De Paula, A C C F F; Sousa, R V; Figueiredo-Ribeiro, R C L; Buckeridge, M S
2005-06-01
Beta-glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of beta-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of beta-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-beta-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa) being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa) to that of maize coleoptile beta-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure beta-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of beta-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar
2017-03-01
Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.
β-glucan extract from oat bran and its industrial importance
NASA Astrophysics Data System (ADS)
Ibrahim, M. N. G.; Selezneva, I. S.
2017-09-01
The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.
Samuelsen, Anne Berit; Rieder, Anne; Grimmer, Stine; Michaelsen, Terje E.; Knutsen, Svein H.
2011-01-01
High intake of dietary fiber is claimed to protect against development of colorectal cancer. Barley is a rich source of dietary fiber, and possible immunomodulatory effects of barley polysaccharides might explain a potential protective effect. Dietary fiber was isolated by extraction and enzyme treatment. A mixed-linked β-glucan (WSM-TPX, 96.5% β-glucan, Mw 886 kDa), an arabinoxylan (WUM-BS-LA, 96.4% arabinoxylan, Mw 156 kDa), a mixed-linked β-glucan rich fraction containing 10% arabinoxylan (WSM-TP) and an arabinoxylan rich fraction containing 30% mixed-linked β-glucan (WUM-BS) showed no significant effect on IL-8 secretion and proliferation of two intestinal epithelial cell lines, Caco-2 and HT-29, and had no significant effect on the NF-κB activity in the monocytic cell line U937-3κB-LUC. Further enriched arabinoxylan fractions (WUM-BS-LA) from different barley varieties (Tyra, NK96300, SB94897 and CDCGainer) were less active than the mixed-linked β-glucan rich fractions (WSM-TP and WSM-TPX) in the complement-fixing test. The mixed-linked β-glucan rich fraction from NK96300 and CDCGainer showed similar activities as the positive control while mixed-linked β-glucan rich fractions from Tyra and SB94897 were less active. From these results it is concluded that the isolated high molecular weight mixed-linked β-glucans and arabinoxylans from barley show low immunological responses in selected in vitro test systems and thus possible anti-colon cancer effects of barley dietary fiber cannot be explained by our observations. PMID:21340001
Zhu, Weili; Xue, Xiaoping; Zhang, Zhanjun
2016-10-01
Polygonum multiflorum is a popular Chinese herbal medicine with various pharmacological functions. In this study, the ultrasonic-assisted extraction condition, structural characterization and antitumor activity of a polysaccharide from roots of P. multiflorum were investigated. The ultrasonic-assisted extraction condition was optimized by single-factor experiments and response surface methodology. Results showed that the maximum extraction yield (5.49%) was obtained at ultrasonic power 158W, extraction temperature 62°C, extraction time 80min and ratio of water to material 20mL/g. The obtained crude polysaccharides were further purified to afford a neutral and an acidic fraction. The structure of the main neutral polysaccharide (named PPS with molecular weight of 3.26×10(5)Da) was characterized as a linear (1→6)-α-d-glucan by gas chromatography, Fourier transform-infrared spectroscopy, methylation analysis, 1D and 2D nuclear magnetic resonance. At the concentration of 400μg/mL, the inhibitory ratios of PPS on HepG-2 and BGC-823 cells were 53.35% and 38.58%, respectively. Results suggested this polysaccharide could be a potential natural antitumor agent. Copyright © 2016 Elsevier B.V. All rights reserved.
Yu, Nianjun; Zhang, Wei; Xing, Lihua; Xie, Dongmei; Peng, Daiyin
2018-01-01
Acquiring high quality RNA is the basis of plant molecular biology research, plant genetics and other physiological investigations. At present, a large number of nucleotide isolation methods have been exploited or modified, such as commercial kits, CTAB, SDS methods and so on. Due to the nature of different plants, extraction methods vary. Moreover, efficiency of certain approach cannot be guaranteed due to composition of different plants and extracting high quality RNA from plants rich in polysaccharides and polyphenols are often difficult. The physical and chemical properties of polysaccharides which are similar to nucleic acids and other secondary metabolites will be coprecipitated with RNA irreversibly. Therefore, how to remove polysaccharides and other secondary metabolites during RNA extraction is the primary challenge. Dendrobium huoshanense is an Orchidaceae perennial herb that is rich in polysaccharides and other secondary metabolites. By using D. huoshanense as the subject, we improved the method originated from CHAN and made it suitable for plants containing high amount of polysaccharides and polyphenols. The extracted total RNA was clear and non-dispersive, with good integrity and no obvious contamination with DNA and other impurities. And it was also evaluated by gel electrophoresis, nucleic acid quantitative detector and PCR assessment. Thus, as a simple approach, it is suitable and efficient in RNA isolation for plants rich in polysaccharides and polyphenols. PMID:29715304
Zhu, Hanyu; Sun, Xueyan; Liu, Dongmei; Zheng, Liesheng; Chen, Liguo
2017-01-01
An improved method for extracting high quality and quantity RNA from a jelly mushroom and a dimorphic fungus—Tremella fuciformis which is especially rich in polysaccharides, is described. RNA was extracted from T. fuciformis mycelium M1332 and its parental monokaryotic yeast-like cells Y13 and Y32. The A260/280 and A260/230 ratios were both approximately 2, and the RNA integrity number was larger than 8.9. The yields of RNA were between 108 and 213 µg/g fresh wt. Downstream molecular applications including reverse transcriptional PCR and quantitative real-time PCR were also performed. This protocol is reliable and may be widely applicable for total RNA extraction from other jelly mushrooms or filamentous fungi rich in polysaccharides. PMID:29371814
Zhao, Yong-Ming; Yang, Jian-Ming; Liu, Ying-Hui; Zhao, Ming; Wang, Jin
2018-02-01
The aim of this study was to optimize the extraction process of polysaccharides from the fruiting bodies of Lentinus edodes and investigate its anti-hepatitis B virus activity. The extracting parameters including ultrasonic power (240-320W), extraction temperature (40-60°C) and extraction time (15-25min) was optimized by using three-variable-three-level Box-Behnken design based on the single-factor experiments. Data analysis results showed that the optimal conditions for extracting LEPs were an extraction temperature of 45°C, extraction time of 21min and ultrasonic power of 290W. Under these optimal conditions, the experimental yield of LEPs was 9.75%, a 1.62-fold increase compared with conventional heat water extraction (HWE). In addition, crude polysaccharides were purified to obtain two fractions (LEP-1 and LEP-2). Chemical analysis showed that these components were rich in glucose, arabinose and mannose. Furthermore, HepG2.2.15 cells were used as in vitro models to evaluate their anti-hepatitis B virus (HBV) activity. The results suggest that LEPs possesses potent anti-HBV activity in vitro. Copyright © 2017 Elsevier B.V. All rights reserved.
Szwengiel, Artur; Stachowiak, Barbara
2016-08-01
Some ß-glucans can be easily extracted from Basidiomycete mushrooms but commonly used extraction procedures are not satisfactory. A simultaneous method for acid extraction and deproteinization in the case of Pleurotus ostreatus was developed using response surface methodology. The optimized extraction conditions proposed here (30°C, 3.8% HCl, 300min, stirring) allow for the simultaneous extraction and deproteinization of polysaccharides. Additionally, the acid extraction yield was 7 times greater than that of hot water extraction. The combined enzymatic digestion with lyticase, ß-glucanase, exo-1,3-ß-d-glucanase, and ß-glucosidase results elucidated that an extract containing ß-1,3-ß-1,6-ß-1,4-glucan. The gel permeation chromatography (GPC) results showed that the two glucan fractions obtained do not contain linked proteins. The weight average molecular weight of the first fraction (Mw=1137kDa) was 60 times higher than that of the second fraction (Mw=19kDa). Copyright © 2016 Elsevier Ltd. All rights reserved.
Soluble β-1,3/1,6-glucan in seaweed from the southern hemisphere and its immunomodulatory effect.
Bobadilla, Francisca; Rodriguez-Tirado, Carolina; Imarai, Mónica; Galotto, María José; Andersson, Roger
2013-01-30
Five types of macroalgae from the southern hemisphere were analysed for the presence of β-1,3/1,6-glucan and its immunostimulant properties. We were able to extract soluble β-1,3/1,6-D-glucan from Durvillaea antarctica (Chamisso) Hariot (DA). The morphology of the brown algae influenced extraction, and the highest percentage of β-glucan was found in the fronds. The content of β-glucan in the stipes and holdfast was on average 33% and <5%, respectively, of that in the fronds. A simple laboratory extraction process was developed. A highly pure water-soluble polysaccharide, mainly composed of glucose residues, was obtained with a dominant average molecular weight of 6.9 kDa. NMR spectroscopy confirmed the polysaccharide structure to be of β-1,3/1,6-glucan type, comprising a β-1,3-glucan backbone and 21% degree of branching of β-1,6-glucan side chains. Mouse cells were exposed to four DA extract concentrations in water (50, 100, 250 and 500 μg/mL) and no adverse effects on survival were noted. Remarkably, the β-glucan induced a 16.9% increase in activated CD19+ B lymphocytes compared with the control sample. The optimal concentration for maximum activity was 100 μg DA extract/mL. Copyright © 2012 Elsevier Ltd. All rights reserved.
Extraction and characterization of beta-D-glucan from oat for industrial utilization.
Ahmad, Asif; Anjum, Faqir Muhammad; Zahoor, Tahir; Nawaz, Haq; Ahmed, Zaheer
2010-04-01
Oat beta-D-glucan is a valuable functional ingredient having numerous industrial, nutritional and health benefits. Its extraction needs careful attention as extraction process may affect the physiochemical and functional properties of extracted beta-D-glucan. The present study aimed at analyzing the effect of extraction of beta-D-glucan gum pellets from oat cultivar followed by detailed chemical and functional analysis. Enzymatic extraction process resulted in highest yield and recovery. Chemical analysis revealed protein as a dominating impurity. The water binding capacity of the beta-D-glucan ranged between 3.14 and 4.52 g g(-1) of sample. beta-D-Glucan exhibited ideal foaming stability when appropriate extraction technique was used. The viscosity of beta-D-glucan gum ranged between 35.6 and 56.16 cp. The color analysis showed L* value of beta-D-glucan gum pellet ranged between 72.18 and 83.54. Phosphorus, potassium and calcium appeared as major minerals in beta-D-glucan gum whereas iron, manganese and copper appeared as minor minerals. FTIR spectroscopy also confirms the presence of beta-D-glucan, protein and other components in extracted beta-D-glucan gum pellets. Overall, extracted beta-D-glucan showed a good potential for industrial usage. Copyright 2010 Elsevier B.V. All rights reserved.
Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou
2004-03-26
The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.
Sulfated Polysaccharides in Marine Sponges: Extraction Methods and Anti-HIV Activity
Esteves, Ana I. S.; Nicolai, Marisa; Humanes, Madalena; Goncalves, Joao
2011-01-01
The extraction, fractionation and HIV-1 inhibition potential of polysaccharides extracted from three species of marine sponges, Erylus discophorus, Cliona celata and Stelletta sp., collected in the Northeastern Atlantic, is presented in this work. The anti-HIV activity of 23 polysaccharide pellets and three crude extracts was tested. Crude extracts prepared from Erylus discophorus specimens were all highly active against HIV-1 (90 to 95% inhibition). Cliona celata pellets showed low polysaccharide content (bellow 38.5%) and almost no anti-HIV activity (<10% inhibition). Stelletta sp. pellets, although quite rich in polysaccharide (up to 97.3%), showed only modest bioactivity (<36% HIV-1 inhibition). Erylus discophorus pellets were among the richest in terms of polysaccharide content (up to 98%) and the most active against HIV-1 (up to 95% inhibition). Chromatographic fractionation of the polysaccharide pellet obtained from a specimen of Erylus discophorus (B161) yielded only modestly active fractions. However, we could infer that the active molecule is most probably a high molecular weight sulfated polysaccharide (>2000 kDa), whose mechanism is possibly preventing viral attachment and entry (fusion inhibitor). PMID:21339952
USDA-ARS?s Scientific Manuscript database
Germinated seed from cereal crops including barley (Hordeum vulgare L.) is an important tissue to extract RNA and analyze expression levels of genes that control aspects of germination. These tissues are rich in polysaccharides and most methods for RNA extraction are not suitable to handle the exces...
Hromádková, Z; Ebringerová, A; Valachovic, P
2002-01-01
The insoluble plant residues, obtained after preparation of medicinal tinctures from the roots of valerian (Valeriana officinalis L.) by classical and ultrasound-assisted extraction with aqueous ethanol in a pilot plant, were subsequently treated with hot water to isolate the accessible polysaccharide cell wall components. At almost equal amounts of the hot-water extractable material, the yields of the recovered polysaccharides were lower in the ultrasonical experiment. This is due to the fact that a part of accessible polysaccharides were already solubilised by the aqueous ethanol and recoverable from the medicinal tincture. Therefore, the net yield of extracted polysaccharides was enhanced in the ultrasonical procedure. This fact as well as the sugar composition and structural features of the isolated polysaccharides suggest that ultrasonication have attacked the integrity of cell walls, released and degraded its most accessible polysaccharides (pectic polysaccharides and starch) and increased also the extractibility of its less accessible components--xylan, mannan and glucan. The water-soluble polysaccharide fractions from both the conventional and ultrasonical experiments exhibit significant immunostimulatory activities in mitogenic and comitogenic thymocyte tests.
Hou, Huiyun; Cao, Xuejun
2015-07-31
In this paper, a recycling aqueous two-phase systems (ATPS) based on two pH-response copolymers PADB and PMDM were used in purification of β-Glucan from Grifola frondosa. The main parameters, such as polymer concentration, type and concentration of salt, extraction temperature and pH, were investigated to optimize partition conditions. The results demonstrated that β-Glucan was extracted into PADB-rich phase, while impurities were extracted into PMDM-rich phase. In this 2.5% PADB/2.5% PMDM ATPS, 7.489 partition coefficient and 96.92% extraction recovery for β-Glucan were obtained in the presence of 30mmol/L KBr, at pH 8.20, 30°C. The phase-forming copolymers could be recycled by adjusting pH, with recoveries of over 96.0%. Furthermore, the partition mechanism of Maitake β-Glucan in PADB/PMDM aqueous two-phase systems was studied. Fourier transform infrared spectra, ForteBio Octet system and low-field nuclear magnetic resonance (LF-NMR) were introduced for elucidating the partition mechanism of β-Glucan. Especially, LF-NMR was firstly used in the mechanism analysis in partition of aqueous two-phase systems. The change of transverse relaxation time (T2) in ATPS could reflect the interaction between polymers and β-Glucan. Copyright © 2015 Elsevier B.V. All rights reserved.
Peasura, Napassorn; Laohakunjit, Natta; Kerdchoechuen, Orapin; Wanlapa, Sorada
2015-11-01
Ulva intestinalis, a tubular green seaweed, is a rich source of nutrient, especially sulphated polysaccharides. Sulphated polysaccharides from U. intestinalis were extracted with distilled water, 0.1N HCl, and 0.1N NaOH at 80°C for 1, 3, 6, 12, and 24h to study the effect of the extraction solvent and time on their chemical composition and antioxidant activity. Different types of solvents and extraction time had a significant influence on the chemical characteristics and antioxidant activity (p<0.05). Monosaccharide composition and FT-IR spectra analyses revealed that sulphated polysaccharides from all solvent extractions have a typical sugar backbone (glucose, rhamnose, and sulphate attached at C-2 or C-3 of rhamnose). Sulphated polysaccharides extracted with acid exhibited greater antioxidant activity than did those extracted with distilled water and alkali. The results indicated that solvent extraction could be an efficacious method for enhancing antioxidant activity by distinct molecular weight and chemical characteristic of sulphated polysaccharides. Copyright © 2015 Elsevier B.V. All rights reserved.
Gonzaga, Maria Leônia Costa; Bezerra, Daniel Pereira; Alves, Ana Paula Negreiros Nunes; de Alencar, Nylane Maria Nunes; Mesquita, Rodney de Oliveira; Lima, Michael Will; Soares, Sandra de Aguiar; Pessoa, Cláudia; de Moraes, Manoel Odorico; Costa-Lotufo, Letícia Veras
2009-01-01
Agaricus blazei Murrill, a native mushroom of Brazil, has been widely consumed in different parts of the world due to its anticancer potential. This effect is generally attributed to its polysaccharides; however, the precise structure of these has not been fully characterized. To better understand the relationship between polysaccharide structures and antitumor activity, we investigated the effect of the intraperitoneally (i.p.) or orally (p.o.) administered alpha-(1-->4)-glucan-beta-(1-->6)-glucan-protein complex polysaccharide from A. blazei alone or in association with 5-fluorouracil (5-FU) in tumor growth using Sarcoma 180 transplanted mice. Hematological, biochemical, and histopathological analyses were performed in order to evaluate the toxicological aspects of the polysaccharide treatment. The polysaccharide had no direct cytotoxic action on tumor cells in vitro. However, the polysaccharide showed strong in vivo antitumor effect. Thus, the tumor growth-inhibitory effect of the polysaccharide is apparently due to host-mediated mechanisms. The histopathological analysis suggests that the liver and the kidney were not affected by polysaccharide treatment. Neither enzymatic activity of transaminases (AST and ALT) nor urea levels were significantly altered. In hematological analysis, leucopeny was observed after 5-FU treatment, but this effect was prevented when the treatment was associated with the polysaccharide. In conclusion, this polysaccharide probably could explain the ethnopharmacological use of this mushroom in the treatment of cancer.
POLYSACCHARIDES FROM CELL WALLS OF AUREOBASIDIUM (PULLULARIA) PULLULANS. PART I. GLUCANS,
The cell wall of Aureobasidium (Pullularia) pullulans contains three types of beta - glucan . One, extracted with dilute alkali, has a linear backbone...insoluble in dilute alkali contains a highly crystalline, essentially linear linked glucan and an amorphous glucan . (Author)
New developments and prospective applications for beta (1,3) glucans.
Laroche, Celine; Michaud, Philippe
2007-01-01
Publications and patents relative to newly observed functions of beta-(1,3)-D-glucans have notably increased in the last few years with the exploitation of their biological activities. The term beta-(1,3)-D-glucans includes a very large number of polysaccharides from bacterial, fungal and vegetable sources. Their structures have a common backbone of beta-(1,3) linked glucopyranosyl residues but the polysaccharidic chain can be beta-(1,6) branched with glucose or integrate some beta-(1,4) linked glucopyranosyl residues in the main chain. Except for the curdlan, a bacterial linear beta-(1,3)-D-glucans, and for the scleroglucan produced by Sclerotium rolfsii, the main drawback limiting the development of these polysaccharides is the lack of efficient processes for their extraction and purification and their cost. However new applications in agronomy, foods, cosmetic and therapeutic could in a next future accentuate the effort of research for their development. So this review focuses on these beta-(1,3)-D-glucans with the objective to detail the strategies employed for their extraction and the relation structure-functions identified when they induce biological activities.
Dourado, Fernando; Madureira, Pedro; Carvalho, Vera; Coelho, Ricardo; Coimbra, Manuel A; Vilanova, Manuel; Mota, Manuel; Gama, Francisco M
2004-10-20
The structure and bioactivity of a polysaccharide extracted and purified from a 4M KOH + H3BO3 solution from Prunus dulcis seed cell wall material was studied. Anion-exchange chromatography of the crude extract yielded two sugar-rich fractions: one neutral (A), the other acidic (E). These fractions contain a very similar monosaccharide composition: 5:2:1 for arabinose, uronic acids and xylose, respectively, rhamnose and galactose being present in smaller amounts. As estimated by size-exclusion chromatography, the acidic fraction had an apparent molecular mass of 762 kDa. Methylation analysis (from the crude and fractions A and E), suggests that the polysaccharide is an arabinan-rich pectin. In all cases, the polysaccharides bear the same type of structural Ara moieties with highly branched arabinan-rich pectic polysaccharides. The average relative proportions of the arabinosyl linkages is 3:2:1:1 for T-Araf:(1-->5)-Araf:(1-->3,5)-Araf:(1-->2,3,5)-Araf. The crude polysaccharide extract and fractions A and E induced a murine lymphocyte stimulatory effect, as evaluated by the in vitro and in vivo expression of lymphocyte activation markers and spleen mononuclear cells culture proliferation. The lymphocyte stimulatory effect was stronger on B- than on T-cells. No evidence of cytotoxic effects induced by the polysaccharide fractions was found.
Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.
Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij
2015-07-20
Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.
Isolation and chemical characterization of dissolved and particulate polysaccharides in Mikawa Bay
NASA Astrophysics Data System (ADS)
Sakugawa, Hiroshi; Handa, Nobuhiko
1985-05-01
Isolation and chemical elucidation of dissolved and particulate polysaccharides in seawater were conducted. The water samples were collected in Mikawa Bay, Japan during a red tide bloom of the dinoflagellate, Prorocentrum minimum. Dissolved polysaccharides were concentrated from 5-101 of seawater with dialysis followed by separation by gel flitration, and isolation by ethanol precipitation. A heteropolysaccharide consisting of glucose, galactose, mannose, xylose, arabinose, fucose and rhamnose and a glucan were isolated from the polysaccharide component having a molecular weight more than 4,000 Dalton and were characterized by several chemical analyses. The heteropolysaccharide is a mucilaginous polysaccharide having a highly branched structure and a molecular weight of 10 4-5 × 10 6 Daltons and probably contains a sulfate half ester: the glucan is a polysaccharide with β-1,3- and 1,6-linkages (chrysolaminaran type). Concentrations of these were respectively ca. 20 and 67 μg l -1 at 1 m, and 2 and 26 μg l -1 at 6 m. A similar heteropolysaccharide was found in the boiling water extract of the particulate matter, while β-glucan was isolated in a much less purified form than the seawater β-glucan. In addition, a large amount of β-1,4 glucan was found in the strong alkali extract of the particulate matter, indicating that this glucan must be a cell wall polysaccharide derived from phytoplankton. These results strongly suggest that the heteropolysaccharide and chrysolaminaran type polysaccharide dissolved in seawater were derived from water soluble carbohydrates of phytoplankton through extracellular release or cell lysis.
Shao, Ping; Liu, Jia; Chen, Xiaoxiao; Fang, Zhongxiang; Sun, Peilong
2015-02-01
A polysaccharide fraction (SHPSA) was obtained from Sargassum horneri by hot-water extraction and sequential purification of anion-exchange chromatography and gel-filtration chromatography. SHPSA was found to be a neutral polysaccharide fraction with an average molecular weight of 5.78×10(5) Da and composed of T-D-Glcp, 1,3-D-Glcp, 1,6-D-Glcp and 1,3,6-D-Glcp in a molar percentage of 1.00:4.17:1.17:0.89, respectively. Based on the results from chemical analysis, NMR, and SHPSA was determined to be a glucan with β-(1→6) side chains linked to a β-(1→3) backbone with relatively few branch points. Moreover, SHPSA could inhibit the growth of human colon cancer DLD cells in a dose-dependent manner by inducing the apoptosis of DLD cells. So, SHPSA was promising for future use as a natural antitumor agent. Copyright © 2014 Elsevier B.V. All rights reserved.
Yoshimi, Akira; Sano, Motoaki; Inaba, Azusa; Kokubun, Yuko; Fujioka, Tomonori; Mizutani, Osamu; Hagiwara, Daisuke; Fujikawa, Takashi; Nishimura, Marie; Yano, Shigekazu; Kasahara, Shin; Shimizu, Kiminori; Yamaguchi, Masashi; Kawakami, Kazuyoshi; Abe, Keietsu
2013-01-01
Although α-1,3-glucan is one of the major cell wall polysaccharides in filamentous fungi, the physiological roles of α-1,3-glucan remain unclear. The model fungus Aspergillus nidulans possesses two α-1,3-glucan synthase (AGS) genes, agsA and agsB. For functional analysis of these genes, we constructed several mutant strains in A. nidulans: agsA disruption, agsB disruption, and double-disruption strains. We also constructed several CagsB strains in which agsB expression was controlled by the inducible alcA promoter, with or without the agsA-disrupting mutation. The agsA disruption strains did not show markedly different phenotypes from those of the wild-type strain. The agsB disruption strains formed dispersed hyphal cells under liquid culture conditions, regardless of the agsA genetic background. Dispersed hyphal cells were also observed in liquid culture of the CagsB strains when agsB expression was repressed, whereas these strains grew normally in plate culture even under the agsB-repressed conditions. Fractionation of the cell wall based on the alkali solubility of its components, quantification of sugars, and 13C-NMR spectroscopic analysis revealed that α-1,3-glucan was the main component of the alkali-soluble fraction in the wild-type and agsA disruption strains, but almost no α-1,3-glucan was found in the alkali-soluble fraction derived from either the agsB disruption strain or the CagsB strain under the agsB-repressed conditions, regardless of the agsA genetic background. Taken together, our data demonstrate that the two AGS genes are dispensable in A. nidulans, but that AgsB is required for normal growth characteristics under liquid culture conditions and is the major AGS in this species. PMID:23365684
Xu, Jikun; Hou, Huijie; Hu, Jingping; Liu, Bingchuan
2018-04-26
Microwave-induced technique was combined with response surface methodology for optimizing the isolation of polysaccharides from Eucommia ulmoides Oliver leaf. The maximum polysaccharides yield of 12.31% was achieved by microwave extraction at 74 °C for 15 min with a solid to liquid ratio of 1:29 g/mL, which agreed with the predicted value and was 2.9-fold higher than that of the conventional heat-reflux extraction method. The dominant bioactive constituent in extracts was chlorogenic acid (1.3-1.9%), followed by geniposidic acid (1.0-1.7%). The polysaccharides from the optimized extraction had a high molecular weight and polydispersity (M w 38,830 g/mol, M w /M n 2.19), as compared to the fraction prepared in the absence of microwave (M w 12,055 g/mol, M w /M n 1.26). Glucose was the dominant sugar component (38.2-39.1%) of heterogeneous polysaccharides which belonged to a structure of β-type acidic heteropolysaccharides with a glucan group and highly branched degree. The polysaccharides showed a higher DPPH radical scavenging index (0.87-1.22) than BHT (0.41) but lower than BHA (3.56), which can act as a favorable antioxidant in functional food.
Immunomodulatory dietary polysaccharides: a systematic review of the literature
2010-01-01
Background A large body of literature suggests that certain polysaccharides affect immune system function. Much of this literature, however, consists of in vitro studies or studies in which polysaccharides were injected. Their immunologic effects following oral administration is less clear. The purpose of this systematic review was to consolidate and evaluate the available data regarding the specific immunologic effects of dietary polysaccharides. Methods Studies were identified by conducting PubMed and Google Scholar electronic searches and through reviews of polysaccharide article bibliographies. Only articles published in English were included in this review. Two researchers reviewed data on study design, control, sample size, results, and nature of outcome measures. Subsequent searches were conducted to gather information about polysaccharide safety, structure and composition, and disposition. Results We found 62 publications reporting statistically significant effects of orally ingested glucans, pectins, heteroglycans, glucomannans, fucoidans, galactomannans, arabinogalactans and mixed polysaccharide products in rodents. Fifteen controlled human studies reported that oral glucans, arabinogalactans, heteroglycans, and fucoidans exerted significant effects. Although some studies investigated anti-inflammatory effects, most studies investigated the ability of oral polysaccharides to stimulate the immune system. These studies, as well as safety and toxicity studies, suggest that these polysaccharide products appear to be largely well-tolerated. Conclusions Taken as a whole, the oral polysaccharide literature is highly heterogenous and is not sufficient to support broad product structure/function generalizations. Numerous dietary polysaccharides, particularly glucans, appear to elicit diverse immunomodulatory effects in numerous animal tissues, including the blood, GI tract and spleen. Glucan extracts from the Trametes versicolor mushroom improved survival and
Xu, Jun; Yue, Rui-Qi; Liu, Jing; Ho, Hing-Man; Yi, Tao; Chen, Hu-Biao; Han, Quan-Bin
2014-06-01
Ethanol precipitation is one of the most widely used methods for preparing natural polysaccharides, in which ethanol concentration significantly affects the precipitate yield, however, is usually set at 70-80%. Whether the standardization of ethanol concentration is appropriate has not been investigated. In the present study, the precipitation yields produced in varied ethanol concentrations (10-90%) were qualitatively and quantitatively evaluated by HPGPC (high-performance gel-permeation chromatography), using two series of standard glucans, namely dextrans and pullulans, as reference samples, and then eight natural samples. The results indicated that the response of a polysaccharide's chemical structure, with diversity in structural features and molecular sizes, to ethanol concentration is the decisive factor in precipitation of these glucans. Polysaccharides with different structural features, even though they have similar molecular weights, exhibit significantly different precipitation behaviors. For a specific glucan, the lower its molecular size, the higher the ethanol concentration needed for complete precipitation. The precipitate yield varied from 10% to 100% in 80% ethanol as the molecular size increased from 1kDa to 270kDa. This paper aims to draw scientists' attention to the fact that, in extracting natural polysaccharides by ethanol precipitation, the ethanol concentration must be individually optimized for each type of material. Copyright © 2014 Elsevier B.V. All rights reserved.
α-Amylase-assisted extraction of polysaccharides from Panax ginseng.
Sun, Lin; Wu, Di; Ning, Xin; Yang, Guang; Lin, Ziheng; Tian, Meihong; Zhou, Yifa
2015-04-01
In this paper, α-amylase-assisted extraction was used to isolate the polysaccharide that remained in hot water-extracted ginseng. The yield of the polysaccharide was 9.0%, almost equal to that of the hot water-extracted polysaccharide. Using anion exchange and gel permeation chromatography, the polysaccharide was fractionated into a neutral polysaccharide fraction and six pectic fractions. The neutral fraction accounted for 76% of the polysaccharide and contained both amylopectin and amylose. The pectic polysaccharide fractions were identified to be arabinogalactan, type-I rhamnogalacturonan and homogalacturonan-type pectin by high-performance liquid chromatography, Fourier transform-infrared and nuclear magnetic resonance analysis. Structural and lymphocyte proliferation activity results showed that these polysaccharides were different from those extracted by hot water, indicating that ginseng contains complex polysaccharides with diverse structures, which results in its diverse pharmacological activities. The α-amylase-assisted extraction is a novel method for preparing ginseng polysaccharides and could be applied toward the further study and exploration of ginseng. These findings provide technical and theoretical support for ginseng pharmacology. Copyright © 2015 Elsevier B.V. All rights reserved.
Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do
2017-02-01
Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.
Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S
2013-03-01
β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P < 0.05). Product expansion increased with the introduction of both barley and mushroom fraction (P < 0.05) which in turn resulted in a reduction in product hardness (P < 0.05). In vitro digestion protocol illustrated that inclusion of barley and mushroom β-glucan rich fractions manipulated the starch digestibility profile and hence rate of glucose release during digestion compared to the control sample. This in turn resulted in a significant (P < 0.05) reduction in potential glycaemic response of the samples of between 20 and 25 % for barley β-glucan rich fractions and between 17 and 25 % for mushroom β-glucan rich fractions. We conclude that the inclusion of these fractions could be utilised by the food industry to manipulate the glycaemic response of extruded snack products.
Ruthes, Andrea Caroline; Smiderle, Fhernanda Ribeiro; Iacomini, Marcello
2015-03-06
D-Glucans from edible mushrooms present diversified chemical structures. The most common type consists of a backbone of β-D-glucose (1→3)-linked frequently branched at O-6 by β-D-glucose residues as side chains. However it is possible to distinguish α-, β- and mixed D-glucans. Further discrimination could be made on the basis of glycosidic bond position in a pyranoid ring, distribution of specific glycosidic bonds along the chain, branching and molecular weight. The present manuscript reviews the processes of extraction, purification and chemical characterization of D-glucans, such as NMR studies, methylation analysis, Smith degradation, and some other methodologies employed in carbohydrate chemistry characterization. In addition, these polysaccharides are important because they can provide many therapeutic benefits related to their biological activity in animals and humans, either immunostimulatory activity, inhibiting tumor growth, as well as exerting antinociceptive and anti-inflammatory action, among others, which are usually attached to their structure, molecular weight and degree of branching. Copyright © 2014 Elsevier Ltd. All rights reserved.
Extraction, characterisation and antioxidant activity of Allium sativum polysaccharide.
Cheng, Hao; Huang, Gangliang
2018-07-15
Extraction and antioxidant activity of polysaccharide from Allium sativum were investigated. The crude polysaccharide was obtained by the hot-water extraction method. The molecular weight of polysaccharide deproteinized with CaCl 2 was 7.35×10 3 . It indicated that polysaccharide from Allium sativum consisted of three monosaccharides, namely fructose, glucose, and galactose by HPLC. The polysaccharide had the β-glycosidic bond. Moreover, it was proved that the polysaccharide had the potential scavenging ability to superoxide anions and hydroxyl radicals. So, it should be a potential antioxidant. Copyright © 2018 Elsevier B.V. All rights reserved.
Miao, X P; Sun, X N; Wei, H; Liu, Z J; Cui, L J; Deng, T Z
2015-02-01
The therapeutic potential of pectic polysaccharides extracted from Rauvolfia verticillata (Lour.) Baill. var. hainanensis Tsiang in ulcerative colitis were investigated. This study showed that pectic polysaccharides extracted from Rauvolfia verticillata (Lour.) Baill. var. hainanensis Tsiang ameliorated ulcerative colitis and were proposed to exhibit anti-inflammatory effects via increased expression of IκB-α proteins and suppressing NF-αB translocation.
Potential of glucans as vaccine adjuvants: A review of the α-glucans case.
Moreno-Mendieta, Silvia; Guillén, Daniel; Hernández-Pando, Rogelio; Sánchez, Sergio; Rodríguez-Sanoja, Romina
2017-06-01
α-Glucans are present in virtually all domains of life, and these glucose chains linked by α-1,4- and α-1,6-linked branches form the most important storage carbohydrates in cells. It is likely for this reason that α-glucans are not generally considered as bioactive molecules as β-glucans are. Nevertheless, it is known that depending on their source, many α-glucans play important roles as modulators of immune response. Recent efforts have attempted to elucidate the mechanisms through which α-glucans exert their immunostimulant effects; however, the main challenge is the accurate identification of the receptors of immune cells involved in their recognition. Here, we review the adjuvant properties reported for some polysaccharides and ultimately focus on α-glucans and how their structural characteristics, such as molecular weight, solubility and derivatization, influence their immunostimulatory properties. As a final point, we discuss the potential and associated challenges of using these polysaccharides as adjuvants, particularly in mucosal vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.
Preparation, characterization, and biological properties of β-glucans
Rahar, Sandeep; Swami, Gaurav; Nagpal, Navneet; Nagpal, Manisha A.; Singh, Gagan Shah
2011-01-01
β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast), and Agaricus blazei murell (mushroom). Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC) analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa) being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa) to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine. PMID:22171300
2011-01-01
Background Mushroom polysaccharides have traditionally been used for the prevention and treatment of a multitude of disorders like infectious illnesses, cancers and various autoimmune diseases. Crude mushroom extracts have been tested without detailed chemical analyses of its polysaccharide content. For the present study we decided to chemically determine the carbohydrate composition of semi-purified extracts from 2 closely related and well known basidiomycete species, i.e. Agaricus bisporus and A. brasiliensis and to study their effects on the innate immune system, in particular on the in vitro induction of pro-inflammatory cytokines, using THP-1 cells. Methods Mushroom polysaccharide extracts were prepared by hot water extraction and precipitation with ethanol. Their composition was analyzed by GC-MS and NMR spectroscopy. PMA activated THP-1 cells were treated with the extracts under different conditions and the production of pro-inflammatory cytokines was evaluated by qPCR. Results Semi-purified polysaccharide extracts of A. bisporus and A. brasiliensis (= blazei) were found to contain (1→6),(1→4)-linked α-glucan, (1→6)-linked β-glucan, and mannogalactan. Their proportions were determined by integration of 1H-NMR signs, and were considerably different for the two species. A. brasiliensis showed a higher content of β-glucan, while A. bisporus presented mannogalactan as its main polysaccharide. The extracts induced a comparable increase of transcription of the pro-inflammatory cytokine genes IL-1β and TNF-α as well as of COX-2 in PMA differentiated THP-1 cells. Pro-inflammatory effects of bacterial LPS in this assay could be reduced significantly by the simultaneous addition of A. brasiliensis extract. Conclusions The polysaccharide preparations from the closely related species A. bisporus and A. brasiliensis show major differences in composition: A. bisporus shows high mannogalactan content whereas A. brasiliensis has mostly β-glucan. Semi
Microwave superheated water extraction of polysaccharides from spent coffee grounds.
Passos, Cláudia P; Coimbra, Manuel A
2013-04-15
The spent coffee grounds (SCG) are a food industry by-product that can be used as a rich source of polysaccharides. In the present work, the feasibility of microwave superheated water extraction of polysaccharides from SCG was studied. Different ratios of mass of SCG to water, from 1:30 to 1:5 (g:mL) were used for a total volume of 80 mL. Although the amount of material extracted/batch (MAE1) increased with the increase of the concentration of the sample, the amount of polysaccharides achieved a maximum of 0.57 g/batch for 1:10. Glycosidic-linkage composition showed that all extraction conditions allowed to obtain mainly arabinogalactans. When the unextracted insoluble material was re-extracted under the same conditions (MAE2), a further extraction of polysaccharides was observed (0.34 g/batch for 1:10), mainly galactomannans. Also, a high amount of oligosaccharides, mainly derived from galactomannans, can be obtained in MAE2 (0.96 g/batch for 1:10). This technology allows to obtain galactomannans and arabinogalactans in proportions that are dependent on the operating conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.
A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.
Semedo, Magda C; Karmali, Amin; Fonseca, Luís
2015-02-01
Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.
Baranowski, E.; Pau-Roblot, C.; Sagné, E.; Citti, C.
2016-01-01
ABSTRACT Mycoplasmas are minimal, wall-less bacteria but have retained the ability to secrete complex carbohydrate polymers that constitute a glycocalyx. In members of the Mycoplasma mycoides cluster, which are important ruminant pathogens, the glycocalyx includes both cell-attached and cell-free polysaccharides. This report explores the potential secretion of polysaccharides by M. agalactiae, another ruminant pathogen that belongs to a distant phylogenetic group. Comparative genomic analyses showed that M. agalactiae possesses all the genes required for polysaccharide secretion. Notably, a putative synthase gene (gsmA) was identified, by in silico reconstruction of the biosynthetic pathway, that could be involved in both polymerization and export of the carbohydrate polymers. M. agalactiae polysaccharides were then purified in vitro and found to be mainly cell attached, with a linear β-(1→6)-glucopyranose structure [β-(1→6)-glucan]. Secretion of β-(1→6)-glucan was further shown to rely on the presence of a functional gsmA gene, whose expression is subjected to high-frequency phase variation. This event is governed by the spontaneous intraclonal variation in length of a poly(G) tract located in the gsmA coding sequence and was shown to occur in most of the M. agalactiae clinical isolates tested in this study. M. agalactiae susceptibility to serum-killing activity appeared to be dictated by ON/OFF switching of β-(1→6)-glucan secretion, suggesting a role of this phenomenon in survival of the pathogen when it invades the host bloodstream. Finally, β-(1→6)-glucan secretion was not restricted to M. agalactiae but was detected also in M. mycoides subsp. capri PG3T, another pathogen of small ruminants. IMPORTANCE Many if not all bacteria are able to secrete polysaccharides, either attached to the cell surface or exported unbound into the extracellular environment. Both types of polysaccharides can play a role in bacterium-host interactions. Mycoplasmas are
Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A
2016-11-01
At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cheng, Poh-Guat; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani
2013-01-01
Ganoderma lucidum (M.A. Curtis:Fr.) P. Karst is a popular medicinal mushroom. Scientific reports had shown that the wound healing effects of G. lucidum were partly attributed to its rich polysaccharides. However, little attention has been paid to its potential effects on wounds associated with diabetes mellitus. In this study, we evaluated the wound healing activity of the hot aqueous extract of G. lucidum in streptozotocin-induced diabetic rats. The extract of G. lucidum was standardised based on chemical contents (w/w) of total polysaccharides (25.1%), ganoderic acid A (0.45%), and adenosine (0.069%). Six groups of six rats were experimentally wounded in the posterior neck region. Intrasite gel was used as a positive control and aqueous cream as the placebo. Topical application with 10% (w/w) of mushroom extract-incorporated aqueous cream was more effective than that with Intrasite gel in terms of wound closure. The antioxidant activity in serum of rats treated with aqueous extract of G. lucidum was significantly higher; whereas the oxidative protein products and lipid damage were lower when compared to those of the controls. These findings strongly support the beneficial effects of standardised aqueous extract of G. lucidum in accelerating wound healing in streptozotocin-induced diabetic rats. PMID:24348715
Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou
2013-01-01
Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884
Sharma, Seema; Saxena, Dharmesh C; Riar, Charanjit S
2018-06-22
β-glucan extracted from raw and germinated foxtail and kodo millets were evaluated for its functional, rheological and in vitro antioxidant characteristics. The in vitro activity determined in terms of diphenyl-p-picryl hydrazy (DPPH) radical scavenging activity and Ferric reducing antioxidant power (FRAP) activity was found higher in germinated kodo millet (78.74%, 48.98%) compared to foxtail millet (34.96%, 38.67%), respectively. Water binding capacity and swelling power of β-glucan extract of foxtail millet increased from 2.88 g/g to 3.06 g/g and 1.32 g/g to 1.67 g/g and that of kodo millet from 3.45 to 3.99 g/g and 2.54 to 2.99 g/g, respectively, after germination. There was a significant improvement in foaming capacity and stability of β-glucan after germination. The 'n' values were less than unity indicated that β-glucan extracts behaved pseudo-plastic like material. The storage modus (G') of β-glucan extracts of germinated kodo millet was higher than foxtail millets, as well as overall higher than the loss modulus (G″) indicating a dominantly viscoelastic behaviour and stability. Peak tanδ was lower for germinated foxtail millet compared to kodo millet indicating more stable gel of the former. Therefore, improvements in the functional as well rheological properties of β-glucan could be exploited in food and pharmaceutical industries. Copyright © 2018. Published by Elsevier B.V.
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii
Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer
2017-01-01
Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate. PMID:28718825
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii.
Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer
2017-07-18
Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.
Zhang, Wiejie; Huang, Jing; Wang, Wei; Li, Qian; Chen, Yao; Feng, Weiwei; Zheng, Daheng; Zhao, Ting; Mao, Guanghua; Yang, Liuqing; Wu, Xiangyang
2016-12-01
An efficient ultrasonic-cellulase-assisted extraction (UCE) of Cistanche tubulosa polysaccharide (CTP) was established. The response surface methodology based on Box-Behnken Design was employed to further optimize extraction conditions. After quaternary ammonium salt precipitation, the polysaccharide of C. tubulosa was characterized by different techniques. The results showed that a maximum polysaccharide yield of 22.31±0.45% was achieved at a pH of 5.2 for 31.5min at 54.1°C. Compared to hot water extraction, the yield of CTP in UCE and polysaccharide content increased to 44.96% and 70.13±2.19%, respectively. There was no marked difference among polysaccharides extracted using different methods from the infrared spectrum. Ultrasonic-cellulase-assisted extraction polysaccharide showed a fibrous structure from scanning electron microscopy and was composed of rhamnose, mannose, glucose, and galactose in a molar ratio of 2.18:1:28.29:1.43 by gas chromatography. The circular dichroism results indicated that polysaccharides had a maximum positive peak around 210nm with different peak values. The thermogravimetric analysis and differential scanning calorimetry were used to test the thermostability of CTP. Besides, CTP demonstrated appreciable antioxidant potential on antioxidant experiments in vitro. The results suggested that UCE is an effective method for CTP extraction and its polysaccharide showed appreciable antioxidant activity. Copyright © 2016 Elsevier B.V. All rights reserved.
Study on extraction process and activity of plant polysaccharides
NASA Astrophysics Data System (ADS)
Ma, Xiaogen; Wang, Xiaojing; Fan, Shuangli; Chen, Jiezhong
2017-10-01
Recent studies have shown that plant polysaccharides have many pharmacological activities, such as hypoglycemic, anti-inflammatory and tumor inhibition. The pharmacological activities of plant polysaccharides were summarized. The extraction methods of plant polysaccharides were discussed. Finally, the extraction process of Herba Taraxaci polysaccharides was optimized by ultrasonic assisted extraction. Through single factor experiments and orthogonal experiment to optimize the optimum extraction process from dandelion polysaccharide, optimum conditions of dandelion root polysaccharide by ultrasonic assisted extraction method for ultrasonic power 320W, temperature 80°C, extraction time 40min, can get higher dandelion polysaccharide extract.
NASA Astrophysics Data System (ADS)
Lai, Wei Hong; Zainal, Zamri; Daud, Fauzi
2014-09-01
Tiger's Milk mushroom is a tropical polypore genus that can be found in the tropical part of the world in Australia, Papua New Guinea, Philippines, Indonesia, Malaysia, Sri Lanka and Vanuatu. In Malaysia, Lignosus rhinocerus is the most sought after medicinal mushroom by Semai aborigine upon request by local herbalist. This priced mushroom has been used traditionally to treat various diseases such as asthma, breast cancer, cough, fever and food poisoning. Current results indicated polysaccharide from sclerotia of indigenous L. rhinocerus extracted through hot water is able to inhibit up to 45% growth of human lung carcinoma. Inhibition is achieved when concentration of polysaccharide are in the range of 4-8 μg/ml. Present preliminary study suggests beta-glucan-rich polysaccharide from sclerotia of indigenous L. rhinocerus has anti-proliferation activity on human lung carcinoma (A549).
Polysaccharide extraction from Sphallerocarpus gracilis roots by response surface methodology.
Ma, Tingting; Sun, Xiangyu; Tian, Chengrui; Luo, Jiyang; Zheng, Cuiping; Zhan, Jicheng
2016-07-01
The extraction process of Sphallerocarpus gracilis root polysaccharides (SGRP) was optimized using response surface methodology with two methods [hot-water extraction (HWE) and ultrasonic-assisted extraction (UAE)]. The antioxidant activities of SGRP were determined, and the structural features of the untreated materials (HWE residue and UAE residue) and the extracted polysaccharides were compared by scanning electron microscopy. Results showed that the optimal UAE conditions were extraction temperature of 81°C, extraction time of 1.7h, liquid-solid ratio of 17ml/g, ultrasonic power of 300W and three extraction cycles. The optimal HWE conditions were 93°C extraction temperature, 3.6h extraction time, 21ml/g liquid-solid ratio and three extraction cycles. UAE offered a higher extraction yield with a shorter time, lower temperature and a lower solvent consumption compared with HWE, and the extracted polysaccharides possessed a higher antioxidant capacity. Therefore, UAE could be used as an alternative to conventional HWE for SGRP extraction. Copyright © 2016 Elsevier B.V. All rights reserved.
Tamura, Kazune; Hemsworth, Glyn R; Déjean, Guillaume; Rogers, Theresa E; Pudlo, Nicholas A; Urs, Karthik; Jain, Namrata; Davies, Gideon J; Martens, Eric C; Brumer, Harry
2017-10-10
Microbial utilization of complex polysaccharides is a major driving force in shaping the composition of the human gut microbiota. There is a growing appreciation that finely tuned polysaccharide utilization loci enable ubiquitous gut Bacteroidetes to thrive on the plethora of complex polysaccharides that constitute "dietary fiber." Mixed-linkage β(1,3)/β(1,4)-glucans (MLGs) are a key family of plant cell wall polysaccharides with recognized health benefits but whose mechanism of utilization has remained unclear. Here, we provide molecular insight into the function of an archetypal MLG utilization locus (MLGUL) through a combination of biochemistry, enzymology, structural biology, and microbiology. Comparative genomics coupled with growth studies demonstrated further that syntenic MLGULs serve as genetic markers for MLG catabolism across commensal gut bacteria. In turn, we surveyed human gut metagenomes to reveal that MLGULs are ubiquitous in human populations globally, which underscores the importance of gut microbial metabolism of MLG as a common cereal polysaccharide. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Trypanocidal activity of polysaccharide extract from Genipa americana leaves.
Souza, Racquel Oliveira da Silva; Sousa, Paloma Leão; Menezes, Ramon Róseo Paula Pessoa Bezerra de; Sampaio, Tiago Lima; Tessarolo, Louise Donadello; Silva, Francisca Crislandia Oliveira; Pereira, Maria Gonçalves; Martins, Alice Maria Costa
2018-01-10
The parts of the Genipa americana (Rubiaceae) tree, also known as "jenipapo" or "jenipapeiro", has been used in traditional Medicine in parasitic and bacterial infections. Thus, the experimental evolution of the antiparasitic activity of polysaccharide extracts from Genipa americana leaves, and correlation with antiparasitic and popular use is important. To evaluate the effect of polysaccharide extract obtained from Genipa americana leaves on all Trypanosoma cruzi (Y strain: benznidazole-resistant) developmental forms, a protozoan that causes Chagas' disease. An extract rich in polysaccharides was obtained from the leaves of Genipa americana (GaEPL) by associating depigmentation in methanol followed by extraction of polysaccharides in NaOH and precipitation with ethanol. Cytotoxicity to mammalian cells (LLC-MK2) was determined using an MTT assay. Antiparasitic activity was evaluated against epimastigote, trypomastigote and amastigote forms of T. cruzi. Cell-death mechanism was determined in epimastigote forms by flow cytometry analysis after FITC-annexin V (Ax), 7-AAD, and H2DCFDA staining. Striking morphological changes were observed by scanning electron microscope. GaEPL (6.5% yield; 54.6% total carbohydrate; 21.1% uronic acid and 12% protein), inhibited all T. cruzi developmental forms, epimastigotes after periods of 24h (IC 50 = 740 ± 0.075µg/mL), 48h (IC 50 = 710 ± 0.053µg/mL) and 72h (IC 50 = 870 ± 0.052µg/mL) of incubation; trypomastigotes (IC 50 = 470 ± 0.082µg/mL) after periods of 24h and intracellular amastigotes (IC 50/2 = 235 or IC 50 = 470µg/mL) after periods of 24 and 48h of incubation, with no toxicity on LLC-MK2 cells at the used concentrations. Analysis of the possible action mechanism in the parasites suggested cell death by necrosis with the involvement of reactive oxygen species (ROS). The scanning electron microscopy (SEM) confirmed T. cruzi death by necrosis. GaEPL showed significant activity against the epimastigote, trypomastigote
Self-Assembled Polysaccharide Nanotubes Generated from β-1,3-Glucan Polysaccharides
NASA Astrophysics Data System (ADS)
Numata, Munenori; Shinkai, Seiji
β-1,3-Glucans act as unique natural nanotubes, the features of which are greatly different from other natural or synthetic helical polymers. The origin mostly stems from their strong helix-forming nature and reversible interconversion between single-strand random coil and triple-strand helix. During this interconversion process, they can accept functional polymers, molecular assemblies and nanoparticles in an induced-fit manner to create water-soluble one-dimensional nanocomposites, where individual conjugated polymers or molecular assemblies can be incorporated into the one-dimensional hollow constructed by the helical superstructure of β-1,3-glucans. The advantageous point of the β-1,3-glucan hosting system is that the selective modification of β-1,3-glucans leads to the creation of various functional one-dimensional nanocomposites in a supramolecular manner, being applicable toward fundamental nanomaterials such as sensors or circuits. Furthermore, the composites with functional surfaces can act as one-dimensional building blocks toward further hierarchical self-assemblies, leading to the creation of two- or three-dimensional nanoarchitectures.
Anjaneyalu, Y V; Jagadish, R L; Raju, T S
1997-06-01
Polysaccharide components present in the pseudo-stem (scape) of M. paradisiaca were purified from acetone powder of the scape by delignification followed by extraction with aqueous solvents into water soluble polysaccharide (WSP), EDTA-soluble polysaccharide (EDTA-SP), alkali-soluble polysaccharide (ASP) and alkali-insoluble polysaccharide (AISP) fractions. Sugar compositional analysis showed that WSP and EDTA-SP contained only D-Glc whereas ASP contained D-Glc, L-Ara and D-Xyl in approximately 1:1:10 ratio, respectively, and AISP contained D-Glc, L-Ara and D-Xyl in approximately 10:1:2 ratio, respectively. WSP was further purified by complexation with iso-amylalcohol and characterized by specific rotation, IR spectroscopy, Iodine affinity, ferricyanide number, blue value, hydrolysis with alpha-amylase and glucoamylase, and methylation linkage analysis, and shown to be a amylopectin type alpha-D-glucan.
Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets.
Knudsen, Knud Erik Bach
2014-09-01
The current paper reviews content and variation in fiber and nonstarch polysaccharides (NSP) of common crops used in broiler diets. The cereal grain is a complex structure, and its cell walls (CW) differ in their composition and hence properties. Arabinoxylan (AX), mixed linkage (1→3; 1→4)-β-glucan (β-glucan), cellulose, and the noncarbohydrate component lignin are the predominant polymers in cereals. They occur in different proportions depending on the species and tissue type. Rye, triticale, wheat, corn, and sorghum are all rich in AX, whereas barley and oats contain a high level of β-glucan. The AX from rye, wheat, and triticale and β-glucan from barley and oats are to a large extent soluble, whereas the solubility of AX found in corn and sorghum is lower than the other cereals. The ratio of arabinose to xylose gives a crude indication of the AX structure, which varies between the endosperm, the aleurone and the outer grain layers as well as between the same tissues from different grains. Varietal differences in AX structure of the endosperm are also identified. From the analysis of the released oligomers after hydrolysis with a specific (1→3,1→4)-β-d-glucan hydrolase, it is found that the ratio of trisaccharides (degree of polymerization 3) and tetrasaccharides (degree of polymerization 4) varies depending on the source, being higher in barley than in oats but lower than in wheat. The molecular weight of β-glucan is higher than that of AX, and both polymers contribute to the viscosity of the extract. However, because AX molecules are more resistant to degradation than β-glucan, the use of AX rich grains in broiler diets is usually more problematic than those containing high concentrations of β-glucan. The cereal coproducts (brans and hulls) are concentrated sources of cellulose, lignin, and insoluble AX, but β-glucan can also be present mainly in rye and wheat brans. The CW composition of seeds and grains of protein crops and feedstuffs are
Jia, Shaoyi; Li, Feng; Liu, Yong; Ren, Haitao; Gong, Guili; Wang, Yanyan; Wu, Songhai
2013-11-01
Five polysaccharides were obtained from Agaricus blazei Murrill (ABM) through different extraction methods including hot water extraction, single enzyme extraction (pectinase, cellulase or papain) and compound enzymes extraction (cellulase:pectinase:papain). Their characteristics such as the polysaccharide yield, polysaccharide content, protein content, infrared spectra were determined, and antioxidant activities were investigated on the basis of hydroxyl radical, DPPH free radical, ABTS free radical and reducing power. The results showed that five extracts exhibited antioxidant activities in a concentration-dependent manner. Compared with other methods, the compound enzymes extraction method was found to present the highest polysaccharides yield (17.44%). Moreover, compound enzymes extracts exhibited the strongest reducing power and highest scavenging rates on hydroxyl radicals, DPPH radicals and ABTS radicals. On the contrary, hot water extraction method had the lowest polysaccharides yield of 11.95%, whose extracts also exhibited the lowest antioxidant activities. Overall, the available data obtained in vitro models suggested that ABM extracts were natural antioxidants and compound enzymes extraction was an appropriate, mild and effective extracting method for obtaining the polysaccharide extracts from Agaricus blazei Murrill (ABM). Copyright © 2013 Elsevier B.V. All rights reserved.
Composition and antioxidant activities of four polysaccharides extracted from Herba Lophatheri.
Ge, Qing; Mao, Jian-wei; Guo, Xiao-qing; Zhou, Yi-feng; Gong, Jing-yan; Mao, Shuang-rong
2013-09-01
Four polysaccharides (BLF80-A, BLF80-B, BLF80-C and BLF80-D) were isolated by hot-water extraction and purified from the leaves of Herba Lophatheri by DEAE-Sepharose fast flow. Their chemical and physical characteristics were determined and antioxidant activities were investigated on the basis of DPPH radical assay, hydroxyl radical assay and superoxide radical assay. The results showed that four polysaccharides exhibited antioxidant activities in a concentration-dependent manner, and the higher molecular weight, the stronger antioxidant activities of polysaccharides. Besides, the monosaccharide compositions of polysaccharides also influence their antioxidant activities. BLP80-D showed the strongest scavenging ability, followed by BLP80-C, BLP80-B and BLP80-A. Copyright © 2013 Elsevier B.V. All rights reserved.
Hsu, Kai-Di; Wu, Shu-Pei; Lin, Shin-Ping; Lum, Chi-Chin; Cheng, Kuan-Chen
2017-10-01
Extracellular polysaccharide (EPS) is one of the major bioactive ingredients contributing to the health benefits of Ganoderma spp. In this study, response surface methodology was applied to determine the optimal culture conditions for EPS production of Ganoderma formosanum. The optimum medium composition was found to be at initial pH 5.3, 49.2 g/L of glucose, and 4.9 g/L of yeast extract by implementing a three-factor-three-level Box-Behnken design. Under this condition, the predicted yield of EPS was up to 830.2 mg/L, which was 1.4-fold higher than the one from basic medium (604.5 mg/L). Furthermore, validating the experimental value of EPS production depicted a high correlation (100.4%) with the computational prediction response model. In addition, the percentage of β-glucan, a well-recognized bioactive polysaccharide, in EPS was 53±5.5%, which was higher than that from Ganoderma lucidum in a previous study. Moreover, results of monosaccharide composition analysis indicated that glucose was the major component of G. formosanum EPS, supporting a high β-glucan percentage in EPS. Taken together, this is the first study to investigate the influence of medium composition for G. formosanum EPS production as well as its β-glucan composition. Copyright © 2017. Published by Elsevier B.V.
Zhang, Zhongshan; Wang, Xiaomei; Yu, Shuchi; Zhao, Mingxing
2011-11-01
Polysaccharides extracted from Phyllostachys edulis (Carr.) are a group of hetero polysaccharides, and their antioxidant activities were investigated employing various established in vitro systems. Available data obtained with in vitro models suggested that among the three samples, B1 (extraction with water) showed significant inhibitory effects on superoxide radical and hydroxyl radical; its reducing power was also the strongest among the three samples. These results clearly establish the possibility that polysaccharides extracted from P. edulis could be effectively employed as ingredient in health or functional food, to alleviate oxidative stress. However, comprehensive studies need to be conducted in experimental animal models. Copyright © 2011 Elsevier B.V. All rights reserved.
Extractability and structure of spent coffee ground polysaccharides by roasting pre-treatments.
Simões, Joana; Nunes, Fernando M; Domingues, M Rosário; Coimbra, Manuel A
2013-08-14
The coffee residue left after the preparation of the brew (spent coffee grounds - SCG) is very rich in polysaccharides, namely galactomannans and arabinogalactans, which are polymers that can be used as dietary fibre and present immunostimulatory activity. Considering the huge amount of SCG produced all over the world, the reutilisation of this by-product by its application as food ingredients is very promising. However, the yields of extraction of these polysaccharides tend to be very low, namely the galactomannans. Based on the observation that the yield of galactomannans extracted from the ground coffee to the brew increase when the coffee is roasted, in this study, with the aim of increasing the yield of these polysaccharides, the SCG was roasted and then extracted with hot water and alkali solutions. The roasting at 160°C promoted an increment of 15% in the yield of galactomannan extractions and further improvement of the yield of extraction until 56% of all galactomannans was achieved by alkali extractions at 60 and 120°C. In these samples the galactomannans still kept their characteristic structure, including the acetylation and branching, determined by sugar linkage analysis and mass spectrometry. The yield of extraction of arabinogalactans under these conditions was 54%. Copyright © 2013 Elsevier Ltd. All rights reserved.
Maca polysaccharides: Extraction optimization, structural features and anti-fatigue activities.
Li, Yujuan; Xin, Yizhou; Xu, Fangxue; Zheng, Mengmeng; Xi, Xiaozhi; Cui, Xiaowei; Cao, Hui; Guo, Hong; Han, Chunchao
2018-08-01
The maca polysaccharides optimal extraction conditions were obtained by using response surface methodology (RSM) method and the anti-fatigue activity of maca polysaccharides (MCP) was explored. The maca polysaccharides extract yield of RSM could reach 9.97 mg/g by using the model predicts, and the total sugar and protein purity were 61.00% and 4.46% with the further isolation process, respectively. And the monosaccharide compositions obtained by gas chromatograph (GC) were composed of rhamnose (rha), glucose (glc), galactose (gal) with the ratio of 2.34:10.21:1.00. Furthermore, the anti-fatigue activity was evaluated by the swimming parameter, biochemistry parameters (liver glycogen (LG), blood urea nitrogen (BUN), and lactic acid (LD)), the result indicated that the low-dose maca polysaccharides group had the significant anti-fatigue activity. Copyright © 2018 Elsevier B.V. All rights reserved.
da Silva, A F; Sartori, D; Macedo, F C; Ribeiro, L R; Fungaro, M H P; Mantovani, M S
2013-06-01
The polysaccharide β-glucan has biological properties that stimulate the immune system and can prevent chronic pathologies, including cancer. It has been shown to prevent damage to DNA caused by the chemical and physical agents to which humans are exposed. However, the mechanism of β-glucan remains poorly understood. The objective of the present study was to verify the protective effect of β-glucan on the expression of the genes ERCC5 (involved in excision repair of DNA damage), CASP9 (involved in apoptosis), and CYP1A1 (involved in the metabolism of xenobiotics) using real-time polymerase chain reaction and perform metabolic profile measurements on the HepG2 cells. Cells were exposed to only benzo[a]pyrene (B[a]P), β-glucan, or a combination of B[a]P with β-glucan. The results demonstrated that 50 µg/mL β-glucan significantly repressed the expression of the ERCC5 gene when compared with the untreated control cells in these conditions. No change was found in the CASP9 transcript level. However, the CYP1A1 gene expression was also induced by HepG2 cells exposed to B[a]P only or in association with β-glucan, showing its effective protector against damage caused by B[a]P, while HepG2 cells exposed to only β-glucan did not show CYP1A1 modulation. The metabolic profiles showed moderate bioenergetic metabolism with an increase in the metabolites involved in bioenergetic metabolism (alanine, glutamate, creatine and phosphocholine) in cells treated with β-glucan and to a lesser extent treated with B[a]P. Thus, these results demonstrate that the chemopreventive activity of β-glucan may modulate bioenergetic metabolism and gene expression.
C, Senthil Kumar; M, Sivakumar; K, Ruckmani
2016-11-01
Response Surface Methodology (RSM) was used to optimize the parameters for microwave-assisted extraction of polysaccharides from Cyphomandra betacea. The results showed a good fit with a second-order polynomial equation that was statistically acceptable at P<0.05. Optimal conditions for the extraction of polysaccharides were: extraction time, 2h; microwave power, 400W; extraction temperature, 60°C; and ratio of raw material to water 1:40 (g/mL). Under the optimized conditions, the yield of polysaccharides was found to be relatively high (about 36.52%). The in vitro biological activities of antioxidant and antitumor were evaluated. The IC 50 value of polysaccharides was found to be 3mg/mL. The percentage of Cell viability was determined by MTT assay. Our results showed that polysaccharides inhibited proliferation of MCF-7 (Breast carcinoma), A549 (Human lung carcinoma) and HepG2 (Liver carcinoma) with an IC 50 of 0.23mg/mL, 0.17mg/mL and 0.62mg/mL respectively after 48h incubation. Polysaccharides were shown to promote apoptosis as seen in the nuclear morphological examination study using acridine orange (AO) and ethidium bromide (EB) staining. This is the first report on the effects of polysaccharides extracted from Cyphomandra betacea which exhibited stronger antioxidant and antitumor activities. Copyright © 2016 Elsevier B.V. All rights reserved.
β-1,3-Glucans are components of brown seaweed (Phaeophyceae) cell walls.
Raimundo, Sandra Cristina; Pattathil, Sivakumar; Eberhard, Stefan; Hahn, Michael G; Popper, Zoë A
2017-03-01
LAMP is a cell wall-directed monoclonal antibody (mAb) that recognizes a β-(1,3)-glucan epitope. It has primarily been used in the immunolocalization of callose in vascular plant cell wall research. It was generated against a brown seaweed storage polysaccharide, laminarin, although it has not often been applied in algal research. We conducted in vitro (glycome profiling of cell wall extracts) and in situ (immunolabeling of sections) studies on the brown seaweeds Fucus vesiculosus (Fucales) and Laminaria digitata (Laminariales). Although glycome profiling did not give a positive signal with the LAMP mAb, this antibody clearly detected the presence of the β-(1,3)-glucan in situ, showing that this epitope is a constituent of these brown algal cell walls. In F. vesiculosus, the β-(1,3)-glucan epitope was present throughout the cell walls in all thallus parts; in L. digitata, the epitope was restricted to the sieve plates of the conductive elements. The sieve plate walls also stained with aniline blue, a fluorochrome used as a probe for callose. Enzymatic digestion with an endo-β-(1,3)-glucanase removed the ability of the LAMP mAb to label the cell walls. Thus, β-(1,3)-glucans are structural polysaccharides of F. vesiculosus cell walls and are integral components of the sieve plates in these brown seaweeds, reminiscent of plant callose.
Hu, Jie; Jia, Xuejing; Fang, Xiaobin; Li, Peng; He, Chengwei; Chen, Meiwan
2016-04-01
Ultrasonic-assisted extraction technology was employed to prepare Ligusticum chuanxiong Hort polysaccharide. Single factor test and orthogonal experimental design were used to optimize the extraction conditions. The results showed that the optimal extraction conditions consisted of ultrasonic temperature of 80°C, ultrasonic time of 40 min and water to raw material ratio of 30 mL/g. Three novel polysaccharides fractions, LCX0, LCX1 and LCX2, were isolated and purified from the crude polysaccharides using DEAE-52 cellulose and Sephadex G-100 column chromatography. The molecular weight and monosaccharide composition of three LCX polysaccharides fractions were analyzed with gel permeation chromatography (GPC) and HPLC analysis, respectively. Furthermore, the antioxidant and in vitro anticancer activities of the polysaccharides were investigated. Compared with LCX0, LCX2 and LCX1 showed relative higher antioxidant activity and inhibitory activity to the growth of HepG2, SMMC7721, A549 and HCT-116 cells. It is suggested that the novel polysaccharides from rhizome of L. chuanxiong could be promising bioactive macromolecules for biomedical use. Copyright © 2016. Published by Elsevier B.V.
