 8-22 (BAM8-22) on bone cancer pain and mirror-image pain. Methods: Bone cancer pain was induced by intramedullary injection of NC2472 fibrosarcoma cells in the mice. BAM8-22 and/or anti-MrgC antibody were injected intrathecally at day 14 after bone cancer induction and their effects on pain behaviors were detected. The pain behaviours were assessed by the number of spontaneous foot lifts and paw withdrawal mechanical threshold (PWMT) tests. MrgC expression was detected using western blot analysis and immunofluorescence assay. Results: There were increased bone cancer pain and mirror-image pain in the tumor-bearing mice while not in the sham-treated mice. BAM8-22 attenuated bone cancer pain in mice dose dependently with the highest effects at 2 hr after BAM8-22 administration, and anti-MrgC antibody reversed the effects of BAM8-22. However, intrathecal administration of BAM8-22 did not affect the mirror-image pain. Furthermore, BAM8-22 stimulated the expression of MrgC in the spinal dorsal horn. Conclusions: MrgC agonist BAM8-22 could attenuate bone cancer pain in mice. This study may provide a novel strategy for the treatment of bone cancer pain. PMID:26884930

  5. Porous tantalum seeded with bone marrow mesenchymal stem cells attenuates steroid-associated osteonecrosis.

    PubMed

    Fu, W-M; Yang, L; Wang, B-J; Xu, J-K; Wang, J-L; Qin, L; Zhao, D-W

    2016-08-01

    Bone marrow mesenchymal stem cells (BMMSCs) have been widely applied in osteonecrosis. However, lack of biomechanical support limited application of BMMSCs. And porous tantalum (PTA) has been identified as a cell-friendly scaffold for bone regeneration. Herein, we aimed to investigate the efficacy of PTA seeded with BMMSCs in the treatment of osteonecrosis. After the production of PTA seeded with BMMSCs, MTT and GFP were performed to identify the proliferation and adhesion of BMMSCs respectively, which was further examined by scanning electron microscopy (SEM). And real-time PCR was also used to determine mRNA level of osteogenic markers, including Alp, OCN, OPN, Col I and Runx-2 in BMMSCs. Nineteen adult rabbits were applied for building steroid-associated osteonecrosis (SAON) models. Bone formation rate (BFR) and mineral apposition rate (MAR) were determined. And Goldner Trichrome Staining was used in these SAON models, which further confirmed the efficacy of PTA seeded with BMMSCs in SAON. PTA seeded with BMMSCs showed excellent biocompatibility. Additionally, SEM assay showed that BMMSCs adhered tightly and spread fully in the pores of PTA. Next, the expression of ALP and OPN mRNA in BMMSCs were significantly (p < 0.05) higher in the PTA-treated group compared to those in the PTA-untreated group. Furthermore, compared to those treated by only PTA, the dynamic bone formation in rabbits treated by PTA seeded with BMMSCs was significantly increased (p < 0.001) at both week 3rd and week 6th. The product, PTA seeded with BMMSCs, was successfully produced, and was determined as high efficacy for treatment of steroid-associated osteonecrosis. PTA seeded with BMMSCs may afford a promising option for treating osteonecrosis.

  6. Bone Marrow-Derived Tenascin-C Attenuates Cardiac Hypertrophy by Controlling Inflammation.

    PubMed

    Song, Lei; Wang, Lai; Li, Fuqiang; Yukht, Ada; Qin, Minghui; Ruther, Haley; Yang, Mingjie; Chaux, Aurelio; Shah, Prediman K; Sharifi, Behrooz G

    2017-09-26

    Tenascin-C (TNC) is a highly conserved matricellular protein with a distinct expression pattern during development and disease. Remodeling of the left ventricle (LV) in response to pressure overload leads to the re-expression of the fetal gene program. The aim of this study was to investigate the function of TNC in cardiac hypertrophy in response to pressure overload. Pressure overload was induced in TNC knockout and wild-type mice by constricting their abdominal aorta or by infusion of angiotensin II. Echocardiography, immunostaining, flow cytometry, quantitative real-time polymerase chain reaction, and reciprocal bone marrow transplantation were used to evaluate the effect of TNC deficiency. Echocardiographic analysis of pressure overloaded hearts revealed that all LV parameters (LV end-diastolic and -systolic dimensions, ejection fraction, and fractional shortening) deteriorated in TNC-deficient mice compared with their wild-type counterparts. Cardiomyocyte size and collagen accumulation were significantly greater in the absence of TNC. Mechanistically, TNC deficiency promoted rapid accumulation of the CCR2(+)/Ly6C(hi) monocyte/macrophage subset into the myocardium in response to pressure overload. Further, echocardiographic and immunohistochemical analyses of recipient hearts showed that expression of TNC in the bone marrow, but not the myocardium, protected the myocardium against excessive remodeling of the pressure-overloaded heart. TNC deficiency further impaired cardiac function in response to pressure overload and exacerbated fibrosis by enhancing inflammation. In addition, expression of TNC in the bone marrow, but not the myocardium, protected the myocardium against excessive remodeling in response to mild pressure overload. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  7. High-Dose Vitamin D and Calcium Attenuates Bone Loss with Antiretroviral Therapy Initiation

    PubMed Central

    Overton, Edgar Turner; Chan, Ellen S.; Brown, Todd T.; Tebas, Pablo; McComsey, Grace A.; Melbourne, Kathleen M.; Napoli, Andrew; Hardin, William Royce; Ribaudo, Heather J.; Yin, Michael T.

    2015-01-01

    Background Antiretroviral therapy (ART) initiation for HIV-1 infection is associated with 2-6% loss in bone mineral density (BMD). Objective To evaluate vitamin D3 (4000 IU daily) plus calcium (1000 mg calcium carbonate daily) supplementation on bone loss associated with ART initiation. Design 48-week prospective, randomized, double-blind, placebo-controlled study. Setting Thirty nine AIDS Clinical Trials Network research units. Participants ART-naïve HIV-infected adults. Measurements BMD by dual-energy X-ray absorptiometry (DXA); 25-hydroxy vitamin D (25(OH)D) levels, parathyroid hormone (PTH), phosphate metabolism, markers of bone turnover and systemic inflammation. Results 165 eligible subjects were randomized (79 Vitamin D/calcium (VitD/Cal); 86 placebo); 142 subjects with evaluable DXA data were included in the primary analysis. The study arms were well-balanced at baseline: median age 33 years; 90% male; 33% non-Hispanic black; median CD4 count 341 cells/mm3; and median 25(OH)D 23 ng/mL (57 nmol/L). At 48 weeks, subjects receiving placebo had greater decline in total hip BMD than VitD/Cal: −3.19% median change (1st-3rd quartile (Q1, Q3) −5.12%, −1.02%) vs. (−1.46% −3.16%,−0.40%). respectively (p=0.001). Lumbar spine BMD loss for the two groups was similar: −2.91% (−4.84%, −1.06%) vs. −1.41% (−3.78%, 0.00%), (p=0.085). At week 48, 90% of participants achieved HIV-1 RNA <50 copies/mL. Levels of 25(OH)D3 increased in the VitD/Cal but not the placebo group: median change of 24.5 (14.6, 37.8) vs. 0.7 (−5.3, 4.3) ng/mL, respectively (p<0.001). Additionally, increases in markers of bone turnover were blunted in the VitD/Cal group. Limitations No international sites were included; only 48 weeks of follow up Conclusion Vitamin D/calcium supplementation mitigates the loss of BMD seen with initiation of efavirenz/emtricitabine/tenofovir, particularly at the total hip, which is the site of greatest concern for fragility fracture. Primary Funding

  8. Bone marrow mesenchymal stem cells attenuate silica-induced pulmonary fibrosis via paracrine mechanisms.

    PubMed

    Li, Xiaoli; Wang, Yan; An, Guoliang; Liang, Di; Zhu, Zhonghui; Lian, Ximeng; Niu, Piye; Guo, Caixia; Tian, Lin

    2017-03-15

    The purpose of this study was to investigate the anti-fibrotic effect and possible mechanism of bone marrow mesenchymal stem cells (BMSCs) in silica-induced lung injury and fibrosis in vivo and in vitro. In vivo, rats were exposed to 50mg/ml silica intratracheally. The rats were sacrificed on day 15 or day 30 after intravenous injection of BMSCs. Histopathological examination demonstrated that BMSCs decreased the blue areas of collagen fibers and the number of nodules. Alveolar epithelium was damaged by silica, but it was restored by BMSCs. In vitro, BMSCs co-cultured with RLE-6TN cells in 6-Transwell plates were evaluated to determine the possible mechanism. The results demonstrated that BMSCs downregulated the expression of collagen I and III. BMSCs reversed morphological abnormalities and reduced the proliferation of RLE-6TN cells. These data showed that BMSCs did not give rise to alveolar epithelial cells directly, while the levels of hepatocyte growth factor, keratinocyte growth factor and bone morphogenetic protein -7 increased and expression of tumor necrosis factor-α and transforming growth factor-β1 decreased in the 6TN+Silica+BMSCs group compared with the 6TN+Silica group. Our results revealed that BMSCs exerted anti-fibrotic effects on silica-induced pulmonary fibrosis, which might be associated with paracrine mechanisms rather than differentiation.

  9. Minocycline attenuates bone cancer pain in rats by inhibiting NF-κB in spinal astrocytes

    PubMed Central

    Song, Zhen-peng; Xiong, Bing-rui; Guan, Xue-hai; Cao, Fei; Manyande, Anne; Zhou, Ya-qun; Zheng, Hua; Tian, Yu-ke

    2016-01-01

    Aim: To investigate the mechanisms underlying the anti-nociceptive effect of minocycline on bone cancer pain (BCP) in rats. Methods: A rat model of BCP was established by inoculating Walker 256 mammary carcinoma cells into tibial medullary canal. Two weeks later, the rats were injected with minocycline (50, 100 μg, intrathecally; or 40, 80 mg/kg, ip) twice daily for 3 consecutive days. Mechanical paw withdrawal threshold (PWT) was used to assess pain behavior. After the rats were euthanized, spinal cords were harvested for immunoblotting analyses. The effects of minocycline on NF-κB activation were also examined in primary rat astrocytes stimulated with IL-1β in vitro. Results: BCP rats had marked bone destruction, and showed mechanical tactile allodynia on d 7 and d 14 after the operation. Intrathecal injection of minocycline (100 μg) or intraperitoneal injection of minocycline (80 mg/kg) reversed BCP-induced mechanical tactile allodynia. Furthermore, intraperitoneal injection of minocycline (80 mg/kg) reversed BCP-induced upregulation of GFAP (astrocyte marker) and PSD95 in spinal cord. Moreover, intraperitoneal injection of minocycline (80 mg/kg) reversed BCP-induced upregulation of NF-κB, p-IKKα and IκBα in spinal cord. In IL-1β-stimulated primary rat astrocytes, pretreatment with minocycline (75, 100 μmol/L) significantly inhibited the translocation of NF-κB to nucleus. Conclusion: Minocycline effectively alleviates BCP by inhibiting the NF-κB signaling pathway in spinal astrocytes. PMID:27157092

  10. Exercise training in obese older adults prevents increase in bone turnover and attenuates decrease in hip bone mineral density induced by weight loss despite decline in bone-active hormones.

    PubMed

    Shah, Krupa; Armamento-Villareal, Reina; Parimi, Nehu; Chode, Suresh; Sinacore, David R; Hilton, Tiffany N; Napoli, Nicola; Qualls, Clifford; Villareal, Dennis T

    2011-12-01

    0.05). In conclusion, the addition of ET to weight loss therapy among obese older adults prevents weight loss-induced increase in bone turnover and attenuates weight loss-induced reduction in hip BMD despite weight loss-induced decrease in bone-active hormones. Copyright © 2011 American Society for Bone and Mineral Research.

  11. FGFR1 signaling in hypertrophic chondrocytes is attenuated by the Ras-GAP neurofibromin during endochondral bone formation

    PubMed Central

    Karolak, Matthew R.; Yang, Xiangli; Elefteriou, Florent

    2015-01-01

    Aberrant fibroblast growth factor receptor 3 (FGFR3) signaling disrupts chondrocyte proliferation and growth plate size and architecture, leading to various chondrodysplasias or bone overgrowth. These observations suggest that the duration, intensity and cellular context of FGFR signaling during growth plate chondrocyte maturation require tight, regulated control for proper bone elongation. However, the machinery fine-tuning FGFR signaling in chondrocytes is incompletely defined. We report here that neurofibromin, a Ras-GAP encoded by Nf1, has an overlapping expression pattern with FGFR1 and FGFR3 in prehypertrophic chondrocytes, and with FGFR1 in hypertrophic chondrocytes during endochondral ossification. Based on previous evidence that neurofibromin inhibits Ras-ERK signaling in chondrocytes and phenotypic analogies between mice with constitutive FGFR1 activation and Nf1 deficiency in Col2a1-positive chondrocytes, we asked whether neurofibromin is required to control FGFR1-Ras-ERK signaling in maturing chondrocytes in vivo. Genetic Nf1 ablation in Fgfr1-deficient chondrocytes reactivated Ras-ERK1/2 signaling in hypertrophic chondrocytes and reversed the expansion of the hypertrophic zone observed in mice lacking Fgfr1 in Col2a1-positive chondrocytes. Histomorphometric and gene expression analyses suggested that neurofibromin, by inhibiting Rankl expression, attenuates pro-osteoclastogenic FGFR1 signaling in hypertrophic chondrocytes. We also provide evidence suggesting that neurofibromin in prehypertrophic chondrocytes, downstream of FGFRs and via an indirect mechanism, is required for normal extension and organization of proliferative columns. Collectively, this study indicates that FGFR signaling provides an important input into the Ras-Raf-MEK-ERK1/2 signaling axis in chondrocytes, and that this input is differentially regulated during chondrocyte maturation by a complex intracellular machinery, of which neurofibromin is a critical component. PMID:25616962

  12. Bone marrow-derived mesenchymal stem cells attenuate phosgene-induced acute lung injury in rats.

    PubMed

    Chen, Junfeng; Shao, Yiru; Xu, Guoxiong; Lim, ChitChoon; Li, Jun; Xu, Daojian; Shen, Jie

    2015-01-01

    Accidental phosgene exposure could result in acute lung injury (ALI), effective therapy is needed for the patients with phosgene-induced ALI. As a type of cells with therapeutic potential, mesenchymal stem cells (MSCs) have been showed its efficacy in multiple diseases. Here, we assessed the therapeutic potential of MSCs in phosgene-induced ALI and explored the related mechanisms. After isolation and characterization of rat bone marrow MSCs (BMMSCs), we transplanted BMMSCs into the rats exposed to phosgene and observed significant improvement on the lung wet-to-dry ratio and partial oxygen pressure (PaO2) at 6, 24, 48 h after phosgene exposure. Histological analyses revealed reduced sign of pathological changes in the lungs. Reduced level of pro-inflammatory tumor necrosis factor α and increased level of anti-inflammatory factor interleukin-10 were found in both bronchoalveolar lavage and plasma. Significant increased expression of epithelial cell marker AQP5 and SP-C was also found in the lung tissue. In conclusion, treatment with MSC markedly decreases the severity of phosgene-induced ALI in rats, and these protection effects were closely related to the pulmonary air blood barrier repairment and inflammatory reaction regulation.

  13. Bone Marrow Stem/Progenitor Cells Attenuate the Inflammatory Milieu Following Substitution Urethroplasty

    PubMed Central

    Liu, Joceline S.; Bury, Matthew I.; Fuller, Natalie J.; Sturm, Renea M.; Ahmad, Nida; Sharma, Arun K.

    2016-01-01

    Substitution urethroplasty for the treatment of male stricture disease is often accompanied by subsequent tissue fibrosis and secondary stricture formation. Patients with pre-existing morbidities are often at increased risk of urethral stricture recurrence brought upon in-part by delayed vascularization accompanied by overactive inflammatory responses following surgery. Within the context of this study, we demonstrate the functional utility of a cell/scaffold composite graft comprised of human bone marrow-derived mesenchymal stem cells (MSC) combined with CD34+ hematopoietic stem/progenitor cells (HSPC) to modulate inflammation and wound healing in a rodent model of substitution urethroplasty. Composite grafts demonstrated potent anti-inflammatory effects with regards to tissue macrophage and neutrophil density following urethral tissue analyses. This was accompanied by a significant reduction in pro-inflammatory cytokines TNFα and IL-1β and further resulted in an earlier transition to tissue remodeling and maturation with a shift in collagen type III to I. Grafted animals demonstrated a progressive maturation and increase in vessel size compared to control animals. Overall, MSC/CD34+ HSPC composite grafts reduce inflammation, enhance an earlier transition to wound remodeling and maturation concurrently increasing neovascularization in the periurethral tissue. We demonstrate the feasibility and efficacy of a stem cell-seeded synthetic graft in a rodent substitution urethroplasty model. PMID:27762304

  14. Infusion of Bone Marrow Mesenchymal Stem Cells Attenuates Experimental Severe Acute Pancreatitis in Rats

    PubMed Central

    Huang, Dandan; Gao, Jun; Gong, Yanfang; Wu, Hongyu; Xu, Aifang

    2016-01-01

    Background & Aims. Severe acute pancreatitis (SAP) remains a high-mortality disease. Bone marrow (BM) mesenchymal stem cells (MSCs) have been demonstrated to have plasticity of transdifferentiation and to have immunomodulatory functions. In the present study, we assessed the roles of MSCs in SAP and the therapeutic effects of MSC on SAP after transplantation. Methods. A pancreatitis rat model was induced by the injection of taurocholic acid (TCA) into the pancreatic duct. After isolation and characterization of MSC from BM, MSC transplantation was conducted 24 hrs after SAP induction by tail vein injection. The survival rate was observed and MSCs were traced after transplantation. The expression of TNF-α and IL-1β mRNA in the transplantation group was also analyzed. Results. The survival rate of the transplantation group was significantly higher compared to the control group (p < 0.05). Infused MSCs were detected in the pancreas and BM 3 days after transplantation. The expression of TNF-α and IL-1β mRNA in the transplantation group was significantly lower than in the control group in both the pancreas and the lungs (p < 0.05). Conclusions. MSC transplantation could improve the prognosis of SAP rats. Engrafted MSCs have the capacity of homing, migration, and planting during the treatment of SAP. PMID:27721836

  15. Green Tea Modulates Cytokine Expression in the Periodontium and Attenuates Alveolar Bone Resorption in Type 1 Diabetic Rats.

    PubMed

    Gennaro, Gabriela; Claudino, Marcela; Cestari, Tania Mary; Ceolin, Daniele; Germino, Patrícia; Garlet, Gustavo Pompermaier; de Assis, Gerson Francisco

    2015-01-01

    Diabetes mellitus comprises a heterogeneous group of disorders with the main feature of hyperglycemia. Chronic hyperglycemia increases the severity of periodontal disease via an exacerbated inflammatory response, activated by advanced glycation end products and their receptor, RAGE. Therefore, anti-inflammatory agents represent potential inhibitors of this pathological interaction. In particular, green tea has been shown to possess anti-inflammatory properties mediated by its polyphenol content. This study investigated the mechanisms by which green tea attenuates the spontaneous onset of diabetes-induced periodontitis. Diabetes was induced in rats via a single intraperitoneal injection of streptozotocin (STZ). Diabetic and control animals were divided into water-treated and green tea-treated subgroups and were analyzed at 15, 30, 60 and 90 days after diabetes induction. Immunohistochemistry was performed to quantitatively evaluate tumor necrosis factor-α (TNF-α), receptor activator of nuclear factor kappa-B ligand (RANKL), osteoprotegerin (OPG), interleukin-10 (IL-10) and runt-related transcription factor 2 (RUNX-2) expression in serial sections of each hemimaxilla. Morphometric measurements of the distance from the cementum-enamel junction (CEJ) of the superior distal root of the first molar to the alveolar bone crest (ABC) were performed to assess bone loss. Diabetes resulted in significant bone loss and alterations in the number of cells that stained positive for inflammatory mediators. In the diabetic rats treated with green tea, we observed a decreased number of cells expressing RANKL and TNF-α compared with that observed in the diabetic rats treated with water. Additionally, green tea increased the numbers of cells that stained positive for OPG, RUNX-2 and IL-10 in the diabetic rats. Green tea intake reduces expression of the pro-inflammatory cytokine TNF-α and the osteoclastogenic mediator RANKL to normal levels while increasing expression of the anti

  16. Green Tea Modulates Cytokine Expression in the Periodontium and Attenuates Alveolar Bone Resorption in Type 1 Diabetic Rats

    PubMed Central

    Gennaro, Gabriela; Claudino, Marcela; Cestari, Tania Mary; Ceolin, Daniele; Germino, Patrícia; Garlet, Gustavo Pompermaier; de Assis, Gerson Francisco

    2015-01-01

    Diabetes mellitus comprises a heterogeneous group of disorders with the main feature of hyperglycemia. Chronic hyperglycemia increases the severity of periodontal disease via an exacerbated inflammatory response, activated by advanced glycation end products and their receptor, RAGE. Therefore, anti-inflammatory agents represent potential inhibitors of this pathological interaction. In particular, green tea has been shown to possess anti-inflammatory properties mediated by its polyphenol content. Objectives: This study investigated the mechanisms by which green tea attenuates the spontaneous onset of diabetes-induced periodontitis. Methods: Diabetes was induced in rats via a single intraperitoneal injection of streptozotocin (STZ). Diabetic and control animals were divided into water-treated and green tea-treated subgroups and were analyzed at 15, 30, 60 and 90 days after diabetes induction. Immunohistochemistry was performed to quantitatively evaluate tumor necrosis factor-α (TNF-α), receptor activator of nuclear factor kappa-B ligand (RANKL), osteoprotegerin (OPG), interleukin-10 (IL-10) and runt-related transcription factor 2 (RUNX-2) expression in serial sections of each hemimaxilla. Morphometric measurements of the distance from the cementum-enamel junction (CEJ) of the superior distal root of the first molar to the alveolar bone crest (ABC) were performed to assess bone loss. Results: Diabetes resulted in significant bone loss and alterations in the number of cells that stained positive for inflammatory mediators. In the diabetic rats treated with green tea, we observed a decreased number of cells expressing RANKL and TNF-α compared with that observed in the diabetic rats treated with water. Additionally, green tea increased the numbers of cells that stained positive for OPG, RUNX-2 and IL-10 in the diabetic rats. Conclusion: Green tea intake reduces expression of the pro-inflammatory cytokine TNF-α and the osteoclastogenic mediator RANKL to normal levels

  17. Attenuation of Hepatic Graft-versus-host Disease in Allogeneic Recipients of MyD88-deficient Donor Bone Marrow.

    PubMed

    Lim, Ji-Young; Lee, Young-Kwan; Lee, Sung-Eun; Ju, Ji-Min; Park, Gyeongsin; Choi, Eun Young; Min, Chang-Ki

    2015-06-01

    Acute graft-versus-host-disease (GVHD) is characterized by selective damage to the liver, the skin, and the gastrointestinal tract. Following allogeneic hematopoietic stem cell transplantation, donor bone marrow (BM) cells repopulate the immune system of the recipient. We previously demonstrated that the acute intestinal GVHD (iGVHD) mortality rate was higher in MyD88-deficient BM recipients than that in the control BM recipients. In the present study, the role of MyD88 (expressed by donor BM) in the pathophysiology of hepatic GVHD (hGVHD) was examined. Unlike iGVHD, transplantation with MyD88-deficient T-cell depleted (TCD) BM attenuated hGVHD severity and was associated with low infiltration of T cells into the liver of the recipients. Moreover, GVHD hosts, transplanted with MyD88-deficient TCD BM, exhibited markedly reduced expansion of CD11b(+)Gr-1(+) myeloid-derived suppressor cells (MDSC) in the liver. Adoptive injection of the MDSC from wild type mice, but not MyD88-deficient mice, enhanced hepatic T cell infiltration in the MyD88-deficient TCD BM recipients. Pre-treatment of BM donors with LPS increased MDSC levels in the liver of allogeneic wild type BM recipients. In conclusion, hGVHD and iGVHD may occur through various mechanisms based on the presence of MyD88 in the non-T cell compartment of the allograft.

  18. Unfractionated bone marrow cells attenuate paraquat-induced glomerular injury and acute renal failure by modulating the inflammatory response

    PubMed Central

    Gu, Sing-Yi; Yeh, Ti-Yen; Lin, Shih-Yi; Peng, Fu-Chuo

    2016-01-01

    The aim of this study was to evaluate the efficacy of unfractionated bone marrow cells (BMCs) in attenuating acute kidney injury (AKI) induced by paraquat (PQ) in a mouse model. PQ (55 mg/kg BW) was intraperitoneally injected into C57BL/6 female mice to induce AKI, including renal function failure, glomerular damage and renal tubule injury. Glomerular podocytes were the first target damaged by PQ, which led to glomerular injury. Upon immunofluorescence staining, podocytes depletion was validated and accompanied by increased urinary podocin levels, measured on days 1 and 6. A total of 5.4 × 106 BMCs obtained from the same strain of male mice were injected into AKI mice through the tail vein at 3, 24, and 48 hours after PQ administration. As a result, renal function increased, tubular and glomerular injury were ameliorated, podocytes loss improved, and recipient mortality decreased. In addition, BMCs co-treatment decreased the extent of neutrophil infiltration and modulated the inflammatory response by shifting from pro-inflammatory Th1 to an anti-inflammatory Th2 profile, where IL-1β, TNF-α, IL-6 and IFN-γ levels declined and IL-10 and IL-4 levels increased. The present study provides a platform to investigate PQ-induced AKI and repeated BMCs injection represents an efficient therapeutic strategy. PMID:26988026

  19. Attenuation of radiation-induced gastrointestinal damage by epidermal growth factor and bone marrow transplantation in mice.

    PubMed

    Pejchal, Jaroslav; Šinkorová, Zuzana; Tichý, Aleš; Kmochová, Adéla; Ďurišová, Kamila; Kubelková, Klára; Pohanka, Miroslav; Bureš, Jan; Tachecí, Ilja; Kuča, Kamil; Vávrová, Jiřina

    2015-01-01

    We examined the effect of epidermal growth factor (EGF) and bone marrow transplantation (BMT) on gastrointestinal damage after high-dose irradiation of mice. C57Black/6 mice were used. Two survival experiments were performed (12 and 13 Gy; (60)Co, 0.59-0.57 Gy/min). To evaluate BMT and EGF action, five groups were established - 0 Gy, 13 Gy, 13 Gy + EGF (at 2 mg/kg, first dose 24 h after irradiation and then every 48 h), 13 Gy + BMT (5 × 10(6) cells from green fluorescent protein [GFP] syngenic mice, 4 h after irradiation), and 13 Gy + BMT + EGF. Survival data, blood cell counts, gastrointestine and liver parameters and GFP positive cell migration were measured. BMT and EGF (three doses, at 2 mg/kg, administered 1, 3 and 5 days after irradiation) significantly increased survival (13 Gy). In blood, progressive cytopenia was observed with BMT, EGF or their combination having no improving effect early after irradiation. In gastrointestinal system, BMT, EGF and their combination attenuated radiation-induced atrophy and increased regeneration during first week after irradiation with the combination being most effective. Signs of systemic inflammatory reaction were observed 30 days after irradiation. Our data indicate that BMT together with EGF is a promising strategy in the treatment of high-dose whole-body irradiation damage.

  20. Bone-marrow-derived mesenchymal stem cells attenuate cognitive deficits in an endothelin-1 rat model of stroke.

    PubMed

    Lowrance, S A; Fink, K D; Crane, A; Matyas, J; Dey, N D; Matchynski, J J; Thibo, T; Reinke, T; Kippe, J; Hoffman, C; Sandstrom, M; Rossignol, J; Dunbar, G L

    2015-01-01

    Stroke is the third leading cause of death and permanent disability in the United States, often producing long-term cognitive impairments, which are not easily recapitulated in animal models. The goals of this study were to assess whether: (1) the endothelin-1 (ET-1) model of chronic stroke produced discernable cognitive deficits; (2) a spatial operant reversal task (SORT) would accurately measure memory deficits in this model; and (3) bone-marrow-derived mesenchymal stem cells (BMMSCs) could reduce any observed deficits. Rats were given unilateral intracerebral injections of vehicle or ET-1, a stroke-inducing agent, near the middle cerebral artery. Seven days later, they were given intrastriatal injections of BMMSCs or vehicle, near the ischemic penumbra. The cognitive abilities of the rats were assessed on a novel SORT, which was designed to efficiently distinguish cognitive deficits from potential motoric confounds. Rats given ET-1 had significantly more cognitive errors at six weeks post-stroke on the SORT, and that these deficits were attenuated by BMMSC transplants. These findings indicate that: (1) the ET-1 model produces chronic cognitive deficits; (2) the SORT efficiently measures cognitive deficits that are not confounded by motoric impairment; and (3) BMMSCs may be a viable treatment for stroke-induced cognitive dysfunction.

  1. Homocysteine and vitamin B12 status relate to bone turnover markers, broadband ultrasound attenuation, and fractures in healthy elderly people.

    PubMed

    Dhonukshe-Rutten, Rosalie A M; Pluijm, Saskia M F; de Groot, Lisette C P G M; Lips, Paul; Smit, Johannes H; van Staveren, Wija A

    2005-06-01

    Hyperhomocysteinemia may contribute to the development of osteoporosis. The relationship of Hcy and vitamin B12 with bone turnover markers, BUA, and fracture incidence was studied in 1267 subjects of the Longitudinal Aging Study Amsterdam. High Hcy and low vitamin B12 concentrations were significantly associated with low BUA, high markers of bone turnover, and increased fracture risk. Hyperhomocysteinemia may contribute to the development of osteoporosis. Vitamin B12 is closely correlated to homocysteine (Hcy). The main objective of our study was to examine the association of Hcy and vitamin B12 status and the combined effect of these two with broadband ultrasound attenuation (BUA), bone turnover markers, and fracture. Subjects were 615 men and 652 women with a mean age of 76 +/- 6.6 (SD) years of the Longitudinal Aging Study Amsterdam (LASA). At baseline (1995/1996), blood samples were taken after an overnight fast for dairy products. Plasma Hcy was measured with IMx, serum vitamin B12 with competitive immunoassay (IA) luminescence, serum osteocalcin (OC) with immunoradiometric assay (IRMA), and urinary excretion of deoxypyridinoline (DPD) with competitive IA and corrected for creatinine (Cr) concentration. CVs were 4%, 5%, 8%, and 5%, respectively. BUA was assessed in the heel bone twice in both the right and left calcaneus. Mean BUA value was calculated from these four measurements. CV was 3.4%. After baseline measurements in 1995, a 3-year prospective follow-up of fractures was carried out until 1998/1999. Subjects were grouped by using two different approaches on the basis of their vitamin B12 concentration, normal versus low (<200 pM) or lowest quartile (Q1) versus normal quartiles (Q2-Q4), and Hcy concentration, normal versus high (>15 microM) or highest quartile (Q4) versus normal quartiles (Q1-Q3). Analysis of covariance was performed to calculate mean values of BUA, OC, and DPD/Cr(urine) based on the specified categories of Hcy and vitamin B12 and

  2. [Administration of bone marrow mesenchymal stem cells attenuates inflammation of rats with sepsis].

    PubMed

    Hao, Yufang; Geng, Lixia

    2016-09-01

    Objective To investigate the therapeutic effects of bone marrow-derived mesenchymal stem cells (BMSCs) in rats with sepsis. Methods Forty-eight Wistar rats were divided into blank group, sham group, model group and treatment group. Sepsis model was made using cecum ligation and puncture (CLP). BMSCs were extracted and cultured to the third generation. The rats in the treatment group received BMSCs through a tail vein and the rats in the model group received an equivalent dose of PBS. The survival rate was recorded in each group 72 hours after operation. Pathological changes of lung tissues were observed by HE staining. The mRNA levels of interleukin 6 (IL-6), tumor necrosis factor alpha (TNF-α), fork head box protein 3 (Foxp3), CC chemokine ligand 2 (CCL2) were tested by quantitative real-time fluorescence PCR. The serum levels of IL-6, IL-17 and TNF-α proteins were detected by ELISA. Results In both blank group and sham group, the survival rate and histological changes of the lungs showed normal; no bacteria were found growing in rats' blood culture; IL-6, IL-17, TNF-α, CCL2, Foxp3 mRNA and IL-6, IL-17, TNF-α protein levels had no significant differences. In the model group, the survival rate of rats was obviously lower than that of the sham group; the pathological changes of the lungs were significant; any amount of enterobacteria were seen growing in rats' blood culture; IL-6, IL-17, TNF-α, CCL2 mRNA and protein expression levels were apparently higher than those of sham group, while Foxp3 mRNA expression level was obviously lower than that of sham group. In the treatment group, the survival rate was significantly higher than that of the model group; the pathological changes of the lung tissues were evidently eased; IL-6, IL-17, TNF-α, CCL2 mRNA and protein expression levels significantly decreased compared with the model group, while Foxp3 mRNA expression level significantly increased compared with the model group. Conclusion BMSCs injection increases the

  3. Correlation of signal attenuation-based quantitative magnetic resonance imaging with quantitative computed tomographic measurements of subchondral bone mineral density in metacarpophalangeal joints of horses.

    PubMed

    Olive, Julien; d'Anjou, Marc-André; Alexander, Kate; Beauchamp, Guy; Theoret, Christine L

    2010-04-01

    To evaluate the ability of signal attenuation-based quantitative magnetic resonance imaging (QMRI) to estimate subchondral bone mineral density (BMD) as assessed via quantitative computed tomography (QCT) in osteoarthritic joints of horses. 20 metacarpophalangeal joints from 10 horse cadavers. Magnetic resonance (MR) images (dorsal and transverse T1-weighted gradient recalled echo [GRE] and dorsal T2*-weighted GRE fast imaging employing steady-state acquisition [T2*-FIESTA]) and transverse single-slice computed tomographic (CT) images of the joints were acquired. Magnetic resonance signal intensity (SI) and CT attenuation were quantified in 6 regions of interest (ROIs) in the subchondral bone of third metacarpal condyles. Separate ROIs were established in the air close to the joint and used to generate corrected ratios and SIs. Computed tomographic attenuation was corrected by use of a calibration phantom to obtain a K(2)HPO(4)-equivalent density of bone. Correlations between QMRI performed with different MR imaging sequences and QCT measurements were evaluated. The intraobserver repeatability of ROI measurements was tested for each modality. Measurement repeatability was excellent for QCT (R(2) = 98.3%) and QMRI (R(2) = 98.8%). Transverse (R(2) = 77%) or dorsal (R(2) = 77%) T1-weighted GRE and QCT BMD measurements were negatively correlated, as were dorsal T2*-FIESTA and QCT (R(2) = 80%) measurements. Decreased bone SI during MR imaging linearly reflected increased BMD. Results of this ex vivo study suggested that signal attenuation-based QMRI was a reliable, clinically applicable method for indirect estimation of subchondral BMD in osteoarthritic metacarpophalangeal joints of horses.

  4. k-space sampling optimization for ultrashort TE imaging of cortical bone: Applications in radiation therapy planning and MR-based PET attenuation correction

    PubMed Central

    Hu, Lingzhi; Su, Kuan-Hao; Pereira, Gisele C.; Grover, Anu; Traughber, Bryan; Traughber, Melanie; Muzic, Raymond F.

    2014-01-01

    Purpose: The ultrashort echo-time (UTE) sequence is a promising MR pulse sequence for imaging cortical bone which is otherwise difficult to image using conventional MR sequences and also poses strong attenuation for photons in radiation therapy and PET imaging. The authors report here a systematic characterization of cortical bone signal decay and a scanning time optimization strategy for the UTE sequence through k-space undersampling, which can result in up to a 75% reduction in acquisition time. Using the undersampled UTE imaging sequence, the authors also attempted to quantitatively investigate the MR properties of cortical bone in healthy volunteers, thus demonstrating the feasibility of using such a technique for generating bone-enhanced images which can be used for radiation therapy planning and attenuation correction with PET/MR. Methods: An angularly undersampled, radially encoded UTE sequence was used for scanning the brains of healthy volunteers. Quantitative MR characterization of tissue properties, including water fraction and R2∗ = 1/T2∗, was performed by analyzing the UTE images acquired at multiple echo times. The impact of different sampling rates was evaluated through systematic comparison of the MR image quality, bone-enhanced image quality, image noise, water fraction, and R2∗ of cortical bone. Results: A reduced angular sampling rate of the UTE trajectory achieves acquisition durations in proportion to the sampling rate and in as short as 25% of the time required for full sampling using a standard Cartesian acquisition, while preserving unique MR contrast within the skull at the cost of a minimal increase in noise level. The R2∗ of human skull was measured as 0.2–0.3 ms−1 depending on the specific region, which is more than ten times greater than the R2∗ of soft tissue. The water fraction in human skull was measured to be 60%–80%, which is significantly less than the >90% water fraction in brain. High-quality, bone

  5. k-space sampling optimization for ultrashort TE imaging of cortical bone: Applications in radiation therapy planning and MR-based PET attenuation correction

    SciTech Connect

    Hu, Lingzhi E-mail: raymond.muzic@case.edu; Traughber, Melanie; Su, Kuan-Hao; Pereira, Gisele C.; Grover, Anu; Traughber, Bryan; Muzic, Raymond F. Jr. E-mail: raymond.muzic@case.edu

    2014-10-15

    Purpose: The ultrashort echo-time (UTE) sequence is a promising MR pulse sequence for imaging cortical bone which is otherwise difficult to image using conventional MR sequences and also poses strong attenuation for photons in radiation therapy and PET imaging. The authors report here a systematic characterization of cortical bone signal decay and a scanning time optimization strategy for the UTE sequence through k-space undersampling, which can result in up to a 75% reduction in acquisition time. Using the undersampled UTE imaging sequence, the authors also attempted to quantitatively investigate the MR properties of cortical bone in healthy volunteers, thus demonstrating the feasibility of using such a technique for generating bone-enhanced images which can be used for radiation therapy planning and attenuation correction with PET/MR. Methods: An angularly undersampled, radially encoded UTE sequence was used for scanning the brains of healthy volunteers. Quantitative MR characterization of tissue properties, including water fraction and R2{sup ∗} = 1/T2{sup ∗}, was performed by analyzing the UTE images acquired at multiple echo times. The impact of different sampling rates was evaluated through systematic comparison of the MR image quality, bone-enhanced image quality, image noise, water fraction, and R2{sup ∗} of cortical bone. Results: A reduced angular sampling rate of the UTE trajectory achieves acquisition durations in proportion to the sampling rate and in as short as 25% of the time required for full sampling using a standard Cartesian acquisition, while preserving unique MR contrast within the skull at the cost of a minimal increase in noise level. The R2{sup ∗} of human skull was measured as 0.2–0.3 ms{sup −1} depending on the specific region, which is more than ten times greater than the R2{sup ∗} of soft tissue. The water fraction in human skull was measured to be 60%–80%, which is significantly less than the >90% water fraction in

  6. MR-based attenuation correction for PET/MRI neurological studies with continuous-valued attenuation coefficients for bone through a conversion from R2* to CT-Hounsfield units.

    PubMed

    Juttukonda, Meher R; Mersereau, Bryant G; Chen, Yasheng; Su, Yi; Rubin, Brian G; Benzinger, Tammie L S; Lalush, David S; An, Hongyu

    2015-05-15

    MR-based correction for photon attenuation in PET/MRI remains challenging, particularly for neurological applications requiring quantitation of data. Existing methods are either not sufficiently accurate or are limited by the computation time required. The goal of this study was to develop an MR-based attenuation correction method that accurately separates bone tissue from air and provides continuous-valued attenuation coefficients for bone. PET/MRI and CT datasets were obtained from 98 subjects (mean age [±SD]: 66yrs [±9.8], 57 females) using an IRB-approved protocol and with informed consent. Subjects were injected with 352±29MBq of (18)F-Florbetapir tracer, and PET acquisitions were begun either immediately or 50min after injection. CT images of the head were acquired separately using a PET/CT system. Dual echo ultrashort echo-time (UTE) images and two-point Dixon images were acquired. Regions of air were segmented via a threshold of the voxel-wise multiplicative inverse of the UTE echo 1 image. Regions of bone were segmented via a threshold of the R2* image computed from the UTE echo 1 and UTE echo 2 images. Regions of fat and soft tissue were segmented using fat and water images decomposed from the Dixon images. Air, fat, and soft tissue were assigned linear attenuation coefficients (LACs) of 0, 0.092, and 0.1cm(-1), respectively. LACs for bone were derived from a regression analysis between corresponding R2* and CT values. PET images were reconstructed using the gold standard CT method and the proposed CAR-RiDR method. The RiDR segmentation method produces mean Dice coefficient±SD across subjects of 0.75±0.05 for bone and 0.60±0.08 for air. The CAR model for bone LACs greatly improves accuracy in estimating CT values (28.2%±3.0 mean error) compared to the use of a constant CT value (46.9%±5.8, p<10(-6)). Finally, the CAR-RiDR method provides a low whole-brain mean absolute percent-error (MAPE±SD) in PET reconstructions across subjects of 2.55%±0

  7. The blocking of uPAR suppresses lipopolysaccharide‐induced inflammatory osteoclastogenesis and the resultant bone loss through attenuation of integrin β3/Akt pathway

    PubMed Central

    Ishisaki, Akira; Miyashita, Mei; Matsuo, Osamu

    2016-01-01

    Abstract Introduction Chronic inflammatory diseases, such as rheumatoid arthritis and periodontitis, cause the bone destruction by promotion of the differentiation of monocyte/macrophage lineage cells into mature osteoclasts (OCs) with active bone‐resorbing character. However, the detailed mechanisms underlying this disorder remain unclear. We herein investigated the role of urokinase plasminogen activator receptor (uPAR) in the bone destruction caused by chronic inflammation. Methods We investigated that the effect of uPAR on inflammatory OC formation induced by lipopolysaccharide (LPS) in inflammatory diseases. Results We found that the LPS more weakly induced OC formation and the resultant bone loss in uPAR‐deficient mice than in wild‐type mice. Additionally, we demonstrated that uPAR significantly potentiated LPS‐induced OC formation of RAW264.7 mouse monocyte/macrophage linage cells in integrin β3/Akt‐dependent manner. Moreover, we showed that the blocking of uPAR function by the administration of anti‐uPAR neutralizing antibody significantly attenuated the LPS‐induced OC formation and the resultant bone loss in mice. Conclusions These results strongly suggest that uPAR negatively regulates the LPS‐induced inflammatory OC formation and the resultant bone loss mediated through the integrin β3/Akt pathway. Our findings partly clarify the molecular mechanisms underlying bone destruction caused by chronic inflammatory diseases, and would benefit research on identifying antibody therapy for the treatment of these diseases. PMID:27621816

  8. Mas-Related Gene (Mrg) C Activation Attenuates Bone Cancer Pain via Modulating Gi and NR2B.

    PubMed

    Sun, Yu'e; Jiang, Ming; Hou, Bailing; Lu, Cui'e; Lei, Yishan; Ma, Zhengliang; Gu, Xiaoping

    2016-01-01

    This study is to investigate the role of Mas-related gene (Mrg) C in the pathogenesis and treatment of bone cancer pain (BCP). BCP mouse model was established by osteosarcoma cell inoculation. Pain-related behaviors were assessed with the spontaneous lifting behavior test and mechanical allodynia test. Expression levels of MrgC, Gi, and NR2B in the spinal cord were detected with Western blot analysis and immunohistochemistry. Pain-related behavior tests showed significantly increased spontaneous flinches (NSF) and decreased paw withdrawal mechanical threshold (PWMT) in mouse models of BCP. Western blot analysis showed that, compared with the control group and before modeling, all the expression levels of MrgC, Gi, and NR2B in the spinal cord of BCP mice were dramatically elevated, which were especially increased at day 7 after operation and thereafter, in a time-dependent manner. Moreover, the treatment of MrgC agonist BAM8-22 significantly up-regulated Gi and down-regulated NR2B expression levels, in the spinal cord of BCP mice, in a time-dependent manner. On the other hand, anti-MrgC significantly down-regulated Gi expression, while dramatically up-regulated NR2B expression, in the BCP mice. Similar results were obtained from the immunohistochemical detection. Importantly, BAM8-22 significantly attenuated the nociceptive behaviors in the BCP mice. Our results indicated the MrgC-mediated Gi and NR2B expression alterations in the BCP mice, which might contribute to the pain hypersensitivity. These findings may provide a novel strategy for the treatment of BCP in clinic.

  9. Mas-Related Gene (Mrg) C Activation Attenuates Bone Cancer Pain via Modulating Gi and NR2B

    PubMed Central

    Lu, Cui’e; Lei, Yishan; Ma, Zhengliang; Gu, Xiaoping

    2016-01-01

    Objective This study is to investigate the role of Mas-related gene (Mrg) C in the pathogenesis and treatment of bone cancer pain (BCP). Methods BCP mouse model was established by osteosarcoma cell inoculation. Pain-related behaviors were assessed with the spontaneous lifting behavior test and mechanical allodynia test. Expression levels of MrgC, Gi, and NR2B in the spinal cord were detected with Western blot analysis and immunohistochemistry. Results Pain-related behavior tests showed significantly increased spontaneous flinches (NSF) and decreased paw withdrawal mechanical threshold (PWMT) in mouse models of BCP. Western blot analysis showed that, compared with the control group and before modeling, all the expression levels of MrgC, Gi, and NR2B in the spinal cord of BCP mice were dramatically elevated, which were especially increased at day 7 after operation and thereafter, in a time-dependent manner. Moreover, the treatment of MrgC agonist BAM8-22 significantly up-regulated Gi and down-regulated NR2B expression levels, in the spinal cord of BCP mice, in a time-dependent manner. On the other hand, anti-MrgC significantly down-regulated Gi expression, while dramatically up-regulated NR2B expression, in the BCP mice. Similar results were obtained from the immunohistochemical detection. Importantly, BAM8-22 significantly attenuated the nociceptive behaviors in the BCP mice. Conclusion Our results indicated the MrgC-mediated Gi and NR2B expression alterations in the BCP mice, which might contribute to the pain hypersensitivity. These findings may provide a novel strategy for the treatment of BCP in clinic. PMID:27152740

  10. MO-G-17A-03: MR-Based Cortical Bone Segmentation for PET Attenuation Correction with a Non-UTE 3D Fast GRE Sequence

    SciTech Connect

    Ai, H; Pan, T; Hwang, K

    2014-06-15

    Purpose: To determine the feasibility of identifying cortical bone on MR images with a short-TE 3D fast-GRE sequence for attenuation correction of PET data in PET/MR. Methods: A water-fat-bone phantom was constructed with two pieces of beef shank. MR scans were performed on a 3T MR scanner (GE Discovery™ MR750). A 3D GRE sequence was first employed to measure the level of residual signal in cortical bone (TE{sub 1}/TE{sub 2}/TE{sub 3}=2.2/4.4/6.6ms, TR=20ms, flip angle=25°). For cortical bone segmentation, a 3D fast-GRE sequence (TE/TR=0.7/1.9ms, acquisition voxel size=2.5×2.5×3mm{sup 3}) was implemented along with a 3D Dixon sequence (TE{sub 1}/TE{sub 2}/TR=1.2/2.3/4.0ms, acquisition voxel size=1.25×1.25×3mm{sup 3}) for water/fat imaging. Flip angle (10°), acquisition bandwidth (250kHz), FOV (480×480×144mm{sup 3}) and reconstructed voxel size (0.94×0.94×1.5mm{sup 3}) were kept the same for both sequences. Soft tissue and fat tissue were first segmented on the reconstructed water/fat image. A tissue mask was created by combining the segmented water/fat masks, which was then applied on the fast-GRE image (MRFGRE). A second mask was created to remove the Gibbs artifacts present in regions in close vicinity to the phantom. MRFGRE data was smoothed with a 3D anisotropic diffusion filter for noise reduction, after which cortical bone and air was separated using a threshold determined from the histogram. Results: There is signal in the cortical bone region in the 3D GRE images, indicating the possibility of separating cortical bone and air based on signal intensity from short-TE MR image. The acquisition time for the 3D fast-GRE sequence was 17s, which can be reduced to less than 10s with parallel imaging. The attenuation image created from water-fat-bone segmentation is visually similar compared to reference CT. Conclusion: Cortical bone and air can be separated based on intensity in MR image with a short-TE 3D fast-GRE sequence. Further research is required

  11. Synergistic attenuation of ovariectomy-induced bone loss by combined use of fish oil and 17β-oestradiol.

    PubMed

    Jin, Youri; Lee, Myoungsook; Park, Yongsoon

    2017-02-01

    Oestrogen and n-3 PUFA, especially EPA and DHA, have been reported to have beneficial effects on bone loss. Thus, the purpose of the present study was to investigate the synergistic bone-protective mechanism of combined treatments of EPA+DHA supplementation and oestrogen injection in ovariectomised rats. Rats were fed a modified American Institute of Nutrition-93G diet with 0 %, 1 % or 2 % n-3 PUFA (EPA+DHA) relative to the total energy intake for 12 weeks. Rats were surgically ovariectomised at week 8, and after a 1-week recovery period rats were injected with either 17β-oestradiol-3-benzoate (E2) or maize oil for the last 3 weeks. Combined use of n-3 PUFA and E2 synergistically increased femoral cortical bone volume, bone mineral content and the bone expression of runt-related transcription factor 2 (RUNX2), but decreased the bone expression of IL-1β. Both n-3 PUFA and E2 decreased the bone expressions of IL-7, TNF-α and PPAR-γ, and increased the bone expression of oestrogen receptor-α. n-3 PUFA in the presence of E2 and E2 alone significantly decreased the bone expressions of IL-1β and IL-6 and increased the bone expression of RUNX2. E2 significantly decreased the serum levels of bone turnover markers and the bone expression of receptor activator of NF-κB ligand, but decreased the bone expression of osteoprotegerin. The combined use of n-3 PUFA and E2 exerted synergistic bone-protective efficacy through up-regulation of RUNX2, an essential transcription factor for bone formation, as well as the suppression of bone-resorbing cytokine IL-1β.

  12. High-fat diet enhances and plasminogen activator inhibitor-1 deficiency attenuates bone loss in mice with Lewis Lung carcinoma

    USDA-ARS?s Scientific Manuscript database

    This study determined the effects of a high-fat diet and plasminogen activator inhibitor-1 deficiency (PAI-1-/-) on bone structure in mice bearing Lewis lung carcinoma (LLC) in lungs. Reduction in bone volume fraction (BV/TV) by 22% and 21%, trabecular number (Tb.N) by 8% and 4% and bone mineral de...

  13. Bone

    NASA Astrophysics Data System (ADS)

    Helmberger, Thomas K.; Hoffmann, Ralf-Thorsten

    The typical clinical signs in bone tumours are pain, destruction and destabilization, immobilization, neurologic deficits, and finally functional impairment. Primary malignant bone tumours are a rare entity, accounting for about 0.2% of all malignancies. Also benign primary bone tumours are in total rare and mostly asymptomatic. The most common symptomatic benign bone tumour is osteoid osteoma with an incidence of 1:2000.

  14. Decibel attenuation of pulsed electromagnetic field (PEMF) in blood and cortical bone determined experimentally and from the theory of ohmic losses.

    PubMed

    Zborowski, Maciej; Kligman, Boris; Midura, Ronald J; Wolfman, Alan; Patterson, Thomas E; Ibiwoye, Michael; Grabiner, Mark

    2006-06-01

    We studied the PEMF power attenuation in tissues representative of clinical applications (blood and cortical bone) to determine the amount of power available for PEMF purported biological effects. The experimental system consisted of a pair of nearly circular, parallel and coaxial coils separated by a distance of one coil diameter. The power attenuation was measured using a small search coil connected to a digital oscilloscope. The coils were powered by a voltage switch operating at two different frequencies (3.8 and 63 kHz) producing bursts of pulses (numbering 21 and 1619) and triggered at two different frequencies (1.5 and 15 Hz, respectively). The tissue samples were placed inside the coils so as to expose them to either transverse electric field (at the center of coils) or the transverse magnetic field (at the coil wire). The cylindrical coil geometry yielded closed-form expressions for power attenuation based on magnetic diffusion equation and ohmic losses due to bulk tissue magnetic permeability and electrical conductivity. The measured power attenuation at these PEMF frequencies of not more than one decibel (1 dB) was well explained by the theory for the 3.8 kHz but less so for the 63 kHz frequency PEMF. The results provide important insights regarding physical mechanism of weak PEMF power dissipation in tissues.

  15. Is calcaneal broadband ultrasound attenuation a valid index of dual-energy x-ray absorptiometry-derived bone mass in children?

    PubMed Central

    Hirsch, R.; Nogueira, R. C.; Beck, B. R.

    2016-01-01

    Objectives The aim of the current study was to assess whether calcaneal broadband ultrasound attenuation (BUA) can predict whole body and regional dual-energy x-ray absorptiometry (DXA)-derived bone mass in healthy, Australian children and adolescents at different stages of maturity. Methods A total of 389 boys and girls across a wide age range (four to 18 years) volunteered to participate. The estimated age of peak height velocity (APHV) was used to classify children into pre-, peri-, and post-APHV groups. BUA was measured at the non-dominant heel with quantitative ultrasonometry (QUS) (Lunar Achilles Insight, GE), while bone mineral density (BMD) and bone mineral content (BMC) were examined at the femoral neck, lumbar spine and whole body (DXA, XR-800, Norland). Associations between BUA and DXA-derived measures were examined with Pearson correlations and linear regression. Participants were additionally ranked in quartiles for QUS and DXA measures in order to determine agreement in rankings. Results For the whole sample, BUA predicted 29% of the study population variance in whole body BMC and BMD, 23% to 24% of the study population variance in lumbar spine BMC and BMD, and 21% to 24% of the variance in femoral neck BMC and BMD (p < 0.001). BUA predictions were strongest for the most mature participants (pre-APHV R2 = 0.03 to 0.19; peri-APHV R2 = 0.05 to 0.17; post-APHV R2 = 0.18 to 0.28) and marginally stronger for girls (R2 = 0.25-0.32, p < 0.001) than for boys (R2 = 0.21-0.27, p < 0.001). Agreement in quartile rankings between QUS and DXA measures of bone mass was generally poor (27.3% to 38.2%). Conclusion Calcaneal BUA has a weak to moderate relationship with DXA measurements of bone mass in children, and has a tendency to misclassify children on the basis of quartile rankings. Cite this article: B. K. Weeks, R. Hirsch, R. C. Nogueira, B. R. Beck. Is calcaneal broadband ultrasound attenuation a valid index of dual-energy x-ray absorptiometry-derived bone mass

  16. Genistein suppresses Prevotella intermedia lipopolysaccharide-induced inflammatory response in macrophages and attenuates alveolar bone loss in ligature-induced periodontitis.

    PubMed

    Choi, Eun-Young; Bae, Seung Han; Ha, Min Hee; Choe, So-Hui; Hyeon, Jin-Yi; Choi, Jeom-Il; Choi, In Soon; Kim, Sung-Jo

    2016-02-01

    Genistein is a major isoflavone subclass of flavonoids found in soybean and a potent tyrosine kinase inhibitor. The present study aimed to assess the effect of genistein on the production of proinflammatory mediators in murine macrophages stimulated with lipopolysaccharide (LPS) isolated from Prevotella intermedia, a pathogen associated with different forms of periodontal disease, and to evaluate its possible influence on alveolar bone loss in ligature-induced periodontitis using micro-computed tomography (micro-CT) analysis as well. LPS was isolated from P. intermedia ATCC 25611 by using the standard hot phenol-water method. Culture supernatants were analyzed for nitric oxide (NO) and interleukin-6 (IL-6). Inducible NO synthase (iNOS) protein expression was evaluated by immunoblot analysis. Real-time PCR was carried out to measure iNOS and IL-6 mRNA expression. In addition, effect of genistein on alveolar bone loss was evaluated in a rat model of experimental periodontitis using micro-CT analysis. Genistein significantly attenuated P. intermedia LPS-induced production of iNOS-derived NO and IL-6 with attendant decrease in their mRNA expression in RAW264.7 cells. In addition, when genistein was administered to rats, decreases in alveolar bone height and bone volume fraction induced by ligature placement were significantly inhibited. Genistein administration also prevented ligature-induced alterations in the microstructural parameters of trabecular bone, including trabecular thickness, trabecular separation, bone mineral density and structure model index. While additional studies are required, we suggest that genistein could be utilized for the therapy of human periodontitis in the future. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. The inhibitor of calcium/calmodulin-dependent protein kinase II KN93 attenuates bone cancer pain via inhibition of KIF17/NR2B trafficking in mice.

    PubMed

    Liu, Yue; Liang, Ying; Hou, Bailing; Liu, Ming; Yang, Xuli; Liu, Chenglong; Zhang, Juan; Zhang, Wei; Ma, Zhengliang; Gu, Xiaoping

    2014-09-01

    The N-methyl-d-aspartate receptor (NMDAR) containing subunit 2B (NR2B) is critical for the regulation of nociception in bone cancer pain, although the precise molecular mechanisms remain unclear. KIF17, a kinesin motor, plays a key role in the dendritic transport of NR2B. The up-regulation of NR2B and KIF17 transcription results from an increase in phosphorylated cAMP-response element-binding protein (CREB), which is activated by calcium/calmodulin-dependent protein kinase II (CaMKII). In this study, we hypothesized that CaMKII-mediated KIF17/NR2B trafficking may contribute to bone cancer pain. Osteosarcoma cells were implanted into the intramedullary space of the right femurs of C3H/HeJ mice to induce progressive bone cancer-related pain behaviors. The expression of spinal t-CaMKII, p-CaMKII, NR2B and KIF17 after inoculation was also evaluated. These results showed that inoculation of osteosarcoma cells induced progressive bone cancer pain and resulted in a significant up-regulation of p-CaMKII, NR2B and KIF17 expression after inoculation. Intrathecal administration of KN93, a CaMKII inhibitor, down-regulated these three proteins and attenuated bone cancer pain in a dose- and time-dependent manner. These findings indicated that CaMKII-mediated KIF17/NR2B trafficking may contribute to bone cancer pain, and inhibition of CaMKII may be a useful alternative or adjunct therapy for relieving cancer pain.

  18. Increased circulating estradiol in mice fed a high-fat diet does not attenuate ovariectomy-induced bone structural deterioration

    USDA-ARS?s Scientific Manuscript database

    Ovariectomy-induced estrogen deficiency increases adiposity and induces substantial bone loss by increasing osteoclast activity. This study investigated whether obesity induced by a high-fat diet alter circulating estradiol levels, mitigates or exacerbates bone structure deterioration, and changes m...

  19. High fat diet attenuates hyperglycemia, body composition changes, and bone loss in male streptozotocin-induced type 1 diabetic mice.

    PubMed

    Carvalho, Adriana Lelis; DeMambro, Victoria E; Guntur, Anyonya R; Le, Phuong; Nagano, Kenichi; Baron, Roland; de Paula, Francisco José Albuquerque; Motyl, Katherine J

    2017-06-20

    There is a growing and alarming prevalence of obesity and the metabolic syndrome in type I diabetic patients (T1DM), particularly in adolescence. In general, low bone mass, higher fracture risk, and increased marrow adipose tissue (MAT) are features of diabetic osteopathy in insulin-deficient subjects. On the other hand, type 2 diabetes (T2DM) is associated with normal or high bone mass, a greater risk of peripheral fractures, and no change in MAT. Therefore, we sought to determine the effect of weight gain on bone turnover in insulin-deficient mice. We evaluated the impact of a 6-week high-fat (HFD) rich in medium chain fatty acids or low-fat diet (LFD) on bone mass and MAT in a streptozotocin (STZ)-induced model using male C57BL/6J mice at 8 weeks of age. Dietary intervention was initiated after diabetes confirmation. At the endpoint, lower non-fasting glucose levels were observed in diabetic mice fed with high fat diet compared to diabetic mice fed the low fat diet (STZ-LFD). Compared to euglycemic controls, the STZ-LFD had marked polydipsia and polyphagia, as well as reduced lean mass, fat mass, and bone parameters. Interestingly, STZ-HFD mice had higher bone mass, namely less cortical bone loss and more trabecular bone than STZ-LFD. Thus, we found that a HFD, rich in medium chain fatty acids, protects against bone loss in a T1DM mouse model. Whether this may also translate to T1DM patients who are overweight or obese in respect to maintenance of bone mass remains to be determined through longitudinal studies. © 2017 Wiley Periodicals, Inc.

  20. Dried Plum Protects From Radiation-Induced Bone Loss by Attenuating Pro-Osteoclastic and Oxidative Stress Responses

    NASA Technical Reports Server (NTRS)

    Globus, Ruth

    2015-01-01

    Future space explorations beyond the earths magnetosphere will increase human exposure to space radiation and associated risks to skeletal health. We hypothesize that oxidative stress resulting from radiation exposure plays a major role in progressive bone loss and dysfunction in associated tissue. In animal studies, increased free radical formation is associated with pathological changes in bone structure, enhanced bone resorption, reduced bone formation and decreased bone mineral density, which can lead to skeletal fragility. Our long-term goals are to define the mechanisms and risk of bone loss in the spaceflight environment and to facilitate the development of effective countermeasures. We had previously reported that exposure to low or high-LET radiation correlates with an acute increase in the expression of pro-osteoclastic and oxidative stress genes in bone during the early response to radiation followed by pathological changes in skeletal structure. We then conducted systematic screening for potential countermeasures against bone loss where we tested the ability of various antioxidants to mitigate the radiation-induced increase in expression of these markers. For the screen, 16-week old C57Bl6J mice were treated with a dietary antioxidant cocktail, injectable DHLA or a dried plum-enriched diet (DP). Mice were then exposed to 2Gy 137Cs radiation and one day later, marrow cells were collected and the relevant genes analyzed for expression levels. Among the candidate countermeasures tested, DP was most effective in reducing the expression of genes associated with bone loss. Furthermore, analysis of skeletal structure by microcomputed tomography (microCT) revealed that DP also prevents the radiation-induced deterioration in skeletal microarchitecture as indicated by parameters such as percent bone volume (BVTV), trabecular spacing and trabecular number. We also found that DP has similar protective effects on skeletal structure in a follow-up study using 1 Gy of

  1. Attenuated Wnt/β-catenin signalling mediates methotrexate chemotherapy-induced bone loss and marrow adiposity in rats.

    PubMed

    Georgiou, Kristen R; King, Tristan J; Scherer, Michaela A; Zhou, Hong; Foster, Bruce K; Xian, Cory J

    2012-06-01

    Cancer chemotherapy often causes significant bone loss, marrow adiposity and haematopoietic defects, yet the underlying mechanisms and recovery potential remain unclear. Wnt/β-catenin signalling is integral to the regulation of osteogenesis, adipogenesis and haematopoiesis; using a rat model, the current study investigated roles of this signalling pathway in changes to bone marrow stromal and haematopoietic cell differentiation after chemotherapy with methotrexate (MTX), a commonly used antimetabolite. MTX treatment in rats (5 daily administrations at 0.75 mg/kg) has previously been found to decrease bone volume and increase marrow fat, which was associated with increased osteoclastogenesis in haematopoietic cells and with an osteogenesis to adipogenesis switch in bone marrow stromal cells of treated rats. In the current study, on day 6 after the first MTX dose we found that accompanying these changes as well as a suppressed haematopoietic cellularity but increased granulocyte/macrophage differentiation potential, there was an increase in mRNA expression of Wnt antagonists sFRP-1 and Dkk-1 in bone, a reduction in nuclear β-catenin protein in bone marrow stromal cells, and decreased mRNA levels of β-catenin target genes lef-1, cyclin D1 and survivin, suggesting reduced activation of Wnt/β-catenin signalling in the bone during MTX-induced damage. Concurrent administration of BIO, a GSK-3β inhibitor that stabilises β-catenin, partially abrogated the MTX-induced transient changes in osteogenic/adipogenic commitment, granulocyte/macrophage lineage differentiation and osteoclast number. These findings demonstrate a potentially important role of Wnt/β-catenin signalling in MTX chemotherapy-induced cellular changes to the bone marrow microenvironment.

  2. Isopsoralen-mediated suppression of bone marrow adiposity and attenuation of the adipogenic commitment of bone marrow-derived mesenchymal stem cells

    PubMed Central

    Wang, Jian; Li, Sheng-Fa; Wang, Ting; Sun, Chun-Han; Wang, Liang; Huang, Min-Jun; Chen, Jian; Zheng, Shao-Wei; Wang, Nan; Zhang, Ying-Jun; Chen, Tian-Yu

    2017-01-01

    Osteoporosis (OP) increases the risk of bone fractures and other complications, and is thus a major clinical problem. In this study, we examined the effect of isopsoralen on the differentiation of bone-derived marrow mesenchymal stem cells (BMSCs) into osteoblasts and adipocytes, as well as bone formation under osteoporotic conditions. Primary femoral BMSCs isolated from C57BL/6 mice were used to evaluate the isopsoralen-mediated regulation of the expression of alkaline phosphatase (ALP), osteocalcin (OCN) and runt-related transcription factor 2 (RUNX2) during osteogenesis 2 weeks. We also examined the expression of peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein β (C/EBPβ) under adipogenic conditions for 1 and 2 weeks. In addition, ovariectomized (OVX) mice were used to examine the effects of isopsoralen on bone formation for 2 months. Finally, mammalian target of rapamycin complex 1 (mTORC1) signaling was examined under osteogenic and adipogenic conditions. We found that following treatment with isopsoralen, the expression levels of ALP, OCN and RUNX2 were upregulated, whereas those of PPARγ and C/EBPβ were downregulated. mTORC1 signaling was also inhibited in vitro and in vivo. In the OVX mice that were intragastrically administered isopsoralen, bone parameters (trabecular thickness, bone volume/total volume and trabecular number) in the distal femoral metaphysis were significantly increased and the adipocyte number was decreased. On the whole, our findings demonstrate that isopsoralen promoted BMSC differentiation into osteoblasts and suppressed differentiation into adipocytes. PMID:28204811

  3. Isopsoralen-mediated suppression of bone marrow adiposity and attenuation of the adipogenic commitment of bone marrow-derived mesenchymal stem cells.

    PubMed

    Wang, Jian; Li, Sheng-Fa; Wang, Ting; Sun, Chun-Han; Wang, Liang; Huang, Min-Jun; Chen, Jian; Zheng, Shao-Wei; Wang, Nan; Zhang, Ying-Jun; Chen, Tian-Yu

    2017-03-01

    Osteoporosis (OP) increases the risk of bone fractures and other complications, and is thus a major clinical problem. In this study, we examined the effect of isopsoralen on the differentiation of bone-derived marrow mesenchymal stem cells (BMSCs) into osteoblasts and adipocytes, as well as bone formation under osteoporotic conditions. Primary femoral BMSCs isolated from C57BL/6 mice were used to evaluate the isopsoralen-mediated regulation of the expression of alkaline phosphatase (ALP), osteocalcin (OCN) and runt-related transcription factor 2 (RUNX2) during osteogenesis 2 weeks. We also examined the expression of peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein β (C/EBPβ) under adipogenic conditions for 1 and 2 weeks. In addition, ovariectomized (OVX) mice were used to examine the effects of isopsoralen on bone formation for 2 months. Finally, mammalian target of rapamycin complex 1 (mTORC1) signaling was examined under osteogenic and adipogenic conditions. We found that following treatment with isopsoralen, the expression levels of ALP, OCN and RUNX2 were upregulated, whereas those of PPARγ and C/EBPβ were downregulated. mTORC1 signaling was also inhibited in vitro and in vivo. In the OVX mice that were intragastrically administered isopsoralen, bone parameters (trabecular thickness, bone volume/total volume and trabecular number) in the distal femoral metaphysis were significantly increased and the adipocyte number was decreased. On the whole, our findings demonstrate that isopsoralen promoted BMSC differentiation into osteoblasts and suppressed differentiation into adipocytes.

  4. Anti-Osteoclastic Activity of Artemisia capillaris Thunb. Extract Depends upon Attenuation of Osteoclast Differentiation and Bone Resorption-Associated Acidification Due to Chlorogenic Acid, Hyperoside, and Scoparone

    PubMed Central

    Lee, Sang-Hyun; Lee, Jung-Yun; Kwon, Young-In; Jang, Hae-Dong

    2017-01-01

    The present study attempts to elucidate the anti-osteoporotic activity of Artemisia capillaris Thunb. in the form of anti-osteoclastic effect and responsible bioactive compounds. The contents of chlorogenic acid, caffeic acid, hyperoside, isoquercitrin, isochlorogenic acid A, and scoparone in Artemisia capillaris hydroethanolic extract (ACHE) were 38.53, 0.52, 4.07, 3.03, 13.90, and 6.59 mg/g, respectively. ACHE diminished osteoclast differentiation and bone resorption due to chlorogenic acid, hyperoside, and scoparone. In addition, ACHE attenuated acidification as well as reducing tumor necrosis factor receptor-associated factor 6 (TRAF6) expression and its association with vacuolar H+-adenosine triphosphatase (V-ATPase). Furthermore, chlorogenic acid, hyperoside, and scoparone from A. capillaris abrogated the association of V-ATPase with TRAF6, suggesting that the blockage of bone resorption by A. capillaris was partially mediated by reducing acidification through down-regulating interaction of V-ATPase with TRAF6 due to scoparone as well as chlorogenic acid and hyperoside. These results imply that the anti-osteoclastic effect of A. capillaris through down-regulating osteoclast differentiation and bone resorption may contribute to its anti-osteoporotic effect. PMID:28165389

  5. Anti-Osteoclastic Activity of Artemisia capillaris Thunb. Extract Depends upon Attenuation of Osteoclast Differentiation and Bone Resorption-Associated Acidification Due to Chlorogenic Acid, Hyperoside, and Scoparone.

    PubMed

    Lee, Sang-Hyun; Lee, Jung-Yun; Kwon, Young-In; Jang, Hae-Dong

    2017-02-04

    The present study attempts to elucidate the anti-osteoporotic activity of Artemisia capillaris Thunb. in the form of anti-osteoclastic effect and responsible bioactive compounds. The contents of chlorogenic acid, caffeic acid, hyperoside, isoquercitrin, isochlorogenic acid A, and scoparone in Artemisia capillaris hydroethanolic extract (ACHE) were 38.53, 0.52, 4.07, 3.03, 13.90, and 6.59 mg/g, respectively. ACHE diminished osteoclast differentiation and bone resorption due to chlorogenic acid, hyperoside, and scoparone. In addition, ACHE attenuated acidification as well as reducing tumor necrosis factor receptor-associated factor 6 (TRAF6) expression and its association with vacuolar H⁺-adenosine triphosphatase (V-ATPase). Furthermore, chlorogenic acid, hyperoside, and scoparone from A. capillaris abrogated the association of V-ATPase with TRAF6, suggesting that the blockage of bone resorption by A. capillaris was partially mediated by reducing acidification through down-regulating interaction of V-ATPase with TRAF6 due to scoparone as well as chlorogenic acid and hyperoside. These results imply that the anti-osteoclastic effect of A. capillaris through down-regulating osteoclast differentiation and bone resorption may contribute to its anti-osteoporotic effect.

  6. Heme oxygenase-1 attenuates acute pulmonary inflammation by decreasing the release of segmented neutrophils from the bone marrow.

    PubMed

    Konrad, Franziska M; Braun, Stefan; Ngamsri, Kristian-Christos; Vollmer, Irene; Reutershan, Jörg

    2014-11-01

    Recruiting polymorphonuclear neutrophil granulocytes (PMNs) from circulation and bone marrow to the site of inflammation is one of the pivotal mechanisms of the innate immune system. During inflammation, the enzyme heme oxygenase 1 (HO-1) has been shown to reduce PMN migration. Although these effects have been described in various models, underlying mechanisms remain elusive. Recent studies revealed an influence of HO-1 on different cells of the bone marrow. We investigated the particular role of the bone marrow in terms of HO-1-dependent pulmonary inflammation. In a murine model of LPS inhalation, stimulation of HO-1 by cobalt (III) protoporphyrin-IX-chloride (CoPP) resulted in reduced segmented PMN migration into the alveolar space. In the CoPP group, segmented PMNs were also decreased intravascularly, and concordantly, mature and immature PMN populations were higher in the bone marrow. Inhibition of the enzyme by tin protoporphyrin-IX increased segmented and banded PMN migration into the bronchoalveolar lavage fluid with enhanced PMN release from the bone marrow and aggravated parameters of tissue inflammation. Oxidative burst activity was significantly higher in immature compared with mature PMNs. The chemokine stromal-derived factor-1 (SDF-1), which mediates homing of leukocytes into the bone marrow and is decreased in inflammation, was increased by CoPP. When SDF-1 was blocked by the specific antagonist AMD3100, HO-1 activation was no longer effective in curbing PMN trafficking to the inflamed lungs. In conclusion, we show evidence that the anti-inflammatory effects of HO-1 are largely mediated by inhibiting the release of segmented PMNs from the bone marrow rather than direct effects within the lung.

  7. A calcium-collagen chelate dietary supplement attenuates bone loss in postmenopausal women with osteopenia: a randomized controlled trial.

    PubMed

    Elam, Marcus L; Johnson, Sarah A; Hooshmand, Shirin; Feresin, Rafaela G; Payton, Mark E; Gu, Jennifer; Arjmandi, Bahram H

    2015-03-01

    Menopause leads to an increased risk for osteoporosis in women. Although drug therapies exist, increasing numbers of people prefer alternative therapies such as dietary supplements, for example, calcium, vitamin D, and collagen hydrolysates for the prevention and treatment of osteoporosis. We have previously shown that a 3-month intervention using a calcium-collagen chelate (CC) dietary supplement was efficacious in improving bone mineral density (BMD) and blood biomarkers of bone turnover in osteopenic postmenopausal women. This study reports the long-term efficacy of CC in reducing bone loss in postmenopausal women with osteopenia. Thirty-nine women were randomly assigned to one of two groups: 5 g of CC containing 500 mg of elemental calcium and 200 IU vitamin D (1,25-dihydroxyvitamin D3) or control (500 mg of calcium and 200 IU vitamin D) daily for 12 months. Total body, lumbar, and hip BMD were evaluated at baseline, 6 and 12 months using dual-energy X-ray absorptiometry. Blood was collected at baseline, 6 and 12 months to assess levels of blood biomarkers of bone turnover. Intent-to-treat (ITT) analysis was performed using repeated measures analysis of variance pairwise comparisons and multivariate analysis to assess time and group interactions. The loss of whole body BMD in women taking CC was substantially lower than that of the control group at 12 months in those who completed the study and the ITT analysis, respectively (CC: -1.33% and -0.33% vs. control: -3.75% and -2.17%; P=.026, P=.035). The CC group had significantly reduced levels of sclerostin and tartrate-resistant acid phosphatase isoform 5b (TRAP5b) (P<.05), and higher bone-specific alkaline phosphatase/TRAP5b ratio (P<.05) than control at 6 months. These results support the use of CC in reducing bone loss in osteopenic postmenopausal women.

  8. Dietary magnesium and potassium intakes and circulating magnesium are associated with heel bone ultrasound attenuation and osteoporotic fracture risk in the EPIC-Norfolk cohort study.

    PubMed

    Hayhoe, Richard P G; Lentjes, Marleen A H; Luben, Robert N; Khaw, Kay-Tee; Welch, Ailsa A

    2015-08-01

    In our aging population, maintenance of bone health is critical to reduce the risk of osteoporosis and potentially debilitating consequences of fractures in older individuals. Among modifiable lifestyle and dietary factors, dietary magnesium and potassium intakes are postulated to influence bone quality and osteoporosis, principally via calcium-dependent alteration of bone structure and turnover. We investigated the influence of dietary magnesium and potassium intakes, as well as circulating magnesium, on bone density status and fracture risk in an adult population in the United Kingdom. A random subset of 4000 individuals from the European Prospective Investigation into Cancer and Nutrition-Norfolk cohort of 25,639 men and women with baseline data was used for bone density cross-sectional analyses and combined with fracture cases (n = 1502) for fracture case-cohort longitudinal analyses (mean follow-up 13.4 y). Relevant biological, lifestyle, and dietary covariates were used in multivariate regression analyses to determine associations between dietary magnesium and potassium intakes and calcaneal broadband ultrasound attenuation (BUA), as well as in Prentice-weighted Cox regression to determine associated risk of fracture. Separate analyses, excluding dietary covariates, investigated associations of BUA and fractures with serum magnesium concentration. Statistically significant positive trends in calcaneal BUA for women (n = 1360) but not men (n = 968) were apparent across increasing quintiles of magnesium plus potassium (Mg+K) z score intake (P = 0.03) or potassium intake alone (P = 0.04). Reduced hip fracture risk in both men (n = 1958) and women (n = 2755) was evident for individuals in specific Mg+K z score intake quintiles compared with the lowest. Statistically significant trends in fracture risk in men across serum magnesium concentration groups were apparent for spine fractures (P = 0.02) and total hip, spine, and wrist fractures (P = 0.02). None of these

  9. Glycinol Enhances Osteogenic Differentiation and Attenuates the Effects of Aging on Bone Marrow-derived Mesenchymal Stem Cells

    USDA-ARS?s Scientific Manuscript database

    Osteoporosis is characterized by decreased bone mineral density and increased risk of fractures. It is most prevalent in the elderly population, leading to significant morbidity and mortality. Recently, phytoestrogens have gained significant attention as an alternative therapy due to their structura...

  10. Norisoboldine, an Anti-Arthritis Alkaloid Isolated from Radix Linderae, Attenuates Osteoclast Differentiation and Inflammatory Bone Erosion in an Aryl Hydrocarbon Receptor-Dependent Manner.

    PubMed

    Wei, Zhi-feng; Lv, Qi; Xia, Ying; Yue, Meng-fan; Shi, Can; Xia, Yu-feng; Chou, Gui-xin; Wang, Zheng-tao; Dai, Yue

    2015-01-01

    Norisoboldine (NOR), the primary isoquinoline alkaloid constituent of the root of Lindera aggregata, has previously been demonstrated to attenuate osteoclast (OC) differentiation. Accumulative evidence has shown that aryl hydrocarbon receptor (AhR) plays an important role in regulating the differentiation of various cells, and multiple isoquinoline alkaloids can modulate AhR. In the present study, we explored the role of NOR in the AhR signaling pathway. These data showed that the combination of AhR antagonist resveratrol (Res) or α-naphthoflavone (α-NF) nearly reversed the inhibition of OC differentiation through NOR. NOR could stably bind to AhR, up-regulate the nuclear translocation of AhR, and enhance the accumulation of the AhR-ARNT complex, AhR-mediated reporter gene activity and CYP1A1 expression in RAW 264.7 cells, suggesting that NOR might be an agonist of AhR. Moreover, NOR inhibited the nuclear translocation of NF-κB-p65, resulting in the evident accumulation of the AhR-NF-κB-p65 complex, which could be markedly inhibited through either Res or α-NF. Although NOR only slightly affected the expression of HIF-1α, NOR markedly reduced VEGF mRNA expression and ARNT-HIF-1α complex accumulation. In vivo studies indicated that NOR decreased the number of OCs and ameliorated the bone erosion in the joints of rats with collagen-induced arthritis, accompanied by the up-regulation of CYP1A1 and the down-regulation of VEGF mRNA expression in the synovium of rats. A combination of α-NF nearly completely reversed the effects of NOR. In conclusion, NOR attenuated OC differentiation and bone erosion through the activation of AhR and the subsequent inhibition of both NF-κB and HIF pathways.

  11. Bone marrow mesenchymal stem cells attenuate 2,5-hexanedione-induced neuronal apoptosis through a NGF/AKT-dependent pathway.

    PubMed

    Wang, Qingshan; Sun, Guohua; Gao, Chenxue; Feng, Lina; Zhang, Yan; Hao, Jie; Zuo, Enjun; Zhang, Cong; Li, Shuangyue; Piao, Fengyuan

    2016-10-05

    Growing evidence suggests that the increased neuronal apoptosis is involved in n-hexane-induced neuropathy. We have recently reported that bone marrow-mesenchymal stem cells-derived conditioned medium (BMSC-CM) attenuated 2,5-hexanedione (HD, the active metabolite of n-hexane)-induced apoptosis in PC12 cells. Here, we explored the anti-apoptotic efficacy of BMSC in vivo. HD-treated rats received BMSC by tail vein injection 5 weeks after HD intoxication. We found that in grafted rats, BMSC significantly attenuated HD-induced neuronal apoptosis in the spinal cord, which was associated with elevation of nerve growth factor (NGF). Neutralization of NGF in BMSC-CM blocked the protection against HD-induced apoptosis in VSC4.1 cells, suggesting that NGF is essential for BMSC-afforded anti-apoptosis. Mechanistically, we found that the decreased activation of Akt induced by HD was significantly recovered in the spinal cord by BMSC and in VSC4.1 cells by BMSC-CM in a TrkA-dependent manner, leading to dissociation of Bad/Bcl-xL complex in mitochondria and release of anti-apoptotic Bcl-xL. The importance of Akt was further corroborated by showing the reduced anti-apoptotic potency of BMSC in HD-intoxicated VSC4.1 cells in the presence of Akt inhibitor, MK-2206. Thus, our findings show that BMSC attenuated HD-induced neuronal apoptosis in vivo through a NGF/Akt-dependent manner, providing a novel solution against n-hexane-induced neurotoxicity.

  12. Bone marrow mesenchymal stem cells attenuate 2,5-hexanedione-induced neuronal apoptosis through a NGF/AKT-dependent pathway

    PubMed Central

    Wang, Qingshan; Sun, Guohua; Gao, Chenxue; Feng, Lina; Zhang, Yan; Hao, Jie; Zuo, Enjun; Zhang, Cong; Li, Shuangyue; Piao, Fengyuan

    2016-01-01

    Growing evidence suggests that the increased neuronal apoptosis is involved in n-hexane-induced neuropathy. We have recently reported that bone marrow-mesenchymal stem cells-derived conditioned medium (BMSC-CM) attenuated 2,5-hexanedione (HD, the active metabolite of n-hexane)-induced apoptosis in PC12 cells. Here, we explored the anti-apoptotic efficacy of BMSC in vivo. HD-treated rats received BMSC by tail vein injection 5 weeks after HD intoxication. We found that in grafted rats, BMSC significantly attenuated HD-induced neuronal apoptosis in the spinal cord, which was associated with elevation of nerve growth factor (NGF). Neutralization of NGF in BMSC-CM blocked the protection against HD-induced apoptosis in VSC4.1 cells, suggesting that NGF is essential for BMSC-afforded anti-apoptosis. Mechanistically, we found that the decreased activation of Akt induced by HD was significantly recovered in the spinal cord by BMSC and in VSC4.1 cells by BMSC-CM in a TrkA-dependent manner, leading to dissociation of Bad/Bcl-xL complex in mitochondria and release of anti-apoptotic Bcl-xL. The importance of Akt was further corroborated by showing the reduced anti-apoptotic potency of BMSC in HD-intoxicated VSC4.1 cells in the presence of Akt inhibitor, MK-2206. Thus, our findings show that BMSC attenuated HD-induced neuronal apoptosis in vivo through a NGF/Akt-dependent manner, providing a novel solution against n-hexane-induced neurotoxicity. PMID:27703213

  13. Simultaneous screening for osteoporosis at CT colonography: bone mineral density assessment using MDCT attenuation techniques compared with the DXA reference standard.

    PubMed

    Pickhardt, Perry J; Lee, Lawrence J; del Rio, Alejandro Muñoz; Lauder, Travis; Bruce, Richard J; Summers, Ron M; Pooler, B Dustin; Binkley, Neil

    2011-09-01

    The purpose of this study was to evaluate the utility of lumbar spine attenuation measurement for bone mineral density (BMD) assessment at screening computed tomographic colonography (CTC) using central dual-energy X-ray absorptiometry (DXA) as the reference standard. Two-hundred and fifty-two adults (240 women and 12 men; mean age 58.9 years) underwent CTC screening and central DXA BMD measurement within 2 months (mean interval 25.0 days). The lowest DXA T-score between the spine and hip served as the reference standard, with low BMD defined per World Health Organization as osteoporosis (DXA T-score ≤ -2.5) or osteopenia (DXA T-score between -1.0 and -2.4). Both phantomless quantitative computed tomography (QCT) and simple nonangled region-of-interest (ROI) multi-detector CT (MDCT) attenuation measurements were applied to the T(12) -L(5) levels. The ability to predict osteoporosis and low BMD (osteoporosis or osteopenia) by DXA was assessed. A BMD cut-off of 90 mg/mL at phantomless QCT yielded 100% sensitivity for osteoporosis (29 of 29) and a specificity of 63.8% (143 of 224); 87.2% (96 of 110) below this threshold had low BMD and 49.6% (69 of 139) above this threshold had normal BMD at DXA. At L(1) , a trabecular ROI attenuation cut-off of 160 HU was 100% sensitive for osteoporosis (29 of 29), with a specificity of 46.4% (104 of 224); 83.9% (125 of 149) below this threshold had low BMD and 57.5% (59/103) above had normal BMD at DXA. ROI performance was similar at all individual T(12) -L(5) levels. At ROC analysis, AUC for osteoporosis was 0.888 for phantomless QCT [95% confidence interval (CI) 0.780-0.946] and ranged from 0.825 to 0.853 using trabecular ROIs at single lumbar levels (0.864; 95% CI 0.752-0.930 at multivariate analysis). Supine-prone reproducibility was better with the simple ROI method compared with QCT. It is concluded that both phantomless QCT and simple ROI attenuation measurements of the lumbar spine are effective for BMD screening at CTC

  14. Suppression of Wnt signaling by Dkk1 attenuates PTH-mediated stromal cell response and new bone formation

    PubMed Central

    Guo, Jun; Liu, Minlin; Yang, Dehong; Bouxsein, Mary L; Saito, Hiroaki; Galvin, R J Sells; Kuhstoss, Stuart A.; Thomas, Clare C; Schipani, Ernestina; Baron, Roland; Bringhurst, F Richard; Kronenberg, Henry M.

    2010-01-01

    SUMMARY Parathyroid hormone (PTH) suppresses Dickkopf 1 (Dkk1) expression in osteoblasts. To determine whether this suppression is essential for PTH-mediated Wnt signaling and bone formation, we examined mice that overexpress Dkk1 in osteoblasts (Dkk1 mice). Dkk1 mice were osteopenic due to abnormal osteoblast and osteoclast activity. When fed a low calcium diet, and in two other models of hyperparathyroidism, these mice failed to develop the peritrabecular stromal cell response (“osteitis fibrosis”) and new bone formation seen in wild type mice. Despite these effects of Dkk1 overexpression, PTH still activated Wnt signaling in Dkk1 mice and in osteoblastic cells cultured from these mice. In cultured MC3T3E1 preosteoblastic cells, PTH dramatically suppressed Dkk1 expression, induced PKA-mediated phosphorylation of β-catenin and significantly enhanced Lef1 expression. Our findings indicate that the full actions of PTH require intact Wnt signaling but that PTH can activate the Wnt pathway despite overexpression of Dkk1. PMID:20142103

  15. Suppression of Wnt signaling by Dkk1 attenuates PTH-mediated stromal cell response and new bone formation.

    PubMed

    Guo, Jun; Liu, Minlin; Yang, Dehong; Bouxsein, Mary L; Saito, Hiroaki; Galvin, R J Sells; Kuhstoss, Stuart A; Thomas, Clare C; Schipani, Ernestina; Baron, Roland; Bringhurst, F Richard; Kronenberg, Henry M

    2010-02-03

    Parathyroid hormone (PTH) suppresses Dickkopf 1 (Dkk1) expression in osteoblasts. To determine whether this suppression is essential for PTH-mediated Wnt signaling and bone formation, we examined mice that overexpress Dkk1 in osteoblasts (Dkk1 mice). Dkk1 mice were osteopenic due to abnormal osteoblast and osteoclast activity. When fed a low-calcium diet, and in two other models of hyperparathyroidism, these mice failed to develop the peritrabecular stromal cell response ("osteitis fibrosis") and new bone formation seen in wild-type mice. Despite these effects of Dkk1 overexpression, PTH still activated Wnt signaling in Dkk1 mice and in osteoblastic cells cultured from these mice. In cultured MC3T3E1 preosteoblastic cells, PTH dramatically suppressed Dkk1 expression, induced PKA-mediated phosphorylation of beta-catenin, and significantly enhanced Lef1 expression. Our findings indicate that the full actions of PTH require intact Wnt signaling but that PTH can activate the Wnt pathway despite overexpression of Dkk1.

  16. Evaluation of imaging technologies to correct for photon attenuation in the overlying tissue for in vivo bone strontium measurements

    NASA Astrophysics Data System (ADS)

    Heirwegh, C. M.; Chettle, D. R.; Pejović-Milić, A.

    2010-02-01

    The interpretation of measurements of bone strontium in vivo using energy dispersive x-ray fluorescence spectroscopy is presently hindered by overlying skin and soft-tissue absorption of the strontium x-rays. The use of imaging technologies to measure the overlying soft-tissue thickness at the index finger measuring site might allow correction of the strontium reading to estimate its concentration in bone. An examination of magnetic resonance (MR), computed tomography (CT) and high-frequency ultrasound (US) imaging technologies revealed that 55 MHz US had the smallest range of measurement uncertainty at 3.2% followed by 1 Tesla MR, 25 MHz US, 8 MHz US and CT at 4.3, 5.4, 6.6 and 7.1% uncertainty, respectively. Of these, only CT imaging appeared to underestimate total thickness (p < 0.05). Furthermore, an inter-study comparison on the accuracy of US measurements of the overlying tissue thickness at finger and ankle in nine subjects was investigated. The 8 MHz US system used in prior in vivo experiments was found to perform satisfactorily in a repeat study of ankle measurements, but indicated that finger thickness measurements may have been misread in previous studies by up to 17.7% (p < 0.025). Repeat ankle measurements were not significantly different from initial measurements at 2.2% difference.

  17. β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease.

    PubMed

    Silva, Viviam de Oliveira; Lobato, Raquel Vieira; Andrade, Eric Francelino; de Macedo, Cristina Gomes; Napimoga, Juliana Trindade Clemente; Napimoga, Marcelo Henrique; Messora, Michel Reis; Murata, Ramiro Mendonça; Pereira, Luciano José

    2015-01-01

    The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p < 0.05). β-glucans reduced blood glucose, cholesterol and triacylglycerol levels in diabetic animals, both with and without periodontal disease (p < 0.05). Furthermore, treatment with β-glucans reduced the expression of cyclooxygenase-2 and receptor activator of nuclear factor kappa-B ligand and increased osteoprotegerin expression in animals with diabetes and periodontal disease (p < 0.05). It was concluded that treatment with β-glucans has beneficial metabolic and periodontal effects in diabetic rats with periodontal disease.

  18. β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

    PubMed Central

    2015-01-01

    The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p < 0.05). β-glucans reduced blood glucose, cholesterol and triacylglycerol levels in diabetic animals, both with and without periodontal disease (p < 0.05). Furthermore, treatment with β-glucans reduced the expression of cyclooxygenase-2 and receptor activator of nuclear factor kappa-B ligand and increased osteoprotegerin expression in animals with diabetes and periodontal disease (p < 0.05). It was concluded that treatment with β-glucans has beneficial metabolic and periodontal effects in diabetic rats with periodontal disease. PMID:26291983

  19. Mitochondrial calcium uniporter inhibition attenuates mouse bone marrow-derived mast cell degranulation induced by beta-1,3-glucan

    PubMed Central

    Cuong, Dang Van; Kim, Hyoung Kyu; Marquez, Jubert; Kim, Nari; Ko, Kyung Soo; Rhee, Byoung Doo

    2016-01-01

    Mast cells are primary mediators of allergic inflammation. Beta-1,3-glucan (BG) protects against infection and shock by activating immune cells. Activation of the BG receptor induces an increase in intracellular Ca2+, which may induce exocytosis. However, little is known about the precise mechanisms underlying BG activation of immune cells and the possible role of mitochondria in this process. The present study examined whether BG induced mast cell degranulation, and evaluated the role of calcium transients during mast cell activation. Our investigation focused on the role of the mitochondrial calcium uniporter (MCU) in BG-induced degranulation. Black mouse (C57) bone marrow-derived mast cells were stimulated with 0.5 µg/ml BG, 100 µg/ml peptidoglycan (PGN), or 10 µM A23187 (calcium ionophore), and dynamic changes in cytosolic and mitochondrial calcium and membrane potential were monitored. BG-induced mast cell degranulation occurred in a time-dependent manner, and was significantly reduced under calcium-free conditions. Ruthenium red, a mitochondrial Ca2+ uniporter blocker, significantly reduced mast cell degranulation induced by BG, PGN, and A23187. These results suggest that the mitochondrial Ca2+ uniporter has an important regulatory role in BG-induced mast cell degranulation. PMID:26937218

  20. Lymphocytes with Aberrant Expression of Fas or Fas-ligand Attenuate Immune Bone Marrow Failure in a Mouse Model

    PubMed Central

    Omokaro, Stephanie O.; Desierto, Marie J.; Eckhaus, Michael A.; Ellison, Felicia M.; Chen, Jichun; Young, Neal S.

    2012-01-01

    Bone marrow (BM) and lymphocyte samples from aplastic anemia patients show up-regulated Fas and Fas-ligand (FasL) expression respectively, supporting a relationship between immune-mediated BM destruction and the Fas apoptotic pathway. Mice with spontaneous lymphoproliferation (lpr) and generalized lymphoproliferative disease (gld) mutations exhibit abnormal expression of Fas and FasL; serving as potential models to elucidate underlying mechanisms of BM failure. We examined cellular and functional characteristics of lpr and gld mutants on the C57BL/6 (B6) background. Lymph node (LN) cells from lpr and gld mice produced less apoptosis when co-incubated with C.B10-H2b/LilMcd (C.B10) BM cells in vitro. This functional difference was confirmed by infusing lpr, gld, and B6 LN cells into sub-lethally irradiated CB10 mice; all donor LN cells showed significant T cell expansion and activation but only B6 LN cells caused severe BM destruction. Mice infused with gld LN cells developed mild to moderate BM failure, despite receiving FasL-deficient effectors, thus suggesting the existence of alternative pathways or incomplete penetrance of the mutation. Paradoxically, mice that received Fas-deficient lpr LN cells also had reduced BM failure, likely due to down-regulation of pro-apoptotic genes, an effect that can be overcome by higher doses of lpr LN cells. Our model demonstrates that abnormal Fas or FasL expression interferes with the development of pancytopenia and marrow hypoplasia, validating a major role for the Fas/FasL cytotoxic pathway in immune-mediated BM failure, although disruption of this pathway does not completely abolish marrow destruction. PMID:19265119

  1. Lymphocytes with aberrant expression of Fas or Fas ligand attenuate immune bone marrow failure in a mouse model.

    PubMed

    Omokaro, Stephanie O; Desierto, Marie J; Eckhaus, Michael A; Ellison, Felicia M; Chen, Jichun; Young, Neal S

    2009-03-15

    Bone marrow (BM) and lymphocyte samples from aplastic anemia patients show up-regulated Fas and Fas-ligand (FasL) expression, respectively, supporting a relationship between immune-mediated BM destruction and the Fas apoptotic pathway. Mice with spontaneous lymphoproliferation (lpr) and generalized lymphoproliferative disease (gld) mutations exhibit abnormal expression of Fas and FasL, serving as potential models to elucidate underlying mechanisms of BM failure. We examined cellular and functional characteristics of lpr and gld mutants on the C57BL/6 (B6) background. Lymph node (LN) cells from lpr and gld mice produced less apoptosis when coincubated with C.B10-H2(b)/LilMcd (C.B10) BM cells in vitro. This functional difference was confirmed by infusing lpr, gld, and B6 LN cells into sublethally irradiated CB10 mice. All donor LN cells showed significant T cell expansion and activation, but only B6 LN cells caused severe BM destruction. Mice infused with gld LN cells developed mild to moderate BM failure despite receiving FasL-deficient effectors, thus suggesting the existence of alternative pathways or incomplete penetrance of the mutation. Paradoxically, mice that received Fas-deficient lpr LN cells also had reduced BM failure, likely due to down-regulation of proapoptotic genes, an effect that can be overcome by higher doses of lpr LN cells. Our model demonstrates that abnormal Fas or FasL expression interferes with the development of pancytopenia and marrow hypoplasia, validating a major role for the Fas/FasL cytotoxic pathway in immune-mediated BM failure, although disruption of this pathway does not completely abolish marrow destruction.

  2. CD147 deficiency blocks IL-8 secretion and inhibits lung cancer-induced osteoclastogenesis.

    PubMed

    Wang, Hongkai; Zhuo, Yunyun; Hu, Xu; Shen, Weiwei; Zhang, Ying; Chu, Tongwei

    2015-03-06

    Bone is a frequent target of lung cancer metastasis, which is associated with significant morbidity and poor prognosis; however, the molecular basis of this process is still unknown. This study investigated the role of extracellular matrix metalloproteinase inducer (also known as cluster of differentiation (CD)147) in osteoclastogenesis resulting from bone metastasis, based on the enrichment of this glycoprotein on the surface of many malignant bone tumors. RNA interference was used to silence CD147 expression in A549 human lung cancer cells. Compared with conditioned medium (CM) from control cells (A549-CM), CM from CD147-deficient cells (A549-si-CM) suppressed receptor activator of nuclear factor κB ligand-stimulated osteoclastogenesis in RAW 264.7 cells and bone marrow-derived macrophages. The mRNA levels of osteoclast-specific genes such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K were also reduced in the presence of A549-si-CM. CD147 knockdown in A549 cells decreased interleukin (IL)-8mRNA and protein expression. IL-8 is present in large amounts in A549-CM and mimicked its inductive effect on osteoclastogenesis; this was reversed by depletion of IL-8 from the medium. Taken together, these results indicate that CD147 promotes lung cancer-induced osteoclastogenesis by modulating IL-8 secretion, and suggest that CD147 is a potential therapeutic target for cancer-associated bone resorption in lung cancer patients.

  3. Citrus unshiu peel extract alleviates cancer-induced weight loss in mice bearing CT-26 adenocarcinoma

    PubMed Central

    Kim, Aeyung; Im, Minju; Gu, Min Jung; Ma, Jin Yeul

    2016-01-01

    Skeletal muscle atrophy is a critical feature of cancer-induced cachexia, caused by pro-cachectic factors secreted by host cells and tumor cells. Therefore, blockade of these factors has considered a reasonable target for pharmacological and nutritional interventions to prevent skeletal muscle loss under cancer-induced cachexia. Citrus unshiu peel (CUP) has been used for treating the common cold, dyspepsia, and bronchial discomfort and reported to have pharmacological activities against inflammation, allergy, diabetes, and viral infection. In the present study, we observed that daily oral administration of water extract of CUP (WCUP) to male BALB/c mice bearing CT-26 adenocarcinoma remarkably reduced the losses in final body weight, carcass weight, gastrocnemius muscle, epididymal adipose tissue, and hemoglobin (Hb), compared with saline treatment. The levels of serum IL-6 and muscle-specific E3 ligases elevated by tumor burden were also considerably reduced by WCUP administration. In an in vitro experiment, WCUP efficiently suppressed the production of pro-cachectic cytokines in immune cells as well as cancer cells. In addition, WCUP treatment attenuated C2C12 skeletal muscle cell atrophy caused by cancer cells. These findings collectively suggest that WCUP is beneficial as a nutritional supplement for the management of cancer patients with severe weight loss. PMID:27064118

  4. Citrus unshiu peel extract alleviates cancer-induced weight loss in mice bearing CT-26 adenocarcinoma.

    PubMed

    Kim, Aeyung; Im, Minju; Gu, Min Jung; Ma, Jin Yeul

    2016-04-11

    Skeletal muscle atrophy is a critical feature of cancer-induced cachexia, caused by pro-cachectic factors secreted by host cells and tumor cells. Therefore, blockade of these factors has considered a reasonable target for pharmacological and nutritional interventions to prevent skeletal muscle loss under cancer-induced cachexia. Citrus unshiu peel (CUP) has been used for treating the common cold, dyspepsia, and bronchial discomfort and reported to have pharmacological activities against inflammation, allergy, diabetes, and viral infection. In the present study, we observed that daily oral administration of water extract of CUP (WCUP) to male BALB/c mice bearing CT-26 adenocarcinoma remarkably reduced the losses in final body weight, carcass weight, gastrocnemius muscle, epididymal adipose tissue, and hemoglobin (Hb), compared with saline treatment. The levels of serum IL-6 and muscle-specific E3 ligases elevated by tumor burden were also considerably reduced by WCUP administration. In an in vitro experiment, WCUP efficiently suppressed the production of pro-cachectic cytokines in immune cells as well as cancer cells. In addition, WCUP treatment attenuated C2C12 skeletal muscle cell atrophy caused by cancer cells. These findings collectively suggest that WCUP is beneficial as a nutritional supplement for the management of cancer patients with severe weight loss.

  5. Intrathecal injection of the peptide myr-NR2B9c attenuates bone cancer pain via perturbing N-methyl-D-aspartate receptor-PSD-95 protein interactions in mice.

    PubMed

    Liu, Yue; Cui, Xinlong; Sun, Yu-E; Yang, Xuli; Ni, Kun; Zhou, Yu; Ma, Zhengliang; Gu, Xiaoping

    2014-06-01

    N-methyl-D-aspartate receptor (NMDARs)-dependent central sensitization plays an important role in cancer pain. Binding of NMDAR subunit 2B (NR2B) by postsynaptic density protein-95 (PSD-95) can couple NMDAR activity to intracellular enzymes, such as neuronal nitric oxide synthase (nNOS), facilitate downstream signaling pathways, and modulate NMDAR stability, contributing to synaptic plasticity. In this study, we investigated whether perturbing the specific interaction between spinal NR2B-containing NMDAR and PSD-95, using a peptide-mimetic strategy, could attenuate bone cancer-related pain behaviors. Osteosarcoma cells were implanted into the intramedullary space of the right femurs of C3H/HeJ mice to induce progressive bone cancer-related pain behaviors. Western blotting was applied to examine the expression of spinal phospho-Tyr1472 NR2B, nNOS, and PSD-95. We further investigated the effects of intrathecal injection of the mimetic peptide Myr-NR2B9c, which competitively disrupts the interaction between PSD-95 and NR2B, on nociceptive behaviors and on the upregulation of phospho-Tyr1472 NR2B, nNOS, and PSD-95 associated with bone cancer pain in the spinal cord. Inoculation of osteosarcoma cells induced progressive bone cancer pain and resulted in a significant upregulation of phospho-Tyr1472 NR2B, nNOS, and PSD-95. Intrathecal administration of Myr-NR2B9c attenuated bone cancer-evoked mechanical allodynia, thermal hyperalgesia, and reduced spinal phospho-Tyr1472 NR2B, nNOS, and PSD-95 expression. Intrathecal administration of Myr-NR2B9c reduced bone cancer pain. Internalization of spinal NR2B and dissociation NR2B-containing NMDARs activation from downstream nNOS signaling may contribute to the analgesic effects of Myr-NR2B9c. This approach may circumvent the negative consequences associated with blocking NMDARs, and may be a novel strategy for the treatment of bone cancer pain.

  6. Monocyte chemotactic protein-1 attenuates and high-fat diet exacerbates bone loss in mice with pulmonary metastasis of Lewis lung carcinoma

    USDA-ARS?s Scientific Manuscript database

    Bone can be adversely affected by obesity and cancer-associated complications including wasting. The objective of this study was to determine whether a high-fat diet and a deficiency in monocyte chemotactic protein-1 (MCP-1) altered bone structural defects found in male C57BL/6 mice with Lewis lung...

  7. Dietary Supplement Attenuates Radiation-Induced Osteoclastogenic and Oxidative Stress-Related Responses and Protects Adult Mice from Radiation-Induced Bone Loss

    NASA Technical Reports Server (NTRS)

    Globus, Ruth; Schreurs, Ann-Sofie; Tahimic, Candice; Shirazi-Fard, Yasaman; Alwood, Joshua; Shahnazari, Mohammed; Halloran, Bernard

    2015-01-01

    Our central hypothesis is that oxidative stress plays a key role in cell dysfunction and progressive bone loss caused by radiation exposure during spaceflight. In animal studies, excess free radical formation is associated with pathological changes in bone structure, enhanced bone resorption, reduced bone formation and decreased bone mineral density, which can lead to skeletal fragility. We previously reported that exposure to low or high-LET radiation rapidly increases expression levels of pro-osteoclastogenic and oxidative stress-related genes in bone and marrow, followed by pathological changes in skeletal structure. To screen various antioxidants for radioprotective effects on bone, 4 month old, male C57Bl6/J mice were treated with a dietary antioxidant cocktail, injectable alpha-lipoic acid, or a dried plum-enriched diet (DP). Mice were then exposed to 2Gy 137Cs total body radiation and one day later marrow cells were collected and the relevant genes analyzed for expression levels. Of the candidates tested, DP was most effective in reducing bone resorption-related gene expression. Microcomputed tomography revealed that DP also prevented the radiation-induced deterioration of skeletal microarchitecture, as indicated by percent bone volume, trabecular spacing and trabecular number. DP had similar protective effects on skeletal structure after sequential exposure to protons (0.5 Gy, 150MeV/n) and 56Fe 0.5Gy, 600 MeV/n). When cultured ex vivo under osteogenic conditions, bone marrow-derived cells from DP-fed animals exhibited increased colony numbers compared to control diet-fed animals. These findings suggest that DP exerted pro-osteogenic effects apart from previously identified anti-resorptive actions, which may contribute to radioprotection of skeletal tissue. In conclusion, a diet enriched in certain types of antioxidants and polyphenols such as DP may be useful as an intervention to protect tissues from degenerative effects of ionizing radiation.