The effects of β-glucan on human immune and cancer cells
Chan, Godfrey Chi-Fung; Chan, Wing Keung; Sze, Daniel Man-Yuen
2009-01-01
Non-prescriptional use of medicinal herbs among cancer patients is common around the world. The alleged anti-cancer effects of most herbal extracts are mainly based on studies derived from in vitro or in vivo animal experiments. The current information suggests that these herbal extracts exert their biological effect either through cytotoxic or immunomodulatory mechanisms. One of the active compounds responsible for the immune effects of herbal products is in the form of complex polysaccharides known as β-glucans. β-glucans are ubiquitously found in both bacterial or fungal cell walls and have been implicated in the initiation of anti-microbial immune response. Based on in vitro studies, β-glucans act on several immune receptors including Dectin-1, complement receptor (CR3) and TLR-2/6 and trigger a group of immune cells including macrophages, neutrophils, monocytes, natural killer cells and dendritic cells. As a consequence, both innate and adaptive response can be modulated by β-glucans and they can also enhance opsonic and non-opsonic phagocytosis. In animal studies, after oral administration, the specific backbone 1→3 linear β-glycosidic chain of β-glucans cannot be digested. Most β-glucans enter the proximal small intestine and some are captured by the macrophages. They are internalized and fragmented within the cells, then transported by the macrophages to the marrow and endothelial reticular system. The small β-glucans fragments are eventually released by the macrophages and taken up by other immune cells leading to various immune responses. However, β-glucans of different sizes and branching patterns may have significantly variable immune potency. Careful selection of appropriate β-glucans is essential if we wish to investigate the effects of β-glucans clinically. So far, no good quality clinical trial data is available on assessing the effectiveness of purified β-glucans among cancer patients. Future effort should direct at performing well
Specht, Charles A; Lee, Chrono K; Huang, Haibin; Tipper, Donald J; Shen, Zu T; Lodge, Jennifer K; Leszyk, John; Ostroff, Gary R; Levitz, Stuart M
2015-12-22
A vaccine capable of protecting at-risk persons against infections due to Cryptococcus neoformans and Cryptococcus gattii could reduce the substantial global burden of human cryptococcosis. Vaccine development has been hampered though, by lack of knowledge as to which antigens are immunoprotective and the need for an effective vaccine delivery system. We made alkaline extracts from mutant cryptococcal strains that lacked capsule or chitosan. The extracts were then packaged into glucan particles (GPs), which are purified Saccharomyces cerevisiae cell walls composed primarily of β-1,3-glucans. Subcutaneous vaccination with the GP-based vaccines provided significant protection against subsequent pulmonary infection with highly virulent strains of C. neoformans and C. gattii. The alkaline extract derived from the acapsular strain was analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS), and the most abundant proteins were identified. Separation of the alkaline extract by size exclusion chromatography revealed fractions that conferred protection when loaded in GP-based vaccines. Robust Th1- and Th17-biased CD4(+) T cell recall responses were observed in the lungs of vaccinated and infected mice. Thus, our preclinical studies have indicated promising cryptococcal vaccine candidates in alkaline extracts delivered in GPs. Ongoing studies are directed at identifying the individual components of the extracts that confer protection and thus would be promising candidates for a human vaccine. The encapsulated yeast Cryptococcus neoformans and its closely related sister species, Cryptococcus gattii, are major causes of morbidity and mortality, particularly in immunocompromised persons. This study reports on the preclinical development of vaccines to protect at-risk populations from cryptococcosis. Antigens were extracted from Cryptococcus by treatment with an alkaline solution. The extracted antigens were then packaged into glucan particles, which are hollow
Sui, ZhiFu; Yang, RongYa; Liu, Biao; Gu, TingMin; Zhao, Zhili; Shi, Dongfang; Chang, DongQing
2010-08-01
Agaricus blazei polysaccharides were analyzed by GC-MS. Results indicated that the polysaccharides contained glucose (93.87%), mannose (3.54%), and arabinose (2.25%). The compositional analysis was completed by the methylation data. These data indicated that Agaricus blazei polysaccharides are glucans. Compared to model rats, rats fed with Agaricus blazei polysaccharides showed a decrease of ratio of IL-1beta/beta-actin and IL-1beta level in skin of burn wound. Recovery rate of wound skin increased with increasing dose of polysaccharides. The results indicated that Agaricus blazei polysaccharides could be useful in promote burn wound healing. Copyright 2010 Elsevier B.V. All rights reserved.
Membrane pore architecture of the CslF6 protein controls (1-3,1-4)-β-glucan structure.
Jobling, Stephen A
2015-06-01
The cereal cell wall polysaccharide (1-3,1-4)-β-glucan is a linear polymer of glucose containing both β1-3 and β1-4 bonds. The structure of (1-3,1-4)-β-glucan varies between different cereals and during plant growth and development, but little is known about how this is controlled. The cellulose synthase-like CslF6 protein is an integral membrane protein and a major component of the (1-3,1-4)-β-glucan synthase. I show that a single amino acid within the predicted transmembrane pore domain of CslF6 controls (1-3,1-4)-β-glucan structure. A new mechanism for the control of the polysaccharide structure is proposed where membrane pore architecture and the translocation of the growing polysaccharide across the membrane control how the acceptor glucan is coordinated at the active site and thus the proportion of β1-3 and β1-4 bonds within the polysaccharide.
Ahmad, Ajaz; Alkharfy, Khalid M; Wani, Tanveer A; Raish, Mohammad
2015-01-01
The objective of the present work was to study the ultrasonic assisted extraction and optimization of polysaccharides from Paeonia emodi and evaluation of its anti-inflammatory response. Specifically, the optimization of polysaccharides was carried out using Box-Behnken statistical experimental design. Response surface methodology (RSM) of three factors (extraction temperature, extraction time and liquid solid ratio) was employed to optimize the percentage yield of the polysaccharides. The experimental data were fitted to quadratic response surface models using multiple regression analysis with high coefficient of determination value (R) of 0.9906. The highest polysaccharide yield (8.69%) as per the Derringer's desirability prediction tool was obtained under the optimal extraction condition (extraction temperature 47.03 °C, extraction time 15.68 min, and liquid solid ratio 1.29 ml/g) with a desirability value of 0.98. These optimized values of tested parameters were validated under similar conditions (n = 6), an average of 8.13 ± 2.08% of polysaccharide yield was obtained in an optimized extraction conditions with 93.55% validity. The anti-inflammatory effect of polysaccharides of P. emodi were studied on carrageenan induced paw edema. In vivo results showed that the P. emodi 200mg/kg of polysaccharide extract exhibited strong potential against inflammatory response induced by 1% suspension of carrageenean in normal saline. Copyright © 2014 Elsevier B.V. All rights reserved.
Kan, Yongjun; Chen, Tiqiang; Wu, Yanbin; Wu, Jianguo; Wu, Jinzhong
2015-01-01
Superfine grinding technology was applied for polysaccharide extraction from the fruiting bodies of Ganoderma lucidum, and response surface methodology (RSM) was used to optimize the effects of processing parameters on polysaccharide extraction yield. Results showed that the maximum yield of G. lucidum polysaccharides (GLP) was obtained at an optimum condition: extraction time 137 min, extraction temperature 66 ̊C, the ratio of water to material 35 mL/g, and the GLP extracting yield reached 2.44% under this condition. GLP were precipitated into three crude polysaccharides, viz. GLP40, GLP60 and GLP80. The basic characterization of polysaccharides was determined by using HPLC and FT-IR methods. GLP, GLP80, GLP60, and GLP40 were composed of Man, Rib, Glc, Gal and Fuc with the molar ratios of 1.27:0.36:22.89:1.61:0.33, 1.40:0.31:23.02:3.46:0.91, 0.96:0.34:25.76:2.47:0.46, and 2.81:1.42:23.83:1.61:0.33, respectively. The result of FT-IR suggested that the monosaccharide residue of the four polysaccharides was β-pyranoid ring. Moreover, the antioxidant activities of these four polysaccharides were evaluated. The results showed that GLP80 had the best reducing power, DPPH radical scavenging ability and oxygen radical scavenging ability followed by GLP, GLP60 and GLP40. Our results demonstrated that RSM might be a valuable technique for optimizing the efficient extraction of GLP, and G. lucidum could be considered as sources of natural antioxidants and preservatives of food industry. Moreover, polysaccharides, especially GLP80, extracted from the fruiting bodies of G. lucidum, exhibited promising antioxidant activities. Copyright © 2014 Elsevier B.V. All rights reserved.
Effect of β-glucan-rich barley flour fraction on rheology and quality of frozen yeasted dough.
Hamed, Abdelmagid; Ragaee, Sanaa; Abdel-Aal, El-Sayed M
2014-12-01
Research has shown that prolonged frozen storage of bread dough reduces the quality of the end product. In this study, the effect of air-classified barley flour fraction rich in β-glucan (approximately 25%) on rheology and quality of frozen yeasted bread dough was investigated. Wheat flour (W) was replaced by air-classified barley flour fraction (B) at 10% without or with 1.4% vital gluten to produce β-glucan enriched barley dough (WB) or barley dough plus gluten (WB + G). Dough products were stored at -18 ºC for 8 wk and their rheological properties were investigated weekly. During frozen storage dough extensibility increased, while elastic and viscous moduli decreased. Differential scanning calorimeter and nuclear magnetic resonance data indicated that WB and WB + G dough products contained approximately 10% less freezable water and 9% more bound water compared to the control dough (W). β-Glucan enriched dough also exhibited less changes in gluten network as shown by SEM photographs. The addition of air-classified barley flour fraction at 10% in frozen dough reduced deterioration effects caused by frozen storage via minimizing water redistribution and maintaining rheological properties of frozen dough. © 2014 Institute of Food Technologists®
Foumani, Maryam; Vuong, Thu V.; MacCormick, Benjamin; Master, Emma R.
2015-01-01
The gluco-oligosaccharide oxidase from Sarocladium strictum CBS 346.70 (GOOX) is a single domain flavoenzyme that favourably oxidizes gluco- and xylo- oligosaccharides. In the present study, GOOX was shown to also oxidize plant polysaccharides, including cellulose, glucomannan, β-(1→3,1→4)-glucan, and xyloglucan, albeit to a lesser extent than oligomeric substrates. To improve GOOX activity on polymeric substrates, three carbohydrate binding modules (CBMs) from Clostridium thermocellum, namely CtCBM3 (type A), CtCBM11 (type B), and CtCBM44 (type B), were separately appended to the amino and carboxy termini of the enzyme, generating six fusion proteins. With the exception of GOOX-CtCBM3 and GOOX-CtCBM44, fusion of the selected CBMs increased the catalytic activity of the enzyme (kcat) on cellotetraose by up to 50%. All CBM fusions selectively enhanced GOOX binding to soluble and insoluble polysaccharides, and the immobilized enzyme on a solid cellulose surface remained stable and active. In addition, the CBM fusions increased the activity of GOOX on soluble glucomannan by up to 30 % and on insoluble crystalline as well as amorphous cellulose by over 50 %. PMID:25932926
Jing, Changliang; Yuan, Yuan; Tang, Qi; Zou, Ping; Li, Yiqiang; Zhang, Chengsheng
2017-10-01
Single-factor experiment and Central Composite Design (CCD) was applied to optimize the ultrasound-assisted extraction (UAE) conditions of polysaccharides from Glycine soja (CGPS), and a preliminary characterization of three polysaccharide fractions (CGPS, GPS-1, and GPS-2) and their antioxidant activities were investigated. Under the optimal conditions: ratio of liquid to solid 42.7mL/g, extraction power 293.7W, extraction temperature 68.9°C, and extraction time 34.7min, the experimental CGPS yield was 6.04mg/g. CGPS was further purified by DEAE-cellulose and Sephadex-100 chromatography to obtain two fractions (GPS-1 and GPS-2), and their monosaccharides compositions were characterized by HPLC. Fourier-transform infrared spectra (FT-IR) indicated the chemical structures of them. Moreover, they exhibited high antioxidant activities in a concentration-dependent manner in vitro. In summary, the present study suggested that UAE was a very effective method to extract polysaccharides from Glycine soja and the polysaccharides could be explored as potential antioxidant agents for medicine and function food. Copyright © 2017 Elsevier B.V. All rights reserved.
Two micro-scale protocols for the isolation of DNA from polysaccharide-rich plant tissue.
Shepherd, Lara D; McLay, Todd G B
2011-03-01
The high polysaccharide content of some plant species hinders the successful isolation of their DNA. As an alternative to the macro-extraction methods previously published for polysaccharide-rich plants, we present two techniques (STE/CTAB and HEPES/CTAB), which are performed in microcentrifuge tubes. These protocols are suitable for small amounts of silica gel-preserved plant tissue such as are commonly available from endangered plants. The critical step to remove polysaccharides was performing initial washes in either STE (0.25 M sucrose, 0.03 M Tris, 0.05 M EDTA) or HEPES (2% β-mercaptoethanol, 0.2% PVP, 0.1 M HEPES, pH 8.0) buffer. Precipitating the DNA at room temperature with isopropanol also aided in decreasing polysaccharide co-precipitation. Of the two protocols we present the STE/CTAB method has the advantages of being more cost-effective and avoiding the use of the hazardous chemical β-mercaptoethanol.
Adrien, Amandine; Dufour, Delphine; Baudouin, Stanislas; Maugard, Thierry; Bridiau, Nicolas
2017-09-01
The aim of this study was to evaluate the potential anticoagulant activity of sulphated polysaccharide-containing extracts of six french edible marine macroalgae. Aqueous extracts of brown (Himanthalia elongata, Laminaria digitata, Ascophyllum nodosum, Fucus vesiculosus), green (Ulva lactuca) and red (Chondrus crispus) macroalgae were prepared and their biochemical properties were determined, including major biomolecules, sulphate and ash contents. The anticoagulant activity of each extract was investigated using different scales from the specific antithrombin-dependent pathway (anti-Xa and anti-IIa) to the intrinsic and/or common (Activated Partial Thromboplastin Time, APTT), extrinsic (Prothrombin Time, PT) or common (Thrombin Time, TT) anticoagulant pathways, and compared with those of commercial anticoagulants, heparin and Lovenox®. Laminaria digitata, Fucus vesiculosus and Chondrus crispus extracts showed a significant APTT anticoagulant capacity, only 5-fold lower than that of Lovenox®, which is a pure low molecular weight heparin used as an anticoagulant agent to prevent pulmonary embolism in patients undergoing surgery.
Cheong, Kit-Leong; Wang, Lan-Ying; Wu, Ding-Tao; Hu, De-Jun; Zhao, Jing; Li, Shao-Ping
2016-09-01
Cordyceps sinensis is a well-known tonic food with broad medicinal properties. The aim of the present study was to investigate the optimization of microwave-assisted extraction (MAE) and characterize chemical structures and chain conformation of polysaccharides from a novel C. sinensis fungus UM01. Ion-exchange and gel filtration chromatography were used to purify the polysaccharides. The chemical structure of purified polysaccharide was determined through gas chromatography-mass spectrometry. Moreover, high performance size exclusion chromatography combined with refractive index detector and multiangle laser light scattering were conducted to analyze the molecular weight (Mw ) and chain conformation of purified polysaccharide. Based on the orthogonal design L9 , optimal MAE conditions could be obtained through 1300 W of microwave power, with a 5-min irradiation time at a solid to water ratio of 1:60, generating the highest extraction yield of 6.20%. Subsequently, the polysaccharide UM01-S1 was purified. The UM01-S1 is a glucan-type polysaccharide with a (1→4)-β-d-glucosyl backbone and branching points located at O-3 of Glcp with a terminal-d-Glcp. The Mw , radius of gyration (Rg ) and hydrodynamic radius (Rh ) of UM01-S1 were determined as 5.442 × 10(6) Da, 21.8 and 20.2 nm, respectively. Using the polymer solution theory, the exponent (ν) value of the power law function was calculated as 0.38, and the shape factor (ρ = Rg /Rh ) was 1.079, indicating that UM01-S1 has a sphere-like conformation with a branched structure in an aqueous solution. These results provide fundamental information for the future application of polysaccharides from cultured C. sinensis in health and functional food area. © 2016 Institute of Food Technologists®
Ferreira, Isabel C F R; Heleno, Sandrina A; Reis, Filipa S; Stojkovic, Dejan; Queiroz, Maria João R P; Vasconcelos, M Helena; Sokovic, Marina
2015-06-01
Ganoderma genus comprises one of the most commonly studied species worldwide, Ganoderma lucidum. However, other Ganoderma species have been also reported as important sources of bioactive compounds. Polysaccharides are important contributors to the medicinal properties reported for Ganoderma species, as demonstrated by the numerous publications, including reviews, on this matter. Yet, what are the chemical features of Ganoderma polysaccharides that have bioactivity? In the present manuscript, the chemical features of Ganoderma polysaccharides with reported antioxidant, antitumor and antimicrobial activities (the most studied worldwide) are analyzed in detail. The composition of sugars (homo- versus hetero-glucans and other polysaccharides), type of glycosidic linkages, branching patterns, and linkage to proteins are discussed. Methods for extraction, isolation and identification are evaluated and, finally, the bioactivity of polysaccharidic extracts and purified compounds are discussed. The integration of data allows deduction of structure-activity relationships and gives clues to the chemical aspects involved in Ganoderma bioactivity. Copyright © 2014 Elsevier Ltd. All rights reserved.
Yan, Jing-Kun; Ding, Zhi-Chao; Gao, Xianli; Wang, Yao-Yao; Yang, Yan; Wu, Di; Zhang, He-Nan
2018-08-01
In this study, hot water, 0.9% NaCl, citric acid, and 1.25 M NaOH/0.05% NaBH 4 were separately used for the extraction of water-soluble H. erinaceus polysaccharides (HEPs; HEP-W, HEP-S, HEP-C, and HEP-A) from the fruit body of Hericium erinaceus. The physicochemical properties and biological activities were then investigated and compared. Results showed that the extraction solvents exhibited significant effects on the extraction yields, molecular weights, monosaccharide compositions, preliminary structural characteristics, microstructures of HEPs and on their contents, such as neutral sugar, uronic acid, protein, and β-(1 → 3)-glucan. In vitro antioxidant activity assays indicated that HEP-C extracted with citric acid solution showed stronger scavenging abilities on hydroxyl and DPPH radicals and antioxidant capacities than HEP-W and HEP-S. Moreover, HEP-C exhibited the strongest inhibitory effects on α-glycosidase and α-amylase activities. Therefore, HEP-C extracted with citric acid can be developed as a potential bioactive ingredient for applications in food, medicine, and cosmetics industries. Copyright © 2018 Elsevier Ltd. All rights reserved.
Is torrefaction of polysaccharides-rich biomass equivalent to carbonization of lignin-rich biomass?
Bilgic, E; Yaman, S; Haykiri-Acma, H; Kucukbayrak, S
2016-01-01
Waste biomass species such as lignin-rich hazelnut shell (HS) and polysaccharides-rich sunflower seed shell (SSS) were subjected to torrefaction at 300°C and carbonization at 600°C under nitrogen. The structural variations in torrefied and carbonized biomasses were compared. Also, the burning characteristics under dry air and pure oxygen (oxy-combustion) conditions were investigated. It was concluded that the effects of carbonization on HS are almost comparable with the effects of torrefaction on SSS in terms of devolatilization and deoxygenation potentials and the increases in carbon content and the heating value. Consequently, it can be proposed that torrefaction does not provide efficient devolatilization from the lignin-rich biomass while it is relatively more efficient for polysaccharides-rich biomass. Heat-induced variations in biomass led to significant changes in the burning characteristics under both burning conditions. That is, low temperature reactivity of biomass reduced considerably and the burning shifted to higher temperatures with very high burning rates. Copyright © 2015 Elsevier Ltd. All rights reserved.
S, Preethi; A, Mary Saral
2016-11-01
Polysaccharides were extracted from the dried fruiting bodies of Pithecellobium dulce with 20% ethanol by microwave-assisted extraction. The polysaccharides were isolated by ion exchange chromatography and afford three water-soluble polysaccharides PDP-1, PDP-2, and PDP-3. These isolated compounds were subjected to acid hydrolysis, methylation, IR and GC-MS for its compositional analysis and revealed that all the three fractions are heteropolysaccharides. PDP-1 was found to be composed of xylose, mannose, galactose and Rhamnose. PDP-2 and PDP-3 composed of xylose, Rhamnose, glucose, ribose, galactose, and mannose. The micromeretic properties of the extracted polysaccharides possessed a bulk density of 0.69g/ml, 0.65g/ml and 0.71g/ml for PDP-1, PDP-2, and PDP-3 respectively. The Hausner's ratio and Carr's index confirm the good flow property and compressibility of the polysaccharides. The polysaccharides extracted from Pithecellobium dulce fruits were tested for its application as a pharmaceutical adjuvant. The in vitro drug release study suggests that the extracted polysaccharides are potential candidates as a pharmaceutical adjuvant. Furthermore, the three isolated polysaccharides were subjected to its radical scavenging activity using DPPH, phospho molybdenum assay and reducing power assay. The results exhibited that the polysaccharides can be explored as a novel natural antioxidant and can be recommended as a functional food. Copyright © 2016 Elsevier B.V. All rights reserved.
Histoplasma capsulatum α-(1,3)-glucan blocks innate immune recognition by the β-glucan receptor
Rappleye, Chad A.; Eissenberg, Linda Groppe; Goldman, William E.
2007-01-01
Successful infection by fungal pathogens depends on subversion of host immune mechanisms that detect conserved cell wall components such as β-glucans. A less common polysaccharide, α-(1,3)-glucan, is a cell wall constituent of most fungal respiratory pathogens and has been correlated with pathogenicity or linked directly to virulence. However, the precise mechanism by which α-(1,3)-glucan promotes fungal virulence is unknown. Here, we show that α-(1,3)-glucan is present in the outermost layer of the Histoplasma capsulatum yeast cell wall and contributes to pathogenesis by concealing immunostimulatory β-glucans from detection by host phagocytic cells. Production of proinflammatory TNFα by phagocytes was suppressed either by the presence of the α-(1,3)-glucan layer on yeast cells or by RNA interference based depletion of the host β-glucan receptor dectin-1. Thus, we have functionally defined key molecular components influencing the initial host–pathogen interaction in histoplasmosis and have revealed an important mechanism by which H. capsulatum thwarts the host immune system. Furthermore, we propose that the degree of this evasion contributes to the difference in pathogenic potential between dimorphic fungal pathogens and opportunistic fungi. PMID:17227865
Li, Yan; Fan, Yihui; Pan, Haiou; Qian, Haifeng; Qi, Xiguang; Wu, Gangcheng; Zhang, Hui; Xu, Meijuan; Rao, Zhiming; Wang, Li; Ying, Hao
2018-05-26
Skeletal muscles plays a crucial role in metabolism and exercise. Fuctional β-glucan is polysaccharide that is found in the cell walls of cereal, which is known to reduce cholesterol and lipid, prevent diabetes, cancer and cardiovascular diseases. In an attempt to identify β-glucan that could promote skeletal muscle function, we analyzed the proliferation, differentiation, metabolism and anti-fibrotic properties of β-glucan in C2C12 muscle cells. Treatment of β-glucan in C2C12 myoblasts led to increased proliferation and differentiation. Besides that, we found that C2C12 myotubes treated with β-glucan displayed a fast-to-slow muscle fiber conversion and improved oxidative metabolism. Further study revealed that β-glucan treatment could prevent myotubes from becoming myofibroblasts. Together, our study suggests that functional β-glucan might have a therapeutic potential to improve skeletal muscle function, which might contribute to the development of β-glucan. Copyright © 2018. Published by Elsevier B.V.
β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.
de Vries, Sonja; Gerrits, Walter J J; Kabel, Mirjam A; Vasanthan, Thava; Zijlstra, Ruurd T
2016-01-01
Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch) on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose) or corn distillers dried grain with solubles (DDGS; (glucurono)arabinoxylans and cellulose) with or without inclusion of β-glucans (6%) or retrograded tapioca (40%) substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg) were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD) of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction) from rapeseed meal (6%-units, P<0.001), but did not affect non-glucosyl polysaccharides from DDGS. Retrograded tapioca reduced ATTD of non-glucosyl polysaccharides from rapeseed meal and DDGS (>10%-units, P<0.001), indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.
β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs
Gerrits, Walter J. J.; Kabel, Mirjam A.; Vasanthan, Thava; Zijlstra, Ruurd T.
2016-01-01
Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch) on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose) or corn distillers dried grain with solubles (DDGS; (glucurono)arabinoxylans and cellulose) with or without inclusion of β-glucans (6%) or retrograded tapioca (40%) substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg) were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD) of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction) from rapeseed meal (6%-units, P<0.001), but did not affect non-glucosyl polysaccharides from DDGS. Retrograded tapioca reduced ATTD of non-glucosyl polysaccharides from rapeseed meal and DDGS (>10%-units, P<0.001), indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value. PMID:27911928
Zhang, Anqiang; Xiao, Nannan; He, Pengfei; Sun, Peilong
2011-12-01
Boletus edulis is a well-known delicious mushroom. In this study, three crude polysaccharides (BEPF30, BEPF60 and BEPF80) were isolated from the fruiting bodies of B. edulis with boiling water. Chemical and physical characteristics of the three crude polysaccharides were investigated by the combination of chemical and instrumental analysis methods. Their antioxidant activities were investigated in vitro systems including hydroxyl assay, superoxide radical assay, reducing power and chelating activity. Among these three polysaccharides, BEPF60 showed more significant reducing power and chelating activity; and highest inhibitory effects on superoxide radical and hydroxyl radical. These results indicated that polysaccharides extracted from B. edulis might be employed as ingredients in healthy and functional food to alleviate the oxidative stress. Copyright © 2011 Elsevier B.V. All rights reserved.
Pakrokh Ghavi, Peyman
2015-04-01
Response surface methodology (RSM) with a central composite rotatable design (CCRD) based on five levels was employed to model and optimize four experimental operating conditions of extraction temperature (10-90 °C) and time (6-30 h), particle size (6-24 mm) and water to solid (W/S, 10-50) ratio, obtaining polysaccharides from Althaea officinalis roots with high yield and antioxidant activity. For each response, a second-order polynomial model with high R(2) values (> 0.966) was developed using multiple linear regression analysis. Results showed that the most significant (P < 0.05) extraction conditions that affect the yield and antioxidant activity of extracted polysaccharides were the main effect of extraction temperature and the interaction effect of the particle size and W/S ratio. The optimum conditions to maximize yield (10.80%) and antioxidant activity (84.09%) for polysaccharides extraction from A. officinalis roots were extraction temperature 60.90 °C, extraction time 12.01 h, particle size 12.0mm and W/S ratio of 40.0. The experimental values were found to be in agreement with those predicted, indicating the models suitability for optimizing the polysaccharides extraction conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
You, Qinghong; Yin, Xiulian; Ji, Chaowen
2014-01-30
Four methods for extracting polysaccharides from Boletus edulis, namely, hot-water extraction, ultrasonic clearer extraction, static probe ultrasonic extraction, and pulsed counter-current probe ultrasonic extraction (CCPUE), were studied. Results showed that CCPUE has the highest extraction efficiency among the methods studied. Under optimal CCPUE conditions, a B. edulis polysaccharide (BEP) yield of 8.21% was obtained. Three purified fractions, BEP-I, BEP-II, and BEP-III, were obtained through sequential purification by DEAE-52 and Sephadex G-75 chromatography. The average molecular weights of BEP-I, BEP-II, and BEP-III were 10,278, 23,761, and 42,736 Da, respectively. The polysaccharides were mainly composed of xylose, mannose, galactose, and glucose; of these, mannose contents were the highest. The antioxidant activities of the BEPs were further investigated by measurement of their ability to scavenge DPPH and hydroxyl radicals as well as their reducing power. The results indicated that the BEPs have good antioxidant activity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Ultrasound assisted extraction of polysaccharides from hazelnut skin.
Yılmaz, Tuncay; Tavman, Şebnem
2016-03-01
In this study ultrasound assisted extraction (UAE) of polysaccharides from hazelnut skin has been studied. Optimum sonication time has been evaluated depending on responses such as amount of carbohydrate and dried sample and thermogravimetric analysis. Chemical and structural properties of extracted material have been determined by Fourier transform spectroscopy attenuated-total reflectance (FTIR-ATR) spectroscopy. Pretreated hazelnut skin powders were extracted in distilled water. Mixture was sonicated by ultrasonic processor probe for 15, 30, 45, 60, 90, and 120 min. The results of UAE showed that maximum ethanol insoluble extracts in 60 min and the highest dry matter content could be obtained in 120 min extraction. Although total carbohydrate content of ethanol insoluble dry extract decreased with time, total carbohydrate in ethanol soluble fraction increased. Polysaccharides extracted from hazelnut skin were assumed to be pectic polysaccharide according to the literature survey of FTIR analysis result. Application time of UAE has an important effect on extraction of polysaccharide from hazelnut skin. This affect could be summarized by enhancing extraction yield up to critical level. Decrease of the yield in ethanol insoluble part could be explained by polymer decomposition. Most suitable model was hyperbolic model by having the lowest root mean square error and the highest R(2) values. © The Author(s) 2015.
USDA-ARS?s Scientific Manuscript database
Glucansucrases catalyze the transfer of D-glucopyranosyl units from sucrose to form a-glucan chains. Glucansucrases are capable of catalyzing the synthesis of several different a-glucosidic linkages that affect molecular mass, branching, and solubility of the polysaccharide. In general, a-glucans co...
NASA Astrophysics Data System (ADS)
Thao, Cao Phuong; Tien, Le Thi Thuy
2017-09-01
β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.
Effect of natural flocculants on purity and properties of β-glucan extracted from barley and oat.
Kurek, Marcin Andrzej; Karp, Sabina; Stelmasiak, Adrian; Pieczykolan, Ewelina; Juszczyk, Karolina; Rieder, Anne
2018-05-15
In this study, β-glucan was extracted from wholegrain oat and barley flours by a novel extraction and purification method employing natural flocculants (chitosan, guar gum and gelatin). The use of flocculants decreased the total amount of extracted gum, which was highest in control samples (9.07 and 7.9% for oat and barley, respectively). The β-glucan specific yield, however, increased with the use of chitosan and guar gum, which were able to remove protein and ash impurities resulting in gums with a higher purity.The highest concentration of chitosan (0.6 %) resulted in gums with the highest β-glucan content (82.0 ± 0.23 and 79.0 ± 0.19 for barley and oat, respectively) and highest β-glucan specific yield (96.9 and 93.3 % for oat and barley, respectively). Explanation is in R&D section. The use of gelatin was not successful. All gum samples had a high content of total dietary fiber (>74%) and a high water holding capacity (4.6-7.4 g/g), but differed in apparent viscosity, which was highest for the oat sample extracted with 0.6% chitosan. This sample also showed the highest β-glucan molecular weight among the oat samples, which were in general 10-fold higher than for the barley samples. Among the barley samples, β-glucan molecular weight was highest for the control. Copyright © 2018 Elsevier Ltd. All rights reserved.
Zhang, Lijin; Wang, Maoshan
2017-02-01
In this study, deep eutectic solvents were proposed for the ultrasound-assisted extraction of polysaccharides from Dioscorea opposita Thunb. Several deep eutectic solvents were prepared for the extraction of polysaccharides, among which the deep eutectic solvent composed of choline chloride and 1,4-butanediol was proved to be suitable for the extraction. Based on the screening of single-factor experiment design and orthogonal experiment design, three experimental factors were optimized for the Box-Behnken experimental design combined with response surface methodology, which gave the optimal extraction conditions: water content of 32.89%(v/v), extraction temperature of 94.00°C, and the extraction time of 44.74min. The optimal extraction conditions could supply higher extraction yield than those of hot water extraction and water-based ultrasound-assisted extraction. Therefore, deep eutectic solvents were an excellent extraction solvent alternative to the extraction of polysaccharides from sample matrices. Copyright © 2016 Elsevier B.V. All rights reserved.
Oliveira, Rodrigo Juliano; Pesarini, João Renato; Sparça Salles, Maria José; Nakamura Kanno, Tatiane Yumi; dos Santos Lourenço, Ana Carolina; da Silva Leite, Véssia; da Silva, Ariane Fernanda; Matiazi, Hevenilton José; Ribeiro, Lúcia Regina; Mantovani, Mário Sérgio
2014-01-01
β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63–116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20–52.54% and −0.95–62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide. PMID:24688298
Oliveira, Rodrigo Juliano; Pesarini, João Renato; Sparça Salles, Maria José; Nakamura Kanno, Tatiane Yumi; Dos Santos Lourenço, Ana Carolina; da Silva Leite, Véssia; da Silva, Ariane Fernanda; Matiazi, Hevenilton José; Ribeiro, Lúcia Regina; Mantovani, Mário Sérgio
2014-03-01
β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.
Chen, Yong; Yin, Luoyi; Zhang, Xuejiao; Wang, Yan; Chen, Qiuzhi; Jin, Chenzhong; Wang, Jihua
2014-01-01
The present study is to explore the optimal extraction parameters, antioxidant activity, and antimicrobial activity of alkaline soluble polysaccharides from rhizome of Polygonatum odoratum. The optimal extraction parameters were determined as the following: NaOH concentration (A) 0.3 M, temperature (B) 80°C, ratio of NaOH to solid (C) 10-fold, and extraction time (D) 4 h, in which ratio of NaOH to solid was a key factor. The order of the factors was ratio of NaOH to solid (fold, C) > extraction temperature (°C, B) > NaOH concentration (M, A) > extraction time (h, D). The monosaccharide compositions of polysaccharides from P. odoratum were rhamnose, mannose, xylose, and arabinose with the molecular ratio of 31.78, 31.89, 11.11, and 1.00, respectively. The reducing power, the 1, 1-diphenyl-2-picryl-hydrazil (DPPH) radical scavenging rate, the hydroxyl radicals scavenging rate, and the inhibition rate to polyunsaturated fatty acid (PUFA) peroxidation of the alkaline soluble polysaccharides from P. odoratum at 1 mg/mL were 9.81%, 52.84%, 19.22%, and 19.42% of ascorbic acid at the same concentration, respectively. They also showed antimicrobial activity against pathogenic bacteria Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, and Escherichia coli. PMID:25093173
Ho, Hoang V T; Sievenpiper, John L; Zurbau, Andreea; Blanco Mejia, Sonia; Jovanovski, Elena; Au-Yeung, Fei; Jenkins, Alexandra L; Vuksan, Vladimir
2016-10-01
Oats are a rich source of β-glucan, a viscous, soluble fibre recognised for its cholesterol-lowering properties, and are associated with reduced risk of CVD. Our objective was to conduct a systematic review and meta-analysis of randomised-controlled trials (RCT) investigating the cholesterol-lowering potential of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for the risk reduction of CVD. MEDLINE, Embase, CINAHL and Cochrane CENTRAL were searched. We included RCT of ≥3 weeks of follow-up, assessing the effect of diets enriched with oat β-glucan compared with controlled diets on LDL-cholesterol, non-HDL-cholesterol or apoB. Two independent reviewers extracted data and assessed study quality and risk of bias. Data were pooled using the generic inverse-variance method with random effects models and expressed as mean differences with 95 % CI. Heterogeneity was assessed by the Cochran's Q statistic and quantified by the I 2-statistic. In total, fifty-eight trials (n 3974) were included. A median dose of 3·5 g/d of oat β-glucan significantly lowered LDL-cholesterol (-0·19; 95 % CI -0·23, -0·14 mmol/l, P<0·00001), non-HDL-cholesterol (-0·20; 95 % CI -0·26, -0·15 mmol/l, P<0·00001) and apoB (-0·03; 95 % CI -0·05, -0·02 g/l, P<0·0001) compared with control interventions. There was evidence for considerable unexplained heterogeneity in the analysis of LDL-cholesterol (I 2=79 %) and non-HDL-cholesterol (I 2=99 %). Pooled analyses showed that oat β-glucan has a lowering effect on LDL-cholesterol, non-HDL-cholesterol and apoB. Inclusion of oat-containing foods may be a strategy for achieving targets in CVD reduction.
Bioactive polysaccharides and gut microbiome (abstract)
USDA-ARS?s Scientific Manuscript database
Many polysaccharides have shown the ability to reduce plasma cholesterol or postprandial glycemia. Viscosity in the small intestine seems to be required to slow glucose uptake. Cereal mixed linkage beta-glucans, psyllium, glucomannans, and other polysaccharides also seem to require higher molecula...
Zhang, Yi; Wang, Hongxin; Wang, Peng; Ma, ChaoYang; He, GuoHua; Rahman, Md Ramim Tanver
2016-11-01
Polyethylene glycol (PEG) as a green solvent was employed to extract polysaccharide. The optimal conditions for PEG-based ultrasonic extraction of Dendrobium nobile Lindl. polysaccharide (JCP) were determined by response surface methodology. Under the optimal conditions: extraction temperature of 58.5°C; ultrasound power of 193W, and the concentration of polyethylene glycol-200 (PEG-200) solution of 45%, the highest JCP yield was obtained as 15.23±0.57%, which was close to the predicted yield, 15.57%. UV and FT-IR analysis revealed the general characteristic absorption peaks of both JCP with water extraction (JCP w ) and PEG-200 solvent extraction (JCP p ). Thermal analysis of both JCPs was performed with Thermal Gravimetric Analyzer (TGA) and Differential Scanning Calorimeter (DSC). Antioxidant activities of two polysaccharides were also compared and no significant difference in vitro was obtained. Copyright © 2016 Elsevier B.V. All rights reserved.
(1-->6)-beta-D-glucan as cell wall receptor for Pichia membranifaciens killer toxin.
Santos, A; Marquina, D; Leal, J A; Peinado, J M
2000-05-01
The killer toxin from Pichia membranifaciens CYC 1106, a yeast isolated from fermenting olive brines, binds primarily to the (1-->6)-beta-D-glucan of the cell wall of a sensitive yeast (Candida boidinii IGC 3430). The (1-->6)-beta-D-glucan was purified from cell walls of C. boidinii by alkali and hot-acetic acid extraction, a procedure which solubilizes glucans. The major fraction of receptor activity remained with the alkali-insoluble (1-->6)-beta- and (1-->3)-beta-D-glucans. The chemical (gas-liquid chromatography) and structural (periodate oxidation, infrared spectroscopy, and (1)H nuclear magnetic resonance) analyses of the fractions obtained showed that (1-->6)-beta-D-glucan was a receptor. Adsorption of most of the killer toxin to the (1-->6)-beta-D-glucan was complete within 2 min. Killer toxin adsorption to the linear (1-->6)-beta-D-glucan, pustulan, and a glucan from Penicillium allahabadense was observed. Other polysaccharides with different linkages failed to bind the killer toxin. The specificity of the killer toxin for its primary receptor provides an effective means to purify the killer toxin, which may have industrial applications for fermentations in which salt is present as an adjunct, such as olive brines. This toxin shows its maximum killer activity in the presence of NaCl. This report is the first to identify the (1-->6)-beta-D-glucan as a receptor for this novel toxin.
Yakushiji, T; Inoue, M; Koga, T
1984-04-15
The biochemical and morphological characteristics of polysaccharides synthesized from sucrose by extracellular enzymes from D-glucose-grown Streptococcus mutans representing serotypes a-g were compared. The polysaccharides synthesized by the enzymes from serotypes a, d, and g formed visible aggregates and firmly adhered to glass surfaces, whereas those formed by the enzymes from serotypes b, c, e, and f floated homogeneously and were poorly adherent. The enzymes of serotypes a, d, and g produced large amounts of water-insoluble polysaccharides (IPs, D-glucans), and those of serotypes b, c, e, and f water-soluble polysaccharides (SPs, D-glucans and D- fructans ). As compared with the IPs of serotypes b, c, e, and f, the IPs of serotypes a, d, and g (a) contained a higher proportion of (1----3)-alpha-D-glucosidic linkages and alpha-D-(1----3,6) branch linkages; (b) showed higher susceptibility to (1----3)-alpha-D-glucanase (serotype a excepted) and lower (1----6)-alpha-D-glucanase sensitivity; (c) contained larger amounts of high-molecular-weight fractions; (d) showed higher intrinsic viscosities (serotype b excepted); and (e) had lower S. mutans cell-agglutination activities. On electron-microscope observation, the IPs of all serotypes showed two fibrillar components; a double-stranded fibril, with short, fluffy protrusions extending out of its periphery, and a fine, single-stranded fibril. Thus, the serotypes could be divided into two major groups: a, d, and g; and b, c, e, and f. No similar grouping of serotypes was indicated by the chemical and morphological properties of SPs.
Effect of β-glucan on MUC4 and MUC5B expression in human airway epithelial cells.
Kim, Yong-Dae; Bae, Chang Hoon; Song, Si-Youn; Choi, Yoon Seok
2015-08-01
β-Glucan is found in the cell walls of fungi, bacteria, and some plant tissues, and is detected by the innate immune system. Furthermore, this recognition is known to worsen respiratory symptoms in patients with allergic and inflammatory airway diseases. However, the means by which β-glucan affects the secretion of major mucins by human airway epithelial cells has not been elucidated. Therefore, in this study, the effect and signaling pathway of β-glucan on mucins MUC4 and MUC5B were investigated in human airway epithelial cells. In NCI-H292 cells and human normal nasal epithelial cells, the effect and signaling pathway of β-glucan on MUC4 and MUC5B expression were investigated using reverse transcriptase-polymerase chain reaction (RT-PCR), real-time PCR, enzyme immunoassay, and immunoblot analysis with specific inhibitors and small interfering RNA (siRNA). β-Glucan increased MUC4 and MUC5B expression and activated the phosphorylation of p38 mitogen-activated protein kinase (MAPK) and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). SB203580 (a p38 MAPK inhibitor) and pyrrolidine dithiocarbamate (PDTC; a NF-κB inhibitor) inhibited β-glucan-induced MUC4 and MUC5B expression. In addition, siRNA knockdown of p38 MAPK blocked β-glucan-induced MUC4 and MUC5B mRNA expression and β-glucan-activated phosphorylation of NF-κB. Furthermore, Toll-like receptor 4 (TLR4) mRNA expression was increased by β-glucan, and siRNA knockdown of TLR4 blocked β-glucan-induced MUC4 and MUC5B mRNA expression and β-glucan-activated phosphorylation of p38 MAPK and NF-κB. These results demonstrate that in human airway epithelial cells β-glucan induces MUC4 and MUC5B expression via the TLR4-p38 MAPK-NF-κB signaling pathway. © 2015 ARS-AAOA, LLC.
Hida, Toshie H; Kawaminami, Hiromi; Ishibashi, Ken-Ichi; Miura, Noriko N; Adachi, Yoshiyuki; Ohno, Naohito
2013-01-01
Soluble β-glucan preparation from the cold NaOH extract of Sparassis crispa (SCG) is a six-branched 1,3-β-D-glucan that is a major cell-wall structural component in fungi. Leukocytes from DBA/2 mice are highly sensitive to SCG, producing cytokines in vitro. We previously reported that the intraperitoneal (i.p.) administration of β-glucan decreased cytokine induction by SCG in vitro in DBA/2 mice. In this study, we examined the effects of the oral (p.o.) administration of polysaccharide fractions extracted from S. crispa, using hot water (SCHWE), a β-glucan from S. crispa, to DBA/2 mice on cytokine induction by SCG in the spleen in vitro. The level of induction of IFN-γ and GM-CSF by SCG was significantly increased in SCHWE-treated mice. This activity was more clearly observed when chlorpromazine was administered as a pretreatment in SCHWE-treated mice. The production of GM-CSF, IFN-γ, and IL-6 by immune cells in Peyer's patches was higher in SCHWE-treated mice than in control mice. These results suggest that orally administered β-glucan may modulate cytokine induction by SCG in the spleen through the activation of Peyer's patches.
Cheng, Zhenyu; Yang, Yingjie; Liu, Yan; Liu, Zhigang; Zhou, Hongli; Hu, Haobin
2014-08-05
A method for two-steps extraction of essential oil, polysaccharides and lignans from Schisandra chinensis Baill had been established. Firstly, S. chinensis was extracted by hydro-distillation, the extracted solution was separated from the water-insoluble residue and precipitated by adding dehydrated alcohol after the essential oil was collected, and then the precipitate as polysaccharide was collected. Finally, second extraction was performed to obtained lignans from the water-insoluble residue with ultrasonic-microwave assisted extraction (UMAE) method. Response surface methodology was employed to optimize the UMAE parameters, the optimal conditions were as follows: microwave power 430W, ethanol concentration 84%, particle size of sample 120-mesh sieves, ratio of water to raw material 15 and extraction time 2.1min. Under these optimized conditions, the total extraction yields of five lignans (Schisandrol A, Schisantherin A, Deoxyschisandrin, Schisandrin B and Schisandrin C) had reached 14.22±0.135mg/g. Compared with the traditional method of direct extraction of different bioactive components in respective procedure, the extraction yields of polysaccharides and the five lignans had reached 99% and 95%, respectively. The mean recoveries of the 5 lignan compounds and polysaccharides were 97.75-101.08% and their RSD value was less than 3.88%.The approach proposed in this study not only improved the extraction yield of lignans, but also elevated the utilization of Schisandra resources. Copyright © 2014 Elsevier B.V. All rights reserved.
Cao, Yin-Guang; Hao, Yu; Li, Zhi-Hui; Liu, Shun-Tao; Wang, Le-Xin
2016-12-01
This study was designed to investigate the inhibition activity of polysaccharide extract from Laminaria japonica against RSV. The polysaccharide from Laminaria japonica was isolated by ethanol precipitation. HEK293 cells were infected with RVS, and the antiviral activity of polysaccharide extract against RSV in host cells was tested. By using ELISA and western blot assay, the expression level of IFN-α and IRF3 and their functional roles in polysaccharide-mediated antiviral activity against RSV were investigated. The polysaccharide extract from Laminaria japonica had low toxicity to HEK293 cell. The TC50 to HEK293 cells was up to 1.76mg/mL. Furthermore, the EC50 of polysaccharide extract to RSV was 5.27μg/mL, and TI was 334. The polysaccharide extract improved IRF-3 expression which promoted the level of IFN-α. Polysaccharide extract from Laminaria japonica elicits antiviral activity against RSV by up-regulation of IRF3 signaling-mediated IFN-α production. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Tian, Suyang; Hao, Changchun; Xu, Guangkuan; Yang, Juanjuan; Sun, Runguang
2017-10-01
In this study, polysaccharides from Angelica sinensis were extracted using the ultrasound-assisted extraction method. Based on the results of single factor experiments and orthogonal tests, three independent variables-water/raw material ratio, ultrasound time, and ultrasound power-were selected for investigation. Then, we used response surface methodology to optimize the extraction conditions. The experimental data were fitted to a quadratic equation using multiple regression analysis, and the optimal conditions were as follows: water/raw material ratio, 43.31 mL/g; ultrasonic time, 28.06 minutes; power, 396.83 W. Under such conditions, the polysaccharide yield was 21.89±0.21%, which was well matched with the predicted yield. In vitro assays, scavenging activity of superoxide anion radicals, hydroxyl radicals, and 2,2-diphenyl-1-picry-hydrazyl radical showed that polysaccharides had certain antioxidant activities and that hydroxyl radicals have a remarkable scavenging capability. Therefore, these studies provide reference for further research and rational development of A. sinensis polysaccharide. Copyright © 2016. Published by Elsevier B.V.
Yin, Xiulian; You, Qinghong; Jiang, Zhonghai; Zhou, Xinghai
2016-02-01
Ultrasonic-microwave synergistic extraction (UMSE) of polysaccharides from Cornus officinalis was optimized by response surface methodology (RSM). The effect of four different factors on the yield of C. officinalis polysaccharides (COP) was studied. RSM results showed that the optimal conditions were extraction time of 31.49823 min, microwave power of 99.39769 W, and water-to-raw material ratio of 28.16273. The COP yield was 11.38±0.31% using the modified optimal conditions, which was consistent with the value predicted by the model. The crude COP was purified by DEAE-Cellulose 52 chromatography and Sephadex G-100 chromatography. Five fractions, namely, crude COP, COP-1, COP-2, COP-3, and COP-4, were obtained. Monosaccharide composition analysis revealed that the COP was composed of glucose, arabinose, fucose, xylose, mannose, and rhamnose. Preliminary structural characterizations of COP were conducted by scanning electron microscopy and Fourier transform infrared spectroscopy. Copyright © 2015 Elsevier B.V. All rights reserved.
Optimized extraction of polysaccharides from Cymbopogon citratus and its biological activities.
Thangam, Ramar; Suresh, Veeraperumal; Kannan, Soundarapandian
2014-04-01
In this study the extraction of hot water soluble polysaccharides (HWSPs) from Cymbopogon citratus using hot water decoction was discussed. Response surface methodology (RSM) based on a three level, three variable central composite rotatable design (CCRD), was employed to obtain best possible combination of extraction time (X1: 30-180 min), extraction temperature (X2: 70-100 °C) and water to the raw material ratio (X3: 10-60) for maximum HWSPs extraction. The optimum extraction conditions were as follows: extraction time was around 113.81 min, extraction temperature at 99.66 °C and the ratio of water to raw material was 33.11 g/mL. Under these conditions, the experimental yield was 13.24±0.23%, which is well in close agreement with the value predicted by RSM model yield (13.19%). The basic characterization of HWSPs was determined by using the FTIR. These preliminary in vitro biological studies indicated that lemongrass polysaccharides were useful for anticancer therapy. Copyright © 2014 Elsevier B.V. All rights reserved.
Ray, Bimalendu; Hutterer, Corina; Bandyopadhyay, Shruti S; Ghosh, Kanika; Chatterjee, Udipta R; Ray, Sayani; Zeitträger, Isabel; Wagner, Sabrina; Marschall, Manfred
2013-12-27
Attachment and entry of many viruses are mediated by their affinity for polysaccharides present on the surface of target cells. In this paper, we demonstrate that sulfated glucans isolated from rice (Oryza sativa) can be utilized as experimental drugs exerting strong antiviral activity. In particular, oleum-DMF-based extraction is described as a procedure for the generation of chemically engineered glucans from commercially available rice bran. The one-step procedure has the potential to provide a spectrum of related glucans with varying molecular masses and modifications, including sulfation. The sulfated glucans P444, P445, and P446 possess increased antiviral activity compared to a previously described glucan (S1G). P444, P445, and P446 were highly active against human cytomegalovirus (HCMV), moderately active against other members of the family Herpesviridae, while not active against unrelated viruses. Specific experimentation with HCMV-infected cells provided evidence that antiviral activity was based on inhibition of viral entry and that inhibition occurred in the absence of drug-induced cytotoxicity. These findings underline the high potential of sulfated glucans for antiviral research and drug development. In addition, the procedure described for the efficient transformation of glucan hydroxy groups to sulfate groups may be similarly beneficial for the chemical alteration of other natural products.
Wilson, Sarah M.; Ho, Yin Ying; Lampugnani, Edwin R.; Van de Meene, Allison M.L.; Bain, Melissa P.; Bacic, Antony; Doblin, Monika S.
2015-01-01
The current dogma for cell wall polysaccharide biosynthesis is that cellulose (and callose) is synthesized at the plasma membrane (PM), whereas matrix phase polysaccharides are assembled in the Golgi apparatus. We provide evidence that (1,3;1,4)-β-d-glucan (mixed-linkage glucan [MLG]) does not conform to this paradigm. We show in various grass (Poaceae) species that MLG-specific antibody labeling is present in the wall but absent over Golgi, suggesting it is assembled at the PM. Antibodies to the MLG synthases, cellulose synthase-like F6 (CSLF6) and CSLH1, located CSLF6 to the endoplasmic reticulum, Golgi, secretory vesicles, and the PM and CSLH1 to the same locations apart from the PM. This pattern was recreated upon expression of VENUS-tagged barley (Hordeum vulgare) CSLF6 and CSLH1 in Nicotiana benthamiana leaves and, consistent with our biochemical analyses of native grass tissues, shown to be catalytically active with CSLF6 and CSLH1 in PM-enriched and PM-depleted membrane fractions, respectively. These data support a PM location for the synthesis of MLG by CSLF6, the predominant enzymatically active isoform. A model is proposed to guide future experimental approaches to dissect the molecular mechanism(s) of MLG assembly. PMID:25770111
USDA-ARS?s Scientific Manuscript database
Nutrim-10 is a newly developed food product containing the dietary of soluble fiber ß-glucan. The micro-structural heterogeneities of Nutrim-10 suspensions were investigated by monitoring the thermally driven displacements of well-dispersed microspheres via video fluorescence microscopy. By comparin...
Characterization of pectic polysaccharides extracted from apple pomace by hot-compressed water.
Wang, Xin; Lü, Xin
2014-02-15
Response surface methodology (RSM) was used to optimize the extraction of pectic polysaccharides from apple pomace by hot-compressed water, by which the optimum levels of the parameters were obtained as follows: extraction temperature 140 °C, extraction time 5 min, S:W ratio 1:14. Compared with commercial pectin, the Mw, galacturonic acid content, DM and protein of the extracted pectic polysaccharides were lower while ash content and neutral sugars were higher. The endothermic transition temperature and fusion heat of the extracted pectic polysaccharides was lower than commercial one according to DSC analysis. For its rheological properties, it was found that the viscosity of the extracted pectic polysaccharides solution was slightly lower than commercial pectin at lower shear rate region while it decreased sharply when the shear rate increased. Besides, both G' and G" moduli of the extracted pectic polysaccharides were lower than the commercial pectin's possibly because of weaker polymer chain interaction, which was also reflected in gel textural properties. However, the extracted pectic polysaccharides showed higher in vitro antioxidant capability and inhibitory effect on HT-29 colon adenocarcinoma cells than commercial pectin. Copyright © 2013 Elsevier Ltd. All rights reserved.
Xylose-rich polysaccharides from the primary walls of embryogenic cell line of Pinus caribaea.
Mollard, A; Domon, J M; David, H; Joseleau, J P
1997-08-01
Embryogenic cell lines of Pinus caribaea were isolated from somatic embryogenesis from zygotic embryos. Previous studies showed that the proteins and glycoproteins were characteristic of the embryogenic state. In the present work we were seeking typical feature in the polysaccharide from the cell walls of embryogenic calli at nine days of culture. Sequential extraction with water, ammonium oxalate, dimethyl sulfoxide, sodium borohydride and 4.3 M potassium hydroxide revealed that the extracted polysaccharides contained high proportions of arabinose and significant amounts of xylose. Fractionation of the hydrosoluble polymers on DEAE cellulose afforded a xylose-rich fraction (80% xylose, 24% glucose and lower properties of fucose and mannose). Methylation analysis and 13C-NMR spectra showed that the glycan backbone consisted of beta 1 --> 4 linked xylosyl residues Similar study of the fractions extracted respectively with DMSO and 4.3 M KOH showed the presence of polydisperse glycoxylans but excluded the presence of xyloglucan in significant amount. This could be a characteristic feature of embryogenic cells walls of Pinus caribaea or could be typical of cells grown as calluses. In the various fractions obtained from DEAE cellulose chromatography of the alkaline extract the infrequent occurrence of fucoxylans beside an arabinogalactan showed again the unusual nature of the cell wall polymers of this embryogenic lines, which seems to differ greatly from those found in the primary wall of cells from suspension cultures.
Romdhane, Molka Ben; Haddar, Anissa; Ghazala, Imen; Jeddou, Khawla Ben; Helbert, Claire Boisset; Ellouz-Chaabouni, Semia
2017-02-01
In the present work, optimization of hot water extraction, structural characteristics, functional properties, and biological activities of polysaccharides extracted from watermelon rinds (WMRP) were investigated. The physicochemical characteristics and the monosaccharide composition of these polysaccharides were then determined using chemical composition analysis, Fourier transform infrared (FT-IR) spectroscopy, scanning electron microscopy (SEM) and gas chromatography-flame ionization detection (GC-FID). SEM images showed that extracted polysaccharides had a rough surface with many cavities. GC-FID results proved that galactose was the dominant sugar in the extracted polysaccharides, followed by arabinose, glucose, galacturonic acid, rhamnose, mannose, xylose and traces of glucuronic acid. The findings revealed that WMRP displayed excellent antihypertensive and antioxidant activities. Those polysaccharides had also a protection effect against hydroxyl radical-induced DNA damage. Functional properties of extracted polysaccharides were also evaluated. WMRP showed good interfacial dose-dependent proprieties. Overall, the results suggested that WMRP presents a promising natural source of antioxidants and antihypertensive agents. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zheng, Quan; Ren, Daoyuan; Yang, Nana; Yang, Xingbin
2016-10-01
Artemisia sphaerocephala Krasch seeds polysaccharides have been reported to have a variety of important biological activities. However, effective extraction of Artemisia sphaerocephala Krasch seeds polysaccharides is still an unsolved issue. In this study, the orthogonal rotatable central composite design was employed to optimize ultrasound-assisted extraction conditions of Artemisia sphaerocephala Krasch seeds polysaccharides. Based on a single-factor analysis method, ultrasonic power, extraction time, solid-liquid ratio and extraction temperature were shown to significantly affect the yield of polysaccharides extracted from the A. sphaerocephala Krasch seeds. The optimal conditions for extraction of Artemisia sphaerocephala Krasch seeds polysaccharides were determined as following: ultrasonic power 243W, extraction time 125min, solid-liquid ratio 64:1 and extraction temperature 64°C, where the experimental yield was 14.78%, which was well matched with the predicted value of 14.81%. Furthermore, ASKP was identified as a typical heteropolysaccharide with d-galacturonic acid (38.8%) d-galactose (20.2%) and d-xylose (15.5%) being the main constitutive monosaccharides. Moreover, Artemisia sphaerocephala Krasch seeds polysaccharides exhibited high total reducing power and considerable scavenging activities on DPPH, hydroxyl and superoxide radicals, in a concentration-dependent manner in vitro. Copyright © 2016 Elsevier B.V. All rights reserved.
Lai, Min-Nan; Ng, Lean Teik
2013-01-01
Culinary-medicinal honey mushroom or Mi-Huan-Ku, Armillaria mellea (AM), is a popular ingredient in the traditional Chinese medicine for treating diseases of geriatric patients. This study aimed to examine the effect of cultured substrates on the mycelial growth of AM and evaluate its antioxidant and antiedema activities as well as its total polysaccharide and polyphenol contents. Results showed that AM grew best on the maize medium and worst on the potato medium. AM ethanol extract (AM-EtOH) showed stronger DPPH radical scavenging activity than AM aqueous extract (AM-H₂O). However, they were weak in metal chelation and reducing power. AM-EtOH but not AM-H₂O at 200 mg/kg showed antiedema activity in rats. The total β-glucan content of AM-H₂O and AM-EtOH was 21.95% and 3.50%, respectively. AM-EtOH showed higher phenol but lower flavonoid content than AM-H₂O. These results indicate that maize is a good source of substrate for mass production of AM mycelia, and its potency of DPPH radical scavenging and antiedema activities was contributed mainly by the phenolic compounds, not the level of polysaccharide content.
Kurd, Forouzan; Samavati, Vahid
2015-03-01
Polysaccharides from Spirulina platensis algae (SP) were extracted by ultrasound-assisted extraction procedure. The optimal conditions for ultrasonic extraction of SP were determined by response surface methodology. The four parameters were, extraction time (X1), extraction temperature (X2), ultrasonic power (X3) and the ratio of water to raw material (X4), respectively. The experimental data obtained were fitted to a second-order polynomial equation. The optimum conditions were extraction time of 25 min, extraction temperature 85°C, ultrasonic power 90 W and ratio of water to raw material 20 mL/g. Under these optimal conditions, the experimental yield was 13.583±0.51%, well matched with the predicted models with the coefficients of determination (R2) of 0.9971. Then, we demonstrated that SP polysaccharides had strong scavenging activities in vitro on DPPH and hydroxyl radicals. Overall, SP may have potential applications in the medical and food industries. Copyright © 2015 Elsevier B.V. All rights reserved.
Characterization of EDTA-soluble polysaccharides from the scape of Musa paradisiaca (banana).
Raju, T S; Jagadish, R L; Anjaneyalu, Y V
2001-02-01
The polysaccharide components present in the scape of Musa paradisiaca (banana) were fractionated into water-soluble (WSP), EDTA-soluble (EDTA-SP), alkali-soluble (ASP) and alkali-insoluble (AISP) polysaccharide fractions [Anjaneyalu, Jagadish and Raju (1997) Glycoconj. J. 14, 507-512]. The EDTA-SP was further fractionated by iso-amyl alcohol into EDTA-SP-A and EDTA-SP-B. The homogeneity of these two polysaccharides was established by repeated precipitation with iso-amyl alcohol, gel-filtration chromatography and sedimentation analysis. The polysaccharides were characterized by monosaccharide composition analysis, methylation linkage analysis, iodine affinity, ferricyanide number, blue value, hydrolysis with alpha-amylase, gold-electron microscopy and X-ray diffraction spectroscopy. Data from all of these studies suggest that EDTA-SP-A is a branched amylose-type alpha-D-glucan and that EDTA-SP-B is a highly branched amylopectin-type polymer. The nature of the branching patterns of these polysaccharides suggests that they are unique to M. paradisiaca.
Bera, K; Nosalova, G; Sivova, V; Ray, B
2016-01-01
Zingiber officinale is used for the management of fever, bronchial asthma and cough for thousands of years. While the link to a particular indication has been established in human, the active principle of the formulation remains unknown. Herein, we have investigated a water extracted polysaccharides (WEP) containing fraction from its rhizome. Utilizing a traditional aqueous extraction protocol and using chemical, chromatographic and spectroscopic methods a fraction containing a branched glucan and polygalaturonan in a ratio of 59:1 was characterized. This glucan, which has a molecular mass of 36 kDa, is made up of terminal-, (1,4)- and (1,4,6)-linked α-Glcp residues. Oral administration of WEP in doses of 25 and 50 mg/kg body weight significantly inhibited the number of citric acid-induced cough efforts in guinea pigs. It does not alter the specific airway smooth muscle reactivity significantly. Thus, traditional aqueous extraction method provides molecular entities, which induces antitussive activity without addiction. Copyright © 2015 John Wiley & Sons, Ltd.
Lee, Chu-I; Wu, Chih-Chung; Hsieh, Shu-Ling; Lee, Chun-Lin; Chang, Yueh-Ping; Chang, Chih-Chuan; Wang, Yi-Zhen; Wang, Jyh-Jye
2014-12-01
Antrodia camphorata is a fungus native to Taiwan, and it is considered a precious medicinal agent. We analyzed triterpenoids, polysaccharides and 1,3-β-D-glucan, three major effective components in A. camphorata extracts (ACE). ACE exhibited a selective cytotoxic effect on BxPC-3 human pancreatic cancer cells. ACE markedly inhibited the migration ability of BxPC-3 cells. Treatment of BxPC-3 cells with ACE resulted in the increase of cells in the sub-G1 phase and G2/M phase arrest. Apoptosis was confirmed by validating phosphatidylserine externalization, the observation of characteristic chromatin condensation, and nuclear DNA fragmentation. ACE induced apoptosis in BxPC-3 cells through a mitochondria-dependent pathway by triggering an appropriate balance of bax/bcl-2, cytochrome c release, activation of caspase-9 and -3, and poly(ADP-ribose) polymerase cleavage. ACE shows great therapeutic potential due to its cytotoxic effects against BxPC-3 cells which include inhibiting cell migration and inducing mitochondria-mediated apoptosis.
Muramatsu, Daisuke; Okabe, Mitsuyasu; Takaoka, Akinori; Kida, Hiroshi; Iwai, Atsushi
2017-06-06
Black yeast, Aureobasidium pullulans is extracellularly produced β-(1,3), (1,6)-D-glucan (β-glucan) under certain conditions. In this study, using Glycine max cv. Kurosengoku (Kurosengoku soybeans), the production of β-glucan through fermentation of A. pullulans was evaluated, and the effects of A. pullulans cultured fluid (AP-CF) containing β-glucan made with Kurosengoku soybeans (kAP-CF) on a human monocyte derived cell line, Mono Mac 6 cells were investigated. Concentration of β-glucan in kAP-CF reached the same level as normal AP-CF. An anti-angiogenic protein, Thrombospondin-1 (THBS1) was effectively induced after the stimulation with kAP-CF for comparison with AP-CF. The THBS1 is also induced after stimulation with hot water extract of Kurosengoku soybeans (KS-E), while the combined stimulation of β-glucan with KS-E more effectively induced THBS1 than that with KS-E alone. These results suggest effects of A. pullulans-produced β-glucan on the enhancement of Kurosengoku soybean-induced THBS1 expression.
de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello
2017-12-20
A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5 Da with a random coil conformation for molecular weights below 1 × 10 6 Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.
A pH-responsive carboxylic β-1,3-glucan polysaccharide for complexation with polymeric guests.