  8. CD147 deficiency blocks IL-8 secretion and inhibits lung cancer-induced osteoclastogenesis

    SciTech Connect

    Wang, Hongkai; Zhuo, Yunyun; Hu, Xu; Shen, Weiwei; Zhang, Ying; Chu, Tongwei

    2015-03-06

    Bone is a frequent target of lung cancer metastasis, which is associated with significant morbidity and poor prognosis; however, the molecular basis of this process is still unknown. This study investigated the role of extracellular matrix metalloproteinase inducer (also known as cluster of differentiation (CD)147) in osteoclastogenesis resulting from bone metastasis, based on the enrichment of this glycoprotein on the surface of many malignant bone tumors. RNA interference was used to silence CD147 expression in A549 human lung cancer cells. Compared with conditioned medium (CM) from control cells (A549-CM), CM from CD147-deficient cells (A549-si-CM) suppressed receptor activator of nuclear factor κB ligand-stimulated osteoclastogenesis in RAW 264.7 cells and bone marrow-derived macrophages. The mRNA levels of osteoclast-specific genes such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K were also reduced in the presence of A549-si-CM. CD147 knockdown in A549 cells decreased interleukin (IL)-8mRNA and protein expression. IL-8 is present in large amounts in A549-CM and mimicked its inductive effect on osteoclastogenesis; this was reversed by depletion of IL-8 from the medium. Taken together, these results indicate that CD147 promotes lung cancer-induced osteoclastogenesis by modulating IL-8 secretion, and suggest that CD147 is a potential therapeutic target for cancer-associated bone resorption in lung cancer patients. - Highlights: • Bone loss frequently results from lung cancer metastasis. • Cluster of differentiation (CD)147 was depleted in A549 lung adenocarcinoma cells. • RAW 264.7 cell osteoclastogenesis was blocked by medium from CD147-deficient cells. • Interleukin (IL)-8 level was reduced in the conditioned medium. • Osteoclastogenesis induced by lung tumor cells requires CD147-mediated IL-8 release.

  9. Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment (Final Report)

    EPA Science Inventory

    EPA announced the release of the final report, Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment . This report provides an overview of the types of mechanisms underlying the lymphohematopoietic cancers induc...

  10. Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment (Final Report)

    EPA Science Inventory

    EPA announced the release of the final report, Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment . This report provides an overview of the types of mechanisms underlying the lymphohematopoietic cancers induc...

  11. A single intraperitoneal injection of bovine fetuin-A attenuates bone resorption in a murine calvarial model of particle-induced osteolysis.

    PubMed

    Jablonski, Heidrun; Polan, Christina; Wedemeyer, Christian; Hilken, Gero; Schlepper, Rüdiger; Bachmann, Hagen Sjard; Grabellus, Florian; Dudda, Marcel; Jäger, Marcus; Kauther, Max Daniel

    2017-09-21

    Particle-induced osteolysis, which by definition is an aseptic inflammatory reaction to implant-derived wear debris eventually leading to local bone destruction, remains the major reason for long-term failure of orthopedic endoprostheses. Fetuin-A, a 66kDa glycoprotein with diverse functions, is found to be enriched in bone. Besides being an important inhibitor of ectopic calcification, it has been described to influence the production of mediators of inflammation. Furthermore, a regulatory role in bone metabolism has been assigned. In the present study, the influence of a single dose of bovine fetuin-A, intraperitoneally injected in mice subjected to particle-induced osteolysis of the calvaria, was analyzed. Twenty-eight male C57BL/6 mice, twelve weeks of age, were randomly divided into four groups. Groups 2 and 4 were subjected to ultra-high molecular weight polyethylene (UHMWPE) particles placed on their calvariae while groups 1 and 3 were sham-operated. Furthermore, groups 3 and 4 received a single intraperitoneal injection of 20mg bovine fetuin-A while groups 1 and 2 were treated with physiologic saline. After 14days calvarial bone was qualitatively and quantitatively assessed using microcomputed tomography (μCT) and histomorphometrical approaches. Application of fetuin-A led to a reduction of particle-induced osteolysis in terms of visible osteolytic lesions and eroded bone surface. The reduction of bone thickness and bone volume, as elicited by UHMWPE, was alleviated by fetuin-A. In conclusion, fetuin-A was found to exert an anti-resorptive effect on particle-induced osteolysis in-vivo. Thus, fetuin-A could play a potentially osteoprotective role in the treatment of bone metabolic disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. A two-year history of high bone loading physical activity attenuates ethnic differences in bone strength and geometry in pre-/early pubertal children from a low-middle income country.

    PubMed

    Meiring, Rebecca M; Avidon, Ingrid; Norris, Shane A; McVeigh, Joanne A

    2013-12-01

    We examined the interplay between ethnicity and weight-bearing physical activity on the content and volumetric properties of bone in a pre- to early pubertal South African Black and White population. Sixty six children [Black boys, 10.4 (1.4)yrs, n=15; Black girls, 10.1 (1.2)yrs, n=27; White boys, 10.1 (1.1)yrs, n=7; White girls, 9.6 (1.3)yrs, n=17] reported on all their physical activities over the past two years in an interviewer administered physical activity questionnaire (PAQ). All participants underwent a whole body and site-specific DXA scan and we also assessed bone structure and estimated bone strength with pQCT. Children were classified as being either high or low bone loaders based on the cohort's median peak bone strain score estimated from the PAQ. In the low bone loading group, Black children had greater femoral neck bone mineral content (BMC) (2.9 (0.08)g) than White children (2.4 (0.11)g; p=0.05). There were no ethnic differences in the high bone loaders for femoral neck BMC. At the cortical site, the Black low bone loaders had a greater radius area (97.3 (1.3) vs 88.8 (2.6)mm(2); p=0.05) and a greater tibia total area (475.5 (8.7) vs. 397.3 (14.0)mm(2); p=0.001) and strength (1633.7 (60.1) vs. 1271.8 (98.6)mm(3); p=0.04) compared to the White low bone loaders. These measures were not different between the Black low and high bone loaders or between the Black and White high bone loaders. In conclusion, the present study shows that there may be ethnic and physical activity associations in the bone health of Black and White pre-pubertal children and further prospective studies are required to determine the possible ethnic specific response to mechanical loading.

  13. Consumption of onion juice modulates oxidative stress and attenuates the risk of bone disorders in middle-aged and post-menopausal healthy subjects.

    PubMed

    Law, Yat-Yin; Chiu, Hui-Fang; Lee, Hui-Hsin; Shen, You-Cheng; Venkatakrishnan, Kamesh; Wang, Chin-Kun

    2016-02-01

    Osteoporosis is a chronic inflammatory condition that is characterized by the loss of bone mineral density (BMD). The current study was undertaken to evaluate the impact of onion juice intake on the bone mineral density (BMD) and bone loss in corroboration with antioxidant effects in human (in vivo) as well as inhibitory effects on the differentiation of osteoclasts in the cell line (in vitro). For in vitro studies, the RAW 264.7 (osteoclast progenitor) cells were used to examine the anti-osteoclastogenic effect of onion. In the case of in vivo studies, twenty-four subjects were divided into two groups and advised to intake 100 mL of onion juice or placebo for 8 weeks. Anthropometric measurements and blood samples were collected at the initial, 2(nd), 6(th), 8(th) and 10(th) week. The result of in vitro studies indicated that onion extract would effectively inhibit the osteoclastogenesis and its differentiation. Significant changes in the levels of alkaline phosphatase (ALP), free radicals, total antioxidant capacity (TEAC) and various antioxidants were observed in onion administered subjects. The BMD of three postmenopausal women was also found to be mildly improved on supplementation with onion juice. Onion juice consumption showed a positive modulatory effect on the bone loss and BMD by improving antioxidant activities and thus can be recommended for treating various bone-related disorders, especially osteoporosis.

  14. New insights into pancreatic cancer-induced paraneoplastic diabetes

    PubMed Central

    Sah, Raghuwansh P.; Nagpal, Sajan Jiv Singh; Mukhopadhyay, Debabrata; Chari, Suresh T.

    2014-01-01

    Up to 85% of patients with pancreatic cancer have diabetes or hyperglycaemia, which frequently manifests as early as 2–3 years before a diagnosis of pancreatic cancer. Conversely, patients with new-onset diabetes have a 5–8-fold increased risk of being diagnosed with pancreatic cancer within 1–3 years of developing diabetes. Emerging evidence now indicates that pancreatic cancer causes diabetes. As in type 2 diabetes, β-cell dysfunction and peripheral insulin resistance are seen in pancreatic cancer-induced diabetes. However, unlike in patients with type 2 diabetes, glucose control worsens in patients with pancreatic cancer in the face of ongoing, often profound, weight loss. Diabetes and weight loss, which precede cachexia onset by several months, are paraneoplastic phenomena induced by pancreatic cancer. Although the pathogenesis of these pancreatic cancer-induced metabolic alterations is only beginning to be understood, these are likely mechanisms to promote the survival and growth of pancreatic cancer in a hostile and highly desmoplastic microenvironment. Interestingly, these metabolic changes could enable early diagnosis of pancreatic cancer, if they can be distinguished from the ones that occur in patients with type 2 diabetes. One such possible biomarker is adrenomedullin, which is a potential mediator of β-cell dysfunction in pancreatic cancer-induced diabetes. PMID:23528347

  15. Celastrol attenuates bone erosion in collagen-Induced arthritis mice and inhibits osteoclast differentiation and function in RANKL-induced RAW264.7.

    PubMed

    Gan, Ke; Xu, Lingxiao; Feng, Xiaoke; Zhang, Qiande; Wang, Fang; Zhang, Miaojia; Tan, Wenfeng

    2015-02-01

    Recently, the traditional Chinese medicine Tripterygium wilfordii Hook f (TwHF) of the Celastraceae family has attracted increasing attention for its potential therapeutic application in patients with rheumatoid arthritis (RA). It is well accepted that TwHF exerts the antirheumatic activity and mainly depends on its potent anti-inflammatory property. To further explore the therapeutic potential of the well-defined TwHF-derived single compound - celastrol in RA, we study the therapeutic efficacy of celastrol on bone erosion in collagen-induced arthritis (CIA) mice and delineate its effects on osteoclast differentiation and functions in RANKL-induced osteoclast precursors RAW264.7 cell line. In CIA mice, daily injection of celastrol (beginning on day 28 after arthritis induction) markedly suppressed arthritis, and reduced bone damage in the joints as demonstrated by histology and bone micro-computed tomography (CT). The effects were accompanied by reductions of osteoclast cells in joints, serum tartrate-resistant acid phosphatase (TRAP) 5b, and expression of osteoclastic genes (Trap, Ctsk, Ctr, Mmp-9) and transcriptional factors (c-Fos, c-Jun and NFATc1). When RAW264.7 cells were treated with RANKL, celastrol inhibited the formation of TRAP+ multinucleated cells and the bone-resorbing activity in dose-dependent manners. Furthermore, celastrol reduced the RANKL-induced expression of osteoclastic genes and transcriptional factors, as well as phosphorylation of NF-kB and mitogen-activated protein kinases (MAPK). These findings show that celastrol could directly inhibit osteoclast formation and function, suggesting a novel therapeutic strategy of celastrol for managing RA, especially in preventing bone destruction.

  16. Silibinin-mediated metabolic reprogramming attenuates pancreatic cancer-induced cachexia and tumor growth

    PubMed Central

    Shukla, Surendra K.; Dasgupta, Aneesha; Mehla, Kamiya; Gunda, Venugopal; Vernucci, Enza; Souchek, Joshua; Goode, Gennifer; King, Ryan; Mishra, Anusha; Rai, Ibha; Nagarajan, Sangeetha; Chaika, Nina V.; Yu, Fang; Singh, Pankaj K.

    2015-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is the fourth leading cause of cancer-related deaths in the US. Cancer-associated cachexia is present in up to 80% of PDAC patients and is associated with aggressive disease and poor prognosis. In the present studies we evaluated an anti-cancer natural product silibinin for its effectiveness in targeting pancreatic cancer aggressiveness and the cachectic properties of pancreatic cancer cells and tumors. Our results demonstrate that silibinin inhibits pancreatic cancer cell growth in a dose-dependent manner and reduces glycolytic activity of cancer cells. Our LC-MS/MS based metabolomics data demonstrates that silibinin treatment induces global metabolic reprogramming in pancreatic cancer cells. Silibinin treatment diminishes c-MYC expression, a key regulator of cancer metabolism. Furthermore, we observed reduced STAT3 signaling in silibinin-treated cancer cells. Overexpression of constitutively active STAT3 was sufficient to substantially revert the silibinin-induced downregulation of c-MYC and the metabolic phenotype. Our in vivo investigations demonstrate that silibinin reduces tumor growth and proliferation in an orthotopic mouse model of pancreatic cancer and prevents the loss of body weight and muscle. It also improves physical activity including grip strength and latency to fall in tumor-bearing mice. In conclusion, silibinin-induced metabolic reprogramming diminishes cell growth and cachectic properties of pancreatic cancer cells and animal models. PMID:26510913

  17. Silibinin-mediated metabolic reprogramming attenuates pancreatic cancer-induced cachexia and tumor growth.

    PubMed

    Shukla, Surendra K; Dasgupta, Aneesha; Mehla, Kamiya; Gunda, Venugopal; Vernucci, Enza; Souchek, Joshua; Goode, Gennifer; King, Ryan; Mishra, Anusha; Rai, Ibha; Nagarajan, Sangeetha; Chaika, Nina V; Yu, Fang; Singh, Pankaj K

    2015-12-01

    Pancreatic ductal adenocarcinoma (PDAC) is the fourth leading cause of cancer-related deaths in the US. Cancer-associated cachexia is present in up to 80% of PDAC patients and is associated with aggressive disease and poor prognosis. In the present studies we evaluated an anti-cancer natural product silibinin for its effectiveness in targeting pancreatic cancer aggressiveness and the cachectic properties of pancreatic cancer cells and tumors. Our results demonstrate that silibinin inhibits pancreatic cancer cell growth in a dose-dependent manner and reduces glycolytic activity of cancer cells. Our LC-MS/MS based metabolomics data demonstrates that silibinin treatment induces global metabolic reprogramming in pancreatic cancer cells. Silibinin treatment diminishes c-MYC expression, a key regulator of cancer metabolism. Furthermore, we observed reduced STAT3 signaling in silibinin-treated cancer cells. Overexpression of constitutively active STAT3 was sufficient to substantially revert the silibinin-induced downregulation of c-MYC and the metabolic phenotype. Our in vivo investigations demonstrate that silibinin reduces tumor growth and proliferation in an orthotopic mouse model of pancreatic cancer and prevents the loss of body weight and muscle. It also improves physical activity including grip strength and latency to fall in tumor-bearing mice. In conclusion, silibinin-induced metabolic reprogramming diminishes cell growth and cachectic properties of pancreatic cancer cells and animal models.

  18. A diet high in protein, dairy, and calcium attenuates bone loss over twelve months of weight loss and maintenance relative to a conventional high-carbohydrate diet in adults.

    PubMed

    Thorpe, Matthew P; Jacobson, Edward H; Layman, Donald K; He, Xuming; Kris-Etherton, Penny M; Evans, Ellen M

    2008-06-01

    Weight loss causes bone mineral loss. Higher protein diets continue to be criticized for further potential harmful bone effects, including elevated urinary calcium, but may promote bone health if protein sources include dairy. Overweight middle-aged subjects (n = 130, 59 males) were randomized to a diet providing 1.4 g.kg(-1).d(-1) protein and 3 daily servings of dairy (PRO) or 0.8 g.kg(-1).d(-1) protein and 2 daily servings of dairy (CARB) for 4 mo of weight loss plus 8 mo of weight maintenance. Diets prescribed 6276 kJ/d for females and 7113 kJ/d for males. Bone mineral content and density (BMD) for whole body (WB), lumbar spine (LS) and total hip (TH) were measured using dual X-ray absorptiometry, and dietary intake using 3-d weighed food records. Urinary calcium was measured using 24-h collection at 0 and 8 mo for a subsample (n = 42). Participants lost body weight (mean, 95% CI) of 8.2% (7.5-8.9%) at 4 mo, 10.6% (9.5-11.8%) at 8 mo, and 10.5% (8.9-12.0%) at 12 mo without differences between groups at any time (P = 0.64). At 12 mo, PRO BMD was higher by 1.6% (0.3-3.0%) at WB, 2.1% (0.6-3.7%) at LS, and 1.4% (0.2-2.5%) at TH compared with CARB. PRO calcium intake was higher (PRO: 1140 +/- 58 mg/d, CARB: 766 +/- 46; P < 0.01), as was urinary calcium (PRO: 163 +/- 15 mg/d, CARB: 100 +/- 9.2; P < 0.01). A reduced-energy diet supplying 1.4 g.kg(-1).d(-1) protein and 3 dairy servings increased urinary calcium excretion but provided improved calcium intake and attenuated bone loss over 4 mo of weight loss and 8 additional mo of weight maintenance.

  19. Bone graft

    MedlinePlus

    Autograft - bone; Allograft - bone; Fracture - bone graft; Surgery - bone graft; Autologous bone graft ... Fuse joints to prevent movement Repair broken bones (fractures) that have bone loss Repair injured bone that ...

  20. Cancer-associated bone disease.

    PubMed

    Rizzoli, R; Body, J-J; Brandi, M-L; Cannata-Andia, J; Chappard, D; El Maghraoui, A; Glüer, C C; Kendler, D; Napoli, N; Papaioannou, A; Pierroz, D D; Rahme, M; Van Poznak, C H; de Villiers, T J; El Hajj Fuleihan, G

    2013-12-01

    Bone is commonly affected in cancer. Cancer-induced bone disease results from the primary disease, or from therapies against the primary condition, causing bone fragility. Bone-modifying agents, such as bisphosphonates and denosumab, are efficacious in preventing and delaying cancer-related bone disease. With evidence-based care pathways, guidelines assist physicians in clinical decision-making. Of the 57 million deaths in 2008 worldwide, almost two thirds were due to non-communicable diseases, led by cardiovascular diseases and cancers. Bone is a commonly affected organ in cancer, and although the incidence of metastatic bone disease is not well defined, it is estimated that around half of patients who die from cancer in the USA each year have bone involvement. Furthermore, cancer-induced bone disease can result from the primary disease itself, either due to circulating bone resorbing substances or metastatic bone disease, such as commonly occurs with breast, lung and prostate cancer, or from therapies administered to treat the primary condition thus causing bone loss and fractures. Treatment-induced osteoporosis may occur in the setting of glucocorticoid therapy or oestrogen deprivation therapy, chemotherapy-induced ovarian failure and androgen deprivation therapy. Tumour skeletal-related events include pathologic fractures, spinal cord compression, surgery and radiotherapy to bone and may or may not include hypercalcaemia of malignancy while skeletal complication refers to pain and other symptoms. Some evidence demonstrates the efficacy of various interventions including bone-modifying agents, such as bisphosphonates and denosumab, in preventing or delaying cancer-related bone disease. The latter includes treatment of patients with metastatic skeletal lesions in general, adjuvant treatment of breast and prostate cancer in particular, and the prevention of cancer-associated bone disease. This has led to the development of guidelines by several societies and

  1. Cancer-associated bone disease

    PubMed Central

    Body, J.-J.; Brandi, M.-L.; Cannata-Andia, J.; Chappard, D.; El Maghraoui, A.; Glüer, C.C.; Kendler, D.; Napoli, N.; Papaioannou, A.; Pierroz, D.D.; Rahme, M.; Van Poznak, C.H.; de Villiers, T.J.; El Hajj Fuleihan, G.

    2016-01-01

    Bone is commonly affected in cancer. Cancer-induced bone disease results from the primary disease, or from therapies against the primary condition, causing bone fragility. Bone-modifying agents, such as bisphosphonates and denosumab, are efficacious in preventing and delaying cancer-related bone disease. With evidence-based care pathways, guidelines assist physicians in clinical decision-making. Of the 57 million deaths in 2008 worldwide, almost two thirds were due to non-communicable diseases, led by cardiovascular diseases and cancers. Bone is a commonly affected organ in cancer, and although the incidence of metastatic bone disease is not well defined, it is estimated that around half of patients who die from cancer in the USA each year have bone involvement. Furthermore, cancer-induced bone disease can result from the primary disease itself, either due to circulating bone resorbing substances or metastatic bone disease, such as commonly occurs with breast, lung and prostate cancer, or from therapies administered to treat the primary condition thus causing bone loss and fractures. Treatment-induced osteoporosis may occur in the setting of glucocorticoid therapy or oestrogen deprivation therapy, chemotherapy-induced ovarian failure and androgen deprivation therapy. Tumour skeletal-related events include pathologic fractures, spinal cord compression, surgery and radiotherapy to bone and may or may not include hypercalcaemia of malignancy while skeletal complication refers to pain and other symptoms. Some evidence demonstrates the efficacy of various interventions including bone-modifying agents, such as bisphosphonates and denosumab, in preventing or delaying cancer-related bone disease. The latter includes treatment of patients with metastatic skeletal lesions in general, adjuvant treatment of breast and prostate cancer in particular, and the prevention of cancer-associated bone disease. This has led to the development of guidelines by several societies and

  2. Culture-modified bone marrow cells attenuate cardiac and renal injury in a chronic kidney disease rat model via a novel antifibrotic mechanism.

    PubMed

    Yuen, Darren A; Connelly, Kim A; Advani, Andrew; Liao, Christine; Kuliszewski, Michael A; Trogadis, Judy; Thai, Kerri; Advani, Suzanne L; Zhang, Yuan; Kelly, Darren J; Leong-Poi, Howard; Keating, Armand; Marsden, Philip A; Stewart, Duncan J; Gilbert, Richard E

    2010-03-04

    Most forms of chronic kidney disease are characterized by progressive renal and cardiac fibrosis leading to dysfunction. Preliminary evidence suggests that various bone marrow-derived cell populations have antifibrotic effects. In exploring the therapeutic potential of bone marrow derived cells in chronic cardio-renal disease, we examined the anti-fibrotic effects of bone marrow-derived culture modified cells (CMCs) and stromal cells (SCs). In vitro, CMC-conditioned medium, but not SC-conditioned medium, inhibited fibroblast collagen production and cell signalling in response to transforming growth factor-beta. The antifibrotic effects of CMCs and SCs were then evaluated in the 5/6 nephrectomy model of chronic cardio-renal disease. While intravascular infusion of 10(6) SCs had no effect, 10(6) CMCs reduced renal fibrosis compared to saline in the glomeruli (glomerulosclerosis index: 0.8+/-0.1 v 1.9+/-0.2 arbitrary units) and the tubulointersitium (% area type IV collagen: 1.2+/-0.3 v 8.4+/-2.0, p<0.05 for both). Similarly, 10(6) CMCs reduced cardiac fibrosis compared to saline (% area stained with picrosirius red: 3.2+/-0.3 v 5.1+/-0.4, p<0.05), whereas 10(6) SCs had no effect. Structural changes induced by CMC therapy were accompanied by improved function, as reflected by reductions in plasma creatinine (58+/-3 v 81+/-11 micromol/L), urinary protein excretion (9x/divided by 1 v 64x/divided by 1 mg/day), and diastolic cardiac stiffness (left ventricular end-diastolic pressure-volume relationship: 0.030+/-0.003 v 0.058+/-0.011 mm Hg/microL, p<0.05 for all). Despite substantial improvements in structure and function, only rare CMCs were present in the kidney and heart, whereas abundant CMCs were detected in the liver and spleen. Together, these findings provide the first evidence suggesting that CMCs, but not SCs, exert a protective action in cardio-renal disease and that these effects may be mediated by the secretion of diffusible anti-fibrotic factor(s).

  3. Culture-Modified Bone Marrow Cells Attenuate Cardiac and Renal Injury in a Chronic Kidney Disease Rat Model via a Novel Antifibrotic Mechanism

    PubMed Central

    Advani, Andrew; Liao, Christine; Kuliszewski, Michael A.; Trogadis, Judy; Thai, Kerri; Advani, Suzanne L.; Zhang, Yuan; Kelly, Darren J.; Leong-Poi, Howard; Keating, Armand; Marsden, Philip A.; Stewart, Duncan J.; Gilbert, Richard E.

    2010-01-01

    Background Most forms of chronic kidney disease are characterized by progressive renal and cardiac fibrosis leading to dysfunction. Preliminary evidence suggests that various bone marrow-derived cell populations have antifibrotic effects. In exploring the therapeutic potential of bone marrow derived cells in chronic cardio-renal disease, we examined the anti-fibrotic effects of bone marrow-derived culture modified cells (CMCs) and stromal cells (SCs). Methodology/Principal Findings In vitro, CMC-conditioned medium, but not SC-conditioned medium, inhibited fibroblast collagen production and cell signalling in response to transforming growth factor-ß. The antifibrotic effects of CMCs and SCs were then evaluated in the 5/6 nephrectomy model of chronic cardio-renal disease. While intravascular infusion of 106 SCs had no effect, 106 CMCs reduced renal fibrosis compared to saline in the glomeruli (glomerulosclerosis index: 0.8±0.1 v 1.9±0.2 arbitrary units) and the tubulointersitium (% area type IV collagen: 1.2±0.3 v 8.4±2.0, p<0.05 for both). Similarly, 106 CMCs reduced cardiac fibrosis compared to saline (% area stained with picrosirius red: 3.2±0.3 v 5.1±0.4, p<0.05), whereas 106 SCs had no effect. Structural changes induced by CMC therapy were accompanied by improved function, as reflected by reductions in plasma creatinine (58±3 v 81±11 µmol/L), urinary protein excretion (9×/÷1 v 64×/÷1 mg/day), and diastolic cardiac stiffness (left ventricular end-diastolic pressure-volume relationship: 0.030±0.003 v 0.058±0.011 mm Hg/µL, p<0.05 for all). Despite substantial improvements in structure and function, only rare CMCs were present in the kidney and heart, whereas abundant CMCs were detected in the liver and spleen. Conclusions/Significance Together, these findings provide the first evidence suggesting that CMCs, but not SCs, exert a protective action in cardio-renal disease and that these effects may be mediated by the secretion of diffusible anti

  4. Early-outgrowth bone marrow cells attenuate renal injury and dysfunction via an antioxidant effect in a mouse model of type 2 diabetes.

    PubMed

    Zhang, Yanling; Yuen, Darren A; Advani, Andrew; Thai, Kerri; Advani, Suzanne L; Kepecs, David; Kabir, M Golam; Connelly, Kim A; Gilbert, Richard E

    2012-08-01

    Cell therapy has been extensively investigated in heart disease but less so in the kidney. We considered whether cell therapy also might be useful in diabetic kidney disease. Cognizant of the likely need for autologous cell therapy in humans, we sought to assess the efficacy of donor cells derived from both healthy and diabetic animals. Eight-week-old db/db mice were randomized to receive a single intravenous injection of PBS or 0.5 × 10(6) early-outgrowth cells (EOCs) from db/m or db/db mice. Effects were assessed 4 weeks after cell infusion. Untreated db/db mice developed mesangial matrix expansion and tubular epithelial cell apoptosis in association with increased reactive oxygen species (ROS) and overexpression of thioredoxin interacting protein (TxnIP). Without affecting blood glucose or blood pressure, EOCs not only attenuated mesangial and peritubular matrix expansion, as well as tubular apoptosis, but also diminished ROS and TxnIP overexpression in the kidney of db/db mice. EOCs derived from both diabetic db/db and nondiabetic db/m mice were equally effective in ameliorating kidney injury and oxidative stress. The similarly beneficial effects of cells from healthy and diabetic donors highlight the potential of autologous cell therapy in the related clinical setting.

  5. Do all β-blockers attenuate the excess hematopoietic progenitor cell mobilization from the bone marrow following trauma/hemorrhagic shock?

    PubMed

    Pasupuleti, Latha V; Cook, Kristin M; Sifri, Ziad C; Alzate, Walter D; Livingston, David H; Mohr, Alicia M

    2014-04-01

    Severe injury results in increased mobilization of hematopoietic progenitor cells (HPC) from the bone marrow (BM) to sites of injury, which may contribute to persistent BM dysfunction after trauma. Norepinephrine is a known inducer of HPC mobilization, and nonselective β-blockade with propranolol has been shown to decrease mobilization after trauma and hemorrhagic shock (HS). This study will determine the role of selective β-adrenergic receptor blockade in HPC mobilization in a combined model of lung contusion (LC) and HS. Male Sprague-Dawley rats were subjected to LC, followed by 45 minutes of HS. Animals were then randomized to receive atenolol (LCHS + β1B), butoxamine (LCHS + β2B), or SR59230A (LCHS + β3B) immediately after resuscitation and daily for 6 days. Control groups were composed of naive animals. BM cellularity, %HPCs in peripheral blood, and plasma granulocyte-colony stimulating factor levels were assessed at 3 hours and 7 days. Systemic plasma-mediated effects were evaluated in vitro by assessment of BM HPC growth. Injured lung tissue was graded histologically by a blinded reader. The use of β2B or β3B following LCHS restored BM cellularity and significantly decreased HPC mobilization. In contrast, β1B had no effect on HPC mobilization. Only β3B significantly reduced plasma G-CSF levels. When evaluating the plasma systemic effects, both β2B and β3B significantly improved BM HPC growth as compared with LCHS alone. The use of β2 and β3 blockade did not affect lung injury scores. Both β2 and β3 blockade can prevent excess HPC mobilization and BM dysfunction when given after trauma and HS, and the effects seem to be mediated systemically, without adverse effects on subsequent healing. Only treatment with β3 blockade reduced plasma G-CSF levels, suggesting different mechanisms for adrenergic-induced G-CSF release and mobilization of HPCs. This study adds to the evidence that therapeutic strategies that reduce the exaggerated sympathetic

  6. Photoacoustic computed tomography correcting for heterogeneity and attenuation

    PubMed Central

    Huang, Chao; Nie, Liming; Schoonover, Robert W.

    2012-01-01

    Abstract. We report an investigation of image reconstruction in photoacoustic tomography for objects that possess heterogeneous material and acoustic attenuation distributions. When the object contains materials, such as bone and soft-tissue, that are modeled using power law attenuation models with distinct exponents, we demonstrate that the effects of acoustic attenuation due to the most strongly attenuating material can be compensated for if the attenuation of the other less attenuating material(s) are neglected. Experiments with phantom objects are presented to validated our findings. PMID:22734741

  7. Pharmacological strategies in lung cancer-induced cachexia: effects on muscle proteolysis, autophagy, structure, and weakness.

    PubMed

    Chacon-Cabrera, Alba; Fermoselle, Clara; Urtreger, Alejandro J; Mateu-Jimenez, Mercè; Diament, Miriam J; de Kier Joffé, Elisa D Bal; Sandri, Marco; Barreiro, Esther

    2014-11-01

    Cachexia is a relevant comorbid condition of chronic diseases including cancer. Inflammation, oxidative stress, autophagy, ubiquitin-proteasome system, nuclear factor (NF)-κB, and mitogen-activated protein kinases (MAPK) are involved in the pathophysiology of cancer cachexia. Currently available treatment is limited and data demonstrating effectiveness in in vivo models are lacking. Our objectives were to explore in respiratory and limb muscles of lung cancer (LC) cachectic mice whether proteasome, NF-κB, and MAPK inhibitors improve muscle mass and function loss through several molecular mechanisms. Body and muscle weights, limb muscle force, protein degradation and the ubiquitin-proteasome system, signaling pathways, oxidative stress and inflammation, autophagy, contractile and functional proteins, myostatin and myogenin, and muscle structure were evaluated in the diaphragm and gastrocnemius of LC (LP07 adenocarcinoma) bearing cachectic mice (BALB/c), with and without concomitant treatment with NF-κB (sulfasalazine), MAPK (U0126), and proteasome (bortezomib) inhibitors. Compared to control animals, in both respiratory and limb muscles of LC cachectic mice: muscle proteolysis, ubiquitinated proteins, autophagy, myostatin, protein oxidation, FoxO-1, NF-κB and MAPK signaling pathways, and muscle abnormalities were increased, while myosin, creatine kinase, myogenin, and slow- and fast-twitch muscle fiber size were decreased. Pharmacological inhibition of NF-κB and MAPK, but not the proteasome system, induced in cancer cachectic animals, a substantial restoration of muscle mass and force through a decrease in muscle protein oxidation and catabolism, myostatin, and autophagy, together with a greater content of myogenin, and contractile and functional proteins. Attenuation of MAPK and NF-κB signaling pathway effects on muscles is beneficial in cancer-induced cachexia.

  8. Bone metastasis risk factors in breast cancer

    PubMed Central

    Pulido, Catarina; Vendrell, Inês; Ferreira, Arlindo R; Casimiro, Sandra; Mansinho, André; Alho, Irina; Costa, Luís

    2017-01-01

    Bone is the single most frequent site for bone metastasis in breast cancer patients. Patients with bone-only metastasis have a fairly good prognosis when compared with patients with visceral disease. Nevertheless, cancer-induced bone disease carries an important risk of developing skeletal related events that impact quality of life (QoL). It is therefore particularly important to stratify patients according to their risk of developing bone metastasis. In this context, several risk factors have been studied, including demographic, clinicopathological, genetic, and metabolic factors. Most of them show conflicting or non-definitive associations and are not validated for clinical use. Nonetheless, tumour intrinsic subtype is widely accepted as a major risk factor for bone metastasis development and luminal breast cancer carries an increased risk for bone disease. Other factors such as gene signatures, expression of specific cytokines (such as bone sialoprotein and bone morphogenetic protein 7) or components of the extracellular matrix (like bone crosslinked C-telopeptide) might also influence the development of bone metastasis. Knowledge of risk factors related with bone disease is of paramount importance as it might be a prediction tool for triggering the use of targeted agents and allow for better patient selection for future clinical trials. PMID:28194227

  9. Role of PARP activity in lung cancer-induced cachexia: Effects on muscle oxidative stress, proteolysis, anabolic markers, and phenotype.

    PubMed

    Chacon-Cabrera, Alba; Mateu-Jimenez, Mercè; Langohr, Klaus; Fermoselle, Clara; García-Arumí, Elena; Andreu, Antoni L; Yelamos, Jose; Barreiro, Esther

    2017-12-01

    Strategies to treat cachexia are still at its infancy. Enhanced muscle protein breakdown and ubiquitin-proteasome system are common features of cachexia associated with chronic conditions including lung cancer (LC). Poly(ADP-ribose) polymerases (PARP), which play a major role in chromatin structure regulation, also underlie maintenance of muscle metabolism and body composition. We hypothesized that protein catabolism, proteolytic markers, muscle fiber phenotype, and muscle anabolism may improve in respiratory and limb muscles of LC-cachectic Parp-1-deficient (Parp-1(-/-) ) and Parp-2(-/-) mice. In diaphragm and gastrocnemius of LC (LP07 adenocarcinoma) bearing mice (wild type, Parp-1(-/-) , and Parp-2(-/-) ), PARP activity (ADP-ribose polymers, pADPr), redox balance, muscle fiber phenotype, apoptotic nuclei, tyrosine release, protein ubiquitination, muscle-specific E3 ligases, NF-κB signaling pathway, markers of muscle anabolism (Akt, mTOR, p70S6K, and mitochondrial DNA) were evaluated along with body and muscle weights, and limb muscle force. Compared to wild type cachectic animals, in both respiratory and limb muscles of Parp-1(-/-) and Parp-2(-/-) cachectic mice: cancer induced-muscle wasting characterized by increased PARP activity, protein oxidation, tyrosine release, and ubiquitin-proteasome system (total protein ubiquitination, atrogin-1, and 20S proteasome C8 subunit) were blunted, the reduction in contractile myosin and atrophy of the fibers was attenuated, while no effects were seen in other structural features (inflammatory cells, internal or apoptotic nuclei), and markers of muscle anabolism partly improved. Activation of either PARP-1 or -2 is likely to play a role in muscle protein catabolism via oxidative stress, NF-κB signaling, and enhanced proteasomal degradation in cancer-induced cachexia. Therapeutic potential of PARP activity inhibition deserves attention. © 2017 Wiley Periodicals, Inc.

  10. Bone Diseases

    MedlinePlus

    ... avoid smoking and drinking too much alcohol. Bone diseases can make bones easy to break. Different kinds ... break Osteogenesis imperfecta makes your bones brittle Paget's disease of bone makes them weak Bones can also ...

  11. Biomaterial scaffolds for treating osteoporotic bone

    PubMed Central

    Sterling, Julie A.

    2014-01-01

    Healing fractures resulting from osteoporosis or cancer remains a significant clinical challenge. In these populations, healing is often impaired not only due to age and disease, but also by other therapeutic interventions such as radiation, steroids, and chemotherapy. Despite substantial improvements in the treatment of osteoporosis over the few decades, osteoporotic fractures are still a major clinical challenge in the elderly population due to impaired healing. Similar fractures with impaired healing are also prevalent in cancer patients, especially those with tumor growing in bone. Treatment options for cancer patients are further complicated by the fact that bone anabolic therapies are contraindicated in patients with tumors. Therefore, many patients undergo surgery to repair the fracture, and bone grafts are often used to stabilize orthopaedic implants and provide a scaffold for ingrowth of new bone. Both synthetic and naturally occurring biomaterials have been investigated as bone grafts for repair of osteoporotic fractures, including calcium phosphate bone cements, resorbable polymers, and allograft or autograft bone. In order to re-establish normal bone repair, bone grafts have been augmented with anabolic agents, such as mesenchymal stem cells (MSC) or recombinant human bone morphogenetic protein-2 (rhBMP2). These developing approaches to bone grafting are anticipated to improve the clinical management of osteoporotic and cancer-induced fractures. PMID:24458428

  12. Rotary antenna attenuator

    NASA Technical Reports Server (NTRS)

    Dickinson, R. M.; Hardy, J. C.

    1969-01-01

    Radio frequency attenuator, having negligible insertion loss at minimum attenuation, can be used for making precise antenna gain measurements. It is small in size compared to a rotary-vane attenuator.

  13. Wnt signaling pathway: implications for therapy in lung cancer and bone metastasis.

    PubMed

    Xi, Yongming; Chen, Yan

    2014-10-10

    Lung cancer remains a major worldwide health problem and patients have high rate of metastasis including bone. Although pathologic characteristics of this disease are clear and well established, much remains to be understood about this tumor, particularly at the molecular signaling level. Secreted signaling molecules of the Wnt family have been widely investigated and found to play a prominent role to induce human malignant diseases, such as breast and prostate cancer. A variety of studies have also demonstrated that the Wnt signaling pathway is closely associated with bone malignancies including osteosarcoma, multiple myeloma, and breast or prostate cancer induced bone metastasis. The aim of this review is to provide a summary regarding the role of the Wnt signaling pathway in lung cancer and bone metastasis, highlighting the aberrant activation of Wnt in this malignancy. We also discuss the potential therapeutic applications for the treatment of lung cancer and cancer induced bone metastasis targeting the Wnt pathway.

  14. Active ghrelin levels and active to total ghrelin ratio in cancer-induced cachexia.

    PubMed

    Garcia, Josè M; Garcia-Touza, Mariana; Hijazi, Rabih A; Taffet, George; Epner, Daniel; Mann, Douglas; Smith, Roy G; Cunningham, Glenn R; Marcelli, Marco

    2005-05-01

    Anorexia and weight loss are negative prognostic factors in patients with cancer. Although total ghrelin levels are increased in energy-negative states, levels of the biologically active octanoylated ghrelin and the anorexigenic peptide YY (PYY) have not been reported in patients with cancer-induced cachexia. We hypothesized that abnormal ghrelin and/or PYY levels contribute to cancer-induced cachexia. We evaluated 21 patients with cancer-induced cachexia; 24 cancer patients without cachexia; and 23 age-, sex-, race-, and BMI-matched subjects without cancer. Active ghrelin levels and the active to total ghrelin ratio were significantly increased in subjects with cancer-induced cachexia, compared with cancer and noncancer controls. PYY levels were similar among groups. Appetite measured by a visual analog scale was not increased in subjects with cachexia. The increase in active ghrelin levels is likely to be a compensatory response to weight loss. Cachexia may be a state of ghrelin resistance because appetite does not correlate with ghrelin levels. Changes in the active to total ghrelin ratio suggest that a mechanism other than increased secretion must be responsible for the increase in active ghrelin levels. PYY is unlikely to play an important role in cancer-induced cachexia.

  15. JiangTang XiaoKe granule attenuates cathepsin K expression and improves IGF-1 expression in the bone of high fat diet induced KK-Ay diabetic mice.

    PubMed

    Guo, Yubo; Wang, Lili; Ma, Rufeng; Mu, Qianqian; Yu, Na; Zhang, Yi; Tang, Yuqing; Li, Yu; Jiang, Guangjian; Zhao, Dandan; Mo, Fangfang; Gao, Sihua; Yang, Meijuan; Kan, Feifei; Ma, Qun; Fu, Min; Zhang, Dongwei

    2016-03-01

    To assess the beneficial effects of JiangTang XiaoKe (JTXK) granule on the bone metabolism in high fat diet (HFD) fed KK-Ay diabetic mice. The KK-Ay mice were used as a diabetic model, while C57BL/6 mice were utilized as the non-diabetic control. The left tibia was used for determining bone mineral density (BMD) and bone ash coefficient. The HE and alizarin red S staining of femur were employed to evaluate bone pathology and calcium deposition. The expressions of alkaline phosphatase (ALP), insulin growth factor 1 (IGF-1) and cathepsin K were assessed by western blotting and immunohistochemical staining. JTXK granule significantly improved the bone ash coefficient, the distribution of trabecular bone and the calcification nodules deposition in KK-Ay mice with diabetes. IGF-1 and ALP expressions were significantly decreased, and cathepsin K expression was dramatically increased in the HFD fed KK-Ay diabetic model mice, which can be reversed by JTXK granule treatment. JTXK granule at medium or high dosage was more efficient in improving diabetic bone quality when compared with that in mice with a low dosage. However, the BMD values in each group of KK-Ay diabetic mice were not significantly different. We demonstrate that cathepsin K expression is increased in KK-Ay diabetic mouse model. JTXK granule treatment inhibits osteoclastic bone resorption and promotes the new bone formation by decreasing cathepsin K activity and increasing IGF-1 and ALP levels. These changes may contribute to the increase of bone strength and thus reducing the risk of bone fractures. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. JNK in spinal cord facilitates bone cancer pain in rats through modulation of CXCL1.

    PubMed

    Wang, Zhong-liang; Du, Ting-ting; Zhang, Rui-guang

    2016-02-01

    In patients with advanced cancer, cancer-induced bone pain (CIBP) is a severe and common problem that is difficult to manage and explain. As c-Jun N-terminal kinase (JNK) and chemokine (C-X-C motif) ligand 1 (CXCL1) have been shown to participate in several chronic pain processes, we investigated the role of JNK and CXCL1 in CIBP and the relationship between them. A rat bone cancer pain model was established by intramedullary injection of Walker 256 rat gland mammary carcinoma cells into the left tibia of Sprague-Dawley rats. As a result, intramedullary injection of Walker 256 carcinoma cells induced significant bone destruction and persistent pain. Both phosphorylated JNK1 (pJNK1) and pJNK2 showed time-dependent increases in the ipsilateral spinal cord from day 7 to day 18 after tumor injection. Inhibition of JNK activation by intrathecal administration of SP600125, a selective pJNK inhibitor, attenuated mechanical allodynia and heat hyperalgesia caused by tumor inoculation. Tumor cell inoculation also induced robust CXCL1 upregulation in the ipsilateral spinal cord on day 18 after tumor injection. Inhibition of CXCL1 by intrathecal administration of CXCL1 neutralizing antibody showed a stable analgesic effect. Intrathecal administration of SP600125 reduced CXCL1 increase in the spinal cord, whereas inhibition of CXCL1 in the spinal cord showed no influence on JNK activation. Taken together, these results suggested that JNK activation in spinal cord contributed to the maintenance of CIBP, which may act through modulation of CXCL1. Inhibition of the pJNK/CXCL1 pathway may provide a new choice for treatment of CIBP.

  17. DC attenuation meter

    DOEpatents

    Hargrove, Douglas L.

    2004-09-14

    A portable, hand-held meter used to measure direct current (DC) attenuation in low impedance electrical signal cables and signal attenuators. A DC voltage is applied to the signal input of the cable and feedback to the control circuit through the signal cable and attenuators. The control circuit adjusts the applied voltage to the cable until the feedback voltage equals the reference voltage. The "units" of applied voltage required at the cable input is the system attenuation value of the cable and attenuators, which makes this meter unique. The meter may be used to calibrate data signal cables, attenuators, and cable-attenuator assemblies.

  18. Osteolytica: An automated image analysis software package that rapidly measures cancer-induced osteolytic lesions in in vivo models with greater reproducibility compared to other commonly used methods☆

    PubMed Central

    Evans, H.R.; Karmakharm, T.; Lawson, M.A.; Walker, R.E.; Harris, W.; Fellows, C.; Huggins, I.D.; Richmond, P.; Chantry, A.D.

    2016-01-01

    Methods currently used to analyse osteolytic lesions caused by malignancies such as multiple myeloma and metastatic breast cancer vary from basic 2-D X-ray analysis to 2-D images of micro-CT datasets analysed with non-specialised image software such as ImageJ. However, these methods have significant limitations. They do not capture 3-D data, they are time-consuming and they often suffer from inter-user variability. We therefore sought to develop a rapid and reproducible method to analyse 3-D osteolytic lesions in mice with cancer-induced bone disease. To this end, we have developed Osteolytica, an image analysis software method featuring an easy to use, step-by-step interface to measure lytic bone lesions. Osteolytica utilises novel graphics card acceleration (parallel computing) and 3-D rendering to provide rapid reconstruction and analysis of osteolytic lesions. To evaluate the use of Osteolytica we analysed tibial micro-CT datasets from murine models of cancer-induced bone disease and compared the results to those obtained using a standard ImageJ analysis method. Firstly, to assess inter-user variability we deployed four independent researchers to analyse tibial datasets from the U266-NSG murine model of myeloma. Using ImageJ, inter-user variability between the bones was substantial (± 19.6%), in contrast to using Osteolytica, which demonstrated minimal variability (± 0.5%). Secondly, tibial datasets from U266-bearing NSG mice or BALB/c mice injected with the metastatic breast cancer cell line 4T1 were compared to tibial datasets from aged and sex-matched non-tumour control mice. Analyses by both Osteolytica and ImageJ showed significant increases in bone lesion area in tumour-bearing mice compared to control mice. These results confirm that Osteolytica performs as well as the current 2-D ImageJ osteolytic lesion analysis method. However, Osteolytica is advantageous in that it analyses over the entirety of the bone volume (as opposed to selected 2-D images

  19. Bone microenvironment-mediated resistance of cancer cells to bisphosphonates and impact on bone osteocytes/stem cells.

    PubMed

    Alasmari, Abeer; Lin, Shih-Chun; Dibart, Serge; Salih, Erdjan

    2016-08-01

    Anti-resorptive bisphosphonates (BPs) have been clinically used to prevent cancer-bone metastasis and cancer-induced bone pathologies despite the fact that the phenotypic response of the cancer-bone interactions to BP exposure is "uncharted territory". This study offers unique insights into the interplay between cancer stem cells and osteocytes/osteoblasts and mesenchymal stem cells using a three-dimensional (3D) live cancer-bone interactive model. We provide extraordinary cryptic details of the biological events that occur as a result of alendronate (ALN) treatment using 3D live cancer-bone model systems under specific bone remodeling stages. While cancer cells are susceptible to BP treatment in the absence of bone, they are totally unaffected in the presence of bone. Cancer cells colonize live bone irrespective of whether the bone is committed to bone resorption or formation and hence, cancer-bone metastasis/interactions are though to be "independent of bone remodeling stages". In our 3D live bone model systems, ALN inhibited bone resorption at the osteoclast differentiation level through effects of mineral-bound ALN on osteocytes and osteoblasts. The mineral-bound ALN rendered bone incapable of osteoblast differentiation, while cancer cells colonize the bone with striking morphological adaptations which led to a conclusion that a direct anti-cancer effect of BPs in a "live or in vivo" bone microenvironment is implausible. The above studies were complemented with mass spectrometric analysis of the media from cancer-bone organ cultures in the absence and presence of ALN. The mineral-bound ALN impacts the bone organs by limiting transformation of mesenchymal stem cells to osteoblasts and leads to diminished endosteal cell population and degenerated osteocytes within the mineralized bone matrix.

  20. The Walker 256 Breast Cancer Cell- Induced Bone Pain Model in Rats.

    PubMed

    Shenoy, Priyank A; Kuo, Andy; Vetter, Irina; Smith, Maree T

    2016-01-01

    The majority of patients with terminal breast cancer show signs of bone metastasis, the most common cause of pain in cancer. Clinically available drug treatment options for the relief of cancer-associated bone pain are limited due to either inadequate pain relief and/or dose-limiting side-effects. One of the major hurdles in understanding the mechanism by which breast cancer causes pain after metastasis to the bones is the lack of suitable preclinical models. Until the late twentieth century, all animal models of cancer induced bone pain involved systemic injection of cancer cells into animals, which caused severe deterioration of animal health due to widespread metastasis. In this mini-review we have discussed details of a recently developed and highly efficient preclinical model of breast cancer induced bone pain: Walker 256 cancer cell- induced bone pain in rats. The model involves direct localized injection of cancer cells into a single tibia in rats, which avoids widespread metastasis of cancer cells and hence animals maintain good health throughout the experimental period. This model closely mimics the human pathophysiology of breast cancer induced bone pain and has great potential to aid in the process of drug discovery for treating this intractable pain condition.

  1. The Walker 256 Breast Cancer Cell- Induced Bone Pain Model in Rats

    PubMed Central

    Shenoy, Priyank A.; Kuo, Andy; Vetter, Irina; Smith, Maree T.

    2016-01-01

    The majority of patients with terminal breast cancer show signs of bone metastasis, the most common cause of pain in cancer. Clinically available drug treatment options for the relief of cancer-associated bone pain are limited due to either inadequate pain relief and/or dose-limiting side-effects. One of the major hurdles in understanding the mechanism by which breast cancer causes pain after metastasis to the bones is the lack of suitable preclinical models. Until the late twentieth century, all animal models of cancer induced bone pain involved systemic injection of cancer cells into animals, which caused severe deterioration of animal health due to widespread metastasis. In this mini-review we have discussed details of a recently developed and highly efficient preclinical model of breast cancer induced bone pain: Walker 256 cancer cell- induced bone pain in rats. The model involves direct localized injection of cancer cells into a single tibia in rats, which avoids widespread metastasis of cancer cells and hence animals maintain good health throughout the experimental period. This model closely mimics the human pathophysiology of breast cancer induced bone pain and has great potential to aid in the process of drug discovery for treating this intractable pain condition. PMID:27630567

  2. Heptamethoxyflavone, a citrus flavonoid, suppresses inflammatory osteoclastogenesis and alveolar bone resorption.

    PubMed

    Matsumoto, Chiho; Inoue, Hiroki; Tominari, Tsukasa; Watanabe, Kenta; Hirata, Michiko; Miyaura, Chisato; Inada, Masaki

    2015-01-01

    We examined the effects of heptamethoxyflavone (HMF), a citrus flavonoid on inflammatory bone resorption. HMF suppressed the osteoclast formation and PGE2 production induced by IL-1. In mouse calvarial organ cultures, HMF attenuated the bone resorption elicited by LPS. HMF suppressed bone resorption in the mandibular alveolar bone. HMF may protect against inflammatory bone loss such as periodontal disease.

  3. Pressure surge attenuator

    DOEpatents

    Christie, Alan M.; Snyder, Kurt I.

    1985-01-01

    A pressure surge attenuation system for pipes having a fluted region opposite crushable metal foam. As adapted for nuclear reactor vessels and heads, crushable metal foam is disposed to attenuate pressure surges.

  4. Living Bones, Strong Bones

    NASA Image and Video Library

    In this classroom activity, engineering, nutrition, and physical activity collide when students design and build a healthy bone model of a space explorer which is strong enough to withstand increas...

  5. Models of ex vivo explant cultures: applications in bone research

    PubMed Central

    Marino, Silvia; Staines, Katherine Ann; Brown, Genevieve; Howard-Jones, Rachel Anne; Adamczyk, Magdalena

    2016-01-01

    Ex vivo explant culture models are powerful tools in bone research. They allow investigation of bone and cartilage responses to specific stimuli in a controlled manner that closely mimics the in vivo processes. Because of limitations in obtaining healthy human bone samples the explant growth of animal tissue serves as a platform to study the complex physico-chemical properties of the bone. Moreover, these models enable preserving important cell–cell and cell–matrix interactions in order to better understand the behaviour of cells in their natural three-dimensional environment. Thus, the use of bone ex vivo explant cultures can frequently be of more physiological relevance than the use of two-dimensional primary cells grown in vitro. Here, we describe isolation and ex vivo growth of different animal bone explant models including metatarsals, femoral heads, calvaria, mandibular slices and trabecular cores. We also describe how these explants are utilised to study bone development, cartilage and bone metabolism, cancer-induced bone diseases, stem cell-driven bone repair and mechanoadaptation. These techniques can be directly used to understand mechanisms linked with bone physiology or bone-associated diseases. PMID:27408711

  6. Inhibition of bone resorption and growth of breast cancer in the bone microenvironment.

    PubMed

    Buijs, Jeroen T; Que, Ivo; Löwik, Clemens W G M; Papapoulos, Socrates E; van der Pluijm, Gabri

    2009-02-01

    Breast cancer frequently metastasizes to bone, where tumor cells induce osteoclasts to locally destroy bone. During bone resorption, growth factors are locally released that may support bone metastatic growth. Differently from most other tissues, drugs that can limit local turnover, such as bisphosphonates and osteoprotegerin (OPG), are available for bone. We examined the hypothesis that inhibition of bone resorption by two different mechanisms may also affect the growth of cancer cells in bone. For this, we tested the effects of high doses of OPG and zoledronic acid (ZOL) on progression of MDA-231-B/Luc+ breast cancer cells in the bone microenvironment using whole body bioluminescent reporter imaging (BLI). Both treatments significantly inhibited the development of radiographically detectable osteolytic lesions. Histologic examination corroborated the radiographic findings, showing that both treatments preserved the integrity of bone trabeculae and prevented bone destruction (significantly higher trabecular bone volumes vs. vehicle). However, whereas practically no TRAcP-positive osteoclasts were observed in tibiae preparations of animals treated with Fc-OPG, TRAcP-positive osteoclasts were still present in the animals treated with ZOL. Intra-bone tumor burden was reduced with ZOL and Fc-OPG treatment. Although there appeared to be a trend for less overall total tumor burden upon treatment with both compounds, this was not significant as assessed by BLI and histomorphometric analysis due to the extramedullary growth of cancer cells which was not affected by these treatments. Collectively, anti-resorptive agents with different mechanisms of action - ZOL and OPG - significantly reduced cancer-induced osteolysis and intra-osseous tumor burden, but failed to restrain local tumor growth. However, interference with the bone micro-environmental growth support could still be of therapeutic relevance when given to patients early in the course of bone metastatic disease.

  7. Bone Cancer

    MedlinePlus

    Cancer that starts in a bone is uncommon. Cancer that has spread to the bone from another ... more common. There are three types of bone cancer: Osteosarcoma - occurs most often between ages 10 and ...

  8. Tracer attenuation in groundwater

    NASA Astrophysics Data System (ADS)

    Cvetkovic, Vladimir

    2011-12-01

    The self-purifying capacity of aquifers strongly depends on the attenuation of waterborne contaminants, i.e., irreversible loss of contaminant mass on a given scale as a result of coupled transport and transformation processes. A general formulation of tracer attenuation in groundwater is presented. Basic sensitivities of attenuation to macrodispersion and retention are illustrated for a few typical retention mechanisms. Tracer recovery is suggested as an experimental proxy for attenuation. Unique experimental data of tracer recovery in crystalline rock compare favorably with the theoretical model that is based on diffusion-controlled retention. Non-Fickian hydrodynamic transport has potentially a large impact on field-scale attenuation of dissolved contaminants.

  9. The Emerging Role of Skeletal Muscle Metabolism as a Biological Target and Cellular Regulator of Cancer-Induced Muscle Wasting

    PubMed Central

    Carson, James A.; Hardee, Justin P.; VanderVeen, Brandon N.

    2015-01-01

    While skeletal muscle mass is an established primary outcome related to understanding cancer cachexia mechanisms, considerable gaps exist in our understanding of muscle biochemical and functional properties that have recognized roles in systemic health. Skeletal muscle quality is a classification beyond mass, and is aligned with muscle’s metabolic capacity and substrate utilization flexibility. This supplies an additional role for the mitochondria in cancer-induced muscle wasting. While the historical assessment of mitochondria content and function during cancer-induced muscle loss was closely aligned with energy flux and wasting susceptibility, this understanding has expanded to link mitochondria dysfunction to cellular processes regulating myofiber wasting. The primary objective of this article is to highlight muscle mitochondria and oxidative metabolism as a biological target of cancer cachexia and also as a cellular regulator of cancer-induced muscle wasting. Initially, we examine the role of muscle metabolic phenotype and mitochondria content in cancer-induced wasting susceptibility. We then assess the evidence for cancer-induced regulation of skeletal muscle mitochondrial biogenesis, dynamics, mitophagy, and oxidative stress. In addition, we discuss environments associated with cancer cachexia that can impact the regulation of skeletal muscle oxidative metabolism. The article also examines the role of cytokine-mediated regulation of mitochondria function regulation, followed by the potential role of cancer-induced hypogonadism. Lastly, a role for decreased muscle use in cancer-induced mitochondrial dysfunction is reviewed. PMID:26593326

  10. Bone and bone turnover.

    PubMed

    Crofton, Patricia M

    2009-01-01

    Children with cancer are exposed to multiple influences that may adversely affect bone health. Some treatments have direct deleterious effects on bone whilst others may have indirect effects mediated through various endocrine abnormalities. Most clinical outcome studies have concentrated on survivors of acute lymphoblastic leukaemia (ALL). There is now good evidence that earlier treatment protocols that included cranial irradiation with doses of 24 Gy or greater may result in growth hormone deficiency and low bone mineral density (BMD) in the lumbar spine and femoral neck. Under current protocols, BMD decreases during intensive chemotherapy and fracture risk increases. Although total body BMD may eventually return to normal after completion of chemotherapy, lumbar spine trabecular BMD may remain low for many years. The implications for long-term fracture risk are unknown. Risk factors for low BMD include high dose methotrexate, higher cumulative doses of glucocorticoids, male gender and low physical activity. BMD outcome in non-ALL childhood cancers has been less well studied but there is evidence that survivors of childhood brain or bone tumours, and survivors of bone marrow transplants for childhood malignancy, all have a high risk of long-term osteopenia. Long-term follow-up is required, with appropriate treatment of any endocrine abnormalities identified.

  11. Using Micro-CT Derived Bone Microarchitecture to Analyze Bone Stiffness – A Case Study on Osteoporosis Rat Bone

    PubMed Central

    Wu, Yuchin; Adeeb, Samer; Doschak, Michael R.

    2015-01-01

    Micro-computed tomography (Micro-CT) images can be used to quantitatively represent bone geometry through a range of computed attenuation-based parameters. Nonetheless, those parameters remain indirect indices of bone microarchitectural strength and require further computational tools to interpret bone structural stiffness and potential for mechanical failure. Finite element analysis (FEA) can be applied to measure trabecular bone stiffness and potentially predict the location of structural failure in preclinical animal models of osteoporosis, although that procedure from image segmentation of Micro-CT derived bone geometry to FEA is often challenging and computationally expensive, resulting in failure of the model to build. Notably, the selection of resolution and threshold for bone segmentation are key steps that greatly affect computational complexity and validity. In the following study, we evaluated an approach whereby Micro-CT derived grayscale attenuation and segmentation data guided the selection of trabecular bone for analysis by FEA. We further correlated those FEA results to both two- and three-dimensional bone microarchitecture from sham and ovariectomized (OVX) rats (n = 10/group). A virtual cylinder of vertebral trabecular bone 40% in length from the caudal side was selected for FEA, because Micro-CT based image analysis indicated the largest differences in microarchitecture between the two groups resided there. Bone stiffness was calculated using FEA and statistically correlated with the three-dimensional values of bone volume/tissue volume, bone mineral density, fractal dimension, trabecular separation, and trabecular bone pattern factor. Our method simplified the process for the assessment of trabecular bone stiffness by FEA from Micro-CT images and highlighted the importance of bone microarchitecture in conferring significantly increased bone quality capable of resisting failure due to increased mechanical loading. PMID:26042089

  12. BRMS1 Suppresses Breast Cancer Metastasis to Bone via its Regulation of microRNA-125b and Downstream Attenuation of TNF-alpha and HER2 Signaling Pathways

    DTIC Science & Technology

    2012-10-01

    Stat3 translocated into nucleus of both vector and BRMS1- expressing cells at a similar rate (Fig. 3d ), suggesting that there may be another method of...capabilities to metastasize to ovaries, liver, lungs, kidneys, and bones following intravenous injection. We also observed skull -restricted bioluminescent... printing ” preformed by the institutional core facility confirmed that cell lines used exhibit properties of MDA- MB-231 cells consistent with ATCC profile

  13. Variable laser attenuator

    DOEpatents

    Foltyn, Stephen R.

    1988-01-01

    The disclosure relates to low loss, high power variable attenuators comprng one or more transmissive and/or reflective multilayer dielectric filters. The attenuator is particularly suitable to use with unpolarized lasers such as excimer lasers. Beam attenuation is a function of beam polarization and the angle of incidence between the beam and the filter and is controlled by adjusting the angle of incidence the beam makes to the filter or filters. Filters are selected in accordance with beam wavelength.

  14. Variable laser attenuator

    DOEpatents

    Foltyn, S.R.

    1987-05-29

    The disclosure relates to low loss, high power variable attenuators comprising one or more transmissive and/or reflective multilayer dielectric filters. The attenuator is particularly suitable to use with unpolarized lasers such as excimer lasers. Beam attenuation is a function of beam polarization and the angle of incidence between the beam and the filter and is controlled by adjusting the angle of incidence the beam makes to the filter or filters. Filters are selected in accordance with beam wavelength. 9 figs.

  15. Microwave variable waveguide attenuator.

    PubMed

    Fabeni, P; Mugnai, D; Pazzi, G P; Ranfagni, A

    2008-06-01

    A new type of cutoff attenuator is presented. The attenuator works in the X-band in conditions of almost perfect matching. This means that the phase of the wave, which propagates inside the guide, does not suffer sensible variation in the passage between X- and K(u)-bands. Moreover, the attenuator works directly in the X-band, avoiding the passage between waveguide and cable, thus eliminating spurious effects due to this (double) passage. Experimental results of attenuation and dephasing using a prototype are also presented.

  16. Bone marrow aspiration

    MedlinePlus

    Iliac crest tap; Sternal tap; Leukemia - bone marrow aspiration; Aplastic anemia - bone marrow aspiration; Myelodysplastic syndrome - bone marrow aspiration; Thrombocytopenia - bone marrow aspiration; Myelofibrosis - bone marrow aspiration

  17. Investigation of the use of X-ray CT images for attenuation compensation in SPECT

    SciTech Connect

    LaCroix, K.J.; Tsui, B.M.W. ); Hasegawa, B.H.; Brown, J.K. )

    1994-12-01

    This study investigates the general use of single-beam X-ray computed tomography (CT) images for generating attenuation maps for compensation of photon attenuation in SPECT images. A 3D mathematical thorax phantom is used to simulate both emission and transmission projection data for monoenergetic and polyenergetic sources. Polyenergetic transmission projection data are simulated for a standard X-ray spectrum and fan-beam geometry. The projection data are reconstructed using filtered backprojection to form an X-ray CT image which is then scaled to produce an estimate of the attenuation map at the energy of the emission radionuclide. Emission projection data are simulated for a fan-beam geometry at the energies of [sup 201]Tl and [sup 99m]Tc, two radionuclides commonly used in cardiac SPECT. Detector response and scatter are not included in the model. Noiseless, emission projection data are iteratively reconstructed using the ML-EM algorithm with nonuniform attenuation compensation and attenuation maps derived from both the simulated X-ray CT image and from a simulated monoenergetic transmission CT image. The attenuation maps generated from the X-ray CT images accurately estimate the attenuation coefficient for muscle and lung tissues, but not for bone tissues, which show error in the attenuation coefficient of 21--42% for spinal bone and 34--58% for rib bone. However, despite the inaccurate estimate of bone attenuation, the reconstructed SPECT images provide estimates of myocardial radioactivity concentration to within 9% and show few artifacts.

  18. Activation of spinal MrgC-Gi-NR2B-nNOS signaling pathway by Mas oncogene-related gene C receptor agonist bovine adrenal medulla 8-22 attenuates bone cancer pain in mice.

    PubMed

    Sun, Yu'e; Zhang, Juan; Lei, Yishan; Lu, Cui'e; Hou, Bailing; Ma, Zhengliang; Gu, Xiaoping

    2016-01-01

    In the present study, we investigate the effects of Mas oncogene-related gene (Mrg) C receptors (MrgC) on the expression and activation of spinal Gi protein, N-methyl-D-aspartate receptor subunit 2B (NR2B), and neuronal nitric oxide synthase (nNOS) in mouse model of bone cancer pain. The number of spontaneous foot lift (NSF) and paw withdrawal mechanical threshold (PWMT) were measured after inoculation of tumor cells and intrathecal injection of MrgC agonist bovine adrenal medulla 8-22 (BAM8-22) or MrgC antagonist anti-MrgC for 14 days after operation. Expression of spinal MrgC, Gi protein, NR2B and nNOS and their phosphorylated forms after inoculation was examined by immunohistochemistry and Western blotting. Double labeling was used to identify the co-localization of NR2B or nNOS with MrgC in spinal cord dorsal horn (SCDH) neurons. The effects of intrathecal injection of BAM8-22 or anti-MrgC on nociceptive behaviors and the corresponding expression of spinal MrgC, Gi protein, NR2B and nNOS were also investigated. The expression of spinal MrgC, Gi protein, NR2B, and nNOS was higher in tumor-bearing mice in comparison to sham mice or normal mice. Intrathecal injection of MrgC agonist BAM8-22 significantly alleviated bone cancer pain, up-regulated MrgC and Gi protein expression, and down-regulated the expression of spinal p-NR2B, t-nNOS and p-nNOS in SCDH on day 14 after operation, whereas administration of anti-MrgC produced the opposite effect. Meanwhile, MrgC-like immunoreactivity (IR) co-localizes with NR2B-IR or nNOS-IR in SCDH neurons. The present study demonstrates that MrgC-activated spinal Gi-NR2B-nNOS signaling pathway plays important roles in the development of bone cancer pain. These findings may provide a novel strategy for the treatment of bone cancer pain.

  19. Activation of spinal MrgC-Gi-NR2B-nNOS signaling pathway by Mas oncogene-related gene C receptor agonist bovine adrenal medulla 8-22 attenuates bone cancer pain in mice

    PubMed Central

    Sun, Yu’e; Zhang, Juan; Lei, Yishan; Lu, Cui’e; Hou, Bailing; Ma, Zhengliang; Gu, Xiaoping

    2016-01-01

    Objectives: In the present study, we investigate the effects of Mas oncogene-related gene (Mrg) C receptors (MrgC) on the expression and activation of spinal Gi protein, N-methyl-D-aspartate receptor subunit 2B (NR2B), and neuronal nitric oxide synthase (nNOS) in mouse model of bone cancer pain. Methods: The number of spontaneous foot lift (NSF) and paw withdrawal mechanical threshold (PWMT) were measured after inoculation of tumor cells and intrathecal injection of MrgC agonist bovine adrenal medulla 8-22 (BAM8-22) or MrgC antagonist anti-MrgC for 14 days after operation. Expression of spinal MrgC, Gi protein, NR2B and nNOS and their phosphorylated forms after inoculation was examined by immunohistochemistry and Western blotting. Double labeling was used to identify the co-localization of NR2B or nNOS with MrgC in spinal cord dorsal horn (SCDH) neurons. The effects of intrathecal injection of BAM8-22 or anti-MrgC on nociceptive behaviors and the corresponding expression of spinal MrgC, Gi protein, NR2B and nNOS were also investigated. Results: The expression of spinal MrgC, Gi protein, NR2B, and nNOS was higher in tumor-bearing mice in comparison to sham mice or normal mice. Intrathecal injection of MrgC agonist BAM8-22 significantly alleviated bone cancer pain, up-regulated MrgC and Gi protein expression, and down-regulated the expression of spinal p-NR2B, t-nNOS and p-nNOS in SCDH on day 14 after operation, whereas administration of anti-MrgC produced the opposite effect. Meanwhile, MrgC-like immunoreactivity (IR) co-localizes with NR2B-IR or nNOS-IR in SCDH neurons. Conclusions: The present study demonstrates that MrgC-activated spinal Gi-NR2B-nNOS signaling pathway plays important roles in the development of bone cancer pain. These findings may provide a novel strategy for the treatment of bone cancer pain. PMID:27158400

  20. Bone Fracture Exacerbates Murine Ischemic Cerebral Injury

    PubMed Central

    Degos, Vincent; Maze, Mervyn; Vacas, Susana; Hirsch, Jan; Guo, Yi; Shen, Fanxia; Jun, Kristine; van Rooijen, Nico; Gressens, Pierre; Young, William L.; Su, Hua

    2014-01-01

    Background Bone fracture increases alarmins and pro-inflammatory cytokines in the blood, and provokes macrophage infiltration and pro-inflammatory cytokine expression in the hippocampus. We recently reported that stroke is an independent risk factor after bone surgery for adverse outcome, the impact of bone fracture on stroke outcome is unknown. We tested the hypothesis that bone fracture, shortly after ischemic stroke, enhances stroke-related injuries by augmenting the neuroinflammatory response. Methods Tibia fracture (bone fracture) was induced in mice one day after permanent occlusion of the distal middle cerebral artery (stroke). High-mobility-group box chromosomal protein-1 (HMGB1) was tested to mimic the bone fracture effects. HMGB1 neutralizing antibody and clodrolip (macrophage depletion) were tested to attenuate the bone fracture effects. Neurobehavioral function (n=10), infarct volume, neuronal death, and macrophages/microglia-infiltration (n=6–7) were analyzed three days after. Results We found that mice with both stroke and bone fracture had larger infarct volumes (mean percentage of ipsilateral hemisphere±SD: 30±7% vs. 12±3%, n=6, P<0.001) more severe neurobehavioral dysfunction, and more macrophages/microglia in the peri-infarct region than mice with stroke only. Intraperitoneal injection of HMGB1 mimicked, whereas neutralizing HMGB1 attenuated, the bone fracture effects and the macrophage/microglia infiltration. Depleting macrophages with clodrolip also attenuated the aggravating effects of bone fracture on stroke lesion and behavioral dysfunction. Conclusions These novel findings suggest that bone fracture shortly after stroke enhances stroke injury via augmented inflammation through HMGB1 and macrophage/microglia infiltration. Interventions to modulate early macrophage/microglia activation could be therapeutic goals to limit the adverse consequences of bone fracture after stroke. PMID:23438676

  1. Bone tumor

    MedlinePlus

    ... primary bone tumors include: Chondrosarcoma Ewing sarcoma Fibrosarcoma Osteosarcomas Cancers that most often spread to the bone are cancers of the: Breast Kidney Lung Prostate Thyroid These forms of cancer usually affect ...

  2. Bone grafts.

    PubMed

    Hubble, Matthew J W

    2002-09-01

    Bone grafts are used in musculoskeletal surgery to restore structural integrity and enhance osteogenic potential. The demand for bone graft for skeletal reconstruction in bone tumor, revision arthroplasty, and trauma surgery, couple with recent advances in understanding and application of the biology of bone transplantation, has resulted in an exponential increase in the number of bone-grafting procedures performed over the last decade. It is estimated that 1.5 million bone-grafting procedures are currently performed worldwide each year, compared to a fraction of that number 20 years ago. Major developments also have resulted in the harvesting, storage, and use of bone grafts and production of graft derivatives, substitutes, and bone-inducing agents.

  3. [Bone disease in Gaucher's disease].

    PubMed

    Roca Espiau, Mercedes

    2011-09-01

    The exposition aims, is to review the pathophysiological mechanisms of bone marrow involvement and the patterns of marrow infiltration by Gaucher cells. We have reviewed the different methods of assessment of bone marrow infiltration and its temporal development. Qualitative methods include simple radiography, magnetic resonance imaging (MRI), computed tomography (CT) and radioisotope. The simple radiography is the basic element, but its sensitivity is limited and only allows for assessing changes and trabecular bone remodeling MRI allows us to appreciate the bone marrow infiltration, detection of complications and response to therapy. Radioisotopes can contribute to the differential diagnosis of osteomyelitis and bone crises. Among the quantitative methods are the QCSI (quantitative chemical shift imaging) and the dual-energy X-ray absorptiometry (DEXA), as well as new quantitative techniques of CT, MRI and ultrasound densitometry. The QCSI performed an assessment of fat content of bone marrow in the spine. DEXA quantifies bone density by measuring the attenuation coefficient. The semiquantitative methods have various "scores" to establish criteria for generalized bone disease endpoints of disease progression and response to therapy.

  4. Bone Analyzer

    NASA Technical Reports Server (NTRS)

    1985-01-01

    The danger of disuse osteoporosis under weightless condition in space led to extensive research into measurements of bone stiffness and mass by the Biomedical Research Division of Ames and Stanford University. Through its Technology Utilization Program, NASA funded an advanced SOBSA, a microprocessor-controlled bone probe system. SOBSA determines bone stiffness by measuring responses to an electromagnetic shaker. With this information, a physician can identify bone disease, measure deterioration and prescribe necessary therapy. The system is now undergoing further testing.

  5. Bone cement

    PubMed Central

    Vaishya, Raju; Chauhan, Mayank; Vaish, Abhishek

    2013-01-01

    The knowledge about the bone cement is of paramount importance to all Orthopaedic surgeons. Although the bone cement had been the gold standard in the field of joint replacement surgery, its use has somewhat decreased because of the advent of press-fit implants which encourages bone in growth. The shortcomings, side effects and toxicity of the bone cement are being addressed recently. More research is needed and continues in the field of nanoparticle additives, enhanced bone–cement interface etc. PMID:26403875

  6. Bone Infections

    MedlinePlus

    ... bloodstream. People who are at risk for bone infections include those with diabetes, poor circulation, or recent injury to the bone. You may also be at risk if you are having hemodialysis. Symptoms of bone infections include Pain in the infected area Chills and ...

  7. Transient Receptor Potential Channel and Interleukin-17A Involvement in LTTL Gel Inhibition of Bone Cancer Pain in a Rat Model.

    PubMed

    Wang, Juyong; Zhang, Ruixin; Dong, Changsheng; Jiao, Lijing; Xu, Ling; Liu, Jiyong; Wang, Zhengtao; Lao, Lixing

    2015-07-01

    Cancer pain management is a challenge for which Chinese herbal medicine might be useful. To study the spinal mechanisms of the Chinese medicated gel Long-Teng-Tong-Luo (LTTL), a 7-herb compound, on bone cancer pain, a bone cancer pain model was made by inoculating the tibias of female rats with Walker 256 cells. LTTL gel or inert gel, 0.5 g/cm(2)/d, was applied to the skin of tumor-bearing tibias for 21 days beginning a day after the inoculation. Mechanical threshold and paw withdrawal latency to thermal stimulation was measured. Transient receptor potential (TRP) cation channels in lumbar dorsal root ganglia (DRG) were immunostained and counted, and lumbar spinal cord interleukin-17A (IL-17A) was measured with real-time polymerase chain reaction and enzyme-linked immunosorbent assay. TRP antagonists and interleukin (IL)-17A antibodies were intrathecally administered to determine their effects on bone cancer pain. The gel significantly (P < .05) alleviated cancer-induced mechanical allodynia and thermal hyperalgesia and inhibited cancer-enhanced expression of IL-17A in spinal astrocytes and the TRP subfamily members V1, A1, and V4 in lumbar DRG. Intrathecal TRP antagonists at 10 µg significantly (P < .05) attenuated mechanical allodynia, thermal hyperalgesia, and IL-17A expression, indicating that TRP channels facilitate spinal IL-17 expression and cancer pain. IL-17A antibodies inhibited cancer pain, suggesting that IL-17A promotes such pain. The data show that LTTL gel inhibits cancer pain, and this might be accounted for by the decrease in expression of DRG TRP channels and spinal astrocyte IL-17A.

  8. Bone Densitometry (Bone Density Scan)

    MedlinePlus

    ... In some communities, a CT scan with special software can also be used to diagnose or monitor ... patient's bone mineral density. DEXA machines feature special software that compute and display the bone density measurements ...

  9. RADIO FREQUENCY ATTENUATOR

    DOEpatents

    Giordano, S.

    1963-11-12

    A high peak power level r-f attenuator that is readily and easily insertable along a coaxial cable having an inner conductor and an outer annular conductor without breaking the ends thereof is presented. Spaced first and second flares in the outer conductor face each other with a slidable cylindrical outer conductor portion therebetween. Dielectric means, such as water, contact the cable between the flares to attenuate the radio-frequency energy received thereby. The cylindrical outer conductor portion is slidable to adjust the voltage standing wave ratio to a low level, and one of the flares is slidable to adjust the attenuation level. An integral dielectric container is also provided. (AFC)

  10. Landing gear noise attenuation

    NASA Technical Reports Server (NTRS)

    Moe, Jeffrey W. (Inventor); Whitmire, Julia (Inventor); Kwan, Hwa-Wan (Inventor); Abeysinghe, Amal (Inventor)

    2011-01-01

    A landing gear noise attenuator mitigates noise generated by airframe deployable landing gear. The noise attenuator can have a first position when the landing gear is in its deployed or down position, and a second position when the landing gear is in its up or stowed position. The noise attenuator may be an inflatable fairing that does not compromise limited space constraints associated with landing gear retraction and stowage. A truck fairing mounted under a truck beam can have a compliant edge to allow for non-destructive impingement of a deflected fire during certain conditions.

  11. Compensation for non-uniform attenuation in SPECT brain imaging

    SciTech Connect

    Glick, S.J.; King, M.A.; Pan, T.S.

    1994-05-01

    Photon attenuation is a major limitation in performing quantitative SPECT brain imaging. A number of methods have been proposed for compensation of attenuation in regions of the body that can be modelled as a uniform attenuator. The magnitude of the errors introduced into reconstructed brain images by assuming the head to be a uniform attenuator are uncertain (the skull, sinus cavities and head holder all have different attenuation properties than brain tissue). Brain imaging is unique in that the radioisotope, for the most part, is taken up within a uniform attenuation medium (i.e., brain tissue) which is surrounded by bone (i.e., the skull) of a different density. Using this observation, Bellini`s method for attenuation compensation (which is an exact solution to the exponential Radon transform) has been modified to account for the different attenuation properties of the skull. To test this modified Bellini method, a simple mathematical phantom was designed to model the brain and a skull of varying thickness less than 7.5 mm. To model brain imaging with Tc-99m HMPAO, the attenuation coefficient of the brain tissue and skull were set to 0.15 cm{sup -1} and 0.22 cm{sup -1} respectively. A ray-driven projector which accounted for non-uniform attenuation was used to simulate projection data from 128 views. The detector response and scatter were not simulated. It was observed that reconstructions processed with uniform attenuation compensation (i.e., where it was assumed that the brain tissue and the skull had the same attenuation coefficient) provided errors of 6-20%, whereas those processed with the non-uniform Bellini algorithm were biased by only 0-5%.

  12. Correlations of linear and nonlinear ultrasound parameters with density and microarchitectural parameters in trabecular bone.

    PubMed

    Lee, Kang Il

    2013-11-01

    In the present study, correlations of linear and nonlinear ultrasound parameters (speed of sound, normalized broadband ultrasound attenuation, and nonlinear parameter B/A) with bone mineral density and microarchitectural parameters were investigated in 28 bovine femoral trabecular bone samples in vitro. All three ultrasound parameters exhibited relatively high correlation coefficients with the indexes of bone quantity (bone mineral density and bone volume fraction) and lower correlation coefficients with the remaining microarchitectural parameters. These results suggest that B/A, in addition to speed of sound and attenuation, may have potential as an index for the assessment of bone status and osteoporosis.

  13. Bone poroelasticity.

    PubMed

    Cowin, S C

    1999-03-01

    Poroelasticity is a well-developed theory for the interaction of fluid and solid phases of a fluid-saturated porous medium. It is widely used in geomechanics and has been applied to bone by many authors in the last 30 years. The purpose of this work is, first, to review the literature related to the application of poroelasticity to the interstitial bone fluid and, second, to describe the specific physical and modeling considerations that establish poroelasticity as an effective and useful model for deformation-driven bone fluid movement in bone tissue. The application of poroelasticity to bone differs from its application to soft tissues in two important ways. First, the deformations of bone are small while those of soft tissues are generally large. Second, the bulk modulus of the mineralized bone matrix is about six times stiffer than that of the fluid in the pores while the bulk moduli of the soft tissue matrix and the pore water are almost the same. Poroelasticity and electrokinetics can be used to explain strain-generated potentials in wet bone. It is noted that strain-generated potentials can be used as an effective tool in the experimental study of local bone fluid flow, and that the knowledge of this technique will contribute to the answers of a number of questions concerning bone mineralization, osteocyte nutrition and the bone mechanosensory system.

  14. [Bone substitutes].

    PubMed

    Jordana, Fabienne; Le Visage, Catherine; Weiss, Pierre

    2017-01-01

    Bone substitutes, used to fill a defect after a surgery or a trauma, provide a mechanical support and might induce bone healing. They constitute an alternative to autogenous bone grafts, the 'gold standard' which remains the reference despite its risk of postoperative complications. The clinician choice of a bone substitute is based on the required bone volume, the handling (injectability, malleability) and mechanical properties (setting time, viscosity, resorbability among others) of the material. Bone substitutes are commonly used in orthopedic surgery, neurosurgery, stomatology and dental applications. Their use increases steadily, with the recent clinical development of injectable forms. In addition, novel technologies by subtractive or additive techniques allow today the production of controlled architecture materials. Here, we present a bone substitutes classification according to their origin (natural or synthetic) and chemical composition, and the most common use of these substitutes. © 2017 médecine/sciences – Inserm.

  15. Attenuator And Conditioner

    SciTech Connect

    Anderson, Gene R.; Armendariz, Marcelino G.; Carson, Richard F.; Bryan, Robert P.; Duckett, III, Edwin B.; Kemme, Shanalyn Adair; McCormick, Frederick B.; Peterson, David W.

    2006-04-04

    An apparatus and method of attenuating and/or conditioning optical energy for an optical transmitter, receiver or transceiver module is disclosed. An apparatus for attenuating the optical output of an optoelectronic connector including: a mounting surface; an array of optoelectronic devices having at least a first end; an array of optical elements having at least a first end; the first end of the array of optical elements optically aligned with the first end of the array of optoelectronic devices; an optical path extending from the first end of the array of optoelectronic devices and ending at a second end of the array of optical elements; and an attenuator in the optical path for attenuating the optical energy emitted from the array of optoelectronic devices. Alternatively, a conditioner may be adapted in the optical path for conditioning the optical energy emitted from the array of optoelectronic devices.

  16. Protein intake and bone health.

    PubMed

    Bonjour, Jean-Philippe

    2011-03-01

    Adequate nutrition plays an important role in the development and maintenance of bone structures resistant to usual mechanical stresses. In addition to calcium in the presence of an adequate supply of vitamin D, dietary proteins represent key nutrients for bone health and thereby function in the prevention of osteoporosis. Several studies point to a positive effect of high protein intake on bone mineral density or content. This fact is associated with a significant reduction in hip fracture incidence, as recorded in a large prospective study carried out in a homogeneous cohort of postmenopausal women. Low protein intake (< 0.8 g/kg body weight/day) is often observed in patients with hip fractures and an intervention study indicates that following orthopedic management, protein supplementation attenuates post-fracture bone loss, tends to increase muscle strength, and reduces medical complications and rehabilitation hospital stay. There is no evidence that high protein intake per se would be detrimental for bone mass and strength. Nevertheless, it appears reasonable to avoid very high protein diets (i. e. more than 2.0 g/kg body weight/day) when associated with low calcium intake (i. e. less than 600 mg/day). In the elderly, taking into account the attenuated anabolic response to dietary protein with ageing, there is concern that the current dietary protein recommended allowance (RDA), as set at 0.8 g/kg body weight/day, might be too low for the primary and secondary prevention of fragility fractures.

  17. Fiber Optic Attenuators

    NASA Technical Reports Server (NTRS)

    1995-01-01

    Mike Buzzetti designed a fiber optic attenuator while working at Jet Propulsion Laboratory, intended for use in NASA's Deep Space Network. Buzzetti subsequently patented and received an exclusive license to commercialize the device, and founded Nanometer Technologies to produce it. The attenuator functions without introducing measurable back-reflection or insertion loss, and is relatively insensitive to vibration and changes in temperature. Applications include cable television, telephone networks, other signal distribution networks, and laboratory instrumentation.

  18. CD169(+) macrophages mediate pathological formation of woven bone in skeletal lesions of prostate cancer.

    PubMed

    Wu, Andy C; He, Yaowu; Broomfield, Amy; Paatan, Nicoll J; Harrington, Brittney S; Tseng, Hsu-Wen; Beaven, Elizabeth A; Kiernan, Deirdre M; Swindle, Peter; Clubb, Adrian B; Levesque, Jean-Pierre; Winkler, Ingrid G; Ling, Ming-Tat; Srinivasan, Bhuvana; Hooper, John D; Pettit, Allison R

    2016-06-01

    Skeletal metastases present a major clinical challenge for prostate cancer patient care, inflicting distinctive mixed osteoblastic and osteolytic lesions that cause morbidity and refractory skeletal complications. Macrophages are abundant in bone and bone marrow and can influence both osteoblast and osteoclast function in physiology and pathology. Herein, we examined the role of macrophages in prostate cancer bone lesions, particularly the osteoblastic response. First, macrophage and lymphocyte distributions were qualitatively assessed in patient's prostate cancer skeletal lesions by immunohistochemistry. Second, macrophage functional contributions to prostate tumour growth in bone were explored using an immune-competent mouse model combined with two independent approaches to achieve in vivo macrophage depletion: liposome encapsulated clodronate that depletes phagocytic cells (including macrophages and osteoclasts); and targeted depletion of CD169(+) macrophages using a suicide gene knock-in model. Immunohistochemistry and histomorphometric analysis were performed to quantitatively assess cancer-induced bone changes. In human bone metastasis specimens, CD68(+) macrophages were consistently located within the tumour mass. Osteal macrophages (osteomacs) were associated with pathological woven bone within the metastatic lesions. In contrast, lymphocytes were inconsistently present in prostate cancer skeletal lesions and when detected, had varied distributions. In the immune-competent mouse model, CD169(+) macrophage ablation significantly inhibited prostate cancer-induced woven bone formation, suggesting that CD169(+) macrophages within pathological woven bone are integral to tumour-induced bone formation. In contrast, pan-phagocytic cell, but not targeted CD169(+) macrophage depletion resulted in increased tumour mass, indicating that CD169(-) macrophage subset(s) and/or osteoclasts influenced tumour growth. In summary, these observations indicate a prominent role

  19. Numerical simulation of wave propagation in cancellous bone.

    PubMed

    Padilla, F; Bossy, E; Haiat, G; Jenson, F; Laugier, P

    2006-12-22

    Numerical simulation of wave propagation is performed through 31 3D volumes of trabecular bone. These volumes were reconstructed from high synchrotron microtomography experiments and are used as the input geometry in a simulation software developed in our laboratory. The simulation algorithm accounts for propagation into both the saturating fluid and bone but absorption is not taken into account. We show that 3D simulation predicts phenomena observed experimentally in trabecular bones : linear frequency dependence of attenuation, increase of attenuation and speed of sound with the bone volume fraction, negative phase velocity dispersion in most of the specimens, propagation of fast and slow wave depending on the orientation of the trabecular network compared to the direction of propagation of the ultrasound. Moreover, the predicted attenuation is in very close agreement with the experimental one measured on the same specimens. Coupling numerical simulation with real bone architecture therefore provides a powerful tool to investigate the physics of ultrasound propagation in trabecular structures.

  20. Oral resveratrol therapy inhibits cancer-induced skeletal muscle and cardiac atrophy in vivo

    PubMed Central

    Shadfar, Scott; Couch, Marion E.; McKinney, Kibwei A.; Weinstein, Lisa J.; Yin, Xiaoying; Rodríguez, Jessica E.; Guttridge, Denis C.; Willis, Monte

    2013-01-01

    The mechanism by which cancer mediates muscle atrophy has been delineated in the past 3 decades, and includes a prominent role of tumor-derived cytokines, such as IL-6, TNFα and IL-1. These cytokines interact with their cognate receptors on muscle to activate the downstream transcription factor NF-κB and induce sarcomere proteolysis. Experimentally, inhibiting NF-κB signaling largely prevents cancer-induced muscle wasting, indicating its prominent role in muscle atrophy. Resveratrol, a natural phytoalexin found in the skin of grapes, has recently been shown to inhibit NF-κB in cancer cells, which led us to hypothesize that it might have a protective role in cancer cachexia. Therefore, we investigated if daily oral resveratrol could protect against skeletal muscle loss and cardiac atrophy in an established mouse model. We demonstrate resveratrol inhibits skeletal muscle and cardiac atrophy induced by C26 adenocarcinoma tumors through its inhibition of NF-κB (p65) activity in the skeletal muscle and heart. These studies demonstrate for the first time the utility of oral resveratrol therapy to provide clinical benefit in cancer-induced atrophy through the inhibition of NF-κB in muscle. These findings may have application in the treatment of diseases with parallel pathophysiologies such as muscular dystrophy and heart failure. PMID:21660860

  1. Oral resveratrol therapy inhibits cancer-induced skeletal muscle and cardiac atrophy in vivo.

    PubMed

    Shadfar, Scott; Couch, Marion E; McKinney, Kibwei A; Weinstein, Lisa J; Yin, Xiaoying; Rodríguez, Jessica E; Guttridge, Denis C; Willis, Monte

    2011-01-01

    The mechanism by which cancer mediates muscle atrophy has been delineated in the past 3 decades and includes a prominent role of tumor-derived cytokines, such as IL-6, TNFα, and IL-1. These cytokines interact with their cognate receptors on muscle to activate the downstream transcription factor NF-κB and induce sarcomere proteolysis. Experimentally, inhibiting NF-κB signaling largely prevents cancer-induced muscle wasting, indicating its prominent role in muscle atrophy. Resveratrol, a natural phytoalexin found in the skin of grapes, has recently been shown to inhibit NF-κB in cancer cells, which led us to hypothesize that it might have a protective role in cancer cachexia. Therefore, we investigated whether daily oral resveratrol could protect against skeletal muscle loss and cardiac atrophy in an established mouse model. We demonstrate resveratrol inhibits skeletal muscle and cardiac atrophy induced by C26 adenocarcinoma tumors through its inhibition of NF-κB (p65) activity in skeletal muscle and heart. These studies demonstrate for the first time the utility of oral resveratrol therapy to provide clinical benefit in cancer-induced atrophy through the inhibition of NF-κB in muscle. These findings may have application in the treatment of diseases with parallel pathophysiologies such as muscular dystrophy and heart failure.

  2. dAcsl, the Drosophila ortholog of acyl-CoA synthetase long-chain family member 3 and 4, inhibits synapse growth by attenuating bone morphogenetic protein signaling via endocytic recycling.

    PubMed

    Liu, Zhihua; Huang, Yan; Hu, Wen; Huang, Sheng; Wang, Qifu; Han, Junhai; Zhang, Yong Q

    2014-02-19

    Fatty acid metabolism plays an important role in brain development and function. Mutations in acyl-CoA synthetase long-chain family member 4 (ACSL4), which converts long-chain fatty acids to acyl-CoAs, result in nonsyndromic X-linked mental retardation. ACSL4 is highly expressed in the hippocampus, a structure critical for learning and memory. However, the underlying mechanism by which mutations of ACSL4 lead to mental retardation remains poorly understood. We report here that dAcsl, the Drosophila ortholog of ACSL4 and ACSL3, inhibits synaptic growth by attenuating BMP signaling, a major growth-promoting pathway at neuromuscular junction (NMJ) synapses. Specifically, dAcsl mutants exhibited NMJ overgrowth that was suppressed by reducing the doses of the BMP pathway components, accompanied by increased levels of activated BMP receptor Thickveins (Tkv) and phosphorylated mothers against decapentaplegic (Mad), the effector of the BMP signaling at NMJ terminals. In addition, Rab11, a small GTPase involved in endosomal recycling, was mislocalized in dAcsl mutant NMJs, and the membrane association of Rab11 was reduced in dAcsl mutant brains. Consistently, the BMP receptor Tkv accumulated in early endosomes but reduced in recycling endosomes in dAcsl mutant NMJs. dAcsl was also required for the recycling of photoreceptor rhodopsin in the eyes, implying a general role for dAcsl in regulating endocytic recycling of membrane receptors. Importantly, expression of human ACSL4 rescued the endocytic trafficking and NMJ phenotypes of dAcsl mutants. Together, our results reveal a novel mechanism whereby dAcsl facilitates Rab11-dependent receptor recycling and provide insights into the pathogenesis of ACSL4-related mental retardation.

  3. Inhibition on Breast Cancer Induced Bone Pain, Metastasis and Osteolysis in Nude Mice by LOVAZA and DHA Fattty Acids

    DTIC Science & Technology

    2011-10-01

    GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007

  4. Bone Metabolism in Obesity and Weight Loss

    PubMed Central

    Shapses, Sue A.; Sukumar, Deeptha

    2014-01-01

    Excess body weight due to obesity has traditionally been considered to have a positive effect on bone; however, more recent findings suggest that bone quality is compromised. Both obesity and caloric restriction increase fracture risk and are regulated by endocrine factors and cytokines that have direct and indirect effects on bone and calcium absorption. Weight reduction will decrease bone mass and mineral density, but this varies by the individual’s age, gender, and adiposity. Dietary modifications, exercise, and medications have been shown to attenuate the bone loss associated with weight reduction. Future obesity and weight loss trials would benefit from assessment of key hormones, adipokine and gut peptides that regulate calcium absorption, and bone mineral density and quality by using sensitive techniques in high-risk populations. PMID:22809104

  5. Bone cutting.

    PubMed

    Giraud, J Y; Villemin, S; Darmana, R; Cahuzac, J P; Autefage, A; Morucci, J P

    1991-02-01

    Bone cutting has always been a problem for surgeons because bone is a hard living material, and many osteotomes are still very crude tools. Technical improvement of these surgical tools has first been their motorization. Studies of the bone cutting process have indicated better features for conventional tools. Several non-conventional osteotomes, particularly ultrasonic osteotomes are described. Some studies on the possible use of lasers for bone cutting are also reported. Use of a pressurised water jet is also briefly examined. Despite their advantages, non-conventional tools still require improvement if they are to be used by surgeons.

  6. [Bone diseases].

    PubMed

    Uebelhart, Brigitte; Rizzoli, René

    2016-01-13

    Calcium intake shows a small impact on bone mineral density and fracture risk. Denosumab is a more potent inhibitor of bone resorption than zoledronate. Abaloparatide, PTHrP analog, increases bone mineral density and decreases fracture incidence. Teriparatide could be delivered via a transdermic device. Romosozumab and odanacatib improve calculated bone strength. Sequential or combined treatments with denosumab and teriparatide could be of interest, but not denosumab followed by teriparatide. Fibrous dysplasia, Paget disease and hypophosphatasia are updated, as well as atypical femoral fracture and osteonecrosis of the jaw.

  7. Lithium chloride attenuates the abnormal osteogenic/adipogenic differentiation of bone marrow-derived mesenchymal stem cells obtained from rats with steroid-related osteonecrosis by activating the β-catenin pathway.

    PubMed

    Yu, Zefeng; Fan, Lihong; Li, Jia; Ge, Zhaogang; Dang, Xiaoqian; Wang, Kunzheng

    2015-11-01

    Steroid-related osteonecrosis of the femoral head (ONFH) may be a disease that results from the abnormal osteogenic/adipogenic differentiation of bone marrow-derived mesenchymal stem cells (BMMSCs). In the present study, we examined the possible use of lithium in an aim to reverse the abnormal osteogenic/adipogenic differentiation of BMMSCs isolated from rats with steroid-related ONFH (termed ONFH-BMMSCs). BMMSCs obtained from steroid‑related ONFH rat femurs were cultured with or without lithium chloride (LiCl). BMMSCs obtained from normal rat femurs were cultured as controls. LiCl significantly increased the expression of osteocalcin and Runx2 in the ONFH-BMMSCs during osteogenic induction. The mineralization of ONFH-BMMSCs following osteogenic induction was also enhanced. Furthermore, LiCl exerted anti-adipogenic effects on the ONFH-BMMSCs by inhibiting the expression of peroxisome proliferator-activated receptor γ (PPARγ) and fatty acid binding protein 4 (Fabp4) during adipogenic induction, and decreasing lipid droplet formation at the end of adipogenic induction. These effects of LiCl on the ONFH-BMMSCs were associated with an increased expression of β-catenin and a decreased expression of phosphorylated GSK-3β at Tyr-216, and these effects were abolished by treatment with quercetin, an antagonist of the β-catenin pathway. The normal osteogenic/adipogenic activity of BMMSCs may be impaired in steroid-related ONFH. However, as demonstrated by our findings, LiCl reduces abnormal adipogenic activity and simultaneously increases the osteogenic differentiation of ONFH-BMMSCs by activating the β-catenin pathway.

  8. Sex steroids and bone.

    PubMed

    Manolagas, S C; Kousteni, S; Jilka, R L

    2002-01-01

    The adult skeleton is periodically remodeled by temporary anatomic structures that comprise juxtaposed osteoclast and osteoblast teams and replace old bone with new. Estrogens and androgens slow the rate of bone remodeling and protect against bone loss. Conversely, loss of estrogen leads to increased rate of remodeling and tilts the balance between bone resorption and formation in favor of the former. Studies from our group during the last 10 years have elucidated that estrogens and androgens decrease the number of remodeling cycles by attenuating the birth rate of osteoclasts and osteoblasts from their respective progenitors. These effects result, in part, from the transcriptional regulation of genes responsible for osteoclastogenesis and mesenchymal cell replication and/or differentiation and are exerted through interactions of the ligand-activated receptors with other transcription factors. However, increased remodeling alone cannot explain why loss of sex steroids tilts the balance of resorption and formation in favor of the former. Estrogens and androgens also exert effects on the lifespan of mature bone cells: pro-apoptotic effects on osteoclasts but anti-apoptotic effects on osteoblasts and osteocytes. These latter effects stem from a heretofore unexpected function of the classical "nuclear" sex steroid receptors outside the nucleus and result from activation of a Src/Shc/extracellular signal-regulated kinase signal transduction pathway probably within preassembled scaffolds called caveolae. Strikingly, estrogen receptor (ER) alpha or beta or the androgen receptor can transmit anti-apoptotic signals with similar efficiency, irrespective of whether the ligand is an estrogen or an androgen. More importantly, these nongenotropic, sex-nonspecific actions are mediated by the ligand-binding domain of the receptor and can be functionally dissociated from transcriptional activity with synthetic ligands. Taken together, these lines of evidence strongly suggest that

  9. Generation of attenuation map for MR-based attenuation correction of PET data in the head area employing 3D short echo time MR imaging

    NASA Astrophysics Data System (ADS)

    Khateri, Parisa; Salighe Rad, Hamidreza; Fathi, Anahita; Ay, Mohammad Reza

    2013-02-01

    Attenuation correction is a crucial step to get accurate quantification of Positron Emission Tomography (PET) data. An attenuation map to provide attenuation coefficients at 511 keV can be generated using Magnetic Resonance Images (MRI). One of the main steps involved in MR-based attenuation correction (MRAC) of PET data is to separate bone from air. Low signal intensity of bone in conventional MRI makes it difficult to separate bone from air in the head area, while their attenuation coefficients are very different. In literature, several groups proposed ultrashort echo-time (UTE) sequences to differentiate bone from air [4,5,7], because these sequences are capable of imaging tissues with short T2* relaxation time, such as cortical bone; however, they are difficult to use, expensive and time-consuming. Employing short echo-time (STE) MRI in combination with long echo-time (LTE) MRI, and along with high performance image processing algorithms is a good substitute for UTE-based PET attenuation correction; they are widely available, easy to use, inexpensive and much faster than UTE pulse sequences. In this work, we propose the use of STE sequences along with LTE ones, as well as a dedicated image processing method to differentiate bone from air cavities in the head area by creating contrast between the tissues. Attenuation coefficients at 511 kev, relying on literature [5], will then be assigned to the voxels. Acquisition was performed on a clinical 3T Tim Trio scanner (Siemens Medical Solution, Erlangen, Germany), employing a dual echo sequence. To achieve an optimized protocol with the best result for discrimination of bone and air, two types of acquisitions were performed, with and without fat suppression; the acquisition parameters were as follows: TE=1.21/5 ms, TR=5/17, FA=30, and TE=1.12/3.16 ms, TR=5/5, FA=12 for non-fat-suppressed and fat-suppressed protocol, respectively. Contrast enhancement and tissue segmentation were applied as processing steps, to

  10. Vortex attenuation flight experiments

    NASA Technical Reports Server (NTRS)

    Barber, M. R.; Hastings, E. C., Jr.; Champine, R. A.; Tymczyszyn, J. J.

    1977-01-01

    Flight tests evaluating the effects of altered span loading, turbulence ingestion, combinations of mass and turbulence ingestion, and combinations of altered span loading turbulance ingestion on trailed wake vortex attenuation were conducted. Span loadings were altered in flight by varying the deflections of the inboard and outboard flaps on a B-747 aircraft. Turbulence ingestion was achieved in flight by mounting splines on a C-54G aircraft. Mass and turbulence ingestion was achieved in flight by varying the thrust on the B-747 aircraft. Combinations of altered span loading and turbulence ingestion were achieved in flight by installing a spoiler on a CV-990 aircraft and by deflecting the existing spoilers on a B-747 aircraft. The characteristics of the attenuated and unattenuated vortexes were determined by probing them with smaller aircraft. Acceptable separation distances for encounters with the attenuated and unattenuated vortexes are presented.

  11. Radiofrequency attenuator and method

    DOEpatents

    Warner, Benjamin P.; McCleskey, T. Mark; Burrell, Anthony K.; Agrawal, Anoop; Hall, Simon B.

    2009-11-10

    Radiofrequency attenuator and method. The attenuator includes a pair of transparent windows. A chamber between the windows is filled with molten salt. Preferred molten salts include quarternary ammonium cations and fluorine-containing anions such as tetrafluoroborate (BF.sub.4.sup.-), hexafluorophosphate (PF.sub.6.sup.-), hexafluoroarsenate (AsF.sub.6.sup.-), trifluoromethylsulfonate (CF.sub.3SO.sub.3.sup.-), bis(trifluoromethylsulfonyl)imide ((CF.sub.3SO.sub.2).sub.2N.sup.-), bis(perfluoroethylsulfonyl)imide ((CF.sub.3CF.sub.2SO.sub.2).sub.2N.sup.-) and tris(trifluoromethylsulfonyl)methide ((CF.sub.3SO.sub.2).sub.3 C.sup.-). Radicals or radical cations may be added to or electrochemically generated in the molten salt to enhance the RF attenuation.