Lien, Le Thi Ngoc; Shiraki, Tomohiro; Dawn, Arnab; Tsuchiya, Youichi; Tokunaga, Daisuke; Tamaru, Shun-ichi; Enomoto, Naoya; Hojo, Junichi; Shinkai, Seiji
2011-06-07
The helix-forming nature of β-1,3-glucan polysaccharides is a characteristic that has potential for producing gene carriers, bio-nanomaterials and other chiral nanowires. Herein, carboxylic curdlan (CurCOOH) bearing the β-1,3-polyglucuronic acid structure was successfully prepared from β-1,3-glucan polysaccharide curdlan (Cur) by one-step oxidation using a 4-acetamido-TEMPO/NaClO/NaClO(2) system as the oxidant. The resulting high-molecular-weight CurCOOH was proved to bear the 6-COOH group in 100% purity. The optical rotatory dispersion (ORD) spectra indicated that the obtained CurCOOH behaves as a water-soluble single-strand in various pH aqueous media. This advantage has allowed us to use CurCOOH as a polymeric host to form various macromolecular complexes. For example, complexation of CurCOOH with single-walled carbon nanotubes (SWNTs) resulted in a water-soluble one-dimensional architecture, which formed a dispersion in aqueous solution that was stable for several months, and much more stable than SWNTs complexes of the similar negatively-charged polyacrylic acid (PAA) and polymethacrylic acid (PMAA). It was shown that in the complex, SWNTs are effectively wrapped by a small amount of CurCOOH, enabling them to avoid electrostatic repulsion. This pH-responsive CurCOOH formed a very stable complex with cationic water-soluble polythiophenes (PT-1), which was stabilized not only by the hydrophobic interaction but also by the electrostatic attraction between trimethylammonium cations in PT-1 and dissociated anionic COO(-) groups in CurCOOH. The included PT-1 became CD-active only in the neutral to basic pH region, and the positive Cotton effect suggested that the conjugated main chain is twisted in the right-handed direction. We also found that CurCOOH can interact with polycytidylic acid (poly(C)) only under high NaCl concentrations, the binding and release of which could be controlled by a change in the salt concentration. We believe, therefore, that Cur
Jiang, Yuanyuan; Wang, Long; Zhang, Li; Wang, Tao; Zhou, Yonghong; Ding, Chunbang; Yang, Ruiwu; Wang, Xiaoli; Yu, Lin
2015-08-01
In this study, the process of extracting polysaccharides from Salvia miltiorrhiza Bunge residue was optimized by using a Box-Behnken design. Statistical analysis of the results showed that the linear and quadratic terms of the three variables of the extraction process had significant effects. The optimal conditions are as follows: extracting time of 2.6 h, extraction temperature of 89 °C, and ratio of water to raw material of 32 mL/g. Moreover, a new polysaccharide with antioxidant activity [i.e., SMWP-1 (∼5.27×10(5) Da)] was isolated from S. miltiorrhiza residue. The carbohydrate, uronic acid, and protein contents of SMWP-1 were 90.11%, 0.13%, and 0.53%, respectively. The SMWP-1 is composed of glucose, xylose, mannose, and galactose. The preliminary structural characterization of SMWP-1 was determined via Fourier transform infrared (FTIR) spectroscopy, and scanning electron microscopy (SEM) analyses. This polysaccharide exhibited strong reducing power and free-radical scavenging activities in vitro against 2,2-diphenyl-1-picrylhydrazyl, superoxide anion, and hydroxyl. Therefore, SMWP-1 can be investigated further as a novel natural antioxidant. Copyright © 2015 Elsevier B.V. All rights reserved.
Wang, Yun; Hu, Xiaowei; Han, Juan; Ni, Liang; Tang, Xu; Hu, Yutao; Chen, Tong
2016-03-01
A polymer-salt aqueous two-phase system (ATPS) consisting of thermosensitive copolymer ethylene-oxide-b-propylene-oxide-b-ethylene-oxide (EOPOEO) and NaH2PO4 was employed in deproteinization for lycium barbarum polysaccharide (LBP). The effects of salt type and concentration, EOPOEO concentration, amount of crude LBP solution and temperature were studied. In the primary extraction process, LBP was preferentially partitioned to the bottom (salt-rich) phase with high recovery ratio of 96.3%, while 94.4% of impurity protein was removed to the top (EOPOEO-rich) phase. Moreover, the majority of pigments could be discarded to top phase. After phase-separation, the LBP in the bottom phase was further purified by dialysis membrane to remove salt and other small molecular impurities. The purity of LBP was enhanced to 64%. Additionally, the FT-IR spectrum was used to identify LBP. EOPOEO was recovered by a temperature-induced separation, and reused in a new ATPS. An ideal extraction and recycle result were achieved. Copyright © 2015 Elsevier Ltd. All rights reserved.
Hot-compressed water extraction of polysaccharides from soy hulls.
Liu, Hua-Min; Wang, Fei-Yun; Liu, Yu-Lan
2016-07-01
The polysaccharides of soy hulls were extracted by hot-compressed water at temperatures of 110 from 180°C and various treatment times (10-150min) in a batch system. It was determined that a moderate temperature and short time are suitable for the preparation of polysaccharides. The structure of xylan and the inter- and intra-chain hydrogen bonding of cellulose fibrils in the soy hulls were not significantly broken down. The polysaccharides obtained were primarily composed of α-L-arabinofuranosyl units, 4-O-methyl-glucuronic acid units and α-D-galactose units attached with substituted units. A sugar analysis indicated that arabinose was the major component, constituting 35.6-46.9% of the polysaccharide products extracted at 130°C, 140°C, and 150°C. This investigation contributes to the knowledge of the polysaccharides of soy by-products, which can reduce the environmental impact of waste from the food industries. Copyright © 2016 Elsevier Ltd. All rights reserved.
β-glucans and cholesterol (Review)
Sima, Petr; Vetvicka, Vaclav
2018-01-01
Hypercholesterolemia is one of primary risk factors of cardiovascular disease, together with metabolic syndrome, hypertension and diabetes. Although progress has been made, the search for novel methods of preventing and treating dyslipidemia is ongoing and current therapies for cardiovascular disease induce various side effects. β-glucans are linear unbranched polysaccharides found in various natural sources, such as mushrooms. Due to their structure they are able to interact with innate immunity receptors, however they also act as dietary fibers in the digestive tract. As there are two forms of β-glucans, insoluble and soluble forms, they are able to interact with lipids and biliary salts in the bowel and consequently reduce cholesterol levels. Therefore, they may be developed as a suitable therapeutic option to treat patients with dyslipidemia, as they are natural molecules that do not induce any significant side effects. The current review discusses the evidence supporting the effects of β-glucans on cholesterol levels. PMID:29393350
Chemical Organization of the Cell Wall Polysaccharide Core of Malassezia restricta
Stalhberger, Thomas; Simenel, Catherine; Clavaud, Cécile; Eijsink, Vincent G. H.; Jourdain, Roland; Delepierre, Muriel; Latgé, Jean-Paul; Breton, Lionel; Fontaine, Thierry
2014-01-01
Malassezia species are ubiquitous residents of human skin and are associated with several diseases such as seborrheic dermatitis, tinea versicolor, folliculitis, atopic dermatitis, and scalp conditions such as dandruff. Host-Malassezia interactions and mechanisms to evade local immune responses remain largely unknown. Malassezia restricta is one of the most predominant yeasts of the healthy human skin, its cell wall has been investigated in this paper. Polysaccharides in the M. restricta cell wall are almost exclusively alkali-insoluble, showing that they play an essential role in the organization and rigidity of the M. restricta cell wall. Fractionation of cell wall polymers and carbohydrate analyses showed that the polysaccharide core of the cell wall of M. restricta contained an average of 5% chitin, 20% chitosan, 5% β-(1,3)-glucan, and 70% β-(1,6)-glucan. In contrast to other yeasts, chitin and chitosan are relatively abundant, and β-(1,3)-glucans constitute a minor cell wall component. The most abundant polymer is β-(1,6)-glucans, which are large molecules composed of a linear β-(1,6)-glucan chains with β-(1,3)-glucosyl side chain with an average of 1 branch point every 3.8 glucose unit. Both β-glucans are cross-linked, forming a huge alkali-insoluble complex with chitin and chitosan polymers. Data presented here show that M. restricta has a polysaccharide organization very different of all fungal species analyzed to date. PMID:24627479
Chemical organization of the cell wall polysaccharide core of Malassezia restricta.
Stalhberger, Thomas; Simenel, Catherine; Clavaud, Cécile; Eijsink, Vincent G H; Jourdain, Roland; Delepierre, Muriel; Latgé, Jean-Paul; Breton, Lionel; Fontaine, Thierry
2014-05-02
Malassezia species are ubiquitous residents of human skin and are associated with several diseases such as seborrheic dermatitis, tinea versicolor, folliculitis, atopic dermatitis, and scalp conditions such as dandruff. Host-Malassezia interactions and mechanisms to evade local immune responses remain largely unknown. Malassezia restricta is one of the most predominant yeasts of the healthy human skin, its cell wall has been investigated in this paper. Polysaccharides in the M. restricta cell wall are almost exclusively alkali-insoluble, showing that they play an essential role in the organization and rigidity of the M. restricta cell wall. Fractionation of cell wall polymers and carbohydrate analyses showed that the polysaccharide core of the cell wall of M. restricta contained an average of 5% chitin, 20% chitosan, 5% β-(1,3)-glucan, and 70% β-(1,6)-glucan. In contrast to other yeasts, chitin and chitosan are relatively abundant, and β-(1,3)-glucans constitute a minor cell wall component. The most abundant polymer is β-(1,6)-glucans, which are large molecules composed of a linear β-(1,6)-glucan chains with β-(1,3)-glucosyl side chain with an average of 1 branch point every 3.8 glucose unit. Both β-glucans are cross-linked, forming a huge alkali-insoluble complex with chitin and chitosan polymers. Data presented here show that M. restricta has a polysaccharide organization very different of all fungal species analyzed to date.
Extraction of Polysaccharide from Spirulina and Evaluation of Its Activities.
Wang, Bingyue; Liu, Qian; Huang, Yinghong; Yuan, Yueling; Ma, Qianqian; Du, Manling; Cai, Tiange; Cai, Yu
2018-01-01
Polysaccharide of Spirulina platensis (PSP) is a kind of water-soluble polysaccharide extracted from Spirulina platensis . It has been proved to have antitumor, antioxidation, antiaging, and antivirus properties. And it has a promising prospect for wide application. This study aims to identify an extraction process for high-purity polysaccharide in Spirulina (PSP) through a series of optimization methods and then evaluates its initial antiaging activities. Four kinds of extraction methods-hot-water extraction, alkali extraction, ultrasonic-assisted extraction, and freeze-thaw extraction-were compared to find the optimal one, which was further optimized by response surface methodology. PSP was obtained after the crude PSP was deproteinized and depigmented. The antiaging effects of PSP were preliminarily evaluated through in vitro cell experiments. The alkali extraction method was determined as the optimal method, with the optimized extraction process consisting of a solid-liquid ratio of 1 : 50, a pH value of 10.25, a temperature of 89.24°C, and a time of 9.99 h. The final PSP contained 71.65% of polysaccharide and 8.54% of protein. At a concentration of 50 μ g/mL, PSP exerted a significant promoting effect on the proliferation and traumatic fusion of human immortalized epidermal cells HaCaT. An extraction method for high-purity PSP with a high extraction rate was established, and in vitro results suggest antioxidation and antiaging activities.
Lu, Zhaolian; Jia, Qi; Wang, Rui; Wu, Ximin; Wu, Yingchun; Huang, Caiguo; Li, Yiming
2011-02-15
Procyanidin oligomers in Cinnamon are thought to be responsible for the biological activity in the treatment of diabetes mellitus (DM). To clarify types of procyanidin oligomers in different Cinnamon species and investigate their different effects, the present study investigated procyanidin oligomers in polyphenolic oligomer-rich extracts of three Cinnamon samples by LC-MS methods, and their hypoglycemic activities were detected in vivo and in vitro. The results showed that two of the three samples from Cinnamomum cassia were rich in B-type procyanidin oligomers, and the other sample was rich in A-type procyanidin oligomers. The Cinnamon extracts were administered at doses of 200 and 300 mg/kg body wt. in high-fat diet-fed and low-dose streptozotocin (STZ)-induced diabetic mice for 14 days. The results showed that blood glucose concentrations were significantly decreased in all Cinnamon extract groups compared with the control group (p<0.05). Administration of the Cinnamon extracts significantly increased the consumption of extracellular glucose in insulin-resistant HepG2 cells and normal HepG2 cells compared with the control group. These results suggest that both A- and B-type procyanidin oligomers in different Cinnamon species have hypoglycemic activities and may improve insulin sensitivity in type 2 DM. Copyright © 2010 Elsevier GmbH. All rights reserved.
Chen, Yun; Yao, Fangke; Ming, Ke; Wang, Deyun; Hu, Yuanliang; Liu, Jiaguo
2016-12-13
Traditional Chinese Medicine (TCM) has been used to treat diseases in China for thousands of years. TCM compositions are complex, using as their various sources plants, animals, fungi, and minerals. Polysaccharides are one of the active and important ingredients of TCMs. Polysaccharides from TCMs exhibit a wide range of biological activities in terms of immunity- modifying, antiviral, anti-inflammatory, anti-oxidative, and anti-tumor properties. With their widespread biological activities, polysaccharides consistently attract scientist's interests, and the studies often concentrate on the extraction, purification, and biological activity of TCM polysaccharides. Currently, numerous studies have shown that the modification of polysaccharides can heighten or change the biological activities, which is a new angle of polysaccharide research. This review highlights the current knowledge of TCM polysaccharides, including their extraction, purification, modification, and biological activity, which will hopefully provide profound insights facilitating further research and development.
Yip, Ka-Man; Xu, Jun; Tong, Wing-Sum; Zhou, Shan-Shan; Yi, Tao; Zhao, Zhong-Zhen; Chen, Hu-Biao
2016-11-18
In clinical practice polysaccharides from herbal medicines are conventionally prepared by boiling water extraction (BWE), while ultrasound-assisted extraction (UAE) has often been used instead employed in laboratory research due to its strong extraction ability and efficiency. However, if and how the polysaccharides obtained by UAE and BWE are comparable, and hence whether the UAE-based research is instructive for the actual usage of herbal polysaccharides still requires further evaluation. To address this issue, here we chemically analyzed and compared the UAE- and BWE-obtained polysaccharides from three herbal medicines, i.e., Ginseng Radix, Astragali Radix and Dendrobii Officinalis Caulis. Then, the spike recovery of two series of standard dextran and pullulan by UAE and BWE was tested. The results showed that the polysaccharides from the herbal medicines by UAE were quantitatively and qualitatively different with those by BWE. The powerful extraction ability and polysaccharide degradation caused by ultrasound collectively contributed to these differences. It was then revealed that not only the UAE conditions but also the polysaccharide structures could affect the extraction ability and polysaccharide degradation. Given these, we highly recommended that the effects of UAE on polysaccharides from herbal medicines should be first carefully considered before employing it in relevant chemical and pharmacological analysis.
Genetic Diversity and Genome Wide Association Study of β-Glucan Content in Tetraploid Wheat Grains
Marcotuli, Ilaria; Houston, Kelly; Schwerdt, Julian G.; Waugh, Robbie; Fincher, Geoffrey B.; Burton, Rachel A.; Blanco, Antonio; Gadaleta, Agata
2016-01-01
Non-starch polysaccharides (NSPs) have many health benefits, including immunomodulatory activity, lowering serum cholesterol, a faecal bulking effect, enhanced absorption of certain minerals, prebiotic effects and the amelioration of type II diabetes. The principal components of the NSP in cereal grains are (1,3;1,4)-β-glucans and arabinoxylans. Although (1,3;1,4)-β-glucan (hereafter called β-glucan) is not the most representative component of wheat cell walls, it is one of the most important types of soluble fibre in terms of its proven beneficial effects on human health. In the present work we explored the genetic variability of β-glucan content in grains from a tetraploid wheat collection that had been genotyped with a 90k-iSelect array, and combined this data to carry out an association analysis. The β-glucan content, expressed as a percentage w/w of grain dry weight, ranged from 0.18% to 0.89% across the collection. Our analysis identified seven genomic regions associated with β-glucan, located on chromosomes 1A, 2A (two), 2B, 5B and 7A (two), confirming the quantitative nature of this trait. Analysis of marker trait associations (MTAs) in syntenic regions of several grass species revealed putative candidate genes that might influence β-glucan levels in the endosperm, possibly via their participation in carbon partitioning. These include the glycosyl hydrolases endo-β-(1,4)-glucanase (cellulase), β-amylase, (1,4)-β-xylan endohydrolase, xylanase inhibitor protein I, isoamylase and the glycosyl transferase starch synthase II. PMID:27045166
Rheological properties and baking performance of new oat beta-glucan-rich hydrocolloids.
Lee, Suyong; Warner, Kathleen; Inglett, George E
2005-12-14
Two new oat beta-glucan hydrocolloids (designated C-trim20 and C-trim30) obtained through a thermal-shearing process were evaluated for their potential use in food products as functional ingredients. Their rheological characteristics were investigated using steady and dynamic shear measurements. Both samples exhibited typical shear-thinning and viscoelastic properties of random coil polysaccharides. The Cross equation was also used to examine the dependence of their apparent viscosity on shear rates. Furthermore, the effects of flour replacement with C-trim20 on the physical, rheological, and sensory properties of cookies were studied. The cookies containing C-trim20 exhibited reduced spreading characteristics compared with the control due to their increased elastic properties. Also, higher water content and water activity were observed in the C-trim20 cookies. However, flour replacement with C-trim20 up to 10% produced cookies with instrumental texture properties similar to those of the control, which was in good agreement with the sensory results.
Ye, Danyan; Jiang, Zebin; Zheng, Fuchun; Wang, Hongmei; Zhang, Yanmei; Gao, Fenfei; Chen, Peihong; Chen, Yicun; Shi, Ganggang
2015-09-16
Polysaccharides from Grateloupia livida (Harv.) Yamada (GL) were extracted by a heating circumfluence method. Single-factor experiments were performed for the three parameters: extraction time (X₁), extraction temperature (X₂) and the ratio of water to raw material (X₃) and their test range. From preliminary experimental results, one type of the response surface methodology, the Box-Behnken design was applied for the optimizing polysaccharide extraction conditions. The experimental data obtained were fitted to a second-order polynomial equation. The optimal conditions were extraction time 5 h, extraction temperature 100 °C and ratio of water to raw material 70 mL/g. Under these conditions, the experimental yield was 39.22% ± 0.09%, which well matched the predicted value (39.25%), with 0.9774 coefficient of determination (R²). GL polysaccharides had scavenging activities for DPPH and hydroxyl radicals in vitro. The scavenging rates for both radicals peaked at 20 mg/mL GL concentration. However, the positive standard, VC (ascorbic acid), possessed stronger antioxidant activities than GL polysaccharides. Furthermore, the anticancer activity of GL polysaccharides on HepG2 cell proliferation increased dose- and time-dependently, but the positive standard, 5-fluorouracil (5-fu) showed more significant anticancer activity in this study. Overall, GL polysaccharides may have potential applications in the medical and food industries.
Clinical and Physiological Perspectives of β-Glucans: The Past, Present, and Future
Bashir, Khawaja Muhammad Imran; Choi, Jae-Suk
2017-01-01
β-Glucans are a group of biologically-active fibers or polysaccharides from natural sources with proven medical significance. β-Glucans are known to have antitumor, anti-inflammatory, anti-obesity, anti-allergic, anti-osteoporotic, and immunomodulating activities. β-Glucans are natural bioactive compounds and can be taken orally, as a food supplement, or as part of a daily diet, and are considered safe to use. The medical significance and efficiency of β-glucans are confirmed in vitro, as well as using animal- and human-based clinical studies. However, systematic study on the clinical and physiological significance of β-glucans is scarce. In this review, we not only discuss the clinical and physiological importance of β-glucans, we also compare their biological activities through the existing in vitro and animal-based in vivo studies. This review provides extensive data on the clinical study of β-glucans. PMID:28872611
Alhudhud, M; Sadiq, S; Ngo, H N; Hidalgo-Cantabrana, C; Ruas-Madiedo, P; van Sinderen, D; Humphreys, P N; Laws, A P
2018-06-15
Three strains of Bifidobacterium breve (JCM 7017, JCM 7019 and JCM 2258) and two strains of Bifidobacterium animalis subsp. lactis (AD011 and A1dOxR) were grown in broth cultures or on plates, and a standard exopolysaccharide extraction method was used in an attempt to recover exocellular polysaccharides. When the extracted materials were analysed by NMR it was clear that mixtures of polysaccharides were being isolated including exopolysaccharides (EPS) cell wall polysaccharides and intracellular polysaccharides. Treatment of the cell biomass from the B. breve strains, or the B. animalis subsp. lactis AD011 strain, with aqueous sodium hydroxide provided a very similar mixture of polysaccharides but without the EPS. The different polysaccharides were partially fractionated by selective precipitation from an aqueous solution upon the addition of increasing percentages of ethanol. The polysaccharides extracted from B. breve JCM 7017 grown in HBM media supplemented with glucose (or isotopically labelled D-glucose-1- 13 C) were characterised using 1D and 2D-NMR spectroscopy. Addition of one volume of ethanol generated a medium molecular weight glycogen (Mw=1×10 5 Da, yield 200 mg/l). The addition of two volumes of ethanol precipitated an intimate mixture of a low molecular weight β-(1→6)-glucan and a low molecular weight β-(1→6)-galactofuranan which could not be separated (combined yield 46 mg/l). When labelled D-glucose-1- 13 C was used as a carbon supplement, the label was incorporated into >95% of the anomeric carbons of each polysaccharide confirming they were being synthesised in situ. Similar 1 H NMR profiles were obtained for polysaccharides recovered from the cells of B. animalis subsp. lactis AD011and A1dOxR (in combination with an EPS), B. breve JCM 7017, B. breve JCM 7019, B. breve JCM 2258 and from an EPS (-ve) mutant of B. breve 7017 (a non-EPS producer).
Immune-modulatory effects of dietary Yeast Beta-1,3/1,6-D-glucan
2014-01-01
Beta-glucans are a heterogeneous group of natural polysaccharides mostly investigated for their immunological effects. Due to the low systemic availability of oral preparations, it has been thought that only parenterally applied beta-glucans can modulate the immune system. However, several in vivo and in vitro investigations have revealed that orally applied beta-glucans also exert such effects. Various receptor interactions, explaining possible mode of actions, have been detected. The effects mainly depend on the source and structure of the beta-glucans. In the meantime, several human clinical trials with dietary insoluble yeast beta-glucans have been performed. The results confirm the previous findings of in vivo studies. The results of all studies taken together clearly indicate that oral intake of insoluble yeast beta-glucans is safe and has an immune strengthening effect. PMID:24774968
Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi.
Yoshimi, Akira; Miyazawa, Ken; Abe, Keietsu
2017-11-18
Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.
Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi
Yoshimi, Akira; Miyazawa, Ken; Abe, Keietsu
2017-01-01
Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan. PMID:29371579
He, Jinzhe; Xu, Yaoyang; Chen, Hongbo; Sun, Peilong
2016-01-01
Four seaweed polysaccharides were extracted from Sarcodia ceylonensis, Ulva lactuca L., Gracilaria lemaneiformis, and Durvillaea antarctica, respectively, by microwave-assisted extraction. The effect of three significant variables (extraction time, extraction temperature, and the ratio of water to raw material) on the process for extracting polysaccharides was investigated, along with the optimization of the extraction using the response surface method (RSM) with a Box–Behnken design. The polysaccharide structure, monosaccharide composition, degree of sulfation, and molecular weight (MW) distribution were analyzed by infrared (IR) spectrometry, gas chromatography (GC), and high-performance gel permeation chromatography (HPGPC). IR spectrometry showed that Sarcodia ceylonensis polysaccharide (SCP), Ulva lactuca L. polysaccharide (ULLP), and Durvillaea antarctica polysaccharide (DAP) were all sulfated polysaccharides and, except Gracilaria lemaneiformis polysaccharide (GLP), all belong to β-pyranosidic polysaccharides. The average molecular weight (MW) of SCP, ULLP, GLP, and DAP was 466, 404, 591, and 482 kDa, respectively. The quantitative and comparative results with external standards indicated that the main monosaccharide in SCP and ULLP was mannose; and GLP and DAP were mainly composed of galactose and glucose, respectively. Then the in vitro antioxidant activity of all of the polysaccharides was evaluated using different assays—2,2–azino –bis (3-ethylbenzthiazoline-6- sulfonate) (ABTS), hydroxyl radical, nitrite scavenging capacity, and reducing power—and the relationship between their antioxidant activity and chemical characteristics were also examined. ULLP presented the highest ABTS radical scavenging activity; ULLP, SCP and DAP also showed a strong effect on the ABTS radical scavenging activity. SCP and ULLP exhibited excellent hydroxyl radical scavenging activities, about 83.33% ± 2.31% and 80.07% ± 2.17%, respectively, at 4 mg/mL. The
He, Jinzhe; Xu, Yaoyang; Chen, Hongbo; Sun, Peilong
2016-11-28
Four seaweed polysaccharides were extracted from Sarcodia ceylonensis , Ulva lactuca L., Gracilaria lemaneiformis , and Durvillaea antarctica , respectively, by microwave-assisted extraction. The effect of three significant variables (extraction time, extraction temperature, and the ratio of water to raw material) on the process for extracting polysaccharides was investigated, along with the optimization of the extraction using the response surface method (RSM) with a Box-Behnken design. The polysaccharide structure, monosaccharide composition, degree of sulfation, and molecular weight ( M W ) distribution were analyzed by infrared (IR) spectrometry, gas chromatography (GC), and high-performance gel permeation chromatography (HPGPC). IR spectrometry showed that Sarcodia ceylonensis polysaccharide (SCP), Ulva lactuca L. polysaccharide (ULLP), and Durvillaea antarctica polysaccharide (DAP) were all sulfated polysaccharides and, except Gracilaria lemaneiformis polysaccharide (GLP), all belong to β-pyranosidic polysaccharides. The average molecular weight ( M W ) of SCP, ULLP, GLP, and DAP was 466, 404, 591, and 482 kDa, respectively. The quantitative and comparative results with external standards indicated that the main monosaccharide in SCP and ULLP was mannose; and GLP and DAP were mainly composed of galactose and glucose, respectively. Then the in vitro antioxidant activity of all of the polysaccharides was evaluated using different assays-2,2-azino -bis (3-ethylbenzthiazoline-6- sulfonate) (ABTS), hydroxyl radical, nitrite scavenging capacity, and reducing power-and the relationship between their antioxidant activity and chemical characteristics were also examined. ULLP presented the highest ABTS radical scavenging activity; ULLP, SCP and DAP also showed a strong effect on the ABTS radical scavenging activity. SCP and ULLP exhibited excellent hydroxyl radical scavenging activities, about 83.33% ± 2.31% and 80.07% ± 2.17%, respectively, at 4 mg/mL. The reducing
Stack, Helena M.; Kearney, Niamh; Stanton, Catherine; Fitzgerald, Gerald F.; Ross, R. Paul
2010-01-01
The exopolysaccharide beta-glucan has been reported to be associated with many health-promoting and prebiotic properties. The membrane-associated glycosyltransferase enzyme (encoded by the gtf gene), responsible for microbial beta-glucan production, catalyzes the conversion of sugar nucleotides into beta-glucan. In this study, the gtf gene from Pediococcus parvulus 2.6 was heterologously expressed in Lactobacillus paracasei NFBC 338. When grown in the presence of glucose (7%, wt/vol), the recombinant strain (pNZ44-GTF+) displayed a “ropy” phenotype, while scanning electron microscopy (SEM) revealed strands of polysaccharide-linking neighboring cells. Beta-glucan biosynthesis was confirmed by agglutination tests carried out with Streptococcus pneumoniae type 37-specific antibodies, which specifically detect glucan-producing cells. Further analysis showed a ∼2-fold increase in viscosity in broth media for the beta-glucan-producing strain over 24 h compared to the control strain, which did not show any significant increase in viscosity. In addition, we analyzed the ability of beta-glucan-producing Lactobacillus paracasei NFBC 338 to survive both technological and gastrointestinal stresses. Heat stress assays revealed that production of the polysaccharide was associated with significantly increased protection during heat stress (60-fold), acid stress (20-fold), and simulated gastric juice stress (15-fold). Bile stress assays revealed a more modest but significant 5.5-fold increase in survival for the beta-glucan-producing strain compared to that of the control strain. These results suggest that production of a beta-glucan exopolysaccharide by strains destined for use as probiotics may afford them greater performance/protection during cultivation, processing, and ingestion. As such, expression of the gtf gene may prove to be a straightforward approach to improve strains that might otherwise prove sensitive in such applications. PMID:19933353
Yuan, Qingxia; Xie, Yufeng; Wang, Wei; Yan, Yuhua; Ye, Hong; Jabbar, Saqib; Zeng, Xiaoxiong
2015-09-05
Extraction optimization, characterization and antioxidant activity in vitro of polysaccharides from mulberry leaves (MLP) were investigated in the present study. The optimal extraction conditions with an extraction yield of 10.0 ± 0.5% for MLP were determined as follows: extraction temperature 92 °C, extraction time 3.5h and ratio (v/w, mL/g) of extraction solvent (water) to raw material 34. Two purified fractions, MLP-3a and MLP-3b with molecular weights of 80.99 and 3.64 kDa, respectively, were obtained from crude MLP by chromatography of DEAE-Cellulose 52 and Sephadex G-100. Fourier transform-infrared spectroscopy revealed that crude MLP, MLP-3a and MLP-3b were acidic polysaccharides. Furthermore, crude MLP and MLP-3a had more complicated monosaccharide compositions, while MLP-3b had a relatively higher content of uronic acid. Crude MLP, MLP-3a and MLP-3b exhibited potent Fe(2+) chelating power and scavenging activities on 1,1-diphenyl-2-picrylhydrazyl, hydroxyl, superoxide and 2,2'-azinobis-(3-ethyl-benzothiazolin-6-sulfonic acid) radicals. The results suggested that MLP could be explored as natural antioxidant. Copyright © 2015 Elsevier Ltd. All rights reserved.
Pu, Jinji; Guo, Jianrong; Fan, Zaifeng
2014-01-01
Small RNAs, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are important regulators of plant development and gene expression. The acquisition of high-quality small RNAs is the first step in the study of its expression and function analysis, yet the extraction method of small RNAs in recalcitrant plant tissues with various secondary metabolites is not well established, especially for tropical and subtropical plant species rich in polysaccharides and polyphenols. Here, we developed a simple and efficient method for high quality small RNAs extraction from recalcitrant plant species. Prior to RNA isolation, a precursory step with a CTAB-PVPP buffer system could efficiently remove compounds and secondary metabolites interfering with RNAs from homogenized lysates. Then, total RNAs were extracted by Trizol reagents followed by a differential precipitation of high-molecular-weight (HMW) RNAs using polyethylene glycol (PEG) 8000. Finally, small RNAs could be easily recovered from supernatant by ethanol precipitation without extra elimination steps. The isolated small RNAs from papaya showed high quality through a clear background on gel and a distinct northern blotting signal with miR159a probe, compared with other published protocols. Additionally, the small RNAs extracted from papaya were successfully used for validation of both predicted miRNAs and the putative conserved tasiARFs. Furthermore, the extraction method described here was also tested with several other subtropical and tropical plant tissues. The purity of the isolated small RNAs was sufficient for such applications as end-point stem-loop RT-PCR and northern blotting analysis, respectively. The simple and feasible extraction method reported here is expected to have excellent potential for isolation of small RNAs from recalcitrant plant tissues rich in polyphenols and polysaccharides. PMID:24787387
Antidiabetic activity of aqueous extract and non polysaccharide fraction of Cynodon dactylon Pers.
Jarald, E E; Joshi, S B; Jain, D C
2008-09-01
Petroleum ether (60 degrees-80 degrees C), chloroform, acetone, ethanol, aqueous and crude hot water extracts of the whole plant of C. dactylon and the two fractions of aqueous extract were tested for antihyperglycaemic activity in glucose overloaded hyperglycemic rats and in alloxan induced diabetic model at two-dose levels, 200 and 400 mg/kg (po) respectively. The aqueous extract of C. dactylon and the non polysaccharide fraction of aqueous extract were found to exhibit significant antihyperglycaemic activity and only the non polysaccharide fraction was found to produce hypoglycemia in fasted normal rats. Treatment of diabetic rats with aqueous extract and non polysaccharide fraction of the plant decreased the elevated biochemical parameters, glucose, urea, creatinine, serum cholesterol, serum triglyceride, high density lipoprotein, low density lipoprotein, haemoglobin and glycosylated haemoglobin significantly. Comparatively, the non polysaccharide fraction of aqueous extract was found to be more effective than the aqueous extract.
Ryden, P; Selvendran, R R
1990-01-01
1. Polymers were solubilized from the cell walls of parenchyma from mature runner-bean pods with minimum degradation by successive extractions with cyclohexane-trans-1,2-diamine-NNN'N'-tetra-acetate (CDTA), Na2CO3 and KOH to leave the alpha-cellulose residue, which contained cross-linked pectic polysaccharides and Hyp-rich glycoproteins. These were solubilized with chlorite/acetic acid and cellulase. The polymers were fractionated by anion-exchange chromatography, and fractions were subjected to methylation analysis. 2. The pectic polysaccharides differed in their ease of extraction, and a small proportion were highly cross-linked. The bulk of the pectic polysaccharides solubilized by CDTA and Na2CO3 were less branched than those solubilized by KOH. There was good evidence that most of the pectic polysaccharides were not degraded during extraction. 3. The protein-containing fractions included Hyp-rich and Hyp-poor glycoproteins associated with easily extractable pectic polysaccharides, Hyp-rich glycoproteins solubilized with 4M-KOH+borate, the bulk of which were not associated with pectic polysaccharides, and highly cross-linked Hyp-rich glycoproteins. 4. Isodityrosine was not detected, suggesting that it does not have a (major) cross-linking role in these walls. Instead, it is suggested that phenolics, presumably linked to C-5 of 3,5-linked Araf residues of Hyp-rich glycoproteins, serve to cross-link some of the polymers. 5. There were two main types of xyloglucan, with different degrees of branching. The bulk of the less branched xyloglucans were solubilized by more-concentrated alkali. The anomeric configurations of the sugars in one of the highly branched xyloglucans were determined by 13C-n.m.r. spectroscopy. 6. The structural features of the cell-wall polymers and complexes are discussed in relation to the structure of the cell walls of parenchyma tissues. PMID:2167068
Zhu, Yang; Li, Qian; Mao, Guanghua; Zou, Ye; Feng, Weiwei; Zheng, Daheng; Wang, Wei; Zhou, Lulu; Zhang, Tianxiu; Yang, Jun; Yang, Liuqing; Wu, Xiangyang
2014-01-30
The enzyme-assisted extraction (EAE) of polysaccharides from the fruits of Hericium erinaceus was studied. In this study, response surface methodology and the Box-Behnken design based on single-factor and orthogonal experiments were applied to optimize the EAE conditions. The optimal extraction conditions were as follows: a pH of 5.71, a temperature of 52.03°C and a time of 33.79 min. The optimal extraction conditions resulted in the highest H. erinaceus polysaccharides (HEP) yield, with a value 13.46 ± 0.37%, which represented an increase of 67.72% compared to hot water extraction (HWE). The polysaccharides were characterized by FT-IR, SEM, CD, AFM, and GC. The results showed that HEP was composed of mannose, glucose, xylose, and galactose in a molar ratio of 15.16:5.55:4.21:1. The functional groups of the H. erinaceus polysaccharides extracted by HWE and EAE were fundamentally identical but had apparent conformational changes. Copyright © 2013 Elsevier Ltd. All rights reserved.
Characterization of polysaccharides extracted from spent coffee grounds by alkali pretreatment.
Ballesteros, Lina F; Cerqueira, Miguel A; Teixeira, José A; Mussatto, Solange I
2015-01-01
Spent coffee grounds (SCG), obtained during the processing of coffee powder with hot water to make soluble coffee, are the main coffee industry residues and retain approximately seventy percent of the polysaccharides present in the roasted coffee beans. The purpose of this study was to extract polysaccharides from SCG by using an alkali pretreatment with sodium hydroxide at 25°C, and determine the chemical composition, as well as the antioxidant and antimicrobial properties of the extracted polysaccharides. Galactose (60.27%mol) was the dominant sugar in the recovered polysaccharides, followed by arabinose (19.93%mol), glucose (15.37%mol) and mannose (4.43%mol). SCG polysaccharides were thermostable, and presented a typical carbohydrate pattern. Additionally, they showed good antioxidant activity through different methods and presented high antimicrobial percent inhibition against Phoma violacea and Cladosporium cladosporioides (41.27% and 54.60%, respectively). These findings allow identifying possible applications for these polysaccharides in the food industry. Copyright © 2015 Elsevier Ltd. All rights reserved.
The Complexity of Fungal β-Glucan in Health and Disease: Effects on the Mononuclear Phagocyte System
Camilli, Giorgio; Tabouret, Guillaume; Quintin, Jessica
2018-01-01
β-glucan, the most abundant fungal cell wall polysaccharide, has gained much attention from the scientific community in the last few decades for its fascinating but not yet fully understood immunobiology. Study of this molecule has been motivated by its importance as a pathogen-associated molecular pattern upon fungal infection as well as by its promising clinical utility as biological response modifier for the treatment of cancer and infectious diseases. Its immune effect is attributed to the ability to bind to different receptors expressed on the cell surface of phagocytic and cytotoxic innate immune cells, including monocytes, macrophages, neutrophils, and natural killer cells. The characteristics of the immune responses generated depend on the cell types and receptors involved. Size and biochemical composition of β-glucans isolated from different sources affect their immunomodulatory properties. The variety of studies using crude extracts of fungal cell wall rather than purified β-glucans renders data difficult to interpret. A better understanding of the mechanisms of purified fungal β-glucan recognition, downstream signaling pathways, and subsequent immune regulation activated, is, therefore, essential not only to develop new antifungal therapy but also to evaluate β-glucan as a putative anti-infective and antitumor mediator. Here, we briefly review the complexity of interactions between fungal β-glucans and mononuclear phagocytes during fungal infections. Furthermore, we discuss and present available studies suggesting how different fungal β-glucans exhibit antitumor and antimicrobial activities by modulating the biologic responses of mononuclear phagocytes, which make them potential candidates as therapeutic agents. PMID:29755450
Camilli, Giorgio; Tabouret, Guillaume; Quintin, Jessica
2018-01-01
β-glucan, the most abundant fungal cell wall polysaccharide, has gained much attention from the scientific community in the last few decades for its fascinating but not yet fully understood immunobiology. Study of this molecule has been motivated by its importance as a pathogen-associated molecular pattern upon fungal infection as well as by its promising clinical utility as biological response modifier for the treatment of cancer and infectious diseases. Its immune effect is attributed to the ability to bind to different receptors expressed on the cell surface of phagocytic and cytotoxic innate immune cells, including monocytes, macrophages, neutrophils, and natural killer cells. The characteristics of the immune responses generated depend on the cell types and receptors involved. Size and biochemical composition of β-glucans isolated from different sources affect their immunomodulatory properties. The variety of studies using crude extracts of fungal cell wall rather than purified β-glucans renders data difficult to interpret. A better understanding of the mechanisms of purified fungal β-glucan recognition, downstream signaling pathways, and subsequent immune regulation activated, is, therefore, essential not only to develop new antifungal therapy but also to evaluate β-glucan as a putative anti-infective and antitumor mediator. Here, we briefly review the complexity of interactions between fungal β-glucans and mononuclear phagocytes during fungal infections. Furthermore, we discuss and present available studies suggesting how different fungal β-glucans exhibit antitumor and antimicrobial activities by modulating the biologic responses of mononuclear phagocytes, which make them potential candidates as therapeutic agents.
Chen, Zhi; Zhang, Wei; Tang, Xunyou; Fan, Huajun; Xie, Xiujuan; Wan, Qiang; Wu, Xuehao; Tang, James Z
2016-06-25
A novel and rapid method for simultaneous extraction and separation of the different polysaccharides from Semen Cassiae (SC) was developed by microwave-assisted aqueous two-phase extraction (MAATPE) in a one-step procedure. Using ethanol/ammonium sulfate system as a multiphase solvent, the effects of MAATPE on the extraction of polysaccharides from SC such as the composition of the ATPS, extraction time, temperature and solvent-to-material ratio were investigated by UV-vis analysis. Under the optimum conditions, the yields of polysaccharides were 4.49% for the top phase, 8.80% for the bottom phase and 13.29% for total polysaccharides, respectively. Compared with heating solvent extraction and ultrasonic assisted extraction, MAATPE exhibited the higher extraction yields in shorter time. Fourier-transform infrared spectra showed that two polysaccharides extracted from SC to the top and bottom phases by MAATPE were different from each other in their chemical structures. Through acid hydrolysis and PMP derivatization prior to HPLC, analytical results by indicated that a polysaccharide of the top phases was a relatively homogeneous homepolysaccharide composed of dominant gucose glucose while that of the bottom phase was a water-soluble heteropolysaccharide with multiple components of glucose, xylose, arabinose, galactose, mannose and glucuronic acid. Molar ratios of monosaccharides were 95.13:4.27:0.60 of glucose: arabinose: galactose for the polysaccharide from the top phase and 62.96:14.07:6.67: 6.67:5.19:4.44 of glucose: xylose: arabinose: galactose: mannose: glucuronic acid for that from the bottom phase, respectively. The mechanism for MAATPE process was also discussed in detail. MAATPE with the aid of microwave and the selectivity of the ATPS not only improved yields of the extraction, but also obtained a variety of polysaccharides. Hence, it was proved as a green, efficient and promising alternative to simultaneous extraction of polysaccharides from SC. Copyright
Baharara, Javad; Amini, Elaheh
2015-01-01
Anti-cancer potential of marine natural products such as polysaccharides represented therapeutic potential in oncological researches. In this study, total polysaccharide from brittle star [Ophiocoma erinaceus (O. erinaceus)] was extracted and chemopreventive efficacy of Persian Gulf brittle star polysaccharide was investigated in HeLa human cervical cancer cells. To extract polysaccharide, dried brittle stars were ground and extracted mechanically. Then, detection of polysaccharide was performed by phenol sulfuric acid, Ultra Violet (UV)-sulfuric acid method and FTIR. The anti proliferative activity of isolated polysaccharide was examined by MTT assay and evaluation of cell death was done through morphological cell changes; Propodium Iodide staining, fluorescence microscopy and caspase-3, -9 enzymatic measurements. To assess its underlying mechanism, expression of Bax, Bcl-2 was evaluated. The polysaccharide detection methods demonstrated isolation of crude polysaccharide from Persian Gulf brittle star. The results revealed that O. erinaceus polysaccharide suppressed the proliferation of HeLa cells in a dose and time dependent manner. Morphological observation of DAPI and Acridine Orange/Propodium Iodide staining was documented by typical characteristics of apoptotic cell death. Flow cytometry analyses exhibited the accumulation of treated cells in sub-G1 region. Additionally, polysaccharide extracted induced intrinsic apoptosis via up-regulation of caspase-3, caspase-9 and Bax along with down-regulation of Bcl-2 in HeLa cells. Taken together, the apoptosis inducing effect of brittle star polysaccharide via intrinsic pathway confirmed the anti tumor potential of marine polysaccharide. Therefore, these findings proposed new insight into anti cancer properties of brittle star polysaccharide as a promising agent in cervical cancer treatment.
Lee, Chrono K.; Huang, Haibin; Shen, Zu T.; Lodge, Jennifer K.; Leszyk, John; Ostroff, Gary R.
2015-01-01
ABSTRACT A vaccine capable of protecting at-risk persons against infections due to Cryptococcus neoformans and Cryptococcus gattii could reduce the substantial global burden of human cryptococcosis. Vaccine development has been hampered though, by lack of knowledge as to which antigens are immunoprotective and the need for an effective vaccine delivery system. We made alkaline extracts from mutant cryptococcal strains that lacked capsule or chitosan. The extracts were then packaged into glucan particles (GPs), which are purified Saccharomyces cerevisiae cell walls composed primarily of β-1,3-glucans. Subcutaneous vaccination with the GP-based vaccines provided significant protection against subsequent pulmonary infection with highly virulent strains of C. neoformans and C. gattii. The alkaline extract derived from the acapsular strain was analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS), and the most abundant proteins were identified. Separation of the alkaline extract by size exclusion chromatography revealed fractions that conferred protection when loaded in GP-based vaccines. Robust Th1- and Th17-biased CD4+ T cell recall responses were observed in the lungs of vaccinated and infected mice. Thus, our preclinical studies have indicated promising cryptococcal vaccine candidates in alkaline extracts delivered in GPs. Ongoing studies are directed at identifying the individual components of the extracts that confer protection and thus would be promising candidates for a human vaccine. PMID:26695631
Miao, Xin-Pu; Sun, Xiao-Ning; Cui, Lu-Jia; Cao, Qin-Fang; Zhuang, Gui-Feng; Deng, Tao-Zhi; Zhang, Dong-Yan
2015-02-01
To investigate the effects of pectic polysaccharides extracted from Rauwolfia verticillata (Lour.) Baill.var.hainanensis Tsiang on an experimental murine colitis model. Experimental colitis was induced by dextran sulfate sodium (DSS), and mice were divided into 4 groups: control, DSS alone, DSS plus SASP, DSS plus pectic polysaccharides. The disease activity index (DAI) and histological score were observed. The tumor necrosis factor (TNF)- α and interleukin (IL)-17 levels were measured by enzyme-linked immunosorbent assay. I κ B and NF- κ B p65 expression were assessed by western blot analysis. Myeloperoxidase (MPO) activity was determined by using MPO assay kit. Administration of pectic polysaccharides significantly reduced the severity of DSS-induced colitis as assessed by DAI and histological score, and resulted in down regulation of MPO activity and NF- κ B p65 expression and subsequent degradation of I κ B protein, strikingly reduced the production of TNF- a and IL-17. Pectic polysaccharides extracted from Rauvolfia verticillata (Lour.)Baill.var. hainanensis Tsiang exerts beneficial effects in experimental colitis and may therefore provide a useful therapeutic approach for the treatment of UC. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.
Li, Cong; Ning, Li-Dan; Si, Jin-Ping; Wu, Ling-Shang; Liu, Jing-Jing; Song, Xian-Shui; Yu, Qiao-Xian
2013-02-01
To reveal the quality variation of polysaccharide in Dendrobium officinale by post-harvest processing and extraction methods, and provide a basis for post-harvest processing and clinical and hygienical applications of Tiepifengdou (Dendrobii Officinalis Caulis). The content of polysaccharides were studied by 4 post-harvest processing methods, i. e. drying by drying closet, drying after scalding by boiling water, drying while twisting, and drying while twisting after scalding by boiling water. And a series of temperatures were set in each processing procedure. An orthogonal test L9 (3(4)) with crushed degrees, solid-liquid ratio, extraction time and extraction times as factors were designed to analyze the dissolution rate of polysaccharides in Tiepifengdou processed by drying while twisting at 80 degrees C. The content of polysaccharides was ranged from 26.59% to 32.70% in different samples processed by different processing methods, among which drying while twisting at 80 degrees C and 100 degrees C respectively were the best. Crushed degree was the most important influence on the dissolution rate of polysaccharides. The dissolution rate of polysaccharides was extremely low when the sample was boiled directly without crushing and sieving. Drying while twisting at 80 degrees C was the best post-harvest processing method, which can help to dry the fresh herbs and improve the accumulation of polysaccharides. Boiling the uncrushed Tiepifengdou for a long time as traditional method could not fully extract polysaccharides, while boiling the crushed Tiepifengdou can efficiently extract polysaccharides.
Ali, Mohamed F.; Driscoll, Christopher B.; Walters, Paula R.; Limper, Andrew H.; Carmona, Eva M.
2015-01-01
B-lymphocytes play an essential regulatory role in the adaptive immune response through antibody production during infection. A less known function of B-lymphocytes is their ability to respond directly to infectious antigens through stimulation of pattern recognition receptors expressed on their surfaces. β-glucans are carbohydrates present in the cell wall of many pathogenic fungi that can be detected in the peripheral blood of patients during infection. They have been shown to participate in the innate inflammatory response as they can directly activate peripheral macrophages and dendritic cells. However, their effect as direct stimulators of B-lymphocytes has not been yet fully elucidated. The aim of this study was to examine the molecular mechanisms and cytokine profiles generated following β-glucan stimulation of B-lymphocytes, compared with the well-established TLR-9 agonist CpG-oligodeoxynucleotide (CpG) and study the participation of β-glucan stimulated B-cells in the innate immune response. Herein, we demonstrate that β-glucan activated B-lymphocytes upregulate pro-inflammatory cytokines (TNFα, IL-6 and IL-8). Interestingly, β-glucan, unlike CpG, had no effect on B-lymphocyte proliferation or IgM production. When compared with CpG (TLR9 agonist), β-glucan-activated cells secreted significantly higher levels of IL-8. Furthermore, IL-8 secretion was partially mediated by Dectin-1 and required SYK, MAPKs and the transcription factors NF-κB and AP-1. Moreover, we observed that conditioned media from β-glucan stimulated B-lymphocytes elicited neutrophil chemotaxis. These studies suggest that β-glucan activated B-lymphocytes have an important and novel role in fungal innate immune responses. PMID:26519534
Han, Qiaohong; Wu, Zili; Huang, Bo; Sun, Liangqi; Ding, Chunbang; Yuan, Shu; Zhang, Zhongwei; Chen, Yanger; Hu, Chao; Zhou, Lijun; Liu, Jing; Huang, Yan; Liao, Jinqiu; Yuan, Ming
2016-11-01
Polysaccharides were extracted from Broussonetia papyrifera ((L.) L'Herit. ex Vent.) fruits (BPP), and response surface methodology was used to maximize extraction yield. The optimum extraction conditions were: ratio of water to solid, 30mL/g; extraction duration, 50min; extraction power, 180W; and extraction temperature, 60°C. Under these conditions, the yield of BPP was 8.61%. Then, BPP was purified, and three purified fractions (designated BPP-1, BPP-2 and BPP-3) were obtained for further physicochemical properties, antioxidant activity and antibacterial activity analysis. These fractions were mainly composed of glucose, mannose and arabinose residue, meanwhile, BPP-3 had a significantly higher rhamnose and uronic acid content than BPP-1 and BPP-2. And BPP-3 showed the best hydroxyl radial scavenging activity, ferric reducing activity power (FRAP), antihemolytic activity and antibacterial activity. Copyright © 2016 Elsevier B.V. All rights reserved.
Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder
2017-07-18
Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.
Shang, Hongmei; Zhou, Haizhu; Duan, Mengying; Li, Ran; Wu, Hongxin; Lou, Yujie
2018-06-01
This study was designed to investigate the extraction conditions of polysaccharides from comfrey (Symphytum officinale L.) root (CRPs) using response surface methodology (RSM). The effects of three variables including liquid-solid ratio, extraction time and extraction temperature on the extraction yield of CRPs were taken into consideration. Moreover, the effects of drying methods including hot air drying (HD), vacuum drying (VD) and freeze drying (FD) on the physicochemical properties and antioxidant activities of CRPs were evaluated. The optimal conditions to extract the polysaccharides were as follows: liquid-solid ratio (15mL/g), extraction time (74min), and extraction temperature (95°C), allowed a maximum polysaccharides yield of 22.87%. Different drying methods had significant effects on the physicochemical properties of CRPs such as the chemical composition (contents of total polysaccharides and uronic acid), relative viscosity, solubility and molecular weight. CRPs drying with FD method showed stronger reducing power and radical scavenging capacities against DPPH and ABTS radicals compared with CRPs drying with HD and VD methods. Therefore, freeze drying served as a good method for keeping the antioxidant activities of polysaccharides from comfrey root. Copyright © 2018 Elsevier B.V. All rights reserved.
Mzoughi, Zeineb; Chakroun, Ibtissem; Hamida, Sarra Ben; Rihouey, Christophe; Mansour, Hedi Ben; Le Cerf, Didier; Majdoub, Hatem
2017-12-01
The isolation, purification and ozone depolymerization of polysaccharides from Arthrocnemum indicum as well as the evaluation of their antiproliferative capacities were investigated. The ozone treatment for various reaction times (0, 15, 30, 45 and 60min) was employed as degradation method in order to attain lower molecular weight product with stronger antiproliferative property. According to FTIR, 1 H NMR and UV-vis analysis, the main chain of ozonolytic degraded polysaccharides could be preserved. The monosaccharide composition, which was determined via GC/MS analysis, showed that extracted polysaccharides were of type of arabinan-rich pectic polysaccharides. Macromolecular characteristics as well as intrinsic viscosity of the degraded polysaccharides were performed by size exclusion chromatography before and after ozone treatment. These experiments showed that intrinsic viscosity and molecular weight (Mn and Mw) of degraded samples decreased with increase in reaction time. Furthermore, preliminary antiproliferative tests indicated that degraded polysaccharide for 1h showed even better antiproliferative capacity. Copyright © 2017 Elsevier B.V. All rights reserved.
Qin, Yujing; Yuan, Qingxia; Zhang, Yuexing; Li, Jialu; Zhu, Xinjiao; Zhao, Lingling; Wen, Jing; Liu, Jikai; Zhao, Longyan; Zhao, Jinhua
2018-03-06
Enzyme-assisted extraction optimization, characterization and in vitro antioxidant activity of polysaccharides from sea cucumber Phyllophorus proteus (PPP) were investigated in the present study. The optimal extraction conditions with a yield of 6.44 ± 0.06% for PPP were determined as follows: Extraction time of 2.89 h, ratio of extraction solvent to raw material of 16.26 mL/g, extraction pH of 6.83, exraction temperature of 50 °C and papain concentration of 0.15%. Three purified fractions, PPP-1a, PPP-1b and PPP-2 with molecular weights of 369.60, 41.73 and 57.76 kDa, respectively, were obtained from PPP by chromatography of FPA98Cl and Sepharose CL-6B columns. Analysis of monosaccharide compositions showed that PPP-1a consisted of N -acetyl-galactosamine (GalNAc), galactose (Gal) and fucose (Fuc), PPP-1b of Fuc as the only monosaccharide and PPP-2 of glucuronic acid, GalNAc and Fuc. Sulfate contents of PPP, PPP-1a, PPP-1b and PPP-2 were determined to be 21.9%, 20.6%, 25.2% and 28.0% ( w / w ), respectively. PPP and PPP-1a had higher molecular weight and intrinsic viscosity than those of the PPP-1b and PPP-2. PPP, PPP-1a, PPP-1b and PPP-2 exhibited obvious activities of scavenging 1,1-diphenyl-2-picrylhydrazyl radical, hydroxyl radical, superoxide radical and ABTS radical in different extent, which suggested that the polysaccharides from Phyllophorus proteus may be novel agents having potential value for antioxidation.
Takeda, Takumi; Nakano, Yuki; Takahashi, Machiko; Sakamoto, Yuichi; Konno, Naotake
2013-08-07
Three genes encoding glycoside hydrolase family 12 (GH12) enzymes from Lentinula edodes, namely Lecel12A, Lecel12B, and Lecel12C, were newly cloned by PCR using highly conserved sequence primers. To investigate enzymatic properties, recombinant enzymes encoded by L. edodes DNAs and GH12 genes from Postia placenta (PpCel12A and PpCel12B) and Schizophyllum commune (ScCel12A) were prepared in Brevibacillus choshinensis. Recombinant LeCel12A, PpCel12A, and PpCel12B, which were grouped in GH12 subfamily 1, preferentially hydrolyzed 1,3-1,4-β-glucan. By contrast, LeCel12B, LeCel12C, and ScCel12A, members of the subfamily 2, exhibited specific hydrolysis of xyloglucan. These results suggest that two subfamilies of GH12 are separated based on the substrate specificity. Transcript levels of L. edodes genes increased 72 h after growth of L. edodes mycelia cells in the presence of plant cell wall polymers such as xyloglucan, 1,3-1,4-β-glucan, and cellulose. These results suggest that L. edodes GH12 enzymes have evolved to hydrolyze 1,3-1,4-β-glucan and xyloglucan, which might enhance hyphal extension and nutrient acquisition.
Cha, Youn Jeong; Alam, Nuhu; Lee, Jae Seong; Lee, Kyung Rim; Shim, Mi Ja; Lee, Min Woong; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Lee, Tae Soo
2012-12-01
Pleurotus nebrodensis is an edible and commercially available mushroom in Korea. This study was conducted in order to evaluate the anticancer and immunopotentiating activities of crude polysaccharides, extracted in methanol, neutral saline, and hot water (hereafter referred to as Fr. MeOH, Fr. NaCl, and Fr. HW, respectively) from the fruiting bodies of P. nebrodensis. β-Glucan and protein contents in Fr. MeOH, Fr. NaCl, and Fr. HW extracts of P. nebrodensis ranged from 23.79~36.63 g/100 g and 4.45~6.12 g/100 g, respectively. Crude polysaccharides were not cytotoxic against sarcoma 180, HT-29, NIH3T3, and RAW 264.7 cell lines at a range of 10~2,000 µg/mL. Intraperitoneal injection with crude polysaccharides resulted in a life prolongation effect of 11.76~27.06% in mice previously inoculated with sarcoma 180. Treatment with Fr. NaCl resulted in an increase in the numbers of spleen cells by 1.49 fold at the concentration of 50 µg/mL, compared with control. Fr. HW improved the immuno-potentiating activity of B lymphocytes through an increase in alkaline phosphatase activity by 1.65 fold, compared with control at 200 µg/mL. Maximum production of nitric oxide (14.3 µM) was recorded in the Fr. NaCl fraction at 200 µg/mL. Production of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) was significantly higher, compared to control, and IL-6 production was highest, in contrast to TNF-α, IL-1β, and positive control, concanavalin at the tested concentration of the various fractions. Results of the current study suggest that polysaccharides extracted from P. nebrodensis have a strong anticancer effect and may be useful as an ingredient of biopharmaceutical products for treatment of cancer.
2013-01-01
Background High quality RNA is a primary requisite for numerous molecular biological applications but is difficult to isolate from several plants rich in polysaccharides, polyphenolics and other secondary metabolites. These compounds either bind with nucleic acids or often co-precipitate at the final step and many times cannot be removed by conventional methods and kits. Addition of vinyl-pyrollidone polymers in extraction buffer efficiently removes polyphenolics to some extent, but, it failed in case of Azadirachta indica and several other medicinal and aromatic plants. Findings Here we report the use of adsorption property of activated charcoal (0.03%–0.1%) in RNA isolation procedures to remove complex secondary metabolites and polyphenolics to yield good quality RNA from Azadirachta indica. We tested and validated our modified RNA isolation method across 21 different plants including Andrographis paniculata, Aloe vera, Rosa damascena, Pelargonium graveolens, Phyllanthus amarus etc. from 13 other different families, many of which are considered as tough system for isolating RNA. The A260/280 ratio of the extracted RNA ranged between 1.8-2.0 and distinct 28S and 18S ribosomal RNA bands were observed in denaturing agarose gel electrophoresis. Analysis using Agilent 2100 Bioanalyzer revealed intact total RNA yield with very good RNA Integrity Number. Conclusions The RNA isolated by our modified method was found to be of high quality and amenable for sensitive downstream molecular applications like subtractive library construction and RT-PCR. This modified RNA isolation procedure would aid and accelerate the biotechnological studies in complex medicinal and aromatic plants which are extremely rich in secondary metabolic compounds. PMID:23537338
Vigor, Kim; Emerson, John; Scott, Robert; Cheek, Julia; Barton, Claire; Bax, Heather J; Josephs, Debra H; Karagiannis, Sophia N; Spicer, James F; Lentfer, Heike
2016-11-01
The presence of impurities or contaminants in biological products such as monoclonal antibodies (mAb) could affect efficacy or cause adverse reactions in patients. ICH guidelines (Q6A and Q6B) are in place to regulate the level of impurities within clinical drug products. An impurity less often reported and, therefore, lacking regulatory guideline is beta-glucan. Beta-glucans are polysaccharides of d-glucose monomers linked by (1-3) beta-glycosidic bonds, and are produced by prokaryotic and eukaryotic organisms, including plants. They may enter manufacturing processes via raw materials such as cellulose-based membrane filters or sucrose. Here we report the detection of beta-glucan contamination of a monoclonal IgE antibody (MOv18), manufactured in our facility for a first-in-human, first-in-class clinical trial in patients with cancer. Since beta-glucans have potential immunostimulatory properties and can cause symptomatic infusion reactions, it was of paramount importance to identify the source of beta-glucans in our product and to reduce the levels to clinically insignificant concentrations. We identified beta-glucans in sucrose within the formulation buffer and within the housing storage buffer of the virus removal filter. We also detected low level beta-glucan contamination in two of four commercially available antibodies used in oncology. Both formulation buffers contained sucrose. We managed to reduce levels of beta-glucan in our product 10-fold, by screening all sucrose raw material, filtering the sucrose by Posidyne® membrane filtration, and by incorporating extra wash steps when preparing the virus removal filter. The beta-glucan levels now lie within a range that is unlikely to cause clinically significant immunological effects. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1494-1502, 2016. © 2016 American Institute of Chemical Engineers.
Chen, Ching-Fu; Su, Chun-Han; Lai, Ming-Nan; Ng, Lean-Teik
2018-05-12
Polysaccharides including β-glucans are important bioactive components of mushroom. Xylaria nigripes is a popular medicinal fungus that has been used for treating trauma, insomnia and mental illness. This study examined the physicochemical characteristics and anti-inflammatory activities of water soluble non-digestible polysaccharides (TXNP and CXNP) from fruiting bodies of two cultivated X. nigripes strains (TXN and CXN). Results showed that both TXNP and CXNP possessed relatively similar FT-IR spectra. TXNP had a triple helix conformation and molecular weight of 853.8 kDa, whereas the molecular weight of CXNP was 14.7 kDa. The monosaccharide composition of TXNP was predominantly glucose, whereas CXNP contained xylose, mannose and glucose. Although both TXNP and CXNP dose-dependently suppressed the production of NO, IL-1β, TNF-α and PGE2, as well as the expression of iNOS, COX-2 and NF-κB in the lipopolysaccharide-induced RAW264.7 macrophages, the potency of TXNP was stronger. This study reveals that under similar conditions of cultivation and extraction procedures, the different physicochemical characteristics of polysaccharides from TXN and CXN may have contributed to the differences in their anti-inflammatory potency. Copyright © 2018. Published by Elsevier B.V.
Zhao, Chengcheng; Li, Xia; Miao, Jing; Jing, Songsong; Li, Xuejiao; Huang, Luqi; Gao, Wenyuan
2017-09-01
The rhizoma of Dioscorea hemsleyi (DH) has been used as a treatment of diabetes in China for hundreds of years. Polysaccharides in DH were extracted by using ultrasonic-assisted extraction (UAE), cold water extraction (CWE), warm water extraction (WWE) and hot water extraction (HWE), separately. Then the different characterizations of four DH polysaccharide (DHP) samples were analyzed by high-performance liquid chromatography (HPLC), high-performance Gel permeation chromatography (HGPC), ultraviolet-visible spectroscopy(UV), fourier transform-infrared spectroscopy (FT-IR) and scanning electron microscopy (SEM). Their activities in vitro of DHP were compared. Experimental results showed that HWE had the highest yield and large molecular weight. CWE had the highest uronic acid yield and little molecular weight, and its DPPH, AGI and AAI activity were the best. The molecular weight of UAE was small, and its RP and FRAP activity were the best. Four DHP samples had differences in the surface topography, while they all had the typical IR spectra characteristic of polysaccharides. According the correlation analysis, it showed that the more uronic acid and the lower molecular weight was, the higher the antioxidant activity was. The high content of monosaccharide composition of Xyl, Ara, GlcA and GalA, and little molecular weight have good effect on antidiabetic activity. Copyright © 2017 Elsevier B.V. All rights reserved.
Ohtani, K; Okai, K; Yamashita, U; Yuasa, I; Misaki, A
1995-03-01
An acidic polysaccharide was isolated from the water-soluble mucilage extracted from dried leaves of Corchorus olitorius, known as Moroheiya in Japan (3.0 g per 100 g). This polysaccharide showed a single peak in a Sepharose CL-6B column, and the specific rotation in H2O at 25 degrees C was +250 degrees. The polysaccharide was rich in uronic acid (65%), and consisted of rhamnose, glucose, galacturonic acid, and glucuronic acid in a molar ratio of 1.0:0.2:0.2:0.9:1.7, in addition to 3.7% of the acetyl group. A methylation analysis, Smith degradation study and fragmentation analysis suggested that this polysaccharide mainly consisted of O-4 substituted galacturonic acid and glucuronic acid, and O-2 substituted rhamnose residues, and that most of the (1-->4)-linked uronic acid residues were substituted at the O-3 position with glucuronic acid residues. This polysaccharide showed proliferative activity toward the murine splenocyte.
Popov, S V; Vinter, V G; Patova, O A; Markov, P A; Nikitina, I R; Ovodova, R G; Popova, G Yu; Shashkov, A S; Ovodov, Yu S
2007-07-01
The pectic polysaccharide named rauvolfian RS was obtained from the dried callus of Rauvolfia serpentina L. by extraction with 0.7% aqueous ammonium oxalate. Crude rauvolfian RS was purified using membrane ultrafiltration to yield the purified rauvolfian RSP in addition to glucan as admixture from the callus, with molecular weights 300 and 100-300 kD, respectively. A peroral pretreatment of mice with the crude and purified samples of rauvolfian (RS and RSP) was found to decrease colonic macroscopic scores, the total area of damage, and tissue myeloperoxidase activity in colons as compared with a colitis group. RS and RSP were shown to stimulate production of mucus by colons of the colitis mice. RSP appeared to be an active constituent of the parent RS. The glucan failed to possess anti-inflammatory activity.
Extraction, purification and anti-proliferative activities of polysaccharides from Lentinus edodes.