  12. Radiofrequency attenuator and method

    DOEpatents

    Warner, Benjamin P [Los Alamos, NM; McCleskey, T Mark [Los Alamos, NM; Burrell, Anthony K [Los Alamos, NM; Agrawal, Anoop [Tucson, AZ; Hall, Simon B [Palmerston North, NZ

    2009-01-20

    Radiofrequency attenuator and method. The attenuator includes a pair of transparent windows. A chamber between the windows is filled with molten salt. Preferred molten salts include quarternary ammonium cations and fluorine-containing anions such as tetrafluoroborate (BF.sub.4.sup.-), hexafluorophosphate (PF.sub.6.sup.-), hexafluoroarsenate (AsF.sub.6.sup.-), trifluoromethylsulfonate (CF.sub.3SO.sub.3.sup.-), bis(trifluoromethylsulfonyl)imide ((CF.sub.3SO.sub.2).sub.2N.sup.-), bis(perfluoroethylsulfonyl)imide ((CF.sub.3CF.sub.2SO.sub.2).sub.2N.sup.-) and tris(trifluoromethylsulfonyl)methide ((CF.sub.3SO.sub.2).sub.3C.sup.-). Radicals or radical cations may be added to or electrochemically generated in the molten salt to enhance the RF attenuation.

  13. Ultrasound attenuation in ferrofluids.

    PubMed

    Shliomis, Mark; Mond, Michael; Morozov, Konstantin

    2008-08-15

    The absorption of acoustic energy by internal degrees of freedom of short chains is proposed as a new viable mechanism of ultrasound attenuation in ferrofluids. It is demonstrated that even though the volume fraction of the chains may be quite small, such an effect may reach the order of magnitude of viscous damping. In addition, by investigating the statistical properties of dimers in ferrofluids, it is shown that an applied magnetic field modifies the sound attenuation in a highly anisotropic manner. The proposed mechanism provides new insight into the fundamental issue of colloidal response, and, in particular, may lead to its utilization in novel experimental concepts.

  14. Talking Bones.

    ERIC Educational Resources Information Center

    Johnson, Jaclyn; Kassing, Sharon

    2002-01-01

    Describes cooperation with the Saint Louis Zoo to provide opportunities for elementary school students to learn about bones, how animals move, what they eat, and how much they grow. Uses biofacts which include bones, skulls, and other parts to make the laboratory a hands-on experience for students. (YDS)

  15. Talking Bones.

    ERIC Educational Resources Information Center

    Johnson, Jaclyn; Kassing, Sharon

    2002-01-01

    Describes cooperation with the Saint Louis Zoo to provide opportunities for elementary school students to learn about bones, how animals move, what they eat, and how much they grow. Uses biofacts which include bones, skulls, and other parts to make the laboratory a hands-on experience for students. (YDS)

  16. CT scanning phantom for normalization of infant brain attenuation.

    PubMed

    Thompson, J R; Triolo, P J; Moore, R J; Hinshaw, D B; Hasso, A N

    1984-01-01

    The x-ray attenuation values of brain studied with computed tomography (CT) are strikingly affected by the ages of the subjects. Premature neonates, for example, may have brain attenuation values 20-30 H below adult values. These lower attenuation values for developing compared with adult brain can be ascribed partly to machine-related effects (beam-hardening, adult algorithms, scanning geometry, etc.). A scanning phantom made from aluminum was developed that can be used to develop a nomogram for any particular scanner from which normalized brain attenuation may be derived for any small head size. Using this nomogram, predicted neonatal attenuations are still 10-15 H higher than those actually observed in scanning neonates. The model predicts that, at the most, 3-4 H of this discrepancy can be accounted for by less beam-hardening from the lower bone attenuation of the thinner developing skull. Presumably, the rest is from a lower brain density in neonates (higher water content). By normalizing to cerebrospinal fluid (water) with special care to avoid partial-volume artifacts, one can predict attenuation values for developing brain more accurately.

  17. Tritium Attenuation by Distillation

    SciTech Connect

    Wittman, N.E.

    2001-07-31

    The objective of this study was to determine how a 100 Area distillation system could be used to reduce to a satisfactory low value the tritium content of the dilute moderator produced in the 100 Area stills, and whether such a tritium attenuator would have sufficient capacity to process all this material before it is sent to the 400 Area for reprocessing.

  18. [Increased efficacy of allogenic bone marrow transplantation].

    PubMed

    Fedotenkov, A G; Danilova, L A; Ignasheva, L P

    1982-08-01

    Experiments made in vivo and vitro have demonstrated that conservation of allogeneic hemopoietic tissue with glycerin brings about a decrease in transplatation, homologous activity of T lymphocytes. Allogeneic bone marrow conserved with glycerin compares very favourably with freshly prepared allogeneic bone marrow since the transplant-versus-host reaction is attenuated under the effect of glycerin. Moreover, it shows a higher proliferative activity. The glycerin-induced reduction of the inactivating effect of lymphocytes against non-syngeneic colony-forming units enables the conserved bone marrow to be transplanted from several donors.

  19. Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment (External Review Draft)

    EPA Science Inventory

    This draft report provides an overview of the types of mechanisms underlying the lymphohematopoietic cancers induced by chemical agents and radiation in humans, with a primary emphasis on leukemia and leukemia-inducing agents. It focuses on how mechanistic information on human l...

  20. Lymphohematopoietic Cancers Induced by Chemicals and Other Agents: Overview and Implications for Risk Assessment (External Review Draft)

    EPA Science Inventory

    This draft report provides an overview of the types of mechanisms underlying the lymphohematopoietic cancers induced by chemical agents and radiation in humans, with a primary emphasis on leukemia and leukemia-inducing agents. It focuses on how mechanistic information on human l...

  1. Paget's Disease of Bone

    MedlinePlus

    ... page please turn Javascript on. Paget's Disease of Bone What is Paget's Disease of Bone? Click for more information Enlarged and Misshapen Bones Paget's disease of bone causes affected bones to ...

  2. In vitro attenuation of impact shock in equine digits.

    PubMed

    Lanovaz, J L; Clayton, H M; Watson, L G

    1998-09-01

    This study was designed to test the impact characteristics of the equine digit in vitro with the objective of providing a better understanding of the role of the digital structures in the attenuation of impact shock. Uni-axial accelerometers were mounted on cadaver digits on the distolateral hoof wall, the proximolateral hoof wall, the dorsal surface of the second phalanx, and the mid-lateral first phalanx. The hoof-mounted accelerometers were aligned with the hoof tubules while the bone-mounted accelerometers were oriented along the longitudinal axis of the bone. Each digit was mounted in a test apparatus designed to simulate impact of the hoof with the ground during locomotion. The digits were subjected to 3 impact trials against a barrier at each of 3 vertical impact velocities that simulated a forward trotting velocity in the range of 2.67 to 4.46 m/s. The impact deceleration tended to increase with impact velocity. Attenuation of the impact shock by the digital tissues resulted in a reduction in impact decleration in the more proximal measuring locations. The interphalangeal joints appeared to play a larger role in amplitude attenuation than the hoof wall or the soft tissue structures within the hoof wall. The signal frequency data showed that the soft tissues within the hoof acted as a 'lowpass' filter, attenuating the higher deceleration frequencies. The hoof wall and the interphalangeal joints showed little frequency attenuation.

  3. Analysis of biased PET images caused by inaccurate attenuation coefficients.

    PubMed

    Son, Young-Don; Kim, Hang-Keun; Kim, Sung-Tae; Kim, Nam-Beom; Kim, Young-Bo; Cho, Zang-Hee

    2010-05-01

    PET scanners with an elongated axial field of view intended to increase overall system sensitivity, such as the high-resolution research tomograph (HRRT) scanner, have been reported to produce images with decreased signals in the brain stem and cerebellum. The cause of this negative bias of the images was analyzed, and the effects of an inaccurate linear attenuation coefficient (mu-value) of tissue and bones were separately examined. A new phantom was manufactured, and 18 human subjects were recruited for the study. (18)F-FDG PET images were reconstructed using attenuation coefficient maps generated by various algorithms. The algorithms included maximum a posteriori reconstruction for transmission data (MAP-TR) with default priors, MAP-TR with adjusted priors for bone (MAP-TR(adj-b)), MAP-TR with adjusted priors for tissue (MAP-TR(adj-t)), and noise-equivalent count TR and CT-TR. With the CT-TR and MAP-TR(adj-t) algorithms, increased intensity in the brain stem and cerebellum was seen, and negative bias was reduced. With the MAP-TR(adj-t) algorithm, however, positive bias increased in the central region. Inappropriate attenuation coefficients of brain tissue increased the positive or negative bias of reconstructed images, especially for the central regions of the volume. Poor representation of the skull or bone also locally increased the bias in the near regions where bone detection had failed. An inaccurate mu-map obtained from the MAP-TR algorithm caused the bias problem for the HRRT system. The CT-TR algorithm provided a relatively more reliable mu-map that demonstrated a small degree of intensity bias. Appropriate priors for mu-values of each tissue compartment and better classification to distinguish bone from tissue are necessary for accurate attenuation correction.

  4. Bone densitometry.

    PubMed

    Chun, Kwang J

    2011-05-01

    Conventional radiographic methods allow physicians to visualize bone structure. However, they do not offer information on the bone mineral density (BMD), which can facilitate early diagnosis and treatment of osteoporosis. Bone densitometry, by contrast, helps to detect bone mineral loss at an early stage because it provides accurate quantitative measurement of BMD. With an emphasis on quantification, shorter scanning time and precision, scientists have been developing BMD measurement devices that use absorption technique. They first developed single-energy absorptiometry (single-photon absorptiometry) by using I-125, which could measure BMD of peripheral bones. Single-photon absorptiometry was replaced by dual-energy absorptiometry (dual photon absorptiometry [DPA]) that used gadolinium-153. DPA had greater accuracy in measuring the BMD of central skeletal bones. Single-energy x-ray absorptiometry was also developed but it had limitations in measuring central skeletal BMD. In the mid-1980s, dual-energy x-ray absorptiometry (DXA) was introduced and widely accepted for the early detection, treatment, and follow-up study of osteoporosis. There are several reasons for the popularity. DXA can measure BMD of posteroanterior spine and hip in a much shorter time than DPA while being capable of measuring BMD of peripheral bones. Other advantages include very low radiation doses to the patients, high image resolution, precision, and stable calibration of the instruments. In recent years, DXA has also been applied to lateral spine for the density of trabecular bone, to the whole body for the measurement of total body bone density and for the body composition, and to the spine for the vertebral fracture assessment. Still, posteroanterior spine and hip scans remain the most common applications of DXA because data on the normal range of BMD of the skeletal sites for different age, sex, and ethnic groups are compiled and made available with the devices, which gives the physician

  5. Soft Tissue Conduction as a Possible Contributor to the Limited Attenuation Provided by Hearing Protection Devices

    PubMed Central

    Chordekar, Shai; Adelman, Cahtia; Sohmer, Haim; Kishon-Rabin, Liat

    2016-01-01

    Context: Damage to the auditory system by loud sounds can be avoided by hearing protection devices (HPDs) such as earmuffs, earplugs, or both for maximum attenuation. However, the attenuation can be limited by air conduction (AC) leakage around the earplugs and earmuffs by the occlusion effect (OE) and by skull vibrations initiating bone conduction (BC). Aims: To assess maximum attenuation by HPDs and possible flanking pathways to the inner ear. Subjects and Methods: AC attenuation and resulting thresholds were assessed using the real ear attenuation at threshold (REAT) procedure on 15 normal-hearing participants in four free-field conditions: (a) unprotected ears, (b) ears covered with earmuffs, (c) ears blocked with deeply inserted customized earplugs, and (d) ears blocked with both earplugs and earmuffs. BC thresholds were assessed with and without earplugs to assess the OE. Results: Addition of earmuffs to earplugs did not cause significantly greater attenuation than earplugs alone, confirming minimal AC leakage through the external meatus and the absence of the OE. Maximum REATs ranged between 40 and 46 dB, leading to thresholds of 46–54 dB HL. Furthermore, calculation of the acoustic impedance mismatch between air and bone predicted at least 60 dB attenuation of BC. Conclusion: Results do not support the notion that skull vibrations (BC) contributed to the limited attenuation provided by traditional HPDs. An alternative explanation, supported by experimental evidence, suggests transmission of sound to inner ear via non-osseous pathways such as skin, soft tissues, and fluid. Because the acoustic impedance mismatch between air and soft tissues is smaller than that between air and bone, air-borne sounds would be transmitted to soft tissues more effectively than to bone, and therefore less attenuation is expected through soft tissue sound conduction. This can contribute to the limited attenuation provided by traditional HPDs. The present study has practical

  6. Regulation of vitamin C transporter in the type 1 diabetic mouse bone and bone marrow.

    PubMed

    Sangani, Rajnikumar; Naime, Mohammad; Zakhary, Ibrahim; Ahmad, Saif; Chutkan, Norman; Zhu, Andy; Ha, Yonju; Hamrick, Mark; Isales, Carlos; Elsalanty, Mohammed; Smith, Sylvia; Liou, Gregory I; Fulzele, Sadanand

    2013-12-01

    A number of studies have revealed that Type I diabetes (T1D) is associated with bone loss and an increased risk of fractures. T1D induces oxidative stress in various tissues and organs. Vitamin C plays an important role in the attenuation of oxidative stress; however, little is known about the effect of T1D induced oxidative stress on the regulation of vitamin C transporter in bone and bone marrow cells. To investigate this, T1D was induced in mice by multiple low dose injections of streptozotocin. We have demonstrated that endogenous antioxidants, glutathione peroxidase (GPx) and superoxide dismutase (SOD) are down-regulated in the bone and bone marrow of T1D. The vitamin C transporter isoform SVCT2, the only known transporter expressed in bone and bone marrow stromal cells (BMSCs), is negatively regulated in the bone and bone marrow of T1D. The μCT imaging of the bone showed significantly lower bone quality in the 8 week T1D mouse. The in-vitro study in BMSCS showed that the knockdown of SVCT2 transporter decreases ascorbic acid (AA) uptake, and increases oxidative stress. The significant reversing effect of antioxidant vitamin C is only possible in control cells, not in knockdown cells. This study suggested that T1D induces oxidative stress and decreases SVCT2 expression in the bone and bone marrow environment. Furthermore, this study confirms that T1D increases bone resorption, decreases bone formation and changes the microstructure of bones. This study has provided evidence that the regulation of the SVCT2 transporter plays an important role not only in T1D osteoporosis but also in other oxidative stress-related musculoskeletal complications.

  7. Bone Health

    PubMed Central

    Manske, Sarah L.; Lorincz, Caeley R.; Zernicke, Ron F.

    2009-01-01

    Mechanical loading is a crucial factor for maintaining skeletal health. Physical activities, exercise, and sports provide a wealth and variety of mechanical loads to bones, through muscle forces, ground reaction forces, and other contact or impact forces. Weightbearing activities can be effective exercises to enhance bone health—particularly, those that involve jumping and impact loads (with greater strain magnitudes, rates, and frequencies). Physical activity appears to be acutely beneficial for enhancing bone health in the early pubertal period and in older age, such as in postmenopausal women. In preparing this article, PubMed, Web of Science, and relevant edited books (English language) were reviewed from 1961 to present. PMID:23015892

  8. Consequences of Daily Administered Parathyroid Hormone on Myeloma Growth, Bone Disease, and Molecular Profiling of Whole Myelomatous Bone

    PubMed Central

    Pennisi, Angela; Ling, Wen; Li, Xin; Khan, Sharmin; Wang, Yuping; Barlogie, Bart; Shaughnessy, John D.; Yaccoby, Shmuel

    2010-01-01

    Background Induction of osteolytic bone lesions in multiple myeloma is caused by an uncoupling of osteoclastic bone resorption and osteoblastic bone formation. Current management of myeloma bone disease is limited to the use of antiresorptive agents such as bisphosphonates. Methodology/Principal Findings We tested the effects of daily administered parathyroid hormone (PTH) on bone disease and myeloma growth, and we investigated molecular mechanisms by analyzing gene expression profiles of unique myeloma cell lines and primary myeloma cells engrafted in SCID-rab and SCID-hu mouse models. PTH resulted in increased bone mineral density of myelomatous bones and reduced tumor burden, which reflected the dependence of primary myeloma cells on the bone marrow microenvironment. Treatment with PTH also increased bone mineral density of uninvolved murine bones in myelomatous hosts and bone mineral density of implanted human bones in nonmyelomatous hosts. In myelomatous bone, PTH markedly increased the number of osteoblasts and bone-formation parameters, and the number of osteoclasts was unaffected or moderately reduced. Pretreatment with PTH before injecting myeloma cells increased bone mineral density of the implanted bone and delayed tumor progression. Human global gene expression profiling of myelomatous bones from SCID-hu mice treated with PTH or saline revealed activation of multiple distinct pathways involved in bone formation and coupling; involvement of Wnt signaling was prominent. Treatment with PTH also downregulated markers typically expressed by osteoclasts and myeloma cells, and altered expression of genes that control oxidative stress and inflammation. PTH receptors were not expressed by myeloma cells, and PTH had no effect on myeloma cell growth in vitro. Conclusions/Significance We conclude that PTH-induced bone formation in myelomatous bones is mediated by activation of multiple signaling pathways involved in osteoblastogenesis and attenuated bone resorption

  9. A compact rotary vane attenuator

    NASA Technical Reports Server (NTRS)

    Nixon, D. L.; Otosh, T. Y.; Stelzried, C. T.

    1969-01-01

    Rotary vane attenuator, when used as a front end attenuator, introduces an insertion loss that is proportional to the angle of rotation. New technique allows the construction of a shortened compact unit suitable for most installations.

  10. Bone Scan

    MedlinePlus

    ... injected, then shortly after the injection, and again two to four hours later. To better see some bones in your body, your doctor might order additional imaging called single-photon emission computerized tomography (SPECT). This imaging can help ...

  11. Interpreting Bones.

    ERIC Educational Resources Information Center

    Weymouth, Patricia P.

    1986-01-01

    Describes an activity which introduces students to the nature and challenges of paleoanthropology. In the exercise, students identify diagrammed bones and make interpretations about the creature. Presents questions and tasks employed in the lesson. (ML)

  12. Bone and bone marrow: the same organ.

    PubMed

    Del Fattore, Andrea; Capannolo, Marta; Rucci, Nadia

    2010-11-01

    Interplays between bone and bone marrow are not limited to merely anatomic and histological connections, but include a tight functional correlation. Bone marrow resides within the medullary cavity of the bones and the process of hematopoiesis is regulated, at least in part, by bone cells. Moreover, osteoclasts and osteoblasts derive from precursors of hematopoietic and mesenchymal origin, respectively, both residing within the bone marrow. Alterations in one of these components typically cause impairment in the other, so diseases of the bone marrow compartment often affect the bone and vice versa. All these findings could make us to speculate that bone and bone marrow are not two separate districts, but can be considered as the two elements of the same unique functional unit, the bone-bone marrow organ. Here we will describe histological and functional interplays between bone and bone marrow, and will illustrate some diseases in which this tight correlation is evident.

  13. Optimization and In Vivo Profiling of a Refined Rat Model of Walker 256 Breast Cancer Cell-Induced Bone Pain Using Behavioral, Radiological, Histological, Immunohistochemical and Pharmacological Methods

    PubMed Central

    Shenoy, Priyank; Kuo, Andy; Vetter, Irina; Smith, Maree T.

    2017-01-01

    In the majority of patients with advanced breast cancer, there is metastatic spread to bones resulting in pain. Clinically available drug treatments for alleviation of breast cancer-induced bone pain (BCIBP) often produce inadequate pain relief due to dose-limiting side-effects. A major impediment to the discovery of novel well-tolerated analgesic agents for the relief of pain due to bony metastases is the fact that most cancer-induced bone pain models in rodents relied on the systemic injection of cancer cells, causing widespread formation of cancer metastases and poor general animal health. Herein, we have established an optimized, clinically relevant Wistar Han female rat model of breast cancer induced bone pain which was characterized using behavioral assessments, radiology, histology, immunohistochemistry and pharmacological methods. In this model that is based on unilateral intra-tibial injection (ITI) of Walker 256 carcinoma cells, animals maintained good health for at least 66 days post-ITI. The temporal development of hindpaw hypersensitivity depended on the initial number of Walker 256 cells inoculated in the tibiae. Hindpaw hypersensitivity resolved after approximately 25 days, in the continued presence of bone tumors as evidenced by ex vivo histology, micro-computed tomography scans and immunohistochemical assessments of tibiae. A possible role for the endogenous opioid system as an internal factor mediating the self-resolving nature of BCIBP was identified based upon the observation that naloxone, a non-selective opioid antagonist, caused the re-emergence of hindpaw hypersensitivity. Bolus dose injections of morphine, gabapentin, amitriptyline and meloxicam all alleviated hindpaw hypersensitivity in a dose-dependent manner. This is a first systematic pharmacological profiling of this model by testing standard analgesic drugs from four important diverse classes, which are used to treat cancer induced bone pain in the clinical setting. Our refined rat

  14. Bone Densitometry (Bone Density Scan)

    MedlinePlus

    ... and display the bone density measurements on a computer monitor. top of page How is the procedure performed? ... passed over the area, generating images on a computer monitor. You must hold very still and may be ...

  15. Control algorithms for dynamic attenuators

    SciTech Connect

    Hsieh, Scott S.; Pelc, Norbert J.

    2014-06-15

    Purpose: The authors describe algorithms to control dynamic attenuators in CT and compare their performance using simulated scans. Dynamic attenuators are prepatient beam shaping filters that modulate the distribution of x-ray fluence incident on the patient on a view-by-view basis. These attenuators can reduce dose while improving key image quality metrics such as peak or mean variance. In each view, the attenuator presents several degrees of freedom which may be individually adjusted. The total number of degrees of freedom across all views is very large, making many optimization techniques impractical. The authors develop a theory for optimally controlling these attenuators. Special attention is paid to a theoretically perfect attenuator which controls the fluence for each ray individually, but the authors also investigate and compare three other, practical attenuator designs which have been previously proposed: the piecewise-linear attenuator, the translating attenuator, and the double wedge attenuator. Methods: The authors pose and solve the optimization problems of minimizing the mean and peak variance subject to a fixed dose limit. For a perfect attenuator and mean variance minimization, this problem can be solved in simple, closed form. For other attenuator designs, the problem can be decomposed into separate problems for each view to greatly reduce the computational complexity. Peak variance minimization can be approximately solved using iterated, weighted mean variance (WMV) minimization. Also, the authors develop heuristics for the perfect and piecewise-linear attenuators which do not requirea priori knowledge of the patient anatomy. The authors compare these control algorithms on different types of dynamic attenuators using simulated raw data from forward projected DICOM files of a thorax and an abdomen. Results: The translating and double wedge attenuators reduce dose by an average of 30% relative to current techniques (bowtie filter with tube current

  16. Control algorithms for dynamic attenuators

    PubMed Central

    Hsieh, Scott S.; Pelc, Norbert J.

    2014-01-01

    Purpose: The authors describe algorithms to control dynamic attenuators in CT and compare their performance using simulated scans. Dynamic attenuators are prepatient beam shaping filters that modulate the distribution of x-ray fluence incident on the patient on a view-by-view basis. These attenuators can reduce dose while improving key image quality metrics such as peak or mean variance. In each view, the attenuator presents several degrees of freedom which may be individually adjusted. The total number of degrees of freedom across all views is very large, making many optimization techniques impractical. The authors develop a theory for optimally controlling these attenuators. Special attention is paid to a theoretically perfect attenuator which controls the fluence for each ray individually, but the authors also investigate and compare three other, practical attenuator designs which have been previously proposed: the piecewise-linear attenuator, the translating attenuator, and the double wedge attenuator. Methods: The authors pose and solve the optimization problems of minimizing the mean and peak variance subject to a fixed dose limit. For a perfect attenuator and mean variance minimization, this problem can be solved in simple, closed form. For other attenuator designs, the problem can be decomposed into separate problems for each view to greatly reduce the computational complexity. Peak variance minimization can be approximately solved using iterated, weighted mean variance (WMV) minimization. Also, the authors develop heuristics for the perfect and piecewise-linear attenuators which do not require a priori knowledge of the patient anatomy. The authors compare these control algorithms on different types of dynamic attenuators using simulated raw data from forward projected DICOM files of a thorax and an abdomen. Results: The translating and double wedge attenuators reduce dose by an average of 30% relative to current techniques (bowtie filter with tube current

  17. Ultrasonic attenuation in pearlitic steel.

    PubMed

    Du, Hualong; Turner, Joseph A

    2014-03-01

    Expressions for the attenuation coefficients of longitudinal and transverse ultrasonic waves are developed for steel with pearlitic microstructure. This type of lamellar duplex microstructure influences attenuation because of the lamellar spacing. In addition, longitudinal attenuation measurements were conducted using an unfocused transducer with 10 MHz central frequency on the cross section of a quenched railroad wheel sample. The dependence of longitudinal attenuation on the pearlite microstructure is observed from the changes of longitudinal attenuation from the quenched tread surface to deeper locations. The results show that the attenuation value is lowest and relatively constant within the quench depth, then increases linearly. The experimental results demonstrate a reasonable agreement with results from the theoretical model. Ultrasonic attenuation provides an important non-destructive method to evaluate duplex microstructure within grains which can be implemented for quality control in conjunction with other manufacturing processes.

  18. Distinct Innate Responses are Induced by Attenuated Salmonella enterica serovar Typhimurium Mutants

    PubMed Central

    Powell, Daniel A.; Roberts, Lydia M.; Ledvina, Hannah E.; Sempowski, Gregory D.; Curtiss, Roy; Frelinger, Jeffrey A.

    2015-01-01

    Upon bacterial infection the host cells generate a wide variety of cytokines. Genetic attenuation of bacterial physiological pathogens can be accomplished not only by disruption of normal bacterial processes, but also by the loss of the ability to redirect the host immune system. We examined nine attenuated Salmonella Typhimurium mutants for their ability to replicate as well as the cytokines produced after infection of Bone Marrow Derived Macrophages (BMDM). Infection of BMDM with attenuated Salmonella mutants led to host cytokine patterns distinct from those that followed WT infection. Surprisingly, each bacterial mutant had a unique cytokine signature. Because some of the mutants induced an IL-10 response not seen in WT, we examined the role of IL-10 on Salmonella replication. Surprisingly, addition of IL-10 before or concurrent with infection restricted growth of WT Salmonella in BMDM. Bacterial attenuation is not a single process and results in attenuated host responses, which result in unique patterns for each attenuated mutants. PMID:26546408

  19. Bone marrow transplant

    MedlinePlus

    Transplant - bone marrow; Stem cell transplant; Hematopoietic stem cell transplant; Reduced intensity nonmyeloablative transplant; Mini transplant; Allogenic bone marrow transplant; Autologous bone marrow transplant; ...

  20. Mesenchymal dental pulp cells attenuate dentin resorption in homeostasis.

    PubMed

    Zheng, Y; Chen, M; He, L; Marão, H F; Sun, D M; Zhou, J; Kim, S G; Song, S; Wang, S L; Mao, J J

    2015-06-01

    Dentin in permanent teeth rarely undergoes resorption in development, homeostasis, or aging, in contrast to bone that undergoes periodic resorption/remodeling. The authors hypothesized that cells in the mesenchymal compartment of dental pulp attenuate osteoclastogenesis. Mononucleated and adherent cells from donor-matched rat dental pulp (dental pulp cells [DPCs]) and alveolar bone (alveolar bone cells [ABCs]) were isolated and separately cocultured with primary rat splenocytes. Primary splenocytes readily aggregated and formed osteoclast-like cells in chemically defined osteoclastogenesis medium with 20 ng/mL of macrophage colony-stimulating factor (M-CSF) and 50 ng/mL of receptor activator of nuclear factor κB ligand (RANKL). Strikingly, DPCs attenuated osteoclastogenesis when cocultured with primary splenocytes, whereas ABCs slightly but significantly promoted osteoclastogenesis. DPCs yielded ~20-fold lower RANKL expression but >2-fold higher osteoprotegerin (OPG) expression than donor-matched ABCs, yielding a RANKL/OPG ratio of 41:1 (ABCs:DPCs). Vitamin D3 significantly promoted RANKL expression in ABCs and OPG in DPCs. In vivo, rat maxillary incisors were atraumatically extracted (without any tooth fractures), followed by retrograde pulpectomy to remove DPCs and immediate replantation into the extraction sockets to allow repopulation of the surgically treated root canal with periodontal and alveolar bone-derived cells. After 8 wk, multiple dentin/root resorption lacunae were present in root dentin with robust RANKL and OPG expression. There were areas of dentin resoprtion alternating with areas of osteodentin formation in root dentin surface in the observed 8 wk. These findings suggest that DPCs of the mesenchymal compartment have an innate ability to attenuate osteoclastogenesis and that this innate ability may be responsible for the absence of dentin resorption in homeostasis. Mesenchymal attenuation of dentin resorption may have implications in internal

  1. A case of laryngeal cancer induced by exposure to asbestos in a construction site supervisor.

    PubMed

    Roh, Sooyong; Park, Soyong; Tae, Gyeong; Song, Jaechul

    2016-01-01

    Construction site supervisors are exposed to many chemicals, dusts, and metals including asbestos. Asbestos is a hazardous chemical that is carcinogenic. Laryngeal cancer is not a rare disease in Korea. The most common causes of this disease are tobacco and alcohol, and representative occupational cause is asbestos. However, up to now, no case of laryngeal cancer induced by asbestos has been reported in Korea. In this study, we report such a case in a construction site supervisor. A 60-year-old man who had been experiencing hoarseness for 2 months was diagnosed with laryngeal cancer. The pathologic diagnosis was squamous cell carcinoma in situ, based on examination of a biopsy specimen obtained by resection of the lesion. The patient had been exposed to asbestos for 38 years at construction sites where he worked until diagnosed with laryngeal cancer. He had been exposed to asbestos when demolishing buildings and inspecting materials. The patient in this case worked with construction materials including asbestos and supervised construction for 38 years, and was thus exposed to asbestos at construction sites. Much of the asbestos was highly concentrated especially during demolition processes. We therefore consider the laryngeal cancer of this patient to be a work-related disease.

  2. 4-1BB protects dendritic cells from prostate cancer-induced apoptosis.

    PubMed

    Youlin, Kuang; Jianwei, Zhang; Xin, Gou; Li, Zhang; Xiaodong, Weng; Xiuheng, Liu; Hengchen, Zhu; Zhiyuan, Chen

    2013-04-01

    It has been shown that human prostate cancer (PCa) cells induced apoptotic death of the most potent antigen-presenting cells, dendritic cells (DCs), which are responsible for the induction of specific antitumor immune responses. Here, we investigated the function of 4-1BB on protecting DCs from prostate cancer-induced apoptosis with an agonistic mAb to 4-1BB. RM-1 cells and DCs were co-incubated for 48 h and DC apoptosis was assessed by Annexin Vassay. TNF-α and IL-12 production were assessed by enzyme-linked immunosorbent assay (ELISA) and Bcl-2 and Bcl-xL on DCs were analyzed by Western blot. We have shown that co-incubation of RM-1 cells with DCs is accompanied by an increased level of DCs apoptosis. Triggering 4-1BB on DCs resulted in increased resistance of DCs to RM-1 cells-induced apoptosis, which was owing to the up-regulated expression of Bcl-2 and Bcl-xL, and increased secretion of TNF-αand IL-12. These results demonstrate that triggering 4-1BB on DCs could increased resistance of DCs to PCa-induced apoptosis.

  3. Cancer-induced anorexia and malaise are mediated by CGRP neurons in the parabrachial nucleus.

    PubMed

    Campos, Carlos A; Bowen, Anna J; Han, Sung; Wisse, Brent E; Palmiter, Richard D; Schwartz, Michael W

    2017-07-01

    Anorexia is a common manifestation of chronic diseases, including cancer. Here we investigate the contribution to cancer anorexia made by calcitonin gene-related peptide (CGRP) neurons in the parabrachial nucleus (PBN) that transmit anorexic signals. We show that CGRP(PBN) neurons are activated in mice implanted with Lewis lung carcinoma cells. Inactivation of CGRP(PBN) neurons before tumor implantation prevents anorexia and loss of lean mass, and their inhibition after symptom onset reverses anorexia. CGRP(PBN) neurons are also activated in Apc(min/+) mice, which develop intestinal cancer and lose weight despite the absence of reduced food intake. Inactivation of CGRP(PBN) neurons in Apc(min/+) mice permits hyperphagia that counteracts weight loss, revealing a role for these neurons in a 'nonanorexic' cancer model. We also demonstrate that inactivation of CGRP(PBN) neurons prevents lethargy, anxiety and malaise associated with cancer. These findings establish CGRP(PBN) neurons as key mediators of cancer-induced appetite suppression and associated behavioral changes.

  4. Bone Marrow Transplantation

    MedlinePlus

    Bone marrow is the spongy tissue inside some of your bones, such as your hip and thigh bones. ... platelets, which help the blood to clot. A bone marrow transplant is a procedure that replaces a person's ...

  5. Bone marrow culture

    MedlinePlus

    ... are very rare. Alternative Names Culture - bone marrow Images Bone marrow aspiration References Chernecky CC, Berger BJ. Bone marrow aspiration analysis-specimen (biopsy, bone marrow iron stain, iron stain, ...

  6. Bone biopsy (image)

    MedlinePlus

    A bone biopsy is performed by making a small incision into the skin. A biopsy needle retrieves a sample of bone and it ... examination. The most common reasons for bone lesion biopsy are to distinguish between benign and malignant bone ...

  7. Bone density scan (image)

    MedlinePlus

    A bone density scan measures the density of bone in a person. The lower the density of a bone the ... and whether any preventative treatment is needed. A bone density scan has the advantage of being painless and ...

  8. Decreased sensory nerve excitation and bone pain associated with mouse Lewis lung cancer in TRPV1-deficient mice.

    PubMed

    Wakabayashi, Hiroki; Wakisaka, Satoshi; Hiraga, Toru; Hata, Kenji; Nishimura, Riko; Tominaga, Makoto; Yoneda, Toshiyuki

    2017-05-17

    Bone pain is one of the most common and life-limiting complications of cancer metastasis to bone. Although the mechanism of bone pain still remains poorly understood, bone pain is evoked as a consequence of sensitization and excitation of sensory nerves (SNs) innervating bone by noxious stimuli produced in the microenvironment of bone metastases. We showed that bone is innervated by calcitonin gene-related protein (CGRP)(+) SNs extending from dorsal root ganglia (DRG), the cell body of SNs, in mice. Mice intratibially injected with Lewis lung cancer (LLC) cells showed progressive bone pain evaluated by mechanical allodynia and flinching with increased CGRP(+) SNs in bone and augmented SN excitation in DRG as indicated by elevated numbers of pERK- and pCREB-immunoreactive neurons. Immunohistochemical examination of LLC-injected bone revealed that the tumor microenvironment is acidic. Bafilomycin A1, a selective inhibitor of H(+) secretion from vacuolar proton pump, significantly alleviated bone pain, indicating that the acidic microenvironment contributes to bone pain. We then determined whether the transient receptor potential vanilloid 1 (TRPV1), a major acid-sensing nociceptor predominantly expressed on SNs, plays a role in bone pain by intratibially injecting LLC cells in TRPV1-deficient mice. Bone pain and SN excitation in the DRG and spinal dorsal horn were significantly decreased in TRPV1 (-/-) mice compared with wild-type mice. Our results suggest that TRPV1 activation on SNs innervating bone by the acidic cancer microenvironment in bone contributes to SN activation and bone pain. Targeting acid-activated TRPV1 is a potential therapeutic approach to cancer-induced bone pain.

  9. Rapid ex vivo imaging of PAIII prostate to bone tumor with SWIFT-MRI

    PubMed Central

    Luhach, Ihor; Idiyatullin, Djaudat; Lynch, Conor C.; Corum, Curt; Martinez, Gary V.; Garwood, Michael; Gillies, Robert J.

    2013-01-01

    Introduction The limiting factor for MRI of skeletal/mineralized tissue is fast transverse relaxation. A recent advancement in MRI technology, SWIFT (Sweep Imaging with Fourier Transform), is emerging as a new approach to overcome this difficulty. Among other techniques like UTE, ZTE and WASPI, the application of SWIFT technology has the strong potential to impact preclinical and clinical imaging, particularly in the context of primary or metastatic bone cancers since it has the added advantage of imaging water in mineralized tissues of bone allowing MRI images to be obtained of tissues previously visible only with modalities such as CT. The goal of the current study is to examine the feasibility of SWIFT for the assessment of the prostate cancer induced changes in bone formation (osteogenesis) and destruction (osteolysis) in ex vivo specimens. Methods A luciferase expressing prostate cancer cell line (PAIII) or saline control was inoculated directly into the tibia of 6-week old immunocompromised male mice. Tumor growth was assessed weekly for three weeks prior to euthanasia and dissection of the tumor bearing and sham tibias. The ex vivo mouse tibia specimens were imaged with a 9.4T and 7T MRI systems. SWIFT images are compared with traditional gradient-echo and spin-echo MRI images as well as CT and histological sections. Results SWIFT images with nominal resolution of 78 μm are obtained with the tumor and different bone structures identified. Prostate cancer induced changes in the bone microstructure are visible in SWIFT images, which is supported by spin-echo, high resolution CT and histological analysis. Conclusions SWIFT MRI is capable of high-quality high-resolution ex vivo imaging of bone tumor and surrounding bone and soft tissues. Furthermore, SWIFT MRI shows promise for in vivo bone tumor imaging, with the added benefits of non-exposure to ionizing radiation, quietness and speed. PMID:24155275

  10. Human Placenta-Derived Adherent Cells Prevent Bone loss, Stimulate Bone formation, and Suppress Growth of Multiple Myeloma in Bone

    PubMed Central

    Li, Xin; Ling, Wen; Pennisi, Angela; Wang, Yuping; Khan, Sharmin; Heidaran, Mohammad; Pal, Ajai; Zhang, Xiaokui; He, Shuyang; Zeitlin, Andy; Abbot, Stewart; Faleck, Herbert; Hariri, Robert; Shaughnessy, John D.; van Rhee, Frits; Nair, Bijay; Barlogie, Bart; Epstein, Joshua; Yaccoby, Shmuel

    2011-01-01

    Human placenta has emerged as a valuable source of transplantable cells of mesenchymal and hematopoietic origin for multiple cytotherapeutic purposes, including enhanced engraftment of hematopoietic stem cells, modulation of inflammation, bone repair, and cancer. Placenta-derived adherent cells (PDACs) are mesenchymal-like stem cells isolated from postpartum human placenta. Multiple myeloma is closely associated with induction of bone disease and large lytic lesions, which are often not repaired and are usually the sites of relapses. We evaluated the antimyeloma therapeutic potential, in vivo survival, and trafficking of PDACs in the severe combined immunodeficiency (SCID)–rab model of medullary myeloma-associated bone loss. Intrabone injection of PDACs into non-myelomatous and myelomatous implanted bone in SCID-rab mice promoted bone formation by stimulating endogenous osteoblastogenesis, and most PDACs disappeared from bone within 4 weeks. PDACs inhibitory effects on myeloma bone disease and tumor growth were dose-dependent and comparable with those of fetal human mesenchymal stem cells (MSCs). Intrabone, but not subcutaneous, engraftment of PDACs inhibited bone disease and tumor growth in SCID-rab mice. Intratumor injection of PDACs had no effect on subcutaneous growth of myeloma cells. A small number of intravenously injected PDACs trafficked into myelomatous bone. Myeloma cell growth rate in vitro was lower in coculture with PDACs than with MSCs from human fetal bone or myeloma patients. PDACs also promoted apoptosis in osteoclast precursors and inhibited their differentiation. This study suggests that altering the bone marrow microenvironment with PDAC cytotherapy attenuates growth of myeloma and that PDAC cytotherapy is a promising therapeutic approach for myeloma osteolysis. PMID:21732484

  11. Attenuation of Cavity Bay Noise

    DTIC Science & Technology

    2012-10-01

    amplification, known as peaking. Overall, the palliative devices based on resonant arrays have demonstrated high levels of attenuation which are...when the resonant frequency condition is met. The attenuation from a Helmholtz type resonator is achieved through frictional losses, vortex shedding...3 the λ/4 condition can be fulfilled and therefore porous mesh devices may not be able to provide a high level of attenuation . Resonant arrays

  12. Ultrasonic Attenuation in Zircaloy-4

    SciTech Connect

    Gomez, M.P.; Banchik, A.D.; Lopez Pumarega, M.I.; Ruzzante, J.E.

    2005-04-09

    In this work the relationship between Zircaloy-4 grain size and ultrasonic attenuation behavior was studied for longitudinal waves in the frequency range of 10-90 MHz. The attenuation was analyzed as a function of frequency for samples with different mechanical and heat treatments having recrystallized and Widmanstatten structures with different grain size. The attenuation behavior was analyzed by different scattering models, depending on grain size, wavelength and frequency.

  13. Chopping-Wheel Optical Attenuator

    NASA Technical Reports Server (NTRS)

    Leviton, Douglas B.

    1988-01-01

    Star-shaped rotating chopping wheel provides adjustable time-averaged attenuation of narrow beam of light without changing length of optical path or spectral distribution of light. Duty cycle or attenuation factor of chopped beam controlled by adjusting radius at which beam intersects wheel. Attenuation factor independent of wavelength. Useful in systems in which chopping frequency above frequency-response limits of photodetectors receiving chopped light. Used in systems using synchronous detection with lock-in amplifiers.

  14. Bone marker gene expression in calvarial bones: different bone microenvironments.

    PubMed

    Al-Amer, Osama

    2017-12-01

    In calvarial mice, mesenchymal stem cells (MSCs) differentiate into osteoprogenitor cells and then differentiate into osteoblasts that differentiate into osteocytes, which become embedded within the bone matrix. In this case, the cells participating in bone formation include MSCs, osteoprogenitor cells, osteoblasts and osteocytes. The calvariae of C57BL/KaLwRijHsD mice consist of the following five bones: two frontal bones, two parietal bones and one interparietal bone. This study aimed to analyse some bone marker genes and bone related genes to determine whether these calvarial bones have different bone microenvironments. C57BL/KaLwRijHsD calvariae were carefully excised from five male mice that were 4-6 weeks of age. Frontal, parietal, and interparietal bones were dissected to determine the bone microenvironment in calvariae. Haematoxylin and eosin staining was used to determine the morphology of different calvarial bones under microscopy. TaqMan was used to analyse the relative expression of Runx2, OC, OSX, RANK, RANKL, OPG, N-cadherin, E-cadherin, FGF2 and FGFR1 genes in different parts of the calvariae. Histological analysis demonstrated different bone marrow (BM) areas between the different parts of the calvariae. The data show that parietal bones have the smallest BM area compared to frontal and interparietal bones. TaqMan data show a significant increase in the expression level of Runx2, OC, OSX, RANKL, OPG, FGF2 and FGFR1 genes in the parietal bones compared with the frontal and interparietal bones of calvariae. This study provides evidence that different calvarial bones, frontal, parietal and interparietal, contain different bone microenvironments.

  15. LINE-ABOVE-GROUND ATTENUATOR

    DOEpatents

    Wilds, R.B.; Ames, J.R.

    1957-09-24

    The line-above-ground attenuator provides a continuously variable microwave attenuator for a coaxial line that is capable of high attenuation and low insertion loss. The device consists of a short section of the line-above- ground plane type transmission lime, a pair of identical rectangular slabs of lossy material like polytron, whose longitudinal axes are parallel to and indentically spaced away from either side of the line, and a geared mechanism to adjust amd maintain this spaced relationship. This device permits optimum fineness and accuracy of attenuator control which heretofore has been difficult to achieve.

  16. Fiber optic attenuator

    NASA Technical Reports Server (NTRS)

    Buzzetti, Mike F. (Inventor)

    1994-01-01

    A fiber optic attenuator of the invention is a mandrel structure through which a bundle of optical fibers is wrapped around in a complete circle. The mandrel structure includes a flexible cylindrical sheath through which the bundle passes. A set screw on the mandrel structure impacts one side of the sheath against two posts on the opposite side of the sheath. By rotating the screw, the sheath is deformed to extend partially between the two posts, bending the fiber optic bundle to a small radius controlled by rotating the set screw. Bending the fiber optic bundle to a small radius causes light in each optical fiber to be lost in the cladding, the amount depending upon the radius about which the bundle is bent.

  17. Nutrition, physical activity, and bone health in women.

    PubMed

    Lewis, R D; Modlesky, C M

    1998-09-01

    Calcium and vitamin D can significantly impact bone mineral and fracture risk in women. Unfortunately, calcium intakes in women are low and many elderly have poor vitamin D status. Supplementation with calcium (approximately 1000 mg) can reduce bone loss in premenopausal and late postmenopausal women, especially at sites that have a high cortical bone composition. Vitamin D supplementation slows bone loss and reduces fracture rates in late postmenopausal women. While an excess of nutrients such as sodium and protein potentially affect bone mineral through increased calcium excretion, phytoestrogens in soy foods may attenuate bone loss through estrogenlike activity. Weight-bearing physical activity may reduce the risk of osteoporosis in women by augmenting bone mineral during the early adult years and reducing the loss of bone following menopause. High-load activities, such as resistance training, appear to provide the best stimulus for enhancing bone mineral; however, repetitive activities, such as walking, may have a positive impact on bone mineral when performed at higher intensities. Irrespective of changes in bone mineral, physical activities that improve muscular strength, endurance, and balance may reduce fracture risk by reducing the risk of falling. The combined effect of physical activity and calcium supplementation on bone mineral needs further investigation.

  18. RNA-sequencing profiles hippocampal gene expression in a validated model of cancer-induced depression.

    PubMed

    Nashed, M G; Linher-Melville, K; Frey, B N; Singh, G

    2016-11-01

    To investigate the pathophysiology of cancer-induced depression (CID), we have recently developed a validated CID mouse model. Given that the efficacy of antidepressants in cancer patients is controversial, it remains unclear whether CID is a biologically distinct form of depression. We used RNA-sequencing (RNA-seq) to investigate differentially expressed genes (DEGs) in hippocampi of animals from our CID model relative a positive control model of depressive-like behavior induced with chronic corticosterone (CORT). To validate RNA-seq results, we performed quantitative real-time RT-PCR (qRT-PCR) on a subset of DEGs. Enrichment analysis using DAVID was performed on DEGs to identify enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and biological process gene ontologies (GO:BP). qRT-PCR results significantly predicted RNA-seq results. RNA-seq revealed that most DEGs identified in the CORT model overlapped with the CID model. Enrichment analyses identified KEGG pathways and GO:BP terms associated with ion homeostasis and neuronal communication for both the CORT and CID model. In addition, CID DEGs were enriched in pathways and terms relating to neuronal development, intracellular signaling, learning and memory. This study is the first to investigate CID at the mRNA level. We have shown that most hippocampal mRNA changes that are associated with a depressive-like state are also associated with cancer. Several other changes occur at the mRNA level in cancer, suggesting that the CID model may represent a biologically distinct form of a depressive-like state.

  19. The role of CCL21/CCR7 chemokine axis in breast cancer-induced lymphangiogenesis.

    PubMed

    Tutunea-Fatan, Elena; Majumder, Mousumi; Xin, Xiping; Lala, Peeyush K

    2015-02-10

    Tumor-induced lymphangiogenesis facilitates breast cancer progression by generating new lymphatic vessels that serve as conduits for tumor dissemination to lymph nodes and beyond. Given the recent evidence suggesting the implication of C-C chemokine ligand 21/chemokine receptor 7 (CCL21/CCR7) in lymph node metastasis, the aim of our study was to define the role of this chemokine pair in breast cancer-associated lymphangiogenesis. The expression analysis of CCL21/CCR7 pair and lymphatic endothelial cell (LEC) markers in breast cancer specimens was performed by means of quantitative real-time PCR. By utilizing CCR7 and CCL21 gene manipulated breast cancer cell implants into orthotopic sites of nude mice, lymphatic vessel formation was assessed through quantitative real-time PCR, immunohistochemistry and immunofluorescence assays. Finally, the lymphangiogenic potential of CCL21/CCR7 was assessed in vitro with primary LECs through separate functional assays, each attempting to mimic different stages of the lymphangiogenic process. We found that CCR7 mRNA expression in human breast cancer tissues positively correlates with the expression of lymphatic endothelial markers LYVE-1, podoplanin, Prox-1, and vascular endothelial growth factor-C (VEGF-C). We demonstrated that the expression of CCL21/CCR7 by breast cancer cells has the ability to promote tumor-induced lymph-vascular recruitment in vivo. In vitro, CCL21/CCR7 chemokine axis regulates the expression and secretion of lymphangiogenic factor VEGF-C and thereby promotes proliferation, migration, as well as tube formation of the primary human LECs. Finally, we showed that protein kinase B (AKT) signaling pathway is the intracellular mechanism of CCR7-mediated VEGF-C secretion by human breast cancer cells. These results reveal that CCR7 and VEGF-C display a significant crosstalk and suggest a novel role of the CCL21/CCR7 chemokine axis in the promotion of breast cancer-induced lymphangiogenesis.

  20. Prostate cancer metastases alter bone mineral and matrix composition independent of effects on bone architecture in mice--a quantitative study using microCT and Raman spectroscopy.

    PubMed

    Bi, Xiaohong; Sterling, Julie A; Merkel, Alyssa R; Perrien, Daniel S; Nyman, Jeffry S; Mahadevan-Jansen, Anita

    2013-10-01

    Prostate cancer is the most common primary tumor and the second leading cause of cancer-related deaths in men in the United States. Prostate cancer bone metastases are characterized by abnormal bone remodeling processes and result in a variety of skeletal morbidities. Prevention of skeletal complications is a crucial element in prostate cancer management. This study investigated prostate cancer-induced alterations in the molecular composition and morphological structure of metastasis-bearing bones in a mouse model of prostate cancer using Raman spectroscopy and micro-computed tomography (microCT). LNCaP C4-2B prostate cancer cells were injected into the right tibiae of 5-week old male SCID mice. Upon sacrifice at 8weeks post tumor inoculation, two out of the ten tumor-bearing tibiae showed only osteoblastic lesions in the radiographs, 4 osteolytic lesions only and 4 mixed with osteoblastic and osteolytic lesions. Carbonate substitution was significantly increased while there was a marked reduction in the level of collagen mineralization, mineral crystallinity, and carbonate:matrix ratio in the cortex of the intact tumor-bearing tibiae compared to contralateral controls. MicroCT analysis revealed a significant reduction in bone volume/total volume, trabecular number and trabecular thickness, as well as significant increase in bone surface/volume ratio in tibiae with osteolytic lesions, suggesting active bone remodeling and bone loss. None of the changes in bone compositional properties were correlated with lesion area from radiographs or the changes in bone architecture from microCT. This study indicates that LNCaP C4-2B prostate cancer metastases alter bone tissue composition independent of changes in architecture, and altered bone quality may be an important contributor to fracture risk in these patients. Raman spectroscopy may provide a new avenue of investigation into interactions between tumor and bone microenvironment.

  1. Prostate Cancer Metastases Alter Bone Mineral and Matrix Composition Independent of Effects on Bone Architecture in Mice A Quantitative Study Using microCT and Raman Spectroscopy

    PubMed Central

    Bi, Xiaohong; Sterling, Julie A.; Merkel, Alyssa R.; Perrien, Daniel S.; Nyman, Jeffry; Mahadevan-Jansen, Anita

    2013-01-01

    Prostate cancer is the most common primary tumor and the second leading cause of cancer-related deaths in men in the United States. Prostate cancer bone metastases are characterized by abnormal bone remodeling processes and result in a variety of skeletal morbidities. Prevention of skeletal complications is a crucial element in prostate cancer management. This study investigated prostate cancer-induced alterations in the molecular composition and morphological structure of metastasis-bearing bones in a mouse model of prostate cancer using Raman spectroscopy and micro-computed tomography (microCT). LNCaP C4-2B prostate cancer cells were injected into the right tibiae of 5-week old male SCID mice. Upon sacrifice at 8 weeks post tumor inoculation, two out of the ten tumor-bearing tibiae showed only osteoblastic lesions in the radiographs, 4 osteolytic lesions only and 4 mixed with osteoblastic and osteolytic lesions.. Carbonate substitution was significantly increased while there was a marked reduction in the level of collagen mineralization, mineral crystallinity, and carbonate:matrix ratio in the cortex of the intact tumor-bearing tibiae compared to contralateral controls. MicroCT analysis revealed a significant reduction in bone volume/total volume, trabecular number and trabecular thickness, as well as significant increase in bone surface/volume ratio in tibiae with osteolytic lesions, suggesting active bone remodeling and bone loss. None of the changes in bone compositional properties were correlated with lesion area from radiographs or the changes in bone architecture from microCT. This study indicates that LNCaP C4-2B prostate cancer metastases alter bone tissue composition independent of changes in architecture, and altered bone quality may be an important contributor to fracture risk in these patients. Raman spectroscopy may provide a new avenue of investigation into interactions between tumor and bone microenvironment. PMID:23867219

  2. Comparison of the Effect of Vitamin K2 and Risedronate on Trabecular Bone in Glucocorticoid-Treated Rats: A Bone Histomorphometry Study

    PubMed Central

    Matsumoto, Hideo; Tadeda, Tsuyoshi; Sato, Yoshihiro; Yeh, James K.

    2009-01-01

    Purpose To compare the effect of vitamin K2 and risedronate on trabecular bone in glucocorticoid (GC)-treated rats. Materials and Methods Forty-eight Sprague-Dawley female rats, 3 months of age, were randomized by the stratified weight method into 5 groups according to the following treatment schedule: age-matched control, GC administration, and GC administration with concomitant administration of vitamin K2, risedronate, or vitamin K2 + risedronate. GC (methylprednisolone sodium succinate, 5.0 mg/kg) and risedronate (10 µg/kg) were administered subcutaneously three and five times a week, respectively. Vitamin K2 (menatetrenone, 30 mg/kg) was administered orally three times a week. At the end of the 8-week experiment, bone histomorphometric analysis was performed on trabecular bone of the tibial proximal metaphysis. Results GC administration decreased trabecular bone mass compared with age-matched controls because of decreased bone formation (mineralizing surface, mineral apposition rate, and bone formation rate) and increased bone erosion. Vitamin K2 attenuated GC-induced trabecular bone loss by preventing GC-induced decrease in bone formation (mineralizing surface) and subsequently reducing GC-induced increase in bone erosion. Risedronate prevented GC-induced trabecular bone loss by preventing GC-induced increase in bone erosion although it also suppressed bone formation (mineralizing surface, mineral apposition rate, and bone formation rate). Vitamin K2 mildly attenuated suppression of bone formation (mineralizing surface) and bone erosion caused by risedronate without affecting trabecular bone mass when administered in combination. Conclusion The present study showed differential effect of vitamin K2 and risedronate on trabecular bone in GC-treated rats. PMID:19430549

  3. [Bone metastases].

    PubMed

    Vicent, S; Luis-Ravelo, D; Antón, I; Hernández, I; Martínez, S; de las Rivas, J; Gúrpide, A; Lecanda, F

    2006-01-01

    Bone metastases represent a devastating clinical problem in the most frequent neoplasies, especially in multiple myeloma, tumours breast, prostate and lung. The consequences include pain which is refractory to conventional analgesics, osteolysis often leading to bone-marrow compression and pathological fractures, and metabolic disorders. Recent advances in diagnosis using imaging techniques as well as different biochemical techniques have helped accurate diagnosis and follow-up. The increase in survival has improved through a multimodal approach combining, inhibition of osteolysis, with prophylactic orthopaedic surgery and radiation therapy. Recent advances in basic research have determined the molecular metastatic that can predict its proclivity to metastasize. Basic research will improve understanding of the basic mechanisms and lead to the clarification of molecular targets that will help in the development of medicines capable of preventing, decreasing or blocking the metastatic process.

  4. Mesenchymal Dental Pulp Cells Attenuate Dentin Resorption in Homeostasis

    PubMed Central

    Zheng, Y.; Chen, M.; He, L.; Marão, H.F.; Sun, D.M.; Zhou, J.; Kim, S.G.; Song, S.; Wang, S.L.

    2015-01-01

    Dentin in permanent teeth rarely undergoes resorption in development, homeostasis, or aging, in contrast to bone that undergoes periodic resorption/remodeling. The authors hypothesized that cells in the mesenchymal compartment of dental pulp attenuate osteoclastogenesis. Mononucleated and adherent cells from donor-matched rat dental pulp (dental pulp cells [DPCs]) and alveolar bone (alveolar bone cells [ABCs]) were isolated and separately cocultured with primary rat splenocytes. Primary splenocytes readily aggregated and formed osteoclast-like cells in chemically defined osteoclastogenesis medium with 20 ng/mL of macrophage colony-stimulating factor (M-CSF) and 50 ng/mL of receptor activator of nuclear factor κB ligand (RANKL). Strikingly, DPCs attenuated osteoclastogenesis when cocultured with primary splenocytes, whereas ABCs slightly but significantly promoted osteoclastogenesis. DPCs yielded ~20-fold lower RANKL expression but >2-fold higher osteoprotegerin (OPG) expression than donor-matched ABCs, yielding a RANKL/OPG ratio of 41:1 (ABCs:DPCs). Vitamin D3 significantly promoted RANKL expression in ABCs and OPG in DPCs. In vivo, rat maxillary incisors were atraumatically extracted (without any tooth fractures), followed by retrograde pulpectomy to remove DPCs and immediate replantation into the extraction sockets to allow repopulation of the surgically treated root canal with periodontal and alveolar bone–derived cells. After 8 wk, multiple dentin/root resorption lacunae were present in root dentin with robust RANKL and OPG expression. There were areas of dentin resoprtion alternating with areas of osteodentin formation in root dentin surface in the observed 8 wk. These findings suggest that DPCs of the mesenchymal compartment have an innate ability to attenuate osteoclastogenesis and that this innate ability may be responsible for the absence of dentin resorption in homeostasis. Mesenchymal attenuation of dentin resorption may have implications in internal

  5. Suicide Risk: Amplifiers and Attenuators.

    ERIC Educational Resources Information Center

    Plutchik, Robert; Van Praag, Herman M.

    1994-01-01

    Attempts to integrate findings on correlates of suicide and violent risk in terms of a theory called a two-stage model of countervailing forces, which assumes that the strength of aggressive impulses is modified by amplifiers and attenuators. The vectorial interaction of amplifiers and attenuators creates an unstable equilibrium making prediction…

  6. Adjustable Optical-Fiber Attenuator

    NASA Technical Reports Server (NTRS)

    Buzzetti, Mike F.

    1994-01-01

    Adjustable fiber-optic attenuator utilizes bending loss to reduce strength of light transmitted along it. Attenuator functions without introducing measurable back-reflection or insertion loss. Relatively insensitive to vibration and changes in temperature. Potential applications include cable television, telephone networks, other signal-distribution networks, and laboratory instrumentation.

  7. Suicide Risk: Amplifiers and Attenuators.

    ERIC Educational Resources Information Center

    Plutchik, Robert; Van Praag, Herman M.

    1994-01-01

    Attempts to integrate findings on correlates of suicide and violent risk in terms of a theory called a two-stage model of countervailing forces, which assumes that the strength of aggressive impulses is modified by amplifiers and attenuators. The vectorial interaction of amplifiers and attenuators creates an unstable equilibrium making prediction…

  8. Adjustable Optical-Fiber Attenuator

    NASA Technical Reports Server (NTRS)

    Buzzetti, Mike F.

    1994-01-01

    Adjustable fiber-optic attenuator utilizes bending loss to reduce strength of light transmitted along it. Attenuator functions without introducing measurable back-reflection or insertion loss. Relatively insensitive to vibration and changes in temperature. Potential applications include cable television, telephone networks, other signal-distribution networks, and laboratory instrumentation.

  9. Bone image segmentation.

    PubMed

    Liu, Z Q; Liew, H L; Clement, J G; Thomas, C D

    1999-05-01

    Characteristics of microscopic structures in bone cross sections carry essential clues in age determination in forensic science and in the study of age-related bone developments and bone diseases. Analysis of bone cross sections represents a major area of research in bone biology. However, traditional approaches in bone biology have relied primarily on manual processes with very limited number of bone samples. As a consequence, it is difficult to reach reliable and consistent conclusions. In this paper we present an image processing system that uses microstructural and relational knowledge present in the bone cross section for bone image segmentation. This system automates the bone image analysis process and is able to produce reliable results based on quantitative measurements from a large number of bone images. As a result, using large databases of bone images to study the correlation between bone structural features and age-related bone developments becomes feasible.

  10. Cadmium content of human cancellous bone

    SciTech Connect

    Knuuttila, M.; Lappalainen, R.; Olkkonen, H.; Lammi, S.; Albava, E.M.

    1982-09-01

    The cadmium content of human cancellous bone was related to age, sex, bone loss, physical properties, and elemental composition. Bone specimens from the anterior iliac crest were collected from 88 cadavers with a normal mineral status, and from 50 cadavers which had bone loss from chronic diseases and immobilization. The element concentrations were analyzed using atomic absorption spectrophotometry. Bone fluoride levels were determined with the ion specific electrode, the mineral density with the gamma ray attenuation method, and the compressive strength with a strain transducer. The data were analyzed using multiple linear regression analysis. The mean cadmium content of 0.22 +/- 0.16 ..mu..g/g dry weight (+/- SD) in the samples did not change with age and its content was slightly greater in males than in females. Furthermore, no statistically significant relationship was found in cadmium content to bone loss changes or to the calcium content of bone. The cadmium content had a high statistically significant positive correlation with the strontium and nickel content.

  11. Rocket engine nozzle attenuator

    NASA Astrophysics Data System (ADS)

    Lewis, David A.

    1993-01-01

    The function of a rocket engine nozzle is to expand the hot engine exhaust gases down to ambient pressure, transforming thermal energy to directed kinetic energy in order to produce thrust. Considering nozzle design, there is an optimum nozzle shape and length, the bell-shaped or contour nozzle. The reason for this specific contour is that the nozzle must be designed in such a manner that the expansion shock waves emanating from the nozzle throat region coincide, and thus diminish the compression effects accompanying the reorientation of flow in the center region of the expansion section. A rocket nozzle must absorb a variety of loads caused by such shocks due to thermal expansion and contraction, as well as shocks from sudden pressurization at startup, and flight accelerations. A rocket engine nozzle is provided which is capable of attenuating nozzle vibrations generated therein during use. The nozzle includes an annular closed chamber surrounding the nozzle adjacent to its gas exhaust end. Within the chamber is a dense but unrestricted particulate mass capable of undergoing frictional movement within the chamber.

  12. Bone growth and turnover in progesterone receptor knockout mice.

    SciTech Connect

    Rickard, David J.; Iwaniec, Urszula T.; Evans, Glenda; Hefferan, Theresa E.; Hunter, Jaime C.; Waters, Katrina M.; Lydon, John P.; O'Malley, Bert W.; Khosla, Sundeep; Spelsberg, Thomas C.; Turner, Russell T.

    2008-05-01

    The role of progesterone receptor (PR) signaling in skeletal metabolism is controversial. To address whether signaling through the PR is necessary for normal bone growth and turnover, we performed histomorphometric and mCT analyses of bone from homozygous female PR knockout (PRKO) mice at 6, 12, and 26 weeks of age. These mice possess a null mutation of the PR locus, which blocks the gene expression of A and B isoforms of PR. Body weight gain, uterine weight gain and tibia longitudinal bone growth was normal in PRKO mice. In contrast, total and cortical bone mass were increased in long bones of post-pubertal (12 and 26-week-old) PRKO mice, whereas cancellous bone mass was normal in the tibia but increased in the humerus. The striking 57% decrease in cancellous bone from the proximal tibia metaphysis which occurred between 6 and 26 weeks in WT mice was abolished in PRKO mice. The improved bone balance in aging PRKO mice was associated with elevated bone formation and a tendency toward reduced osteoclast perimeter. Taken together, these findings suggest that PR signaling in mice attenuates the accumulation of cortical bone mass during adolescence and is required for early age-related loss of cancellous bone.

  13. Bisphosphonates as a Countermeasure to Space Flight Induced Bone Loss

    NASA Technical Reports Server (NTRS)

    LeBlanc, A.; Matsumoto, T.; Jones, J.; Shapiro, J.; Lang, T.; Shackelford, L.; Smith, S.; Evans, H.; Spector, E.; Ploutz-Snyder, R.; hide

    2011-01-01

    This poster reviews the possibility of using Bisphosphonates to counter the bone loss that is experienced during space flight. The Hypothesis that is tested in this experiment is that the combined effect of anti-resorptive drugs plus in-flight exercise regimen will attenuate space flight induced loss in bone mass and strength and reduce renal stone risk. The experiment design, the status and the results are described.

  14. A Citizen's Guide to Monitored Natural Attenuation

    EPA Pesticide Factsheets

    Citizen's Guide describing how natural attenuation relies on natural processes to decrease or attenuate concentrations of contaminants in soil and groundwater. Scientists monitor these conditions to make sure natural attenuation is working.

  15. Proximal Tibial Bone Graft

    MedlinePlus

    ... All Site Content AOFAS / FootCareMD / Treatments Proximal Tibial Bone Graft Page Content What is a bone graft? Bone grafts may be needed for various ... the proximal tibia. What is a proximal tibial bone graft? Proximal tibial bone graft (PTBG) is a ...

  16. Bone scan in metabolic bone diseases. Review.

    PubMed

    Abdelrazek, Saeid; Szumowski, Piotr; Rogowski, Franciszek; Kociura-Sawicka, Agnieszka; Mojsak, Małgorzata; Szorc, Małgorzata

    2012-08-25

    Metabolic bone disease encompasses a number of disorders that tend to present a generalized involvement of the whole skeleton. The disorders are mostly related to increased bone turnover and increased uptake of radiolabelled diphosphonate. Skeletal uptake of 99mTc-labelled diphosphonate depends primarily upon osteoblastic activity, and to a lesser extent, skeletal vascularity. A bone scan image therefore presents a functional display of total skeletal metabolism and has valuable role to play in the assessment of patients with metabolic bone disorders. However, the bone scan appearances in metabolic bone disease are often non-specific, and their recognition depends on increased tracer uptake throughout the whole skeleton. It is the presence of local lesions, as in metastatic disease, that makes a bone scan appearance obviously abnormal. In the early stages, there will be difficulty in evaluating the bone scans from many patients with metabolic bone disease. However, in the more severe cases scan appearances can be quite striking and virtually diagnostic.

  17. Bone scan appearances following bone and bone marrow biopsy

    SciTech Connect

    McKillop, J.H.; Maharaj, D.; Boyce, B.F.; Fogelman, I.

    1984-01-01

    Bone marrow and bone biopsies are performed not infrequently in patients referred for bone scans and represent a potential cause of a ''false positive'' focal abnormality on the bone scan. The authors have therefore examined the scan appearances in a series of patients who had undergone either sternal marrow biopsy, (Salah needle, diameter 1.2 mm) trephine iliac crest marrow biopsy (Jamshidi 11 gauge needle, diameter 3.5 mm) or a transiliac bone biopsy (needle diameter 8 mm). Of 18 patients studied 1 to 45 days after sternal marrow 17 had normal scan appearances at the biopsy site and 1 had a possible abnormality. None of 9 patients studied 4 to 19 days after trephine iliac crest marrow biopsy had a hot spot at the biopsy site. A focal scan abnormality was present at the biopsy site in 9/11 patients studied 5 to 59 days after a trans iliac bone biopsy. No resultant scan abnormality was seen in 4 patients imaged within 3 days of the bone biopsy or in 3 patients imaged 79 to 138 days after the procedure. Bone marrow biopsy of the sternum or iliac crest does not usually cause bone scan abnormalities. A focal abnormality at the biopsy site is common in patients imaged 5 days to 2 months after bone biopsy. The gauge of the needle employed in the biopsy and thus the degree of bone trauma inflicted, is likely to be main factor determining the appearance of bone scan abnormalities at the biopsy site.

  18. Bone development

    PubMed Central

    Berendsen, Agnes D.; Olsen, Bjorn R.

    2015-01-01

    The development of the vertebrate skeleton reflects its evolutionary history. Cartilage formation came before biomineralization and a head skeleton evolved before the formation of axial and appendicular skeletal structures. This review describes the processes that result in endochondral and intramembranous ossification, the important roles of growth and transcription factors, and the consequences of mutations in some of the genes involved. Following a summary of the origin of cartilage, muscle, and tendon cell lineages in the axial skeleton, we discuss the role of muscle forces in the formation of skeletal architecture and assembly of musculoskeletal functional units. Finally, ontogenetic patterning of bones in response to mechanical loading is reviewed. PMID:26453494

  19. Daily parathyroid hormone administration enhances bone turnover and preserves bone structure after severe immobilization-induced bone loss.

    PubMed

    Harlow, Lauren; Sahbani, Karim; Nyman, Jeffry S; Cardozo, Christopher P; Bauman, William A; Tawfeek, Hesham A

    2017-09-01

    Immobilization, as a result of motor-complete spinal cord injury (SCI), is associated with severe osteoporosis. Whether parathyroid hormone (PTH) administration would reduce bone loss after SCI remains unclear. Thus, female mice underwent sham or surgery to produce complete spinal cord transection. PTH (80 μg/kg) or vehicle was injected subcutaneously (SC) daily starting on the day of surgery and continued for 35 days. Isolated tibias and femurs were examined by microcomputed tomography scanning (micro-CT) and histology and serum markers of bone turnover were measured. Micro-CT analysis of tibial metaphysis revealed that the SCI-vehicle animals exhibited 49% reduction in fractional trabecular bone volume and 18% in trabecular thickness compared to sham-vehicle controls. SCI-vehicle animals also had 15% lower femoral cortical thickness and 16% higher cortical porosity than sham-vehicle counterparts. Interestingly, PTH administration to SCI animals restored 78% of bone volume, increased connectivity to 366%, and lowered structure model index by 10% compared to sham-vehicle animals. PTH further favorably attenuated femoral cortical bone loss to 5% and prevented the SCI-associated cortical porosity. Histomorphometry evaluation of femurs of SCI-vehicle animals demonstrated a marked 49% and 38% decline in osteoblast and osteoclast number, respectively, and 35% reduction in bone formation rate. In contrast, SCI-PTH animals showed preserved osteoblast and osteoclast numbers and enhanced bone formation rate. Furthermore, SCI-PTH animals had higher levels of bone formation and resorption markers than either SCI- or sham-vehicle groups. Collectively, these findings suggest that intermittent PTH receptor activation is an effective therapeutic strategy to preserve bone integrity after severe immobilization. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  20. Smoking and Bone Health

    MedlinePlus

    ... supported by your browser. Home Bone Basics Lifestyle Smoking and Bone Health Publication available in: PDF (85 ... late to adopt new habits for healthy bones. Smoking and Osteoporosis Cigarette smoking was first identified as ...

  1. Menopause and Bone Loss

    MedlinePlus

    Fact Sheet & Menopause Bone Loss How are bone loss and menopause related? Throughout life your body keeps a balance between the ... lose bone faster than it can be replaced. Menopause—the time when menstrual periods end, which usually ...

  2. Calcium and bones

    MedlinePlus

    ... Your body also needs calcium (as well as phosphorus) to make healthy bones. Bones are the main ... nlm.nih.gov/pubmed/25182228 . De Paula FJA, Black DM, Rosen CJ. Osteoporosis and bone biology. In: ...

  3. Disorders of Bone Remodeling

    PubMed Central

    Feng, Xu; McDonald, Jay M.

    2013-01-01

    The skeleton provides mechanical support for stature and locomotion, protects vital organs, and controls mineral homeostasis. A healthy skeleton must be maintained by constant bone modeling to carry out these crucial functions throughout life. Bone remodeling involves the removal of old or damaged bone by osteoclasts (bone resorption) and the subsequent replacement of new bone formed by osteoblasts (bone formation). Normal bone remodeling requires a tight coupling of bone resorption to bone formation to guarantee no alteration in bone mass or quality after each remodeling cycle. However, this important physiological process can be derailed by a variety of factors, including menopause-associated hormonal changes, age-related factors, changes in physical activity, drugs, and secondary diseases, which lead to the development of various bone disorders in both women and men. We review the major diseases of bone remodeling, emphasizing our current understanding of the underlying pathophysiological mechanisms. PMID:20936937

  4. What Is Bone?

    MedlinePlus

    ... important to learn about bone. Made mostly of collagen, bone is living, growing tissue. Collagen is a protein that provides a soft framework, ... strength and hardens the framework. This combination of collagen and calcium makes bone strong and flexible enough ...

  5. Bone marrow aspiration (image)

    MedlinePlus

    ... amount of bone marrow is removed during a bone marrow aspiration. The procedure is uncomfortable, but can be tolerated by both children and adults. The marrow can be studied to determine ... metabolic products are stored in certain bone marrow cells.

  6. Dietary restrictions, bone density, and bone quality.

    PubMed

    Huang, Tsang-hai; Ables, Gene P

    2016-01-01

    Caloric restriction (CR), protein restriction (PR), and specific amino acid restriction (e.g., methionine restriction (MR)) are different dietary interventions that have been confirmed with regard to their comprehensive benefits to metabolism and health. Based on bone densitometric measurements, weight loss induced by dietary restriction is known to be accompanied by reduced areal bone mineral density, bone mass, and/or bone size, and it is considered harmful to bone health. However, because of technological advancements in bone densitometric instruments (e.g., high-resolution X-ray tomography), dietary restrictions have been found to cause a reduction in bone mass/size rather than volumetric bone mineral density. Furthermore, when considering bone quality, bone health consists of diverse indices that cannot be fully represented by densitometric measurements alone. Indeed, there is evidence that moderate dietary restrictions do not impair intrinsic bone material properties, despite the reduction in whole-bone strength because of a smaller bone size. In the present review, we integrate research evidence from traditional densitometric measurements, metabolic status assays (e.g., energy metabolism, oxidative stresses, and inflammatory responses), and biomaterial analyses to provide revised conclusions regarding the effects of CR, PR, and MR on the skeleton.

  7. Green tea polyphenols supplementation improves bone microstructure in orchidectomized middle-Aged rats

    USDA-ARS?s Scientific Manuscript database

    Our recent study shows that green tea polyphenols (GTP) attenuate trabecular bone loss in ovariectomized middle-aged female rats. To investigate whether GTP prevents bone loss in male rats, 40 rats with and without oriectomy (ORX) were assigned to 4 groups in a 2 (sham vs. ORX)× 2 (no GTP and 0.5% G...

  8. Absolute measurement of optical attenuation

    NASA Astrophysics Data System (ADS)

    Wetsel, Grover C., Jr.; Stotts, Steven A.

    1983-06-01

    We have discovered that laser beam deflection spectroscopy can be used for the absolute measurement of wave or particle beam attenuation in condensed matter. The concept has been experimentally evaluated by successfully measuring the absolute optical attenuation in a crystal of U3+:CaF2 at 514 nm. A theoretical model that explains the experiment and characterizes the range of applicability of the method has been developed.

  9. Bone marrow transplant - discharge

    MedlinePlus

    Transplant - bone marrow - discharge; Stem cell transplant - discharge; Hematopoietic stem cell transplant - discharge; Reduced intensity; Non-myeloablative transplant - discharge; Mini transplant - discharge; Allogenic bone marrow transplant - ...

  10. Technical aspects of bone scintigraphy.

    PubMed

    Brown, M L; O'Connor, M K; Hung, J C; Hayostek, R J

    1993-07-01

    Optimal bone scintigraphy is obtained by using a current generation gamma camera with a high-resolution collimator, minimizing the patient-to-collimator distance, using scatter reduction techniques where possible, and obtaining a 500,000 to 1 million count image for 40-cm field of view camera. Hard copy images from an analog or digital formatter should be optimized to display all intensities either on the same images or, when necessary, to display the low count information on one image and the high count information on another. Additional images using different collimators, such as converging or pinhole collimators, and oblique and lateral views should be obtained when necessary to demonstrate or define the pathologic area. To optimize SPECT imaging, the following parameters should be used: a high-resolution collimator, a 128 x 128 acquisition matrix, and minimum separation between the patient and the collimator, which may require the use of an elliptic orbit. Between 64 and 128 views should be obtained, and depending on preference, the planar data should be prefiltered with a Butterworth, order 8-12 and a cutoff at 0.5 Nyquist. The data should then be reconstructed using a simple ramp filter. This method provides a good technique when one is first beginning to perform bone SPECT. Attenuation correction is not generally beneficial for SPECT bone studies, although sometimes weighted backprojection may improve image contrast and resolution. Finally, the use of volume rendering may help clarify the location of suspect lesions.

  11. Bone and bone marrow involvement in sarcoidosis.

    PubMed

    Yachoui, Ralph; Parker, Brian J; Nguyen, Thanhcuong T

    2015-11-01

    Bone and bone marrow involvement in sarcoidosis have been infrequently reported. We aimed to describe the clinical features, radiological descriptions, pathological examinations, and outcomes of three patients with osseous sarcoidosis and one patient with bone marrow sarcoidosis seen at our institution. Our case series included fluorodeoxyglucose positron emission tomography descriptions in assessing the whole-body extent of sarcoidosis. In the era of advanced imaging, large bone and axial skeleton sarcoidosis lesions are more common than previously reported.

  12. Classification of bones from MR images in torso PET-MR imaging using a statistical shape model

    NASA Astrophysics Data System (ADS)

    Reza Ay, Mohammad; Akbarzadeh, Afshin; Ahmadian, Alireza; Zaidi, Habib

    2014-01-01

    There have been exclusive features for hybrid PET/MRI systems in comparison with its PET/CT counterpart in terms of reduction of radiation exposure, improved soft-tissue contrast and truly simultaneous and multi-parametric imaging capabilities. However, quantitative imaging on PET/MR is challenged by attenuation of annihilation photons through their pathway. The correction for photon attenuation requires the availability of patient-specific attenuation map, which accounts for the spatial distribution of attenuation coefficients of biological tissues. However, the lack of information on electron density in the MR signal poses an inherent difficulty to the derivation of the attenuation map from MR images. In other words, the MR signal correlates with proton densities and tissue relaxation properties, rather than with electron density and, as such, it is not directly related to attenuation coefficients. In order to derive the attenuation map from MR images at 511 keV, various strategies have been proposed and implemented on prototype and commercial PET/MR systems. Segmentation-based methods generate an attenuation map by classification of T1-weighted or high resolution Dixon MR sequences followed by assignment of predefined attenuation coefficients to various tissue types. Intensity-based segmentation approaches fail to include bones in the attenuation map since the segmentation of bones from conventional MR sequences is a difficult task. Most MR-guided attenuation correction techniques ignore bones owing to the inherent difficulties associated with bone segmentation unless specialized MR sequences such as ultra-short echo (UTE) sequence are utilized. In this work, we introduce a new technique based on statistical shape modeling to segment bones and generate a four-class attenuation map. Our segmentation approach requires a torso bone shape model based on principle component analysis (PCA). A CT-based training set including clearly segmented bones of the torso region

  13. Skeletal muscle Ca(2+) mishandling: Another effect of bone-to-muscle signaling.

    PubMed

    Regan, Jenna N; Waning, David L; Guise, Theresa A

    2016-01-01

    Our appreciation of crosstalk between muscle and bone has recently expanded beyond mechanical force-driven events to encompass a variety of signaling factors originating in one tissue and communicating to the other. While the recent identification of new 'myokines' has shifted some focus to the role of muscle in this partnership, bone-derived factors and their effects on skeletal muscle should not be overlooked. This review summarizes some previously known mediators of bone-to-muscle signaling and also recent work identifying a new role for bone-derived TGF-β as a cause of skeletal muscle weakness in the setting of cancer-induced bone destruction. Oxidation of the ryanodine receptor/calcium release channel (RyR1) in skeletal muscle occurs via a TGF-β-Nox4-RyR1 axis and leads to calcium mishandling and decreased muscle function. Multiple points of potential therapeutic intervention were identified, from preventing the bone destruction to stabilizing the RYR1 calcium channel. This new data reinforces the concept that bone can be an important source of signaling factors in pathphysiological settings. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Tissue Probability-Based Attenuation Correction for Brain PET/MR by Using SPM8

    NASA Astrophysics Data System (ADS)

    Teuho, J.; Linden, J.; Johansson, J.; Tuisku, J.; Tuokkola, T.; Teräs, M.

    2016-10-01

    Bone attenuation remains a methodological challenge in hybrid PET/MR, as bone is hard to visualize via magnetic resonance imaging (MRI). Therefore, novel methods for taking into account bone attenuation in MR-based attenuation correction (MRAC) are needed. In this study, we propose a tissue-probability based attenuation correction (TPB-AC), which employs the commonly available neurological toolbox SPM8, to derive a subject-specific μ-map by segmentation of T1-weighted MR images. The procedures to derive a μ-map representing soft tissue, air and bone from the New Segment function in SPM8 and MATLAB are described. Visual and quantitative comparisons against CT-based attenuation correction (CTAC) data were performed using two μ-values ( 0.135 cm-1 and 0.145 cm-1) for bone. Results show improvement of visual quality and quantitative accuracy of positron emission tomography (PET) images when TPB-AC μ-map is used in PET/MR image reconstruction. Underestimation in PET images was decreased by an average of 5 ±2 percent in the whole brain across all patients. In addition, the method performed well when compared to CTAC, with maximum differences (mean ± standard deviation) of - 3 ±2 percent and 2 ±4 percent in two regions out of 28. Finally, the method is simple and computationally efficient, offering a promising platform for further development. Therefore, a subject-specific MR-based μ-map can be derived only from the tissue probability maps from the New Segment function of SPM8.

  15. Factors affecting bone growth.

    PubMed

    Gkiatas, Ioannis; Lykissas, Marios; Kostas-Agnantis, Ioannis; Korompilias, Anastasios; Batistatou, Anna; Beris, Alexandros

    2015-02-01

    Bone growth and development are products of the complex interactions of genetic and environmental factors. Longitudinal bone growth depends on the growth plate. The growth plate has 5 different zones-each with a different functional role-and is the final target organ for longitudinal growth. Bone length is affected by several systemic, local, and mechanical factors. All these regulation systems control the final length of bones in a complicated way. Despite its significance to bone stability, bone growth in width has not been studied as extensively as longitudinal bone growth. Bone growth in width is also controlled by genetic factors, but mechanical loading regulates periosteal apposition. In this article, we review the most recent data regarding bone growth from the embryonic age and analyze the factors that control bone growth. An understanding of this complex system is important in identifying metabolic and developmental bone diseases and fracture risk.

  16. Method and system for in vivo measurement of bone tissue using a two level energy source

    NASA Technical Reports Server (NTRS)

    Cameron, J. R.; Judy, P. F. (Inventor)

    1976-01-01

    Methods and apparatus are provided for radiologically determining the bone mineral content of living human bone tissue independently of the concurrent presence of adipose and other soft tissues. A target section of the body of the subject is irradiated with a beam of penetrative radiations of preselected energy to determine the attenuation of such beam with respect to the intensity of each of two radiations of different predetermined energy levels. The resulting measurements are then employed to determine bone mineral content.

  17. A structural approach in the study of bones: fossil and burnt bones at nanosize scale

    NASA Astrophysics Data System (ADS)

    Piga, Giampaolo; Baró, Maria Dolors; Escobal, Irati Golvano; Gonçalves, David; Makhoul, Calil; Amarante, Ana; Malgosa, Assumpció; Enzo, Stefano; Garroni, Sebastiano

    2016-12-01

    We review the different factors affecting significantly mineral structure and composition of bones. Particularly, it is assessed that micro-nanostructural and chemical properties of skeleton bones change drastically during burning; the micro- and nanostructural changes attending those phases manifest themselves, amongst others, in observable alterations to the bones colour, morphology, microstructure, mechanical strength and crystallinity. Intense changes involving the structure and chemical composition of bones also occur during the fossilization process. Bioapatite material is contaminated by an heavy fluorination process which, on a long-time scale reduces sensibly the volume of the original unit cell, mainly the a-axis of the hexagonal P63/m space group. Moreover, the bioapatite suffers to a varying degree of extent by phase contamination from the nearby environment, to the point that rarely a fluorapatite single phase may be found in fossil bones here examined. TEM images supply precise and localized information, on apatite crystal shape and dimension, and on different processes that occur during thermal processes or fossilization of ancient bone, complementary to that given by X-ray diffraction and Attenuated Total Reflection Infrared spectroscopy. We are presenting a synthesis of XRD, ATR-IR and TEM results on the nanostructure of various modern, burned and palaeontological bones.

  18. miR-142-3p prevents macrophage differentiation during cancer-induced myelopoiesis.

    PubMed

    Sonda, Nada; Simonato, Francesca; Peranzoni, Elisa; Calì, Bianca; Bortoluzzi, Stefania; Bisognin, Andrea; Wang, Ena; Marincola, Francesco M; Naldini, Luigi; Gentner, Bernhard; Trautwein, Christian; Sackett, Sara Dutton; Zanovello, Paola; Molon, Barbara; Bronte, Vincenzo

    2013-06-27

    Tumor progression is accompanied by an altered myelopoiesis causing the accumulation of immunosuppressive cells. Here, we showed that miR-142-3p downregulation promoted macrophage differentiation and determined the acquisition of their immunosuppressive function in tumor. Tumor-released cytokines signaling through gp130, the common subunit of the interleukin-6 cytokine receptor family, induced the LAP∗ isoform of C/EBPβ transcription factor, promoting macrophage generation. miR-142-3p downregulated gp130 by canonical binding to its messenger RNA (mRNA) 3' UTR and repressed C/EBPβ LAP∗ by noncanonical binding to its 5' mRNA coding sequence. Enforced miR expression impaired macrophage differentiation both in vitro and in vivo. Mice constitutively expressing miR-142-3p in the bone marrow showed a marked increase in survival following immunotherapy with tumor-specific T lymphocytes. By modulating a specific miR in bone marrow precursors, we thus demonstrated the feasibility of altering tumor-induced macrophage differentiation as a potent tool to improve the efficacy of cancer immunotherapy.

  19. Dietary protein level and source differentially affect bone metabolism, strength, and intestinal calcium transporter expression during ad libitum and food-restricted conditions in male rats

    USDA-ARS?s Scientific Manuscript database

    High protein diets may attenuate bone loss during energy restriction (ER). The objective of the current study was to determine whether high protein diets suppress bone turnover and improve bone quality in rats during ER and whether dietary protein source affects this relationship. Eighty 12-week o...

  20. Interaural attenuation in the cat, measured with single fibre data.

    PubMed

    Caird, D; Göttl, K H; Klinke, R

    1980-12-01

    Acoustic crosstalk was measured in the pentobarbital anesthetized cat using the responses of single units in the auditory nerve to ipsilateral and contralateral sound stimuli. The mean interaural attenuation (IATT) was found to be 76 dB between 350 and 18,000 Hz. No systematic variation of IATT with frequency was found although a large variation between different units with similar characteristic frequencies could be seen. We suggest that this scatter is due to the complex fine structure of the bone conduction pathways (Tonndorf (1966) Bone conduction. Acta Otolaryngol. Suppl. 213, 1-132). There are large discrepancies between these data and values obtained using cochlear microphonic potentials as an indicator. We suggest that cochlear microphonic crosstalk data in the literature should be treated with caution as it is extremely difficult to exclude the effect or direct electrical crosstalk on these analog signals.

  1. Soy Isoflavones and Osteoporotic Bone Loss: A Review with an Emphasis on Modulation of Bone Remodeling

    PubMed Central

    Zheng, Xi; Lee, Sun-Kyeong

    2016-01-01

    Abstract Osteoporosis is an age-related disorder that affects both women and men, although estrogen deficiency induced by menopause accelerates bone loss in older women. As the demographic shifts to a more aged population, a growing number of men and women will be afflicted with osteoporosis. Since the current drug therapies available have multiple side effects, including increased risk of developing certain types of cancer or complications, a search for potential nonpharmacologic alternative therapies for osteoporosis is of prime interest. Soy isoflavones (SI) have demonstrated potential bone-specific effects in a number of studies. This article provides a systematic review of studies on osteoporotic bone loss in relation to SI intake from diet or supplements to comprehensively explain how SI affect the modulation of bone remodeling. Evidence from epidemiologic studies supports that dietary SI attenuate menopause-induced osteoporotic bone loss by decreasing bone resorption and stimulating bone formation. Other studies have also illustrated that bone site-specific trophic and synergistic effects combined with exercise intervention might contribute to improve the bioavailability of SI or strengthen the bone-specific effects. To date, however, the effects of dietary SI on osteoporotic bone loss remain inconclusive, and study results vary from study to study. The current review will discuss the potential factors that result in the conflicting outcomes of these studies, including dosages, intervention materials, study duration, race, and genetic differences. Further well-designed studies are needed to fully understand the underlying mechanism and evaluate the effects of SI on osteoporosis in humans. PMID:26670451

  2. Bone scan appearances following biopsy of bone and bone marrow

    SciTech Connect

    McKillop, J.H.; Maharaj, D.; Boyce, B.F.; Fogelman, I.

    1984-10-01

    The influence of sternal marrow aspiration, iliac crest marrow aspiration, and iliac crest bone biopsy on bone scan appearances was examined. Eighteen patients were scanned a mean of 9.9 days after sternal marrow aspiration with a Salah needle. Bone scans obtained in 9 patients a mean of 10 days aftr iliac crest trephine marrow biopsy with a Jamshidi needle showed no abnormality at the biopsy site. In 18 patients with metabolic bone disease who had undergone iliac crest bone biopsy with an 8 mm needle, a scan abnormality due to the biopsy was usually present when the interval between the biopsy and the scan was 5 days to 2 months. Patients who were scanned within 3 days of iliac crest bone biopsy or more than 2 months after biopsy had normal scan appearance at the biopsy site.

  3. Dissolution of the inorganic phase of bone leading to release of calcium regulates osteoclast survival.

    PubMed

    Nielsen, Rasmus H; Karsdal, Morten A; Sørensen, Mette G; Dziegiel, Morten H; Henriksen, Kim

    2007-09-07

    Osteoclasts are the sole cells possessing the ability to resorb calcified bone matrix. This occurs via secretion of hydrochloric acid mediated by the V-ATPase and the chloride channel ClC-7. Loss of acidification leads to osteopetrosis characterized by ablation of bone resorption and increased osteoclast numbers, indicating increased life span of the osteoclasts. To investigate the role of the inorganic phase of bone with respect to osteoclast life span, we used the V-ATPase inhibitor bafilomycin and the calcium uptake antagonist ryanodine on human osteoclasts cultured on calcified and decalcified bone slices. Bafilomycin inhibited bone resorption and increased osteoclast survival on calcified but not decalcified bones. Ryanodine attenuated calcium uptake and thereby augmented osteoclast survival on calcified bones. In summary, we found that acidification leading to calcium release from bone during resorption controls osteoclast survival, potentially explaining the increased numbers of osteoclasts in patients with osteopetrosis.

  4. Ultrasonic characterization of human trabecular bone microstructure.

    PubMed

    Hakulinen, Mikko A; Day, Judd S; Töyräs, Juha; Weinans, Harrie; Jurvelin, Jukka S

    2006-03-21

    New quantitative ultrasound (QUS) techniques involving ultrasound backscattering have been introduced for the assessment of bone quality. QUS parameters are affected by the transducer characteristics, e.g. frequency range, wave and pulse length. Although frequency-dependent backscattering has been studied extensively, understanding of the ultrasound scattering phenomenon in trabecular bone is still limited. In the present study, the relationships between QUS parameters and the microstructure of human trabecular bone were investigated experimentally and by using numerical simulations. Speed of sound (SOS), normalized broadband ultrasound attenuation (nBUA), average attenuation, integrated reflection coefficient (IRC) and broadband ultrasound backscatter (BUB) were measured for 26 human trabecular bone cylinders. Subsequently, a high-resolution microCT system was used to determine the microstructural parameters. Moreover, based on the sample-specific microCT data, a numerical model for ultrasound propagation was developed for the simulation of experimental measurements. Experimentally, significant relationships between the QUS parameters and microstructural parameters were demonstrated. The relationships were dependent on the frequency, and the strongest association (r = 0.88) between SOS and structural parameters was observed at a centre frequency of 5 MHz. nBUA, average attenuation, IRC and BUB showed somewhat lower linear correlations with the structural properties at a centre frequency of 5 MHz, as compared to those determined at lower frequencies. Multiple regression analyses revealed that the variation of acoustic parameters could best be explained by parameters reflecting the amount of mineralized tissue. A principal component analysis demonstrated that the strongest determinants of BUB and IRC were related to the trabecular structure. However, other structural characteristics contributed significantly to the prediction of the acoustic parameters as well. The

  5. Bone Health and Osteoporosis.

    PubMed

    Lupsa, Beatrice C; Insogna, Karl

    2015-09-01

    Osteoporosis is characterized by low bone mass and microarchitectural deterioration of bone tissue leading to decreased bone strength and an increased risk of low-energy fractures. Central dual-energy X-ray absorptiometry measurements are the gold standard for determining bone mineral density. Bone loss is an inevitable consequence of the decrease in estrogen levels during and following menopause, but additional risk factors for bone loss can also contribute to osteoporosis in older women. A well-balanced diet, exercise, and smoking cessation are key to maintaining bone health as women age. Pharmacologic agents should be recommended in patients at high risk for fracture.

  6. [Imaging of bone metastases].

    PubMed

    Amoretti, Nicolas; Thariat, Juliette; Nouri, Yasir; Foti, Pauline; Hericord, Olivier; Stolear, Sandy; Coco, Lucia; Hauger, Olivier; Huwart, Laurent; Boileau, Pascal

    2013-11-01

    Bone metastases are detected at initial diagnosis of cancer in 25% of cases and bone metastases are common in the course of a majority of cancer types. The spine and proximal long bones are the most affected sites. Knowledge of the basic radiological semiology is important to make the proper diagnosis of metastasis(s) bone(s), especially in situations in which the clinical context is not suggestive of metastases (such as cases where bone metastases are inaugural or cases of peripheral solitary metastasis). Tumor aggressiveness can be assessed at the level of the cortical bone and periosteum. Lodwick criteria are useful for the diagnosis of malignancy and tumor aggressiveness at initial diagnosis on plain radiographs, which are very important in the context of bone metastases. A CT scanner is required to confirm the malignancy of a bone lesion. MRI is complementary to the scanner including for the assessment of bone marrow involvement and tumor extensions.

  7. Attenuation correction methods suitable for brain imaging with a PET/MRI scanner: a comparison of tissue atlas and template attenuation map approaches.

    PubMed

    Malone, Ian B; Ansorge, Richard E; Williams, Guy B; Nestor, Peter J; Carpenter, T Adrian; Fryer, Tim D

    2011-07-01

    Modeled attenuation correction (AC) will be necessary for combined PET/MRI scanners not equipped with transmission scanning hardware. We compared 2 modeled AC approaches that use nonrigid registration with rotating (68)Ge rod-based measured AC for 10 subjects scanned with (18)F-FDG. Two MRI and attenuation map pairs were evaluated: tissue atlas-based and measured templates. The tissue atlas approach used a composite of the BrainWeb and Zubal digital phantoms, whereas the measured templates were produced by averaging spatially normalized measured MR image and coregistered attenuation maps. The composite digital phantom was manually edited to include 2 additional tissue classes (paranasal sinuses, and ethmoidal air cells or nasal cavity). In addition, 3 attenuation values for bone were compared. The MRI and attenuation map pairs were used to generate subject-specific attenuation maps via nonrigid registration of the MRI to the MR image of the subject. SPM2 and a B-spline free-form deformation algorithm were used for the nonrigid registration. To determine the accuracy of the modeled AC approaches, radioactivity concentration was assessed on a voxelwise and regional basis. The template approach produced better spatial consistency than the phantom-based atlas, with an average percentage error in radioactivity concentration across the regions, compared with measured AC, of -1.2% ± 1.2% and -1.5% ± 1.9% for B-spline and SPM2 registration, respectively. In comparison, the tissue atlas method with B-spline registration produced average percentage errors of 0.0% ± 3.0%, 0.9% ± 2.9%, and 2.9% ± 2.8% for bone attenuation values of 0.143 cm(-1), 0.152 cm(-1), and 0.172 cm(-1), respectively. The largest errors for the template AC method were found in parts of the frontal cortex (-3%) and the cerebellar vermis (-5%). Intersubject variability was higher with SPM2 than with B-spline. Compared with measured AC, template AC with B-spline and SPM2 achieved a correlation

  8. Topical treatment with Tong-Luo-San-Jie Gel alleviates bone cancer pain in rats

    PubMed Central

    Wang, Juyong; Zhang, Ruixin; Dong, Changsheng; Jiao, Liying; Xu, Ling; Liu, Jiyong; Wang, Zhengtao; Ying, Qi Liang Mao; Fong, Harry; Lao, Lixing

    2012-01-01

    Ethnopharmacological relevance The herbal analgesic gel Tong-Luo-San-Jie (TLSJ) and its modifications are used in traditional Chinese medicine to manage cancer pain. However, its mechanisms are still unknown. Aim of the study To investigate the effects and mechanisms of TLSJ gel on bone cancer pain in a rat model. Materials and Methods A bone cancer pain rat model was established by inoculating Walker 256 rat carcinoma cells directly into the right tibial medullary cavity of Sprague-Dawley rats (150–170 g); Phosphate buffered saline (PBS) tibial inoculation was used as control. Cancer-bearing rats were treated twice a day with external TLSJ gel (0.5 g/cm2/day) or inert gel control for 21 days (n=10/group). Behavioral tests such as mechanical threshold and paw withdrawal latency (PWL) were carried out. Osteoclastic activities were determined and carboxyterminal pyridinoline cross-linked type I collagen telopeptides (ICTP) and bone-specific alkaline phosphatase (BAP) concentrations were detected with ELISA after treatment. Adverse effects were monitored, and biochemical and histological tests were performed in naïve rats treated with local TLSJ gel for six weeks. Results TLSJ treatment significantly restored bone cancer-induced decrease of PWL and mechanical threshold compared to inert gel. It also decreased the level of blood serum ICTP and BAP and inhibited osteoclast activities. No adverse effects or abnormal biochemical and histological changes were detected after TLSJ treatment. Conclusion The present study shows that TLSJ significantly inhibits bone cancer-induced thermal and mechanical sensitization. It suggests that the gel may be useful in managing cancer pain and that it may act by inhibiting osteoclastic activity. PMID:22960543

  9. Exercise and bone mass in adults.

    PubMed

    Guadalupe-Grau, Amelia; Fuentes, Teresa; Guerra, Borja; Calbet, Jose A L

    2009-01-01

    There is a substantial body of evidence indicating that exercise prior to the pubertal growth spurt stimulates bone growth and skeletal muscle hypertrophy to a greater degree than observed during growth in non-physically active children. Bone mass can be increased by some exercise programmes in adults and the elderly, and attenuate the losses in bone mass associated with aging. This review provides an overview of cross-sectional and longitudinal studies performed to date involving training and bone measurements. Cross-sectional studies show in general that exercise modalities requiring high forces and/or generating high impacts have the greatest osteogenic potential. Several training methods have been used to improve bone mineral density (BMD) and content in prospective studies. Not all exercise modalities have shown positive effects on bone mass. For example, unloaded exercise such as swimming has no impact on bone mass, while walking or running has limited positive effects. It is not clear which training method is superior for bone stimulation in adults, although scientific evidence points to a combination of high-impact (i.e. jumping) and weight-lifting exercises. Exercise involving high impacts, even a relatively small amount, appears to be the most efficient for enhancing bone mass, except in postmenopausal women. Several types of resistance exercise have been tested also with positive results, especially when the intensity of the exercise is high and the speed of movement elevated. A handful of other studies have reported little or no effect on bone density. However, these results may be partially attributable to the study design, intensity and duration of the exercise protocol, and the bone density measurement techniques used. Studies performed in older adults show only mild increases, maintenance or just attenuation of BMD losses in postmenopausal women, but net changes in BMD relative to control subjects who are losing bone mass are beneficial in

  10. SEISMIC ATTENUATION FOR RESERVOIR CHARACTERIZATION

    SciTech Connect

    Joel Walls; M.T. Taner; Naum Derzhi; Gary Mavko; Jack Dvorkin

    2003-04-01

    In this report we will show results of seismic and well log derived attenuation attributes from a deep water Gulf of Mexico data set. This data was contributed by Burlington Resources and Seitel Inc. The data consists of ten square kilometers of 3D seismic data and three well penetrations. We have computed anomalous seismic absorption attributes on the seismic data and have computed Q from the well log curves. The results show a good correlation between the anomalous absorption (attenuation) attributes and the presence of gas as indicated by well logs.

  11. The LCLS Gas Attenuator Revisited

    SciTech Connect

    Ryutov, D

    2005-06-07

    In the report ''X-ray attenuation cell'' [1] a preliminary analysis of the gas attenuator for the Linac Coherent Light Source (LCLS) was presented. This analysis was carried out for extremely stringent set of specifications. In particular, a very large diameter for the unobstructed beam was set (1 cm) to accommodate the spontaneous radiation; the attenuator was supposed to cover the whole range of energies of the coherent radiation, from 800 eV to 8000 eV; the maximum attenuation was set at the level of 10{sup 4}; the use of solid attenuators was not allowed, as well as the use of rotating shutters. The need to reach a sufficient absorption at the high-energy end of the spectrum predetermined the choice of Xe as the working gas (in order to have a reasonable absorption at a not-too-high pressure). A sophisticated differential pumping system that included a Penning-type ion pump was suggested in order to minimize the gas leak into the undulator/accelerator part of the facility. A high cost of xenon meant also that an efficient (and expensive) gas-recovery system would have to be installed. The main parameter that determined the high cost and the complexity of the system was a large radius of the orifice. The present viewpoint allows for much smaller size of the orifice, r{sub 0} = 1.5 mm. (1) The use of solid attenuators is also allowed (R.M. Bionta, private communication). It is, therefore, worthwhile to reconsider various parameters of the gas attenuator for these much less stringent conditions. This brief study should be considered as a physics input for the engineering design. As a working gas we consider now the argon, which, on the one hand, provides a reasonable absorption lengths and, on the other hand, is inexpensive enough to be exhausted into the atmosphere (no recovery). The absorption properties of argon are illustrated by Fig.1 where the attenuation factor A is shown for various beam energies, based on Ref. [2]. The other relevant parameters for argon

  12. X-Ray Attenuation Cell

    SciTech Connect

    Ryutov, D.; Toor, A.

    2000-03-03

    To minimize the pulse-to-pulse variation, the LCLS FEL must operate at saturation, i.e. 10 orders of magnitude brighter spectral brilliance than 3rd-generation light sources. At this intensity, ultra-high vacuums and windowless transport are required. Many of the experiments, however, will need to be conducted at a much lower intensity thereby requiring a reliable means to reduce the x-ray intensity by many orders of magnitude without increasing the pulse-to-pulse variation. In this report we consider a possible solution for controlled attenuation of the LCLS x-ray radiation. We suggest using for this purpose a windowless gas-filled cell with the differential pumping. Although this scheme is easily realizable in principle, it has to be demonstrated that the attenuator can be made short enough to be practical and that the gas loads delivered to the vacuum line of sight (LOS) are acceptable. We are not going to present a final, optimized design. Instead, we will provide a preliminary analysis showing that the whole concept is robust and is worth further study. The spatial structure of the LCLS x-ray pulse at the location of the attenuator is shown in Fig. 1. The central high-intensity component, due to the FEL, has a FWHM of {approx}100 {micro}m. A second component, due to the undulator's broad band spontaneous radiation is seen as a much lower intensity ''halo'' with a FWHM of 1 mm. We discuss two versions of the attenuation cell. The first is directed towards a controlled attenuation of the FEL up to the 4 orders of magnitude in the intensity, with the spontaneous radiation halo being eliminated by collimators. In the second version, the spontaneous radiation is not sacrificed but the FEL component (as well as the first harmonic of the spontaneous radiation) gets attenuated by a more modest factor up to 100. We will make all the estimates assuming that the gas used in the attenuator is Xenon and that the energy of the FEL is 8.25 keV. At lower FEL energies the

  13. Probiotics protect mice from ovariectomy-induced cortical bone loss.

    PubMed

    Ohlsson, Claes; Engdahl, Cecilia; Fåk, Frida; Andersson, Annica; Windahl, Sara H; Farman, Helen H; Movérare-Skrtic, Sofia; Islander, Ulrika; Sjögren, Klara

    2014-01-01

    The gut microbiota (GM) modulates the hosts metabolism and immune system. Probiotic bacteria are defined as live microorganisms which when administered in adequate amounts confer a health benefit on the host and can alter the composition of the GM. Germ-free mice have increased bone mass associated with reduced bone resorption indicating that the GM also regulates bone mass. Ovariectomy (ovx) results in bone loss associated with altered immune status. The purpose of this study was to determine if probiotic treatment protects mice from ovx-induced bone loss. Mice were treated with either a single Lactobacillus (L) strain, L. paracasei DSM13434 (L. para) or a mixture of three strains, L. paracasei DSM13434, L. plantarum DSM 15312 and DSM 15313 (L. mix) given in the drinking water during 6 weeks, starting two weeks before ovx. Both the L. para and the L. mix treatment protected mice from ovx-induced cortical bone loss and bone resorption. Cortical bone mineral content was higher in both L. para and L. mix treated ovx mice compared to vehicle (veh) treated ovx mice. Serum levels of the resorption marker C-terminal telopeptides and the urinary fractional excretion of calcium were increased by ovx in the veh treated but not in the L. para or the L. mix treated mice. Probiotic treatment reduced the expression of the two inflammatory cytokines, TNFα and IL-1β, and increased the expression of OPG, a potent inhibitor of osteoclastogenesis, in cortical bone of ovx mice. In addition, ovx decreased the frequency of regulatory T cells in bone marrow of veh treated but not probiotic treated mice. In conclusion, treatment with L. para or the L. mix prevents ovx-induced cortical bone loss. Our findings indicate that these probiotic treatments alter the immune status in bone resulting in attenuated bone resorption in ovx mice.