Zhao, Yong-Ming; Wang, Jin; Wu, Zhi-Gang; Yang, Jian-Ming; Li, Wei; Shen, Li-Xia
2016-12-01
In this study, the enzyme-assisted extraction of polysaccharides from Lentinus edodes (LEPs) was optimized by response surface methodology, and a preliminary characterization of the extracted LEPs and their anti-proliferative activities were investigated. An orthogonal assay was constructed to determine the optimal amounts of cellulase, papain and pectinase, which were 15, 20 and 15g/kg, respectively. Then effects of extraction conditions were evaluated and optimized using a Box-Behnken design. The results showed that the highest polysaccharides yield of 15.65% was achieved with an extraction temperature of 54°C, pH 5.0, enzymatic treatment time of 93min and a liquid/material ratio of 29:1mL/g, which correlated well with the predicted yield of 15.58%. Subsequently, the crude LEPs were further purified by DEAE-cellulose and Sephadex-100 chromatography to obtain two fractions, which were designated as LEP-1 and LEP-2 and their monosaccharide compositions were characterized by GC. Fourier-transform infrared spectra demonstrated that LEP-1 and LEP-2 were distinct from each other regarding their chemical structures. In addition, the LEPs exhibited inhibition of cell proliferation on HCT-116 and HeLa cells in vitro. In summary, this study provides an efficient enzyme-assisted extraction for LEPs, which can be used as natural antitumor agents in the pharmaceutical and functional food industries. Copyright © 2016 Elsevier B.V. All rights reserved.
Production of beta-glucan and related glucan-hydrolases by Botryosphaeria rhodina.
Crognale, S; Bruno, M; Fidaleo, M; Moresi, M; Petruccioli, M
2007-03-01
Characterization of beta-glucan production from Botryosphaeria rhodina DABAC-P82 by detecting simultaneously glucan-hydrolytic enzymes and their localization, culture medium rheology and oxygen transfer. Mycelium growth, beta-glucan production, substrate consumption and glucan-hydrolytic enzymes were monitored both in shaken flasks and in a 3-l stirred-tank bioreactor. Glucan production (19.7 and 15.2 g l(-1), in flask and bioreactor, respectively) was accompanied by extra-cellular and cell-bound beta-glucanase and beta-glucosidase activities. In the bioreactor scale, in the time interval of 0-78 h the apparent viscosity of the culture broth exhibited a general increase; thereafter, it began to reduce, probably because of the above glucan-hydrolytic activities. Moreover, the culture media collected after 45 h behaved as solid-like materials at shear rates smaller than 0.001 s(-1), as pseudo-plastic liquids in the middle shear rate range and as Newtonian ones at shear rates greater than 1000 s(-1). The greatest beta-glucan accumulation in the bioreactor was found to be associated with nitrogen and dissolved oxygen concentrations smaller than 0.15 g l(-1) and 25%, respectively, and with the peak points of the glucan-degrading enzymes. A careful analysis of the critical factors (such as, culture broth rheology, oxygen mass transfer and glucan-hydrolytic enzymes) limiting the beta-glucan production by B. rhodina is a prerequisite to maximize beta-glucan yield and production, as well as to define the process flow sheet capable of maximizing biopolymer recovery, solvent re-utilization and glucose consumption.
Tessari, Paolo; Lante, Anna
2017-01-01
Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350
Qian, Zhi-Gang
2014-01-30
In this study, cellulase-assisted extraction of water soluble polysaccharides from pumpkin (Cucurbita moschata) and their antibacterial activity were investigated. The polysaccharides yield was monitored during the extraction process. The optimum extraction conditions were determined as follows: time, 40 min; temperature, 55°C; pH, 4.5; and cellulase amount, 4,000 U/g. The extracts were centrifuged, filtered, proteins removed by Sevag method, concentrated to approximately 15% (w/v), precipitated with 5 volumes of absolute ethanol, freeze-dried, and pulverized to yield a water soluble powder of pumpkin polysaccharides (PP). The sugar content of the product was 68.3%, and the yield was 17.34% (w/w), respectively. The PP had high antibacterial activity against Bacillus subtilis, Staphylococcus aureus, and Escherichia coli at the concentration of 100 mg/mL. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Nguyen, Hoang Chinh; Thi, Dinh Huynh Mong; Pham, Dinh Chuong
2018-04-01
Polysaccharides from fruiting body of Cordyceps militaris (L.) Link possess various pharmaceutical activities. In this study, polysaccharides from the fruiting body of C. militaris were extracted with different solvents. Of those solvents tested, distilled water was identified as the most efficient solvent for the extraction, resulting in a significant increase in polysaccharides yield. Response surface methodology was then used to optimize the extraction conditions and establish a reliable mathematical model for prediction. A maximum polysaccharides yield of 11.07% was reached at a ratio of water to raw material of 23.2:1 mL/g, an extraction time of 76 min, and a temperature of 93.6°C. This study indicates that the obtained optimal extraction conditions are an efficient method for extraction of polysaccharides from the fruiting body of C. militaris.
Radioprotection by polysaccharides alone and in combination with aminothiols
NASA Astrophysics Data System (ADS)
Patchen, Myra L.; Macvittie, Thomas J.; Solberg, Brian D.; D'Alesandro, Michele M.; Brook, Itzhak
We demonstrated that glucan, a beta-1,3 polysaccharide immunomodulator, enhances survival of mice when administered before radiation exposure. Glucan's prophylactic survival-enhancing effects are mediated by several mechanisms including (1) increasing macrophage-mediated resistance to potentially lethal postirradiation opportunistic infections, (2) increasing the Do of hematopoietic progenitor cells, and (3) accelerating hematopoietic reconstitution. In addition, even when administered shortly after some otherwise lethal doses of radiation, glucan increases survival. Glucan's therapeutic survival-enhancing effects are also mediated through its ability to enhance macrophage function and to accelerate hematopoietic reconstitution; glucan's therapeutic potential, however, is ultimately dependent on the survival of a critical number of hematopoietic stem cells capable of responding to glucan's stimulatory effects. Preirradiation administration of the traditional aminothiol radioprotectants WR-2721 and WR-3689 has been previously demonstrated to be an extremely effective means to increase hematopoietic stem cell survival. Therapeutic glucan treatment administered in combination with preirradiation WR-2721 or WR-3689 treatment synergistically increases both hematopoietic reconstitution and survival. Such combined modality treatments offer new promise in treating acute radiation injury.
Xu, Qi-Xin; Shi, Jun-Jun; Zhang, Jian-Guo; Li, Ling; Jiang, Li; Wei, Zhao-Jun
2016-12-01
Plant polysaccharides are widely used in food industry as thickening and gelling agents and these attributes largely depend on their thermal, emulsifying and rheological properties. As known, the extraction methods always bring about the diversification of property and functions of polysaccharides. Thus, the Vaccinium bracteatum Thunb leaves polysaccharides (VBTLP) were sequentially extracted using hot buffer (HBSS), chelating agent (CHSS), dilute alkaline (DASS) and concentrated alkaline (CASS). The thermal, emulsifying and rheological properties of VBTLP were investigated in the present study. Within the range of 20-225°C, CHSS showed the highest peak temperature, whereas HBSS displayed the highest endothermic enthalpy and highest emulsifying activity, while, CASS showed the longest emulsifying stability. The VBTLP solutions exhibited non-Newtonian shear-thinning behavior within the concentrations of 0.6-2.5%. The apparent viscosity of VBTLP solution decreased under following conditions: acidic pH (4.0), alkaline pH (10.0), in the presence of Ca 2+ and at high temperature, while it increased in the presence of Na + and at freezing conditions. The modulus G' and G″ of VBTLP solutions were increased with increasing oscillation frequency, and the crossover frequency shifted to lower values when the polysaccharide content increased. The above results of thermal, emulsifying and rheological properties of VBTLPs supplied the basis for V. bracteatum leaves in potential industrial applications of foods. Copyright © 2016 Elsevier B.V. All rights reserved.
Li, Fengwei; Gao, Jian; Xue, Feng; Yu, Xiaohong; Shao, Tao
2016-03-23
Extraction of polysaccharides from Gynura medica (GMPs) was optimized by response surface methodology (RSM). A central composition design including three parameters, namely extraction temperature (X₁), ratio of water to raw material (X₂) and extraction time (X₃), was used. The best conditions were extraction temperature of 91.7 °C, extraction time of 4.06 h and ratio of water to raw material of 29.1 mL/g. Under the optimized conditions, the yield of GMPs was 5.56%, which was similar to the predicted polysaccharides yield of 5.66%. A fraction named GMP-1 was obtained after isolation and purification by DEAE-52 and Sephadex G-100 gel chromatography, respectively. GMP-1, with a molecular weight of 401 kDa, mainly consisted of galacturonic acid (GalA), xylose (Xyl), glucose (Glu). Infrared spectroscopy was used to characterize the major functional groups of GMP-1 and the results indicated that it was an acidic polysaccharide. The antioxidant and α-glucosidase inhibitory activities of GMPs and GMP-1 were determined in vitro. The results indicated that GMPs and GMP-1 show potential for use in functional foods or medicines.
de Lourdes Corradi da Silva, Maria; Fukuda, Eliane K; Vasconcelos, Ana Flora D; Dekker, Robert F H; Matias, Andreza C; Monteiro, Nilson K; Cardoso, Marilsa S; Barbosa, Aneli M; Silveira, Joana L M; Sassaki, Guilherme L; Carbonero, Elaine R
2008-03-17
Three D-glucans were isolated from the mycelium of the fungus Botryosphaeria rhodina MAMB-05 by sequential extraction with hot-water and hot aqueous KOH (2% w/v) followed by ethanol precipitation. Following their purification by gel permeation chromatography on Sepharose CL-4B, the structural characteristics of the D-glucans were determined by FT-IR and 13C NMR spectroscopy and, after methylation, by GC-MS. The hot-water extract produced a fraction designated Q1A that was a beta-(1-->6)-D-glucan with the following structure: [Formula: see text] The alkaline extract, when subjected to repeated freeze-thawing, yielded two fractions: K1P (insoluble) that comprised a beta-(1-->3)-D-glucan with beta-D-glucose branches at C-6 with the structure: [Formula: see text] and K1SA (soluble) consisting of a backbone chain of alpha-(1-->4)-linked D-glucopyranosyl residues substituted at O-6 with alpha-D-glucopyranosyl residues: [Formula: see text
Action of an endo-β-1,3(4)-glucanase on cellobiosyl unit structure in barley β-1,3:1,4-glucan
Kuge, Takao; Nagoya, Hiroki; Tryfona, Theodora; Kurokawa, Tsunemi; Yoshimi, Yoshihisa; Dohmae, Naoshi; Tsubaki, Kazufumi; Dupree, Paul; Tsumuraya, Yoichi; Kotake, Toshihisa
2015-01-01
β-1,3:1,4-Glucan is a major cell wall component accumulating in endosperm and young tissues in grasses. The mixed linkage glucan is a linear polysaccharide mainly consisting of cellotriosyl and cellotetraosyl units linked through single β-1,3-glucosidic linkages, but it also contains minor structures such as cellobiosyl units. In this study, we examined the action of an endo-β-1,3(4)-glucanase from Trichoderma sp. on a minor structure in barley β-1,3:1,4-glucan. To find the minor structure on which the endo-β-1,3(4)-glucanase acts, we prepared oligosaccharides from barley β-1,3:1,4-glucan by endo-β-1,4-glucanase digestion followed by purification by gel permeation and paper chromatography. The endo-β-1,3(4)-glucanase appeared to hydrolyze an oligosaccharide with degree of polymerization 5, designated C5-b. Based on matrix-assisted laser desorption/ionization (MALDI) time-of-flight (ToF)/ToF-mass spectrometry (MS)/MS analysis, C5-b was identified as β-Glc-1,3-β-Glc-1,4-β-Glc-1,3-β-Glc-1,4-Glc including a cellobiosyl unit. The results indicate that a type of endo-β-1,3(4)-glucanase acts on the cellobiosyl units of barley β-1,3:1,4-glucan in an endo-manner. PMID:26027730
López-García, Marta; García, María Sonia Dopico; Vilariño, José Manuel López; Rodríguez, María Victoria González
2016-05-15
In this work MALDI-TOF mass spectroscopy was investigated to characterise the β-glucan profiles of several commercial health supplements, without any derivatisation or purification pre-treatment. The effect of two solvents (water and dimethyl sulfoxide) and two MALDI matrices (2,5-dihydroxybenzoic acid and 2',4',6'-trihydroxyacetophenone) was first evaluated on dextran standards. MALDI-TOF was found as a useful and quick technique to obtain structural information of diverse food supplements based on mushroom extracts. The MALDI polysaccharide profiles of 5 supplements from different mushroom species were qualitatively similar showing [Glucan+Na](+) cations with a peak-to-peak mass difference of 16 Da consistent with the repeating unit of the β-(1→3)-glucan. The profiles strongly depended on the sample solvent used, with m/z values around 5000-8000 for water and 2000 for dimethyl sulfoxide; differences between samples were revealed in the molecular weight of the aqueous preparation, with the highest values for Maitake and Cordyceps species. Copyright © 2015 Elsevier Ltd. All rights reserved.
Palacios, Irene; García-Lafuente, Ana; Guillamón, Eva; Villares, Ana
2012-09-01
Novel water-soluble polysaccharides have been isolated from the fruiting bodies of the edible mushroom Pleurotus ostreatus. Three polysaccharide fractions were obtained by ethanol precipitation from cold water, hot water and hot aqueous NaOH extracts. The fractions were purified by size exclusion chromatography showing a unique carbohydrate occurring in each fraction: PC from the cold fraction, PH from the hot fraction and PB from the hot aqueous NaOH fraction. The analysis of the methylated alditol acetates and the NMR studies revealed that all the polysaccharides displayed a linear backbone. PC was formed by α-(1→3),(1→6)-linked galactopyranosyl residues whereas PH and PB consisted of glucose-linked units. PH was exclusively composed of glucopyranosyl units bound by α-(1→4) linkages whereas PB was a β-linked glucan showing (1→3) and (1→6) glycosidic bonds. The analysis of molecular arrangement by complexation with Congo red showed that only the β-linked polysaccharide (PB) displayed a triple helix conformation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Dectin-1 is required for β-glucan recognition and control of fungal infection
Taylor, Philip R; Tsoni, S Vicky; Willment, Janet A; Dennehy, Kevin M; Rosas, Marcela; Findon, Helen; Haynes, Ken; Steele, Chad; Botto, Marina; Gordon, Siamon; Brown, Gordon D
2007-01-01
β-Glucan is one of the most abundant polysaccharides in fungal pathogens, yet its importance in antifungal immunity is unclear. Here we show that deficiency of dectin-1, the myeloid receptor for β-glucan, rendered mice susceptible to infection with Candida albicans. Dectin-1-deficient leukocytes demonstrated significantly impaired responses to fungi even in the presence of opsonins. Impaired leukocyte responses were manifested in vivo by reduced inflammatory cell recruitment after fungal infection, resulting in substantially increased fungal burdens and enhanced fungal dissemination. Our results establish a fundamental function for β-glucan recognition by dectin-1 in antifungal immunity and demonstrate a signaling non–Toll-like pattern-recognition receptor required for the induction of protective immune responses. PMID:17159984
Ben Salem, Yosra; Abdelhamid, Amal; Mkadmini Hammi, Khaoula; Le Cerf, Didier; Bouraoui, Abderrahman; Majdoub, Hatem
2017-10-01
Microwave-assisted extraction was employed for the isolation of polysaccharides from Posidonia oceanica (PPO). The extracting parameters were optimized adopting response surface methodology. The highest polysaccharide yield (2.55 ± 0.09%), which is in concordance with the predicted value (2.76%), was obtained under the following conditions: extraction time 60 s, liquid-solid ratio of 50:1 (mL/g) and power of 800 W. This polysaccharide, with molecular weight of 524 KDa, characterized by gas chromatography-mass spectrometry showed that PPO was mainly composed of galactose, glucose, and arabinose with molar percentages 25.38, 24.37, and 21.64%, respectively. The pharmacological evaluation of PPO using animal models at the dose of 100 mg/kg indicated a significant anti-inflammatory activity with a percentage of inhibition of edema of 54.65% and a significant antinociceptive activity with 78.91% inhibition of writhing for peripheral analgesic activity and an increase in the hot plate reaction time for central analgesic activity.
Anti-inflammatory and angiogenic activity of polysaccharide extract obtained from Tibetan kefir.
Prado, Maria Rosa Machado; Boller, Christian; Zibetti, Rosiane Guetter Mello; de Souza, Daiany; Pedroso, Luciana Lopes; Soccol, Carlos Ricardo
2016-11-01
The search for new bioactive molecules is a driving force for research pharmaceutical industries, especially those molecules obtained from fermentation. The molecules possessing angiogenic and anti-inflammatory attributes have attracted attention and are the focus of this study. Angiogenic activity from kefir polysaccharide extract, via chorioallantoic membrane assay, exhibited a pro-angiogenic effect compared with vascular endothelial factor (pro-angiogenic) and hydrocortisone (anti-angiogenic) activity as standards with an EC50 of 192ng/mL. In terms of anti-inflammatory activity determined via hyaluronidase enzyme assay, kefir polysaccharide extract inhibited the enzyme with a minimal activity of 2.08mg/mL and a maximum activity of 2.57mg/mL. For pharmaceutical purposes, kefir polysaccharide extract is considered to be safe because it does not inhibit VERO cells in cytotoxicity assays. Copyright © 2016 Elsevier Inc. All rights reserved.
Zha, Shenghua; Zhao, Qingsheng; Chen, Jinjin; Wang, Liwei; Zhang, Guifeng; Zhang, Hong; Zhao, Bing
2014-10-13
Water-soluble polysaccharides were separated from maca (Lepidium meyenii) aqueous extract (MAE). The crude polysaccharides were deproteinized by Sevag method. During the preparation process of maca polysaccharides, amylase and glucoamylase effectively removed starch in maca polysaccharides. Four Lepidium meyenii polysaccharides (LMPs) were obtained by changing the concentration of ethanol in the process of polysaccharide precipitation. All of the LMPs were composed of rhamnose, arabinose, glucose and galactose. Antioxidant activity tests revealed that LMP-60 showed good capability of scavenging hydroxyl free radical and superoxide radical at 2.0mg/mL, the scavenging rate was 52.9% and 85.8%, respectively. Therefore, the results showed that maca polysaccharides had a high antioxidant activity and could be explored as the source of bioactive compounds. Copyright © 2014 Elsevier Ltd. All rights reserved.
Glucan common to the microcyst walls of cyst-forming bacteria.
Sutherland, I W; Mackenzie, C L
1977-01-01
Chemical analysis indicated that D-glucose is tha major neutral monosaccharide present in the microcysts of a range of gram-negative bacteria. Varying amounts of other neutral sugars were found. The glucose was mainly present as a glucan that could be extracted from microcysts of representative strains with alkali or mild acid treatment. The glucan could be identified as an alpha-1,3-linked polymer on the basis of (i) periodate resistance of the extracted polymer and the material present in microcysts; (ii) lectin agglutination of the microcysts; (iii) lectin precipitation of the extracted glucans; and (iv) susceptibility of the glucan either in the walls or after extraction to a specific alpha-1,3-glucanase from Aspergillus nidulans, yielding glucose as the sole hydrolysis product. The galactosamine found in microcysts of Myxococcus xanthus by other workers is clearly a component of another polymer, distinct from the glucan. The presence of an alpha 1,3-linked glucan, common to microcyst walls of various bacterial genera, probably contributes to the rigidity of the walls of these forms and, inter alia, to their resistance to ultrasonic treatment. Preliminary experiments indicate that the gulcan is discarded on germination of the microcysts rather than being broken down by specific enzymes. PMID:402353
Zhao, Yong-Ming; Song, Jin-Hui; Wang, Jin; Yang, Jian-Ming; Wang, Zhi-Bao; Liu, Ying-Hui
2016-10-01
Tricholoma mongolicum Imai is a well-known edible and medicinal mushroom which in recent years has attracted increasing attention because of its bioactivities. In this study, water-soluble polysaccharides were extracted from T. mongolicum Imai by cellulase-assisted extraction and their antioxidant activities were investigated. In order to improve the yield of polysaccharides, four variables, cellulase amount (X1 ), pH (X2 ), temperature (X3 ) and extraction time (X4 ), were investigated with a Box-Behnken design. The optimal conditions were predicted to be cellulase amount of 20 g kg(-1) , pH of 4.0, temperature of 50 °C and extraction time of 127 min, with a predicted polysaccharide yield of 190.1 g kg(-1) . The actual yield of polysaccharides under these conditions was 189.6 g kg(-1) , which matched the predicted value well. The crude polysaccharides were purified to obtain four fractions, and characterization of each was carried out. In addition, antioxidant properties of four polysaccharides assessed by 1,1-diphenyl-2-picryldydrazyl (DPPH) and hydroxyl radical-scavenging assays indicated that polysaccharides from T. mongolicum Imai (TMIPs) possessed antioxidant activity in a dose-dependent manner. TMIPs show moderate antioxidant activities in vitro. Therefore it is suggested that TMIPs are potential natural antioxidants for use in functional foods. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Cardone, Marco; Dzutsev, Amiran K.; Li, Hongchuan; Riteau, Nicolas; Gerosa, Franca; Shenderov, Kevin; Winkler-Pickett, Robin; Provezza, Lisa; Riboldi, Elena; Leighty, Robert M.; Orr, Selinda J.; Steinhagen, Folkert; Wewers, Mark D.; Sher, Alan; Anderson, Stephen K.; Goldszmid, Romina; McVicar, Daniel W.
2014-01-01
Recognition of microbial components via innate receptors including the C-type lectin receptor Dectin-1, together with the inflammatory environment, programs dendritic cells (DCs) to orchestrate the magnitude and type of adaptive immune responses. The exposure to β-glucan, a known Dectin-1 agonist and component of fungi, yeasts, and certain immune support supplements, activates DCs to induce T helper (Th)17 cells that are essential against fungal pathogens and extracellular bacteria but may trigger inflammatory pathology or autoimmune diseases. However, the exact mechanisms of DC programming by β-glucan have not yet been fully elucidated. Using a gene expression/perturbation approach, we demonstrate that in human DCs β-glucan transcriptionally activates via an interleukin (IL)-1- and inflammasome-mediated positive feedback late-induced genes that bridge innate and adaptive immunity. We report that in addition to its known ability to directly prime T cells toward the Th17 lineage, IL-1 by promoting the transcriptional cofactor inhibitor of κB-ζ (IκB-ζ) also programs β-glucan-exposed DCs to express cell adhesion and migration mediators, antimicrobial molecules, and Th17-polarizing factors. Interferon (IFN)-γ interferes with the IL-1/IκB-ζ axis in β-glucan-activated DCs and promotes T cell-mediated immune responses with increased release of IFN-γ and IL-22, and diminished production of IL-17. Thus, our results identify IL-1 and IFN-γ as regulators of DC programming by β-glucan. These molecular networks provide new insights into the regulation of the Th17 response as well as new targets for the modulation of immune responses to β-glucan-containing microorganisms. PMID:25474109
Cantu-Jungles, Thaisa Moro; Almeida, Carolina Pierobom de; Iacomini, Marcello; Cipriani, Thales R; Cordeiro, Lucimara M C
2015-05-20
Primary cell wall polysaccharides from aqueous extract of buriti fruit pulp (Mauritia flexuosa, an exotic tropical palm) were isolated and characterized. After freeze-thaw and α-amylase treatments, extracted polysaccharides were purified by sequential ultrafiltration through membranes. Two homogeneous fractions were obtained, SBW-100R and SBW-30R (Mw of 126 kDa and 20 kDa, respectively). Monosaccharide composition, methylation and (13)C NMR analysis showed that fraction SBW-100R contained a (1 → 5)-linked arabinan, branched at O-3 and O-2 positions, linked to a type I rhamnogalacturonan. Low amounts of these polymers were also present in fraction SBW-30R according to (13)C NMR analysis and monosaccharide composition. However, a high methyl esterified homogalacturonan (HG) was present in higher proportions. These results reinforce previous findings present in literature data which indicate that pectic polysaccharides are found in high amounts in primary cell walls of palms, which are commelinid monocotyledons. Copyright © 2015 Elsevier Ltd. All rights reserved.
Bayar, Nadia; Kriaa, Mouna; Kammoun, Radhouane
2016-11-01
The chemical extraction and the characterization of polysaccharides from mucilage (MC), pectin (PC) and total pectic mucilage fraction (TFC) of Opuntia ficus indica cladodes as well as the evaluation of their antioxidant activities was investigated. The FTIR spectroscopic analysis revealed the presence of carboxyl and hydroxyl groups corresponding to polysaccharides. Uronic acid and the total sugar contents of PC were higher than those of TFC and MC whereas ash content of MC was considerably more important. In addition, the findings showed that all the samples had little protein content and low average molecular weight compared to the results mentioned in literature. Furthermore, MC reached not only the highest water (WHC) and oil holding (OHC) capacities (7.81g/g and 1.34g/g, respectively) but also the highest antioxidant properties (DPPH and ABTS scavenging activities, β-carotene bleaching inhibition activity and reducing power). However, PC had the strongest emulsifying and foaming properties. As for TFC, it had low WHC, OHC and emulsifying properties whereas it had higher foaming properties than MC and greater antioxidant properties compared to PC. These outcomes can encourage the use of PC as a surfactant and MC and TFC as natural antioxidants in food and pharmaceutical industries. Copyright © 2016 Elsevier B.V. All rights reserved.
Lyu, Qianqian; Jiao, Wenqian; Zhang, Keke; Bao, Zhenmin; Wang, Shi; Liu, Weizhi
2016-12-16
Marine polysaccharides are used in a variety of applications, and the enzymes that degrade these polysaccharides are of increasing interest. The main food source of herbivorous marine mollusks is seaweed, and several polysaccharide-degrading enzymes have been extracted from mollusk digestive glands (hepatopancreases). Here, we used a comprehensive proteomic approach to examine the hepatopancreatic proteins of the Zhikong scallop (Chlamys farreri). We identified 435 proteins, the majority of which were lysosomal enzymes and carbohydrate and protein metabolism enzymes. However, several new enzymes related to polysaccharide metabolism were also identified. Phylogenetic and structural analyses of these enzymes suggest that these polysaccharide-degrading enzymes may have a variety of potential substrate specificities. Taken together, our study characterizes several novel polysaccharide-degrading enzymes in the scallop hepatopancreas and provides an enhanced view of these enzymes and a greater understanding of marine polysaccharide digestion.
Yang, Xiu-Yan; Xue, Zhi-Yuan; Yang, Ya-Fei; Fang, Yao-Yao; Zhou, Xiang-Lin; Zhao, Liang-Gong; Feng, Shi-Lan
2018-06-01
In this study, complex enzymes combined with ultrasonic extraction technology(MC) were used, to select optimal extraction combinations by single factor and orthogonal test, with Hedysarum polysaccharides yield and content as the comprehensive indexes. The components, physicochemical properties and antioxidant activity of Hedysarum polysaccharides from complex enzyme combined with ultrasonic extraction(HPS-MC)and the Hedysarum polysaccharides from hot water extraction(HPS-R)were analyzed. The results showed that:complex enzymes had significant effect on the yield and content of Hedysarum polysaccharides, and the ultrasonic power could significantly improve the content of Hedysarum polysaccharides. The optimum technological parameters were as follows: complex enzyme ratio 1:1, ultrasonic power 105 W, ultrasonic time 60 min, and enzymatic hydrolysis pH 5, achieving (14.01±0.64)% and (92.45±1.47)% respectively for the yield and content of Polysaccharides. As compared with HPS-R, the molecular weight, absolute viscosity and protein content of HPS-MC were decreased, while the content of uronic acid was increased. In the antioxidant system, the concentration of polysaccharide was within the range of 1-7 g·L⁻¹; the antioxidant activity of HPS-MC was higher than that of HPS-R, and HPS-MC (80%) with the lowest molecular weight showed a significant dose effect relationship with the increase of the experimental concentration. In conclusion, MC is a simple, convenient, economical and environmentally friendly extraction technology, and the Hedysarum polysaccharides extracted by this method have obvious antioxidant activity. Copyright© by the Chinese Pharmaceutical Association.
Liang, Tu; Fu, Qing; Xin, Huaxia; Li, Fangbing; Jin, Yu; Liang, Xinmiao
2014-12-01
Water-soluble polysaccharides from traditional Chinese medicine (TCM) have properties of broad-spectrum treatment and low toxicity, making them as important components in natural medicines and health products. In order to solve the problem of polysaccharides characterization caused by their complex structures, a "bottom-up" approach was developed to complete the characterization of polysaccharides from Astragalus. Firstly, Astragalus pieces were extracted with hot water and then were precipitated by ethanol to obtain Astragalus polysaccharides. Secondly, a partial acid hydrolysis method was carried out and the effects of time, acid concentration and temperature on hydrolysis were investigated. The degree of hydrolysis increased along with the increase of hydrolysis time and acid concentration. The temperature played a great role in the hydrolysis process. No hydrolysis of the polysaccharides occurred at low temperature, while the polysaccharides were almost hydrolyzed to monosaccharide at high temperature. Under the optimum hydrolysis conditions (4 h, 1.5 mol/L trifluoroacetic acid, and 80 °C), Astragalus polysaccharides were hydrolyzed to characteristic oligosaccharide fragments. At last, a hydrophilic liquid chromatography-mass spectrometry method was used for the separation and structural characterization of the polysaccharide hydrolysates. The results showed that the resulting polysaccharides were mainly 1--> 4 linear glucan, and gluco-oligosaccharides with the degrees of polymerization (DP) of 4 - 11 were obtained after partial acid hydrolysis. The significance of this study is that it is the guidance for the characterization of other TCM polysaccharides.
Shi, Jinming; Cheng, Cuilin; Zhao, Haitian; Jing, Jing; Gong, Ning; Lu, Weihong
2013-09-01
Polysaccharides with different molecular weights were extracted from Ulva pertusa and fractionated by ultrafiltration. Iron(III) complex of the low molecular-weight U. pertusa polysaccharides were synthesized. Atomic absorption spectrum showed that the iron content of iron(III)-polysaccharide complex was 27.4%. The comparison between U. pertusa polysaccharides and their iron(III) complex showed that iron chelating altered the structural characteristics of the polysaccharides. The bioactivity analysis showed that polysaccharide with low molecular weight was more effective than polysaccharide with high molecular weight in protecting mice from radiation induced damages on bone marrow cells and immune system. Results also proved that the anti-radiation and anti-oxidative activity of iron(III) complex of low molecular-weight polysaccharides were not less than that of low molecular-weight polysaccharides. Copyright © 2013 Elsevier B.V. All rights reserved.
Kim, Hoon; Kwak, Bong-Shin; Hong, Hee-Do; Suh, Hyung-Joo; Shin, Kwang-Soon
2016-06-01
Four polysaccharide fractions were isolated from young barley leaves treated with or without pectinase followed by ethanol fractionation. Among the polysaccharide fractions, BLE-P isolated from pectinase digested with a high molecular weight had the most enhanced macrophage stimulatory activity, indicating that pectinase digestion of barley leaf is a useful method for enhancement of its activity. BLE-P was further purified by column chromatography to identify the chemical and structural properties. BLE-P-I eluted in void volume fraction showed potent macrophage stimulatory activity. Monosaccharide composition and linkage analysis indicated that at least three kinds of polysaccharide, that is, glucuronoarabinoxylan (GAX; 40-45%), rhamnogalacturonan-I (RG-I) with branching mainly involving a type II arabinogalactan (AG-II) side chain (30-35%), and linear glucan such as starch and cellulose (less than 10%) coexisted in BLE-P-I. Given the association with macrophage stimulatory activity, it is likely that the GAX and to the RG-I polysaccharide branched with an AG-II side chain may be important for expression of the activity in barley leaf. Copyright © 2016 Elsevier B.V. All rights reserved.
Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria
Arena, Mattia P.; Caggianiello, Graziano; Fiocco, Daniela; Russo, Pasquale; Torelli, Michele; Spano, Giuseppe; Capozzi, Vittorio
2014-01-01
Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed. PMID:24562330
Jonathan, Melliana C; Haenen, Daniëlle; Souza da Silva, Carol; Bosch, Guido; Schols, Henk A; Gruppen, Harry
2013-03-01
To investigate the effect of resistant starch to the degradation of other non-starch polysaccharides (NSPs) in the large intestine of pigs, two groups of pigs were fed either a diet containing digestible starch (DS) or a diet containing resistant starch (RS). Both diets contained NSPs from wheat and barley. Digesta from different parts of the large intestine were collected and analysed for sugar composition and carbohydrate-degrading-enzyme activities. Resistant starch, as well as β-glucans and soluble arabinoxylan, was utilised mainly in the caecum. The utilisation of β-glucans and soluble arabinoxylan in the caecum was higher in DS-fed pigs than in RS-fed pigs. Analyses on carbohydrate-degrading-enzyme activities demonstrated that microbial enzyme production was stimulated according to the diet composition, and the enzyme profile throughout the large intestine of RS-fed pigs indicated that the presence of resistant starch shifted the utilisation of NSPs to more distal parts of the colon. Copyright © 2012 Elsevier Ltd. All rights reserved.
Antioxidant and immunoregulatory activity of alkali-extractable polysaccharides from mung bean.
Yao, Yang; Zhu, Yingying; Ren, Guixing
2016-03-01
Alkali-extractable polysaccharides from the seeds of mung beans and two polysaccharide sub-fractions (MAP-1 and MAP-2) were isolated and purified by anion-exchange and gel filtration chromatography. The average molecular weights (Mws) of MAP-1 and MAP-2 were 94.2 kDa and 60.4 kDa, respectively. Monosaccharide component analysis indicated that MAP-1 was composed of Rha, Ara, Glu, Gal, and GalA in a molar ratio of 1.1:0.4:0.7:0.5:0.3. MAP-2 consisted of Xyl, Rha, Gal, Glu and GalA with a relative molar ratio of 0.4:1.4:1.6:0.5:0.2. Antioxidant assays indicated that both MAP-1 and MAP-2 exhibit significant antioxidant activity in a dose-dependent manner. An in vitro study further showed that MAP-1 and MAP-2 were both able to stimulate the production of secretory molecules (NO, TNF-α and IL-6) by RAW 264.7 murine macrophages in a concentration-dependent manner. These findings suggest that the polysaccharides isolated in our study have immunoregulatory effects on macrophages and can be used as a beneficial health food. Copyright © 2015. Published by Elsevier B.V.
Biosynthesis of a (1. -->. 4)-. beta. -D-glucan. [Lupinus albus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brummond, D.O.
1983-01-01
An enzymatic activity isolated from Lupinus albus that produced an insoluble (1..-->..4)-..beta..-D-glucan from UDP-D-glucose has been solubilized and partially purified. Some of the properties of the enzyme system have been characterized. A proposed sequence of reactions between UDP-D-glucose and the final dextran may involve a (1..-->..4)-..beta..-linked polysaccharide bonded to UDP.
Dendritic Cell Activation by Glucan Isolated from Umbilicaria Esculenta
Kim, Hyung Sook; Kim, Jee Youn; Lee, Hong Kyung; Kim, Moo Sung; Lee, Sang Rin; Kang, Jong Soon; Kim, Hwan Mook; Lee, Kyung-Ae; Hong, Jin Tae; Kim, Youngsoo
2010-01-01
Background Lichen-derived glucans have been known to stimulate the functions of immune cells. However, immunostimulatory activity of glucan obtained from edible lichen, Umbilicaria esculenta, has not been reported. Thus we evaluated the phenotype and functional maturation of dendritic cells (DCs) following treatment of extracted glucan (PUE). Methods The phenotypic and functional maturation of PUE-treated DCs was assessed by flow cytometric analysis and cytokine production, respectively. PUE-treated DCs was also used for mixed leukocyte reaction to evaluate T cell-priming capacity. Finally we detected the activation of MAPK and NF-κB by immunoblot. Results Phenotypic maturation of DCs was shown by the elevated expressions of CD40, CD80, CD86, and MHC class I/II molecules. Functional activation of DCs was proved by increased cytokine production of IL-12, IL-1β, TNF-α, and IFN-α/β, decreased endocytosis, and enhanced proliferation of allogenic T cells. Polymyxin B, specific inhibitor of lipopolysaccharide (LPS), did not affect PUE activity, which suggested that PUE was free of LPS contamination. As a mechanism of action, PUE increased phosphorylation of ERK, JNK, and p38 MAPKs, and enhanced nuclear translocation of NF-κB p50/p65 in DCs. Conclusion These results indicate that PUE induced DC maturation via MAPK and NF-κB signaling pathways. PMID:21286379
Chen, Guangjing; Chen, Kewei; Zhang, Renfeng; Chen, Xiaolong; Hu, Peng; Kan, Jianquan
2018-04-15
In this study, an efficient accelerated solvent extraction (ASE) technology was applied for rapid extraction of polysaccharides from the processing by-products of Chimonobambusa quadrangularis (CPS). The extraction yields, physicochemical characterization, and antioxidant activities of CPS obtained by ASE and hot water extraction (HWE) were further compared. A maximal ASE-CPS yield was obtained by optimized extraction conditions (temperature 126 °C, 2 cycles, and 22 min) using response surface methodology. The yield of polysaccharides from ASE (9.96% ± 0.39%) was significantly higher than that from HWE (7.16% ± 0.32%). Differences were found between ASE and HWE with the chemical composition, molecular weight distribution, rheological property, and antioxidant activities of the obtained polysaccharides, while the primary structure remained the same. ASE-CPS exhibited better chemical antioxidant activities in oxygen radical absorbance capacity (ORAC), reducing power, and DPPH and hydroxyl radical scavenging ability, whereas HWE-CPS displayed higher activity in metal chelating activity assay. Copyright © 2017 Elsevier Ltd. All rights reserved.
Jiang, Zheng; Wang, Hong; Wu, Qi-nan
2015-06-01
To optimize the processing of polysaccharide extraction from Spirodela polyrrhiza. Five factors related to extraction rate of polysaccharide were optimized by the Plackett-Burman design. Based on this study, three factors, including alcohol volume fraction, extraction temperature and ratio of material to liquid, were regarded as investigation factors by Box-Behnken response surface methodology. The effect order of three factors on the extraction rate of polysaccharide from Spirodela polyrrhiza were as follows: extraction temperature, alcohol volume fraction,ratio of material to liquid. According to Box-Behnken response, the best extraction conditions were: alcohol volume fraction of 81%, ratio of material to liquid of 1:42, extraction temperature of 100 degrees C, extraction time of 60 min for four times. Plackett-Burman design and Box-Behnken response surface methodology used to optimize the extraction process for the polysaccharide in this study is effective and stable.
Yin, Chaomin; Fan, Xiuzhi; Fan, Zhe; Shi, Defang; Gao, Hong
2018-05-01
Enzymes-microwave-ultrasound assisted extraction (EMUE) method had been used to extract Lentinus edodes polysaccharides (LEPs). The enzymatic temperature, enzymatic pH, microwave power and microwave time were optimized by response surface methodology. The yields, properties and antioxidant activities of LEPs from EMUE and other extraction methods including hot-water extraction, enzymes-assisted extraction, microwave-assisted extraction and ultrasound-assisted extraction were evaluated. The results showed that the highest LEPs yield of 9.38% was achieved with enzymatic temperature of 48°C, enzymatic pH of 5.0, microwave power of 440W and microwave time of 10min, which correlated well with the predicted value of 9.79%. Additionally, LEPs from different extraction methods possessed typical absorption peak of polysaccharides, which meant different extraction methods had no significant effects on type of glycosidic bonds and sugar ring of LEPs. However, SEM images of LEPs from different extraction methods were significantly different. Moreover, the different LEPs all showed antioxidant activities, but LEPs from EMUE showed the highest reducing power when compared to other LEPs. The results indicated LEPs from EMUE can be used as natural antioxidant component in the pharmaceutical and functional food industries. Copyright © 2018 Elsevier B.V. All rights reserved.
Neha Sawhney; Casey Crooks; Virginia Chow; James F. Preston; Franz St. John
2016-01-01
Background: Polysaccharides comprising plant biomass are potential resources for conversion to fuels and chemicals. These polysaccharides include xylans derived from the hemicellulose of hardwoods and grasses, soluble beta-glucans from cereals and starch as the primary form of energy storage in plants. Paenibacillus sp...
Iñón de Iannino, Nora; Briones, Gabriel; Tolmasky, Marcelo; Ugalde, Rodolfo A.
1998-01-01
The animal pathogen Brucella abortus contains a gene, cgs, that complemented a Rhizobium meliloti nodule development (ndvB) mutant and an Agrobacterium tumefaciens chromosomal virulence (chvB) mutant. The complemented strains recovered the synthesis of cyclic β(1-2) glucan, motility, virulence in A. tumefaciens, and nitrogen fixation in R. meliloti; all traits were strictly associated with the presence of an active cyclic β(1-2) glucan synthetase protein in the membranes. Nucleotide sequencing revealed the presence in B. abortus of an 8.49-kb open reading frame coding for a predicted membrane protein of 2,831 amino acids (316.2 kDa) and with 51% identity to R. meliloti NdvB. Four regions of the B. abortus protein spanning amino acids 520 to 800, 1025 to 1124, 1284 to 1526, and 2400 to 2660 displayed similarities of higher than 80% with R. meliloti NdvB. Tn3-HoHo1 mutagenesis showed that the C-terminal 825 amino acids of the Brucella protein, although highly conserved in Rhizobium, are not necessary for cyclic β(1-2) glucan synthesis. Confirmation of the identity of this protein as B. abortus cyclic β(1-2) glucan synthetase was done by the construction of a B. abortus Tn3-HoHo1 insertion mutant that does not form cyclic β(1-2) glucan and lacks the 316.2-kDa membrane protein. The recovery of this mutant from the spleens of inoculated mice was decreased by 3 orders of magnitude compared with that of the parental strain; this result suggests that cyclic β(1-2) glucan may be a virulence factor in Brucella infection. PMID:9721274
Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.
Mushroom β-Glucan May Immunomodulate the Tumor-Associated Macrophages in the Lewis Lung Carcinoma
Wang, Wan-Jhen; Wu, Yu-Sheng; Chen, Sherwin; Liu, Chi-Feng
2015-01-01
The present study showed that oral mushroom beta-glucan treatment significantly increased IFN-γ mRNA expression but significantly reduced COX-2 mRNA expression within the lung. For LLC tumor model, oral Ganoderma lucidum or Antrodia camphorata polysaccharides treatments significantly reduced TGF-β production in serum. In addition, IL-12 and IFN-γ mRNA expression were significantly increased, but IL-6, IL-10, COX-2, and TGF-β mRNA expression were substantially following oral mushroom polysaccharides treatments. The study highlights the efficacious effect of mushroom polysaccharides for ameliorating the immune suppression in the tumor microenvironment. Increased M1 phenotype of tumor-associated macrophages and attenuated M2 phenotype of tumor-associated macrophages could be achieved by ingesting mushroom polysaccharides. PMID:26167490
NASA Astrophysics Data System (ADS)
Wan, Peng; Yang, Xiaoman; Cai, Bingna; Chen, Hua; Sun, Huili; Chen, Deke; Pan, Jianyu
2015-08-01
In the present study, ultrasonic extraction technique (UET) is used to improve the yield of polysaccharides from Laminaria japonica (LJPs). And their antioxidative as well as glycosidase inhibitory activities are investigated. Box-Behnken design (BBD) combined with response surface methodology (RSM) is applied to optimize ultrasonic extraction for polysaccharides. The optimized conditions are obtained as extraction time at 54 min, ultrasonic power at 1050 W, extraction temperature at 80°C and ratio of material to solvent at 1:50 (g mL-1). Under these optimal ultrasonic extraction conditions, an actual experimental yield (5.75% ± 0.3%) is close to the predicted result (5.67%) with no significant difference ( P > 0.05). Vitro antioxidative and glycosidase inhibitory activities tests indicate that the crude polysaccharides (LJP) and two major ethanol precipitated fractions (LJP1 and LJP2) are in a concentration-dependent manner. LJP2 (30%-60% ethanol precipitated polysaccharides) possesses the strongest α-glucosidase inhibitory activity and moderate scavenging activity against hydroxyl radicals (66.09% ± 2.19%, 3.0 mg mL-1). Also, the inhibitory activity against α-glucosidase (59.08% ± 3.79%, 5.0 mg mL-1) is close to that of acarbose (63.99% ± 3.27%, 5.0 mg mL-1). LJP1 (30% ethanol precipitated polysaccharides) exhibits the strongest scavenging activity against hydroxyl radicals (99.80% ± 0.00%, 3.0 mg mL-1) and moderate α-glucosidase inhibitory activity (47.76% ± 1.92%, 5.0 mg mL-1). LJP shows the most remarkable DPPH scavenging activity (66.20% ± 0.11%, 5.0 mg mL-1) but weakest α-glucosidase inhibitory activity (37.77% ± 1.30%, 5.0 mg mL-1). However, all these LJPs exert weak inhibitory effects against α-amylase. These results show that UET is an effective method for extracting bioactive polysaccharides from seaweed materials. LJP1 and LJP2 can be developed as a potential ingredient in hypoglycemic agents or functional food for the management of
Spada, Jordana C; Marczak, Ligia D F; Tessaro, Isabel C; Cardozo, Nilo S M
2015-12-10
This study focuses on the investigation of the interactions between polysaccharides (carrageenan and carboxymethylcellulose--CMC) and soy proteins from the water-soluble soy extract. The influence of pH (2-7) and protein-polysaccharide ratio (5:1-40:1) on the interaction between these polyelectrolytes was investigated in aqueous solutions with 10% of polydextrose and without polydextrose. The studied systems were analyzed in terms of pH-solubility profile of protein, ζ-potential, methylene blue-polysaccharide interactions, differential scanning calorimetry (DSC), Fourier transform infrared spectroscopy (FTIR), and confocal laser scanning microscopy. Although the mixtures of soy extract with both carrageenan and CMC showed dependency on the pH and protein-polysaccharide ratio, they did not present the same behavior. Both polysaccharides modified the pH-solubility profile of the soy protein, shifting the pH range in which the coacervate is formed to a lower pH region with the decrease of the soy extract-polysaccharide ratio. The samples also presented detectable differences regarding to ζ-potential, DSC, FTIR and microscopy analyses. The complex formation was also detected even in a pH range where both biopolymers were net-negatively charged. The changes promoted by the presence of polydextrose were mainly detected by blue-polysaccharide interactions measures and confocal microscopy. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cellulase-assisted extraction and antioxidant activity of polysaccharides from Rhizoma imperata.
Jiang, Long-Fa
2014-08-08
In this study, the cellulase-assisted extraction and antioxidant activity of the polysaccharides from Rhizoma imperata were investigated. To improve the yield of R. Imperata polysaccharides (RPs), the extraction conditions were optimized as follows: time, 69.48 min; temperature, 45.36°C; pH, 4.58; cellulase amount, 1,200 U/g. Under these optimum conditions, the yield of RPs reached 0.67% (w/w), and was higher than that of the traditionally aqueous extraction method. The sugar content in the RPs product reached up to 93.25% (w/w). The RPs product has high antioxidant activity including hydroxyl radical scavenging activity and 2,2-diphenyl-β-picrylhydrazyl radical scavenging activity at the concentration of 100mg/mL. Copyright © 2014 Elsevier Ltd. All rights reserved.
Su, Chun-Han; Lai, Min-Nan; Lin, Ching-Chuan; Ng, Lean-Teik
2016-05-01
Mushroom polysaccharides have been known to possess various pharmacological activities. However, information on their chemical and biological differences between mushrooms remains limited. In this study, we aimed to examine the differences in physicochemical characteristics of polysaccharides prepared from Antrodia cinnamomea (AC-P), Coriolus versicolor (CV-P), Grifola frondosa (GF-P), Ganoderma lucidum (GL-P), and Phellinus linteus (PL-P), followed by evaluating their inhibitory effects on nitric oxide (NO) production in lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. Results showed that under similar conditions of preparation, the monosaccharide composition of polysaccharides varied between different mushrooms, and glucose was the predominant monosaccharide, followed by galactose and mannose. AC-P and GF-P contained the highest amount of (1,3;1,6)-β-D-glucans. The degree of branching of (1,3;1,6)-β-D-glucans in all polysaccharides ranged from 0.21 to 0.26, with the exception of GF-P (0.38). The molecular weights of different polysaccharides showed diverse distributions; AC-P, CV-P, and GF-P contained two major macromolecular populations (< 30 and >200 kDa) and possessed triple-helix conformation, whereas GL-P (10.2 kDa) and PL-P (15.5 kDa) only had a low molecular weight population without triple-helix structure. These polysaccharides showed different inhibitory potency on NO production in LPS-stimulated RAW264.7 cells.
A Candida Biofilm-Induced Pathway for Matrix Glucan Delivery: Implications for Drug Resistance
Taff, Heather T.; Nett, Jeniel E.; Zarnowski, Robert; Ross, Kelly M.; Sanchez, Hiram; Cain, Mike T.; Hamaker, Jessica; Mitchell, Aaron P.; Andes, David R.
2012-01-01
Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics. PMID:22876186
Wet processing barley grains into concentrates with protein, beta-glucan, and starch
USDA-ARS?s Scientific Manuscript database
An improved wet method was developed to process barley into fractions concentrated in protein, (1-3)(1-4)-b-D-glucan (BG), starch, or other carbohydrates (CHO). Alkaline concentration, solvent to barley flour ratio (SFR), and extraction temperature were evaluated for their effects on concentration a...
Song, Yi; Du, Bingjian; Zhou, Ting; Han, Bing; Yu, Fei; Yang, Rui; Hu, Xiaosong; Ni, Yuanying; Li, Quanhong
2011-02-01
In this work, response surface methodology was used to determine optimum conditions for extraction of polysaccharides from defatted peanut cake. A central composite design including independent variables, such as extraction temperature (x(1)), extraction time (x(2)), and ethanol concentration (x(3)) was used. Selected response which evaluates the extraction process was polysaccharide yield, and the second-order model obtained for polysaccharide yield revealed coefficient of determination of 97.81%. The independent variable with the largest effect on response was ethanol concentration (x(3)). The optimum extraction conditions were found to be extraction temperature 48.7°C, extraction time 1.52 h, and ethanol concentration of 61.9% (v/v), respectively. Under these conditions, the extraction efficiency of polysaccharide can increase to 25.89%. The results of structural analysis showed that the main composition of defatted peanut cake polysaccharide was α-galactose. 2010 Elsevier Ltd. All rights reserved.
Zhang, Bing-Zhao; Inngjerdingen, Kari T; Zou, Yuan-Feng; Rise, Frode; Michaelsen, Terje E; Yan, Pei-Sheng; Paulsen, Berit S
2014-11-15
Exo-polysaccharides were purified and characterized from the fermentation broth of Hypsizigus marmoreus, a popular edible mushroom consumed in Asia. Among them, B-I-I and B-II-I exhibited potent complement fixating activity, meanwhile, B-N-I, B-I-I, B-II-I and B-II-II exhibited significant macrophage stimulating activity. Molecular weights of the four exo-polysaccharides were determined to be 6.3, 120, 150 and 11 kDa respectively. Molecular characterisation showed that B-N-I is basically an α-1→4 glucan, with branches on C6; B-I-I is a heavily branched α-mannan with 1→2 linked main chain. B-II-I and B-II-II, have a backbone of rhamno-galacturonan with 1→2 linked l-rhamnose interspersed with 1→4 linked galacturonic acid. Structure-activity relationship analysis indicated that monosaccharide compositions, molecular weight, certain structural units (rhamno-galacturonan type I and arabinogalactan type II) are the principal factors responsible for potent complement fixating and macrophage-stimulating activities. Their immunomodulating activities may, at least partly, explain the health benefits of the mushroom. Copyright © 2014 Elsevier Ltd. All rights reserved.
Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R
2018-04-03
Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which
Ballesteros, Lina F; Teixeira, José A; Mussatto, Solange I
2017-02-10
The extraction of polysaccharides by autohydrolysis of spent coffee grounds (SCG) was studied. Experimental assays were performed using different temperatures (160-200°C), liquid/solid ratios (5-15ml water/g SCG) and extraction times (10-50min) in order to determine the conditions that maximize the extraction of polysaccharides with high antioxidant activity. Autohydrolysis was demonstrated to be an efficient technique to recover antioxidant polysaccharides from SCG. The best process conditions consisted in using 15ml water/g SCG, during 10min at 160°C. The polysaccharides obtained under these conditions were mainly in the form of galactomannans and arabinogalactans. They presented high antioxidant activity (assessed by four different methods), were thermostable in a large range of temperature, and had a typical carbohydrate pattern, being of interest for industrial applications, mainly in the food area. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yang, Xinhe; Huang, Mingjun; Qin, Caiqin; Lv, Bangyu; Mao, Qingli; Liu, Zhonghua
2017-08-01
The crude tea polysaccharides (CTPS) from Qingzhuan brick tea(QZBT) were extracted and fractionated to afford two fractions, namely TPS-1 and TPS-2. Analyses were conducted concerning the structural characterization and antioxidant activities of these samples. Component analysis revealed that the carbohydrate, uronic acid, protein and polyphenol contents of these samples differed significantly. Fourier transform infrared analysis showed that these samples showed similar characteristic absorption peaks for polysaccharides. Ultraviolet-visible spectroscopy, circular dichroism, scanning electron microscopy and thermogravimetric analyses indicated that there were considerable differences in the presence of protein, surface features, conformational characteristics and thermodynamic behaviors. For antioxidant activities in vitro, CTPS, TPS-1 and TPS-2 exhibited concentration-dependent antioxidant activities, with TPS-2 showing significantly higher antioxidant activity than CTPS and TPS-1. These results provide a scientific and strong foundation for the use of tea polysaccharides(TPS) from QZBT and further research towards the relationships between the characteristics and antioxidant activities of TPS. Copyright © 2017 Elsevier B.V. All rights reserved.
Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S.; Westler, William M.; Azadi, Parastoo; Nett, Jeniel
2018-01-01
ABSTRACT Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non-albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan-Candida species biofilm therapy. PMID:29615504
Zhang, Qihong; Yu, Jingbo; Zhang, Leifang; Hu, Meiqun; Xu, Yan; Su, Weike
2016-12-01
Four water-soluble polysaccharides, designated as SF1, SF2, SF3 and SF4, were efficiently extracted from the roots of Sophora flavescens by mechanochemistry under the conditions of rotational speed of 400rpm, grinding time of 10min, powder to ball weight ratio of 1:20, and Na 2 CO 3 loading of 7wt%. The results obtained indicated that all of these four acid heteropolysaccharides are composed of rhamnose, arabinose, xylose, mannose, glucose and galactose, with the average molecular weights of 400.9, 98.6, 99.3, 42.7kDa, respectively. In vitro, SF4 showed the most significant scavenging activity on superoxide radical, ABTS, and DPPH radical, while SF3 had the most significant scavenging activity on hydroxyl radical. Immunological tests demonstrated that SF1, SF2, SF3 and SF4 significantly stimulated nitric oxide production without cytotoxicity in macrophages and promoted splenocyte proliferation. These data suggest that the four polysaccharides fractions have the potential as novel natural sources of antioxidative and immunopotentiating agents. Copyright © 2016 Elsevier B.V. All rights reserved.
Prakash Maran, J; Manikandan, S; Thirugnanasambandham, K; Vigna Nivetha, C; Dinesh, R
2013-01-30
In this study, ultrasound assisted extraction (UAE) conditions on the yield of polysaccharide from corn silk were studied using three factors, three level Box-Behnken response surface design. Process parameters, which affect the efficiency of UAE such as extraction temperature (40-60 °C), time (10-30 min) and solid-liquid ratio (1:10-1:30 g/ml) were investigated. The results showed that, the extraction conditions have significant effects on extraction yield of polysaccharide. The obtained experimental data were fitted to a second-order polynomial equation using multiple regression analysis with high coefficient of determination value (R(2)) of 0.994. An optimization study using Derringer's desired function methodology was performed and the optimal conditions based on both individual and combinations of all independent variables (extraction temperature of 56 °C, time of 17 min and solid-liquid ratio of 1:20 g/ml) were determined with maximum polysaccharide yield of 6.06%, which was confirmed through validation experiments. Copyright © 2012 Elsevier Ltd. All rights reserved.
Blanco, Noelia; Arroyo, Javier
2012-01-01
Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan. PMID:22366124
Cabib, Enrico; Blanco, Noelia; Arroyo, Javier
2012-04-01
Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.
He, Li-xia; Zhao, Jian; Huang, Yuan-sheng; Li, Yong
2016-03-01
Increasing oats and beta-glucan extract intake has been associated with improved glycemic control, which is associated with the reduction in the development of diabetes. This study aims to assess the different effects between oat (whole and bran) and beta-glucan extract intake on glycemic control and insulin sensitivity. PubMed, Embase, Medline, The Cochrane Library, CINAHL and Web of Science were searched up to February 2014. We included randomized controlled trials with interventions that lasted at least four weeks that compared oats and beta-glucan (extracted from oats or other sources) intake with a control. A total of 1351 articles were screened for eligibility, and relevant data were extracted from 18 studies (n = 1024). Oat product dose ranged from 20 g d(-1) to 136 g d(-1), and beta-glucan extract dose ranged from 3 g d(-1) to 10 g d(-1). Compared with the control, oat intake resulted in a greater decrease in fasting glucose and insulin of subjects (P < 0.05), but beta-glucan extract intake did not. Furthermore, oat intake resulted in a greater decrease in glycosylated hemoglobin (HbA1c) (P < 0.001, I(2) = 0%) and fasting glucose (P < 0.001, I(2) = 68%) after removing one study using a concentrate and a different design and fasting insulin of type 2 diabetes (T2D) (P < 0.001, I(2) = 0%). The intake of oats and beta-glucan extracted from oats were effective in decreasing fasting glucose (P = 0.007, I(2) = 91%) and fasting insulin of T2D (P < 0.001, I(2) = 0%) and tented to lower HbA1c (P = 0.09, I(2) = 92%). Higher consumption of whole oats and oat bran, but not oat or barley beta-glucan extracts, are associated with lower HbA1c, fasting glucose and fasting insulin of T2D, hyperlipidaemic and overweight subjects, especially people with T2D, which supports the need for clinical trials to evaluate the potential role of oats in approaching to the management of glycemic control and insulin sensitivity of diabetes or metabolic syndrome subjects.
Viscoelastic properties of oat ß-glucan-rich aqueous dispersions
USDA-ARS?s Scientific Manuscript database
C-trim is a healthy food product containing the dietary of soluble fiber ß-glucan. The suspension of C-trim in water is a hydrocolloid biopolymer. The linear and non-linear rheological properties for suspensions of C-trim biopolymers were investigated. The linear viscoelastic behaviors for C-trim...
Repin, Nikolay; Scanlon, Martin G; Fulcher, R Gary
2012-07-01
Enrichment of colloidal dairy systems with dietary fibre frequently causes quality defects because of phase separation. We investigate phase separation in skimmed milk enriched with Glucagel (a commercial product made from barley that is predominantly comprised of the polysaccharide β-glucan). The driving force for phase separation was depletion flocculation of casein micelles in the presence of molecules of the polysaccharide. Depending on the volume fraction of casein micelles and the concentration of Glucagel, the stable system phase separated either as a transient gel or as a sedimented system. The rate at which phase separation progressed also depended on the volume fraction of casein micelles and the concentration of Glucagel. To confirm the role of depletion flocculation in the phase separation process, enzymatic reduction in the molecular weight of β-glucan was shown to limit the range of attraction between micelles and allow the stable phase to exist at a higher β-glucan concentration for any given volume fraction of casein micelles. These phase diagrams will be useful to dairy product manufacturers striving to improve the nutrient profile of their products while avoiding product quality impairment. Copyright © 2012 Elsevier Inc. All rights reserved.
Structural features of the exocellular polysaccharides of Mycobacterium tuberculosis.
Lemassu, A; Daffé, M
1994-01-01
The cell envelope which surrounds pathogenic mycobacteria is postulated to be a defence barrier against phagocytic cells and its outermost constituents have a tendency to accumulate in the culture medium. The present work demonstrates that the exocellular material of Mycobacterium tuberculosis contains large amounts of polysaccharides with only traces, if any at all, of lipids. Three types of polysaccharides were purified by anion-exchange and gel-filtration chromatography; all were found to be neutral compounds devoid of acyl substituents. They consisted of D-glucan, D-arabino-D-mannan and D-mannan, which were eluted from gel-filtration columns in positions corresponding to molecular masses of 123, 13 and 4 kDa respectively. Their predominant structural features were determined by the characterization of the per-O-methyl derivatives of enzymic, acetolysis and Smith-degradation products and by 1H- and 13C-n.m.r. spectroscopy of the purified polysaccharides, using mono- and two-dimensional homonuclear chemical-shift correlated spectroscopy and two-dimensional heteronuclear (1H/13C) spectroscopy. The glucan which represented up to 90% of the polysaccharides was composed of repeating units of five or six-->4-alpha-D-Glcp-1--> residues and a -->4-alpha-D-Glcp substituted at position 6 with an alpha-D-Glcp, indicating a glycogen-like highly branched structure not related to the so-called polysaccharide-II previously identified in tuberculin. The arabinomannan consisted of a mannan segment composed of a -->6-alpha-D-Man-1--> core substituted at some positions 2 with an alpha-D-Manp. The arabinan termini of the arabinomannan were found to be extensively capped with mannosyl residues. The possibility that these polysaccharides contribute to the persistence of the tubercle bacillus in the macrophage by molecular mimicry is discussed. PMID:8297342
Structural features of the exocellular polysaccharides of Mycobacterium tuberculosis.
Lemassu, A; Daffé, M
1994-01-15
The cell envelope which surrounds pathogenic mycobacteria is postulated to be a defence barrier against phagocytic cells and its outermost constituents have a tendency to accumulate in the culture medium. The present work demonstrates that the exocellular material of Mycobacterium tuberculosis contains large amounts of polysaccharides with only traces, if any at all, of lipids. Three types of polysaccharides were purified by anion-exchange and gel-filtration chromatography; all were found to be neutral compounds devoid of acyl substituents. They consisted of D-glucan, D-arabino-D-mannan and D-mannan, which were eluted from gel-filtration columns in positions corresponding to molecular masses of 123, 13 and 4 kDa respectively. Their predominant structural features were determined by the characterization of the per-O-methyl derivatives of enzymic, acetolysis and Smith-degradation products and by 1H- and 13C-n.m.r. spectroscopy of the purified polysaccharides, using mono- and two-dimensional homonuclear chemical-shift correlated spectroscopy and two-dimensional heteronuclear (1H/13C) spectroscopy. The glucan which represented up to 90% of the polysaccharides was composed of repeating units of five or six-->4-alpha-D-Glcp-1--> residues and a -->4-alpha-D-Glcp substituted at position 6 with an alpha-D-Glcp, indicating a glycogen-like highly branched structure not related to the so-called polysaccharide-II previously identified in tuberculin. The arabinomannan consisted of a mannan segment composed of a -->6-alpha-D-Man-1--> core substituted at some positions 2 with an alpha-D-Manp. The arabinan termini of the arabinomannan were found to be extensively capped with mannosyl residues. The possibility that these polysaccharides contribute to the persistence of the tubercle bacillus in the macrophage by molecular mimicry is discussed.
Inorganic Phosphate Limitation Modulates Capsular Polysaccharide Composition in Mycobacteria.
van de Weerd, Robert; Boot, Maikel; Maaskant, Janneke; Sparrius, Marion; Verboom, Theo; van Leeuwen, Lisanne M; Burggraaf, Maroeska J; Paauw, Nanne J; Dainese, Elisa; Manganelli, Riccardo; Bitter, Wilbert; Appelmelk, Ben J; Geurtsen, Jeroen
2016-05-27
Mycobacterium tuberculosis is protected by an unusual and highly impermeable cell envelope that is critically important for the successful colonization of the host. The outermost surface of this cell envelope is formed by capsular polysaccharides that play an important role in modulating the initial interactions once the bacillus enters the body. Although the bioenzymatic steps involved in the production of the capsular polysaccharides are emerging, information regarding the ability of the bacterium to modulate the composition of the capsule is still unknown. Here, we study the mechanisms involved in regulation of mycobacterial capsule biosynthesis using a high throughput screen for gene products involved in capsular α-glucan production. Utilizing this approach we identified a group of mutants that all carried mutations in the ATP-binding cassette phosphate transport locus pst These mutants collectively exhibited a strong overproduction of capsular polysaccharides, including α-glucan and arabinomannan, suggestive of a role for inorganic phosphate (Pi) metabolism in modulating capsular polysaccharide production. These findings were corroborated by the observation that growth under low Pi conditions as well as chemical activation of the stringent response induces capsule production in a number of mycobacterial species. This induction is, in part, dependent on σ factor E. Finally, we show that Mycobacterium marinum, a model organism for M. tuberculosis, encounters Pi stress during infection, which shows the relevance of our findings in vivo. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Palma, Angelina S.; Liu, Yan; Zhang, Hongtao; Zhang, Yibing; McCleary, Barry V.; Yu, Guangli; Huang, Qilin; Guidolin, Leticia S.; Ciocchini, Andres E.; Torosantucci, Antonella; Wang, Denong; Carvalho, Ana Luísa; Fontes, Carlos M. G. A.; Mulloy, Barbara; Childs, Robert A.; Feizi, Ten; Chai, Wengang
2015-01-01
Glucans are polymers of d-glucose with differing linkages in linear or branched sequences. They are constituents of microbial and plant cell-walls and involved in important bio-recognition processes, including immunomodulation, anticancer activities, pathogen virulence, and plant cell-wall biodegradation. Translational possibilities for these activities in medicine and biotechnology are considerable. High-throughput micro-methods are needed to screen proteins for recognition of specific glucan sequences as a lead to structure–function studies and their exploitation. We describe construction of a “glucome” microarray, the first sequence-defined glycome-scale microarray, using a “designer” approach from targeted ligand-bearing glucans in conjunction with a novel high-sensitivity mass spectrometric sequencing method, as a screening tool to assign glucan recognition motifs. The glucome microarray comprises 153 oligosaccharide probes with high purity, representing major sequences in glucans. Negative-ion electrospray tandem mass spectrometry with collision-induced dissociation was used for complete linkage analysis of gluco-oligosaccharides in linear “homo” and “hetero” and branched sequences. The system is validated using antibodies and carbohydrate-binding modules known to target α- or β-glucans in different biological contexts, extending knowledge on their specificities, and applied to reveal new information on glucan recognition by two signaling molecules of the immune system against pathogens: Dectin-1 and DC-SIGN. The sequencing of the glucan oligosaccharides by the MS method and their interrogation on the microarrays provides detailed information on linkage, sequence and chain length requirements of glucan-recognizing proteins, and are a sensitive means of revealing unsuspected sequences in the polysaccharides. PMID:25670804
Gong, Amy Gw; Zhang, Laura Ml; Lam, Candy Tw; Xu, Miranda L; Wang, Huai Y; Lin, H Q; Dong, Tina Tx; Tsim, Karl Wk
2017-02-01
Danggui Buxue Tang (DBT) is an ancient Chinese herbal decoction containing two herbs, Astragali Radix (AR) and Angelicae Sinensis Radix (ASR): this herbal decoction serves as dietary supplement for women during menopause. DBT has been known to modulate immune responses, and its polysaccharide is proposed to be one of the active components. However, the polysaccharide-induced signaling in immune activation is not revealed. Here, we are identifying that the immune activation, triggered by DBT, could be mediated by polysaccharide. In cultured macrophages (RAW 264.7 cells), the application of polysaccharide-enriched extract of DBT significantly increased the expressions of mRNA and protein levels of interleukin-1β, interleukin-6 and tumor necrosis factor. The induction was much stronger than the polysaccharide extract generated singly from AR, or from ASR, or from their simple mixture. The induced cytokine release in cultured macrophage was revealed to be triggered by activation of nuclear factor-kappa B (NF-κB) signaling, including (i) degradation of IkBα; (ii) translocation of NF-κB p65 from cytosol to nuclei; and (iii) activation of NF-κB transcriptional elements. These results verified the possible role of DBT polysaccharide in modulating immune responses. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B
2016-04-05
Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.