  14. Bone health in HIV and hepatitis B or C infections

    PubMed Central

    Biver, Emmanuel; Calmy, Alexandra; Rizzoli, René

    2016-01-01

    Chronic infections with human immunodeficiency virus (HIV), hepatitis B virus (HBV) or hepatitis C virus (HCV) add to age-dependent bone loss and may contribute to lower bone strength in the elderly. In this review, we report recent highlights on the epidemiology of bone fragility in chronic viral infections with HIV, HCV and HBV, its physiopathology and discuss the interference of antiviral therapies with bone metabolism. Chronic infections influence bone through the interactions between risk factors for bone fragility and falls (which are highly prevalent in infected patients), virus activity and antiviral drugs. HIV-infected patients are at increased risk of fracture and the risk is higher in cases of co-infection with HIV and untreated chronic viral hepatitis. In HIV patients, the majority of bone loss occurs during virus activity and at initiation of antiretroviral therapy (ART). However, long-term elderly HIV-infected patients on successful ART display bone microstructure alterations only partially captured by dual energy X-ray absorptiometry (DXA). Bone loss is associated with an increase of bone resorption, reflecting the upregulation of the receptor activator of nuclear factor-kappaB ligand (RANKL) and osteoprotegerin (OPG) pathways via a crosstalk between virus activity, inflammation and the immune system. The use of some antiviral drugs, such as tenofovir (controlling both HBV and HIV infections) or protease inhibitors, may be associated with higher bone toxicity. The reduction of tenofovir plasma concentrations with the implementation of tenofovir alafenamide (TAF) attenuates bone mineral density (BMD) loss but it remains unknown whether it will contribute to reducing fracture risk in long-term HIV-treated patients. Moreover, to what extent the new direct-acting agents for treatment of HCV, including nucleotide inhibitors and protease inhibitors, may affect bone health similarly as ART in HIV should be investigated. PMID:28101146

  15. Probiotics Protect Mice from Ovariectomy-Induced Cortical Bone Loss

    PubMed Central

    Ohlsson, Claes; Engdahl, Cecilia; Fåk, Frida; Andersson, Annica; Windahl, Sara H.; Farman, Helen H.; Movérare-Skrtic, Sofia; Islander, Ulrika; Sjögren, Klara

    2014-01-01

    The gut microbiota (GM) modulates the hosts metabolism and immune system. Probiotic bacteria are defined as live microorganisms which when administered in adequate amounts confer a health benefit on the host and can alter the composition of the GM. Germ-free mice have increased bone mass associated with reduced bone resorption indicating that the GM also regulates bone mass. Ovariectomy (ovx) results in bone loss associated with altered immune status. The purpose of this study was to determine if probiotic treatment protects mice from ovx-induced bone loss. Mice were treated with either a single Lactobacillus (L) strain, L. paracasei DSM13434 (L. para) or a mixture of three strains, L. paracasei DSM13434, L. plantarum DSM 15312 and DSM 15313 (L. mix) given in the drinking water during 6 weeks, starting two weeks before ovx. Both the L. para and the L. mix treatment protected mice from ovx-induced cortical bone loss and bone resorption. Cortical bone mineral content was higher in both L. para and L. mix treated ovx mice compared to vehicle (veh) treated ovx mice. Serum levels of the resorption marker C-terminal telopeptides and the urinary fractional excretion of calcium were increased by ovx in the veh treated but not in the L. para or the L. mix treated mice. Probiotic treatment reduced the expression of the two inflammatory cytokines, TNFα and IL-1β, and increased the expression of OPG, a potent inhibitor of osteoclastogenesis, in cortical bone of ovx mice. In addition, ovx decreased the frequency of regulatory T cells in bone marrow of veh treated but not probiotic treated mice. In conclusion, treatment with L. para or the L. mix prevents ovx-induced cortical bone loss. Our findings indicate that these probiotic treatments alter the immune status in bone resulting in attenuated bone resorption in ovx mice. PMID:24637895

  16. Adverse effects of hyperlipidemia on bone regeneration and strength.

    PubMed

    Pirih, Flavia; Lu, Jinxiu; Ye, Fei; Bezouglaia, Olga; Atti, Elisa; Ascenzi, Maria-Grazia; Tetradis, Sotirios; Demer, Linda; Aghaloo, Tara; Tintut, Yin

    2012-02-01

    Hyperlipidemia increases the risk for generation of lipid oxidation products, which accumulate in the subendothelial spaces of vasculature and bone. Atherogenic high-fat diets increase serum levels of oxidized lipids, which are known to attenuate osteogenesis in culture and to promote bone loss in mice. In this study, we investigated whether oxidized lipids affect bone regeneration and mechanical strength. Wild-type (WT) and hyperlipidemic (Ldlr(-/-)) mice were placed on a high-fat (HF) diet for 13 weeks. Bilateral cranial defects were introduced on each side of the sagittal suture, and 5 weeks postsurgery on the respective diets, the repair/regeneration of cranial bones and mechanical properties of femoral bones were assessed. MicroCT and histological analyses demonstrated that bone regeneration was significantly impaired by the HF diet in WT and Ldlr(-/-) mice. In femoral bone, cortical bone volume fraction (bone volume [BV]/tissue volume [TV]) was significantly reduced, whereas cortical porosity was increased by the HF diet in Ldlr(-/-) but not in WT mice. Femoral bone strength and stiffness, measured by three-point bending analysis, were significantly reduced by the HF diet in Ldlr(-/-), but not in WT mice. Serum analysis showed that the HF diet significantly increased levels of parathyroid hormone, tumor necrosis factor (TNF)-α, calcium, and phosphorus, whereas it reduced procollagen type I N-terminal propeptide, a serum marker of bone formation, in Ldlr(-/-), but not in WT mice. The serum level of carboxyl-terminal collagen crosslinks, a marker for bone resorption, was also 1.7-fold greater in Ldlr(-/-) mice. These findings suggest that hyperlipidemia induces secondary hyperparathyroidism and impairs bone regeneration and mechanical strength.

  17. [Bone involvement in endocrinopathies].

    PubMed

    Ribot, C; Trémollières, F; Pouillès, J M

    1994-06-04

    Progress in bone densitometry, particularly biphotonic absoptiometry, has made it possible to better identify the effects of endocrinopathies on bone. Both cortical and trabecular bone structures can be evaluated quantitatively and topographically revealing important information on the pathophysiology of bone loss. Sex hormones play a major role in the regulation of bone mineralization and hypogonadism, whatever the origin, can lead to deleterious effects. Bone loss is known to be significative in high performance female athletes with amenorrhoea; long-term consequences are not yet determined, but stress fractures have been reported in up to 50%. Other hypogonadisms leading to bone demineralization include anorexia nervosa, chronic intake of gonadotrophin releasing hormone analogues and anti-oestrogens, and hyperprolactinism. Hyperthyroidism leads to a negative calcium balance and demineralization with remodelling, predominantly in cortical bone. In hypothyroid states a 10% bone loss is observed in vertebrae. In both cases, bone densitometry should be performed in order to evaluate the effect of treatment. The deleterious effect of spontaneous or iatrogenic hypercortisism is well known, leading to spontaneous wedge fractures of the vertebrae due to predominating trabecular bone loss. The mechanism of action of corticosteroids on bone metabolism is complex, but the major effect is an inhibition of osteoblast maturation. Recovery may be possible, but no large long-term series have yet been reported. Hyperparathyroidism and acromegaly also affect bone mineralization. The information provided by bone densitometry is essential to properly manage patients with endocrinopathies affecting bone mineralization.

  18. Anorexia Nervosa and Bone

    PubMed Central

    Misra, Madhusmita; Klibanski, Anne

    2014-01-01

    Anorexia nervosa (AN) is a condition of severe low weight that is associated with low bone mass, impaired bone structure and reduced bone strength, all of which contribute to increased fracture risk., Adolescents with AN have decreased rates of bone accrual compared with normal-weight controls, raising addition concerns of suboptimal peak bone mass and future bone health in this age group. Changes in lean mass and compartmental fat depots, hormonal alterations secondary to nutritional factors contribute to impaired bone metabolism in AN. The best strategy to improve bone density is to regain weight and menstrual function. Oral estrogen-progesterone combinations are not effective in increasing bone density in adults or adolescents with AN, and transdermal testosterone replacement is not effective in increasing bone density in adult women with AN. However, physiologic estrogen replacement as transdermal estradiol with cyclic progesterone does increase bone accrual rates in adolescents with AN to approximate that in normal-weight controls, leading to a maintenance of bone density Z-scores. A recent study has shown that risedronate increases bone density at the spine and hip in adult women with AN. However, bisphosphonates should be used with great caution in women of reproductive age given their long half-life and potential for teratogenicity, and should be considered only in patients with low bone density and clinically significant fractures when non-pharmacological therapies for weight gain are ineffective. Further studies are necessary to determine the best therapeutic strategies for low bone density in AN. PMID:24898127

  19. Levels of miRNA and Hormones in Thoracic Duct Lymph in Rats with Experimental Breast Cancer Induced by N-Methyl-N-Nitrosourea.

    PubMed

    Lykov, A P; Kabakov, A V; Kazakov, O V; Bondarenko, N A; Poveshchenko, O V; Raiter, T V; Poveshchenko, A F; Strunkin, D N; Konenkov, V I

    2017-01-01

    We studied hormone levels in the thoracic duct lymph and expression of miRNA involved in the pathogenesis of breast cancer induced in rats by intramammary injection of N-methyl-Nnitrosourea. The correlations between miRNA expression and hormone levels depended on the type of treatment.

  20. Detection of Pancreatic Cancer-induced Cachexia using a Fluorescent Myoblast Reporter System and Analysis of Metabolite Abundance

    PubMed Central

    Winnard, Paul T.; Bharti, Santosh; Penet, Marie-France; Marik, Radharani; Mironchik, Yelena; Wildes, Flonne; Maitra, Anirban; Bhujwalla, Zaver M.

    2016-01-01

    The dire effects of cancer-induced cachexia undermine treatment and contribute to decreased survival rates. Therapeutic options for this syndrome are limited, and therefore efforts to identify signs of precachexia in cancer patients are necessary for early intervention. The applications of molecular and functional imaging that would enable a whole-body “holistic” approach to this problem may lead to new insights and advances for diagnosis and treatment of this syndrome. Here we have developed a myoblast optical reporter system with the purpose of identifying early cachectic events. We generated a myoblast cell line expressing a dual tdTomato:GFP construct that was grafted onto the muscle of mice bearing human pancreatic cancer xenografts to provide noninvasive live imaging of events associated with cancer-induced cachexia (i.e., weight loss). Real time optical imaging detected a strong tdTomato fluorescent signal from skeletal muscle grafts in mice with weight loses of only 1.2 to 2.7% and tumor burdens of only ~79 to ~170 mm3. Weight loss in cachectic animals was also associated with a depletion of lipid, cholesterol, valine, and alanine levels, which may provide informative biomarkers of cachexia. Taken together, our findings demonstrate the utility of a reporter system that is capable of tracking tumor-induced weight loss, an early marker of cachexia. Future studies incorporating resected tissue from human pancreatic ductal adenocarcinoma (PDAC) into a reporter-carrying mouse may be able to provide a risk assessment of cachexia with possible implications for therapeutic development. PMID:26719527

  1. Interstitial ultrasound ablation of tumors within or adjacent to bone: Contributions of preferential heating at the bone surface

    NASA Astrophysics Data System (ADS)

    Scott, Serena J.; Prakash, Punit; Salgaonkar, Vasant; Jones, Peter D.; Cam, Richard N.; Han, Misung; Rieke, Viola; Burdette, E. Clif; Diederich, Chris J.

    2013-02-01

    Preferential heating of bone due to high ultrasound attenuation may enhance thermal ablation performed with cathetercooled interstitial ultrasound applicators in or near bone. At the same time, thermally and acoustically insulating cortical bone may protect sensitive structures nearby. 3D acoustic and biothermal transient finite element models were developed to simulate temperature and thermal dose distributions during catheter-cooled interstitial ultrasound ablation near bone. Experiments in ex vivo tissues and tissue-mimicking phantoms were performed to validate the models and to quantify the temperature profiles and ablated volumes for various distances between the interstitial applicator and the bone surface. 3D patient-specific models selected to bracket the range of clinical usage were developed to investigate what types of tumors could be treated, applicator configurations, insertion paths, safety margins, and other parameters. Experiments show that preferential heating at the bone surface decreases treatment times compared to when bone is absent and that all tissue between an applicator and bone can be ablated when they are up to 2 cm apart. Simulations indicate that a 5-7 mm safety margin of normal bone is needed to protect (thermal dose < 6 CEM43°C and T < 45°C) sensitive structures behind ablated bone. In 3D patient-specific simulations, tumors 1.0-3.8 cm (L) and 1.3-3.0 cm (D) near or within bone were ablated (thermal dose > 240 CEM43°C) within 10 min without damaging the nearby spinal cord, lungs, esophagus, trachea, or major vasculature. Preferential absorption of ultrasound by bone may provide improved localization, faster treatment times, and larger treatment zones in tumors in and near bone compared to other heating modalities.

  2. Norathyriol Suppresses Skin Cancers Induced by Solar Ultraviolet Radiation by Targeting ERK Kinases

    SciTech Connect

    Li, Jixia; Malakhova, Margarita; Mottamal, Madhusoodanan; Reddy, Kanamata; Kurinov, Igor; Carper, Andria; Langfald, Alyssa; Oi, Naomi; Kim, Myoung Ok; Zhu, Feng; Sosa, Carlos P.; Zhou, Keyuan; Bode, Ann M.; Dong, Zigang

    2012-06-27

    Ultraviolet (UV) irradiation is the leading factor in the development of skin cancer, prompting great interest in chemopreventive agents for this disease. In this study, we report the discovery of norathyriol, a plant-derived chemopreventive compound identified through an in silico virtual screening of the Chinese Medicine Library. Norathyriol is a metabolite of mangiferin found in mango, Hypericum elegans, and Tripterospermum lanceolatum and is known to have anticancer activity. Mechanistic investigations determined that norathyriol acted as an inhibitor of extracellular signal-regulated kinase (ERK)1/2 activity to attenuate UVB-induced phosphorylation in mitogen-activated protein kinases signaling cascades. We confirmed the direct and specific binding of norathyriol with ERK2 through a cocrystal structural analysis. The xanthone moiety in norathyriol acted as an adenine mimetic to anchor the compound by hydrogen bonds to the hinge region of the protein ATP-binding site on ERK2. Norathyriol inhibited in vitro cell growth in mouse skin epidermal JB6 P+ cells at the level of G{sub 2}-M phase arrest. In mouse skin tumorigenesis assays, norathyriol significantly suppressed solar UV-induced skin carcinogenesis. Further analysis indicated that norathyriol mediates its chemopreventive activity by inhibiting the ERK-dependent activity of transcriptional factors AP-1 and NF-{kappa}B during UV-induced skin carcinogenesis. Taken together, our results identify norathyriol as a safe new chemopreventive agent that is highly effective against development of UV-induced skin cancer.

  3. Norathyriol suppresses skin cancers induced by solar ultraviolet radiation by targeting ERK kinases.

    PubMed

    Li, Jixia; Malakhova, Margarita; Mottamal, Madhusoodanan; Reddy, Kanamata; Kurinov, Igor; Carper, Andria; Langfald, Alyssa; Oi, Naomi; Kim, Myoung Ok; Zhu, Feng; Sosa, Carlos P; Zhou, Keyuan; Bode, Ann M; Dong, Zigang

    2012-01-01

    Ultraviolet (UV) irradiation is the leading factor in the development of skin cancer, prompting great interest in chemopreventive agents for this disease. In this study, we report the discovery of norathyriol, a plant-derived chemopreventive compound identified through an in silico virtual screening of the Chinese Medicine Library. Norathyriol is a metabolite of mangiferin found in mango, Hypericum elegans, and Tripterospermum lanceolatum and is known to have anticancer activity. Mechanistic investigations determined that norathyriol acted as an inhibitor of extracellular signal-regulated kinase (ERK)1/2 activity to attenuate UVB-induced phosphorylation in mitogen-activated protein kinases signaling cascades. We confirmed the direct and specific binding of norathyriol with ERK2 through a cocrystal structural analysis. The xanthone moiety in norathyriol acted as an adenine mimetic to anchor the compound by hydrogen bonds to the hinge region of the protein ATP-binding site on ERK2. Norathyriol inhibited in vitro cell growth in mouse skin epidermal JB6 P+ cells at the level of G(2)-M phase arrest. In mouse skin tumorigenesis assays, norathyriol significantly suppressed solar UV-induced skin carcinogenesis. Further analysis indicated that norathyriol mediates its chemopreventive activity by inhibiting the ERK-dependent activity of transcriptional factors AP-1 and NF-κB during UV-induced skin carcinogenesis. Taken together, our results identify norathyriol as a safe new chemopreventive agent that is highly effective against development of UV-induced skin cancer. ©2011 AACR.

  4. Observation and analysis on skin cancer induced by UVB irradiation using optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Wang, Yunxia; Wu, Shulian; Li, Hui; Zheng, Xiaoxiao

    2014-09-01

    Basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) are the prevalent skin cancers, which have a quite high incidence in the white race. In recent years, however, their incidences have been increasing in the yellow race, resulting in a great threat to the public health. According to researches, chronics UVB irradiation (280nm~320nm) is the major culprit of skin cancer in humans. In our study, the model of UVB induced skin cancer was established firstly. Optical coherence tomography (OCT) combined with the histopathology was exploited to monitor the morphologic and histological changes of the process of UVB induced skin cancer. Meanwhile, this canceration process was systematically studied and analyzed from the perspective of tissue optics. The attenuation coefficient (μt) has a rising trend in the epidermis, but which shows a downward trend in the dermis. The results are conducive to understand the process of UVB-induced skin cancer and further be able to provide a reference for medical researchers.

  5. Heating of fetal bone by diagnostic ultrasound

    NASA Astrophysics Data System (ADS)

    Doody, Claire

    Most pregnant women in the Western world undergo an ultrasound examination and so it is important to ensure that exposure of the embryo or fetus does not produce unwanted effects. It is known that ultrasound can heat tissue, especially bone, and so this thesis explores the degree to which fetal bone might be heated during a pulsed Doppler examination. This is done both by carrying out measurements and by developing computer models. Thermal measurements on human fetal thoracic vertebrae of gestational age ranging from 14 to 39 weeks are reported. The bone samples were insonated in vitro with an ultrasound beam which had power and intensity values typical of those from a clinical scanner operating in pulsed Doppler mode. Temperature rises ranging from 0.6°C to 1.8°C were observed after five minutes, with approximately 75% of the temperature rise occurring in the first minute. Two approaches to computer modelling are described. These are the heated disc technique, which is commonly used to model the temperature rise generated by an ultrasound beam, and finite element modelling, a more general approach used to obtain solutions to differential equations. The degree to which our limited knowledge of the properties of fetal tissue affect our ability to make accurate predictions of in vivo heating is explored. It is shown that the present uncertainty in the value of the thermal conductivity and attenuation coefficient of fetal bone can lead to significant uncertainty in predictions of heating. The degree to which the simplifications inherent in the heated disc model affect the results will also be discussed. The results from the models are compared with the experimental measurements in order to estimate the attenuation coefficient of the bone.

  6. SEISMIC ATTENUATION FOR RESERVOIR CHARACTERIZATION

    SciTech Connect

    Joel Walls; M.T. Taner; Gary Mavko; Jack Dvorkin

    2002-07-01

    In fully-saturated rock and at ultrasonic frequencies, the microscopic squirt flow induced between the stiff and soft parts of the pore space by an elastic wave is responsible for velocity-frequency dispersion and attenuation. In the seismic frequency range, it is the macroscopic cross-flow between the stiffer and softer parts of the rock. We use the latter hypothesis to introduce simple approximate equations for velocity-frequency dispersion and attenuation in a fully water saturated reservoir. The equations are based on the assumption that in heterogeneous rock and at a very low frequency, the effective elastic modulus of the fully-saturated rock can be estimated by applying a fluid substitution procedure to the averaged (upscaled) dry frame whose effective porosity is the mean porosity and the effective elastic modulus is the Backus-average (geometric mean) of the individual dry-frame elastic moduli of parts of the rock. At a higher frequency, the effective elastic modulus of the saturated rock is the Backus-average of the individual fully-saturated-rock elastic moduli of parts of the rock. The difference between the effective elastic modulus calculated separately by these two methods determines the velocity-frequency dispersion. The corresponding attenuation is calculated from this dispersion by using (e.g.) the standard linear solid attenuation model.

  7. [Microdestruction of the bone].

    PubMed

    Iankovskiĭ, V É

    2014-01-01

    The objective of the present study was the detection of microcracks in the compact bone tissue surrounding the fracture and in deformed bone undergoing subcritical loading. The portions of deformed bone tissue and terminal fragments of broken bones were obtained in the form of blocks longitudinally sawcut from the regions of primary and secondary bone rupture. A total of 300 such blocks were available for the examination. All portions of the deformed bone tissue and terminal fragments of broken bones showed up microcracks commensurate with the bone structures. They were actually hardened traces of deformation that preceded the fracture and reflected the volume of the destroyed bone tissue; moreover, in certain cases they allowed to identify the kind of the object that exerted the external action (either a blow or slow bending).

  8. Bisphosphonates and bone quality

    PubMed Central

    Pazianas, Michael; van der Geest, Stefan; Miller, Paul

    2014-01-01

    Bisphosphonates (BPs) are bone-avid compounds used as first-line medications for the prevention and treatment of osteoporosis. They are also used in other skeletal pathologies such as Paget's and metastatic bone disease. They effectively reduce osteoclast viability and also activity in the resorptive phase of bone remodelling and help preserve bone micro-architecture, both major determinants of bone strength and ultimately of the susceptibility to fractures. The chemically distinctive structure of each BP used in the clinic determines their unique affinity, distribution/penetration throughout the bone and their individual effects on bone geometry, micro-architecture and composition or what we call ‘bone quality'. BPs have no clinically significant anabolic effects. This review will touch upon some of the components of bone quality that could be affected by the administration of BPs. PMID:24876930

  9. Regulation of Bone Metabolism

    PubMed Central

    Shahi, Maryam; Peymani, Amir; Sahmani, Mehdi

    2017-01-01

    Bone is formed through the processes of endochondral and intramembranous ossification. In endochondral ossification primary mesenchymal cells differentiate to chondrocytes and then are progressively substituted by bone, while in intramembranous ossification mesenchymal stem cells (MSCs) differentiate directly into osteoblasts to form bone. The steps of osteogenic proliferation, differentiation, and bone homeostasis are controlled by various markers and signaling pathways. Bone needs to be remodeled to maintain integrity with osteoblasts, which are bone-forming cells, and osteoclasts, which are bone-degrading cells.In this review we considered the major factors and signaling pathways in bone formation; these include fibroblast growth factors (FGFs), bone morphogenetic proteins (BMPs), wingless-type (Wnt) genes, runt-related transcription factor 2 (RUNX2) and osteoblast-specific transcription factor (osterix or OSX). PMID:28367467

  10. Factors stimulating bone formation.

    PubMed

    Lind, M; Bünger, C

    2001-10-01

    The aim of this review is to describe major approaches for stimulating bone healing and to review other factors affecting bone healing. Spinal bone fusion after surgery is a demanding process requiring optimal conditions for clinical success. Bone formation and healing can be enhanced through various methods. Experimental studies have revealed an array of stimulative measures. These include biochemical stimulation by use of hormones and growth factors, physical stimulation through mechanical and electromagnetic measures, and bone grafting by use of bone tissue or bone substitutes. Newer biological techniques such as stem cell transplantation and gene therapy can also be used to stimulate bone healing. Apart from bone transplantation, clinical experience with the many stimulation modalities is limited. Possible areas for clinical use of these novel methods are discussed.

  11. Regulation of Bone Metabolism.

    PubMed

    Shahi, Maryam; Peymani, Amir; Sahmani, Mehdi

    2017-04-01

    Bone is formed through the processes of endochondral and intramembranous ossification. In endochondral ossification primary mesenchymal cells differentiate to chondrocytes and then are progressively substituted by bone, while in intramembranous ossification mesenchymal stem cells (MSCs) differentiate directly into osteoblasts to form bone. The steps of osteogenic proliferation, differentiation, and bone homeostasis are controlled by various markers and signaling pathways. Bone needs to be remodeled to maintain integrity with osteoblasts, which are bone-forming cells, and osteoclasts, which are bone-degrading cells.In this review we considered the major factors and signaling pathways in bone formation; these include fibroblast growth factors (FGFs), bone morphogenetic proteins (BMPs), wingless-type (Wnt) genes, runt-related transcription factor 2 (RUNX2) and osteoblast-specific transcription factor (osterix or OSX).

  12. Nonlinear attenuation and dispersion in human calcaneus in vitro: statistical validation and relationships to microarchitecture.

    PubMed

    Wear, Keith A

    2015-03-01

    Through-transmission measurements were performed on 30 human calcaneus samples in vitro. Nonlinear attenuation and dispersion measurements were investigated by estimating 95% confidence intervals of coefficients of polynomial expansions of log magnitude and phase of transmission coefficients. Bone mineral density (BMD) was measured with dual x-ray absorptiometry. Microarchitecture was measured with microcomputed tomography. Statistically significant nonlinear attenuation and nonzero dispersion were confirmed for a clinical bandwidth of 300-750 kHz in 40%-43% of bone samples. The mean linear coefficient for attenuation was 10.3 dB/cm MHz [95% confidence interval (CI): 9.0-11.6 dB/cm MHz]. The mean quadratic coefficient for attenuation was 1.6 dB/cm MHz(2) (95% CI: 0.4-2.8 dB/cm MHz(2)). Nonlinear attenuation provided little information regarding BMD or microarchitecture. The quadratic coefficient for phase (which is related to dispersion) showed moderate correlations with BMD (r = -0.65; 95% CI: -0.82 to -0.36), bone surface-to-volume ratio (r = 0.47; 95% CI: 0.12-0.72) and trabecular thickness (r = -0.40; 95% CI: -0.67 to -0.03). Dispersion was proportional to bone volume fraction raised to an exponent of 2.1 ± 0.2, which is similar to the value for parallel nylon-wire phantoms (2.4 ± 0.2) and supports a multiple-scattering model for dispersion.

  13. Feasibility of bone assessment by using the nonlinear parameter in trabecular bone

    NASA Astrophysics Data System (ADS)

    Lee, Kang Il

    2013-04-01

    The purpose of the present study is to investigate the feasibility of assessing bone status and osteoporosis by using the nonlinear parameter B/A in bovine trabecular bone in vitro. The B/A values measured in 18 bovine femoral trabecular bone samples by using a finite-amplitude through-transmission method ranged from 63.3 to 122.6. The apparent bone density was highly correlated with the B/A and with the existing quantitative ultrasound parameters of the speed of sound (SOS) and the normalized broadband ultrasound attenuation (nBUA), with Pearson's correlation coefficients of r = 0.83 to 0.96. The best univariate predictor of the apparent bone density was the B/A, with an adjusted squared correlation coefficient of r 2 = 0.91. These results suggest that the B/A, in addition to the SOS and the nBUA, may have potential as an index for the assessment of bone status and osteoporosis.

  14. Bone-immune cell crosstalk: bone diseases.

    PubMed

    Mori, Giorgio; D'Amelio, Patrizia; Faccio, Roberta; Brunetti, Giacomina

    2015-01-01

    Bone diseases are associated with great morbidity; thus, the understanding of the mechanisms leading to their development represents a great challenge to improve bone health. Recent reports suggest that a large number of molecules produced by immune cells affect bone cell activity. However, the mechanisms are incompletely understood. This review aims to shed new lights into the mechanisms of bone diseases involving immune cells. In particular, we focused our attention on the major pathogenic mechanism underlying periodontal disease, psoriatic arthritis, postmenopausal osteoporosis, glucocorticoid-induced osteoporosis, metastatic solid tumors, and multiple myeloma.

  15. Stormwater Attenuation by Green Roofs

    NASA Astrophysics Data System (ADS)

    Sims, A.; O'Carroll, D. M.; Robinson, C. E.; Smart, C. C.

    2014-12-01

    Innovative municipal stormwater management technologies are urgently required in urban centers. Inadequate stormwater management can lead to excessive flooding, channel erosion, decreased stream baseflows, and degraded water quality. A major source of urban stormwater is unused roof space. Green roofs can be used as a stormwater management tool to reduce roof generated stormwater and generally improve the quality of runoff. With recent legislation in some North American cities, including Toronto, requiring the installation of green roofs on large buildings, research on the effectiveness of green roofs for stormwater management is important. This study aims to assess the hydrologic response of an extensive sedum green roof in London, Ontario, with emphasis on the response to large precipitation events that stress municipal stormwater infrastructure. A green roof rapidly reaches field capacity during large storm events and can show significantly different behavior before and after field capacity. At field capacity a green roof has no capillary storage left for retention of stormwater, but may still be an effective tool to attenuate peak runoff rates by transport through the green roof substrate. The attenuation of green roofs after field capacity is linked to gravity storage, where gravity storage is the water that is temporarily stored and can drain freely over time after field capacity has been established. Stormwater attenuation of a modular experimental green roof is determined from water balance calculations at 1-minute intervals. Data is used to evaluate green roof attenuation and the impact of field capacity on peak flow rates and gravity storage. In addition, a numerical model is used to simulate event based stormwater attenuation. This model is based off of the Richards equation and supporting theory of multiphase flow through porous media.

  16. RB1 deficiency in triple-negative breast cancer induces mitochondrial protein translation

    PubMed Central

    Jones, Robert A.; Robinson, Tyler J.; Liu, Jeff C.; Shrestha, Mariusz; Voisin, Veronique; Ju, YoungJun; Chung, Philip E.D.; Pellecchia, Giovanna; Fell, Victoria L.; Bae, SooIn; Muthuswamy, Lakshmi; Egan, Sean E.; Jiang, Zhe; Leone, Gustavo; Bader, Gary D.; Schimmer, Aaron

    2016-01-01

    Triple-negative breast cancer (TNBC) includes basal-like and claudin-low subtypes for which no specific treatment is currently available. Although the retinoblastoma tumor-suppressor gene (RB1) is frequently lost together with TP53 in TNBC, it is not directly targetable. There is thus great interest in identifying vulnerabilities downstream of RB1 that can be therapeutically exploited. Here, we determined that combined inactivation of murine Rb and p53 in diverse mammary epithelial cells induced claudin-low–like TNBC with Met, Birc2/3-Mmp13-Yap1, and Pvt1-Myc amplifications. Gene set enrichment analysis revealed that Rb/p53-deficient tumors showed elevated expression of the mitochondrial protein translation (MPT) gene pathway relative to tumors harboring p53 deletion alone. Accordingly, bioinformatic, functional, and biochemical analyses showed that RB1-E2F complexes bind to MPT gene promoters to regulate transcription and control MPT. Additionally, a screen of US Food and Drug Administration–approved (FDA-approved) drugs identified the MPT antagonist tigecycline (TIG) as a potent inhibitor of Rb/p53-deficient tumor cell proliferation. TIG preferentially suppressed RB1-deficient TNBC cell proliferation, targeted both the bulk and cancer stem cell fraction, and strongly attenuated xenograft growth. It also cooperated with sulfasalazine, an FDA-approved inhibitor of cystine xCT antiporter, in culture and xenograft assays. Our results suggest that RB1 deficiency promotes cancer cell proliferation in part by enhancing mitochondrial function and identify TIG as a clinically approved drug for RB1-deficient TNBC. PMID:27571409

  17. Cancer-induced anorexia in tumor-bearing mice is dependent on cyclooxygenase-1.

    PubMed

    Ruud, Johan; Nilsson, Anna; Engström Ruud, Linda; Wang, Wenhua; Nilsberth, Camilla; Iresjö, Britt-Marie; Lundholm, Kent; Engblom, David; Blomqvist, Anders

    2013-03-01

    It is well-established that prostaglandins (PGs) affect tumorigenesis, and evidence indicates that PGs also are important for the reduced food intake and body weight loss, the anorexia-cachexia syndrome, in malignant cancer. However, the identity of the PGs and the PG producing cyclooxygenase (COX) species responsible for cancer anorexia-cachexia is unknown. Here, we addressed this issue by transplanting mice with a tumor that elicits anorexia. Meal pattern analysis revealed that the anorexia in the tumor-bearing mice was due to decreased meal frequency. Treatment with a non-selective COX inhibitor attenuated the anorexia, and also tumor growth. When given at manifest anorexia, non-selective COX-inhibitors restored appetite and prevented body weight loss without affecting tumor size. Despite COX-2 induction in the cerebral blood vessels of tumor-bearing mice, a selective COX-2 inhibitor had no effect on the anorexia, whereas selective COX-1 inhibition delayed its onset. Tumor growth was associated with robust increase of PGE(2) levels in plasma - a response blocked both by non-selective COX-inhibition and by selective COX-1 inhibition, but not by COX-2 inhibition. However, there was no increase in PGE(2)-levels in the cerebrospinal fluid. Neutralization of plasma PGE(2) with specific antibodies did not ameliorate the anorexia, and genetic deletion of microsomal PGE synthase-1 (mPGES-1) affected neither anorexia nor tumor growth. Furthermore, tumor-bearing mice lacking EP(4) receptors selectively in the nervous system developed anorexia. These observations suggest that COX-enzymes, most likely COX-1, are involved in cancer-elicited anorexia and weight loss, but that these phenomena occur independently of host mPGES-1, PGE(2) and neuronal EP(4) signaling. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Determining Source Attenuation History to Support Closure by Natural Attenuation

    DTIC Science & Technology

    2013-11-01

    Low k zone (clay) k interface High k zone (sand) Interval w/ highest contaminant levels ( approximate ) MIP (continuous data) Geoprobe HPT (continuous...reflective of long - term trends. Furthermore, regulators frequently adhere to a conceptual model of an unchanging, non- attenuating source zone, and...especially as subsurface releases age over time. To aid in the selection of MNA as a long - term remedy, we propose a new approach that allows for

  19. Depression induces bone loss through stimulation of the sympathetic nervous system

    PubMed Central

    Yirmiya, Raz; Goshen, Inbal; Bajayo, Alon; Kreisel, Tirzah; Feldman, Sharon; Tam, Joseph; Trembovler, Victoria; Csernus, Valér; Shohami, Esther; Bab, Itai

    2006-01-01

    Major depression is associated with low bone mass and increased incidence of osteoporotic fractures. However, causality between depression and bone loss has not been established. Here, we show that mice subjected to chronic mild stress (CMS), an established model of depression in rodents, display behavioral depression accompanied by impaired bone mass and structure, as portrayed by decreases in trabecular bone volume density, trabecular number, and trabecular connectivity density assessed in the distal femoral metaphysis and L3 vertebral body. Bone remodeling analysis revealed that the CMS-induced skeletal deficiency is accompanied by restrained bone formation resulting from reduced osteoblast number. Antidepressant therapy, which prevents the behavioral responses to CMS, completely inhibits the decrease in bone formation and markedly attenuates the CMS-induced bone loss. The depression-triggered bone loss is associated with a substantial increase in bone norepinephrine levels and can be blocked by the β-adrenergic antagonist propranolol, suggesting that the sympathetic nervous system mediates the skeletal effects of stress-induced depression. These results define a linkage among depression, excessive adrenergic activity, and reduced bone formation, thus demonstrating an interaction among behavioral responses, the brain, and the skeleton, which leads to impaired bone structure. Together with the common occurrence of depression and bone loss in the aging population, the present data implicate depression as a potential major risk factor for osteoporosis and the associated increase in fracture incidence. PMID:17075068

  20. Ferrite attenuator modulation improves antenna performance

    NASA Technical Reports Server (NTRS)

    Hooks, J. C.; Larson, S. G.; Shorkley, F. H.; Williams, B. T.

    1970-01-01

    Ferrite attenuator inserted into appropriate waveguide reduces the gain of the antenna element which is causing interference. Modulating the ferrite attenuator to change the antenna gain at the receive frequency permits ground tracking until the antenna is no longer needed.

  1. Bone lymphoma with multiple negative bone biopsies.

    PubMed

    Riaz, Irbaz Bin; Khan, Muhammad Shahzeb; Mazursky, Konstantin; Husnain, Muhammad; Anwer, Faiz

    2017-09-01

    This article describes a 71-year-old man with right knee pain, prerenal azotemia, hypercalcemia, and a mass in the distal femur. Although testing, including bone marrow biopsy, initially ruled out myeloma, an open surgical biopsy eventually confirmed the diagnosis as lymphoma involving the bone with classic histologic findings of mature B-cell neoplasm of germinal cell origin.

  2. Factors that characterize bone health with aging in healthy postmenopausal women.

    PubMed

    Ikegami, Shota; Uchiyama, Shigeharu; Nakamura, Yukio; Mukaiyama, Keijiro; Hirabayashi, Hiroki; Kamimura, Mikio; Nonaka, Kiichi; Kato, Hiroyuki

    2015-07-01

    The exponential increase in the incidence of fragility fractures in older people is attributed to attenuation of both bone strength and neuromuscular function. Decrease in bone mineral density (BMD) does not entirely explain this increase. The objective of this study is to investigate the effect of age on various parameters related to bone health with aging, and to identify combinations of factors that collectively express the bone metabolic state in healthy postmenopausal women. Height, weight, and grip strength were measured in 135 healthy postmenopausal volunteer women. Hip BMD, biomechanical indices derived from quantitative computed tomography (QCT), cross-sectional areas of muscle and fat of the proximal thigh, and various biochemical markers of bone metabolism were measured. A smaller group of factors explanatory for bone health was identified using factor analysis and each was newly named. As a result, the factors bone mass, bone turnover, bone structure, and muscle strength had the greatest explanatory power for assessing the bone health of healthy postmenopausal women. Whereas dual X-ray absorptiometry parameters only loaded on the factor bone mass, QCT parameters loaded on both the factors bone mass and bone structure. Most bone turnover markers loaded on the factor bone turnover, but deoxypyridinoline loaded on both bone turnover and muscle strength. Age was negatively correlated with bone mass (r = -0.49, p < 0.001) and muscle strength (r = -0.67, p < 0.001). We conclude that aging is associated as much with muscle weakening as with low BMD. More attention should be paid to the effects of muscle weakening during aging in assessments of bone health.

  3. Bone Marrow Diseases

    MedlinePlus

    ... that help with blood clotting. With bone marrow disease, there are problems with the stem cells or ... marrow makes too many white blood cells Other diseases, such as lymphoma, can spread into the bone ...

  4. Bone fracture repair - slideshow

    MedlinePlus

    ... page: //medlineplus.gov/ency/presentations/100077.htm Bone fracture repair - series—Indications To use the sharing features ... Go to slide 4 out of 4 Overview Fractures of the bones are classified in a number ...

  5. Food and Your Bones

    MedlinePlus

    ... your bones. Learning about the foods that are rich in calcium, vitamin D and other nutrients that ... Calcium, Vitamin D Leafy greens and other nutrient-rich foods are good for your bones. More Examples ...

  6. Bone Graft Alternatives

    MedlinePlus

    ... disease transmission and a lessened effectiveness since the bone growth cells and proteins are removed during the cleansing ... mesh. Although ceramics may provide a framework for bone growth, they contain none of the natural proteins that ...

  7. Ultrasonic bone densitometer

    NASA Technical Reports Server (NTRS)

    Hoop, J. M.

    1972-01-01

    Human bone density changes can be determined by a device originally developed for in-flight testing of astronauts' bones during extended space missions. Device is comparable in size, weight and power consumption to portable television set.

  8. [Development of a Novel Body Phantom with Bone Equivalent Density for Evaluation of Bone SPECT].

    PubMed

    Ichikawa, Hajime; Miwa, Kenta; Matsutomo, Norikazu; Watanabe, Yoichi; Kato, Toyohiro; Shimada, Hideki

    2015-12-01

    We developed a custom-designed phantom for bone single photon emission computed tomography (SPECT)-specific radioactivity distribution and linear attenuation coefficient. The aim of this study was to evaluate the accuracy of the phantom. The lumbar phantom consisted of the trunk of a body phantom (background) containing a cylinder (vertebral body), a sphere (tumor), and a T-shaped container (processus). The vertebral body, tumor, and processus phantoms contained a K(2)HPO(4) solution of bone equivalent density and 50, 300 and 50 kBq/mL of (99m)Tc, respectively. The body phantom contained 8 kBq/mL of (99m)Tc solution. SPECT images were acquired using low-energy high-resolution collimation, a 128 × 128 matrix and 120 projections over 360° with a dwell time of 15 sec/view × 4 times. Thereafter, CT images were acquired at 130 kV and 70 ref mAs using adaptive dose modulation. The SPECT data were reconstructed with ordered subset expectation maximization with three-dimensional, scatter, and CT-based attenuation correction. Count ratio, linear attenuation coefficient (LAC), and full-width at half-maximum (FWHM) were measured. Count ratios between the background, the vertebral body, and the tumor in SPECT images were 463.8: 2888.0: 15150.3 (1: 6.23: 32.7). The LAC of the background and vertebral body in the CT-derived attenuation map were 0.155 cm⁻¹ and 0.284 cm⁻¹, respectively, and the FWHM measured from the processus was 15.27 mm. The precise counts and LAC indicated that the phantom was accurate and could serve as a tool for evaluating acquisition, reconstruction parameters, and quantitation in bone SPECT images.

  9. Denosumab, a RANK ligand inhibitor, for the management of bone loss in cancer patients.

    PubMed

    Yee, Andrew J; Raje, Noopur S

    2012-01-01

    Bone loss is a common side effect of cancer treatments, especially antihormonal treatments used in the treatment of breast and prostate cancer. Denosumab is a monoclonal antibody given subcutaneously that inhibits osteoclast activity by targeting the RANK ligand. It is effective in settings ranging from preventing skeletal-related complications in cancer patients with metastatic disease to increasing bone mineral density in patients with osteoporosis. In cancer patients with early stage disease, denosumab can attenuate bone loss from antihormonal treatments, and in prostate cancer, may reduce disease progression. Here, we will discuss the important role denosumab may play in the management of bone loss in patients with cancer.

  10. Dynamic skeletal muscle stimulation and its potential in bone adaptation

    PubMed Central

    Qin, Y-X.; Lam, H.; Ferreri, S.; Rubin, C.

    2016-01-01

    To identify mechanotransductive signals for combating musculoskeletal deterioration, it is essential to determine the components and mechanisms critical to the anabolic processes of musculoskeletal tissues. It is hypothesized that the interaction between bone and muscle may depend on fluid exchange in these tissues by mechanical loading. It has been shown that intramedullary pressure (ImP) and low-level bone strain induced by muscle stimulation (MS) has the potential to mitigate bone loss induced by disuse osteopenia. Optimized MS signals, i.e., low-intensity and high frequency, may be critical in maintaining bone mass and mitigating muscle atrophy. The objectives for this review are to discuss the potential for MS to induce ImP and strains on bone, to regulate bone adaptation, and to identify optimized stimulation frequency in the loading regimen. The potential for MS to regulate blood and fluid flow will also be discussed. The results suggest that oscillatory MS regulates fluid dynamics with minimal mechanical strain in bone. The response was shown to be dependent on loading frequency, serving as a critical mediator in mitigating bone loss. A specific regimen of dynamic MS may be optimized in vivo to attenuate disuse osteopenia and serve as a biomechanical intervention in the clinical setting. PMID:20190376

  11. Phytoestrogens and bone health at different reproductive stages.

    PubMed

    Castelo-Branco, Camil; Soveral, Iris

    2013-08-01

    Isoflavones are an alternative to hormonal therapy for the relief of menopausal symptoms. Since isoflavones interact with estrogen receptors it has been hypothesized that such substances may have an effect on bone health. To clarify the effect of isoflavones on bone at experimental and clinical level, and to identify areas that require further clarification and research. A systematic review of studies involving isoflavones and bone health was performed, and a specific search on isoflavone's mechanism of action and the importance of equol production was made based on Internet search engines, MEDLINE (1966-October 2012) and the Cochrane Controlled Clinical Trials Register. This search was supplemented by a handsearch of reference lists of selected papers. In vitro and animal studies show a positive effect of isoflavones on bone which has not been clearly confirmed by long-term human trials. Equol producers seem to present a more positive response to isoflavone intervention. Isoflavone rich diets could help maintain peak bone mass in premenopausal women. The effect of isoflavones in perimenopausal women is insufficiently studied but it seems to attenuate bone loss in the menopausal transition. In postmenopause, isoflavones may present a modest benefit but its clinical relevance in preventing osteoporotic fractures remains to be determined. The present review suggests that isoflavone increase bone mineral density and decrease the bone turnover resorption markers. The effect of soy isoflavones on BMD is mediated by equol production, reproductive status, supplement type, isoflavone dose and intervention duration.

  12. ENHANCEMENTS TO NATURAL ATTENUATION: SELECTED CASE STUDIES

    SciTech Connect

    Vangelas, K; W. H. Albright, W; E. S. Becvar, E; C. H. Benson, C; T. O. Early, T; E. Hood, E; P. M. Jardine, P; M. Lorah, M; E. Majche, E; D. Major, D; W. J. Waugh, W; G. Wein, G; O. R. West, O

    2007-05-15

    In 2003 the US Department of Energy (DOE) embarked on a project to explore an innovative approach to remediation of subsurface contaminant plumes that focused on introducing mechanisms for augmenting natural attenuation to achieve site closure. Termed enhanced attenuation (EA), this approach has drawn its inspiration from the concept of monitored natural attenuation (MNA).

  13. Chlorine signal attenuation in concrete.

    PubMed

    Naqvi, A A; Maslehuddin, M; ur-Rehman, Khateeb; Al-Amoudi, O S B

    2015-11-01

    The intensity of prompt gamma-ray was measured at various depths from chlorine-contaminated silica fume (SF) concrete slab concrete specimens using portable neutron generator-based prompt gamma-ray setup. The intensity of 6.11MeV chloride gamma-rays was measured from the chloride contaminated slab at distance of 15.25, 20.25, 25.25, 30.25 and 35.25cm from neutron target in a SF cement concrete slab specimens. Due to attenuation of thermal neutron flux and emitted gamma-ray intensity in SF cement concrete at various depths, the measured intensity of chlorine gamma-rays decreases non-linearly with increasing depth in concrete. A good agreement was noted between the experimental results and the results of Monte Carlo simulation. This study has provided useful experimental data for evaluating the chloride contamination in the SF concrete utilizing gamma-ray attenuation method.

  14. Ultrasound fields in attenuating media.

    PubMed

    Lerch, R; Friedrich, W

    1986-10-01

    For medical ultrasonic imaging and for nondestructive testing, the attenuation of pressure waves and the resulting shift in wave velocity are important features in commonly used transmission media such as biological tissue. An algorithm for the numerical evaluation of pressure field distributions generated by ultrasonic transducers is presented. The attenuation and dispersion of the sound transmission medium are taken into consideration. The sound fields are computed numerically for continuous wave as well as pulse excitation. The transducer has plane or gently curved geometry and is embedded in a plane rigid baffle. The numerically determined pressure fields are presented as 3D plots, as gray-scale images for a fixed time stamp (like a snapshot), or as isobars regarding the maximum values over time for each local point in the area under investigation. The algorithm described here can be utilized as a tool for design of ultrasound transducers, especially array antennas.

  15. Direct Reconstruction of CT-based Attenuation Correction Images for PET with Cluster-Based Penalties

    PubMed Central

    Kim, Soo Mee; Alessio, Adam M.; De Man, Bruno; Asma, Evren; Kinahan, Paul E.

    2015-01-01

    Extremely low-dose CT acquisitions for the purpose of PET attenuation correction will have a high level of noise and biasing artifacts due to factors such as photon starvation. This work explores a priori knowledge appropriate for CT iterative image reconstruction for PET attenuation correction. We investigate the maximum a posteriori (MAP) framework with cluster-based, multinomial priors for the direct reconstruction of the PET attenuation map. The objective function for direct iterative attenuation map reconstruction was modeled as a Poisson log-likelihood with prior terms consisting of quadratic (Q) and mixture (M) distributions. The attenuation map is assumed to have values in 4 clusters: air+background, lung, soft tissue, and bone. Under this assumption, the MP was a mixture probability density function consisting of one exponential and three Gaussian distributions. The relative proportion of each cluster was jointly estimated during each voxel update of direct iterative coordinate decent (dICD) method. Noise-free data were generated from NCAT phantom and Poisson noise was added. Reconstruction with FBP (ramp filter) was performed on the noise-free (ground truth) and noisy data. For the noisy data, dICD reconstruction was performed with the combination of different prior strength parameters (β and γ) of Q- and M-penalties. The combined quadratic and mixture penalties reduces the RMSE by 18.7% compared to post-smoothed iterative reconstruction and only 0.7% compared to quadratic alone. For direct PET attenuation map reconstruction from ultra-low dose CT acquisitions, the combination of quadratic and mixture priors offers regularization of both variance and bias and is a potential method to derive attenuation maps with negligible patient dose. However, the small improvement in quantitative accuracy relative to the substantial increase in algorithm complexity does not currently justify the use of mixture-based PET attenuation priors for reconstruction of CT

  16. A bone composition model for Monte Carlo x-ray transport simulations

    SciTech Connect

    Zhou Hu; Keall, Paul J.; Graves, Edward E.

    2009-03-15

    In the megavoltage energy range although the mass attenuation coefficients of different bones do not vary by more than 10%, it has been estimated that a simple tissue model containing a single-bone composition could cause errors of up to 10% in the calculated dose distribution. In the kilovoltage energy range, the variation in mass attenuation coefficients of the bones is several times greater, and the expected error from applying this type of model could be as high as several hundred percent. Based on the observation that the calcium and phosphorus compositions of bones are strongly correlated with the bone density, the authors propose an analytical formulation of bone composition for Monte Carlo computations. Elemental compositions and densities of homogeneous adult human bones from the literature were used as references, from which the calcium and phosphorus compositions were fitted as polynomial functions of bone density and assigned to model bones together with the averaged compositions of other elements. To test this model using the Monte Carlo package DOSXYZnrc, a series of discrete model bones was generated from this formula and the radiation-tissue interaction cross-section data were calculated. The total energy released per unit mass of primary photons (terma) and Monte Carlo calculations performed using this model and the single-bone model were compared, which demonstrated that at kilovoltage energies the discrepancy could be more than 100% in bony dose and 30% in soft tissue dose. Percentage terma computed with the model agrees with that calculated on the published compositions to within 2.2% for kV spectra and 1.5% for MV spectra studied. This new bone model for Monte Carlo dose calculation may be of particular importance for dosimetry of kilovoltage radiation beams as well as for dosimetry of pediatric or animal subjects whose bone composition may differ substantially from that of adult human bones.

  17. Medicines and Bone Loss

    MedlinePlus

    ... studies also show that drinking a lot of alcohol might weaken bones. Questions to ask your doctor • Do any of my medicines cause bone loss? • Are there different medicines I can take? • Do I need a bone density test? • What should I do to protect my ...

  18. What's a Funny Bone?

    MedlinePlus

    ... Lifesaver Kids Talk About: Coaches What's a Funny Bone? KidsHealth > For Kids > What's a Funny Bone? Print A A A Have you ever hit ... prickly kind of dull pain? That's your funny bone! It doesn't really hurt as much as ...

  19. What causes bone loss?

    MedlinePlus

    ... more calcium than normal in the urine Certain habits can affect your bones. Drinking alcohol. Too much alcohol can damage your bones. It can also put you at risk of falling and breaking a bone. Smoking. Men and women who smoke ...