Rosburg, Valerie; Boylston, Terri; White, Pamela
2010-06-01
Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.
Back, C R; Douglas, S K; Emerson, J E; Nobbs, A H; Jenkinson, H F
2015-10-01
Streptococcus gordonii SspA and SspB proteins, members of the antigen I/II (AgI/II) family of Streptococcus adhesins, mediate adherence to cysteine-rich scavenger glycoprotein gp340 and cells of other oral microbial species. In this article we investigated further the mechanism of coaggregation between S. gordonii DL1 and Actinomyces oris T14V. Previous mutational analysis of S. gordonii suggested that SspB was necessary for coaggregation with A. oris T14V. We have confirmed this by showing that Lactococcus lactis surrogate host cells expressing SspB coaggregated with A. oris T14V and PK606 cells, while L. lactis cells expressing SspA did not. Coaggregation occurred independently of expression of A. oris type 1 (FimP) or type 2 (FimA) fimbriae. Polysaccharide was prepared from cells of A. oris T14V and found to contain 1,4-, 4,6- and 3,4-linked glucose, 1,4-linked mannose, and 2,4-linked galactose residues. When immobilized onto plastic wells this polysaccharide supported binding of L. lactis expressing SspB, but not binding of L. lactis expressing other AgI/II family proteins. Purified recombinant NAVP region of SspB, comprising amino acid (aa) residues 41-847, bound A. oris polysaccharide but the C-domain (932-1470 aa residues) did not. A site-directed deletion of 29 aa residues (Δ691-718) close to the predicted binding cleft within the SspB V-region ablated binding of the NAVP region to polysaccharide. These results infer that the V-region head of SspB recognizes an actinomyces polysaccharide ligand, so further characterizing a lectin-like coaggregation mechanism occurring between two important primary colonizers. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Zhang, Tian-Tian; Lu, Chuan-Li; Jiang, Jian-Guo; Wang, Min; Wang, Dong-Mei; Zhu, Wei
2015-10-05
Polysaccharides of Rubus chingii Hu fruit and leaf were extracted to compare their antioxidant, anti-inflammatory, and anticancer activities against breast cancer cells MCF-7 and liver cancer cells Bel-7402. Results showed that all the tested bioactivities of polysaccharides from leaf (L-Ps) were better than those of polysaccharides from fruit (F-Ps). Response surface methodology was then used to optimize the extraction conditions of polysaccharides from leaf. Additionally, polysaccharides from fruit and leaf were characterized and their contents of total sugars, proteins and uronic acid were compared. It was found that polysaccharides from fruit and leaf were similar in IR and UV absorption, but significantly different in contents of total sugars, protein and uronic acid. Their elution profiles of DEAE-Sepharose fast flow column were different too. The main peak of polysaccharides from fruit was eluted with 0.3 mol/l NaCl solution and the main peak of polysaccharides from leaf was eluted with deionized water. The differences between the two polysaccharides may be responsible for their differences in bioactivities. Further studies are required to explore their complete structural characteristics, structure-activity relationship and the mechanism of their activities. Copyright © 2015 Elsevier Ltd. All rights reserved.
Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil
NASA Astrophysics Data System (ADS)
Chang, I.; Cho, G.
2012-12-01
Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.
Austin, Ceri; Stewart, Derek; Allwood, J William; McDougall, Gordon J
2018-01-24
A polyphenol-rich extract (PRE) from the edible seaweed, Ascophyllum nodosum, inhibited pancreatic lipase activity in an oil-based turbidimetric assay with an IC 50 of 200 μg gallic acid equivalents (GAE) perassay) [∼230 μg DW] whereas the known inhibitor, Orlistat, gave an IC 50 at 0.4 μg per assay. A phlorotannin-enriched fraction (TRF) purified from the PRE was more potent with an IC 50 = 60 μg GAE per assay (∼65 μg DW). When the assay was started by the addition of lipase, both Orlistat and TRF were much less effective which suggests that pre-incubation of enzyme and inhibitor improved inhibition. Based on phenol content, water extracts from Ascophyllum were more potent lipase inhibitors than PRE (IC 50 ∼ 150 μg GAE per assay). However, this was equivalent to ∼580 μg DW and these extracts contained polysaccharides (e.g. alginate content = 110 μg mL -1 ) which may also contribute to inhibition. Indeed, a polysaccharide-enriched fraction obtained by ethanol precipitation gave an IC 50 of 1000 μg DW which was equivalent to 130 μg GAE and 420 μg alginate per assay. Therefore a >3 fold increase in alginate content did not markedly improve inhibition. Re-precipitation increased alginate content and reduced polyphenol content but lipase inhibition was markedly reduced (i.e. IC 50 at ∼1100 μg DW per assay, 700 μg alginate and 25 μg GAE). Purifying the polysaccharide fraction by ion exchange removed all phenolics but the IC 50 increased to >2500 μg DW, equivalent to >1970 μg alginate per assay. In conclusion, polysaccharides and phlorotannins may inhibit lipase in an additive fashion, with phlorotannins apparently more effective in vitro. However, interactions between these components may be important when food products containing this edible seaweed are consumed.
Leemhuis, Hans; Dobruchowska, Justyna M; Ebbelaar, Monique; Faber, Folkert; Buwalda, Pieter L; van der Maarel, Marc J E C; Kamerling, Johannis P; Dijkhuizen, Lubbert
2014-12-10
Dietary fibers are at the forefront of nutritional research because they positively contribute to human health. Much of our processed foods contain, however, only small quantities of dietary fiber, because their addition often negatively affects the taste, texture, and mouth feel. There is thus an urge for novel types of dietary fibers that do not cause unwanted sensory effects when applied as ingredient, while still positively contributing to the health of consumers. Here, we report the generation and characterization of a novel type of soluble dietary fiber with prebiotic properties, derived from starch via enzymatic modification, yielding isomalto/malto-polysaccharides (IMMPs), which consist of linear (α1 → 6)-glucan chains attached to the nonreducing ends of starch fragments. The applied Lactobacillus reuteri 121 GTFB 4,6-α-glucanotransferase enzyme synthesizes these molecules by transferring the nonreducing glucose moiety of an (α1 → 4)-glucan chain to the nonreducing end of another (α1 → 4)-α-glucan chain, forming an (α1 → 6)-glycosidic linkage. Once elongated in this way, the molecule becomes a better acceptor substrate and is then further elongated with (α1 → 6)-linked glucose residues in a linear way. Comparison of 30 starches, maltodextrins, and α-glucans of various botanical sources, demonstrated that substrates with long and linear (α1 → 4)-glucan chains deliver products with the highest percentage of (α1 → 6) linkages, up to 92%. In vitro experiments, serving as model of the digestive power of the gastrointestinal tract, revealed that the IMMPs, or more precisely the IMMP fraction rich in (α1 → 6) linkages, will largely pass the small intestine undigested and therefore end up in the large intestine. IMMPs are a novel type of dietary fiber that may have health promoting activity.
Zhu, Zhen-Yuan; Dong, Fengying; Liu, Xiaocui; Lv, Qian; YingYang; Liu, Fei; Chen, Ling; Wang, Tiantian; Wang, Zheng; Zhang, Yongmin
2016-04-20
This study was to investigate the effects of different extraction methods on the yield, chemical structure and antitumor activity of polysaccharides from Cordyceps gunnii (C. gunnii) mycelia. Five extraction methods were used to extract crude polysaccharides (CPS), which include room-temperature water extraction (RWE), hot-water extraction (HWE), microwave-assisted extraction (MAE), ultrasound-assisted extraction (UAE) and cellulase-assisted extraction (CAE). Then Sephadex G-100 was used for purification of CPS. As a result, the antitumor activities of CPS and PPS on S180 cells were evaluated. Five CPS and purified polysaccharides (PPS) were obtained. The yield of CPS by microwave-assisted extraction (CPSMAE) was the highest and its anti-tumor activity was the best and its macromolecular polysaccharide (3000-1000kDa) ratio was the largest. The PPS had the same monosaccharide composition, but their obvious difference was in the antitumor activity and the physicochemical characteristics, such as intrinsic viscosity, specific rotation, scanning electron microscopy and circular dichroism spectra. Copyright © 2015 Elsevier Ltd. All rights reserved.
Jeong, Sang-Chul; Yang, Byung-Keun; Kim, Guk-Nam; Jeong, Hun; Wilson, Michael A; Cho, Yip; Rao, K Sundar; Song, Chi-Hyun
2006-01-01
The macrophage-stimulating effect of polysaccharides extracted from Coriolus versicolor (Turkey Tail mushroom) was investigated, and their effectiveness was compared with that of lipopolysaccharide (LPS). The purified polysaccharide (CV-S2-Fr.I) of C. versicolor obtained by Sepharose CL-6B gel chromatography stimulated macrophage lysosomal enzyme activity by 250% at a concentration of 100 microg/mL, which was higher than that of LPS at the same concentration. When CV-S2-Fr.I was used in combination with interferon-gamma, there was a marked cooperative induction of nitric oxide production. However, CV-S2-Fr.I had no effect on nitric oxide production by itself. The proportion of C3-positive macrophages in the CV-S2-Fr.I group increased by 7.2-fold compared with the control group.
Venditto, Immacolata; Najmudin, Shabir; Luís, Ana S; Ferreira, Luís M A; Sakka, Kazuo; Knox, J Paul; Gilbert, Harry J; Fontes, Carlos M G A
2015-04-24
Structural carbohydrates comprise an extraordinary source of energy that remains poorly utilized by the biofuel sector as enzymes have restricted access to their substrates within the intricacy of plant cell walls. Carbohydrate active enzymes (CAZYmes) that target recalcitrant polysaccharides are modular enzymes containing noncatalytic carbohydrate-binding modules (CBMs) that direct enzymes to their cognate substrate, thus potentiating catalysis. In general, CBMs are functionally and structurally autonomous from their associated catalytic domains from which they are separated through flexible linker sequences. Here, we show that a C-terminal CBM46 derived from BhCel5B, a Bacillus halodurans endoglucanase, does not interact with β-glucans independently but, uniquely, acts cooperatively with the catalytic domain of the enzyme in substrate recognition. The structure of BhCBM46 revealed a β-sandwich fold that abuts onto the region of the substrate binding cleft upstream of the active site. BhCBM46 as a discrete entity is unable to bind to β-glucans. Removal of BhCBM46 from BhCel5B, however, abrogates binding to β-1,3-1,4-glucans while substantially decreasing the affinity for decorated β-1,4-glucan homopolymers such as xyloglucan. The CBM46 was shown to contribute to xyloglucan hydrolysis only in the context of intact plant cell walls, but it potentiates enzymatic activity against purified β-1,3-1,4-glucans in solution or within the cell wall. This report reveals the mechanism by which a CBM can promote enzyme activity through direct interaction with the substrate or by targeting regions of the plant cell wall where the target glucan is abundant. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Jia, Xuejing; Zhang, Chao; Hu, Jie; He, Muxue; Bao, Jiaolin; Wang, Kai; Li, Peng; Chen, Meiwan; Wan, Jianbo; Su, Huanxing; Zhang, Qingwen; He, Chengwei
2015-11-23
Box-Behnken design (BBD), one of the most common response surface methodology (RSM) methods, was used to optimize the experimental conditions for ultrasound-assisted extraction of polysaccharides from Rhynchosia minima root (PRM). The antioxidant abilities and anticancer activity of purified polysaccharide fractions were also measured. The results showed that optimal extraction parameters were as follows: ultrasound exposure time, 21 min; ratio of water to material, 46 mL/g; ultrasound extraction temperature, 63 °C. Under these conditions, the maximum yield of PRM was 16.95%±0.07%. Furthermore, the main monosaccharides of purified fractions were Ara and Gal. PRM3 and PRM5 exhibited remarkable DPPH radical scavenging activities and reducing power in vitro. PRM3 showed strong inhibitory activities on the growth of MCF-7 cells in vitro. The above results indicate that polysaccharides from R. minima root have the potential to be developed as natural antioxidants and anticancer ingredients for the food and pharmaceutical industries.
Mycelium and polysaccharide production of Agaricus blazei Murrill by submerged fermentation.
Lin, Jr-Hui; Yang, Shang-Shyng
2006-04-01
Over the last decade, Agaricus blazei Murrill has been studied and developed as a novel functional food in Japan, Korea, China, and Taiwan. Due to the low yields, the fruiting bodies of A. blazei Murrill are relatively expensive, and a cheap and stable source of A. blazei Murrill mycelium for commercial purposes is highly desirable. Culture media and conditions were investigated with a view to reducing the cost and improving the mycelium and polysaccharide production of A. blazei Murrill by submerged fermentation. Thirty six isolates of A. blazei Murrill were isolated from 22 fruiting bodies produced in Taiwan, and 16 of them could be successfully cultivated on mannitol-egg yolk-polymyxin medium. The isolates were identified by species-specific polymerase chain reaction (PCR) and optimized for the culture media and conditions by submerged fermentation for mycelium and polysaccharide production. Some properties of polysaccharide extract were also investigated. All of the PCR products with species-specific primers showed high identity and matched the internal transcribed spacer 1 sequences of A. blazei Murrill. The phylogenic tree of A. blazei Murrill isolates generated from random amplified polymorphic DNAs arranged all samples into 3 groups and 2 independent cases. The optimal culture media of mycelium production in submerged fermentation were 5% malt extract, 0.1% yeast extract, and 0.5% peptone at pH 6.0, while the optimal culture conditions were 200 mL medium in 500 mL Hinton flask, shaking at 90 rpm for 3 days and then shifting to 105 rpm for 5 days at 27 degrees C. Each liter of A. blazei Murrill M72 yielded 10.83 +/- 0.24 g dried mycelia weight and each liter of A. blazei Murrill M152 produced 0.251 +/- 0.004 g crude polysaccharide (3.03 +/- 0.05% of dried mycelia weight). Crude polysaccharide of A. blazei Murrill M162 contained 82.27-99.14% of total sugar and less than 1.63% of protein; it had 4 major molecular weight components (274.1, 32.7, 7.5, and 2.1 k
Mkadmini Hammi, Khaoula; Hammami, Majdi; Rihouey, Christophe; Le Cerf, Didier; Ksouri, Riadh; Majdoub, Hatem
2016-12-01
Response surface methodology using a Box-Behnken design was employed to optimize extraction temperature, extraction time and ratio of water to material to obtain a maximum polysaccharide yield with high uronic acid content and antioxidant property from edible Zizyphus lotus fruit. The optimal conditions were: extraction time of 3h 15min, extraction temperature of 91.2°C and water to solid ratio of 39mL/g. Under these conditions, the experimental extraction yield, uronic acid content and 2,2-diphenyl-1-picrylhydrazyl scavenging ability (IC50) were 18.88%, 41.89 and 0.518mg/mL, respectively. Chemical analysis revealed that the extract was composed of 97.92% carbohydrate of which 41.89% is uronic acid. The extracted polysaccharides, with an average molecular weight of 2720kDa, are composed of arabinose, rhamnose, glucose, fructose, galactose and xylose. Moreover, the polysaccharides exhibited a significant reducing power and anti-lipid peroxidation activities. Copyright © 2016 Elsevier Ltd. All rights reserved.
Praznik, Werner; Huber, Anton
2005-09-25
A major capability of polysaccharides in aqueous media is their tendency for aggregation and dynamic formation of supermolecular structures. Even extended dissolution processes will not eliminate these structures which dominate many analytical approaches, in particular absolute molecular weight determinations referring to light scattering data. An alternative approach for determination of de facto molecular weight for glucans with free terminal hemiacetal functionality (reducing end group) has been adjusted from carbohydrates for midrange and high-dp glucans: quantitative and stabilized labeling as aminopyridyl-derivatives (AP-glucans) and subsequent analysis of SEC-separated elution profiles based on simultaneously monitored mass and molar fractions by refractive index and fluorescence detection. SEC-DRI/FL of AP-glucans proved as an appropriate approach for determination of de facto molecular weight of constituting glucan molecules even in the presence of supermolecular structures for non-branched (pullulan), branched (dextran), narrow distributed and broad distributed and for mixes of compact and loose packed polymer coils (starch glucan hydrolizate).
CROSS-REACTIONS OF ANTITYPHOID AND ANTIPARATYPHOID B HORSE SERA WITH VARIOUS POLYSACCHARIDES
Heidelberger, Michael; Cordoba, Felix
1956-01-01
A study was made of cross-reactions of synthetic polyglucose and of numerous plant and bacterial gums in an antityphoid and an antiparatyphoid B horse serum. The observed differences permit conclusions to be drawn regarding certain of the linkages likely to be found in the fine structures of each of the corresponding Salmonella polysaccharides:— 1. Cross-reactions of the antityphoid serum with the specific polysaccharide of Type II pneumococcus and with tamarind seed polysaccharide, glycogen and synthetic polyglucose indicate that the acetic acid-degraded O-polysaccharide of S. typhi, strain O 901, may contain part, at least, of its glucose as 1,4,6-branch points or in 1,6-linkage, perhaps adjacent to a terminal, non-reducing, galactopyranose unit. 2. Cross-reactions of both antisera with arabogalactans point to the existence of (probably β-) 1,3-, 1,6-, and/or 1,3,6-linkages of galactose in both the typhoid and paratyphoid B polysaccharides. 3. The differential reactivities of the galactomannans and yeast mannan suggest that the mannose in the typhoid polysaccharide is linked 1,2- or 1,3- with possible non-reducing mannopyranose end groups attached 1,6-. In the paratyphoid B polysaccharide the linkages are probably galacto-oligomannose 1,4-, or 1,4,6-, or the corresponding linkages of mannose alone. PMID:13357691
1980-01-01
A method is presented for covalently bonding Haemophilus influenzae type b capsular polysaccharide (HIB Ps) to several proteins. The method is efficient and relies upon the use of adipic dihydrazide as a spacer between the capsular polysaccharide and the carrier protein. In contrast to the poor immunogenicity of the purified HIB Ps in mice and rabbits, the HIB Ps-protein conjugates induced serum anti-type b antibodies having bactericidal activity at levels shown to be protective in humans when low doses were injected subcutaneously in a saline solution. The antibody response in mice was related to the dose of the conjugates, increased with the number of injections, and could be primed by the previous injection of the carrier protein. The HIB Ps- protein conjugates were immunogenic in three different mouse strains. The importance of the carrier molecule for the enhanced immunogenicity of the HIB Ps-protein conjugates was shown by the failure of HIB Ps hybrids prepared with either the homologous polysaccharide or pneumococcus type 3 polysaccharide to induce antibodie in mice. Rabbits injected with the HIB Ps-protein conjugates emulsified in Freund's adjuvant produced high levels of serum anti-type b antibodies which induced a bactericidal effect upon H. influenzae type b organisms. It is proposed that the HIB Ps component of the polysaccharide protein conjugates has been converted to a thymic-dependent immunogen. This method may be used to prepare protein-polysaccharide conjugates with HIB Ps and other polysaccharides to be considered for human use. PMID:6967514
Ishimoto, Yuina; Ishibashi, Ken-Ichi; Yamanaka, Daisuke; Adachi, Yoshiyuki; Ito, Hisatomi; Igami, Kentaro; Miyazaki, Toshitsugu; Ohno, Naohito
2017-01-01
Ganoderma lingzhi is a widely used medicinal mushroom that has antioxidative effects, ameliorates insulin resistance, and improves quality of life in patients with metabolic syndrome. Potentiation of immunity is also a major function of G. lingzhi, and this has been applied in patients with cancer. Supplementing G. lingzhi into foods reduced the metastasis of cancer cells. β-l,3-glucan is an important bioactive component of G. lingzhi. In this study we enhanced the solubilization ofimmunostimulating β-l,3-glucan by autodigestion of G. lingzhi. Fruiting bodies of G. lingzhi were disrupted and suspended in distilled water, then autodigested at 37°C for 24 hours. The resulting suspension was dried by spray drying. To assess the solubilization of β-l,3-glucan by autodigestion, cold and hot water extracts and sodium hydroxide extracts of G. lingzhi were prepared with and without autodigestion. Sodium hydroxide extracts were neutralized and dialyzed against distilled water. The resulting soluble and precipitated fractions were collected. Chemical, biochemical, and immunochemical characteristics of the extracts were compared. The yields of cold water extracts of autodigested and native G. lingzhi were significantly lower than the other extracts. Glucose was the major sugar component of the hot water extract, cold alkali extract (CAS), and the cold hydroxide extract insoluble in neutral aqueous condition (CASP) of the autodigested and native G. lingzhi. Nuclear magnetic resonance analysis revealed branched β-glucans in the hot water extract and CAS of the autodigested and native G. lingzhi. By contrast, the CASP of the autodigested and native G. lingzhi comprised mainly mixtures of linear α-l,3-glucans and linear β-l,3-glucans. Immunostimulation by β-l,3-glucan was examined by limulus factor G activation, dectin-1 binding, and anti-β-glucan antibody binding. Comparing relative activity, immunostimulating β-l,3-glucan was detected in the hot water extract, rather
Samar, Danial; Kieler, Joshua B.; Klutts, J. Stacey
2015-01-01
Aspergillus fumigatus is an environmental mold that causes severe, often fatal invasive infections in immunocompromised patients. The search for new antifungal drug targets is critical, and the synthesis of the cell wall represents a potential area to find such a target. Embedded within the main β-1,3-glucan core of the A. fumigatus cell wall is a mixed linkage, β-D-(1,3;1,4)-glucan. The role of this molecule or how it is synthesized is unknown, though it comprises 10% of the glucans within the wall. While this is not a well-studied molecule in fungi, it has been studied in plants. Using the sequences of two plant mixed linkage glucan synthases, a single ortholog was identified in A. fumigatus (Tft1). A strain lacking this enzyme (tft1Δ) was generated along with revertant strains containing the native gene under the control of either the native or a strongly expressing promoter. Immunofluorescence staining with an antibody against β-(1,3;1,4)-glucan and biochemical quantification of this polysaccharide in the tft1Δ strain demonstrated complete loss of this molecule. Reintroduction of the gene into the knockout strain yielded reappearance in amounts that correlated with expected expression of the gene. The loss of Tft1 and mixed linkage glucan yielded no in vitro growth phenotype. However, there was a modest increase in virulence for the tft1Δ strain in a wax worm model. While the precise roles for β-(1,3;1,4)-glucan within A. fumigatus cell wall are still uncertain, it is clear that Tft1 plays a pivotal role in the biosynthesis of this cell wall polysaccharide. PMID:25723175
Extraction, characterization and antioxidant activities of Se-enriched tea polysaccharides.
Wang, Yuanfeng; Li, Yongfu; Liu, Yangyang; Chen, Xueqing; Wei, Xinlin
2015-01-01
Se-polysaccharides from Se-enriched tea leaves were purified by DEAE-sepharose fast flow gel column (2.5×60cm) and three polysaccharide fractions (Se-TPS1, Se-TPS2, and Se-TPS3) were isolated and purified with yields of 6.5, 37.14, and 8.57%, respectively. The average sizes of Se-TPS1 and Se-TPS2 were determined by HPGPC system, with molecular weights of 1.1×10(5) and 2.4×10(5)Da, respectively. Se-TPS3 was a polysaccharide polymer with two peaks with molecular weights of 9.2×10(5) and 2.5×10(5)Da. Monosaccharide components analysis by ion chromatography revealed Se-polysaccharides were acidic polysaccharoses and different from each other in monosaccharide kinds and molar ratio. Elements of Se, C, H, N, S, and 14 kinds of mineral elements were analyzed by AFS, EA, and ICP-AES, respectively. Spectral analysis (IR and UV) indicated Se-polysaccharides were typical glycoproteins. Morphological analyses of the samples were determined by SEM and AFM. In addition, the DPPH and superoxide radicals scavenging activities were also discussed to assess antioxidant activities of the samples, and Se-polysaccharides showed higher antioxidant activities compared to the ordinary polysaccharides. Copyright © 2015 Elsevier B.V. All rights reserved.
Some structural studies on the galactose-containing polysaccharide from bovine placenta.
Pontarolo, R; Duarte, J H; Feijó, M A
1993-01-01
Polysaccharides were extracted from 8-month-old placenta with aqueous HgCl2. The protein-free material was purified by selective precipitation with Cetavlon in the presence of sodium borate at pH 8.5 and was homogeneous on molecular-sieve chromatography, electrophoresis, and on treatment with Concanavalin A. The preparation contained galactose and glucose as principal monosaccharides with 5 per cent of hexosamines. Methylation studies suggested that D-gluco and D-galactopyranosyl units may be constituents of glucan and galactan respectively which form a molecular aggregate that does not dissociate during the fractionation procedures. After treatment of the fraction with beta-amylase, the proportion of glucose in the polysaccharide diminished, indicating the presence of (1-->4)-linked alpha-D-glucopyranosyl residues. Also, when the fraction was treated with a crude protease having glucosidase activity a residual alpha-D-galactopyranan was isolated and found to contain non-reducing end-groups (30.0 per cent), 3-O-(39.5 per cent) and 3,6-di-O-substituted (30.5 per cent) units. The structure of the galactan was not modified according to methylation data, on removal of the glucosyl component. The polysaccharide fraction (pH 8.5 Cetavlon), isolated from bovine placenta, thus contains a glycogen-like material associated with a galactan as molecular aggregate. This galactan has not been previously recognized in bovine placenta and its occurrence in this organ supports the hypothesis that galactose-containing polysaccharides are involved in foetal development.
Cheng, Zhenyu; Song, Haiyan; Yang, Yingjie; Liu, Yan; Liu, Zhigang; Hu, Haobin; Zhang, Yang
2015-05-01
A microwave-assisted enzymatic extraction (MAEE) method had been developed, which was optimized by response surface methodology (RSM) and orthogonal test design, to enhance the extraction of crude polysaccharides (CPS) from the fruit of Schisandra chinensis Baill. The optimum conditions were as follows: microwave irradiation time of 10 min, extraction pH of 4.21, extraction temperature of 47.58°C, extraction time of 3h and enzyme concentration of 1.5% (wt% of S. chinensis powder) for cellulase, papain and pectinase, respectively. Under these conditions, the extraction yield of CPS was 7.38 ± 0.21%, which was well in close agreement with the value predicted by the model. The three methods including heat-refluxing extraction (HRE), ultrasonic-assisted extraction (UAE) and enzyme-assisted extraction (EAE) for extracting CPS by RSM were further compared. Results indicated MAEE method had the highest extraction yields of CPS at lower temperature. It was indicated that the proposed approach in this study was a simple and efficient technique for extraction of CPS in S. chinensis Baill. Copyright © 2015 Elsevier B.V. All rights reserved.
Wu-Yuan, Christine D.; Tai, Stella; Slade, Hutton D.
1979-01-01
The influence of culture media on various properties of Streptococcus mutans was investigated. Strains of S. mutans (serotypes c, d, f, and g) were grown in a complex medium (Todd-Hewitt broth [THB]) or a synthetic medium (SYN). The SYN cells, in contrast to THB cells, did not bind extracellular glucosyltransferase and did not produce in vitro adherence. Both types of cells possessed constitutive levels of glucosyltransferase. B13 cells grown in SYN plus invertase-treated glucose possessed the same level of constitutive enzyme as THB cells. In contrast to THB cells, the SYN cells of seven serotype strains did not agglutinate upon the addition of high-molecular-weight dextran/glucan. Significant quantities of lower-molecular-weight (2 × 104 or 7 × 104) dextran and B13 glucan were bound by SYN cells. SYN cells agglutinated weakly in anti-glucan serum (titers, 0 to 16), whereas THB cells possessed titers of 32 to 256. Evidence for the existence of a second binding site in agglutination which does not possess a glucan-like polymer has been obtained. B13 cells grown in invertase-treated THB agglutinated to the same degree as normal THB cells. The nature of this site is unknown. SYN cells possess the type-specific polysaccharide antigen. B13 cells did not bind from THB a glycoprotein which reacts with antisera to the A, B, or T blood group antigens or which allows agglutination upon the addition of dextran. The results demonstrate that S. mutans grown in a chemically defined medium possesse markedly different biochemical and biological activities than cells grown in a complex organic medium. PMID:457252
Afshari, Kasra; Samavati, Vahid; Shahidi, Seyed-Ahmad
2015-03-01
The effects of ultrasonic power, extraction time, extraction temperature, and the water-to-raw material ratio on extraction yield of crude polysaccharide from the leaf of Hibiscus rosa-sinensis (HRLP) were optimized by statistical analysis using response surface methodology. The response surface methodology (RSM) was used to optimize HRLP extraction yield by implementing the Box-Behnken design (BBD). The experimental data obtained were fitted to a second-order polynomial equation using multiple regression analysis and also analyzed by appropriate statistical methods (ANOVA). Analysis of the results showed that the linear and quadratic terms of these four variables had significant effects. The optimal conditions for the highest extraction yield of HRLP were: ultrasonic power, 93.59 W; extraction time, 25.71 min; extraction temperature, 93.18°C; and the water to raw material ratio, 24.3 mL/g. Under these conditions, the experimental yield was 9.66±0.18%, which is well in close agreement with the value predicted by the model 9.526%. The results demonstrated that HRLP had strong scavenging activities in vitro on DPPH and hydroxyl radicals. Copyright © 2014 Elsevier B.V. All rights reserved.
Wu, Hao; Zhu, Junxiang; Diao, Wenchao; Wang, Chengrong
2014-11-26
An efficient ultrasound-assisted enzymatic extraction (UAEE) of Cucurbita moschata polysaccharides (CMCP) was established and the CMCP antioxidant activities were studied. The UAEE operating parameters (extraction temperature, ultrasonic power, pH, and liquid-to-material ratio) were optimized using the central composite design (CCD) and the mass transfer kinetic study in UAEE procedure was used to select the optimal extraction time. Enzymolysis and ultrasonication that were simultaneously conducted was selected as the UAEE synergistic model and the optimum extraction conditions with a maximum polysaccharide yield of 4.33 ± 0.15% were as follows: extraction temperature, 51.5 °C; ultrasonic power, 440 W; pH, 5.0; liquid-to-material ratio, 5.70:1 mL/g; and extraction time, 20 min. Evaluation of the antioxidant activity in vitro suggested that CMCP has good potential as a natural antioxidant used in the food or medicine industry because of their high reducing power and positive radical scavenging activity for DPPH radical. Copyright © 2014 Elsevier Ltd. All rights reserved.
Wee, May S M; Matia-Merino, Lara; Carnachan, Susan M; Sims, Ian M; Goh, Kelvin K T
2014-09-01
A shear-thickening water-soluble polysaccharide was purified from mucilage extracted from the fronds of the New Zealand black tree fern (Cyathea medullaris or 'mamaku' in Māori) and its structure characterised. Constituent sugar analysis by three complementary methods, combined with linkage analysis (of carboxyl reduced samples) and 1H and 13C nuclear magnetic resonance spectroscopy (NMR) revealed a glucuronomannan comprising a backbone of 4-linked methylesterified glucopyranosyl uronic acid and 2-linked mannopyranosyl residues, branched at O-3 of 45% and at both O-3 and O-4 of 53% of the mannopyranosyl residues with side chains likely comprising terminal xylopyranosyl, terminal galactopyranosyl, non-methylesterified terminal glucopyranosyl uronic acid and 3-linked glucopyranosyl uronic acid residues. The weight-average molecular weight of the purified polysaccharide was ∼1.9×10(6) Da as determined by size-exclusion chromatography coupled with multi-angle laser light scattering (SEC-MALLS). The distinctive rheological properties of this polysaccharide are discussed in relation to its structure. Copyright © 2014 Elsevier B.V. All rights reserved.
Chen, Huoliang; Ju, Ying; Li, Junjie; Yu, Min
2012-01-01
The crude polysaccharide (LEP) was extracted by hot water from the fruiting bodies of Lentinus edodes, and further purified by DEAE-cellulose and Sepharose CL-6B chromatography, giving three polysaccharide fractions coded as LEPA1, LEPB1 and LEPC1. In this study, their chemical and physical characteristics of polysaccharide fractions and antioxidant capacities, including scavenging activity against hydroxyl radicals, superoxide radicals and Fe(2+)-chelating ability, were valuated. The results showed that LEPC1 exhibited significantly antioxidant activity at a concentration-dependent manner. Therefore these results indicated that the water-extractable polysaccharide fraction was a potent antioxidant and could be developed to be new health medicine for fighting against various human diseases. Copyright © 2011 Elsevier B.V. All rights reserved.
Nelson, Erika D.; Ramberg, Jane E.; Best, Talitha; Sinnott, Robert A.
2012-01-01
Objectives Current research efforts are centered on delineating the novel health benefits of naturally derived saccharides, including growing interest in their abilities to influence neurologic health. We performed a comprehensive review of the literature to consolidate all controlled studies assessing various roles of exogenous saccharide compounds and polysaccharide-rich extracts from plants, fungi, and other natural sources on brain function, with a significant focus on benefits derived from oral intake. Methods Studies were identified by conducting electronic searches on PubMed and Google Scholar. Reference lists of articles were also reviewed for additional relevant studies. Only articles published in English were included in this review. Results Six randomized, double-blind, placebo-controlled clinical studies were identified in which consumption of a blend of plant-derived polysaccharides showed positive effects on cognitive function and mood in healthy adults. A separate controlled clinical study observed improvements in well-being with ingestion of a yeast beta-glucan. Numerous animal and in vitro studies have demonstrated the ability of individual saccharide compounds and polysaccharide-rich extracts to modify behavior, enhance synaptic plasticity, and provide neuroprotective effects. Discussion Although the mechanisms by which exogenous saccharides can influence brain function are not well understood at this time, the literature suggests that certain naturally occurring compounds and polysaccharide-rich extracts show promise, when taken orally, in supporting neurologic health and function. Additional well-controlled clinical studies on larger populations are necessary, however, before specific recommendations can be made. PMID:22417773
Zhao, Wenzhu; Yu, Zhipeng; Liu, Jingbo; Yu, Yiding; Yin, Yongguang; Lin, Songyi; Chen, Feng
2011-09-01
Corn silk is a traditional Chinese herbal medicine, which has been widely used for treatment of some diseases. In this study the effects of pulsed electric field on the extraction of polysaccharides from corn silk were investigated. Polysaccharides in corn silk were extracted by pulsed electric field and optimized by response surface methodology (RSM), based on a Box-Behnken design (BBD). Three independent variables, including electric field intensity (kV cm(-1) ), ratio of liquid to raw material and pulse duration (µs), were investigated. The experimental data were fitted to a second-order polynomial equation and also profiled into the corresponding 3-D contour plots. Optimal extraction conditions were as follows: electric field intensity 30 kV cm(-1) , ratio of liquid to raw material 50, and pulse duration 6 µs. Under these condition, the experimental yield of extracted polysaccharides was 7.31% ± 0.15%, matching well with the predicted value. The results showed that a pulsed electric field could be applied to extract value-added products from foods and/or agricultural matrix. Copyright © 2011 Society of Chemical Industry.
Water-soluble polysaccharides from Pleurotus ostreatus var. florida mycelial biomass.
Komura, Dirce L; Ruthes, Andrea C; Carbonero, Elaine R; Gorin, Philip A J; Iacomini, Marcello
2014-09-01
Pleurotus ostreatus var. florida known as Hiratake has a high nutritional value, presents medicinal and nutraceutical properties and it is one of the consumed mushrooms in Brazil. Thus, the aim of this study was to characterize the chemical structure of polysaccharides found in mycelial biomass produced by submerged culture of P. ostreatus var. florida in order to compare with those found in P. ostreatus var. florida fruit bodies. Aqueous and alkali extracts obtained from mycelial biomass were purified, 13C NMR, GC-MS and chemical techniques were used to characterize three polysaccharide structures: a mannogalactan (MG-PfM) with α-D-Galp and 3-O-Me-α-D-Galp units, both (1→6)-linked, highly substituted at O-2 by D-Manp, a glycogen-like polymer (GLY-PfM) with α-D-Glp (1→4)-linked main chain, partially substituted at O-6 by α-D-Glcp side chains and a (1→3), (1→6) β-D-glucan (βGLC-PfM) with a main chain of β-D-Glcp (1→3)-linked units, partially substituted at O-6 by side chains of 6-O-substituted β-D-glucopyranosyl units, on an average of one to every two residues of the backbone. These results show the possibility to obtain similar and also different molecules from those found in the fruiting body of the same mushroom species, therefore the submerged culture of mushroom is a promising way to give raise molecules of interest. Copyright © 2014. Published by Elsevier B.V.
Rostami, Hosein; Gharibzahedi, Seyed Mohammad Taghi
2016-06-05
The operational parameters involved in microwave-assisted extraction (MAE) of jujube polysaccharide including microwave power, water to raw material ratio and extraction temperature and time were optimized by RSM. MAE at 400W, 75°C, 60 min, using 30 g water/g powdered jujube was the best condition for maximum yield (9.02%) of polysaccharide. Two novel water-soluble polysaccharides (JCP-1 and JCP-2) with average molecular weights of 9.1×10(4)-1.5×10(5)Da in term of the symmetrical narrow peaks were identified using the analytical purification procedures. The JCP-1 and JCP-2 mainly composed of glucose, arabinose, galactose and rhamnose in molar ratios of 1.4:2.1:4.2:0.9 and 1.2:1.8:4.1:1.1, respectively. The use of 1.5% JCP-1 led to a high emulsifying stability (95.5%) in a model oil-in-water type emulsion with a reduced surface tension (44.1 mN/m) and droplet size (1.32 μm), and an increased apparent viscosity (0.13 Pas) during 21-day cold storage. The antioxidant activities were increased in dose-dependent manners (25-200 μg/mL). Copyright © 2016 Elsevier Ltd. All rights reserved.
Fraunhofer, Marion E; Geissler, Andreas J; Wefers, Daniel; Bunzel, Mirko; Jakob, Frank; Vogel, Rudi F
2018-02-01
Despite several hurdles, which hinder bacterial growth in beer, certain bacteria are still able to spoil beer. One type of spoilage is characterized by an increased viscosity and slimy texture caused by exopolysaccharide (EPS) formation of lactic acid bacteria (LAB). In this study, we characterize for the first time EPS production in a beer-spoiling strain (TMW 1.2112) of Lactobacillus brevis, a species commonly involved in beer spoilage. The strain's growth dynamics were assessed and we found an increased viscosity or ropiness in liquid or on solid media, respectively. Capsular polysaccharides (CPS) and released EPS from the cells or supernatant, respectively, were analyzed via NMR spectroscopy and methylation analysis. Both are identical β-(1→3)-glucans, which are ramified with β-glucose residues at position O2. Therefore, we assume that this EPS is mainly produced as CPS and partially released into the surrounding medium, causing viscosity of e.g. beer. CPS formation was confirmed via an agglutination test. A plasmid-located glycosyltransferase-2 was found as responsible for excess β-glucan formation, chromosomal glucanases were proposed for its degradation. The glycosyltransferase-2 gene could also be specifically identified in beer-spoiling, slime-producing Lactobacillus rossiae and Lactobacillus parabuchneri strains, suggesting it as promising marker gene for the early detection of β-glucan-producing Lactobacilli in breweries. Copyright © 2017 Elsevier B.V. All rights reserved.
Wang, Juan; Lu, He Dong; Muḥammad, Umair; Han, Jin Zhi; Wei, Zhao Hui; Lu, Zhao Xin; Bie, Xiao Mei; Lu, Feng Xia
2016-02-01
Artemisia selengensis Turcz (AST) is a perennial herb with therapeutic and economic applications in China. The effects of ultrasound-assisted extraction (UAE) parameters upon extraction yield (EY%), antioxidant and antitumor activities of the polysaccharides extracts were studied by using a factorial design and response surface methodology. The optimal conditions determined were as: ultrasonic power 146 W, extraction time 14.5 min. and extraction temperature 60 °C. The average molecular weights of two homogeneous polysaccharides (APS1 and APS2) purified by DEAE cellulose-52 and Sephadex G-100 column chromatography were 125.4 and 184.1 kDa, respectively. Monosaccharide analysis showed that APS1 and APS2 were composed of five common monomers i.e., galactose, mannose, arabinose, xylose and rhamnose and one different monomer glucose and galacturonic acid respectively, with a most abundant part in molar % of APS1 and APS2 were glucose (83.01 %) and galacturonic acid (48.87 %) while least were xylose (0.80 %) and mannose (1.73 %) respectively. The antioxidant properties were determined by evaluating DPPH, hydroxyl radical scavenging activity and reducing power which indicated both APS1 and APS2 showed strong scavenging activities and anticancer activities on HT-29, BGC823 and antitumor activity on HepG-2. As UAE improved the polysaccharides yield than CSE, meanwhile, no significant difference of polysaccharides chemical compositions. Therefore, the present study suggests that the consumption of AST leaves may beneficial for the treatment of many diseases.
Macrophage immunomodulatory activity of polysaccharides isolated from Opuntia polyacantha
Schepetkin, Igor A.; Xie, Gang; Kirpotina, Liliya N.; Klein, Robyn A.; Jutila, Mark A.; Quinn, Mark T.
2008-01-01
Opuntia polyacantha (prickly pear cactus) has been used extensively for its nutritional properties; however, less is known regarding medicinal properties of Opuntia tissues. In the present study, we extracted polysaccharides from O. polyacantha and used size-exclusion chromatography to fractionate the crude polysaccharides into four polysaccharide fractions (designated as Opuntia polysaccharides C-I to C-IV). The average Mr of fractions C-I through C-IV was estimated to be 733, 550, 310, and 168 kDa, respectively, and sugar composition analysis revealed that Opuntia polysaccharides consisted primarily of galactose, galacturonic acid, xylose, arabinose, and rhamnose. Analysis of the effects of Opuntia polysaccharides on human and murine macrophages demonstrated that all four fractions had potent immunomodulatory activity, inducing production of reactive oxygen species, nitric oxide, tumor necrosis factor α, and interleukin 6. Furthermore, modulation of macrophage function by Opuntia polysaccharides was mediated, at least in part, through activation of nuclear factor κB. Together, our results provide a molecular basis to explain a portion of the beneficial therapeutic properties of extracts from O. polyacantha and support the concept of using Opuntia polysaccharides as an immunotherapeutic adjuvant. PMID:18597716
Bzducha-Wróbel, Anna; Błażejak, Stanisław; Kieliszek, Marek; Pobiega, Katarzyna; Falana, Katarzyna; Janowicz, Monika
2018-06-06
Changes in cell wall structure of four strains of Sacccharomyces cerevisiae species (brewer's, baker's and probiotic yeast) after culturing on deproteinated potato juice water (DPJW) with diverse addition of glycerol and different pH were investigated. It allowed to select conditions intensifying biosynthesis of β(1,3)/(1,6)-glucan and mannoproteins of cell walls of tested strains. Yeast cell wall structural polysaccharides show biological activity and technological usability in food industry but also decide about therapeutic properties of yeast biomass. The highest increase in the thickness of walls (by about 100%) and β-glucan layer (by about 120%) was stated after cultivation of S. cerevisiae R9 brewer's yeast in DPJW supplemented with 5 and 10% (w/v) of glycerol and pH 7.0 while S. cerevisiae var. boulardi PAN yeast synthesized by ab. 70% thicker β-glucan layer when the pH of growth medium was equal to 5.0. The cells of brewer's yeast (S. cerevisiae R9), probiotic (S. cerevisiae CNCM 1-745) and baker's (S. cerevisiae 102) intensified the ratio of mannoproteins in the structure of cell walls cultivated in mediums supplemented with above 15% of glycerol what point out the protective action of glycoprotein's under osmotic stress conditions. The study confirms at the first time the possibility of using agro-industrial waste in biosynthesis of functional polysaccharides of S. cerevisiae cell wall. It could be an new advantage in production of yeast biomass with therapeutic properties or β-glucan preparation as a novel food ingredient. Copyright © 2018 Elsevier B.V. All rights reserved.
Wang, Donghui; Fan, Bei; Wang, Yan; Zhang, Lijing
2018-01-01
Response surface methodology (RSM) was employed to optimize the conditions for the ultrasonic-assisted extraction (UAE) of polysaccharides from the flowers of Dendrobium devonianum. The optimal conditions for the maximum yields of DDFPs are as follows: an extraction temperature of 63.13°C, an extraction time of 53.10 min, and a water-to-raw material ratio of 22.11 mL/g. Furthermore, three fractions (DDFPs30, DDFPs50, and DDFPs70) were prepared from Dendrobium devonianum flowers polysaccharides (DDFPs) by the stepwise ethanol precipitation method. The DDFPs50 exhibited the highest antioxidant activity compared to the other fractions. The molecular weight, polydispersity, and conformation of these fractions were also characterized. In particular, the monosaccharide composition analysis of the DDFPs indicates that mannose and glucose are the primary components, similar to those of the D. officinale plant. This study provides a rapid extraction technology and essential information for the production of DDFPs, which could be potentially used as healthcare food. PMID:29581723
Extraction, purification and elicitor activities of polysaccharides from Chrysanthemum indicum.
Du, Ningning; Tian, Wei; Zheng, Dongfang; Zhang, Xinyi; Qin, Pinyan
2016-01-01
Polysaccharides isolated from Chrysanthemum indicum were studied for their pathogen-derived resistance against Sclerotium rolfsii sacc in Atractylodis maceocephalae koidz. The total sugar content and monosaccharide analysis were determined by phenol-sulfuric acid method and gas chromatography, and infrared spectroscopy performed for simple structure information. The activities of CAT and POD as protective enzymes in A. maceocephalae leaves were evaluated. The purified polysaccharides exhibited strong CAT and POD activities in inoculated with S. rolfsii in A. macrocephala leaves, attained the maximum value 568.3 Ug(-1)min(-1) and 604.4 Ug(-1)min(-1)respectively. Whereas, when compared with the control plants, 20mg/ml purified polysaccharides exhibited the strongest CAT and POD activities. Notably, the treatments of A. macepcephalae seedlings with C. indicum polysaccharides (CIP) decreased disease index development caused by S. rolfsii. The disease index after 10 days was significantly reduced when the seedlings treated with 20mg/ml CIP, 4.41 compared to the control plants 32.00. Given together, these results indicated that purified polysaccharides derived from C. indicum may be useful as a natural inducer. Copyright © 2015 Elsevier B.V. All rights reserved.
Immunochemical characterization of the "native" type III polysaccharide of group B Streptococcus
1976-01-01
The type III polysaccharide of -roup B Streptococcus has been isolated and purified by a method that employs washing of intact cells at neutral pH. That the polysaccharide prepared by this procedure is the "native" type III antigen is suggested by its molecular size in excess of 10(6) daltons, its degradation by acid and heat treatment to a fragment with immunologic characteristics of the classical HCl antigen, and its type-specific serologic activity. The type III polysaccharide in native form contains sialic acid, galactose, glucose, glucosamine, heptose, and mannose. It is acidic in nature, is resistant to neuramindiase degradation, contains no O-acetyl groups, and does not share antigenic determinants with capsular type K1 antigen of Escherichia coli or Group B polysaccharide antigen of Neiserria meningitidis. PMID:55450
Antibody to soluble 1,3/1,6-beta-D-glucan, SCG in sera of naive DBA/2 mice.
Harada, Toshie; Nagi Miura, Noriko; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito
2003-08-01
A branched beta-glucan from Sparassis crispa (SCG) is a major 6-branched 1,3-beta-D-glucan showing antitumor activity. In the present study, we examined the anti-SCG antibody in naive mice by ELISA. Using SCG coated plate, sera of naive DBA/1 and DBA/2 mice contained significantly higher titers of antibody than other strains of mice. Anti-SCG Ab titers of each DBA/1 and DBA/2 mice were significantly varied. Using various polysaccharide-coated plate, sera of DBA/2 mice also reacted with a beta-glucan from Candida spp. (CSBG) having 1,3-beta and 1,6-beta-glucosidic linkages. The SCG specific immunoglobulin (Ig) M but G was detected in sera. The reactivity of sera to coated SCG was neutralized by adding soluble SCG and CSBG as competitor. These results suggested that DBA/1 and DBA/2 strains carry specific and unique immunological characteristics to branched 1,3-/1,6-beta-glucan.
Multiple fingerprinting analyses in quality control of Cassiae Semen polysaccharides.
Cheng, Jing; He, Siyu; Wan, Qiang; Jing, Pu
2018-03-01
Quality control issue overshadows potential health benefits of Cassiae Semen due to the analytic limitations. In this study, multiple-fingerprint analysis integrated with several chemometrics was performed to assess the polysaccharide quality of Cassiae Semen harvested from different locations. FT-IR, HPLC, and GC fingerprints of polysaccharide extracts from the authentic source were established as standard profiles, applying to assess the quality of foreign sources. Analyses of FT-IR fingerprints of polysaccharide extracts using either Pearson correlation analysis or principal component analysis (PCA), or HPLC fingerprints of partially hydrolyzed polysaccharides with PCA, distinguished the foreign sources from the authentic source. However, HPLC or GC fingerprints of completely hydrolyzed polysaccharides couldn't identify all foreign sources and the methodology using GC is quite limited in determining the monosaccharide composition. This indicates that FT-IR/HPLC fingerprints of non/partially-hydrolyzed polysaccharides, respectively, accompanied by multiple chemometrics methods, might be potentially applied in detecting and differentiating sources of Cassiae Semen. Copyright © 2018 Elsevier B.V. All rights reserved.
Chen, Chun; You, Li-Jun; Abbasi, Arshad Mehmood; Fu, Xiong; Liu, Rui Hai
2015-10-05
Single-factor experiment and Box-Behnken design (BBD) were applied to optimize the ultrasound-assisted extraction of mulberry fruits polysaccharides (MFP). Under optimum conditions: ratio of water to raw material 40.25, extraction temperature 69°C, ultrasonic power 190W and extraction time 75 min, the MFP yield was 3.13% (±0.07%), in accordance to the predicted value of 3.04%. The mulberry fruits polysaccharides fractions was obtained by deproteinization (MFP-1), followed by decolorization and deionization (MFP-2). Carbohydrate content in MFP, MFP-1 and MFP-2 was 58.61% (±1.47%), 69.98% (±0.91%), 81.18% (±1.29%), as well as proteins was estimated 16.50% (±0.86%), 1.57% (±0.63%), 1.02% (±0.18%), respectively. The FT-IR indicated that MFP, MFP-1 and MFP-2 were acidic polysaccharides. The MFP-1 exhibited the strongest antioxidant activity, while MFP-2 showed the strongest hyperglycemic activity in vitro. This may be caused by their different compositions and physical properties in the different mulberry fruit polysaccharides fractions. Copyright © 2015 Elsevier Ltd. All rights reserved.
Gamma-irradiated β-glucan modulates signaling molecular targets of hepatocellular carcinoma in rats.
Elsonbaty, Sawsan M; Zahran, Walid E; Moawed, Fatma Sm
2017-08-01
β-glucans are one of the most abundant forms of polysaccharides known as biological response modifiers which influence host's biological response and stimulate immune system. Accordingly, this study was initiated to evaluate irradiated β-glucan as a modulator for cellular signaling growth factors involved in the pathogenesis of hepatocellular carcinoma in rats. Hepatocellular carcinoma was induced with 20 mg diethylnitrosamine/kg BW. Rats received daily by gastric gavage 65 mg irradiated β-glucan/kg BW. It was found that treatment of rats with diethylnitrosamine induced hepatic injury and caused significant increase in liver injury markers with a concomitant significant increase in both hepatic oxidative and inflammatory indices: alpha-fetoprotein, interferon gamma, and interleukin 6 in comparison with normal and irradiated β-glucan-treated groups. Western immunoblotting showed a significant increase in the signaling growth factors: extracellular signal-regulated kinase 1 and phosphoinositide 3-kinase proteins in a diethylnitrosamine-treated group while both preventive and therapeutic irradiated β-glucan treatments recorded significant improvement versus diethylnitrosamine group via the modulation of growth factors that encounters hepatic toxicity. The transcript levels of vascular endothelial growth factor A and inducible nitric oxide synthase genes were significantly higher in the diethylnitrosamine-treated group in comparison with controls. Preventive and therapeutic treatments with irradiated β-glucan demonstrated that the transcript level of these genes was significantly decreased which demonstrates the protective effect of β-glucan. Histological investigations revealed that diethylnitrosamine treatment affects the hepatic architecture throughout the significant severe appearance of inflammatory cell infiltration in the portal area and congestion in the portal vein in association with severe degeneration and dysplasia in hepatocytes all over hepatic
Hou, Qidong; Li, Weizun; Ju, Meiting; Liu, Le; Chen, Yu; Yang, Qian; Wang, Jingyu
2015-11-20
A solvent system consisting of 1,3-dimethyl-2-imidazolidinone (DMI), and ionic liquid 1-butyl-3-methylimidazolium acetate (BMIMOAc) was used to separate polysaccharides from rice husk and wheat bran. The effects of the DMI/BMIMOAc ratios, temperature, and time on the dissolution of rice husk and wheat bran were investigated, and the influence of anti-solvents on the regeneration of polysaccharides-rich material was evaluated. We found that the solvent system is more powerful to dissolve rice husk and wheat bran than pure BMIMOAc, and that polysaccharides-rich material can be effectively separated from the biomass solution. The polysaccharides content of regenerated material from wheat bran can reach as high as 94.4% when ethanol was used as anti-solvents. Under optimized conditions, the extraction rate of polysaccharides for wheat bran can reach as high as 71.8% at merely 50°C. The recycled solvent system exhibited constant ability to separate polysaccharides from rice husk and wheat bran. Copyright © 2015 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
To reduce susceptibility to stressors and diseases, immune-modulators such as ß-glucans have been proven effective tools to enhance the innate immune responses of fish. Consequently, commercial sources of this polysaccharide are becoming increasingly more available. AlgamuneTM is a commercial addi...
Hoson, Takayuki; Wakabayashi, Kazuyuki; Soga, Kouichi
2003-08-01
The involvement of anti-gravitational polysaccharides in gravity resistance, one of two major gravity responses in plants, was discussed. In dicotyledons, xyloglucans are the only cell wall polysaccharides, whose level, molecular size, and metabolic turnover were modified under both hypergravity and microgravity conditions, suggesting that xyloglucans act as anti-gravitational polysaccharides. In monocotyledonous Poaceae, (1-->3),(1-->4)-beta glucans, instead of xyloglucans, were shown to play a role as anti-gravitational polysaccharides. These polysaccharides are also involved in plant responses to other environmental factors, such as light and temperature, and to some phytohormones, such as auxin and ethylene. Thus, the type of anti-gravitational polysaccharides is different between dicotyledons and Poaceae, but such polysaccharides are universally involved in plant responses to environmental and hormonal signals. In gravity resistance, the gravity signal may be received by the plasma membrane mechanoreceptors, transformed and transduced within each cell, and then may modify the processes of synthesis and secretion of the anti-gravitational polysaccharides and the cell wall enzymes responsible for their degradation, as well as the apoplastic pH, leading to the cell wall reinforcement. A series of events inducing gravity resistance are quite independent of those leading to gravitropism.
Belhaj, Dalel; Frikha, Donyez; Athmouni, Khaled; Jerbi, Bouthaina; Ahmed, Mohammad Boshir; Bouallagui, Zouhaier; Kallel, Monem; Maalej, Sami; Zhou, John; Ayadi, Habib
2017-12-01
In this study, response surface methodology (RSM) based on Box-Behnken design (BBD) was employed to optimize the aqueous extraction of crude polysaccharides from Tunisian cyanobacteria Phormidium versicolor (NCC 466). The optimal extraction conditions with an extraction yield of 21.56±0.92% were as follows: extraction temperature at 81.05°C, extraction time of 3.99h, and water to raw material ratio of 21.52mLg -1 . Crude Phormidium versicolor polysaccharides (CPv-PS) are found to be a hetero-sulfated-anionic polysaccharides that contained carbohydrate (79.37±1.58%), protein (0.45±0.11%), uronic acids (4.37±0.19%) and sulfate (6.83±0.28%). The carbohydrate fraction was composed of arabinose, xylose, ribose, rhamnose, N-acetyl glucosamine, galactose, glucose, mannose, glucuronic acid and saccharose with corresponding mole percentages of 2.41, 14.58, 2.18, 6.23, 7.04, 28.21, 26.04, 3.02, 0.86 and 5.07, respectively. Evaluation of the antioxidant activity in vitro suggested that CPv-PS strongly scavenged radicals, prevented bleaching of β-carotene and reduced activity. Furthermore, the CPv-PS exhibited effective antimicrobial properties. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Twelve different amino acids were each substituted for Threonine-654 in a cloned glucansucrase from Leuconostoc mesenteroides NRRL B-1118 (DSR-I). The native enzyme produces a water-insoluble glucan containing approximately 44 mol% 1,3-disubstituted a-D-glucopyranosyl units and 29 mol% 1,6-disubstit...
Yamada, Koji; Suzuki, Hideyuki; Takeuchi, Takuto; Kazama, Yusuke; Mitra, Sharbanee; Abe, Tomoko; Goda, Keisuke; Suzuki, Kengo; Iwata, Osamu
2016-01-01
Euglena gracilis, a microalgal species of unicellular flagellate protists, has attracted much attention in both the industrial and academic sectors due to recent advances in the mass cultivation of E. gracilis that have enabled the cost-effective production of nutritional food and cosmetic commodities. In addition, it is known to produce paramylon (β-1,3-glucan in a crystalline form) as reserve polysaccharide and convert it to wax ester in hypoxic and anaerobic conditions–a promising feedstock for biodiesel and aviation biofuel. However, there remain a number of technical challenges to be solved before it can be deployed in the competitive fuel market. Here we present a method for efficient selective breeding of live oil-rich E. gracilis with fluorescence-activated cell sorting (FACS). Specifically, the selective breeding method is a repetitive procedure for one-week heterotrophic cultivation, staining intracellular lipids with BODIPY505/515, and FACS-based isolation of top 0.5% lipid-rich E. gracilis cells with high viability, after inducing mutation with Fe-ion irradiation to the wild type (WT). Consequently, we acquire a live, stable, lipid-rich E. gracilis mutant strain, named B1ZFeL, with 40% more lipid content on average than the WT. Our method paves the way for rapid, cost-effective, energy-efficient production of biofuel. PMID:27212384
Liu, Min; Luo, Fengling; Ding, Chuanlin; Albeituni, Sabrin; Hu, Xiaoling; Ma, Yunfeng; Cai, Yihua; McNally, Lacey; Sanders, Mary Ann; Jain, Dharamvir; Kloecker, Goetz; Bousamra, Michael; Zhang, Huang-ge; Higashi, Richard M.; Lane, Andrew N.; Fan, Teresa W-M.; Yan, Jun
2015-01-01
Tumor-associated macrophages (TAM) with an M2-like phenotype have been linked to tumor-elicited inflammation, immunosuppression, and resistance to chemotherapies in cancer, thus representing an attractive target for an effective cancer immunotherapy. Here, we demonstrate that particulate yeast-derived β-glucan, a natural polysaccharide compound, converts polarized M2 macrophages or immunosuppressive TAM into an M1-like phenotype with potent immuno-stimulating activity. This process is associated with macrophage metabolic reprograming with enhanced glycolysis, krebs cycle and glutamine utilization. In addition, particulate β-glucan converts immunosuppressive TAM via the C-type lectin receptor dectin-1-induced Syk-Card9-Erk pathway. Further in vivo studies show that oral particulate β-glucan treatment significantly delays tumor growth, which is associated with in vivo TAM phenotype conversion and enhanced effector T cell activation. Mice injected with particulate β-glucan-treated TAM mixed with tumor cells have significantly reduced tumor burden with less blood vascular vessels compared to those with TAM plus tumor cell injection. In addition, macrophage depletion significantly reduced the therapeutic efficacy of particulate β-glucan in tumor-bearing mice. These findings have established a new paradigm for macrophage polarization and immunosuppressive TAM conversion and shed the light on the action mode of β-glucan treatment in cancer. PMID:26453753
Gao, Yu; Fangel, Jonatan U; Willats, William G T; Vivier, Melané A; Moore, John P
2016-11-05
The effectiveness of enzyme-mediated-maceration in red winemaking relies on the use of an optimum combination of specific enzymes. A lack of information on the relevant enzyme activities and the corresponding polysaccharide-rich berry cell wall structure is a major limitation. This study used different combinations of purified recombinant pectinases with cell wall profiling tools to follow the deconstruction process during winemaking. Multivariate data analysis of the glycan microarray (CoMPP) and gas chromatography (GC) results revealed that pectin lyase performed almost as effectively in de-pectination as certain commercial enzyme mixtures. Surprisingly the combination of endo-polygalacturonase and pectin-methyl-esterase only unraveled the cell walls without de-pectination. Datasets from the various combinations used confirmed pectin-rich and xyloglucan-rich layers within the grape pomace. These data support a proposed grape cell wall model which can serve as a foundation to evaluate testable hypotheses in future studies aimed at developing tailor-made enzymes for winemaking scenarios. Copyright © 2016 Elsevier Ltd. All rights reserved.
Han, Wenfang; Li, Jiangtao; Ding, Yuqin; Xiong, Shanbai; Zhao, Siming
2017-10-01
In this study, rice bran polysaccharides (RBP) were extracted using the hydrothermal method (RBP-H), microwave-assisted extraction (RBP-M) and enzyme-assisted extraction (RBP-E). The prepared RBP samples exhibited the typical spectral patterns of polysaccharides, but differed in chemical composition, molecular features, antitumor and antioxidant activities. The molecular weights (Mw) of RBP-H, RBP-M, and RBP-E were 1.03 × 10 5 , 2.62 × 10 5 , and 0.46 × 10 5 g/mol, respectively. In vitro, all RBP samples significantly inhibited mouse sarcoma S180 cells viability in a dose-dependent manner. In vivo, RBP-M or RBP-E could not only inhibit the growth of the tumor, but also enhance the spleen index. In addition, RBP-E could induce an enhancement of superoxide dismutase (SOD) and glutathione peroxidase activities and a scavenging effect on malondialdehyde. This study demonstrated that the effective antitumor activity of RBP may be owed to its enhancement of antioxidant activity function. The present work suggested that RBP, especially RBP-E could be a safe and effective antitumor, bioactive agent or functional food. Polysaccharides is extracted from rice bran (RBP) using hydrothermal, microwave-assisted and enzyme-assisted extraction methods. The results suggested that the antitumor activity of RBP was associated with enhancement of immunization and antioxidant. RBP could be explored as a natural antitumor and antioxidant agent applied in medicines and functional foods. © 2017 Institute of Food Technologists®.
Anatomy and cell wall polysaccharides of almond (Prunus dulcis D. A. Webb) seeds.
Dourado, Fernando; Barros, António; Mota, Manuel; Coimbra, Manuel A; Gama, Francisco M
2004-03-10
The anatomy of Prunus dulcis was analyzed by applying several differential staining techniques and light microscopy. Prunus dulcis seed has a thin and structurally complex seed coat, with lignified cellulosic tissue. The embryo has two voluminous cotyledons. Cotyledon cells have a high number of protein and lipid bodies, some of which have phytin. The provascular tissue, located in the cotyledons, is oriented in small bundles perpendicular to the transverse embryonic axis. Prunus dulcis cell wall material is very rich in arabinose (45 mol %). Glucose (23%), uronic acids (12%), and xylose (12%) are also major sugar components. The polymers obtained from the imidazole and Na(2)CO(3) extracts contain mainly pectic substances rich in arabinose, but the sugar content of these extracts was very low. The majority of the pectic substances (also rich in arabinose) was recovered with the KOH extracts. These extracts, with high sugar content, yielded also xyloglucans and acidic xylans. The 4 M KOH + H(3)BO(3) extracts yielded polysaccharides rich in uronic acids and xylose and very rich in arabinose, accounting for 27% of the cell wall material.
Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz
2012-01-01
Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.
Wang, Hong-Bin
2014-03-15
In the present study, we investigated the cellulase-assisted extraction and antibacterial activity of water-soluble polysaccharides from the dandelion Taraxacum officinale. The extraction conditions, optimized for improving yield, were as follows: time, 46.11 min; temperature, 54.87 °C; pH, 4.51 and cellulase enzyme, 4000 U/g. Under these conditions, the yield of polysaccharides from dandelion (PD) reached 20.67% (w/w). The sugar content of PD was 95.6% (w/w), and it displayed high antibacterial activity at a concentration of 100mg/mL against Escherichia coli, Bacillus subtilis and Staphylococcus aureus. These results indicate that PD may be a viable option for use as a food preservative. Copyright © 2013 Elsevier Ltd. All rights reserved.
Biosynthesis of plant cell wall polysaccharides.
Gibeaut, D M; Carpita, N C
1994-09-01
The cell wall is the principal structural element of plant form. Cellulose, long crystals of several dozen glucan chains, forms the microfibrillar foundation of plant cell walls and is synthesized at the plasma membrane. Except for callose, all other noncellulosic components are secreted to the cell surface and form a porous matrix assembled around the cellulose microfibrils. These diverse noncellulosic polysaccharides and proteins are made in the endomembrane system. Many questions about the biosynthesis and modification within the Golgi apparatus and integration of cell components at the cell surface remain unanswered. The lability of synthetic complexes upon isolation is one reason for slow progress. However, with new methods of membrane isolation and analysis of products in vitro, recent advances have been made in purifying active synthases from plasma membrane and Golgi apparatus. Likely synthase polypeptides have been identified by affinity-labeling techniques, but we are just beginning to understand the unique features of the coordinated assembly of complex polysaccharides. Nevertheless, such progress renews hope that the first gene of a synthase for a wall polysaccharide from higher plants is within our grasp.
Morris, Jessica D.; Rajaram, Murugesan V.S.; Schlesinger, Larry S.
2014-01-01
The yeast polysaccharide, β-glucan, has been shown to promote both anti-microbial and anti-tumor activities through its interaction with macrophages. Here we analyzed the effects of an insoluble whole glucan particle (WGP), a 1,3/1,6-β-glucan from Saccharomyces cerevisiae, and a soluble poly-1-6-β-d-glucopyranosyl-1-3-β-d-glucopyranose (PGG), a hydrolytic product of WGP, on the anti-microbial response of human macrophages against mycobacterial infection. Treatment of macrophages with WGP and PGG significantly decreased cell association and intracellular growth of Mycobacterium bovis BCG, but not Mycobacterium tuberculosis (M.tb) when compared to untreated controls. We characterized the influence of β-glucans on the generation of macrophage oxidative products and pro-inflammatory cytokines, two important anti-microbial defense mechanisms. WGP but not PGG treatment enhanced the oxidative response of macrophages as determined by the 2′,7′-dichlorofluorescin (DCF) assay. WGP treatment also induced macrophages to produce pro-inflammatory cytokines. The β-glucan receptor, Dectin-1, was found to be involved in the WGP-induced macrophage oxidative burst and intracellular growth inhibition of M. bovis BCG. This report indicates that although some forms of β-glucan are able to stimulate the respiratory burst and cytokine production in human macrophages, and exhibit antimicrobial properties against M. bovis BCG, the β-glucans tested here did not inhibit growth of M.tb within human macrophages. PMID:21762773
Chen, Xiaoqiang; Song, Wei; Zhao, Jin; Zhang, Zhifa; Zhang, Yuntian
2017-05-31
Polysaccharide conjugates were alkali-extracted from green tea (TPC-A). Although it contained 11.80% covalently binding proteins, TPC-A could not bind to the Coomassie Brilliant Blue dyes G250 and R250. TPC-A had no expected characteristic absorption peak of protein in the UV-vis spectrum scanning in the range of 200-700 nm. The UV-vis wavelength of 280 nm was not suitable to detect the presence of the protein portion of TPC-A. The zeta potential of TPC-A merely presented the negative charge properties of polysaccharides instead of the acid-base property of its protein section across the entire pH range. Furthermore, TPC-A was more stable when the pH of solution exceeded 4.0. In addition, no precipitation or haze was generated in the TPC-A/(-)-epigallocatechin gallate (EGCG) mixtures during 12 h storage. TPC-A has emulsifying activity, which indicated that its protein moiety formed hydrophobic groups. Thus, it was proposed that some physical properties of TPC-A protein were shielded by its olysaccharide, since the protein moiety was wrapped by its polysaccharide chains.
Liu, Chao; Sun, Yonghai; Mao, Qian; Guo, Xiaolei; Li, Peng; Liu, Yang; Xu, Na
2016-01-01
Polysaccharides from Morchella esculenta have been proven to be functional and helpful for humans. The purpose of this study was to investigate the chemical structure and anti-proliferating and antitumor activities of a Morchella esculenta polysaccharide (MEP) extracted by pulsed electric field (PEF) in submerged fermentation. The endo-polysaccharide was separated and purified by column chromatography and Gel permeation chromatography, and analyzed by gas chromatography. The MEP with an average molecular weight of 81,835 Da consisted of xylose, glucose, mannose, rhamnose and galactose at the ratio of 5.4:5.0:6.5:7.8:72.3. Structure of MEP was further analyzed by Fourier-transform infrared spectroscopy and 1H and 13C liquid-state nuclear magnetic resonance spectroscopy. Apoptosis tests proved that MEP could inhibit the proliferation and growth of human colon cancer HT-29 cells in a time- and dose-dependent manner within 48 h. This study provides more information on chemical structure of anti-proliferating polysaccharides isolated from Morchella esculenta. PMID:27338370
Chang, Ke Liang B.; Kong, Zwe-Ling
2015-01-01
Antrodia camphorata is a well-known medicinal mushroom in Taiwan and has been studied for decades, especially with focus on anti-cancer activity. Polysaccharides are the major bioactive compounds reported with anti-cancer activity, but the debates on how they target cells still remain. Research addressing the encapsulation of polysaccharides from A. camphorata extract (ACE) to enhance anti-cancer activity is rare. In this study, ACE polysaccharides were nano-encapsulated in chitosan-silica and silica (expressed as ACE/CS and ACE/S, respectively) to evaluate the apoptosis effect on a hepatoma cell line (Hep G2). The results showed that ACE polysaccharides, ACE/CS and ACE/S all could damage the Hep G2 cell membrane and cause cell death, especially in the ACE/CS group. In apoptosis assays, DNA fragmentation and sub-G1 phase populations were increased, and the mitochondrial membrane potential decreased significantly after treatments. ACE/CS and ACE/S could also increase reactive oxygen species (ROS) generation, induce Fas/APO-1 (apoptosis antigen 1) expression and elevate the proteolytic activities of caspase-3, caspase-8 and caspase-9 in Hep G2 cells. Unsurprisingly, ACE/CS induced a similar apoptosis mechanism at a lower dosage (ACE polysaccharides = 13.2 μg/mL) than those of ACE/S (ACE polysaccharides = 21.2 μg/mL) and ACE polysaccharides (25 μg/mL). Therefore, the encapsulation of ACE polysaccharides by chitosan-silica nanoparticles may provide a viable approach for enhancing anti-tumor efficacy in liver cancer cells. PMID:26327534
Liu, Ying; Zhang, Bin; Ibrahim, S A; Gao, Shuang-Shuang; Yang, Hong; Huang, Wen
2016-07-10
In this study, we isolated polysaccharides from Flammulina velutipes residue (FVRP) using microwave-assisted extraction and then purified the polysaccharides by column chromatography to yield FVRP-1, FVRP-2 and FVRP-3. The structural characteristics of FVRP-1, FVRP-2 and FVRP-3 were investigated, and their antioxidant activities against ABTS(+), DPPH and hydroxyl radicals were also analyzed in vitro. FVRP-1 was found to be neutral and rich in galactose. However, FVRP-2 and FVRP-3 were acidic polysaccharides and were rich in glucose. The average molecular weight of FVRP-1, FVRP-2 and FVRP-3 were 29,930, 62,290, and 36,310Da, respectively. The glycosyl residue of FVRP-1 was an α-type glycosidic linkage, whereas FVRP-2 and FVRP-3 were β-type glycosidic linkages. We found FVRP-1, FVRP-2 and FVRP-3 had strong potential antioxidant activities in the order of FVRP-1
White, Paul B; Wang, Tuo; Park, Yong Bum; Cosgrove, Daniel J; Hong, Mei
2014-07-23
Polysaccharide-rich plant cell walls are hydrated under functional conditions, but the molecular interactions between water and polysaccharides in the wall have not been investigated. In this work, we employ polarization transfer solid-state NMR techniques to study the hydration of primary-wall polysaccharides of the model plant, Arabidopsis thaliana. By transferring water (1)H polarization to polysaccharides through distance- and mobility-dependent (1)H-(1)H dipolar couplings and detecting it through polysaccharide (13)C signals, we obtain information about water proximity to cellulose, hemicellulose, and pectins as well as water mobility. Both intact and partially extracted cell wall samples are studied. Our results show that water-pectin polarization transfer is much faster than water-cellulose polarization transfer in all samples, but the extent of extraction has a profound impact on the water-polysaccharide spin diffusion. Removal of calcium ions and the consequent extraction of homogalacturonan (HG) significantly slowed down spin diffusion, while further extraction of matrix polysaccharides restored the spin diffusion rate. These trends are observed in cell walls with similar water content, thus they reflect inherent differences in the mobility and spatial distribution of water. Combined with quantitative analysis of the polysaccharide contents, our results indicate that calcium ions and HG gelation increase the amount of bound water, which facilitates spin diffusion, while calcium removal disrupts the gel and gives rise to highly dynamic water, which slows down spin diffusion. The recovery of spin diffusion rates after more extensive extraction is attributed to increased water-exposed surface areas of the polysaccharides. Water-pectin spin diffusion precedes water-cellulose spin diffusion, lending support to the single-network model of plant primary walls in which a substantial fraction of the cellulose surface is surrounded by pectins.
Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert
2016-01-20
α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.
Linkage Analyses of Extracellular Glucans from Streptococcus sanguis and Streptococcus mitior
Freedman, M.; Birkhed, D.; Coykendall, A.; Rizzo, D.
1979-01-01
Similar α-(1→6) linkage-rich, soluble, extracellular glucans have been isolated from six strains of two genetically distinct groups of Streptococcus sanguis and three strains of Streptococcus mitior. PMID:457265
Williams, Roderick; Dias, Daniel A; Jayasinghe, Nirupama; Roessner, Ute; Bennett, Louise E
2016-04-15
Regulation of the human immune system requires controlled pro- and anti-inflammatory responses for host defence against infection and disease states. Yeasts (Saccharomyces cerevisiae), as used in brewing and baking, are mostly known for ability to stimulate the human immune-system predominantly reflecting the pro-inflammatory cell wall β-glucans. However, in this study, using food-compatible processing methods, glycopeptide-enriched and β-glucan-depleted products were each prepared from Brewer's and Baker's yeasts, which suppressed production of interferon-γ (IFN-γ) in human whole blood cell assay, signifying that anti-inflammatory factors are also present in yeast. Anti-inflammatory bioactivities of products prepared from Brewer's and Baker's yeast were compared with the commercial yeast product, Epicor®. While unfractionated Epicor was inactive, the C18 resin-binding fractions of Brewer's and Baker's yeast products and Epicor dose-dependently lowered IFN-γ, demonstrating that Epicor also contained both pro-inflammatory (β-glucans) and anti-inflammatory components. Anti-inflammatory activity was attributed to C18 resin-binding species glyco-peptides in Epicor and experimental yeast products. This study demonstrated that pro- and anti-inflammatory factors could be resolved and enriched in yeasts by suitable processing, with potential to improve specific activities. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Li, Huan-Jun; Zhang, De-Huai; Yue, Tong-Hui; Jiang, Lu-Xi; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2016-01-10
Expression of Vitreoscilla hemoglobin (VHb) gene was used to improve polysaccharide production in Ganoderma lucidum. The VHb gene, vgb, under the control of the constitutive glyceraldehyde-3-phosphate dehydrogenase gene promoter was introduced into G. lucidum. The activity of expressed VHb was confirmed by the observation of VHb specific CO-difference spectrum with a maximal absorption at 419 nm for the transformant. The effects of VHb expression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production and transcription levels of three genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), uridine diphosphate glucose pyrophosphorylase (UGP), and β-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in the vgb-bearing G. lucidum were 26.4 mg/100mg dry weight and 0.83 g/L, respectively, which were higher by 30.5% and 88.2% than those of the wild-type strain. The transcription levels of PGM, UGP and GLS were up-regulated by 1.51-, 1.55- and 3.83-fold, respectively, in the vgb-bearing G. lucidum. This work highlights the potential of VHb to enhance G. lucidum polysaccharide production by large scale fermentation. Copyright © 2015 Elsevier B.V. All rights reserved.
Puanglek, Sakarin; Kimura, Satoshi; Enomoto-Rogers, Yukiko; Kabe, Taizo; Yoshida, Makoto; Wada, Masahisa; Iwata, Tadahisa
2016-01-01
Bio-based polymer is considered as one of potentially renewable materials to reduce the consumption of petroleum resources. We report herein on the one-pot synthesis and development of unnatural-type bio-based polysaccharide, α-1,3-glucan. The synthesis can be achieved by in vitro enzymatic polymerization with GtfJ enzyme, one type of glucosyltransferase, cloned from Streptococcus salivarius ATCC 25975 utilizing sucrose, a renewable feedstock, as a glucose monomer source, via environmentally friendly one-pot water-based reaction. The structure of α-1,3-glucan is completely linear without branches with weight-average molecular weight (Mw) of 700 kDa. Furthermore, acetate and propionate esters of α-1,3-glucan were synthesized and characterized. Interestingly, α-1,3-glucan acetate showed a comparatively high melting temperature at 339 °C, higher than that of commercially available thermoplastics such as PET (265 °C) and Nylon 6 (220 °C). Thus, the discovery of crystalline α-1,3-glucan esters without branches with high thermal stability and melting temperature opens the gate for further researches in the application of thermoplastic materials. PMID:27469976
NASA Astrophysics Data System (ADS)
Puanglek, Sakarin; Kimura, Satoshi; Enomoto-Rogers, Yukiko; Kabe, Taizo; Yoshida, Makoto; Wada, Masahisa; Iwata, Tadahisa
2016-07-01
Bio-based polymer is considered as one of potentially renewable materials to reduce the consumption of petroleum resources. We report herein on the one-pot synthesis and development of unnatural-type bio-based polysaccharide, α-1,3-glucan. The synthesis can be achieved by in vitro enzymatic polymerization with GtfJ enzyme, one type of glucosyltransferase, cloned from Streptococcus salivarius ATCC 25975 utilizing sucrose, a renewable feedstock, as a glucose monomer source, via environmentally friendly one-pot water-based reaction. The structure of α-1,3-glucan is completely linear without branches with weight-average molecular weight (Mw) of 700 kDa. Furthermore, acetate and propionate esters of α-1,3-glucan were synthesized and characterized. Interestingly, α-1,3-glucan acetate showed a comparatively high melting temperature at 339 °C, higher than that of commercially available thermoplastics such as PET (265 °C) and Nylon 6 (220 °C). Thus, the discovery of crystalline α-1,3-glucan esters without branches with high thermal stability and melting temperature opens the gate for further researches in the application of thermoplastic materials.
Maca polysaccharides: A review of compositions, isolation, therapeutics and prospects.
Li, Yujuan; Xu, Fangxue; Zheng, Mengmeng; Xi, Xiaozhi; Cui, Xiaowei; Han, Chunchao
2018-05-01
Maca polysaccharides, some of the major bioactive substances in Lepidium meyenii (Walp.) (Maca), have various biological properties, including anti-oxidant, anti-fatigue, anti-tumor, and immunomodulatory effects, as well as hepatoprotective activity and regulation function. Although many therapeutics depend on multiple structures of maca polysaccharides in addition to providing sufficient foundations for maca polysaccharide products in industrial applications, the relationships between the pharmacological effects and structures have not been established. Therefore, this article summarizes the extraction and purification methods, compositions, pharmacological effects, prospects and industrial applications of maca polysaccharides. Copyright © 2018 Elsevier B.V. All rights reserved.
Chaouch, Mohamed Aymen; Hafsa, Jawhar; Rihouey, Christophe; Le Cerf, Didier; Majdoub, Hatem
2015-08-01
The extraction, purification and degradation of polysaccharides from Opuntia ficus indica cladodes, as well as the evaluation of their antioxidant and antiglycated activities in vitro were investigated. The optimization of the extraction showed that extraction by ultrasound at 40 °C presented the best carbohydrates yield. The degradation of the extracted polysaccharides was achieved by free radical depolymerization with H2O2 in the presence of copper(II) acetate for various reaction times. Sugar contents were determined by colorimetric assays. The macromolecular characteristics of the different isolated and degraded carbohydrates were carried by size exclusion chromatography (SEC/MALS/VD/DRI). These experiments showed that all samples are polysaccharides, which are probably pectins and that molecular weight (Mw) has decreased from 6,800,000 to 14,000 g/mol after 3 h of depolymerization without changing the structure. Preliminary antioxidant and antiglycated tests indicated that degraded polysaccharides for 2 and 3 h showed even better antioxidant and antiglycated activities. Copyright © 2015 Elsevier B.V. All rights reserved.
Hydrolytic stability of pneumococcal group 6 (type 6A and 6B) capsular polysaccharides.
Zon, G; Szu, S C; Egan, W; Robbins, J D; Robbins, J B
1982-01-01
The hydrolyses of the immunologically cross-reactive and constitutionally isomeric group 6 pneumococcal polysaccharides, types 6A and 6B, were investigated by 31P nuclear magnetic resonance spectroscopy, gel filtration through Sepharose 4B, reducing-sugar analysis, and rocket immunoelectrophoresis. Phosphorus nuclear magnetic resonance spectroscopy showed that cleavage of the repeating-unit phosphodiester linkages at pH 10, 60 degrees C was considerably faster (greater than 10(3) ) for the type 6A than the type 6B polysaccharide. Under these reaction conditions, 31P nuclear magnetic resonance kinetic measurements showed that the Na+ form of the type 6A polysaccharide underwent phosphodiester-linkage hydrolysis two times slower than the corresponding Ca+2 form; a stoichiometrically excess amount of Ca+2 caused a 30-fold enhancement of the latter hydrolysis rate. The spectroscopic characterization of phosphorus-containing end groups resulting from hydrolysis of the type 6A polymer provided additional mechanistic information. Heating the type 6A and 6B polysaccharides at 56 degrees C for various times led to gel filtration coefficients of distribution (Kd values) which indicated that the type 6A material underwent size reductions considerably faster than did the type 6B antigen; these increased Kd values qualitatively correlated with the loss of immunochemical reactivity measured by rocket immunoelectrophoresis. The application of a statistical theory to the depolymerization of the type 6A and 6B polysaccharides was consistent with random bond cleavage, as evidenced by the calculated versus measured gel filtration patterns. Although the molecular changes causing the size reductions were not fully elaborated, it was established that the acetal linkages of the type 6A and 6B polysaccharides were comparatively resistant to hydrolysis and that depolymerization by hydrolysis of the phosphodiester linkage was a major factor only in the type 6A structure. It was concluded
Kono, Hiroyuki; Kondo, Nobuhiro; Hirabayashi, Katsuki; Ogata, Makoto; Totani, Kazuhide; Ikematsu, Shinya; Osada, Mitsumasa
2017-12-01
This article contains two-dimensional (2D) NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany) which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG) and a water-soluble β-(1→3, 1→6)-glucan from Aureobasidium pullulans . Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers , entitled "NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6)-glucan from A. pullulans " (Kono et al., 2017) [1]. Data can help to assign the 1 H and 13 C chemical shifts of the structurally complex polysaccharides.
Boulos, Samy; Nyström, Laura
2017-01-01
The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO • ) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO • -attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random
Boulos, Samy; Nyström, Laura
2017-01-01
The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO
Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J
2009-10-14
To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.
Ballesteros, Lina F; Cerqueira, Miguel A; Teixeira, José A; Mussatto, Solange I
2018-01-01
Extracts rich in polysaccharides were obtained by alkali pretreatment (PA) or autohydrolysis (PB) of spent coffee grounds, and incorporated into a carboxymethyl cellulose (CMC)-based film aiming at the development of bio-based films with new functionalities. Different concentrations of PA or PB (up to 0.20% w/v) were added to the CMC-based film and the physicochemical properties of the final films were determined. Scanning electron microscopy, Fourier-transform infrared spectroscopy, X-ray diffraction, thermogravimetric analysis, as well as determinations of optical and mechanical properties, moisture content, solubility in water, water vapor permeability, contact angle and sorption isotherms were performed. The addition of PA or PB resulted in important changes in the properties of the CMC-based film, mainly in color and opacity. The polysaccharides incorporation significantly improved the light barrier of the film and provided an enhancement or at least a preservation in the physicochemical properties. Copyright © 2017 Elsevier B.V. All rights reserved.
Binding of Soluble Yeast β-Glucan to Human Neutrophils and Monocytes is Complement-Dependent
Bose, Nandita; Chan, Anissa S. H.; Guerrero, Faimola; Maristany, Carolyn M.; Qiu, Xiaohong; Walsh, Richard M.; Ertelt, Kathleen E.; Jonas, Adria Bykowski; Gorden, Keith B.; Dudney, Christine M.; Wurst, Lindsay R.; Danielson, Michael E.; Elmasry, Natalie; Magee, Andrew S.; Patchen, Myra L.; Vasilakos, John P.
2013-01-01
The immunomodulatory properties of yeast β-1,3/1,6 glucans are mediated through their ability to be recognized by human innate immune cells. While several studies have investigated binding of opsonized and unopsonized particulate β-glucans to human immune cells mainly via complement receptor 3 (CR3) or Dectin-1, few have focused on understanding the binding characteristics of soluble β-glucans. Using a well-characterized, pharmaceutical-grade, soluble yeast β-glucan, this study evaluated and characterized the binding of soluble β-glucan to human neutrophils and monocytes. The results demonstrated that soluble β-glucan bound to both human neutrophils and monocytes in a concentration-dependent and receptor-specific manner. Antibodies blocking the CD11b and CD18 chains of CR3 significantly inhibited binding to both cell types, establishing CR3 as the key receptor recognizing the soluble β-glucan in these cells. Binding of soluble β-glucan to human neutrophils and monocytes required serum and was also dependent on incubation time and temperature, strongly suggesting that binding was complement-mediated. Indeed, binding was reduced in heat-inactivated serum, or in serum treated with methylamine or in serum reacted with the C3-specific inhibitor compstatin. Opsonization of soluble β-glucan was demonstrated by detection of iC3b, the complement opsonin on β-glucan-bound cells, as well as by the direct binding of iC3b to β-glucan in the absence of cells. Binding of β-glucan to cells was partially inhibited by blockade of the alternative pathway of complement, suggesting that the C3 activation amplification step mediated by this pathway also contributed to binding. PMID:23964276
Karumuthil-Melethil, Subha; Gudi, Radhika; Johnson, Benjamin M.; Perez, Nicolas; Vasu, Chenthamarakshan
2014-01-01
Beta-glucans (β-glucans) are naturally occurring polysaccharides in cereal grains, mushrooms, algae, or microbes including bacteria, fungi, and yeast. Immune cells recognize these β-glucans through a cell surface pathogen recognition receptor (PRR) called Dectin-1. Studies using β-glucans and other Dectin-1 binding components have demonstrated the potential of these agents in activating the immune cells for cancer treatment and controlling infections. Here, we show that the β-glucan from Saccharomyces cerevisiae induces the expression of immune regulatory cytokines (IL-10, TGF-β1 and IL-2) and a tolerogenic enzyme (Indoleamine 2, 3-dioxygenase; IDO) in bone marrow derived DCs (BM DCs) as well as spleen cells. These properties can be exploited to modulate autoimmunity in non-obese diabetic (NOD) mouse model of type 1 diabetes (T1D). Treatment of pre-diabetic NOD mice with low dose β-glucan resulted in a profound delay in hyperglycemia and this protection was associated with increase in the frequencies of Foxp3-, LAP-, and GARP-positive T cells. Upon antigen presentation, β-glucan-exposed DCs induced a significant increase in Foxp3− and LAP− positive T cells in in vitro cultures. Further, systemic co-administration of β-glucan plus pancreatic β-cell-Ag resulted in an enhanced protection of NOD mice from T1D as compared to treatment with β-glucan alone. These observations demonstrate that the innate immune response induced by low dose β-glucan is regulatory in nature and can be exploited to modulate T cell response to β-cell-Ag for inducing an effective protection from T1D. PMID:25143443
Matloub, Azza A; Aglan, Hadeer A; Mohamed El Souda, Sahar Salah; Aboutabl, Mona Elsayed; Maghraby, Amany Sayed; Ahmed, Hanaa H
2016-12-01
To explore the in vivo anticancer, anti-angiogenesis and immunomodulatory efficacies of the bioactive polysaccharide isolated from cold aqueous extract of Jania rubens (JCEM) and Pterocladia capillacea (PCEM) as well as hot aqueous extract of Enteromorpha intestinalis (EHEM) against hepatocellular carcinoma rat model (HCC) and to study their chemical composition. The sugars and amino acids composition of the bioactive polysaccharides of JCEM, PCEM and EHEM were determined using gas liquid chromatography and amino acid analyzer, respectively. These polysaccharide extracts (20 mg/kg b.wt. for 5 weeks) were assessed on hepatocarcinogenesis in rats and α-fetoprotein (AFP), carcinoembryonic antigen (CEA), glypican-3 (GPC-3), hepatocyte growth factor (HGF) and vascular endothelial growth factor (VEGF) and Ig G levels were evaluated. The GLC analysis of JCEM, PCEM and EHEM polysaccharide revealed the presence of 10, 9 and 10 sugars, in addition the amino acid analyzer enable identification of 16, 15 and 15 amino acids, respectively. These polysaccharide extracts of JCEM, PCEM and EHEM produced significant decrease in serum AFP, CEA, GPC-3, HGF and VEGF compared with untreated HCC group. JCEM, PCEM and EHEM had an immunostimulatory responses by increasing the IgG levels as compared by naïve value (1.23, 1.53 and 1.17 folds), respectively. The bioactive polysaccharides in HCC induced rats improved the humoral immune response. The photomicrographs of liver tissue sections of the groups of HCC treated with polysaccharide extracts of Jania rubens and Enteromorpha intestinalis showed intact histological structure. Moreover, fractions HE1, HE4, HE7 obtained from polysaccharide of EHEM showed moderate cytotoxic activity against HepG2 in vitro with IC 50 73.1, 42.6, 76.2 μg/mL. However, fractions of PCEM and JCEM show no or weak cytotoxicity against HepG2 in vitro where the cytotoxic activity of their crude polysaccharide extract proved synergetic effect. The pronounced
Pectic polysaccharides from Panax ginseng as the antirotavirus principals in ginseng.
Baek, Seung-Hoon; Lee, Jin Gyun; Park, Seo Young; Bae, Ok Nam; Kim, Dong-Hyun; Park, Jeong Hill
2010-08-09
To evaluate the antidiarrheal effect of ginseng, the active principals of ginseng were studied in vitro model of rotavirus infection, the leading cause of severe diarrhea. Two pectic polysaccharides, named as GP50-dHR (56.0 kDa) and GP50-eHR (77.0 kDa), were purified from hot water extract of ginseng by bioassay-linked fractionation. Both polysaccharides rescued cell viability from rotavirus infection dose-dependently (IC50 are 15 and 10 microg/mL, respectively). Both polysaccharides had common structural features of homogalacturonan backbone with hairy regions of rhamnogalacturonan type I. Arabinose-rich side chains with abundant branch points were unique in GP50-eHR and may contribute to a greater antirotavirus effect of GP50-eHR than GP50-dHR. Because homogalacturonan itself did not show an antirotavirus effect, hairy regions might be functional sites. Of note, the antirotavirus effect of both polysaccharides resulted from inhibiting rotavirus attachment to cells. Together with a wide range of noncytotoxicity, these findings suggest that ginseng polysaccharides are viable therapeutic options for rotavirus diarrhea.
Zhang, Hai-Lin; Cui, Shao-Hua; Zha, Xue-Qiang; Bansal, Vibha; Xue, Lei; Li, Xiao-Long; Hao, Ran; Pan, Li-Hua; Luo, Jian-Ping
2014-06-15
In this work, response surface methodology was used to determine optimum conditions for extraction of polysaccharides from jellyfish skin (JSP). The optimum parameters were found to be raw material to water ratio 1:7.5 (w/v), extraction temperature 100°C and extraction time 4h. Under these conditions, the JSP yield reached 1.007 mg/g. Papain (15 U/mL) in combination with Sevag reagent was beneficial in removing proteins from JSP. After precipitation with ethanol at final concentration of 40%, 60% and 80% in turn, three polysaccharide fractions of JSP1, JSP2 and JSP3 were obtained from JSP, respectively. The three fractions exhibited different physicochemical properties with respect to molecular weight distribution, monosaccharide composition, infrared absorption spectra, and glycosyl bond composition. In addition, JSP3 showed strong inhibitory effects on oxidized low-density lipoprotein (oxLDL) induced conversion of macrophages into foam cells, which possibly attributed to the down-regulation of some atherogenesis-related gene expressions. Copyright © 2014 Elsevier Ltd. All rights reserved.
Baik, Joo Hyun; Shin, Kwang-Soon; Park, Yooheon; Yu, Kwang-Won; Suh, Hyung Joo; Choi, Hyeon-Son
2015-08-30
Green tea is a dietary source of bioactive compounds for human health. Enzymatic treatments induce the bioconversion of bioactive components, which can improve biological activities. In this study, we investigated the effect of simultaneous treatment with tannase and Rapidase on biotransformation of catechins and extraction of polysaccharide from green tea extract (GTE). Tannase and pectinase treatments induced the biotransformation of catechins and altered tea polysaccharide () content. The addition of GTE to the enzyme reaction resulted in a significant increase in degallated catechins, including gallic acid, a product of the tannase reaction (314.5-4076.0 µg mL(-1)) and a reduction in epigallocatechin gallate (EGCG). Biotransformation of catechins improved the radical scavenging activity of GTE. Pectinase treatment led to change of TPS composition in GTE by hydrolyzing polysaccharides. In addition, pectinase-driven hydrolysis in polysaccharides significantly increased TPS-induced Interleukin 6 (IL-6) production in macrophages. In particular, treatment of Rapidase (TPS-Ra) led to the highest IL-6 production among TPS samples, similar to treatment of highly purified pectinase (TPS-GTE), a positive control. Simultaneous processing with tannase and Rapidase can be an efficient method for the extraction of bioactive polysaccharides and biotransformation of catechins with enhanced radical scavenging activity from green tea. © 2014 Society of Chemical Industry.
Chen, Ti Qiang; Wu, Jian-Guo; Kan, Yong-Jun; Yang, Chi; Wu, Yan-Bin; Wu, Jin-Zhong
2018-01-01
We recently proposed, and successfully applied, a novel and efficient technique-ultrasonic-circulating extraction (UCE) integrating superfine pulverization-to extract and prepare antioxidant crude polysaccharides other natural active substances from Ganoderma lucidum. The aim of this study was to evaluate the antioxidant and hepatoprotective activities and active ingredients in the powder from UCE (UCEP) through comparison with powder from hot water extraction (HWEP). The DPPH radical, ABTS radical, superoxide anion, total antioxidant activity, and ferric-reducing antioxidant power assay results showed that the UCEP exhibited stronger (P < 0.01) in vitro antioxidant activity than the HWEP. The hepatoprotective activity of the extracts was evaluated against CCl4-induced oxidative damage in the liver. Measurements of reduced glutathione, superoxide dismutase, and malondialdehyde in rat liver; measurements of alanine transaminase, aspartate transaminase, and lactate dehydrogenase in rat blood; and Western blotting for antioxidant proteins of transforming growth factor-β1, heme-oxygenase 1, and glutathione per-oxidase showed that the UCEP had antioxidant activity in vivo either similar to or slightly stronger than (P < 0.1) the HWEP. Further analysis of the active ingredients revealed that the UCEP and HWEP have similar mean yield and total triterpenoid content, but the former has significantly higher (P < 0.05) mean yield and total polysaccharide content than the latter. Our results suggest that the UCEP displays stronger antioxidant activities because of the larger amount of total polysaccharides; the UCEP may be able to be used as an antioxidant and liver protectant.
Carbohydrase Systems of Saccharophagus degradans Degrading Marine Complex Polysaccharides
Hutcheson, Steven W.; Zhang, Haitao; Suvorov, Maxim
2011-01-01
Saccharophagus degradans 2–40 is a γ-subgroup proteobacterium capable of using many of the complex polysaccharides found in the marine environment for growth. To utilize these complex polysaccharides, this bacterium produces a plethora of carbohydrases dedicated to the processing of a carbohydrate class. Aiding in the identification of the contributing genes and enzymes is the known genome sequence for this bacterium. This review catalogs the genes and enzymes of the S. degradans genome that are likely to function in the systems for the utilization of agar, alginate, α- and β-glucans, chitin, mannans, pectins, and xylans and discusses the cell biology and genetics of each system as it functions to transfer carbon back to the bacterium. PMID:21731555
Shobharani, P; Nanishankar, V H; Halami, P M; Sachindra, N M
2014-04-01
The current investigation was carried out with an objective of determining the structural characteristic of polysaccharides extracted from fermented Sargassum sp. to be used as potent natural heparin substitute anticoagulant compound. Sargassum sp. fermented with marine lactic acid bacteria was initially subjected to ethanol precipitation for the recovery of bioactive compounds. Antioxidant activity was maximum in the soluble fraction whereas anticoagulant activity was observed to be high in the precipitate which correlated with the increased polyphenols and total sugars respectively. The precipitate was purified by anion exchange chromatography and the fractions collected were analyzed for total sugars and anticoagulant activity. There was 2.6-3.9-folds increase in anticoagulant activity in the final purified fractions, with a maximum activity in case of sample fermented with Enterococcus faecium (6.7±0.22 IU/mg). Structural elucidation of potential anticoagulant polysaccharide by Fourier Transform Infrared Spectroscopy (FT-IR) and Nuclear Magnetic Resonance (NMR) analysis indicated the presence of alginate rich in mannuronic acid. Copyright © 2014 Elsevier B.V. All rights reserved.
Liu, Yu-Jie; Mo, Xue-Lin; Tang, Xiao-Zhang; Li, Jiang-Hua; Hu, Mei-Bian; Yan, Dan; Peng, Wei; Wu, Chun-Jie
2017-06-09
In this study, the ultrasound-assisted extraction of polysaccharides (PSA) from Pinelliae Rhizoma Praeparatum Cum Alumine (PRPCA) was optimized by response surface methodology (RSM). The structural characteristics of PSA were analyzed by UV-vis spectroscopy, infrared spectroscopy, scanning electron microscopy, high performance gel permeation chromatography and high performance liquid chromatography, respectively. In addition, antioxidant and antimicrobial activities of PSA were studied by different in vitro assays. Results indicated that the optimal extraction conditions were as follows: the ratio of water to raw of 30 mL/g, extraction time of 46.50 min, ultrasonic temperature of 72.00 °C, and ultrasonic power of 230 W. Under these conditions, the obtained PSA yield (13.21 ± 0.37%) was closely agreed with the predicted yield by the model. The average molecular weights of the PSA were estimated to be 5.34 × 10³ and 6.27 × 10⁵ Da. Monosaccharide composition analysis indicated that PSA consisted of mannose, galactose uronic acid, glucose, galactose, arabinose with a molar ratio of 1.83:0.55:75.75:1.94:0.45. Furthermore, PSA exhibited moderate antioxidant and antibacterial activities in vitro. Collectively, this study provides a promising strategy to obtain bioactive polysaccharides from processed products of herbal medicines.
Immunostimulatory properties and antitumor activities of glucans
VANNUCCI, LUCA; KRIZAN, JIRI; SIMA, PETR; STAKHEEV, DMITRY; CAJA, FABIAN; RAJSIGLOVA, LENKA; HORAK, VRATISLAV; SAIEH, MUSTAFA
2013-01-01
New foods and natural biological modulators have recently become of scientific interest in the investigation of the value of traditional medical therapeutics. Glucans have an important part in this renewed interest. These fungal wall components are claimed to be useful for various medical purposes and they are obtained from medicinal mushrooms commonly used in traditional Oriental medicine. The immunotherapeutic properties of fungi extracts have been reported, including the enhancement of anticancer immunity responses. These properties are principally related to the stimulation of cells of the innate immune system. The discovery of specific receptors for glucans on dendritic cells (dectin-1), as well as interactions with other receptors, mainly expressed by innate immune cells (e.g., Toll-like receptors, complement receptor-3), have raised new attention toward these products as suitable therapeutic agents. We briefly review the characteristics of the glucans from mycelial walls as modulators of the immunity and their possible use as antitumor treatments. PMID:23739801
Uchiyama, Hirofumi; Iwai, Atsushi; Dohra, Hideo; Ohnishi, Toshiyuki; Kato, Tatsuya; Park, Enoch Y
2018-05-01
Killer toxin resistant 6 (Kre6) and its paralog, suppressor of Kre null 1 (Skn1), are thought to be involved in the biosynthesis of cell wall β-(1 → 6)-D-glucan in baker's yeast, Saccharomyces cerevisiae. The Δkre6Δskn1 mutant of S. cerevisiae and other fungi shows severe growth defects due to the failure to synthesize normal cell walls. In this study, two homologs of Kre6, namely, K6LP1 (Kre6-like protein 1) and K6LP2 (Kre6-like protein 2), were identified in Aureobasidium pullulans M-2 by draft genome analysis. The Δk6lp1, Δk6lp2, and Δk6lp1Δk6lp2 mutants were generated in order to confirm the functions of the Kre6-like proteins in A. pullulans M-2. The cell morphologies of Δk6lp1 and Δk6lp1Δk6lp2 appeared to be different from those of wild type and Δk6lp2 in both their yeast and hyphal forms. The productivity of the extracellular polysaccharides, mainly composed of β-(1 → 3),(1 → 6)-D-glucan (β-glucan), of the mutants was 5.1-17.3% less than that of wild type, and the degree of branching in the extracellular β-glucan of mutants was 14.5-16.8% lower than that of wild type. This study showed that the gene disruption of Kre6-like proteins affected the cell morphology, the productivity of extracellular polysaccharides, and the structure of extracellular β-glucan, but it did not have a definite effect on the cell viability even in Δk6lp1Δk6lp2, unlike in the Δkre6Δskn1 of S. cerevisiae.
Tako, Masakuni; Dobashi, Yahiko; Shimabukuro, Junpei; Yogi, Takuya; Uechi, Keiko; Tamaki, Yukihiro; Konishi, Teruko
2013-02-15
A novel α-glucan substituted rare 6-deoxy-D-altropyranose was isolated from edible fruiting bodies of a mushroom (Lactarius lividatus) grown in Okinawa, Japan. The polysaccharide consists of D-glucose, D-galactose and 6-deoxy-D-altrose in a molar ratio of 3.0:1.0:1.0. The specific rotation [α](589) was estimated as +64.3° (0.2% in water) at 25 °C. Based on results of IR, NMR ((1)H, (13)C, 2D-COSY, 2D-HMQC, 2D-ROESY and 2D-HMBC), and methylation analyses, the structure of the polysaccharide was determined as [formula, see text] This work is the first demonstration of rare 6-deoxy-D-altropyranose moiety on polysaccharides. Copyright © 2012 Elsevier Ltd. All rights reserved.
Tan, Li-Hong; Zhang, Dan; Yu, Bao; Zhao, Sheng-Ping; Wang, Jian-Wei; Yao, Ling; Cao, Wei-Guo
2015-11-01
Polysaccharide extraction from Dipsacus asperoides roots (DAP) was proved to possess strong antioxidant activities, including 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2-Azobis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS) radical scavenging activities, inhibiting β-carotene bleaching and strong reducing power. Cell assay demonstrated that the crude DAP possessed antioxidant activity and were effective against H2O2-induced L02 cells injury. Then, response surface methodology (RSM) was applied to optimize the ultrasonic extraction of DAP. The optimum variables given by central composite design (CCD) were as follows: ratio of water to raw material, 38.61mL/g; ultrasonic power, 308.68W; extraction time, 38.61min; and extraction temperature, 89°C. Under these conditions, the maximum yield of DAP obtained was 7.12±0.45%. Moreover, high performance liquid chromatography (HPLC) analysis suggested that the monosaccharide compositions of DAP contained primarily mannose, ribose, glucose, galactose, xylose and arabinose, with a molar ratio of 0.22:0.48:2.29:0.34:1.39:1.41. The results of the present study showed that DAP could be considered as potential sources of natural antioxidants. Copyright © 2015 Elsevier B.V. All rights reserved.
Santas, Jonathan; Lázaro, Elisabet; Cuñé, Jordi
2017-09-01
In the present study we evaluated the weight loss effect of a polysaccharide-rich food supplement, LipiGo®, comprising a specific β-glucan-chitin-chitosan fraction (BGCC) obtained from the chemical hydrolysis of Saccharomyces cerevisiae, resulting as a by-product of the brewing process. A randomised, double-blind, placebo-controlled clinical trial was performed enrolling 56 overweight and obese subjects (body mass index, BMI, 25-35 kg m -2 ) who were not following any specific diet, and were given placebo or BGCC (3 g d -1 ) for 12 weeks. Results were analysed by intention-to-treat (ITT) and per-protocol (PP) methods. Body weight increased in the placebo group compared to baseline (ITT: 1.0 kg, P < 0.001; PP: 1.5 kg, P = 0.003), while it was slightly lowered in the BGCC group (ITT: -0.8 kg, P = 0.210; PP: -1.1 kg, P = 0.182). BGCC, but not the consumption of placebo, also resulted in a reduction of waist circumference and body fat compared to baseline. Results suggest that daily supplementation of BGCC may be useful for improving body weight and waist circumference in overweight and obese subjects, without relevant adverse effects. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Immunomodulatory activity of polysaccharides isolated from Alchornea cordifolia
Kouakou, Koffi; Schepetkin, Igor A.; Yapi, Ahoua; Kirpotina, Liliya N.; Jutila, Mark A.; Quinn, Mark T.
2013-01-01
Ethnopharmacological relevance Extracts of leaves from different species of the genus Alchornea have been used for centuries to treat a variety of medicinal problems in tropical Africa. However, little is known about the high-molecular weight active components conferring therapeutic properties to these extracts. Objective The aim of this study was to evaluate the immunomodulatory activity of polysaccharides isolated from the leaves of Alchornea cordifolia. Materials and methods Water-soluble polysaccharides from leaves of A. cordifolia were extracted and fractionated by DEAE-cellulose, Diaion HP-20, and size-exclusion chromatography. Molecular weight, sugar analysis, and other physical and chemical characterization of the fractions were performed. Immunomodulatory activity of the polysaccharide fractions was evaluated by determining their ability to induce monocyte/macrophage nitric oxide (NO) and cytokine production. Activation of mitogen activated protein kinases (MAPK) was also assessed using a phospho-MAPK array. Activation of nuclear factor κB (NF-κB) was measured using an alkaline phosphatase reporter gene assay in THP1-Blue monocytic cells. Results Six polysaccharide fractions from A. cordifolia were isolated. Fractions containing type II arabinogalactan had potent immunomodulatory activity. Particularly, the parent fraction AP-AU and its high-molecular weight sub-fraction AP-AU1 (average Mr was estimated to be 39.5 kDa) induced production of NO and cytokines [interleukin (IL)-1β, -6, -10, tumor necrosis factor (TNF)-α, and granulocyte macrophage-colony stimulating factor (GM-CSF)] in human peripheral blood mononuclear cells and human and murine monocyte/macrophages cell lines in vitro. Furthermore, treatment with AP-AU1 induced phosphorylation of Akt2, p38δ/p38γ, p70S6K1, RSK2, and mTOR, as well as stimulation of NF-κB transcriptional activity. Conclusion Our results provide a molecular basis to explain a portion of the beneficial therapeutic
Immunomodulatory activity of polysaccharides isolated from Alchornea cordifolia.
Kouakou, Koffi; Schepetkin, Igor A; Yapi, Ahoua; Kirpotina, Liliya N; Jutila, Mark A; Quinn, Mark T
2013-03-07
Extracts of leaves from different species of the genus Alchornea have been used for centuries to treat a variety of medicinal problems in tropical Africa. However, little is known about the high-molecular weight active components conferring therapeutic properties to these extracts. The aim of this study was to evaluate the immunomodulatory activity of polysaccharides isolated from the leaves of Alchornea cordifolia. Water-soluble polysaccharides from leaves of Alchornea cordifolia were extracted and fractionated by DEAE-cellulose, Diaion HP-20, and size-exclusion chromatography. Molecular weight, sugar analysis, and other physical and chemical characterization of the fractions were performed. Immunomodulatory activity of the polysaccharide fractions was evaluated by determining their ability to induce monocyte/macrophage nitric oxide (NO) and cytokine production. Activation of mitogen activated protein kinases (MAPK) was also assessed using a phospho-MAPK array. Activation of nuclear factor κB (NF-κB) was measured using an alkaline phosphatase reporter gene assay in THP1-Blue monocytic cells. Six polysaccharide fractions from Alchornea cordifolia were isolated. Fractions containing type II arabinogalactan had potent immunomodulatory activity. Particularly, the parent fraction AP-AU and its high-molecular weight sub-fraction AP-AU1 (average M(r) was estimated to be 39.5kDa) induced production of NO and cytokines [interleukin (IL)-1β, -6, -10, tumor necrosis factor (TNF)-α, and granulocyte-macrophage-colony stimulating factor (GM-CSF)] in human peripheral blood mononuclear cells and human and murine monocyte/macrophages cell lines in vitro. Furthermore, treatment with AP-AU1 induced phosphorylation of Akt2, p38δ/p38γ, p70S6K1, RSK2, and mTOR, as well as stimulation of NF-κB transcriptional activity. Our results provide a molecular basis to explain a portion of the beneficial therapeutic properties of water extracts from Alchornea cordifolia leaves in
Lim, Sun Ha; Kim, Yaesil; Yun, Ki Na; Kim, Jin Young; Jang, Jung-Hee; Han, Mee-Jung; Lee, Jongwon
2016-12-08
Many cohort studies have shown that consumption of diets containing a higher composition of foods derived from plants reduces mortality from coronary heart disease (CHD). Here, we examined the active components of a plant-based diet and the underlying mechanisms that reduce the risk of CHD using three rat models and a quantitative proteomics approach. In a short-term myocardial infarction (MI) model, intake of wheat extract (WE), the representative cardioprotectant identified by screening approximately 4,000 samples, reduced myocardial injury by inhibiting apoptosis, enhancing ATP production, and maintaining protein homeostasis. In long-term post-MI models, this myocardial protection resulted in ameliorating adverse left-ventricular remodelling, which is a predictor of heart failure. Among the wheat components, arabinose and xylose were identified as active components responsible for the observed efficacy of WE, which was administered via ingestion and tail-vein injections. Finally, the food components of plant-based diets that contained cell wall polysaccharides rich in arabinose, xylose, and possibly fucose were found to confer protection against myocardial injury. These results show for the first time that specific monosaccharides found in the cell wall polysaccharides in plant-based diets can act as active ingredients that reduce CHD by inhibiting postocclusion steps, including MI and heart failure.
Rostami, Hosein; Gharibzahedi, Seyed Mohammad Taghi
2017-08-01
Enzyme-assisted extraction process of the water-soluble Malva sylvestris polysaccharides (MSPs) was optimized using response surface methodology (RSM). The highest yield (10.40%) of MSPs was achieved at 5.64% cellulase, 55.65°C temperature, 3.4h time, and 5.22 pH. Three homogeneous polysaccharide fractions (MSP-1, MSP-2, MSP-3) were purified by DEAE-cellulose and Sephadex G-100 chromatography, which were composed of galactose, glucuronic acid, arabinose, rhamnose and mannose in different molar ratios with molecular weight range of 2.6×10 5 -8.8×10 5 Da. The fractions could significantly increase antioxidant, antitumor and antimicrobial activities in a dose-dependent pattern. MSP-2 revealed stronger antioxidant activities than MSP-1 and MSP-3, including reducing power and scavenging activity of DPPH and OH radicals. The antiproliferative activity of MSP-2 (1.0mg/mL) on the growth of A549 and HepG2 cells was 45.1% and 53.2%, respectively. The Gram-positive bacteria (Bacillus cereus PTCC 1015 and Staphylococcus aureus PTCC 1112) compared with Gram-negative ones (Escherichia coli PTCC 1763 and Salmonella typhimurium PTCC 1709) showed less sensitivity against the various MSPs (3-15mg/mL). Copyright © 2017 Elsevier B.V. All rights reserved.
The structure of a β-(1→6)-d-glucan from yeast cell walls
Manners, David J.; Masson, Alan J.; Patterson, James C.; Björndal, Håkan; Lindberg, Bengt
1973-01-01
By selective enzymolysis, or chemical fractionation, a minor polysaccharide component has been isolated from yeast (Saccharomyces cerevisiae) glucan. This minor component has a degree of polymerization of about 130–140, a highly branched structure, and a high proportion of β-(1→6)-glucosidic linkages. The molecules also contain a smaller proportion of β-(1→3)-glucosidic linkages that serve mainly as interchain linkages, but some may also be inter-residue linkages. PMID:4590991
Chemical characteristics and anti-proliferation activities of Ganoderma tsugae polysaccharides.
Chien, Rao-Chi; Yen, Ming-Tsung; Tseng, Yu-Hsiu; Mau, Jeng-Leun
2015-09-05
Polysaccharides were extracted by hot-water and hot-alkali from four forms of Ganoderma tsugae including mature and baby Ling chih, mycelium and filtrate. Different profiles of proximate composition and monosaccharide constituents, and element contents were found in the extracted polysaccharides from different extractions and different forms. The molecular weight distributions of polysaccharides were 2.8×10(4)-6.5×10(5)Da and their infrared spectra were comparable. The hot-alkali extracted polysaccharides exhibited better anti-proliferation on IMR32 cells than the hot-water extracted polysaccharides, which were in turn more effective than the hot-water extracts. Besides, most hot-water extracts and both extracted polysaccharides exhibited an anti-proliferation effect on Hep G2 cells. However, the hot-water extracts showed less effective in anti-proliferation of IMR32 and Hep G2 cells. Based on the anti-tumor effects, both polysaccharides could be prepared for use in the formulation of nutraceuticals and functional foods. Copyright © 2015 Elsevier Ltd. All rights reserved.
The Eng1 β-Glucanase Enhances Histoplasma Virulence by Reducing β-Glucan Exposure
Garfoot, Andrew L.; Shen, Qian; Wüthrich, Marcel; Klein, Bruce S.
2016-01-01
ABSTRACT The fungal pathogen Histoplasma capsulatum parasitizes host phagocytes. To avoid antimicrobial immune responses, Histoplasma yeasts must minimize their detection by host receptors while simultaneously interacting with the phagocyte. Pathogenic Histoplasma yeast cells, but not avirulent mycelial cells, secrete the Eng1 protein, which is a member of the glycosylhydrolase 81 (GH81) family. We show that Histoplasma Eng1 is a glucanase that hydrolyzes β-(1,3)-glycosyl linkages but is not required for Histoplasma growth in vitro or for cell separation. However, Histoplasma yeasts lacking Eng1 function have attenuated virulence in vivo, particularly during the cell-mediated immunity stage. Histoplasma yeasts deficient for Eng1 show increased exposure of cell wall β-glucans, which results in enhanced binding to the Dectin-1 β-glucan receptor. Consistent with this, Eng1-deficient yeasts trigger increased tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6) cytokine production from macrophages and dendritic cells. While not responsible for large-scale cell wall structure and function, the secreted Eng1 reduces levels of exposed β-glucans at the yeast cell wall, thereby diminishing potential recognition by Dectin-1 and proinflammatory cytokine production by phagocytes. In α-glucan-producing Histoplasma strains, Eng1 acts in concert with α-glucan to minimize β-glucan exposure: α-glucan provides a masking function by covering the β-glucan-rich cell wall, while Eng1 removes any remaining exposed β-glucans. Thus, Histoplasma Eng1 has evolved a specialized pathogenesis function to remove exposed β-glucans, thereby enhancing the ability of yeasts to escape detection by host phagocytes. PMID:27094334
Mzoughi, Zeineb; Chaouch, Mohamed Aymen; Hammi, Khaoula Mkadmini; Hafsa, Jawhar; Le Cerf, Didier; Ksouri, Riadh; Majdoub, Hatem
2018-07-01
Central composite design was performed to optimize uronic acid rate, esterification degree, total antioxidant ability and antiglycation capacity of carbohydrates from Arthrocnemum indicum leaves. Three independent variables were opted: extraction temperature, time and ratio (solvent/material). The optimal settings were: extraction temperature of 80°C, time of 288min and (solvent/solid) ratio of 40mL/g. Under these settings, uronic acid rate and esterification degree were 49.29%, 30.24%, respectively, whereas total antioxidant activity and antiglycation capacity was 35.81mg ascorbic acid equivalents/g matter and 69.81%, respectively. Colorimetric assays showed that total sugar and uronic acid contents for polysaccharide were 71.78% and 49.24%, respectively. Furthermore, Preliminary structure study was performed via various methods including FT-IR, NMR and UV-vis analysis. SEC analyzes revealed that polysaccharide had an average molecular weight of 2179kDa. Moreover, GC-MS analyzes showed that extracted polysaccharide was a pectic polysaccharide which formed of arabinose, mannose, galactose, rhamnose, glucose and xylose in the molar percentage of 66.68%, 3.93%, 12.71%, 6.31%, 6.08% and 4.29%, respectively. This results revealed that extracted polysaccharide can be employed as source of natural antioxidants and as possible antiglycated agents. Copyright © 2018 Elsevier B.V. All rights reserved.
Li, Ran; Duan, Meng-Ying; Wu, Hong-Xin
2017-01-01
Response surface methodology (RSM) was used to investigate the extraction condition of polysaccharide from cup plant (Silphium perfoliatum L.) (named CPP). Water to raw material ratio (10–30 mL/g), extraction time (40–80 min) and extraction temperature (60–100°C) were set as the 3 independent variables, and their effects on the extraction yield of CPP were measured. In addition, the effects of drying methods including hot air drying (HD), vacuum drying (VD) and freeze drying (FD) on the antioxidant activities of CPP were evaluated. The results showed that the optimal condition to extract CPP was: water to raw material ratio (15 mL/g), extraction time (61 min), and extraction temperature (97°C), a maximum CPP yield of 6.49% was obtained under this condition. CPP drying with FD method showed stronger reducing power (0.943 at 6 mg/mL) and radical scavenging capacities against DPPH radical (75.71% at 1.2 mg/mL) and ABTS radical (98.06 at 1.6 mg/mL) than CPP drying with HD and VD methods. Therefore, freeze drying served as a good method for keeping the antioxidant activities of polysaccharide from cup plant. The polysaccharide from cup plant has potential to use as a natural antioxidant. PMID:28837625
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Getachew, Adane Tilahun; Cho, Yeon Jin; Chun, Byung Soo
2018-04-01
In this study, we used a novel approach to recover polysaccharide from spent coffee ground (SCG) by combining pretreatments and subcritical water hydrolysis (SCWH). The independent variables which affect SCWH were optimized using response surface methodology. The highest yield of SCG polysaccharides (SCGPSs) (18.25 ± 0.21%) was obtained using ultrasonic pretreatment and SCWH conditions of temperature (178.85 °C), pressure (20 bar), and extraction time (5 min). The extracted SCGPSs showed high antioxidant activity as measured using ABTS + and DPPH radical scavenging assay with IC 50 values of 1.83 ± 0.03 and 2.66 ± 0.13 mg/ml respectively. SCGPSs also showed in vitro hypoglycemic activities. The structural and thermal characterization of the polysaccharide showed that the extracted polysaccharide has a typical carbohydrate features. The results of this study suggested that the extracted polysaccharide could have a potential application in food and related industries. Copyright © 2017 Elsevier B.V. All rights reserved.
Wang, Junlong; Zhang, Ji; Wang, Xiaofang; Zhao, Baotang; Wu, Yiqian; Yao, Jian
2009-12-01
The conventional extraction methods for polysaccharides were time-consuming, laborious and energy-consuming. Microwave-assisted extraction (MAE) technique was employed for the extraction of Artemisia sphaerocephala polysaccharides (ASP), which is a traditional Chinese food. The extracting parameters were optimized by Box-Behnken design. In microwave heating process, a decrease in molecular weight (M(w)) was detected in SEC-LLS measurement. A d(f) value of 2.85 indicated ASP using MAE exhibited as a sphere conformation of branched clusters in aqueous solution. Furthermore, it showed stronger antioxidant activities compared with hot water extraction. The data obtained showed that the molecular weights played a more important role in antioxidant activities.
Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe
2017-01-01
Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, Jie; Li, Wan-chen; Gu, Xin-li
2017-01-01
Background This study performed optimized extraction, preliminary characterization, and in vitro antioxidant activities of polysaccharides from Glycyrrhiza uralensis Fisch. Material/Methods Three parameters (extraction temperature, ratio of water to raw material, and extraction time) were optimized for yields of G. uralensis polysaccharides (GUP) using response surface methodology with Box-Behnken design (BBD). The GUP was purified using DEAE cellulose 32-column chromatography. The main fraction obtained from G. uralensis Fisch was GUP-II, which was composed of rhamnose, arabinose, galactose, and glucose monosaccharide, was screened for antioxidant properties using DP Hand hydroxyl radical scavenging assays. In addition, immunological activity of GUP-II was determined by nitric oxide and lymphocyte proliferation assays. Results Optimization revealed maximum GUP yields with an extraction temperature of 99°C, water: raw material ratio of 15: 1, and extraction duration of 2 h. GUP-II purified from G. uralensis Fisch had good in vitro DPPH and hydroxyl radical scavenging abilities. Immunologically, GUP-II significantly stimulated NO production in RAW 264.7 macrophages, and significantly enhanced LPS-induced lymphocyte proliferation. Conclusions Extraction of GUP from G. uralensis Fisch can be optimized with respect to temperature, extraction period, and ratio of water to material, using response surface methodology. The purified product (GUP-II) possesses excellent antioxidant and immunological activities. PMID:28404983
Impact of new ingredients obtained from brewer's spent yeast on bread characteristics.
Martins, Z E; Pinho, O; Ferreira, I M P L V O
2018-05-01
The impact of bread fortification with β-glucans and with proteins/proteolytic enzymes from brewers' spent yeast on physical characteristics was evaluated. β-Glucans extraction from spent yeast cell wall was optimized and the extract was incorporated on bread to obtain 2.02 g β-glucans/100 g flour, in order to comply with the European Food Safety Authority guidelines. Protein/proteolytic enzymes extract from spent yeast was added to bread at 60 U proteolytic activity/100 g flour. Both β-glucans rich and proteins/proteolytic enzymes extracts favoured browning of bread crust. However, breads with proteins/proteolytic enzymes addition presented lower specific volume, whereas the incorporation of β-glucans in bread lead to uniform pores that was also noticeble in terms of higher specific volume. Overall, the improvement of nutritional/health promoting properties is highlighted with β-glucan rich extract, not only due to bread β-glucan content but also for total dietary fibre content (39% increase). The improvement was less noticeable for proteins/proteolytic enzymes extract. Only a 6% increase in bread protein content was noted with the addition of this extract and higher protein content would most likely accentuate the negative impact on bread specific volume that in turn could impair consumer acceptance. Therefore, only β-glucan rich extract is a promising bread ingredient.
Kurita, Keisuke; Matsumura, Yuriko; Takahara, Hiroki; Hatta, Kiyoshige; Shimojoh, Manabu
2011-06-13
N-Acetyl-d-glucosamine branches were incorporated at the C-6 position of curdlan, a linear β-1,3-d-glucan, and the resulting nonnatural branched polysaccharides were evaluated in terms of the immunomodulation activities in comparison with lentinan, a β-1,3-d-glucan having d-glucose branches at C-6. To incorporate the amino sugar branches, we conducted a series of regioselective protection-deprotections of curdlan involving triphenylmethylation at C-6, phenylcarbamoylation at C-2 and C-4, and detriphenylmethylation. Subsequent glycosylation with a d-glucosamine-derived oxazoline, followed by deprotection gave rise to the branched curdlans with various substitution degrees. The products exhibited remarkable solubility in both organic solvents and water. Their immunomodulation activities were determined using mouse macrophagelike cells, and the secretions of both the tumor necrosis factor and nitric oxide proved to be significantly higher than those with lentinan. These results conclude that the amino sugar/curdlan hybrid materials are promising as a new type of polysaccharide immunoadjuvants useful for cancer chemotherapy.
Moriartey, Stephanie; Temelli, Feral; Vasanthan, Thava
2011-01-01
The viscosity and solubility of β-glucan in muffins have been shown to be reduced by certain storage conditions, though the effect of storage on bread fortified with barley β-glucan concentrate has not been investigated. Therefore, this study investigated the effect of storage temperature and time (23 °C for 1, 4, and 7 d, 4 °C for 4, 7, and 14 d, and -20 °C for 1, 2, 4, and 8 wk) on the solubility and viscosity of β-glucan upon incorporation into bread at levels corresponding to 0 or 1.5 g β-glucan/serving, with or without vital gluten addition. The firmness and moisture content of bread following each storage treatment were also evaluated. The highest moisture and lowest firmness values were found in fresh bread, though these parameters were still maintained at appreciable levels upon room temperature storage of the 1.5 g β-glucan/serving bread with added gluten and at either room temperature or frozen storage for the 1.5 g β-glucan/serving bread for 4 d. If it is desirable to store bread for 7 d or more, frozen storage should be utilized in order to best maintain bread moisture and firmness levels. It is recommended that β-glucan-fortified bread be consumed fresh for greatest β-glucan solubility and viscosity, though β-glucan solubility of approximately 40% is still achievable upon frozen storage of the bread for up to 2 wk. It is still unclear, however, as to what extent of reductions in the solubility and viscosity of β-glucan would lower its physiological effectiveness. Previous research has demonstrated that solubility and thus viscosity of β-glucan, which is an important property associated with its health benefits can be impacted by different storage conditions applied to some bakery products, like muffins. This study demonstrates the extent of changes in the solubility and viscosity of β-glucan incorporated into bread. Therefore, storage time and temperature should be optimized to minimize changes in β-glucan for maintaining its efficacy
Wang, Ping; Ingram-Smith, Cheryl; Hadley, Jill A.; Miller, Karen J.
1999-01-01
Periplasmic cyclic β-glucans of Rhizobium species provide important functions during plant infection and hypo-osmotic adaptation. In Sinorhizobium meliloti (also known as Rhizobium meliloti), these molecules are highly modified with phosphoglycerol and succinyl substituents. We have previously identified an S. meliloti Tn5 insertion mutant, S9, which is specifically impaired in its ability to transfer phosphoglycerol substituents to the cyclic β-glucan backbone (M. W. Breedveld, J. A. Hadley, and K. J. Miller, J. Bacteriol. 177:6346–6351, 1995). In the present study, we have cloned, sequenced, and characterized this mutation at the molecular level. By using the Tn5 flanking sequences (amplified by inverse PCR) as a probe, an S. meliloti genomic library was screened, and two overlapping cosmid clones which functionally complement S9 were isolated. A 3.1-kb HindIII-EcoRI fragment found in both cosmids was shown to fully complement mutant S9. Furthermore, when a plasmid containing this 3.1-kb fragment was used to transform Rhizobium leguminosarum bv. trifolii TA-1JH, a strain which normally synthesizes only neutral cyclic β-glucans, anionic glucans containing phosphoglycerol substituents were produced, consistent with the functional expression of an S. meliloti phosphoglycerol transferase gene. Sequence analysis revealed the presence of two major, overlapping open reading frames within the 3.1-kb fragment. Primer extension analysis revealed that one of these open reading frames, ORF1, was transcribed and its transcription was osmotically regulated. This novel locus of S. meliloti is designated the cgm (cyclic glucan modification) locus, and the product encoded by ORF1 is referred to as CgmB. PMID:10419956
Modifications of Saccharomyces pastorianus cell wall polysaccharides with brewing process.
Bastos, Rita; Coelho, Elisabete; Coimbra, Manuel A
2015-06-25
The cell wall polysaccharides of brewers spent yeast Saccharomyces pastorianus (BSY) and the inoculum yeast (IY) were studied in order to understand the changes induced by the brewing process. The hot water and alkali extractions performed solubilized mainly mannoproteins, more branched for BSY than those of IY. Also, (31)P solid state NMR showed that the BSY mannoproteins were 3 times more phosphorylated. By electron microscopy it was observed that the final residues of alkali sequential extraction until 4M KOH preserved the yeast three-dimensional structure. The final residues, composed mainly by glucans (92%), showed that the BSY, when compared with IY, contained higher amount of (1→4)-linked Glc (43% for BSY and 16% for IY) and lower (1→3)-linked Glc (17% for BSY and 42% for IY). The enzymatic treatment of final residue showed that both BSY and IY had (α1→4)-linked Glc and (β1→4)-linked Glc, in a 2:1 ratio, showing that S. pastorianus increases their cellulose-like linkages with the brewing process. Copyright © 2015 Elsevier Ltd. All rights reserved.
Chemical studies on the polysaccharides of Salicornia brachiata.
Sanandiya, Naresh D; Siddhanta, A K
2014-11-04
A group of 12 polysaccharide extracts were prepared from the tips, stem and roots of an Indian halophyte Salicornia brachiata Roxb. obtained by sequential extractions with cold water (CW), hot water (HW), aqueous ammonium oxalate (OX) and aqueous sodium hydroxide (ALK) solutions. Monosaccharide composition analysis revealed that all the polysaccharide extract samples consisted primarily of rhamnose, arabinose, mannose, galactose, glucose, whereas ribose and xylose were present only in some of the extracts. All the extracts exhibited low apparent viscosity (1.47-2.02 cP) and sulphate and contained no prominent toxic metal ions. Fucose was detected only in OX extract of the roots. These polysaccharides were found to be heterogeneous and highly branched (glycoside linkage analysis, size-exclusion chromatography, (13)C-NMR, FT-IR, circular dichroism and optical rotation data). Physico-chemical analyses of these polysaccharides including uronic acid, sulphate and protein contents were also carried out. This constitutes the first report on the profiling of Salicornia polysaccharides. Copyright © 2014 Elsevier Ltd. All rights reserved.
Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga
2012-01-01
The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard
Extraction of Cell-Wall Polysaccharide Antigen from Streptococci
Slade, Hutton D.
1965-01-01
Slade, Hutton D. (Northwestern University Medical School, Chicago, Ill., and Max-Planck Institut für Immunbiologie, Freiburg, Germany). Extraction of cell-wall polysaccharide antigen from streptococci. J. Bacteriol. 90:667–672. 1965.—The carbohydrate grouping antigens in the cell walls of streptococci belonging to groups A, E, G, L, and T were extracted with 5% trichloroacetic acid at 90 C. The antigens were removed also from dry whole cells by extraction with trichloroacetic acid followed by treatment with phenol-water. Details of the methods are presented. The antigens obtained by use of either of these procedures were suitable for studies on immunological specificity and chemical structure. Quantitative enzymatic and chemical analyses of two group E antigens and one group T preparation showed the presence of l-rhamnose (22 to 44%), d-glucose (7 to 22%), d-galactose (T antigen only, 26%), glucosamine (2 to 16%), and galactosamine (T antigen only, 3%). In addition, analyses of A and G antigen preparations are presented. The protein and phosphate content of the A and E antigens were about 1% each. Quantitative precipitin curves of these antigens are presented. PMID:16562065
Genetics and physiology of cell wall polysaccharides in the model C4 grass, Setaria viridis spp.
Ermawar, Riksfardini A; Collins, Helen M; Byrt, Caitlin S; Henderson, Marilyn; O'Donovan, Lisa A; Shirley, Neil J; Schwerdt, Julian G; Lahnstein, Jelle; Fincher, Geoffrey B; Burton, Rachel A
2015-10-02
Setaria viridis has emerged as a model species for the larger C4 grasses. Here the cellulose synthase (CesA) superfamily has been defined, with an emphasis on the amounts and distribution of (1,3;1,4)-β-glucan, a cell wall polysaccharide that is characteristic of the grasses and is of considerable value for human health. Orthologous relationship of the CesA and Poales-specific cellulose synthase-like (Csl) genes among Setaria italica (Si), Sorghum bicolor (Sb), Oryza sativa (Os), Brachypodium distachyon (Bradi) and Hordeum vulgare (Hv) were compared using bioinformatics analysis. Transcription profiling of Csl gene families, which are involved in (1,3;1,4)-β-glucan synthesis, was performed using real-time quantitative PCR (Q-PCR). The amount of (1,3;1,4)-β-glucan was measured using a modified Megazyme assay. The fine structures of the (1,3;1,4)-β-glucan, as denoted by the ratio of cellotriosyl to cellotetraosyl residues (DP3:DP4 ratio) was assessed by chromatography (HPLC and HPAEC-PAD). The distribution and deposition of the MLG was examined using the specific antibody BG-1 and captured using fluorescence and transmission electron microscopy (TEM). The cellulose synthase gene superfamily contains 13 CesA and 35 Csl genes in Setaria. Transcript profiling of CslF, CslH and CslJ gene families across a vegetative tissue series indicated that SvCslF6 transcripts were the most abundant relative to all other Csl transcripts. The amounts of (1,3;1,4)-β-glucan in Setaria vegetative tissues ranged from 0.2% to 2.9% w/w with much smaller amounts in developing grain (0.003% to 0.013% w/w). In general, the amount of (1,3;1,4)-β-glucan was greater in younger than in older tissues. The DP3:DP4 ratios varied between tissue types and across developmental stages, and ranged from 2.4 to 3.0:1. The DP3:DP4 ratios in developing grain ranged from 2.5 to 2.8:1. Micrographs revealing the distribution of (1,3;1,4)-β-glucan in walls of different cell types and the data were
Towards a more versatile alpha-glucan biosynthesis in plants.
Kok-Jacon, Géraldine A; Ji, Qin; Vincken, Jean-Paul; Visser, Richard G F
2003-07-01
Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated in many different ways to gain insight into the process of starch biosynthesis and to engineer starches with improved functionalities. With respect to the latter, two generic technologies with great potential have been developed: (i) introduction of new linkage types in starch polymers (1,3- and 1,6-linkages), and (ii) engineering granule-boundness. The toolbox to engineer this new generation of starch polymers is discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vega-Sánchez, Miguel E.; Loqué, Dominique; Lao, Jeemeng
Reduced cell wall recalcitrance and increased C6 monosaccharide content are desirable traits for future biofuel crops, as long as these biomass modifications do not significantly alter normal growth and development. Mixed-linkage glucan (MLG), a cell wall polysaccharide only present in grasses and related species among flowering plants, is comprised of glucose monomers linked by both β-1,3 and β-1,4 bonds. Previous data have shown that constitutive production of MLG in barley (Hordeum vulgare) severely compromises growth and development. Here, we used spatio-temporal strategies to engineer Arabidopsis thaliana plants to accumulate significant amounts of MLG in the cell wall by expressing themore » rice CslF6 MLG synthase using secondary cell wall and senescence-associated promoters. Results using secondary wall promoters were suboptimal. When the rice MLG synthase was expressed under the control of a senescence-associated promoter, we obtained up to four times more glucose in the matrix cell wall fraction and up to a 42% increase in saccharification compared to control lines. Importantly, these plants grew and developed normally. The induction of MLG deposition at senescence correlated with an increase of gluconic acid in cell wall extracts of transgenic plants in contrast to the other approaches presented in this study. MLG produced in Arabidopsis has an altered structure compared to the grass glucan, which likely affects its solubility, while its molecular size is unaffected. The induction of cell wall polysaccharide biosynthesis in senescing tissues offers a novel engineering alternative to enhance cell wall properties of lignocellulosic biofuel crops.« less
Faijes, Magda; Imai, Tomoya; Bulone, Vincent; Planas, Antoni
2004-01-01
Oligo- and poly-saccharides have a large number of important biological functions, and they occur in natural composite materials, such as plant cell walls, where they self-assemble during biosynthesis in a poorly understood manner. They can also be used for the formation of artificial composite materials with industrial applications. Fundamental and applied research in biology and nanobiotechnology would benefit from the possibility of synthesizing tailor-made oligo-/poly-saccharides. In the present paper, we demonstrate that such syntheses are possible using genetically modified glycoside hydrolases, i.e. glycosynthases. The ability of the endoglycosynthase derived from Bacillus (1-->3,1-->4)-beta-D-glucanase to catalyse self-condensation of sugar donors was exploited for the in vitro synthesis of a regular polysaccharide. The specificity of the enzyme allowed the polymerization of alpha-laminaribiosyl fluoride via the formation of (1-->4)-beta-linkages to yield a new linear crystalline (1-->3,1-->4)-beta-D-glucan with a repeating 4betaG3betaG unit. MS and methylation analyses indicated that the in vitro product consisted of a mixture of oligosaccharides, the one having a degree of polymerization of 12 being the most abundant. Morphological characterization revealed that the (1-->3,1-->4)-beta-D-glucan forms spherulites which are composed of platelet crystals. X-ray and electron diffraction analyses allowed the proposition of a putative crystallographic structure which corresponds to a monoclinic unit cell with a =0.834 nm, b =0.825 nm, c =2.04 nm and gamma=90.5 degrees. The dimensions of the ab plane are similar to those of cellulose I(beta), but the length of the c -axis is nearly twice that of cellulose I. It is proposed that four glucose residues are present in an extended conformation along the c -axis of the unit cell. The data presented show that glycosynthases represent promising enzymic systems for the synthesis of novel polysaccharides with specific and
Vasconcelos, Ana Flora D; Monteiro, Nilson K; Dekker, Robert F H; Barbosa, Aneli M; Carbonero, Elaine R; Silveira, Joana L M; Sassaki, Guilherme L; da Silva, Roberto; de Lourdes Corradi da Silva, Maria
2008-09-22
Four exopolysaccharides (EPS) obtained from Botryosphaeria rhodina strains isolated from rotting tropical fruit (graviola, mango, pinha, and orange) grown on sucrose were purified on Sepharose CL-4B. Total acid hydrolysis of each EPS yielded only glucose. Data from methylation analysis and (13)C NMR spectroscopy indicated that the EPS from the graviola isolate consisted of a main chain of glucopyranosyl (1-->3) linkages substituted at O-6 as shown in the putative structure below: [carbohydrate structure: see text]. The EPS of the other fungal isolates consisted of a linear chain of (1-->6)-linked glucopyranosyl residues of the following structure: [carbohydrate structure: see text]. FTIR spectra showed one band at 891 cm(-1), and (13)C NMR spectroscopy showed that all glucosidic linkages were of the beta-configuration. Dye-inclusion studies with Congo Red indicated that each EPS existed in a triple-helix conformational state. beta-(1-->6)-d-Glucans produced as exocellular polysaccharides by fungi are uncommon.
Weng, Brian Bor-Chun; Lin, Yu-Chih; Hu, Chia-Wen; Kao, Ming-Yuan; Wang, Shih-Hao; Lo, Dan-Yuan; Lai, Tzu-Yuan; Kan, Lou-Sing; Chiou, Robin Yih-Yuan
2011-04-01
Toxicological and immunomodulatory activities of botryosphaeran (BR), a newly emerged β-glucan that comprises a β-(1 → 3) backbone and β-(1 → 6) branched glucose residues were assessed. BR was 1.82 × 10(6) Da (M.W.) estimated by reversely-linear equation constructed by regression of logarithms of standard polysaccharides and their retention times of gel permeation chromatography. Sprague-Dawley rats were daily gavage-administered with BR at doses of 0, 1.25, 12.5, and 125 mg/kg body weight (BW) for 28 d. Serum hematological and biochemical analysis of all treatment were all within normal ranges. Mitogen-stimulated lymphoblastogenesis of spleno-lymphocytes was enhanced by BR at doses of 1.25 and 12.5 mg/kg BW. Through in vitro comparative assessments, RAW 264.7 macrophage (RAW) cells were treated with BR and two commercial β-glucans, zymosan (ZY) and barley β-glucan (GB), to characterize their relative immunomodulatory properties. All three β-glucans stimulated phagocytosis on fluorescence-labeled Escherichia coli. At dose levels from 5 to 200 μg/mL for 24h, nitric oxide produced by BR- and ZY-treated cells were higher than those produced by GB-treated and control groups. BR, ZY but GB also stimulated RAW cells in producing TNF-α. The results demonstrate that BR is toxicologically accepted and features as a potent immunomodulator. Copyright © 2011 Elsevier Ltd. All rights reserved.
Effects of polysaccharide from mycelia of Ganoderma lucidum on intestinal barrier functions of rats.
Jin, Mingliang; Zhu, Yimin; Shao, Dongyan; Zhao, Ke; Xu, Chunlan; Li, Qi; Yang, Hui; Huang, Qingsheng; Shi, Junling
2017-01-01
The intestinal mucosal barriers play essential roles not only in the digestion and absorption of nutrients, but also the innate defense against most intestinal pathogens. In the present study, polysaccharide from the mycelia of Ganoderma lucidum was given via oral administration to rats (100mg/kg body weight, 21days) to investigate its effects on intestinal barrier functions, including the mechanical barrier, immunological barrier and biological barrier function. It was found that the polysaccharide administration could significantly up-regulate the expression of occludin, nuclear factor-κB p65 (NF-κB p65) and secretory immunoglobulin A (SIgA) in ileum, markedly improve the levels of interferon-γ (IFN-γ), interleukin-2 (IL-2), and IL-4, and decrease the level of diamine oxidase (DAO) in serum. Meanwhile, rats from the polysaccharide group showed significant higher microbiota richness in cecum as reflected by the Chao 1 index compared with the control group. Moreover, the polysaccharide decreased the Firmicutes-to-Bacteroidetes ratio. Our results indicated that the polysaccharide from the mycelia of G. lucidum might be used as functional agent to regulate the intestinal barrier functions. Copyright © 2016 Elsevier B.V. All rights reserved.
Extraction and characterization of the auricularia auricular polysaccharide
NASA Astrophysics Data System (ADS)
Zhang, Q. T.
2016-07-01
To study a new protein drugs carrier, the Auricularia auricular polysaccharide (AAP) was extracted and purified from Auricularia auricular, and then characterized by the micrOTOF-Q mass spectrometer, UV/Vis spectrophotometer, moisture analyzer and SEM. The results showed that the AAP sample was water- soluble and white flocculence, its molecular weight were 20506.9 Da∼⃒63923.7 Da, and the yield, moisture, and total sugar contents of the AAP were 4.5%, 6.2% and 90.12%(w/w), respectively. The results of the SEM revealed that the AAP dried by vacuum were spherical particles with a smooth surface, and the AAP freeze-dried had continuous porous sheet shape with the loose structure.
Mirończuk-Chodakowska, Iwona; Witkowska, Anna Maria; Zujko, Małgorzata Elżbieta; Terlikowska, Katarzyna Maria
Macrofungal β-glucans are mainly represented by compounds with β-1,3- and β-1,6 glycosidic bonds. They have been shown to have immunomodulatory, anticancer, and antioxidant properties. Although there are many reports on the bioactivity and structure of fungal glucans, studies on the quantitative assessment of these compounds are sparse. The aim of the study was to determine total β-glucans and 1,3-1,6-β-D-glucan contents in selected species of wild-growing edible Polish mushrooms. Eight species of wild-growing edible mushrooms Boletus pinophilus, Hydnum repandum, Craterellus cornucopioides, Suillus variegatus, Suillus granulatus, Gyroporus cyanescens, Tricholomopsis rutilans, and Auricularia auricula-judae and one species of cultivated mushroom for comparison purposes Agaricus bisporus, were analyzed. Quantitative analysis of 1,3-1,6-β-D-glucans was done using a colorimetric method in accordance with Nitschke et al. Mean total β-glucan content varied from 13.5 g/100 g dry mass in A. bisporus (portobello variety) to 40.9 g/100 g dry mass in T. rutilans. Mean 1,3-1,6-β-D-glucan content in the analyzed fruiting bodies ranged from 3.9 g/100 g dry mass in Agaricus bisporus (cremini) to 16.8 g/100 g dry mass in Auricularia auricula-judae (wood ear). The following mushrooms demonstrated the greatest percentage of 1,3-1,6-β-D-glucan contents in relation to the total β-glucan content: Gyroporus cyanescens (54%), Suillus granulatus (49.8%), Auricularia auricula-judae (47.9%), and Suillus variegatus (40.6%). Among the analyzed species, wild-growing mushrooms had a generally higher average 1,3-1,6-β-Dglucan content compared with cultivated mushrooms such as A. bisporus. The highest average content of these polysaccharides was observed in medicinal mushroom Auricularia auricula-judae. Comparable 1,3-1,6-β-D-glucan content, in relation to this mushroom species, was found in Gyroporus cyanescens, Suillus granulatus and Suillus variegatus, which points to the
NASA Astrophysics Data System (ADS)
Boulos, Samy; Nyström, Laura
2017-11-01
The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO
Bonfim-Mendonça, Patrícia de Souza; Capoci, Isis Regina Grenier; Tobaldini-Valerio, Flávia Kelly; Negri, Melyssa; Svidzinski, Terezinha Inez Estivalet
2017-01-01
Glucans are a group of glucose polymers that are found in bacteria, algae, fungi, and plants. While their properties are well known, their biochemical and solubility characteristics vary considerably, and glucans obtained from different sources can have different applications. Research has described the bioactivity of β-glucans extracted from the algae of the Laminaria genus, including in vivo and in vitro studies assessing pro- and anti-inflammatory cytokines, vaccine production, inhibition of cell proliferation, and anti- and pro-oxidant activity. Thus, the objective of this article was to review the potential application of β-glucans from Laminaria spp. in terms of their immunomodulatory properties, microorganism host interaction, anti-cancer activity and vaccine development. PMID:28878139
Chamorro, S; Viveros, A; Alvarez, I; Vega, E; Brenes, A
2012-07-15
Grape seed extract and grape pomace are rich sources of polyphenols. The aim of this study was to evaluate the release of polyphenols, the solubilisation of carbohydrate, and the antioxidant capacity of these grape by-products after enzymatic reaction with carbohydrases (cellulolytic and pectinolytic activities) and tannase for 24h. The use of tannase in these by-products, and pectinase in grape pomace changed the galloylated form of catechin to its free form, releasing gallic acid and increasing the antioxidant activity. In grape pomace, cellulase treatment was not efficient for phenolic release and antioxidant activity improvement. The addition of carbohydrases to grape pomace, either alone or in combination, degraded the cell wall polysaccharides, increasing the content of monosaccharides. These results provide relevant data about the potential of pectinase, tannase and combinations of enzymes on the release of polyphenols and monosaccharides from grape by-products, improving the antioxidant capacity and the nutritional value. Copyright © 2012 Elsevier Ltd. All rights reserved.
Marine polysaccharide-based nanomaterials as a novel source of nanobiotechnological applications.
Manivasagan, Panchanathan; Oh, Junghwan
2016-01-01
Research on marine polysaccharide-based nanomaterials is emerging in nanobiotechnological fields such as drug delivery, gene delivery, tissue engineering, cancer therapy, wound dressing, biosensors, and water treatment. Important properties of the marine polysaccharides include biocompatibility, biodegradability, nontoxicity, low cost, and abundance. Most of the marine polysaccharides are derived from natural sources such as fucoidan, alginates, carrageenan, agarose, porphyran, ulvan, mauran, chitin, chitosan, and chitooligosaccharide. Marine polysaccharides are very important biological macromolecules that widely exist in marine organisms. Marine polysaccharides exhibit a vast variety of structures and are still under-exploited and thus should be considered as a novel source of natural products for drug discovery. An enormous variety of polysaccharides can be extracted from marine organisms such as algae, crustaceans, and microorganisms. Marine polysaccharides have been shown to have a variety of biological and biomedical properties. Recently, research and development of marine polysaccharide-based nanomaterials have received considerable attention as one of the major resources for nanotechnological applications. This review highlights the recent research on marine polysaccharide-based nanomaterials for biotechnological and biomedical applications. Copyright © 2015 Elsevier B.V. All rights reserved.
Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin
2014-01-01
A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571
Characterization and antioxidant activities of polysaccharides from thirteen boletus mushrooms.
Zhang, Lan; Hu, Yu; Duan, Xiaoyu; Tang, Tingting; Shen, Yingbin; Hu, Bin; Liu, Aiping; Chen, Hong; Li, Cheng; Liu, Yuntao
2018-07-01
Water-soluble polysaccharides were extracted from the caps and stipes of thirteen boletus mushrooms representing five different species collected in Southwest China. Investigations of their structures and antioxidant activities allowed an evaluation of structure-function relationships. The polysaccharides were composed mainly of the monosaccharides arabinose, xylose, mannose, glucose and galactose. Most samples displayed a broad molecular weight range, with significant differences observed between the molecular weight ranges of the polysaccharides from the caps and the stipes. FT-IR spectral analysis of the polysaccharides revealed that most of polysaccharides from boletus mushrooms (except Boletus edulis) contained a pyranose ring. The antioxidant activities of the polysaccharides in stipes showed a significant correlation with their monosaccharide composition, and were also related to their molecular weight and anomeric configuration. Suillellus luridus collected in Pingwu, Mianyang, Sichuan, China had remarkably superior antioxidant activity and might be developed as a natural antioxidant. Copyright © 2018 Elsevier B.V. All rights reserved.
Zhang, Anqiang; Deng, Jiaying; Liu, Xiaoqing; He, Pengfei; He, Liang; Zhang, Fuming; Linhardt, Robert J; Sun, Peilong
2018-07-01
Agaricus blazei Murill is an edible and medicinal mushroom favored in many countries, by virtue of both its delicious taste and its potential health benefits such as its purported anticancer activity. A neutral α-glucan (ABM40-1) with a carbohydrate content of 96% was purified from the high-speed shearing homogenization extracts of A. Blazei Murill by ethanol precipitation and column chromatography. Methylation analysis along with nuclear magnetic resonance spectroscopy revealed that ABM40-1 was an α-(1→4)-d-glucopyranan with O-6 position occasionally occupied with α-Glcp-(1→or α-Glcp-(1→6)-β-Glcp-(1→side chains. A weight-average molecular weight of 7.34×10 6 Da was determined for ABM40-1 and its chain in solution was revealed as a compact sphere by size exclusion chromatography (SEC) coupled with a laser light scattering. This spherical conformation was also further confirmed by Congo red test and using atom force microscopy. These results suggest it would be worthwhile to further study the potential bioactivities of ABM40-1. Copyright © 2018 Elsevier B.V. All rights reserved.
Osaku, Erica F; Menolli, Rafael A; de M Costa, Claudia R L; Tessaro, Fernando Henrique G; de Melo, Renan H; do Amaral, Alex E; Duarte, Péricles A D; de Santana Filho, Arquimedes Paixão; Ruthes, Andrea Caroline; da C Silva, José Luis; Mello, Rosiane G
2018-06-01
Paecilomyces variotii is a filamentous fungus that occurs worldwide in soil and decaying vegetation. Optimization of the fermentation process for exopolysaccharide (EPS) production from the fungus P. variotii, structure determination and immuno-stimulating activity of EPS were performed. Response surface methodology (RSM) coupled with central composite design (CCD) was used to optimize the physical and chemical factors required to produce EPS in submerged fermentation. Preliminary investigations to choose the three factors for the present work were made using a factorial experimental design. Glucose, ammonium nitrate (NH 4 NO 3 ) and pH were used as variables for which, with constant temperature of 28 °C and agitation of 90 rpm, the optimal process parameters were determined as glucose values of 0.96%, NH 4 NO 3 0.26% and pH 8.0. The three parameters presented significant effects. In this condition of culture, the main composition of the isolated EPS was a linear β-(1 → 6)-linked-D-glucan, as determined by Nuclear Magnetic Resonance (NMR) and methylation analysis. This polysaccharide is a very unusual as an EPS from fungi, especially a filamentous fungus such as P. variotii. Murine peritoneal macrophages cultivated with β-glucan for 6 and 48 h showed an increase in TNF-α, IL-6 and nitric oxide release with increased polysaccharide concentrations. Therefore, we conclude that the β-(1 → 6)-linked-D-glucan produced in optimised conditions of P. variotii cultivation has an immune-stimulatory activity on murine macrophages.
Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L
2014-02-07
The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.
Lowman, Douglas W.; Greene, Rachel R.; Bearden, Daniel W.; Kruppa, Michael D.; Pottier, Max; Monteiro, Mario A.; Soldatov, Dmitriy V.; Ensley, Harry E.; Cheng, Shih-Chin; Netea, Mihai G.; Williams, David L.
2014-01-01
The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. 1H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or “closed chain” structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae. PMID:24344127
Polysaccharide structure of tetrasporic red seaweed Tichocarpus crinitus.
Byankina Barabanova, A O; Sokolova, E V; Anastyuk, S D; Isakov, V V; Glazunov, V P; Volod'ko, A V; Yakovleva, I M; Solov'eva, T F; Yermak, I M
2013-10-15
Sulfated polysaccharide isolated from tetrasporic plants of Tichocarpus crinitus was investigated. The polysaccharide was isolated by two methods: with water extraction at 80 °C (HT) and with a mild alkaline extraction (AE). The extracted polysaccharides were presented by non-gelling ones only, while galactose and 3,6-AG were the main monosaccharides, at the same time amount of 3,6-AG in AE polysaccharides was the similar to that of HT. According to methods of spectroscopy and mass spectrometry, the polysaccharide from tetrasporic T. crinitus contains main blocks of 1,3-linked β-D-galactopyranosyl-2,4-disulfates and 1,4-linked 3,6-anhydro-α-D-galactopyranosyl while 6-sulfated 4-linked galactopyranosyl resudies are randomly distributed along the polysaccharide chain. The alkaline treatment of HT polysaccharide results in obtaining polysaccharide with regular structure that composed of alternating 1,3-linked β-D-galactopyranosyl-2,4-disulfates and 1,4-linked 3,6-anhydro-α-D-galactopyranosyl residues. Native polysaccharide (HT) possessed both high anticoagulant and antiplatelet activity measured by fibrin clotting and platelet aggregation induced by collagen. This activity could be connected with peculiar chemical structure of HT polysaccharide which has high sulfation degree and contains also 3,6-anhydrogalactose in the polymer chain. Copyright © 2013 Elsevier Ltd. All rights reserved.
Klimaszewska, Marzenna; Górska, Sandra; Dawidowski, Maciej; Podsadni, Piotr; Szczepanska, Agnieszka; Orzechowska, Emilia; Kurpios-Piec, Dagmara; Grosicka-Maciag, Emilia; Rahden-Staroń, Iwonna; Turło, Jadwiga
2017-01-01
Numerous formulations derived from the shiitake medicinal mushroom, Lentinus edodes, demonstrate anticancer activities. We hypothesized that isolates from selenium (Se)-enriched mycelia of L. edodes would possess stronger cancer-preventive properties than current preparations. The aim of this study was to investigate whether the presence of Se-methyl-seleno-L-cysteine in mycelial extracts of L. edodes affects their cytotoxic activity (makes them stronger) or whether they are as effective as Se-containing polysaccharides. Extracts were prepared from Se-containing mycelia under various conditions and assayed for cytotoxic activity in cancer (PC3 and HeLa) and normal (HMEC-1) cell lines. The chemical composition of the extracts was examined; specifically, the amounts of potentially cytotoxic Se compounds (methylselenocysteine, selenomethionine, and Se-containing polysaccharides) were measured. The relationship between extract composition and biological activity was characterized. Mycelial cultures were cultivated in a 10-L bioreactor in medium enriched with sodium selenite. Mycelial extracts were prepared either at 100°C or at 4°C in acidic solution. Total Se content was determined using the atomic absorption spectrometry method, and methylselenocysteine and selenomethionine contents were measured using reverse-phase high-performance liquid chromatography. Protein, carbohydrate, and polyphenolic contents were determined with spectrophotometric methods, and Se-containing polysaccharides were measured with the use of precipitation. Anticancer activity of mycelial extracts was examined using the MTT cell viability assay. Extracts containing Se-methyl-seleno-L-cysteine or Se-polysaccharides prepared at 4°C and 100°C, respectively, display moderate, time-dependent, specific cytotoxic activity in HeLa and PC3 cell lines. The effect in HeLa cells is more pronounced in the extract prepared at 4°C than at 100°C. The effect is almost equal for the PC3 cell line. However
Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi
NASA Astrophysics Data System (ADS)
van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.
Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.
Abundance of mixed linkage glucan in mature tissues and secondary cell walls of grasses
Vega-Sánchez, Miguel E.; Verhertbruggen, Yves; Scheller, Henrik V.; Ronald, Pamela C.
2013-01-01
(1,3; 1,4)-β-D-glucan, also known as mixed linkage glucan (MLG), is a polysaccharide that in flowering plants is unique to the cell walls of grasses and other related members of Poales. MLG is highly abundant in endosperm cell walls, where it is considered a storage carbohydrate. In vegetative tissues, MLG transiently accumulates in the primary cell walls of young, elongating organs. In evolutionary distant species such as Equisetum, MLG accumulates predominantly in old tissues in the stems. Similarly, we have recently shown that rice accumulates a large amount of MLG in mature stems, which prompted us to re-evaluate the hypothesis that MLG is solely related to growth in grass vegetative tissues. Here, we summarize data that confirms the presence of MLG in secondary cell walls and mature tissues in rice and other grasses. Along with these results, we discuss additional evidence indicating a broader role for MLG than previously considered. PMID:23299432
Chen, Guijie; Yuan, Qingxia; Saeeduddin, Muhammad; Ou, Shiyi; Zeng, Xiaoxiong; Ye, Hong
2016-11-20
Tea has a long history of medicinal and dietary use. Tea polysaccharide (TPS) is regarded as one of the main bioactive constituents of tea and is beneficial for health. Over the last decades, considerable efforts have been devoted to the studies on TPS: extraction, structural feature and bioactivity of TPS. However, it has been received much less attention compared with tea polyphenols. In order to provide new insight for further development of TPS in functional foods, in present review we summarize the recent literature, update the information and put forward future perspectives on TPS covering its extraction, purification, quantitative determination techniques as well as physicochemical characterization and bioactivities. Copyright © 2016 Elsevier Ltd. All rights reserved.
Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide
Choi, E. Y.; Lee, S. S.; Hyeon, J. Y.; Choe, S. H.; Keum, B. R.; Lim, J. M.; Park, D. C.; Choi, I. S.; Cho, K. K.
2016-01-01
This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS) of Escherichia. The incubated layer was used for a nitric oxide (NO) analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli) LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS)-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1) in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP). This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK) and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α) decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1) that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator. PMID:27488844
Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung
2017-01-01
ABSTRACT Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast (Saccharomyces cerevisiae) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter (malEFG1) and pullulanase (aapA) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically
Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan
2017-04-01
Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable
Anti-inflammatory activity of aqueous and alkaline extracts from mushrooms (Agaricus blazei Murill).
Padilha, Marina M; Avila, Ana A L; Sousa, Pergentino J C; Cardoso, Luis Gustavo V; Perazzo, Fábio F; Carvalho, José Carlos T
2009-04-01
The effects of aqueous and alkaline extracts from Agaricus blazei Murill, an edible mushroom used as folk medicine in Brazil, Japan, and China to treat several illnesses, were investigated on the basis of the inflammatory process induced by different agents. Oral administration of A. blazei extracts marginally inhibited the edema induced by nystatin. In contrast, when complete Freund's adjuvant was used as the inflammatory stimulus, both extracts were able to inhibit this process significantly (P < .05, analysis of variance followed by Tukey-Kramer multiple comparison post hoc test), although it inhibited the granulomatous tissue induction moderately. These extracts were able to decrease the ulcer wounds induced by stress. Also, administration of extracts inhibited neutrophil migration to the exudates present in the peritoneal cavity after carrageenin injection. Therefore, it is possible that A. blazei extracts can be useful in inflammatory diseases because of activation of the immune system and its cells induced by the presence of polysaccharides such as beta-glucans.
Pawlikowska, Małgorzata; Jędrzejewski, Tomasz; Piotrowski, Jakub; Kozak, Wiesław
2016-12-01
The aim of the study was to explore whether fever-range hyperthermia (FRH) might enhance the anticancer and immunoregulatory activities of protein-bound polysaccharides (PBP), a class of fungus derived immunomodifiers used in the cancer adjuvant therapy. Blood lymphocytes and breast cancer cells (MCF-7) were cultured at 39.5°C in humidified atmosphere containing 5% CO 2 for 2h. After rested at 37°C for 6h, the cells were treated with PBP extract at 100- and 300μg/ml concentration. After indicated time, the proliferative response was analyzed and cytokine mRNA expression assessment was performed by qRT-PCR. In animal model, the FRH was induced by placing rats in the Homeothermic Controller with heating blanket. Animals were heated until Tb reached 39.5°C (±0.2°C) and were maintained at this temperature for 30min. The protein-bound polysaccharides solution was injected i.p. at a dose of 100 mg/kg 6h post FRH. Twenty four hours after treatment, the blood was collected and cytokines expression analysis were performed. The results have shown that fever-range hyperthermia has an inhibitory effect on PBP extract-induced proliferative response of blood lymphocytes, as well as IL-1β and IL-6 mRNA expression. Moreover, the temperature of 39.5°C blocks PBP-induced cytotoxicity against MCF-7 cells, which correlates with significant reduction in TNF-α level. Combined treatment of rats (FRH+PBP) results in decrease of IL-1β, IL-6 and TNF-α mRNA expression in peripheral blood mononuclear cells compared to cells derived from rats treated with protein-bound polysaccharides extract alone. This study demonstrates that fever-range temperature inhibits immunostimulatory as well as anticancer effects mediated by protein-bound polysaccharides. Copyright © 2016. Published by Elsevier Ltd.
Cai, Y; Cai, B; Ikeda, S
2017-10-01
Pectic polysaccharides were extracted from soy flour at either room temperature (SPRT) or 121°C (SPH), and their abilities to stabilize milk proteins in acidic conditions were evaluated. Both SPRT and SPH were found to contain proteinaceous components that were difficult to dissociate from polysaccharide components using size exclusion chromatography, whereas the molar mass of the former was approximately twice that of the latter. Due to the higher molar mass, SPRT was expected to provide stronger steric effects to prevent aggregation between milk proteins in acidic conditions than SPH. Alkaline treatment of SPRT for breaking O-linkages between AA and monosaccharide residues decreased its molar mass by approximately 160 kDa, indicating that they contained naturally occurring conjugates of pectic and proteinaceous moieties. Particle size distributions in simulated acidified milk drink samples containing 0.2% SPRT or SPH showed monomodal distributions with median diameters of around 1.2 μm at pH 4. The presence of large protein aggregates (∼5 μm) was detected at 0.2% SPRT and pH 3.2, 0.6 to 0.8% SPRT and pH 4, or 0.2% SPH and pH 3.4. The presence of excess polysaccharide molecules unbound to proteins was detected at 0.2% SPRT and pH 3.2 to 3.4, 0.4 to 0.8% SPRT and pH 4, 0.2% SPH and pH 3.4 to 3.6, and 0.4 to 0.8% SPH and pH 4. The present results suggest that molecular characteristics of pectic polysaccharides vary depending on extraction conditions and hence their functional behavior. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Resistant-hemicelluloses toward successive chemical treatment during cellulose fibre extraction
NASA Astrophysics Data System (ADS)
Naqiya, F. M. Z.; Ahmad, I.; Airianah, O. B.
2018-04-01
Lignocellulosic materials have high demand bio-polymers industries as it is rich in cellulose but other residues that still remain in the extracted cellulose might influence the ability of cellulose-rich material to interact with other polymers. In this study, cellulose fibre was extracted from oil palm frond (OPF) using alkali and bleaching treatment. The morphological changes of each sample after every treatment was observed using Scanning Electron Microscope (SEM) and was further chemically extracted and quantitatively evaluated via spectrophotometric method. The non-cellulosic component was found predominantly contained hemicelluloses and these remaining hemicelluloses were hydrolysed and the monosaccharides of hemicelluloses were visualised by Thin Layer Chromatography (TLC). Xylose, arabinose, mannose and glucose were detected and therefore, it is suggested that the plausible type of resistant-hemicelluloses in OPF extracted fibre are arabinoxylan, glucomannan and/or glucan.
Production of low-molecular weight soluble yeast β-glucan by an acid degradation method.
Ishimoto, Yuina; Ishibashi, Ken-Ichi; Yamanaka, Daisuke; Adachi, Yoshiyuki; Kanzaki, Ken; Iwakura, Yoichiro; Ohno, Naohito
2018-02-01
β-glucan is widely distributed in nature as water soluble and insoluble forms. Both forms of β-glucan are utilized in several fields, especially for functional foods. Yeast β-glucan is a medically important insoluble particle. Solubilization of yeast β-glucan may be valuable for improving functional foods and in medicinal industries. In the present study, we applied an acid degradation method to solubilize yeast β-glucan and found that β-glucan was effectively solubilized to low-molecular weight β-glucans by 45% sulfuric acid treatment at 20°C. The acid-degraded soluble yeast β-glucan (ad-sBBG) was further fractionated into a higher-molecular weight fraction (ad-sBBG-high) and a lower-molecular weight fraction (ad-sBBG-low). Since ad-sBBG-high contained mannan, while ad-sBBG-low contained it only scarcely, it was possible to prepare low-molecular weight soluble β-glucan with higher purity. In addition, ad-sBBG-low bound to dectin-1, which is an innate immunity receptor of β-glucan, and showed antagonistic activity against reactive oxygen production and cytokine synthesis by macrophages. Thus, this acid degradation method is an important procedure for generating immune-modulating, low-molecular weight, soluble yeast β-glucan. Copyright © 2017 Elsevier B.V. All rights reserved.
Antibacterial activities of β-glucan (laminaran) against gram-negative and gram-positive bacteria
NASA Astrophysics Data System (ADS)
Chamidah, A.; Hardoko, Prihanto, A. A.
2017-05-01
This study aimed to determine the antibacterial activity of β-Glucan (laminaran) of LAE and LME extracts from brown algae Sargassum crassifolium using HPMS and Ultrasonication against Gram-positive bacteria (Bacillus subtilis and Staphylococcus aureus) and Gram-negative bacteria (Salmonella typhimurium and Escherichia coli). The highest antibacterial activities of LME extract obtained using the HPMS method against Gram-positive bacteria (B. subtilis and S. aureus) were at 18:10 and 18.80 mm. The ultrasonication method showed a lower inhibition trend than the HPMS method, with MIC and MBC values of 250 mg/ml and 2-8 CFU/ml, respectively, in all Gram-negative and Gram-positive bacteria. The results showed that LME extract at a concentration of 250 mg/mL is bacteriostatic against Gram-positive and -negative bacteria.
The role of wine polysaccharides on salivary protein-tannin interaction: A molecular approach.
Brandão, Elsa; Silva, Mafalda Santos; García-Estévez, Ignacio; Williams, Pascale; Mateus, Nuno; Doco, Thierry; de Freitas, Victor; Soares, Susana
2017-12-01
Polysaccharides are described to inhibit aggregation between food polyphenols and salivary proteins (SP) and may hence lead to astringency modulation. In this work, the effect of two wine polysaccharides (arabinogalactan proteins-AGPs and rhamnogalacturonan II- RGII) on SP-polyphenol interaction was evaluated. In general, both polysaccharides were effective to inhibit or reduce SP-polyphenol interaction and aggregation. They can act by two different mechanisms (ternary or competitive) depending on the SP-tannin pair. In the case of salivary P-B peptide, AGPs and RGII seem to act by a ternary mechanism, in which they surround this complex, enhancing its solubility. Concerning acidic proline-rich proteins (aPRPs), it was possible to observe both mechanisms, depending on the tannin and the polysaccharide involved. Overall, this work point out for a specific property of wine polysaccharides important to modulate this and other beverages and food astringency perception. Copyright © 2017 Elsevier Ltd. All rights reserved.
Durgo, Ksenija; Koncar, Mladen; Komes, Drazenka; Belscak-Cvitanovic, Ana; Franekic, Jasna; Jakopovich, Ivan; Jakopovich, Neven; Jakopovich, Boris
2013-01-01
The use of mushrooms contributes to human nutrition by providing low lipid content of lipids and high dietary fiber content, as well as significant content of other biologically active compounds such as polysaccharides, minerals, vitamins, and polyphenolic antioxidants. This study aimed to determine the content of polyphenols and polysaccharides, as well as the cytotoxic and antioxidative properties of several medicinal mushroom preparations. The content of total phenols and flavonoids of preparations of blended mushroom extracts (Lentifom, Super Polyporin, Agarikon, Agarikon Plus, Agarikon.1, and Mykoprotect.1) was evaluated quantitatively by using ultraviolet-visible spectroscopy spectrophotometric methods. The antioxidant capacity of the preparations was evaluated using the ABTS (2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and ferric reducing/antioxidant power assays. The content of water-soluble polysaccharides was determined using a specific gravimetric method, based on ethanol precipitation. To determine cytotoxic effects of single and blended mushroom extracts, MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) and neutral red assays were conducted using human small cell lung cancer, lung adenocarcinoma, colon cancer, and brain astrocytoma cancer cells. The obtained results suggest that due to the significant content of beneficial polyphenolic antioxidants and soluble polysaccharides, use of these mushroom preparations is beneficial in maintaining good health, as well as in the prevention and adjuvant biotherapy of various human pathological aberrations. These results reveal that these extracts exhibit different cytotoxic effects on tumor cells originating from different tissues. In addition, the comparison of investigated blended mushroom extracts with three well-known commercial mushroom products derived from single mushroom species or single mushroom compounds shows that blended mushroom extracts exhibit significantly stronger
Vega-Sánchez, Miguel E; Loqué, Dominique; Lao, Jeemeng; Catena, Michela; Verhertbruggen, Yves; Herter, Thomas; Yang, Fan; Harholt, Jesper; Ebert, Berit; Baidoo, Edward E K; Keasling, Jay D; Scheller, Henrik V; Heazlewood, Joshua L; Ronald, Pamela C
2015-09-01
Reduced cell wall recalcitrance and increased C6 monosaccharide content are desirable traits for future biofuel crops, as long as these biomass modifications do not significantly alter normal growth and development. Mixed-linkage glucan (MLG), a cell wall polysaccharide only present in grasses and related species among flowering plants, is comprised of glucose monomers linked by both β-1,3 and β-1,4 bonds. Previous data have shown that constitutive production of MLG in barley (Hordeum vulgare) severely compromises growth and development. Here, we used spatio-temporal strategies to engineer Arabidopsis thaliana plants to accumulate significant amounts of MLG in the cell wall by expressing the rice CslF6 MLG synthase using secondary cell wall and senescence-associated promoters. Results using secondary wall promoters were suboptimal. When the rice MLG synthase was expressed under the control of a senescence-associated promoter, we obtained up to four times more glucose in the matrix cell wall fraction and up to a 42% increase in saccharification compared to control lines. Importantly, these plants grew and developed normally. The induction of MLG deposition at senescence correlated with an increase of gluconic acid in cell wall extracts of transgenic plants in contrast to the other approaches presented in this study. MLG produced in Arabidopsis has an altered structure compared to the grass glucan, which likely affects its solubility, while its molecular size is unaffected. The induction of cell wall polysaccharide biosynthesis in senescing tissues offers a novel engineering alternative to enhance cell wall properties of lignocellulosic biofuel crops. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Wang, Xiaoqin; Li, Guizhen; Row, Kyung Ho
2017-08-01
Magnetic graphene oxide was modified by four imidazole-based ionic liquids to synthesize materials for the extraction of polysaccharides by magnetic solid-phase extraction. Fucoidan and laminarin were chosen as the representative polysaccharides owing to their excellent pharmaceutical value and availability. Fourier transform infrared spectroscopy, field-emission scanning electron microscopy, and thermogravimetric analysis were applied to characterize the synthesized materials. Single-factor experiments showed that the extraction efficiency of polysaccharides was affected by the amount of ionic liquids for modification, solid-liquid ratio of brown alga and ethanol, the stirring time of brown alga and ionic liquid-modified magnetic graphene oxide materials, and amount of 1-(3-aminopropyl)imidazole chloride modified magnetic graphene oxide materials added to the brown alga sample solution. The results indicated that 1-(3-aminopropyl)imidazole chloride modified magnetic graphene oxide possessed better extraction ability than graphene oxide, magnetic graphene oxide, and other three ionic-liquid-modified magnetic graphene oxide materials. The highest extraction recoveries of fucoidan and laminarin extracted by 1-(3-aminopropyl)imidazole chloride modified magnetic graphene oxide were 93.3 and 87.2%, respectively. In addition, solid materials could be separated and reused easily owing to their magnetic properties. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Theuwissen, Elke; Mensink, Ronald P
2007-03-01
Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.
Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter
2017-07-20
Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus ), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast).
Friedman, Mendel
2016-11-29
More than 2000 species of edible and/or medicinal mushrooms have been identified to date, many of which are widely consumed, stimulating much research on their health-promoting properties. These properties are associated with bioactive compounds produced by the mushrooms, including polysaccharides. Although β-glucans (homopolysaccharides) are believed to be the major bioactive polysaccharides of mushrooms, other types of mushroom polysaccharides (heteropolysaccharides) also possess biological properties. Here we survey the chemistry of such health-promoting polysaccharides and their reported antiobesity and antidiabetic properties as well as selected anticarcinogenic, antimicrobial, and antiviral effects that demonstrate their multiple health-promoting potential. The associated antioxidative, anti-inflammatory, and immunomodulating activities in fat cells, rodents, and humans are also discussed. The mechanisms of action involve the gut microbiota, meaning the polysaccharides act as prebiotics in the digestive system. Also covered here are the nutritional, functional food, clinical, and epidemiological studies designed to assess the health-promoting properties of polysaccharides, individually and as blended mixtures, against obesity, diabetes, cancer, and infectious diseases, and suggestions for further research. The collated information and suggested research needs might guide further studies needed for a better understanding of the health-promoting properties of mushroom polysaccharides and enhance their use to help prevent and treat human chronic diseases.
Friedman, Mendel
2016-01-01
More than 2000 species of edible and/or medicinal mushrooms have been identified to date, many of which are widely consumed, stimulating much research on their health-promoting properties. These properties are associated with bioactive compounds produced by the mushrooms, including polysaccharides. Although β-glucans (homopolysaccharides) are believed to be the major bioactive polysaccharides of mushrooms, other types of mushroom polysaccharides (heteropolysaccharides) also possess biological properties. Here we survey the chemistry of such health-promoting polysaccharides and their reported antiobesity and antidiabetic properties as well as selected anticarcinogenic, antimicrobial, and antiviral effects that demonstrate their multiple health-promoting potential. The associated antioxidative, anti-inflammatory, and immunomodulating activities in fat cells, rodents, and humans are also discussed. The mechanisms of action involve the gut microbiota, meaning the polysaccharides act as prebiotics in the digestive system. Also covered here are the nutritional, functional food, clinical, and epidemiological studies designed to assess the health-promoting properties of polysaccharides, individually and as blended mixtures, against obesity, diabetes, cancer, and infectious diseases, and suggestions for further research. The collated information and suggested research needs might guide further studies needed for a better understanding of the health-promoting properties of mushroom polysaccharides and enhance their use to help prevent and treat human chronic diseases. PMID:28231175
Sulfated Seaweed Polysaccharides as Multifunctional Materials in Drug Delivery Applications
Cunha, Ludmylla; Grenha, Ana
2016-01-01
In the last decades, the discovery of metabolites from marine resources showing biological activity has increased significantly. Among marine resources, seaweed is a valuable source of structurally diverse bioactive compounds. The cell walls of marine algae are rich in sulfated polysaccharides, including carrageenan in red algae, ulvan in green algae and fucoidan in brown algae. Sulfated polysaccharides have been increasingly studied over the years in the pharmaceutical field, given their potential usefulness in applications such as the design of drug delivery systems. The purpose of this review is to discuss potential applications of these polymers in drug delivery systems, with a focus on carrageenan, ulvan and fucoidan. General information regarding structure, extraction process and physicochemical properties is presented, along with a brief reference to reported biological activities. For each material, specific applications under the scope of drug delivery are described, addressing in privileged manner particulate carriers, as well as hydrogels and beads. A final section approaches the application of sulfated polysaccharides in targeted drug delivery, focusing with particular interest the capacity for macrophage targeting. PMID:26927134
Beta-glucan enhances the response to SVCV infection in zebrafish.
M Medina-Gali, Regla; Ortega-Villaizan, María Del Mar; Mercado, Luis; Novoa, Beatriz; Coll, Julio; Perez, Luis
2018-07-01
The antiviral effects of beta-glucan, an immunostimulatory agent were studied in zebrafish both in vitro and in vivo. Here we show that zebrafish ZF4 cells as well as whole fish primed with yeast β-glucan zymosan exhibited increased cytokine expression and elevated response to spring viremia of carp virus (SVCV) infection. In vitro, previous treatment of β-glucan enhanced ZF4 cell viability against SVCV infection which is associated to the activation of interferon signaling pathway and inflammatory cytokines gene expression. In vivo, the SVCV-infected fish primed with β-glucan had a higher survival rate (≈73%) than the control SVCV-infected group (≈33%). Additionally, up-regulation of the expression of a set of genes involved in innate immune response was detected in zebrafish intraperitoneally injected of β-glucan: il1b, il6, il8, il10 and tnfa transcripts showed increased expression that appear to be rapid (2 days) but not long-lived (less than 2 weeks). The present study is, to our knowledge, the first to combine cell culture and in vivo approaches to describe host response to β-glucan stimulation and viral infection in zebrafish. Copyright © 2018 Elsevier Ltd. All rights reserved.
Oliveira-Garcia, Ely; Deising, Holger B.
2013-01-01
β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035
Castro-Alves, Victor Costa; Nascimento, João Roberto Oliveira do
2018-05-01
Macrophages play an essential role in lipid metabolism; however, the excessive uptake of modified lipids and cholesterol crystals (CC) leads to the formation of pro-inflammatory lipid-laden macrophages called foam cells. Since the α-1,6- and β-1,3-d-glucans from the basidiome and the mycelium of the edible mushroom Pleurotus albidus have previously been shown to regulate macrophage function, these glucans were tested in macrophage-like THP-1 cells previously exposed to acetylated low-density lipoproteins (acLDL) or CC. The glucans inhibited lipid-induced inflammation, but only the β-1,3-d-glucan regulated both the NLRP3 inflammasome activation and the expression of genes involved on lipid efflux in acLDL- or CC-pretreated cells, thereby reducing foam cell formation. In contrast, the two α-1,6-glucans tested inhibited foam cell formation only in acLDL-pretreated cells and had no effect on the expression of the peroxisome proliferator-activated receptor gamma and liver X receptor alpha genes, suggesting that these glucans regulate lipid influx rather than lipid efflux. Thus, α- and β-d-glucans differentially regulate lipid-induced inflammation and foam cell formation in macrophage-like cells. Furthermore, results emphasize that P. albidus has potential to be used as a functional food or as a source for the extraction of biologically-active glucans. Copyright © 2018 Elsevier B.V. All rights reserved.
Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.
Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G
2017-08-15
Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Velusami, Chandrasekaran Chinampudur; Boddapati, Srinivasa Rao; Hongasandra Srinivasa, Srikanth; Richard, Edwin Jothie; Balasubramanian, Murali
2013-01-01
Curcuma longa Linn. (Zingiberaceae) commonly known as turmeric has long been used for centuries as a spice and household remedy. The present study was carried out to assess the possible mutagenic potential and acute oral toxicity of polysaccharide extract of turmeric rhizome (NR-INF-02) using standard tests. The standard battery of in vitro genotoxicity tests, bacterial reverse mutation test (BRMT), chromosome aberration (CA), and micronucleus (MN) tests were employed to assess the possible mutagenic activity of NR-INF-02 (Turmacin). The results showed no mutagenic effect with NR-INF-02 up to a dose of 5000 µg/mL in BRMT. The results on CA and MN tests revealed the non clastogenic activity of NR-INF-02 in a dose range of 250.36 to 2500 µg/mL with and without metabolic activation (S9). In acute oral toxicity study, NR-INF-02 was found to be safe up to 5 g/kg body weight in Wistar rats. Overall, results indicated that polysaccharide extract of C. longa was found to be genotoxically safe and also exhibited maximum tolerable dose of more than 5 g/kg rat body weight. PMID:24455673
β-Glucoside Activators of Mung Bean UDP-Glucose: β-Glucan Synthase 1
Callaghan, Theresa; Ross, Peter; Weinberger-Ohana, Patricia; Benziman, Moshe
1988-01-01
n-Alkyl (C6-C12) β-d-monoglucopyranosides have been found to be highly potent activators of mung bean β-glucan synthase in vitro, increasing the Vmax of the enzyme as much as 60-fold and with Ka values as low as 10 micromolar. Activation is highly specific for the β-linked terminal glucose residue; other alkyl glycosides such as, octyl-α-glucoside, dodecyl β-maltoside, 6-lauryl sucrose, 6-lauryl glucose, which lack this structure, are ineffective as activators. Based on the similarities in their structure and effects on β-glucan synthesis under a variety of conditions, it is proposed that the alkyl β-glucosides are structural analogs of the native glucolipid activator of β-glucan synthase isolated from mung bean extracts. PMID:16666039
Carrieri, Raffaele; Manco, Rosanna; Sapio, Daniela; Iannaccone, Marco; Fulgione, Andrea; Papaianni, Marina; de Falco, Bruna; Grauso, Laura; Tarantino, Paola; Ianniello, Flora; Lanzotti, Virginia; Lahoz, Ernesto; Capparelli, Rosanna
2017-09-01
Mushrooms produce a wide range of bioactive polysaccharides, different from each other in chemical structure and biological effects. In the last years, the idea to develop functional foods or drugs containing fungal polysaccharides is attracting great attention. Fruiting bodies of Basidiomycetes Ganoderma lucidum are commonly used in Oriental medicine to treat several disorders. G. lucidum polysaccharides - mainly β-glucans and heteroglycans - have numerous biological properties such as antitumour and immunomodulatory activities. This report shows, by gene expression analyses and bioenergetic assays, immunomodulatory properties and capacity to improve glucose metabolism of a water-soluble heteroglycan extracted from mycelium of an Italian isolate of G. lucidum. The findings suggest the use of the heteroglycan as probiotic or ingredient in functional foods, being easy to produce and disperse in a food matrix thanks to its water-solubility. Heteroglycan could exert protective effects in pro-inflammatory conditions and benefits for people characterised by suppressed immune response.
Khatib, Mohamad; Giuliani, Camilla; Rossi, Federico; Adessi, Alessandra; Al-Tamimi, Amal; Mazzola, Giuseppe; Di Gioia, Diana; Innocenti, Marzia; Mulinacci, Nadia
2017-11-15
The main crude polysaccharides (CPS), extracted from two widely cultivated pomegranate varieties, Laffan and Wonderful, were studied and characterized. We obtained the highest CPS extraction yield (approximatively 10% w/w on dried matter) by 1h of decoction (ratio 1/40w/v). The predominant polymers (75-80%) of the CPS samples showed a hydrodynamic volume close to 2000kDa by size exclusion chromatography and the exocarp and mesocarp profiles were very similar. The proton spectra ( 1 H NMR), according to sugar composition and gelling ability, confirmed the main polysaccharide fractions were pectin with different acylation and methylation degree. The CPS from Laffan and Wonderful mesocarp showed prebiotic properties in vitro with Lactobacillus and Bifidobacterium strains. The composition of the decoction (12% ellagitannins and 10% of CPS) obtained by a green extraction process of pomegranate by-products, makes it a suitable component of functional food formulations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Jin, Weihua; Zhang, Wenjing; Liu, Ge; Yao, Jianting; Shan, Tifeng; Sun, Chaomin; Zhang, Quanbin
2017-12-01
Polysaccharides derived from Sargassum thunbergii were prepared to investigate the structure-activity relationship between polysaccharides and anti-tumor activity in vitro. Many factors were examined. Overall, STW (polysaccharide extracted by hot water) had the best activity, followed by STJ (polysaccharide extracted by dilute alkali), and then STA (polysaccharide extracted by dilute acid). Location of algae had no effect at 500μg/mL and 1000μg/mL, while STW-QD (algae collected from Qingdao, China) had the best activity, followed by STW-WZ (algae collected from Wenzhou, China) and STW-LJ (algae collected from Lianjiang, China) and then STW-DL (algae collected from Dalian, China) and STW-RC (algae collected from Rongcheng, China) at 250μg/mL. Moreover, molecular weight had no effect at 1000μg/mL, while higher molecular weights were associated with better activities at 250μg/mL and 500μg/mL. Sulfate content had no effect at 1000μg/mL, while anti-tumor activities decreased accompanying with the changes of sulfate content. Uronic acid content was an important factor influencing activity. The fractions of STW showed little anti-tumor activity; however, the mixture of the fractions of STW showed approximately 60% inhibition. Overall, these findings suggested that the anti-tumor activity of polysaccharides required multilateral cooperation and that some of the effective components were lost. Copyright © 2017 Elsevier B.V. All rights reserved.
Sasmito, Ediati; Hertiani, Triana; Novlita Renggani, Tiya; Jaya Laksana, Brata
2015-01-01
Noni fruit (Morinda citrifolia L.) has been acknowledged for its cytotoxic and immunostimulatory activity. Our previous results on the immunomodulatory effect of a noni juice polysaccharide-rich fraction encouraged this research to evaluate the potency of the polysaccharide-rich fraction as co-chemotherapy with doxorubicin (DOX) administration. Macrophage activity (MA) was evaluated with the latex bead method. The phagocytic index (PI) was measured as the number of latex beads ingested by 100 macrophages, while the phagocytosis ratio (PR) was indicated by the percentage of macrophages that ingested three or more latex beads. The CEC was evaluated by using a commercial assay kit, while CD8+ T lymphocyte proliferation was evaluated using a flowcytometry method following in vivo administration. Thirty male Wistar rats were divided into five groups (n = 6 each). The control group received DOX via i.p. at a concentration of 4.67 mg/kg BW on days 1 and 4; four treatment groups received PF p.o. at a concentration of 25; 50; 100; 200 mg/kg BW daily, respectively, and additionally DOX i.p. 4.67 mg/kg BW (days 1 and 4) for 7 days. The phagocytic activity was not affected significantly by PF administration compared to the Dox control, but PF administration at a dose of 25 and 50 mg/kg BW has been proven to increase TCD8+ cell proliferation in combination with DOX. The catalase concentration, on the other hand, significantly decreased following PF administration at a dose of 100 mg/kg BW. The results suggest that the polysaccharide-rich fraction of noni juice might induce immunomodulatory effects via TCD8+ activation, have antioxidant activity, and thus might be a potential candidate to be used as an adjuvant to DOX chemotherapy. PMID:26839832
Sasmito, Ediati; Hertiani, Triana; Novlita Renggani, Tiya; Jaya Laksana, Brata
2015-01-01
Noni fruit (Morinda citrifolia L.) has been acknowledged for its cytotoxic and immunostimulatory activity. Our previous results on the immunomodulatory effect of a noni juice polysaccharide-rich fraction encouraged this research to evaluate the potency of the polysaccharide-rich fraction as co-chemotherapy with doxorubicin (DOX) administration. Macrophage activity (MA) was evaluated with the latex bead method. The phagocytic index (PI) was measured as the number of latex beads ingested by 100 macrophages, while the phagocytosis ratio (PR) was indicated by the percentage of macrophages that ingested three or more latex beads. The CEC was evaluated by using a commercial assay kit, while CD8+ T lymphocyte proliferation was evaluated using a flowcytometry method following in vivo administration. Thirty male Wistar rats were divided into five groups (n = 6 each). The control group received DOX via i.p. at a concentration of 4.67 mg/kg BW on days 1 and 4; four treatment groups received PF p.o. at a concentration of 25; 50; 100; 200 mg/kg BW daily, respectively, and additionally DOX i.p. 4.67 mg/kg BW (days 1 and 4) for 7 days. The phagocytic activity was not affected significantly by PF administration compared to the Dox control, but PF administration at a dose of 25 and 50 mg/kg BW has been proven to increase TCD8+ cell proliferation in combination with DOX. The catalase concentration, on the other hand, significantly decreased following PF administration at a dose of 100 mg/kg BW. The results suggest that the polysaccharide-rich fraction of noni juice might induce immunomodulatory effects via TCD8+ activation, have antioxidant activity, and thus might be a potential candidate to be used as an adjuvant to DOX chemotherapy.
Kiho, T; Hui, J; Yamane, A; Ukai, S
1993-12-01
Crude polysaccharides were obtained from a hot-water extract and alkaline extracts of the cultural mycelium of Cordyceps sinensis. They showed significant activity in normal mice and streptozotocin-induced diabetic mice as a result of intraperitoneal (i.p.) injection. A crude polysaccharide (CS-OHEP) obtained from 5% sodium hydroxide extract slightly lowered the plasma glucose level in normal mice by oral (p.o.) administration. A neutral polysaccharide (CS-F30) exhibited higher hypoglycemic activity than its crude polysaccharide (CS-OHEP), exhibited by i.p. injection, and it significantly lowered the glucose level by p.o. administration (50 mg/kg). However, it hardly affected the plasma insulin level in normal mice. CS-F30 ([alpha]D + 21 degrees in water) is composed of galactose, glucose and mannose (molar percent, 62:28:10), and its molecular weight is about 45000.
Sun, Lin; Peng, Xiaoxia; Sun, Pan; Shi, Jiahong; Yuan, Xiaowen; Zhu, Jingjing; Tai, Guihua; Zhou, Yifa
2012-08-01
Panax ginseng C. A. Meyer is a well-known plant medicine in the world. Ginseng polysaccharides mainly contain starch-like glucan and pectin. In this paper, a novel glucan WGPA-UH-N1 was purified from ginseng pectin by the treatment of de-esterification and endo-polygalacturonase, followed by the chromatographies on DEAE-Sepharose Fast Flow and Sephadex G-50 column. WGPA-UH-N1 has molecular weight about 17 kDa. WGPA-UH-N1 was determined to be a linear α-(1→6)-D-glucan without side chains by FT-IR, (13)C-NMR, (1)H-NMR, HMQC and HMBC spectra. It is the first time to isolate a linear α-(1→6)-D-glucan from Panax ginseng C. A. Meyer. Immunological activity assays showed that WGPA-UH-N1, although not effective on the phagocytosis of macrophage, could significantly induce lymphocyte proliferation without mitogenic stimuli at 1.0 mg/mL or with LPS at 0.5 mg/mL, also significantly increase NO production at the range of 0.1-1.0 mg/mL in a dose-dependent manner. The immunological activities of WGPA-UH-N1 are different from those of the β-(1→6)-D-glucan (BIWP2) isolated from the fruit bodies of Bulgaria Inquinans (Fries).
Mieher, Joshua L; Larson, Matthew R; Schormann, Norbert; Purushotham, Sangeetha; Wu, Ren; Rajashankar, Kanagalaghatta R; Wu, Hui; Deivanayagam, Champion
2018-07-01
The high-resolution structure of glucan binding protein C (GbpC) at 1.14 Å, a sucrose-dependent virulence factor of the dental caries pathogen Streptococcus mutans , has been determined. GbpC shares not only structural similarities with the V regions of AgI/II and SspB but also functional adherence to salivary agglutinin (SAG) and its scavenger receptor cysteine-rich domains (SRCRs). This is not only a newly identified function for GbpC but also an additional fail-safe binding mechanism for S. mutans Despite the structural similarities with S. mutans antigen I/II (AgI/II) and SspB of Streptococcus gordonii , GbpC remains unique among these surface proteins in its propensity to adhere to dextran/glucans. The complex crystal structure of GbpC with dextrose (β-d-glucose; Protein Data Bank ligand BGC) highlights exclusive structural features that facilitate this interaction with dextran. Targeted deletion mutant studies on GbpC's divergent loop region in the vicinity of a highly conserved calcium binding site confirm its role in biofilm formation. Finally, we present a model for adherence to dextran. The structure of GbpC highlights how artfully microbes have engineered the lectin-like folds to broaden their functional adherence repertoire. Copyright © 2018 American Society for Microbiology.
Huang, Weichao; Haferkamp, Ilka; Lepetit, Bernard; Molchanova, Mariia; Hou, Shengwei; Jeblick, Wolfgang; Río Bártulos, Carolina; Kroth, Peter G
2018-05-01
The β-1,3-glucan chrysolaminarin is the main storage polysaccharide of diatoms. In contrast to plants and green algae, diatoms and most other algal groups do not accumulate storage polysaccharides in their plastids. The diatom Phaeodactylum tricornutum possesses only a single gene encoding a putative β-1,3-glucan synthase ( Pt BGS). Here, we characterize this enzyme by expressing GFP fusion proteins in P. tricornutum and by creating and investigating corresponding gene silencing mutants. We demonstrate that Pt BGS is a vacuolar protein located in the tonoplast. Metabolite analyses of two mutant strains with reduced amounts of Pt BGS reveal a reduction in their chrysolaminarin content and an increase of soluble sugars and lipids. This indicates that carbohydrates are shunted into alternative pathways when chrysolaminarin production is impaired. The mutant strains show reduced growth and lower photosynthetic capacities, while possessing higher photoprotective abilities than WT cells. Interestingly, a strong reduction in Pt BGS expression also results in aberrations of the usually very regular thylakoid membrane patterns, including increased thylakoid thickness, reduced numbers of thylakoids per plastid, and increased numbers of lamellae per thylakoid stack. Our data demonstrate the complex intertwinement of carbohydrate storage in the vacuoles with carbohydrate metabolism, photosynthetic homeostasis, and plastid morphology.
Inhibitory effects of polysaccharide extract from Spirulina platensis on corneal neovascularization
Yang, Lingling; Wang, Yao; Zhou, Qingjun; Chen, Peng; Wang, Yiqiang; Wang, Ye; Liu, Ting
2009-01-01
Purpose To assess the effects of polysaccharide extract from Spirulina platensis (PSP) on corneal neovascularization (CNV) in vivo and in vitro. Methods PSP was extracted from dry powder of Spirulina platensis. Its anti-angiogenic activity was evaluated in the mouse corneal alkali burn model after topical administration of PSP four times daily for up to seven days. Corneal samples were processed for histochemical, immunohistochemical, and gene expression analyses. The effects of PSP on proliferation, migration, tube formation, and serine threonine kinase (AKT) and extracellular regulated kinase1/2 (ERK1/2) signaling levels in vascular endothelial cells were determined using 3-(4,5)-dimethylthiahiazo (-z-y1)-3, 5-di-phenytetrazoliumromide (MTT) and carboxyfluorescein succinimidyl ester (CFSE) labeling assays, wound healing assay, Matrigel tube formation assay, and western blot. Results Topical application of PSP significantly inhibited CNV caused by alkali burn. Corneas treated with PSP showed reduced levels of platelet endothelial cell adhesion molecule (CD31) and stromal cell-derived factor 1 (SDF1) proteins, reduced levels of vascular endothelial growth factor (VEGF), matrix metalloproteinase-2 (MMP2), matrix metalloproteinase-9 (MMP9), SDF1, and tumor necrosis factor-alpha (TNF-α) mRNAs, and an increased level of pigment epithelium-derived factor (PEDF) mRNA. These are parameters that have all been related to CNV and/or inflammation. In human vascular endothelial cells, PSP significantly inhibited proliferation, migration, and tube formation in a dose-dependent manner. Furthermore, PSP also decreased the levels of activated AKT and ERK 1/2. Conclusions These data suggest that polysaccharide extract from Spirulina platensis is a potent inhibitor of CNV and that it may be of benefit in the therapy of corneal diseases involving neovascularization and inflammation. PMID:19784394
Pulmonary α-1,3-Glucan-Specific IgA-Secreting B Cells Suppress the Development of Cockroach Allergy1
Patel, Preeyam S.; King, R. Glenn; Kearney, John F.