  20. Temporal bone meningiomas.

    PubMed

    Hooper, R; Siu, K; Cousins, V

    1990-10-01

    Meningiomas should be considered in the differential diagnosis of space-occupying lesions of the temporal bone. Five cases of meningiomas of the temporal bone are described and the literature reviewed. These tumours may stimulate Schwannomas and glomus tumours in their presentation and radiological findings. The tumours were managed by combining standard neurosurgical approaches with temporal bone and skull base techniques.

  1. Lg wave attenuation in Britain

    NASA Astrophysics Data System (ADS)

    Sargeant, Susanne; Ottemöller, Lars

    2009-12-01

    The Lg wave quality factor (QLg) in Britain has been modelled using data from the UK Seismic Network, operated by the British Geological Survey. The data set consists of 631 vertical, mostly short-period recordings of Lg waves from 64 earthquakes (2.7-4.7 ML) and 93 stations. We have inverted for both regional average QLg and tomographic images of QLg, and simultaneously a source term for each event and a site term for each station for 22 frequencies in the band 0.9-10.0 Hz. The regional average model is 266f0.53 between 1.0 and 10.0 Hz and indicates that attenuation in Britain is slightly higher than in France, and significantly higher than in eastern North America and Scandinavia. Tomographic inversions at each frequency indicate that QLg varies spatially. Broadly speaking, southeastern England, the Lake District and parts of the East Irish Sea Basin, and a small region between the Highland Boundary Fault and the Southern Uplands Fault are characterized by higher than average attenuation. Southwestern England, eastern central England and northwestern Scotland are regions of relatively low attenuation. To some extent, these regions correlate with what is known about the tectonics and structure of the crust in the UK.

  2. Wave dispersion and attenuation on human femur tissue.

    PubMed

    Strantza, Maria; Louis, Olivia; Polyzos, Demosthenes; Boulpaep, Frans; van Hemelrijck, Danny; Aggelis, Dimitrios G

    2014-08-15

    Cortical bone is a highly heterogeneous material at the microscale and has one of the most complex structures among materials. Application of elastic wave techniques to this material is thus very challenging. In such media the initial excitation energy goes into the formation of elastic waves of different modes. Due to "dispersion", these modes tend to separate according to the velocities of the frequency components. This work demonstrates elastic wave measurements on human femur specimens. The aim of the study is to measure parameters like wave velocity, dispersion and attenuation by using broadband acoustic emission sensors. First, four sensors were placed at small intervals on the surface of the bone to record the response after pencil lead break excitations. Next, the results were compared to measurements on a bulk steel block which does not exhibit heterogeneity at the same wave lengths. It can be concluded that the microstructure of the tissue imposes a dispersive behavior for frequencies below 1 MHz and care should be taken for interpretation of the signals. Of particular interest are waveform parameters like the duration, rise time and average frequency, since in the next stage of research the bone specimens will be fractured with concurrent monitoring of acoustic emission.

  3. Mapping Lateral Pn Attenuation Variation in Asia

    NASA Astrophysics Data System (ADS)

    Yang, X.; Phillips, W. S.; Randall, G. E.

    2009-12-01

    Pn travels most of its path in the uppermost mantle. Mapping of the lateral variation of Pn amplitude attenuation may shed light on the physical and chemical state, and dynamics of the upper mantle. In addition to material attenuation, Pn amplitudes are affected by other factors including the spherical shape of the Earth and Moho topography. In order to derive reliable Pn attenuation, we adopt a frequency-dependent Pn geometric-spreading model, which was designed to account for the effect of the Earth’s sphericity, to correct Pn amplitudes in preparation for attenuation estimation. We obtain physically reasonable attenuation estimates from Pn amplitudes corrected using the new spreading model. Pn amplitudes corrected using the traditional frequency-independent power-law spreading model, on the other hand, yield attenuation estimates that are either too large or negative. Using properly geometric-spreading corrected Pn amplitudes, we conducted attenuation tomography and developed 2D Pn attenuation models at multiple frequencies from 0.5 Hz to 8 Hz for Asia. Overall Pn attenuation patterns correlate, to some degree, with our current knowledge of the state of the upper mantle of the region. We see consistent low attenuation in cratonic regions and high attenuation along the western Pacific Ocean. The attenuation pattern in the Tibetan Plateau region seems to be frequency dependent with high attenuation around 1 Hz and low attenuation at 8 Hz. Application of the attenuation model to the nuclear-explosion discrimination problem leads to appreciable improvements of the discriminant compared with currently adopted method.

  4. Dual energy CT for attenuation correction with PET/CT

    SciTech Connect

    Xia, Ting; Alessio, Adam M.; Kinahan, Paul E.

    2014-01-15

    Purpose: The authors evaluate the energy dependent noise and bias properties of monoenergetic images synthesized from dual-energy CT (DECT) acquisitions. These monoenergetic images can be used to estimate attenuation coefficients at energies suitable for positron emission tomography (PET) and single-photon emission computed tomography (SPECT) imaging. This is becoming more relevant with the increased use of quantitative imaging by PET/CT and SPECT/CT scanners. There are, however, potential variations in the noise and bias of synthesized monoenergetic images as a function of energy. Methods: The authors used analytic approximations and simulations to estimate the noise and bias of synthesized monoenergetic images of water-filled cylinders with different shapes and the NURBS-based cardiac-torso (NCAT) phantom from 40 to 520 keV, the range of SPECT and PET energies. The dual-kVp spectra were based on the GE Lightspeed VCT scanner at 80 and 140 kVp with added filtration of 0.5 mm Cu. The authors evaluated strategies of noise suppression with sinogram smoothing and dose minimization with reduction of tube currents at the two kVp settings. The authors compared the impact of DECT-based attenuation correction with single-kVp CT-based attenuation correction on PET quantitation for the NCAT phantom for soft tissue and high-Z materials of bone and iodine contrast enhancement. Results: Both analytic calculations and simulations displayed the expected minimum noise value for a synthesized monoenergetic image at an energy between the mean energies of the two spectra. In addition the authors found that the normalized coefficient of variation in the synthesized attenuation map increased with energy but reached a plateau near 160 keV, and then remained constant with increasing energy up to 511 keV and beyond. The bias was minimal, as the linear attenuation coefficients of the synthesized monoenergetic images were within 2.4% of the known true values across the entire energy range

  5. Dual energy CT for attenuation correction with PET/CT

    SciTech Connect

    Xia, Ting; Alessio, Adam M.; Kinahan, Paul E.

    2014-01-15

    Purpose: The authors evaluate the energy dependent noise and bias properties of monoenergetic images synthesized from dual-energy CT (DECT) acquisitions. These monoenergetic images can be used to estimate attenuation coefficients at energies suitable for positron emission tomography (PET) and single-photon emission computed tomography (SPECT) imaging. This is becoming more relevant with the increased use of quantitative imaging by PET/CT and SPECT/CT scanners. There are, however, potential variations in the noise and bias of synthesized monoenergetic images as a function of energy. Methods: The authors used analytic approximations and simulations to estimate the noise and bias of synthesized monoenergetic images of water-filled cylinders with different shapes and the NURBS-based cardiac-torso (NCAT) phantom from 40 to 520 keV, the range of SPECT and PET energies. The dual-kVp spectra were based on the GE Lightspeed VCT scanner at 80 and 140 kVp with added filtration of 0.5 mm Cu. The authors evaluated strategies of noise suppression with sinogram smoothing and dose minimization with reduction of tube currents at the two kVp settings. The authors compared the impact of DECT-based attenuation correction with single-kVp CT-based attenuation correction on PET quantitation for the NCAT phantom for soft tissue and high-Z materials of bone and iodine contrast enhancement. Results: Both analytic calculations and simulations displayed the expected minimum noise value for a synthesized monoenergetic image at an energy between the mean energies of the two spectra. In addition the authors found that the normalized coefficient of variation in the synthesized attenuation map increased with energy but reached a plateau near 160 keV, and then remained constant with increasing energy up to 511 keV and beyond. The bias was minimal, as the linear attenuation coefficients of the synthesized monoenergetic images were within 2.4% of the known true values across the entire energy range

  6. Oxytocin and bone

    PubMed Central

    Sun, Li; Zaidi, Mone; Zallone, Alberta

    2014-01-01

    One of the most meaningful results recently achieved in bone research has been to reveal that the pituitary hormones have profound effect on bone, so that the pituitary-bone axis has become one of the major topics in skeletal physiology. Here, we discuss the relevant evidence about the posterior pituitary hormone oxytocin (OT), previously thought to exclusively regulate parturition and breastfeeding, which has recently been established to directly regulate bone mass. Both osteoblasts and osteoclasts express OT receptors (OTR), whose stimulation enhances bone mass. Consistent with this, mice deficient in OT or OTR display profoundly impaired bone formation. In contrast, bone resorption remains unaffected in OT deficiency because, even while OT stimulates the genesis of osteoclasts, it inhibits their resorptive function. Furthermore, in addition to its origin from the pituitary, OT is also produced by bone marrow osteoblasts acting as paracrine-autocrine regulator of bone formation modulated by estrogens. In turn, the power of estrogen to increase bone mass is OTR-dependent. Therefore, OTR−/− mice injected with 17β-estradiol do not show any effects on bone formation parameters, while the same treatment increases bone mass in wild-type mice. These findings together provide evidence for an anabolic action of OT in regulating bone mass and suggest that bone marrow OT may enhance the bone-forming action of estrogen through an autocrine circuit. This established new physiological role for OT in the maintenance of skeletal integrity further suggests the potential use of this hormone for the treatment of osteoporosis. PMID:25209411

  7. High bone density and bone health.

    PubMed

    Sarkis, Karin Sedó; Pinheiro, Marcelo de Medeiros; Szejnfeld, Vera Lúcia; Martini, Lígia Araújo

    2012-03-01

    The aim of this paper is to review the main aspects related to high bone density (HBD) as well as to discuss the physiologic mechanisms involved in bone health. There are still no well-defined criteria for identification of individuals with HBD and there are few studies on the topic. Most studies demonstrate that overweight, male gender, black ethnic background, physical activity, calcium and fluoride intake and use of medications such as statins and thiazide diuretics play a relevant and positive role on bone mineral density. Moreover, it is known that individuals with certain diseases such as obesity, diabetes, estrogen receptor-positive breast or endometrial cancer have greater bone density than healthy individuals, as well as athletes having higher bone density than non-athletes does not necessarily mean that they have healthy bones. A better understanding of risk and protective factors may help in the management of patients with bone frailty and have applicability in the treatment and in the prevention of osteoporosis, especially intervening on non-modifiable risk factors. Copyright © 2011 SEEN. Published by Elsevier Espana. All rights reserved.

  8. Cytology of Bone.

    PubMed

    Barger, Anne M

    2017-01-01

    Cytology of bone is a useful diagnostic tool. Aspiration of lytic or proliferative lesions can assist with the diagnosis of inflammatory or neoplastic processes. Bacterial, fungal, and protozoal organisms can result in significant osteomyelitis, and these organisms can be identified on cytology. Neoplasms of bone including primary bone tumors such as osteosarcoma, chondrosarcoma, fibrosarcoma, synovial cell sarcoma, and histiocytic sarcoma and tumors of bone marrow including plasma cell neoplasia and lymphoma and metastatic neoplasia can result in significant bone lysis or proliferation and can be diagnosed effectively with cytology. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Bone-Forming Tumors.

    PubMed

    Zhang, Yaxia; Rosenberg, Andrew E

    2017-09-01

    Bone-forming tumors are defined by neoplastic cells that differentiate along the lines of osteoblasts that deposit neoplastic bone. The morphology and biological spectrum of bone-forming tumors is broad, and their accurate diagnosis requires the careful correlation of their clinical, morphologic, and radiologic characteristics. Immunohistochemical and molecular analyses have an important role in select instances. At present, the identification of neoplastic bone largely depends on histologic analysis, which can be subjective. The major types of osteosarcoma are defined according to their morphology, origin within or on the surface of the bone, and their histologic grade. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Method for fusing bone

    DOEpatents

    Mourant, Judith R.; Anderson, Gerhard D.; Bigio, Irving J.; Johnson, Tamara M.

    1996-01-01

    Method for fusing bone. The present invention is a method for joining hard tissue which includes chemically removing the mineral matrix from a thin layer of the surfaces to be joined, placing the two bones together, and heating the joint using electromagnetic radiation. The goal of the method is not to produce a full-strength weld of, for example, a cortical bone of the tibia, but rather to produce a weld of sufficient strength to hold the bone halves in registration while either external fixative devices are applied to stabilize the bone segments, or normal healing processes restore full strength to the tibia.

  11. Variants of Osteoprotegerin Lacking TRAIL Binding for Therapeutic Bone Remodeling in Osteolytic Malignancies

    PubMed Central

    Higgs, Jerome T.; Jarboe, John S.; Lee, Joo Hyoung; Chanda, Diptiman; Lee, Carnellia M.; Deivanayagam, Champion; Ponnazhagan, Selvarangan

    2015-01-01

    Osteolytic bone damage is a major cause of morbidity in several metastatic pathologies. Current therapies using bisphosphonates provide modest improvement, but cytotoxic side effects still occur prompting the need to develop more effective therapies to target aggressive osteoclastogenesis. Increased levels of Receptor Activator of Nuclear Factor Kappa B Ligand (TNFSF11/RANKL), leading to RANKL-RANK signaling, remains the key axis for osteoclast activation and bone resorption. Osteoprotegerin (TNFRSF11B/OPG), a decoy receptor for RANKL is significantly decreased in patients who present with bone lesions. Despite its potential in inhibiting osteoclast activation, OPG also binds to tumor necrosis factor related apoptosis-inducing ligand (TNFSF10/TRAIL), making tumor cells resistant to apoptosis. Towards uncoupling the events of TRAIL binding of OPG and to improve its utility for bone remodeling without inducing tumor resistance to apoptosis, OPG mutants were developed by structural homology modeling based on interactive domain identification and by superimposing models of OPG, TRAIL and its receptor DR5 (TNFRSF10B) to identify regions of OPG for rational design. The OPG mutants were purified and extensively characterized for their ability to decrease osteoclast damage without affecting tumor apoptosis pathway both in vitro and in vivo, confirming their potential in bone remodeling following cancer-induced osteolytic damage. PMID:25636966

  12. Selective inhibition of matrix metalloproteinase-2 in the multiple myeloma-bone microenvironment

    PubMed Central

    Shay, Gemma; Tauro, Marilena; Loiodice, Fulvio; Tortorella, Paolo; Sullivan, Daniel M.; Hazlehurst, Lori A.; Lynch, Conor C.

    2017-01-01

    Multiple myeloma is a plasma cell malignancy that homes aberrantly to bone causing extensive skeletal destruction. Despite the development of novel therapeutic agents that have significantly improved overall survival, multiple myeloma remains an incurable disease. Matrix metalloproteinase-2 (MMP-2) is associated with cancer and is significantly overexpressed in the bone marrow of myeloma patients. These data provide rationale for selectively inhibiting MMP-2 activity as a multiple myeloma treatment strategy. Given that MMP-2 is systemically expressed, we used novel “bone-seeking” bisphosphonate based MMP-2 specific inhibitors (BMMPIs) to target the skeletal tissue thereby circumventing potential off-target effects of MMP-2 inhibition outside the bone marrow-tumor microenvironment. Using in vivo models of multiple myeloma (5TGM1, U266), we examined the impact of MMP-2 inhibition on disease progression using BMMPIs. Our data demonstrate that BMMPIs can decrease multiple myeloma burden and protect against cancer-induced osteolysis. Additionally, we have shown that MMP-2 can be specifically inhibited in the multiple myeloma-bone microenvironment, underscoring the feasibility of developing targeted and tissue selective MMP inhibitors. Given the well-tolerated nature of bisphosphonates in humans, we anticipate that BMMPIs could be rapidly translated to the clinical setting for the treatment of multiple myeloma. PMID:28611279

  13. Morbid obesity attenuates the skeletal abnormalities associated with leptin deficiency in mice.

    PubMed

    Turner, Russell T; Philbrick, Kenneth A; Wong, Carmen P; Olson, Dawn A; Branscum, Adam J; Iwaniec, Urszula T

    2014-10-01

    Leptin-deficient ob/ob mice are morbidly obese and exhibit low total bone mass and mild osteopetrosis. In order to disassociate the skeletal effects of leptin deficiency from those associated with morbid obesity, we evaluated bone mass, architecture, gene expression, and indices of bone turnover in WT mice, ob/ob mice allowed to feed ad libitum (ob/ob), and ob/ob mice pair-fed equivalent to WT mice (pair-fed ob/ob). Mice were maintained at 32 °C (thermoneutral) from 6 to 18 weeks of age to minimize differences in resting energy expenditure. ob/ob mice were heavier, had more abdominal white adipose tissue (WAT), and were hyperglycemic compared with WT mice. Femur length, bone mineral content (BMC) and bone mineral density, and midshaft femur cortical thickness were lower in ob/ob mice than in WT mice. Cancellous bone volume (BV) fraction was higher but indices of bone formation and resorption were lower in ob/ob mice compared with WT mice; reduced bone resorption in ob/ob mice resulted in pathological retention of calcified cartilage. Pair-fed ob/ob mice were lighter and had lower WAT, uterine weight, and serum glucose than ob/ob mice. Similarly, femoral length, BMC, and cortical thickness were lower in pair-fed ob/ob mice compared with ob/ob mice, as were indices of cancellous bone formation and resorption. In contrast, bone marrow adiposity, calcified cartilage, and cancellous BV fraction were higher at one or more cancellous sites in pair-fed ob/ob mice compared with ob/ob mice. These findings indicate that the skeletal abnormalities caused by leptin deficiency are markedly attenuated in morbidly obese ob/ob mice. © 2014 Society for Endocrinology.

  14. MR-Consistent Simultaneous Reconstruction of Attenuation and Activity for Non-TOF PET/MR

    NASA Astrophysics Data System (ADS)

    Heußer, Thorsten; Rank, Christopher M.; Freitag, Martin T.; Dimitrakopoulou-Strauss, Antonia; Schlemmer, Heinz-Peter; Beyer, Thomas; Kachelrieß, Marc

    2016-10-01

    Attenuation correction (AC) is required for accurate quantification of the reconstructed activity distribution in positron emission tomography (PET). For simultaneous PET/magnetic resonance (MR), however, AC is challenging, since the MR images do not provide direct information on the attenuating properties of the underlying tissue. Standard MR-based AC does not account for the presence of bone and thus leads to an underestimation of the activity distribution. To improve quantification for non-time-of-flight PET/MR, we propose an algorithm which simultaneously reconstructs activity and attenuation distribution from the PET emission data using available MR images as anatomical prior information. The MR information is used to derive voxel-dependent expectations on the attenuation coefficients. The expectations are modeled using Gaussian-like probability functions. An iterative reconstruction scheme incorporating the prior information on the attenuation coefficients is used to update attenuation and activity distribution in an alternating manner. We tested and evaluated the proposed algorithm for simulated 3D PET data of the head and the pelvis region. Activity deviations were below 5% in soft tissue and lesions compared to the ground truth whereas standard MR-based AC resulted in activity underestimation values of up to 12%.

  15. Distinct innate responses are induced by attenuated Salmonella enterica serovar Typhimurium mutants.

    PubMed

    Powell, Daniel A; Roberts, Lydia M; Ledvina, Hannah E; Sempowski, Gregory D; Curtiss, Roy; Frelinger, Jeffrey A

    2016-01-01

    Upon bacterial infection the host cells generate a wide variety of cytokines. Genetic attenuation of bacterial physiological pathogens can be accomplished not only by disruption of normal bacterial processes, but also by the loss of the ability to redirect the host immune system. We examined nine attenuated Salmonella Typhimurium mutants for their ability to replicate as well as the cytokines produced after infection of Bone Marrow Derived Macrophages (BMDM). Infection of BMDM with attenuated Salmonella mutants led to host cytokine patterns distinct from those that followed WT infection. Surprisingly, each bacterial mutant had a unique cytokine signature. Because some of the mutants induced an IL-10 response not seen in WT, we examined the role of IL-10 on Salmonella replication. Surprisingly, addition of IL-10 before or concurrent with infection restricted growth of WT Salmonella in BMDM. Bacterial attenuation is not a single process and results in attenuated host responses, which result in unique patterns for each attenuated mutants. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Modifying the osteoblastic niche with zoledronic acid in vivo—Potential implications for breast cancer bone metastasis

    PubMed Central

    Haider, Marie-Therese; Holen, Ingunn; Dear, T. Neil; Hunter, Keith; Brown, Hannah K.

    2014-01-01

    Introduction Bone metastasis is the most common complication of advanced breast cancer. The associated cancer-induced bone disease is treated with bone-sparing agents like zoledronic acid. Clinical trials have shown that zoledronic acid also reduces breast cancer recurrence in bone; potentially by modifying the bone microenvironment surrounding disseminated tumour cells. We have characterised the early effects of zoledronic acid on key cell types of the metastatic niche in vivo, and investigated how these modify the location of breast tumour cells homing to bone. Methods Female mice were treated with a single, clinically achievable dose of zoledronic acid (100 μg/kg) or PBS. Bone integrity, osteoclast and osteoblast activity and number/mm trabecular bone on 1, 3, 5 and 10 days after treatment were assessed using μCT, ELISA (TRAP, PINP) and bone histomorphometry, respectively. The effect of zoledronic acid on osteoblasts was validated in genetically engineered mice with GFP-positive osteoblastic cells. The effects on growth plate cartilage were visualised by toluidine blue staining. For tumour studies, mice were injected i.c. with DID-labelled MDA-MB-231-NW1-luc2 breast cancer cells 5 days after zoledronic acid treatment, followed by assessment of tumour cell homing to bone and soft tissues by multiphoton microscopy, flow cytometry and ex vivo cultures. Results As early as 3 days after treatment, animals receiving zoledronic acid had significantly increased trabecular bone volume vs. control. This rapid bone effect was reflected in a significant reduction in osteoclast and osteoblast number/mm trabecular bone and reduced bone marker serum levels (day 3–5). These results were confirmed in mice expressing GFP in osteoblastic linage cells. Pre-treatment with zoledronic acid caused accumulation of an extra-cellular matrix in the growth plate associated with a trend towards preferential [1] homing of tumour cells to osteoblast-rich areas of bone, but without

  17. Attenuation tomography of the upper mantle

    NASA Astrophysics Data System (ADS)

    Adenis, Alice; Debayle, Eric; Ricard, Yanick

    2017-08-01

    We present QsADR17, a global shear wave attenuation model of the upper mantle. Synthetic tests confirm that large-scale shear attenuation anomalies are resolved in the whole upper mantle with limited vertical smearing (≤50 km). QsADR17 shows strong correlation with surface tectonics down to 200 km depth, with low attenuation beneath continents and high attenuation beneath oceans. The attenuation signal near 250 km depth is dominated by a high-quality factor along subduction zones. Attenuating anomalies are found beneath mid-ocean ridges down to 150 km and under most Pacific hot spots from the lithosphere down to the transition zone. The presence of broad attenuating anomalies at 150 km depth in the Pacific Ocean suggests that several thermal plumes pond in the asthenosphere. Evidence for compositional heterogeneities is found in the lithosphere at the base of cratons and in a number of active regions.

  18. Three-dimensional simulation of ultrasound propagation through trabecular bone structures measured by synchrotron microtomography.

    PubMed

    Bossy, Emmanuel; Padilla, Frédéric; Peyrin, Françoise; Laugier, Pascal

    2005-12-07

    Three-dimensional numerical simulations of ultrasound transmission were performed through 31 trabecular bone samples measured by synchrotron microtomography. The synchrotron microtomography provided high resolution 3D mappings of bone structures, which were used as the input geometry in the simulation software developed in our laboratory. While absorption (i.e. the absorption of ultrasound through dissipative mechanisms) was not taken into account in the algorithm, the simulations reproduced major phenomena observed in real through-transmission experiments in trabecular bone. The simulated attenuation (i.e. the decrease of the transmitted ultrasonic energy) varies linearly with frequency in the MHz frequency range. Both the speed of sound (SOS) and the slope of the normalized frequency-dependent attenuation (nBUA) increase with the bone volume fraction. Twenty-five out of the thirty-one samples exhibited negative velocity dispersion. One sample was rotated to align the main orientation of the trabecular structure with the direction of ultrasonic propagation, leading to the observation of a fast and a slow wave. Coupling numerical simulation with real bone architecture therefore provides a powerful tool to investigate the physics of ultrasound propagation in trabecular structures. As an illustration, comparison between results obtained on bone modelled either as a fluid or a solid structure suggested the major role of mode conversion of the incident acoustic wave to shear waves in bone to explain the large contribution of scattering to the overall attenuation.

  19. Three-dimensional simulation of ultrasound propagation through trabecular bone structures measured by synchrotron microtomography

    NASA Astrophysics Data System (ADS)

    Bossy, Emmanuel; Padilla, Frédéric; Peyrin, Françoise; Laugier, Pascal

    2005-12-01

    Three-dimensional numerical simulations of ultrasound transmission were performed through 31 trabecular bone samples measured by synchrotron microtomography. The synchrotron microtomography provided high resolution 3D mappings of bone structures, which were used as the input geometry in the simulation software developed in our laboratory. While absorption (i.e. the absorption of ultrasound through dissipative mechanisms) was not taken into account in the algorithm, the simulations reproduced major phenomena observed in real through-transmission experiments in trabecular bone. The simulated attenuation (i.e. the decrease of the transmitted ultrasonic energy) varies linearly with frequency in the MHz frequency range. Both the speed of sound (SOS) and the slope of the normalized frequency-dependent attenuation (nBUA) increase with the bone volume fraction. Twenty-five out of the thirty-one samples exhibited negative velocity dispersion. One sample was rotated to align the main orientation of the trabecular structure with the direction of ultrasonic propagation, leading to the observation of a fast and a slow wave. Coupling numerical simulation with real bone architecture therefore provides a powerful tool to investigate the physics of ultrasound propagation in trabecular structures. As an illustration, comparison between results obtained on bone modelled either as a fluid or a solid structure suggested the major role of mode conversion of the incident acoustic wave to shear waves in bone to explain the large contribution of scattering to the overall attenuation.

  20. Tanshinol Rescues the Impaired Bone Formation Elicited by Glucocorticoid Involved in KLF15 Pathway

    PubMed Central

    Yang, Yajun; Su, Yanjie; Wang, Dongtao; Chen, Yahui; Liu, Yuyu; Luo, Shiying; Wu, Tie

    2016-01-01

    Decreased bone formation is responsible for the pathogenesis of glucocorticoid- (GC-) induced osteoporosis (GIO), while the mechanism remains to be elucidated. The aim was to investigate how natural antioxidant tanshinol attenuates oxidative stress and rescues impaired bone formation elicited by GC in Sprague-Dawley rats and in C2C12 cells and/or MC3T3-E1 cells. The results showed that tanshinol prevented bone loss and decreased biomechanical characteristics and suppressed reduction of biomarkers related to osteogenesis in GIO rats. Further study revealed that tanshinol reversed decrease of transcription activity of Osterix-luc and rescued impairment of osteoblastic differentiation and bone formation involved in induction of KLF15 mRNA. Meanwhile, tanshinol diminished inhibition of protein expression of β-catenin and Tcf4 and transcription activity of Tcf4-luc induced by GC, especially under conditions of KLF siRNA in vitro. Additionally, tanshinol attenuated increase of reactive oxygen species (ROS) generation, phosphorylation of p66Shc expression, TUNEL-positive cells, and caspase-3 activity elicited by KLF15 under conditions of GC. Taken together, the present findings suggest that tanshinol attenuated the decrease of bone formation and bone mass and bone quality elicited by GC involved in KLF15/Wnt signaling transduction and counteracted GC-evoked oxidative stress and subsequent cell apoptosis involved in KLF15/p66Shc pathway cascade. PMID:27051474

  1. Effects of Active Mastication on Chronic Stress-Induced Bone Loss in Mice

    PubMed Central

    Azuma, Kagaku; Furuzawa, Manabu; Fujiwara, Shu; Yamada, Kumiko; Kubo, Kin-ya

    2015-01-01

    Chronic psychologic stress increases corticosterone levels, which decreases bone density. Active mastication or chewing attenuates stress-induced increases in corticosterone. We evaluated whether active mastication attenuates chronic stress-induced bone loss in mice. Male C57BL/6 (B6) mice were randomly divided into control, stress, and stress/chewing groups. Stress was induced by placing mice in a ventilated restraint tube (60 min, 2x/day, 4 weeks). The stress/chewing group was given a wooden stick to chew during the experimental period. Quantitative micro-computed tomography, histologic analysis, and biochemical markers were used to evaluate the bone response. The stress/chewing group exhibited significantly attenuated stress-induced increases in serum corticosterone levels, suppressed bone formation, enhanced bone resorption, and decreased trabecular bone mass in the vertebrae and distal femurs, compared with mice in the stress group. Active mastication during exposure to chronic stress alleviated chronic stress-induced bone density loss in B6 mice. Active mastication during chronic psychologic stress may thus be an effective strategy to prevent and/or treat chronic stress-related osteopenia. PMID:26664256

  2. Anti-IL-20 monoclonal antibody promotes bone fracture healing through regulating IL-20-mediated osteoblastogenesis

    PubMed Central

    Hsu, Yu-Hsiang; Chiu, Yi-Shu; Chen, Wei-Yu; Huang, Kuo-Yuan; Jou, I-Ming; Wu, Po-Tin; Wu, Chih-Hsing; Chang, Ming-Shi

    2016-01-01

    Bone loss and skeletal fragility in bone fracture are caused by an imbalance in bone remodeling. The current challenge in bone fracture healing is to promote osteoblastogenesis and bone formation. We aimed to explore the role of IL-20 in osteoblastogenesis, osteoblast differentiation and bone fracture. Serum IL-20 was significantly correlated with serum sclerostin in patients with bone fracture. In a mouse model, anti-IL-20 monoclonal antibody (mAb) 7E increased bone formation during fracture healing. In vitro, IL-20 inhibited osteoblastogenesis by upregulating sclerostin, and downregulating osterix (OSX), RUNX2, and osteoprotegerin (OPG). IL-20R1 deficiency attenuated IL-20-mediated inhibition of osteoblast differentiation and maturation and reduced the healing time after a bone fracture. We conclude that IL-20 affects bone formation and downregulates osteoblastogenesis by modulating sclerostin, OSX, RUNX2, and OPG on osteoblasts. Our results demonstrated that IL-20 is involved in osteoregulation and anti-IL-20 mAb is a potential therapeutic for treating bone fracture or metabolic bone diseases. PMID:27075747

  3. Marble Bone Disease: A Rare Bone Disorder

    PubMed Central

    Harinathbabu, Maheswari; Thillaigovindan, Ranjani; Prabhu, Geetha

    2015-01-01

    Osteopetrosis, or marble bone disease, is a rare skeletal disorder due to a defective function of the osteoclasts. This defect renders bones more susceptible to osteomyelitis due to decreased vascularity. This disorder is inherited as autosomal dominant and autosomal recessive. Healthcare professionals should urge these patients to maintain their oral health as well as general health, as this condition makes these patients more susceptible to frequent infections and fractures. This case report emphasizes the signs and symptoms of marble bone disease and presents clinical and radiographic findings.  PMID:26594603

  4. Calcium and bone disease

    PubMed Central

    Blair, Harry C.; Robinson, Lisa J.; Huang, Christopher L.-H.; Sun, Li; Friedman, Peter A.; Schlesinger, Paul H.; Zaidi, Mone

    2013-01-01

    Calcium transport and calcium signaling are of basic importance in bone cells. Bone is the major store of calcium and a key regulatory organ for calcium homeostasis. Bone, in major part, responds to calcium-dependent signals from the parathyroids and via vitamin D metabolites, although bone retains direct response to extracellular calcium if parathyroid regulation is lost. Improved understanding of calcium transporters and calcium-regulated cellular processes has resulted from analysis of genetic defects, including several defects with low or high bone mass. Osteoblasts deposit calcium by mechanisms including phosphate and calcium transport with alkalinization to absorb acid created by mineral deposition; cartilage calcium mineralization occurs by passive diffusion and phosphate production. Calcium mobilization by osteoclasts is mediated by acid secretion. Both bone forming and bone resorbing cells use calcium signals as regulators of differentiation and activity. This has been studied in more detail in osteoclasts, where both osteoclast differentiation and motility are regulated by calcium. PMID:21674636

  5. Bone scintiscanning updated.

    PubMed

    Lentle, B C; Russell, A S; Percy, J S; Scott, J R; Jackson, F I

    1976-03-01

    Use of modern materials and methods has given bone scintiscanning a larger role in clinical medicine, The safety and ready availability of newer agents have led to its greater use in investigating both benign and malignant disease of bone and joint. Present evidence suggests that abnormal accumulation of 99mTc-polyphosphate and its analogues results from ionic deposition at crystal surfaces in immature bone, this process being facilitated by an increase in bone vascularity. There is, also, a component of matrix localization. These factors are in keeping with the concept that abnormal scintiscan sites represent areas of increased osteoblastic activity, although this may be an oversimplification. Increasing evidence shows that the bone scintiscan is more sensitive than conventional radiography in detecting focal disease of bone, and its ability to reflect the immediate status of bone further complements radiographic findings. The main limitation of this method relates to nonspecificity of the results obtained.

  6. Nanomaterials and bone regeneration

    PubMed Central

    Gong, Tao; Xie, Jing; Liao, Jinfeng; Zhang, Tao; Lin, Shiyu; Lin, Yunfeng

    2015-01-01

    The worldwide incidence of bone disorders and conditions has been increasing. Bone is a nanomaterials composed of organic (mainly collagen) and inorganic (mainly nano-hydroxyapatite) components, with a hierarchical structure ranging from nanoscale to macroscale. In consideration of the serious limitation in traditional therapies, nanomaterials provide some new strategy in bone regeneration. Nanostructured scaffolds provide a closer structural support approximation to native bone architecture for the cells and regulate cell proliferation, differentiation, and migration, which results in the formation of functional tissues. In this article, we focused on reviewing the classification and design of nanostructured materials and nanocarrier materials for bone regeneration, their cell interaction properties, and their application in bone tissue engineering and regeneration. Furthermore, some new challenges about the future research on the application of nanomaterials for bone regeneration are described in the conclusion and perspectives part. PMID:26558141

  7. Bone regeneration in dentistry

    PubMed Central

    Tonelli, Paolo; Duvina, Marco; Barbato, Luigi; Biondi, Eleonora; Nuti, Niccolò; Brancato, Leila; Rose, Giovanna Delle

    2011-01-01

    Summary The edentulism of the jaws and the periodontal disease represent conditions that frequently leads to disruption of the alveolar bone. The loss of the tooth and of its bone of support lead to the creation of crestal defects or situation of maxillary atrophy. The restoration of a functional condition involves the use of endosseous implants who require adequate bone volume, to deal with the masticatory load. In such situations the bone need to be regenerated, taking advantage of the biological principles of osteogenesis, osteoinduction and osteoconduction. Several techniques combine these principles with different results, due to the condition of the bone base on which we operate changes, the surgical technique that we use, and finally for the bone metabolic conditions of the patient who can be in a state of systemic osteopenia or osteoporosis; these can also affect the result of jaw bone reconstruction. PMID:22461825

  8. Assessing Bone Mineral Density Following Acute Hip Fractures

    PubMed Central

    Wiggin, Molly; Hemmati, Pouya; Switzer, Julie

    2015-01-01

    Objectives: In older patients, bone mineral density (BMD) diminishes with age, increasing susceptibility to femoral neck fractures. Evidence has emerged that patients who should have dual x-ray absorptiometry scans to evaluate their bone health are not doing so. Because computed tomography (CT) attenuation has now been correlated with BMD thresholds relating to osteoporosis, virtually any existing CT scan that includes the L1 vertebra can be used to assess BMD. This study evaluates the utility of CT attenuation in characterizing BMD in patients after femoral neck fractures. Methods: The electronic medical records of adults who presented to a level I trauma center with hip fractures were evaluated for eligibility. Those with a CT scan of the abdomen or other CT scan with a complete view of the L1 vertebra were included. To measure attenuation, a region of interest was selected to include the body of the L1 vertebra in the axial plane and exclude the cortices and posterior venous complex. Results: Of the 589 patients reviewed, 217 met inclusion criteria; 112 were aged 18 to 64, while 105 were ≥65. Eight (7.1%) patients in the younger cohort had a mean CT attenuation below the 110-HU threshold set for 90% specificity, whereas 31 (29.5%) patients in the older cohort had a mean CT attenuation below this threshold. Using the 160-HU threshold set for 90% sensitivity, 39 (34.8%) patients of the younger cohort and 74 (70%) patients of the older cohort were osteoporotic; all differences in CT attenuation by age were strongly significant (P < .0001). Conclusions: A significantly larger proportion of older patients with hip fractures had osteoporosis, helping validate the utility of CT attenuation in this context. In addition, a large proportion of these patients already had these images available, thus potentially helping limit cost and unnecessary medical investigations. PMID:26246948

  9. Intrathecal administration of roscovitine attenuates cancer pain and inhibits the expression of NMDA receptor 2B subunit mRNA.

    PubMed

    Zhang, Rui; Liu, Yue; Zhang, Juan; Zheng, Yaguo; Gu, Xiaoping; Ma, Zhengliang

    2012-07-01

    Cancer pain is one of the most severe chronic pains. The mechanisms underlying cancer pain are still unclear. Because of the pain-relieving effects of Cdk5 (Cyclin-dependent kinase 5) antagonist roscovitine in inflammation pain models, we tested whether roscovitine would induce antihyperalgesia in cancer pain. Our previous study showed that the NR2B (N-methyl-D-aspartate receptor 2B) in the spinal cord participates in bone cancer pain in mice. In this study, we used a mouse model of bone cancer pain to investigate whether roscovitine could attenuate bone cancer pain by regulating the expression level of NR2B mRNA in spinal cord. C3H/HeJ mice were inoculated into the intramedullary space of the right femur with Osteosarcoma cells to induce ongoing bone cancer pain behaviors. At day 14 after operation, inoculation of Osteosarcoma cells significantly enhanced mechanical allodynia and thermal hyperalgesia, which was attenuated by intrathecal administration of different doses of roscovitine. Correlated with the pain behaviors changes, RT-PCR experiments in our study revealed that there was a marked increase in the expression of NR2B mRNA in spinal cord after operation, which was attenuated by intrathecal administration of roscovitine. These results suggest that roscovitine may be a useful adjunct therapy for bone cancer pain, and NR2B in spinal cord may participate in this effect. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. [Chemoprotective effect of the alkaloid extract of Melocactus bellavistensis against colon cancer induced in rats using 1,2-dimethylhydrazine].

    PubMed

    Ríos-León, Karla; Fuertes-Ruiton, Cesar; Arroyo, Jorge; Ruiz, Julio

    2017-01-01

    To determine the toxicity and chemoprotective effect of the alkaloid extract of Melocactus bellavistensis against colon cancer induced in rats using 1,2-dimethylhydrazine (DMH). The alkaloid extract was obtained from the fleshy part of M. bellavistensis, and an acute toxicity test was then carried out on 30 mice of the Balb C57 strain. To assess its chemoprotective effect, colon cancer was induced in 45 Holtzman rats using DMH according to the following experimental design: one control group received 2 mL/kg sodium polysorbate, and four groups received 20 mg/kg DMH plus 0, 1, 5, or 10 mg/kg M. bellavistensis alkaloid extract. With a sample of 5 g of alkaloid extract, an LD50 greater than 1000 mg/mL was determined in the acute toxicity test. Histological indicators revealed that the 5 and 10 mg/kg doses had significant anti-tumor activity with 100% neoplasia inhibition against DMH- induced colon cancer in rats. Under experimental conditions, the alkaloid extract of M. bellavistensis has a chemoprotective effect against DMH-induced colon cancer in rats.

  11. Behavioural Effects of Using Sulfasalazine to Inhibit Glutamate Released by Cancer Cells: A Novel target for Cancer-Induced Depression

    PubMed Central

    Nashed, Mina G.; Ungard, Robert G.; Young, Kimberly; Zacal, Natalie J.; Seidlitz, Eric P.; Fazzari, Jennifer; Frey, Benicio N.; Singh, Gurmit

    2017-01-01

    Despite the lack of robust evidence of effectiveness, current treatment options for cancer-induced depression (CID) are limited to those developed for non-cancer related depression. Here, anhedonia-like and coping behaviours were assessed in female BALB/c mice inoculated with 4T1 mammary carcinoma cells. The behavioural effects of orally administered sulfasalazine (SSZ), a system xc− inhibitor, were compared with fluoxetine (FLX). FLX and SSZ prevented the development of anhedonia-like behaviour on the sucrose preference test (SPT) and passive coping behaviour on the forced swim test (FST). The SSZ metabolites 5-aminosalicylic acid (5-ASA) and sulfapyridine (SP) exerted an effect on the SPT but not on the FST. Although 5-ASA is a known anti-inflammatory agent, neither treatment with SSZ nor 5-ASA/SP prevented tumour-induced increases in serum levels of interleukin-1β (IL-1β) and IL-6, which are indicated in depressive disorders. Thus, the observed antidepressant-like effect of SSZ may primarily be attributable to the intact form of the drug, which inhibits system xc−. This study represents the first attempt at targeting cancer cells as a therapeutic strategy for CID, rather than targeting downstream effects of tumour burden on the central nervous system. In doing so, we have also begun to characterize the molecular pathways of CID. PMID:28120908

  12. Effect of Sipjeondaebo-Tang on Cancer-Induced Anorexia and Cachexia in CT-26 Tumor-Bearing Mice

    PubMed Central

    Jung, Ki Yong; Woo, Sang-Mi; Jun, Chan-Yong; Park, Jong Hyeong; Shin, Yong Cheol; Ko, Seong-Gyu

    2014-01-01

    Cancer-associated anorexia and cachexia are a multifactorial condition described by a loss of body weight and muscle with anorexia, asthenia, and anemia. Moreover, they correlate with a high mortality rate, poor response to chemotherapy, poor performance status, and poor quality of life. Cancer cachexia is regulated by proinflammatory cytokines such as interleukin-6 (IL-6), monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor-α (TNF-α). In addition, glucagon like peptide-1 (GIP-1), peptide YY (PYY), ghrelin, and leptin plays a crucial role in food intake. In this study, we investigated the therapeutic effects of one of the traditional herbal medicines, Sipjeondaebo-tang (Juzen-taiho-to in Japanese; SJDBT), on cancer anorexia and cachexia in a fundamental mouse cancer anorexia/cachexia model, CT-26 tumor-bearing mice. SJDBT was more significantly effective in a treatment model where it was treated after anorexia and cachexia than in a prevention model where it was treated before anorexia and cachexia on the basis of parameters such as weights of muscles and whole body and food intakes. Moreover, SJDBT inhibited a production of IL-6, MCP-1, PYY, and GLP-1 and ameliorated cancer-induced anemia. Therefore, our in vivo studies provide evidence on the role of SJDBT in cancer-associated anorexia and cachexia, thereby suggesting that SJDBT may be useful for treating cancer-associated anorexia and cachexia. PMID:24963216

  13. Effect of Sipjeondaebo-tang on cancer-induced anorexia and cachexia in CT-26 tumor-bearing mice.

    PubMed

    Choi, Youn Kyung; Jung, Ki Yong; Woo, Sang-Mi; Yun, Yee Jin; Jun, Chan-Yong; Park, Jong Hyeong; Shin, Yong Cheol; Cho, Sung-Gook; Ko, Seong-Gyu

    2014-01-01

    Cancer-associated anorexia and cachexia are a multifactorial condition described by a loss of body weight and muscle with anorexia, asthenia, and anemia. Moreover, they correlate with a high mortality rate, poor response to chemotherapy, poor performance status, and poor quality of life. Cancer cachexia is regulated by proinflammatory cytokines such as interleukin-6 (IL-6), monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor- α (TNF- α). In addition, glucagon like peptide-1 (GIP-1), peptide YY (PYY), ghrelin, and leptin plays a crucial role in food intake. In this study, we investigated the therapeutic effects of one of the traditional herbal medicines, Sipjeondaebo-tang (Juzen-taiho-to in Japanese; SJDBT), on cancer anorexia and cachexia in a fundamental mouse cancer anorexia/cachexia model, CT-26 tumor-bearing mice. SJDBT was more significantly effective in a treatment model where it was treated after anorexia and cachexia than in a prevention model where it was treated before anorexia and cachexia on the basis of parameters such as weights of muscles and whole body and food intakes. Moreover, SJDBT inhibited a production of IL-6, MCP-1, PYY, and GLP-1 and ameliorated cancer-induced anemia. Therefore, our in vivo studies provide evidence on the role of SJDBT in cancer-associated anorexia and cachexia, thereby suggesting that SJDBT may be useful for treating cancer-associated anorexia and cachexia.

  14. Is central skeleton bone quality a predictor of the severity of proximal humeral fractures?

    PubMed

    Lee, Seung Yeol; Kwon, Soon-Sun; Kim, Tae Hoon; Shin, Sang-Jin

    2016-12-01

    The objectives of this study were to evaluate the correlation between bone attenuation around the shoulder joint assessed on conventional computed tomography (CT) and bone mineral density (BMD) based on dual-energy X-ray absorptiometry (DEXA) of the central skeleton and the correlation between the bone quality around the shoulder joint and the severity of the fracture pattern of the proximal humerus. A total of 200 patients with proximal humeral fracture who underwent preoperative 3-dimensional shoulder CT as well as DEXA within 3 months of the CT examination were included. Fracture types were divided into simple and comminuted fracture based on the Neer classification. After reliability testing, bone attenuation of the glenoid, three portions of the humeral head, and metaphysis was measured by placing a circular region of interest on the center of each bony region on CT images. Partial correlation analysis was used to assess the correlation between the bone quality around the shoulder joint on CT and the BMD on the central skeleton after adjusting for age and body mass index. Partial correlations between fracture classification and CT/DEXA results were also evaluated. Bone attenuation measurements of the glenoid and humeral head showed good to excellent reliability (intraclass correlation coefficient, 0.623-0.998). Bone attenuation of the central portion of the humeral head on CT showed a significant correlation with the BMD of L1, L4, the femoral neck, and femoral trochanter (correlation coefficient, 0.269-0.431). Bone attenuation of other areas showed a lower correlation with BMD by DEXA. As the level of the Neer classification increased from a 2 to 4-part fracture, bone attenuation of the central humeral head decreased significantly (r=-0.150, p=0.034). However, the BMD on DEXA was not a predictive factor for comminuted fracture of the proximal humerus. DEXA examination of the central skeleton may not reflect the bone quality of the proximal humerus and

  15. Cytokine-mediated protection of human dendritic cells from prostate cancer-induced apoptosis is regulated by the Bcl-2 family of proteins.

    PubMed

    Pirtskhalaishvili, G; Shurin, G V; Esche, C; Cai, Q; Salup, R R; Bykovskaia, S N; Lotze, M T; Shurin, M R

    2000-08-01

    Prostate cancer is the most common cancer in men in the United States, and second in cancer-induced mortality. It is likely that tumour-induced immunosuppression is one of the reasons for low treatment efficacy in patients with advanced prostate cancer. It has been recently demonstrated that prostate cancer tissue is almost devoid of dendritic cells (DC), the major antigen-presenting cells responsible for the induction of specific antitumour immune responses. In this study, we have tested the hypothesis that prostate cancer induces progressive suppression of the DC system. We found that co-incubation of human DC with three prostate cancer cell lines led to the high levels of premature apoptosis of DC, which were significantly higher than in DC cultures co-incubated with normal prostate cells or blood leucocytes. Stimulation of DC for 24 hours with CD40 ligand (CD154), IL-12 or IL-15 prior to their co-incubation with prostate cancer cells resulted in a significant increase in DC survival in the tumour microenvironment. Furthermore, activation of DC with these cytokines was also accompanied by increased expression of the anti-apoptotic protein Bcl-x(L) in DC, suggesting a possible mechanism involved in DC protection from apoptotic death. In summary, our data demonstrate that prostate cancer induces active elimination of DC in the tumour microenvironment. Stimulation of DC by CD154, IL-12 or IL-15 leads to an increased expression of the anti-apoptotic protein Bcl-x(L) and increased resistance of DC to prostate cancer-induced apoptosis. These results suggest a new mechanism of tumour escape from immune recognition and demonstrate the cytokine-based approaches which might significantly increase the efficacy of DC-based therapies for cancer.

  16. The Use of Computed Tomography Attenuation to Evaluate Osteoporosis Following Acute Fractures of the Thoracic and Lumbar Vertebra

    PubMed Central

    Cagan, Amanda; Morgan, Robert; Davis, Rick; Asis, Martin; Switzer, Julie; Polly, David W.

    2014-01-01

    Background: Relatively few patients have dual-energy x-ray absorptiometry to quantify the magnitude of bone loss as they age. Recent work correlates mean computed tomography (CT) attenuation in the level I (L1) vertebra with bone mineral density (BMD), making it possible to objectively evaluate the magnitude of bone loss in osteoporosis by this method. The aims of this study were to evaluate the utility of using CT scans in patients with acute thoracic and lumbar spine fractures to diagnose osteoporosis and using CT attenuation to evaluate the association between age and BMD. Methods: We performed a retrospective study of patients with acute fractures of the thoracic or lumbar spine who had also undergone an abdominal (or L1) CT scan and compared mean CT attenuation in L1 against threshold values. We also compared differences in CT attenuation between younger (<65 years) and older (≥65 years) and older patients. Results: A total of 124 patients were evaluated (74 thoracic and 50 lumbar fractures). Overall, there was a strong correlation between age and bone density as measured by CT attenuation (r = −.76). Among those with thoracic fractures (<65 years), mean CT attenuation was 196.51 HU. Forty-one patients were ≥65 years and had mean CT attenuation of 105.90 HU (P < .001). In patients with lumbar fractures, 27 patients were <65 years and had a mean CT attenuation of 192.26 HU and 23 patients were ≥65 years and had mean CT attenuation of 114.31 HU (P < .001). At the threshold of 110 HU, set for specificity, the magnitude of difference between the age-stratified cohorts was greater in the thoracic spine (P < .0001 vs P = .003). Discussion: Using opportunistic CT, we demonstrate the relative frequency of osteoporosis in patients with acute fractures of the thoracic and lumbar spine and confirm that the association increases with age. The CT attenuation may provide a cheap and convenient method to help confirm a clinical diagnosis of osteoporosis in patients

  17. Biological Regulation of Bone Quality

    PubMed Central

    Alliston, Tamara

    2014-01-01

    The ability of bone to resist fracture is determined by the combination of bone mass and bone quality. Like bone mass, bone quality is carefully regulated. Of the many aspects of bone quality, this review focuses on biological mechanisms that control the material quality of the bone extracellular matrix (ECM). Bone ECM quality depends upon ECM composition and organization. Proteins and signaling pathways that affect the mineral or organic constituents of bone ECM impact bone ECM material properties, such as elastic modulus and hardness. These properties are also sensitive to pathways that regulate bone remodeling by osteoblasts, osteoclasts, and osteocytes. Several extracellular proteins, signaling pathways, intracellular effectors, and transcription regulatory networks have been implicated in the control of bone ECM quality. A molecular understanding of these mechanisms will elucidate the biological control of bone quality and suggest new targets for the development of therapies to prevent bone fragility. PMID:24894149

  18. [Bone homeostasis and Mechano biology.

    PubMed

    Nakashima, Tomoki

    The weight-bearing exercises help to build bones and to maintain them strength. Bone is constantly renewed by the balanced action of osteoblastic bone formation and osteoclastic bone resorption both of which mainly occur at the bone surface. This restructuring process called "bone remodeling" is important not only for normal bone mass and strength, but also for mineral homeostasis. Bone remodeling is stringently regulated by communication between bone component cells such as osteoclasts, osteoblasts and osteocytes. An imbalance of this process is often linked to various bone diseases. During bone remodeling, resorption by osteoclasts precedes bone formation by osteoblasts. Based on the osteocyte location within the bone matrix and the cellular morphology, it is proposed that osteocytes potentially contribute to the regulation of bone remodeling in response to mechanical and endocrine stimuli.

  19. Bone grafts, bone substitutes and orthobiologics

    PubMed Central

    Roberts, Timothy T.; Rosenbaum, Andrew J.

    2012-01-01

    The biology of fracture healing is better understood than ever before, with advancements such as the locking screw leading to more predictable and less eventful osseous healing. However, at times one’s intrinsic biological response, and even concurrent surgical stabilization, is inadequate. In hopes of facilitating osseous union, bone grafts, bone substitutes and orthobiologics are being relied on more than ever before. The o