2016-01-01
There is a higher incidence of allergic conditions among children living in industrialized countries than those in developing regions. One explanation for this is reduced neonatal exposure to microbes and the consequent lack of immune stimulation. Sensitivity to cockroach allergen is highly correlated with the development of severe asthma. In this study, we determined that an antibody to microbial α-1,3-glucan binds an Enterobacter species and cockroach allergen. Neonatal, but not adult, mice immunized with this α-1,3-glucan-bearing Enterobacter (MK7) are protected against cockroach allergy. Following exposure to cockroach allergen, α-1,3-glucan-specific IgA-secreting cells are present in the lungs of mice immunized with MK7 as neonates, but not in the lungs of those immunized as adults. Mice that are unable to generate anti-α-1,3-glucan IgA antibodies were immunized with MK7 as neonates and were no longer protected against cockroach allergy. Thus, neonatal, but not adult, exposure to α-1,3-glucan results in suppressed development of cockroach allergy via pulmonary α-1,3-glucan-specific IgA-secreting cells. PMID:27581173
Liu, Zi-Jun; Wang, Ya-Lan; Li, Qi-Ling; Yang, Liu
2018-01-01
Cuscuta chinensis polysaccharide (CPS) was extracted using hot water and enzymatically hydrolyzed C. chinensis polysaccharide (ECPS) was produced by the mannase enzymatic hydrolysis process. The purpose of this research was to investigate the antimelanogenic activity of ECPS and CPS in B16F10 melanoma cells. The in vitro antioxidant activity was assessed by their ferric iron reducing power and DPPH free radical scavenging activities. The molecular mass distribution of polysaccharides was determined using SEC-MALLS-RI. CPS was successfully enzymatically degraded using mannase and the weighted average molecular weights of CPS and ECPS were 434.6 kDa and 211.7 kDa. The results of biological activity assays suggested that the enzymatically hydrolyzed polysaccharide had superior antimelanogenic activity and antioxidant effect than the original polysaccharide. ECPS exhibited antimelanogenic activity by down-regulating the expression of tyrosinase, MITF, and TRP-1 without cytotoxic effects in B16F10 melanoma cells. In conclusion, ECPS have the potential to become a skin whitening product.
NASA Technical Reports Server (NTRS)
Nakamura, Yukiko; Wakabayashi, Kazuyuki; Hoson, Takayuki
2003-01-01
The present study was conducted to investigate the mechanism inducing the difference in the cell wall extensibility of rice (Oryza sativa L. cv. Koshihikari) coleoptiles grown under various temperature (10-50 degrees C) conditions. The growth rate and the cell wall extensibility of rice coleoptiles exhibited the maximum value at 30-40 degrees C, and became smaller as the growth temperature rose or dropped from this temperature range. The amounts of cell wall polysaccharides per unit length of coleoptile increased in coleoptiles grown at 40 degrees C, but not at other temperature conditions. On the other hand, the molecular size of hemicellulosic polysaccharides was small at temperatures where the cell wall extensibility was high (30-40 degrees C). The autolytic activities of cell walls obtained from coleoptiles grown at 30 and 40 degrees C were substantially higher than those grown at 10, 20 and 50 degrees C. Furthermore, the activities of (1-->3),(1-->4)-beta-glucanases extracted from coleoptile cell walls showed a similar tendency. When oat (1-->3),(1-->4)-beta-glucans with high molecular mass were incubated with the cell wall enzyme preparations from coleoptiles grown at various temperature conditions, the extensive molecular mass downshifts were brought about only by the cell wall enzymes obtained from coleoptiles grown at 30-40 degrees C. There were close correlations between the cell wall extensibility and the molecular mass of hemicellulosic polysaccharides or the activity of beta -glucanases. These results suggest that the environmental temperature regulates the cell wall extensibility of rice coleoptiles by modifying mainly the molecular mass of hemicellulosic polysaccharides. Modulation of the activity of beta-glucanases under various temperature conditions may be involved in the alteration of the molecular size of hemicellulosic polysaccharides.
Zhang, Jianjun; Meng, Guangyuan; Zhai, Guoyin; Yang, Yongheng; Zhao, Huajie; Jia, Le
2016-01-01
To contribute toward effective exploitation and utilization of spent mushroom compost (SMC) of Ganoderma lucidum (SMC-G), a water-soluble polysaccharide of GPS was extracted, and then two fractions (GPS-1 and GPS-2) were purified from SMC-G. The optimum conditions for GPS extraction were optimized by the central composite design (CCD) and the GPS yield reached 3.84% at a ratio of water to material of 34.5, a precipitation time of 19.82h, and pH of 7.88. Characteristic analysis showed that GPS-1 and GPS-2 were heteropolysaccharides, and had glycosidic structures (OH, CH, CO and COC). Both GPS and its fractions showed potential antioxidant activities by scavenging hydroxyl and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals, and increasing the reducing power in vitro; and by improving the CAT activities, and lowing the LPO and MDA contents in vivo, respectively. The results provided a reference for the exploitation of SMC-G which would be significant to sustainable development of industry and agriculture, environmental protection and full utilization of resources. Copyright © 2015 Elsevier B.V. All rights reserved.
Aditya, Jessika; Lewis, John; Shirley, Neil J; Tan, Hwei-Ting; Henderson, Marilyn; Fincher, Geoffrey B; Burton, Rachel A; Mather, Diane E; Tucker, Matthew R
2015-07-01
Heterodera avenae (cereal cyst nematode, CCN) infects the roots of barley (Hordeum vulgare) forming syncytial feeding sites. In resistant host plants, relatively few females develop to maturity. Little is known about the physiological and biochemical changes induced during CCN infection. Responses to CCN infection were investigated in resistant (Rha2) and susceptible barley cultivars through histological, compositional and transcriptional analysis. Two phases were identified that influence CCN viability, including feeding site establishment and subsequent cyst maturation. Syncytial development progressed faster in the resistant cultivar Chebec than in the susceptible cultivar Skiff, and was accompanied by changes in cell wall polysaccharide abundance, particularly (1,3;1,4)-β-glucan. Transcriptional profiling identified several glycosyl transferase genes, including CELLULOSE SYNTHASE-LIKE F10 (HvCslF10), which may contribute to differences in polysaccharide abundance between resistant and susceptible cultivars. In barley, Rha2-mediated CCN resistance drives rapid deterioration of CCN feeding sites, specific changes in cell wall-related transcript abundance and changes in cell wall composition. During H. avenae infection, (1,3;1,4)-β-glucan may influence CCN feeding site development by limiting solute flow, similar to (1,3)-β-glucan during dicot cyst nematode infections. Dynamic transcriptional changes in uncharacterized HvCslF genes, possibly involved in (1,3;1,4)-β-glucan synthesis, suggest a role for these genes in the CCN infection process. © 2015 The University of Adelaide. New Phytologist © 2015 New Phytologist Trust.
Enzymatic degradation of cell wall and related plant polysaccharides.
Ward, O P; Moo-Young, M
1989-01-01
Polysaccharides such as starch, cellulose and other glucans, pectins, xylans, mannans, and fructans are present as major structural and storage materials in plants. These constituents may be degraded and modified by endogenous enzymes during plant growth and development. In plant pathogenesis by microorganisms, extracellular enzymes secreted by infected strains play a major role in plant tissue degradation and invasion of the host. Many of these polysaccharide-degrading enzymes are also produced by microorganisms widely used in industrial enzyme production. Most commerical enzyme preparations contain an array of secondary activities in addition to the one or two principal components which have standardized activities. In the processing of unpurified carbohydrate materials such as cereals, fruits, and tubers, these secondary enzyme activities offer major potential for improving process efficiency. Use of more defined combinations of industrial polysaccharases should allow final control of existing enzyme processes and should also lead to the development of novel enzymatic applications.
Martínez-Lapuente, Leticia; Apolinar-Valiente, Rafael; Guadalupe, Zenaida; Ayestarán, Belén; Pérez-Magariño, Silvia; Williams, Pascale; Doco, Thierry
2018-01-01
Verdejo and Tempranillo are traditional varieties for producing still wines; however, they could provide an alternative for the manufacturing of sparkling wines. Sparkling wines were elaborated by the traditional method, followed by ageing on lees for 9 months. A study on the changes that take place in polysaccharides, oligosaccharides and nitrogenous compounds during the ageing on lees of Tempranillo and Verdejo sparkling wines has been undertaken. Mannoproteins and the glucose residue of oligosaccharides were the major carbohydrates detected in all vinification stages. Yeast polysaccharides and glucan-like structures of the oligosaccharides increased after 3 months of ageing. The evolution of yeast polysaccharides and the composition of PRAG-like structure were different among grape varieties. A decrease in amino acids and biogenic amines was observed during the ageing. The contents of polysaccharides, oligosaccharides and nitrogenous compound were significantly higher in Tempranillo than in Verdejo sparkling wines at the end of the ageing period. Polysaccharides and oligosaccharides from yeast were more significant autolysis markers of sparkling wines than the nitrogenous compounds. Our data suggest a potential cultivar effect on the evolution of yeast polysaccharides and on the composition of PRAG, which may influence the physico-chemical and sensory properties of sparkling wines. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh
2017-12-05
Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Zhu, Dan-Ye; Ma, Yi-Long; Wang, Cai-Hong; Wang, Hao; Ren, Ya-Fei; Zhang, Jian-Guo; Thakur, Kiran; Wei, Zhao-Jun
2017-12-01
Onion polysaccharides (ACLP) were sequentially extracted with four different solvents (hot buffer, chelating agent, dilute alkaline and concentrated alkaline) and obtained four fractions, named as HBSS, CHSS, DASS and CASS, respectively. The present studies characterized the ACLP concerning its physicochemical and functional properties. Monosaccharides analysis revealed that mannose (81.68%) was the dominant sugar in HBSS and galactose (67.59%) was the most in CASS. Similarly, CHSS and DASS possessed mannose and galactose as major sugar, which were 25.80% and 31.37%, 20.33% and 33.96%, respectively. The obtained molecular weight of ACLPs were 7.702×10 3 (HBSS), 4.690×10 3 (CHSS), 4.943×10 3 (DASS) and 1.390×10 3 kDa (CASS). CASS resulted in the strongest solubility, fat-binding capacity, foam capacity and foam stability whereas, HBSS showed the highest thermal stability. DASS showed the best hygroscopicity and the best moisture retention was obtained by CHSS. Subsequently, the emulsifying activity and emulsifying stability were the highest for HBSS and the longest for of CASS, respectively. The rheological properties of CHSS exhibited the largest viscosity. Our results indicated that all factions could be considered as functional polysaccharides according to their respective characteristics, which have vast potential in food production. Copyright © 2017 Elsevier B.V. All rights reserved.
Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter
2017-01-01
Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast). PMID:28726737
Yang, Xiumei; Yang, Yu; Zhao, Gan; Wang, Bin; Wu, Daocheng
2018-01-01
A safe and effective vaccine adjuvant is important in modern vaccines. Various Chinese herbal polysaccharides can activate the immune system. Cistanche deserticola (CD) is a traditional Chinese herb and an adjuvant candidate. Here, we confirmed that water-extractable polysaccharides of CD (WPCD) could modulate immune responses in vitro and in vivo. In a dose-dependent manner, WPCD significantly promoted the maturation and function of murine marrow-derived dendritic cells (BM-DCs) through up-regulating the expression levels of MHC-II, CD86, CD80, and CD40, allogenic T cell proliferation, and the yields of IL-12 and TNF-α via toll-like receptor4 (TLR4), as indicated by in vitro experiments. In addition, its immunomodulatory activity was also observed in mice. WPCD effectively improved the titers of IgG, IgG1 and IgG2a and markedly enhanced the proliferation of T and B cells, the production of IFN-γ and IL-4 in CD4+ T cells and the expression level of IFN-γ in CD8+ T cells better than Alum. Furthermore, WPCD could markedly up-regulate the expression levels of CD40 and CD80 on DCs in spleen and down-regulate the Treg frequency. The study suggests that polysaccharides of Cistanche deserticola are a safe and effective vaccine adjuvant for eliciting both humoral immunity and cellular immunity by activating DCs via TLR4 signaling pathway. PMID:29360858
Zhang, Qisen; Zhang, Xiaoqi; Pettolino, Filomena; Zhou, Gaofeng; Li, Chengdao
2016-02-01
Barley (Hordeum vulgare L.) seed germination initiates many important biological processes such as DNA, membrane and mitochondrial repairs. However, little is known on cell wall modifications in germinating embryos. We have investigated cell wall polysaccharide composition change, gene transcription and alternative splicing events in four barley varieties at 24h and 48 h germination. Cell wall components in germinating barley embryos changed rapidly, with increases in cellulose and (1,3)(1,4)-β-D-glucan (20-100%) within 24h, but decreases in heteroxylan and arabinan (3-50%). There were also significant changes in the levels of type I arabinogalactans and heteromannans. Alternative splicing played very important roles in cell wall modifications. At least 22 cell wall transcripts were detected to undergo either alternative 3' splicing, alternative 5' splicing or intron retention type of alternative splicing. These genes coded enzymes catalyzing synthesis and degradation of cellulose, heteroxylan, (1,3)(1,4)-β-D-glucan and other cell wall polymers. Furthermore, transcriptional regulation also played very important roles in cell wall modifications. Transcript levels of primary wall cellulase synthase, heteroxylan synthesizing and nucleotide sugar inter-conversion genes were very high in germinating embryos. At least 50 cell wall genes changed transcript levels significantly. Expression patterns of many cell wall genes coincided with changes in polysaccharide composition. Our data showed that cell wall polysaccharide metabolism was very active in germinating barley embryos, which was regulated at both transcriptional and post-transcriptional levels. Copyright © 2015 Elsevier GmbH. All rights reserved.
Deters, Alexandra; Zippel, Janina; Hellenbrand, Nils; Pappai, Dirk; Possemeyer, Cathleen; Hensel, Andreas
2010-01-08
Aqueous extracts from the roots of Althea officinalis L. (Malvaceae) are widely used for treatment of irritated mucosa. The clinical proven effects are related to the presence of bioadhesive and mucilaginous polysaccharides from the rhamnogalacturonan type, leading to the physical formation of mucin-like on top of the irritated tissues. No data are available if the extracts or the polysaccharides from these extract exert an active influence on mucosal or connective tissue cells, in order to initiated changes in cell physiology, useful for better tissue regeneration. In vitro investigations of aqueous A. officinalis extract AE and raw polysaccharides (RPS) on epithelial KB cells and primary dermal human fibroblasts (pNHF) using WST1 vitality test and BrdU proliferation ELISA. Gene expression analysis by microarray from KB cells. Internalisation studies of polysaccharides were performed by laser scanning microscopy. AE (1, 10 microg/mL) had stimulating effect on cell viability and proliferation of epithelial KB cells. RPS (1, 10 microg/mL) stimulated cell vitality of epithelial cells significantly without triggering the cells into higher proliferation status. Neither AE nor RPS had any effect on fibroblasts. FITC-labeled RPS was shown to be internalised into epithelial cells, but not into fibroblasts. FITC-RPS was shown to form bioadhesive layers on the cell surface of dermal fibroblasts. Microarray analysis indicated an up-regulation of genes related to cell adhesion proteins, growth regulators, extracellular matrix, cytokine release and apoptosis. Aqueous extracts and polysaccharides from the roots of A. officinalis are effective stimulators of cell physiology of epithelial cells which can prove the traditional use of Marshmallow preparations for treatment of irritated mucous membranes within tissue regeneration. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Algamune™ is a commercial feed additive derived from Euglena gracilis, providing a rich source of the ß-1,3-glucan paramylon. Isolated kidney phagocytes of Nile tilapia were incubated with graded doses (0, 8, 16, 32, 64, and 128 µg mL-1) of Algamune™ and purified ß-1,3-glucan paramylon to gauge the...
Zhang, Yun; Ma, Fanyi; Zhu, Jinhua; Du, Zuliang; Zhao, Ying-Yong; Liu, Xiuhua
2017-01-01
Dioscorea opposita Thunb is the famous food and traditional medicine in China and it was rich in polysaccharides. Polysaccharides of Dioscorea Opposita Thunb possess immunoregulatory activity, free radical scavenging activity and anti-diabetic activity. A novel polysaccharide- iron(III) complex (CYPIC) was synthesized by using crude polysaccharide extracted from Dioscorea opposita Thunb. The component, structure, morphology and molecular weights of CYPIC were analysed, and the anti-anemia, acute toxicity and nonspecific immune regulating activities of CYPIC were assayed. The results showed that CYPIC could increase red blood cell count (RBC), hemoglobin (Hb), hematocrit (HCT), thymus and spleen index of mice with iron deficiency anemia (IDA). Although the structure and deeper mechanisms of CYPIC should be further studied, CYPIC has the potential to be used as an iron supplement for the treatment of iron deficiency anemia. The large scale industrial production was suggested due to the simple preparation processing of CYPIC. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
da Silva, Daiany Priscilla Bueno; Florentino, Iziara Ferreira; da Silva Moreira, Lorrane Kelle; Brito, Adriane Ferreira; Carvalho, Verônica Vale; Rodrigues, Marcella Ferreira; Vasconcelos, Géssica Adriana; Vaz, Boniek Gontijo; Pereira-Junior, Marcus Antônio; Fernandes, Kátia Flávia; Costa, Elson Alves
2018-03-01
-inflammatory effect. Furthermore, CGE (150mg/kg, p.o.) presented an antihyperalgic effect at all hours of the carrageenan-induced hyperalgesia test. However, this dose of CGE was not able to reduce the hyperalgesia induced by PGE 2 , suggesting that the anti-inflammatory effect of this extract depends on the reduction in the PGE 2 levels. The anacardic acids are the predominant phytoconstituents identified in the CGE. The action mechanisms of CGE suggest the reduction in the PGE 2 levels. These findings support the use of cashew gum in popular medicine and demonstrate that part of its antinociceptive and anti-inflammatory effects should also be attributed to the presence of anacardic acids in its composition, independent of the presence of polysaccharides. Copyright © 2017 Elsevier B.V. All rights reserved.
Yang, Pengjie; Zhou, Mingda; Zhou, Chengyun; Wang, Qian; Zhang, Fangfang; Chen, Jian
2015-02-01
A novel method to separate and purify tea seed polysaccharide and tea seed saponin from camellia cake extract by macroporous resin was developed. Among four kinds of resins (AB-8, NKA-9, XDA-6, and D4020) tested, AB-8 macroporous resin possessed optimal separating capacity for the two substances and thus was selected for the separation, in which deionized water was used to elute tea seed polysaccharide, 0.25% NaOH solution to remove the undesired pigments, and 90% ethanol to elute tea seed saponin. Further dynamic adsorption/desorption experiments on AB-8 resin-based column chromatography were conducted to obtain the optimal parameters. Under optimal dynamic adsorption and desorption conditions, 18.7 and 11.8% yield of tea seed polysaccharide and tea seed saponin were obtained with purities of 89.2 and 96.0%, respectively. The developed method provides a potential approach for the large-scale production of tea seed polysaccharide and tea seed saponin from camellia cake. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yoo, Sang-Hun; Chang, Yoon Hyuk
2017-01-01
The purposes of this study were to produce polysaccharides from red pepper stems using different extraction methods and evaluate their chemical composition, in vitro biological capacities, and rheological properties. Two polysaccharides were extracted from red pepper stems using an autoclave and alkali treatments, and the extracts were named PAU and PAL, respectively. The contents of total phenolics and flavonoids were significantly higher in PAU than those in PAL. PAU exhibited greater scavenging activities on 2,2-diphenyl-1-picrylhydrazyl radicals, 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt radicals, superoxide radicals, and nitrite compared to PAL, suggesting that PAU served as better antioxidants. Similarly, in vitro inhibitory abilities against carbohydrate hydrolyzing enzymes of PAU were higher than those of PAL. Steady shear rheological analysis demonstrated that PAU showed higher psuedoplastic shear-thinning behavior compared to PAL. Based on the results from dynamic shear rheological properties, it was found that both samples had predominantly viscous behavior rather than elastic behavior. PMID:29043221
Yoo, Sang-Hun; Chang, Yoon Hyuk
2017-09-01
The purposes of this study were to produce polysaccharides from red pepper stems using different extraction methods and evaluate their chemical composition, in vitro biological capacities, and rheological properties. Two polysaccharides were extracted from red pepper stems using an autoclave and alkali treatments, and the extracts were named PAU and PAL, respectively. The contents of total phenolics and flavonoids were significantly higher in PAU than those in PAL. PAU exhibited greater scavenging activities on 2,2-diphenyl-1-picrylhydrazyl radicals, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt radicals, superoxide radicals, and nitrite compared to PAL, suggesting that PAU served as better antioxidants. Similarly, in vitro inhibitory abilities against carbohydrate hydrolyzing enzymes of PAU were higher than those of PAL. Steady shear rheological analysis demonstrated that PAU showed higher psuedoplastic shear-thinning behavior compared to PAL. Based on the results from dynamic shear rheological properties, it was found that both samples had predominantly viscous behavior rather than elastic behavior.
Pawar, Harshal Ashok; Gavasane, Amit Jagannath; Choudhary, Pritam Dinesh
2018-08-01
The objective of the present work was to isolate and characterize polysaccharide from fruits of Cordia dichotoma G. Forst. (Family Boraginaceae). Polysaccharide was isolated by using 1% Hydrochloric acid solution. The isolated polysaccharide was tested for physicochemical characteristics such as solubility, pH (1% w/w in water), swelling capacity, loss on drying, ash value, bulk and tapped density, Carr's capacity, Hausner's ratio and angle of repose. Also isolated polysaccharide was characterized by Differential scanning colorimeter (DSC), Estimation of total sugar content, Rheological study and infrared spectroscopy (FT-IR). The isolated mucilage showed positive results for Molisch's test and negative for Ruthenium red test which indicated presence of carbohydrate and gum. The result of physicochemical characteristics reveals that isolated Cordia dichotoma polysaccharide possesses good flow properties. The total polysaccharide content of Cordia dichotoma polymer isolate was found to be 86.24% (w/w). From this study it can be concluded that the polysaccharide isolated from Cordia dichotoma fruits has the required properties and could be used as an excipient for pharmaceutical dosage forms. Copyright © 2018 Elsevier B.V. All rights reserved.
Hussein, Usama K; Mahmoud, Hamada M; Farrag, Asmaa G; Bishayee, Anupam
2015-11-01
Hepatocellular carcinoma (HCC) is one of the common cancers and lethal diseases worldwide. Both oxidative stress and chronic inflammation contribute to the pathogenesis of HCC. Because of limited treatment options and a grave prognosis of HCC, preventive management has been emphasized. The marine macroalgae Ulva lactuca (Ulvaceae) is consumed by humans and livestock because of its nutritional value. Recent studies showed that various extracts of U. lactuca possess antiviral, antiplasmodial, antinephrotoxic, antioxidant, and anti-inflammatory properties. However, very limited information is available on anticancer potential of U. lactuca with no reports on liver cancer chemopreventive efficacy of this marine algae. Accordingly, the present study was initiated to evaluate the possible antihepatocarcinogenic effects and antioxidant mechanisms of action of various U. lactuca extracts against a clinically relevant rodent model of HCC. Initiation of hepatocarcinogenesis was performed in Sprague-Dawley rats by a single injection of dietary carcinogen diethylnitrosamine (DENA, 200 mg/kg, intraperitoneally), followed by promotion with phenobarbital (0.05%) in drinking water. The rats were fed with daily oral dose (50 mg/kg) of polysaccharide sulfate or aqueous extract of U. lactuca for 2, 12, and 24 weeks. At these timepoints, blood samples were taken to measure hepatic injury markers, including alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, γ-glutamyl transferase, and bilirubin. The liver tissue was harvested for measurement of hepatic oxidative indices, including lipid peroxidation, reduced glutathione, nitric oxide, catalase, superoxide dismutase, glutathione reductase, and glutathione S-transferase. Hepatic histopathology, immunohistochemical analysis of cell proliferation and apoptosis by DNA fragmentation assay were performed. Our results clearly indicate that sulfated polysaccharides of U. lactuca exert a marked chemoprevention of DENA
Wang, Huizhu; Li, Yan; Ren, Zhihui; Cong, Zhongcheng; Chen, Mengjie; Shi, Lin; Han, Xu; Pei, Jin
2018-06-01
An extraction assay applying microwave-assisted enzymatic treatment for polysaccharides in Rosa roxburghii was developed using response surface methodology. The process parameters were optimized using Plackett-Burman (PB) design and central composite design to enhance the Rosa roxburghii polysaccharide extraction yield. Specific conditions (microwave power, 575W; microwave time, 18min; liquid-to-material ratio, 13.5:1mL/g; and enzyme dose, 6.5g/mL) generated an experimental yield of 36.21±0.62%, which closely agreed with the predicted value of 35.75%. Purification with a DEAE-52 cellulose column generated two fractions, PR-1 (from 6.2×10 3 to 7.4KDa) and PR-2 (from 559.8 to 106.6KDa). Subsequently, the antioxidant activity and α-d-glucosidase inhibitory activity of the two polysaccharide fractions were assessed; PR-1 exhibited stronger antioxidant activity and α-d-glucosidase inhibitory activity than PR-2. Finally, the monosaccharide composition of PR-1 was determined by HPLC using a 1-phenyl-3-methyl-5-pyrazolone precolumn derivatization method. The result showed that PR-1 contained mannose, ribose, rhamnose, glucosamine hydrochloride, glucuronic acid, galacturonic acid, glucose, galactose, arabinose and fucose with molar percentages of 2.1%, 0.54%, 2.1%, 0.26%, 1.5%, 22.7%, 24.0%, 26.4%, 19.6% and 0.89%, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.
Liu, Feng; Liu, Wenhui; Tian, Shuge
2014-09-01
A combination of an orthogonal L16(4)4 test design and a three-layer artificial neural network (ANN) model was applied to optimize polysaccharides from Althaea rosea seeds extracted by hot water method. The highest optimal experimental yield of A. rosea seed polysaccharides (ARSPs) of 59.85 mg/g was obtained using three extraction numbers, 113 min extraction time, 60.0% ethanol concentration, and 1:41 solid-liquid ratio. Under these optimized conditions, the ARSP experimental yield was very close to the predicted yield of 60.07 mg/g and was higher than the orthogonal test results (40.86 mg/g). Structural characterizations were conducted using physicochemical property and FTIR analysis. In addition, the study of ARSP antioxidant activity demonstrated that polysaccharides exhibited high superoxide dismutase activity, strong reducing power, and positive scavenging activity on superoxide anion, hydroxyl radical, 2,2-diphenyl-1-picrylhydrazyl, and reducing power. Our results indicated that ANNs were efficient quantitative tools for predicting the total ARSP content. Copyright © 2014 Elsevier B.V. All rights reserved.
Prospecting for Energy-Rich Renewable Raw Materials: Agave Leaf Case Study.
Corbin, Kendall R; Byrt, Caitlin S; Bauer, Stefan; DeBolt, Seth; Chambers, Don; Holtum, Joseph A M; Karem, Ghazwan; Henderson, Marilyn; Lahnstein, Jelle; Beahan, Cherie T; Bacic, Antony; Fincher, Geoffrey B; Betts, Natalie S; Burton, Rachel A
2015-01-01
Plant biomass from different species is heterogeneous, and this diversity in composition can be mined to identify materials of value to fuel and chemical industries. Agave produces high yields of energy-rich biomass, and the sugar-rich stem tissue has traditionally been used to make alcoholic beverages. Here, the compositions of Agave americana and Agave tequilana leaves are determined, particularly in the context of bioethanol production. Agave leaf cell wall polysaccharide content was characterized by linkage analysis, non-cellulosic polysaccharides such as pectins were observed by immuno-microscopy, and leaf juice composition was determined by liquid chromatography. Agave leaves are fruit-like--rich in moisture, soluble sugars and pectin. The dry leaf fiber was composed of crystalline cellulose (47-50% w/w) and non-cellulosic polysaccharides (16-22% w/w), and whole leaves were low in lignin (9-13% w/w). Of the dry mass of whole Agave leaves, 85-95% consisted of soluble sugars, cellulose, non-cellulosic polysaccharides, lignin, acetate, protein and minerals. Juice pressed from the Agave leaves accounted for 69% of the fresh weight and was rich in glucose and fructose. Hydrolysis of the fructan oligosaccharides doubled the amount of fermentable fructose in A. tequilana leaf juice samples and the concentration of fermentable hexose sugars was 41-48 g/L. In agricultural production systems such as the tequila making, Agave leaves are discarded as waste. Theoretically, up to 4000 L/ha/yr of bioethanol could be produced from juice extracted from waste Agave leaves. Using standard Saccharomyces cerevisiae strains to ferment Agave juice, we observed ethanol yields that were 66% of the theoretical yields. These data indicate that Agave could rival currently used bioethanol feedstocks, particularly if the fermentation organisms and conditions were adapted to suit Agave leaf composition.
Prospecting for Energy-Rich Renewable Raw Materials: Agave Leaf Case Study
Corbin, Kendall R.; Byrt, Caitlin S.; Bauer, Stefan; DeBolt, Seth; Chambers, Don; Holtum, Joseph A. M.; Karem, Ghazwan; Henderson, Marilyn; Lahnstein, Jelle; Beahan, Cherie T.; Bacic, Antony; Fincher, Geoffrey B.; Betts, Natalie S.; Burton, Rachel A.
2015-01-01
Plant biomass from different species is heterogeneous, and this diversity in composition can be mined to identify materials of value to fuel and chemical industries. Agave produces high yields of energy-rich biomass, and the sugar-rich stem tissue has traditionally been used to make alcoholic beverages. Here, the compositions of Agave americana and Agave tequilana leaves are determined, particularly in the context of bioethanol production. Agave leaf cell wall polysaccharide content was characterized by linkage analysis, non-cellulosic polysaccharides such as pectins were observed by immuno-microscopy, and leaf juice composition was determined by liquid chromatography. Agave leaves are fruit-like—rich in moisture, soluble sugars and pectin. The dry leaf fiber was composed of crystalline cellulose (47–50% w/w) and non-cellulosic polysaccharides (16–22% w/w), and whole leaves were low in lignin (9–13% w/w). Of the dry mass of whole Agave leaves, 85–95% consisted of soluble sugars, cellulose, non-cellulosic polysaccharides, lignin, acetate, protein and minerals. Juice pressed from the Agave leaves accounted for 69% of the fresh weight and was rich in glucose and fructose. Hydrolysis of the fructan oligosaccharides doubled the amount of fermentable fructose in A. tequilana leaf juice samples and the concentration of fermentable hexose sugars was 41–48 g/L. In agricultural production systems such as the tequila making, Agave leaves are discarded as waste. Theoretically, up to 4000 L/ha/yr of bioethanol could be produced from juice extracted from waste Agave leaves. Using standard Saccharomyces cerevisiae strains to ferment Agave juice, we observed ethanol yields that were 66% of the theoretical yields. These data indicate that Agave could rival currently used bioethanol feedstocks, particularly if the fermentation organisms and conditions were adapted to suit Agave leaf composition. PMID:26305101
Characterization of β-Glucan Recognition Site on C-Type Lectin, Dectin 1
Adachi, Yoshiyuki; Ishii, Takashi; Ikeda, Yoshihiko; Hoshino, Akiyoshi; Tamura, Hiroshi; Aketagawa, Jun; Tanaka, Shigenori; Ohno, Naohito
2004-01-01
Dectin 1 is a mammalian cell surface receptor for (1→3)-β-d-glucans. Since (1→3)-β-d-glucans are commonly present on fungal cell walls, it has been suggested that dectin 1 is important for recognizing fungal invasion. In this study we tried to deduce the amino acid residues in dectin 1 responsible for β-glucan recognition. HEK293 cells transfected with mouse dectin 1 cDNA could bind to a gel-forming (1→3)-β-d-glucan, schizophyllan (SPG). The binding of SPG to a dectin 1 transfectant was inhibited by pretreatment with other β-glucans having a (1→3)-β-d-glucosyl linkage but not by pretreatment with α-glucans. Dectin 1 has a carbohydrate recognition domain (CRD) consisting of six cysteine residues that are highly conserved in C-type lectins. We prepared 32 point mutants with mutations in the CRD and analyzed their binding to SPG. Mutations at Trp221 and His223 resulted in decreased binding to β-glucan. Monoclonal antibody 4B2, a dectin- 1 monoclonal antibody which had a blocking effect on the β-glucan interaction, completely failed to bind the dectin-1 mutant W221A. A mutant with mutations in Trp221 and His223 did not have a collaborative effect on Toll-like receptor 2-mediated cellular activation in response to zymosan. These amino acid residues are distinct from residues in other sugar-recognizing peptide sequences of typical C-type lectins. These results suggest that the amino acid sequence W221-I222-H223 is critical for formation of a β-glucan binding site in the CRD of dectin 1. PMID:15213161
Pukrop, J R; Brennan, K M; Funnell, B J; Schoonmaker, J P
2018-06-23
A two-part experiment was conducted to determine the effects of a blend of specialized mannan rich and glucan rich fractions of yeast (Select-TC, Alltech Inc.) on the health status and performance of steers during the first two months of the feedlot period. Eighty crossbred steers were acquired from commercial sale barns in Mississippi and Georgia, and transported to Purdue University. All animals were fed a corn silage based receiving diet, and were checked and treated daily for respiratory disease as needed following established treatment protocols. In Exp. 1, 64 steers (246.5 ± 4.7 kg initial weight) were blocked by body weight (BW) and randomly allocated to 2 treatments to determine the impact of supplementation of a hydrolyzed mannan and glucan rich yeast fraction for 56 d on BW, average daily gain (ADG), daily dry matter intake (DMI), and gain:feed: hydrolyzed yeast fed at 13 g (as-fed)/steer daily (TC) or non-supplemented control (CON). Steers in Exp. 1 were housed in bedded pens with 2 animals/pen (n = 16 pens [32 steers]/treatment). In Exp. 2, 16 steers (247.1 ± 5.4 kg initial BW) were similarly allotted to two treatments (CON and TC), individually penned, and subjected to a lipopolysaccharide (LPS) endotoxin challenge on d 62 or 63 after the start of the study to determine the animal's response to an inflammatory agent. Serum samples and rectal temperatures were taken every half an hour from -2 to 8 h relative to LPS injection from steers in Exp. 2. Data were analyzed as a complete randomized block design using the MIXED procedure of SAS. Morbidity for both experiments did not differ (P ≥ 0.16). Weight, ADG, DMI and gain:feed, did not differ among treatments (P ≥ 0.32) in Exp. 1. After the LPS infusion in Exp. 2, rectal temperatures (P = 0.03) and serum non-esterified fatty acid (NEFA) concentration (P = 0.04) were decreased in TC compared to CON steers. Concentrations of blood urea nitrogen (P = 0.31), glucose (P = 0.70), insulin (P = 0.57) and
Buckeridge; Vergara; Carpita
1999-08-01
We examined the mechanism of synthesis in vitro of (1-->3), (1-->4)beta-D-glucan (beta-glucan), a growth-specific cell wall polysaccharide found in grasses and cereals. beta-Glucan is composed primarily of cellotriosyl and cellotetraosyl units linked by single (1-->3)beta-linkages. The ratio of cellotriosyl and cellotetraosyl units in the native polymer is strictly controlled at between 2 and 3 in all grasses, whereas the ratios of these units in beta-glucan formed in vitro vary from 1.5 with 5 &mgr;M UDP-glucose (Glc) to over 11 with 30 mM substrate. These results support a model in which three sites of glycosyl transfer occur within the synthase complex to produce the cellobiosyl-(1-->3)-D-glucosyl units. We propose that failure to fill one of the sites results in the iterative addition of one or more cellobiosyl units to produce the longer cellodextrin units in the polymer. Variations in the UDP-Glc concentration in excised maize (Zea mays) coleoptiles did not result in wide variations in the ratios of cellotriosyl and cellotetraosyl units in beta-glucan synthesized in vivo, indicating that other factors control delivery of UDP-Glc to the synthase. In maize sucrose synthase is enriched in Golgi membranes and plasma membranes and may be involved in the control of substrate delivery to beta-glucan synthase and cellulose synthase.
Yoshida, Mia; Hida, Toshie H; Takeshita, Kazuo; Tsuboi, Masamichi; Kanamori, Masato; Akachi, Natsuko; Miura, Noriko N; Adachi, Yoshiyuki; Ohno, Naohito
2012-01-01
Fungal β-glucan is a representative pathogen-associated microbial pattern (PAMP) from mushroom, yeast, and fungi, and stimulates innate as well as acquired immune systems. It is a widely used functional food to enhance immunity. Such plant extracts have been known as folk medicines and reported to show various biological activities beneficial to human health, such as anti-tumor, anti-allergic, and anti-inflammatory activities. In the present study, the cooperative effect of bamboo water-soluble methanol precipitation (BWMP), a macromolecular fraction of the hot-water extract of Sasa veitchii (Japanese folk medicine Kumazasa), and the β-glucan from the medicinal mushroom Sparassis crispa (SCG) was analyzed in vitro using DBA/2 mice. The splenocytes from male DBA/2 mice were cultured with BWMP in the presence of SCG, and the responses were assessed by measuring cytokines. BWMP suppressed IFN-γ and GM-CSF production by SCG, but not TNF-α production. To analyze the specificity of the reaction, similar experiments were conducted with BWMP in the presence of bacterial lipopolysaccharide (LPS); however, none of the cytokines were inhibited. Cytokine production of splenocytes by SCG was suggested to be largely dependent on the binding of lymphocytes with dendritic cells. Functions of BWMP were also analyzed by mixed lymphocyte reaction, and IFN-γ production was suppressed. These findings suggested that BWMP modulated the cell-to-cell contact induced by SCG and inhibited cytokine production. It is strongly suggested that the plant extracts modulate the immunostimulating effects of medicinal mushrooms. Cooperative effects of plants and mushrooms would be an important issue for functional foods.
A method suitable for DNA extraction from humus-rich soil.
Miao, Tianjin; Gao, Song; Jiang, Shengwei; Kan, Guoshi; Liu, Pengju; Wu, Xianming; An, Yingfeng; Yao, Shuo
2014-11-01
A rapid and convenient method for extracting DNA from soil is presented. Soil DNA is extracted by direct cell lysis in the presence of EDTA, SDS, phenol, chloroform and isoamyl alcohol (3-methyl-1-butanol) followed by precipitation with 2-propanol. The extracted DNA is purified by modified DNA purification kit and DNA gel extraction kit. With this method, DNA extracted from humus-rich dark brown forest soil was free from humic substances and, therefore, could be used for efficient PCR amplification and restriction digestion. In contrast, DNA sample extracted with the traditional CTAB-based method had lower yield and purity, and no DNA could be extracted from the same soil sample with a commonly-used commercial soil DNA isolation kit. In addition, this method is time-saving and convenient, providing an efficient choice especially for DNA extraction from humus-rich soils.
Hassan, Sherif M; Byrd, James A; Cartwright, Aubry L; Bailey, Chris A
2010-10-01
Hemolytic and antibacterial activities of eight serial concentrations ranged from 5-666 microg/mL of saponin-rich extracts from guar meal (GM), quillaja, yucca, and soybean were tested in 96-well plates and read by enzyme-linked immunosorbent assay plate-well as 650 nm. Hemolytic assay used a 1% suspension of chicken red blood cells with water and phosphate buffered saline as positive and negative controls, respectively. Antibacterial activity against Staphylococcus aureus, Salmonella typhimurium, and Escherichia coli were evaluated using ampicillin and bacteria without saponin-rich extract as positive and negative controls, respectively. The 100% MeOH GM and commercial quillaja saponin-rich extracts were significantly the highest in both hemolytic and antibacterial activities against all bacteria at the same concentration tested. Soybean saponin-rich extract had no antibacterial activity against any of the bacteria at the concentrations tested while yucca saponin-rich extract had no antibacterial activity against the gram-negative bacteria at the concentrations tested. GM and quillaja saponin-rich extracts were hemolytic, while yucca and soybean saponin-rich extracts were not hemolytic at the concentrations tested. No saponin-rich extract source had antibacterial activity against S. typhimurium or E. coli at the concentrations tested. Both GM and quillaja saponin-rich extracts exhibited antibacterial activity against S. aureus. Saponin-rich extracts from different plant sources have different hemolytic and antibacterial activities.
Cai, Ming; Lin, Yang; Luo, Yin-long; Liang, Han-hua; Sun, Pei-long
2015-01-01
In this study, crude polysaccharides of culinary-medicinal mushroom Auricularia auricular-judae were extracted by hot water extraction and alcohol precipitation, and their antimicrobial and antioxidant activities were investigated. An optimum extraction condition was obtained at a ratio of liquid to solid 70 mL/g, temperature 90°C, time 4 h and extraction number 4. Accordingly, the best yield of crude polysaccharides was 6.89% with 76.12% in purity. Some bacteria and fungi were used for antimicrobial studies. It was found that crude A. auricula-judae had great antimicrobial activities against Escherichia coli and Staphylococcus aureus, but no activities on the others. The inhibitory diameters of antimicrobial zones for the two were 5.55 ± 0.182 and 9.84 ± 0.076 mm, respectively. Moreover, crude A. auricula-judae had significant antioxidant activities in scavenging free radicals, reducing power assays, and Fe2+ chelating ability assay. Results revealed that crude A. auricula-judae has a great potential as antimicrobial and antioxidant, and it can be a supplementary food for human health.
Yamamoto, Fernando Y; Yin, Fei; Rossi, Waldemar; Hume, Michael; Gatlin, Delbert M
2018-06-01
To reduce susceptibility to stressors and diseases, immune-modulators such as β-glucans have been proven effective tools to enhance the innate immune responses of fish. Consequently, commercial sources of this polysaccharide are becoming increasingly more available. Algamune™ is a commercial additive produced from Euglena gracilis, as a source of linear β-1,3-glucan. In order to evaluate the immunomodulatory effects of this β-glucan product, the present study assessed the innate immune parameters of red drum (Sciaenops ocellatus) exposed to Algamune™ ex vivo and in vivo. Isolated kidney phagocytes were incubated with graded concentrations (0, 0.2, 0.4, 0.8, 1.6 and 3.2 mg L -1 ) of dried Euglena gracilis (Algamune™) as well as purified Paramylon (linear β-1,3 glucan). Increased bactericidal activity against Streptococcus iniae, and production of intracellular O 2 - anion superoxide were stimulated by both β-glucan sources. A reduced activity of extracellular anion superoxide was observed by the phagocytes incubated with Algamune ™. After corroborating the effectiveness of the glucan source ex vivo, a feeding trial was conducted using red drum juveniles (∼26.6 g initial weight). Fish were fed diets with graded levels of Algamune™ (0, 100, 200, 400 and 800 mg kg -1 ) twice daily for 21 days. No significant differences were detected regarding production performance parameters. At the end of the feeding trial, blood, intestinal content, and kidney were sampled. Intestinal microbiota from fecal material was analyzed through denaturing gradient gel electrophoresis (DGGE) and found to be similar among all treatments. No significant differences were detected for oxidative radical production from whole blood, and isolated phagocytes, and plasma lysozyme activity. However, the total hemolytic activity of red drum plasma was increased in fish fed 100 and 200 mg kg -1 of dietary Algamune™ when compared to fish fed the basal diet. Based on
Differential effects of THC- or CBD-rich cannabis extracts on working memory in rats.
Fadda, Paola; Robinson, Lianne; Fratta, Walter; Pertwee, Roger G; Riedel, Gernot
2004-12-01
Cannabinoid receptors in the brain (CB(1)) take part in modulation of learning, and are particularly important for working and short-term memory. Here, we employed a delayed-matching-to-place (DMTP) task in the open-field water maze and examined the effects of cannabis plant extracts rich in either Delta(9)-tetrahydrocannabinol (Delta(9)-THC), or rich in cannabidiol (CBD), on spatial working and short-term memory formation in rats. Delta(9)-THC-rich extracts impaired performance in the memory trial (trial 2) of the DMTP task in a dose-dependent but delay-independent manner. Deficits appeared at doses of 2 or 5 mg/kg (i.p.) at both 30 s and 4 h delays and were similar in severity compared with synthetic Delta(9)-THC. Despite considerable amounts of Delta(9)-THC present, CBD-rich extracts had no effect on spatial working/short-term memory, even at doses of up to 50 mg/kg. When given concomitantly, CBD-rich extracts did not reverse memory deficits of the additional Delta(9)-THC-rich extract. CBD-rich extracts also did not alter Delta(9)-THC-rich extract-induced catalepsy as revealed by the bar test. It appears that spatial working/short-term memory is not sensitive to CBD-rich extracts and that potentiation and antagonism of Delta(9)-THC-induced spatial memory deficits is dependent on the ratio between CBD and Delta(9)-THC.
Brandi, Jamile; Oliveira, Éder C; Monteiro, Nilson; Vasconcelos, Ana Flora D; Dekker, Robert F H; Barbosa, Aneli M; Silveira, Joana L M; Mourão, Paulo A S; Corradi da Silva, Maria de Lourdes
2011-10-01
The exopolysaccharide botryosphaeran (EPS(GLC); a (1--> 3)(1-->6)-β-D-glucan from Botryosphaeria rhodina MAMB- 05) was sulfonated to produce a water-soluble fraction (EPS(GLC)-S) using pyridine and chlorosulfonic acid in formamid. This procedure was then repeated twice to produce another fraction (EPSGLC-RS) with a higher degree of substitution (DS, 1.64). The purity of each botryosphaeran sample (unsulfonated and sulfonated) was assessed by gel filtration chromatography (Sepharose CL-4B), where each polysaccharide was eluted as a single symmetrical peak. The structures of the sulfonated and re-sulfonated botryosphaerans were investigated using ultraviolet-visible (UV-Vis), Fourier-transform infrared (FT-IR), and (13)C nuclear magnetic resonance ((13)C NMR) spectroscopies. EPS(GLC) and EPS(GLC)-RS were also assayed for anticoagulation activity, and EPS(GLC)-RS was identified as an anticoagulant.
Haemolytic and Antimicrobial Activites of Saponin-Rich Extracts from Guar Meal
USDA-ARS?s Scientific Manuscript database
Saponin-rich GM extract was prepared by refluxing 25 g of GM with 250 ml of EtOH/H2O (1:1, v/v) for 3 h then filtering and distilling EtOH at 50oC. The refluxed extract was partitioned with equal volume of BuOH obtaining crude saponin-rich GM extract with 4.8 ± 0.6% DM of GM that was purified by RP...
Antunes, Sílvia; Freitas, Filomena; Alves, Vítor D; Grandfils, Christian; Reis, Maria A M
2015-09-20
Cheese whey was used as the sole substrate for the production of extracellular polysaccharides (EPS) by Enterobacter A47. An EPS concentration of 6.40 g L(-1) was reached within 3.2 days of cultivation, corresponding to a volumetric productivity of 2.00 g L(-1) d(-1). The produced EPS was mainly composed of glucuronic acid (29 mol%) and fucose (29 mol%), with lower contents of glucose and galactose (21 mol% each) and a total acyl groups content of 32 wt.%. The polymer had an average molecular weight of 1.8×10(6) Da, with a polydispersity index of 1.2, and an intrinsic viscosity of 8.0 dL g(-1). EPS aqueous solutions (1.0 wt.% in 0.01 M NaCl, at pH 8.0) presented a shear thinning behavior with a viscosity of the first Newtonian plateau approaching 0.1 Pas. This novel glucuronic acid-rich polymer possesses interesting rheological properties, which, together with its high content of glucuronic acid and fucose, two bioactive sugar monomers, confers it a great potential for use in high-value applications, such as cosmetics and pharmaceuticals. Copyright © 2015 Elsevier B.V. All rights reserved.
Barrasa, J. M.; Gutiérrez, A.; Escaso, V.; Guillén, F.; Martínez, M. J.; Martínez, A. T.
1998-01-01
The ligninolytic fungus Pleurotus eryngii grown in liquid medium secreted extracellular polysaccharide (87% glucose) and the H2O2-producing enzyme aryl-alcohol oxidase (AAO). The production of both was stimulated by wheat-straw. Polyclonal antibodies against purified AAO were obtained, and a complex of glucanase and colloidal gold was prepared. With these tools, the localization of AAO and extracellular glucan in mycelium from liquid medium and straw degraded under solid-state fermentation conditions was investigated by transmission electron microscopy (TEM) and fluorescence microscopy. These studies revealed that P. eryngii produces a hyphal sheath consisting of a thin glucan layer. This sheath appeared to be involved in both mycelial adhesion to the straw cell wall during degradation and AAO immobilization on hyphal surfaces, with the latter evidenced by double labeling. AAO distribution during differential degradation of straw tissues was observed by immunofluorescence microscopy. Finally, TEM immunogold studies confirmed that AAO penetrates the plant cell wall during P. eryngii degradation of wheat straw. PMID:9435085
Linzer, R; Slade, H D
1976-02-01
An anti-glucosyltransferase serum, which synthesized 96% insoluble glucans, was prepared against a purified enzyme preparation from Streptococcus mutans strain HS6 (serotype a). This serum was examined for its effects on glucan synthesis by crude enzyme preparations from eight strains (four serotypes) of S. mutans and for the ability of these preparations to promote adherence of S. mutans to a smooth surface. Glucosyltransferase activity was assayed by measuring the incorporation of glucose from [14C]glucose-labeled sucrose into water-insoluble and water-soluble (ethanol-insoluble) glucans. Anti-glucosyltransferase serum inhibited insoluble glucan synthesis by crude enzyme preparations from cells of the four serotypes of S. mutans. Enzymes from strains of types a, b, and d were inhibited between 70 to 90%; enzymes from type c strains were inhibited from 45 to 60%. The adherence to a glass surface of heat-killed cells from these four serotypes was likewise inhibited. Soluble glucan synthesis was not inhibited by the serum, and in some cases its synthesis increased as insoluble glucan synthesis decreased.
Nguyen, An Thi-Binh; Nigen, Michaël; Jimenez, Luciana; Ait-Abderrahim, Hassina; Marchesseau, Sylvie; Picart-Palmade, Laetitia
2018-01-15
Dextran or xanthan were used as model exocellular polysaccharides (EPS) to compare the extraction efficiency of EPS from skim milk acid gels using three different protocols. Extraction yields, residual protein concentrations and the macromolecular properties of extracted EPS were determined. For both model EPS, the highest extraction yield (∼80%) was obtained when samples were heated in acidic conditions at the first step of extraction (Protocol 1). Protocols that contained steps of acid/ethanol precipitation without heating (Protocols 2 and 3) show lower extraction yields (∼55%) but allow a better preservation of the EPS macromolecular properties. Changing the pH of acid gels up to 7 before extraction (Protocol 3) improved the extraction yield of anionic EPS without effect on the macromolecular properties of EPS. Protocol 1 was then applied for the quantification of EPS produced during the yogurt fermentation, while Protocol 3 was dedicated to their macromolecular characterization. Copyright © 2017 Elsevier Ltd. All rights reserved.
Xue, Hongxia; Gan, Fang; Zhang, Zheqian; Hu, Junfa; Chen, Xingxiang; Huang, Kehe
2015-11-01
Porcine circovirus type 2 (PCV2) is the primary causative agent of porcine circovirus-associated disease (PCVAD). Astragalus polysaccharide (APS), as one kind of biological macromolecule extracted from Astragalus, has antiviral activities. This study was undertaken to explore the effect of APS on PCV2 replication in vitro and the underlying mechanisms. Our results showed that adding APS before PCV2 infection decreased significantly PCV2 DNA copies, the number of infected cells, MDA level, ROS level and NF-κB activation in PK15 cells and increased significantly GSH contents and SOD activity compared to control without APS. Oxidative stress induced by BSO could eliminate the effect of PCV2 replication inhibition by APS. LPS, as a NF-κB activator, could attenuate the effect of PCV2 replication inhibition by APS. BAY 11-7082, as a NF-κB inhibitor, could increase the effect of PCV2 replication inhibition by APS. In conclusion, APS inhibits PCV2 replication by decreasing oxidative stress and the activation of NF-κB signaling pathway, which suggests that APS might be employed for the prevention of PCV2 infection. Copyright © 2015 Elsevier B.V. All rights reserved.
Binding of glucosyltransferase and glucan synthesis by Streptococcus mutans and other bacteria.
Hamada, S; Tai, S; Slade, H D
1978-07-01
Lyophilized and heat-treated cells from the seven serotypes of Streptococcus mutans were examined for their ability to bind added insoluble-product glucosyl-transferase (GTase) and to synthesize cell-associated glucan from [(14)C]sucrose. Lyophilized cells of serotypes a and g did not synthesize any more additional glucan than did the controls after exposure to GTase. These cells, however, synthesized four- to eightfold-greater quantities of glucan than did the cells of the remaining serotypes. Lyophilized cells of serotypes b, c, d, e, and f synthesized two- to threefold-greater quantities of glucan after exposure to GTase than did the controls without added enzyme. Lyophilized cells of serotypes a and g synthesized 6- to 10-fold-greater quantities of glucan than did heat-treated cells of the same strain after binding of GTase. Lyophilized cells of the remaining serotypes synthesized only 1.6- to 3.3-fold-greater quantities of glucan than did the heat-treated cells. These results demonstrate that heat treatment to inactivate cell-associated GTase does not create additional GTase binding sites in S. mutans and that serotypes a and g are considerably more active in cell-associated glucan synthesis than cells of the other five serotypes. Ten species of gram-positive and gram-negative bacteria from five genera which do not produce in vitro plaque synthesized 10- to 100-fold-less glucan than did the S. mutans strains after exposure to GTase. Of these species, S. sanguis, Actinomyces viscosus, and A. naeslundii synthesized the largest quantities of glucan. Three mutant strains of S. mutans which possess a reduced ability for in vitro adherence but do agglutinate with glucan or dextran synthesized only one-third as much glucan after binding of GTase as the control. These results are discussed in relation to in vitro and in vivo plaque development and the agglutination of S. mutans. The results support earlier findings which indicate that the presence of bacterial species
Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.
2016-03-22
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E
2013-07-23
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E
2014-04-08
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Kim, Kui-Jin; Lee, Ok-Hwan; Han, Chan-Kyu; Kim, Young-Chan; Hong, Hee-Do
2012-01-01
Obesity is associated with a broad spectrum of cardio-metabolic disturbances, including atherosclerosis and cardiovascular disease (CDV). A high-fat diet has been shown to cause an elevation of the plasma cholesterol levels in humans, and the control of serum cholesterol has been demonstrated to be important in the prevention of CVD and atherosclerosis. The aims of this study were to demonstrate that crude and acidic polysaccharide extracts from Gastrodia rhizomes suppress atherosclerosis through the regulation of serum lipids in Sprague Dawley (SD) rats fed a high-fat diet. We examined the concentrations of serum lipids, including total cholesterol, triglycerides, high-density lipoproteins (HDL) cholesterol, and low-density lipoproteins (LDL) cholesterol, in SD rats fed a high-fat diet and evaluated the atherogenic index. Here, we show that both crude and acidic polysaccharide extracts from Gastrodia rhizomes inhibited the total cholesterol and LDL levels. Moreover, there was a significantly suppressed atherosclerosis risk due to the acidic polysaccharide extract from Gastrodia rhizome. Taken together, our results suggested that acidic polysaccharide extracts from Gastrodia rhizomes might be beneficial for lowering the incidence of CVD and atherosclerosis by reducing the de novo synthesis of total cholesterol and the LDL levels. PMID:22408412
Kim, Kui-Jin; Lee, Ok-Hwan; Han, Chan-Kyu; Kim, Young-Chan; Hong, Hee-Do
2012-01-01
Obesity is associated with a broad spectrum of cardio-metabolic disturbances, including atherosclerosis and cardiovascular disease (CDV). A high-fat diet has been shown to cause an elevation of the plasma cholesterol levels in humans, and the control of serum cholesterol has been demonstrated to be important in the prevention of CVD and atherosclerosis. The aims of this study were to demonstrate that crude and acidic polysaccharide extracts from Gastrodia rhizomes suppress atherosclerosis through the regulation of serum lipids in Sprague Dawley (SD) rats fed a high-fat diet. We examined the concentrations of serum lipids, including total cholesterol, triglycerides, high-density lipoproteins (HDL) cholesterol, and low-density lipoproteins (LDL) cholesterol, in SD rats fed a high-fat diet and evaluated the atherogenic index. Here, we show that both crude and acidic polysaccharide extracts from Gastrodia rhizomes inhibited the total cholesterol and LDL levels. Moreover, there was a significantly suppressed atherosclerosis risk due to the acidic polysaccharide extract from Gastrodia rhizome. Taken together, our results suggested that acidic polysaccharide extracts from Gastrodia rhizomes might be beneficial for lowering the incidence of CVD and atherosclerosis by reducing the de novo synthesis of total cholesterol and the LDL levels.
Park, Jong-Seok; Lim, Youn-Mook; Baik, Jae; Jeong, Jin-Oh; An, Sung-Jun; Jeong, Sung-In; Gwon, Hui-Jeong; Khil, Myung-Seob
2018-06-14
β-Glucan can provide excellent environment to apply to drug carrier due to its immunological and anti-inflammatory effect. Minocycline hydrochloride (MH) has excellent oral bioavailability pharmacological properties. Specifically, MH is effectively absorbed into the gingiva for periodontal disease treatment. In this study, we attempt to develop MH loaded β-glucan hydrogel for periodontal disease treatment through radiation-crosslinking technique. In addition, MH loaded β-glucan hydrogels were tested for their cytotoxicity and antibacterial activity. Finally, we conducted an in vivo study to demonstrate the potential to prevent the invasion of bacteria to treat periodontal disease. The gel content and compressive strength of the β-glucan hydrogels increased as the β-glucan content and the absorbed dose (up to 7 kGy) increased. For a radiation dose of 7 kGy, the gelation and the compressive strength of a 6 wt% β-glucan hydrogel were approximately 92% and 270 kPa, respectively. As a drug, MH was consistently released from β-glucan hydrogels, reaching 80% at approximately 90 min. Furthermore, the MH loaded β-glucan hydrogels showed no cytotoxicity. The MH loaded β-glucan hydrogels exhibited good antibacterial activity against Porphyromonas gingivalis. In addition, MH loaded β-glucan hydrogel demonstrated the potential of a good capability to prevent the invasion of bacteria and to treat wounds. Copyright © 2017. Published by Elsevier B.V.
Hirabayashi, Katsuki; Kondo, Nobuhiro; Hayashi, Sachio
2016-12-01
The chemical structure of hydrothermally treated β-1,3-1,6-glucan from Aureobasidium pullulans was characterized using techniques such as gas chromatography/mass spectrometry (GC/MS) and nuclear magnetic resonance (NMR). The chemical shifts of anomeric carbons observed in the 13 C-NMR spectra suggested the presence of single flexible chains of polysaccharide in the sample. β-1,3-1,6-Glucan from A. pullulans became water-soluble, with an average molecular weight of 128,000 Da after hydrothermal treatment, and the solubility in water was approximately 10% (w/w). Sample (3% w/v) was completely hydrolyzed to glucose by enzymatic reaction with Lysing enzymes from Trichoderma harzianum. Gentiobiose (Glcβ1 → 6Glc) and glucose were released as products during the reaction, and the maximum yield of gentiobiose was approximately 70% (w/w). The molar ratio of gentiobiose to glucose after 1 h reaction suggested that the sample is likely highly branched. Sample (3% w/v) was also hydrolyzed to glucose by Uskizyme from Trichoderma sp., indicating that it is very sensitive to enzymatic hydrolysis.
Wang, Tuo; Hong, Mei
2016-01-01
Until recently, the 3D architecture of plant cell walls was poorly understood due to the lack of high-resolution techniques for characterizing the molecular structure, dynamics, and intermolecular interactions of the wall polysaccharides in these insoluble biomolecular mixtures. We introduced multidimensional solid-state NMR (SSNMR) spectroscopy, coupled with (13)C labelling of whole plants, to determine the spatial arrangements of macromolecules in near-native plant cell walls. Here we review key evidence from 2D and 3D correlation NMR spectra that show relatively few cellulose-hemicellulose cross peaks but many cellulose-pectin cross peaks, indicating that cellulose microfibrils are not extensively coated by hemicellulose and all three major polysaccharides exist in a single network rather than two separate networks as previously proposed. The number of glucan chains in the primary-wall cellulose microfibrils has been under active debate recently. We show detailed analysis of quantitative (13)C SSNMR spectra of cellulose in various wild-type (WT) and mutant Arabidopsis and Brachypodium primary cell walls, which consistently indicate that primary-wall cellulose microfibrils contain at least 24 glucan chains. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Ma, Huiying; Zhang, Keke; Jiang, Qing; Dai, Diya; Li, Hongli; Bi, Wentao; Chen, David Da Yong
2018-04-27
Plant polysaccharides have numerous medicinal functions. Due to the differences in their origins, regions of production, and cultivation conditions, the quality and the functions of polysaccharides can vary significantly. They are macromolecules with large molecular weight (MW) and complex structure, and pose great challenge for the analytical technology used. Taking Dendrobium officinale (DO) from various origins and locations as model samples. In this investigation, mechanochemical extraction method was used to successfully extract polysaccharides from DO using water as solvent, the process is simple, fast (40 s) and with high yield. The MWs of the intact saccharides from calibration curve and light scattering measurement were determined and compared after separation with size exclusion chromatography (SEC). The large polysaccharide was acid hydrolyzed to oligosaccharides and the products were efficiently separated and identified using liquid chromatography coupled to a high resolution tandem mass spectrometry (LC-MS 2 ). Obvious differences were observed among LC-MS 2 chromatograms of digested products, and the chemical structures for the products were proposed based on accurate mass values. More importantly, isomeric digested carbohydrate compounds were explored and characterized. All the chromatographic and mass spectrometric results in this study provided a multi-dimensional characterization, fingerprint analysis, and molecular structure level assessment of plant polysaccharides. Copyright © 2018 Elsevier B.V. All rights reserved.
Majee, Sujay Kumar; Ray, Sayani; Ghosh, Kanika; Micard, Valérie; Ray, Bimalendu
2015-04-01
Red peppers, Capsicum annuum, are used worldwide as spices, foods and medicines. Herein, we have analyzed an antiradical polysaccharide isolated from red peppers through successive acetate buffer extraction. This macromolecule was purified using graded precipitation with ethanol, α-amylase treatment, deproteination and anion-exchange chromatography. This highly-branched polysaccharide (360 kDa) was esterified with phenolic acids and contained a (1,3)-linked-β-Galp chain substituted at O-6 by (1,6)-linked-β-Galp residues. The latter was substituted at O-3 by (1,5)- and (1,3,5)-linked-α-Araf residues, and non-reducing end-units of α-Araf and β-Galp. The antiradical potential of this polysaccharide was comparable to standard antioxidants. The phenolic acid residues were the functional sites. This polysaccharide could form complex with bovine serum albumin having binding constant K = 5.24 × 10(6)/M and change its microenvironment. Thus, aqueous extraction method provides a macromolecule that stimulates biological responses; this emphasizes the significance of red pepper as dietary antioxidant. Copyright © 2015 Elsevier B.V. All rights reserved.
Rajalakshmi, Manikkam; Anita, Roy
2016-01-05
The use of herbal supplements either as extracts or plant-derived individual molecules has significantly increased in the process of drug discovery and development for their potential efficacy or reduced risk in treating human disorders. Tinospora cordifolia (T. cordifolia) is a widely used herbal source to treat various human ailments, including diabetes mellitus. The present study was aimed on evaluating the antidiabetic property of a novel polysaccharide isolated from the methanolic extract of T. cordifolia stem. Bioassay guided fractionation was followed to isolate a compound from the methanol extract. The compound was administered orally at a dose of 20 mg/kg.b.wt for 60 days to control and STZ-induced diabetic male Wistar rats. It was found that plasma glucose was significantly (p < 0.05) reduced compared to normal. Oral administration of the compound significantly decreased HBA1c, triglycerides and total cholesterol and at the same time markedly increased hemoglobin, tissue glycogen and HDL cholesterol. Also the compounds restored the altered carbohydrate metabolizing enzymes, insulin, C-peptide, (14)C-glucose oxidation levels to near normal. In addition, the histological studies revealed that there was regeneration of β-cells in the pancreatic sections. The expression of Glut-4 mRNA and protein in the gasrtocnemius muscle were significantly enhanced after the compound treatment. These results confirm that the novel polysaccharide possesses hypoglycemic, glucose oxidizing, hypolipidemic and β-cell regenerative properties and hence it could be developed into potential oral hypoglycemic drug with lesser side effects. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Giese, Ellen C; Gascon, Jacob; Anzelmo, Gianluca; Barbosa, Aneli M; da Cunha, Mário A Alves; Dekker, Robert F H
2015-01-01
β-D-Glucans are known to present antitumor, anticancer, and anti-inflammatory activities that are influenced by their own antioxidant capacity. The antioxidant activity of botryosphaeran, an exopolysaccharide of the (1 → 3;1 → 6)-β-D-glucan type produced by the Botryosphaeria rhodina MAMB-05 was evaluated and compared to some other β-D-glucans (lasiodiplodan an exocellular (1 → 6)-β-D-glucan from Lasiodiplodia theobromae, laminarin and curdlan), and oligosaccharides, disaccharides, and monosaccharides in a study of scavenging activities of free radicals in-vitro. Botryosphaeran displayed high total antioxidant activity (80%) as well as good scavenging activity against hydroxyl radical (90.6%), superoxide anion (37%), hydrogen peroxide (38%), and nitric oxide radical (90%). No reducing power, metal-chelating capacity or inhibition of lipid peroxidation was observed for these β-D-glucans. The results demonstrated that botryosphaeran exhibited effective antioxidant activity as supported by many different assays, suggesting that this β-D-glucan may serve as a source of a new bioactive compound with effective antioxidant activity. Copyright © 2014 Elsevier B.V. All rights reserved.
McCann, Frances; Carmona, Eva; Puri, Vishwajeet; Pagano, Richard E.; Limper, Andrew H.
2005-01-01
Cell wall β-glucans are highly conserved structural components of fungi that potently trigger inflammatory responses in an infected host. Identification of molecular mechanisms responsible for internalization and signaling of fungal β-glucans should enhance our understanding of innate immune responses to fungi. In this study, we demonstrated that internalization of fungal β-glucan particles requires actin polymerization but not participation of components of caveolar uptake mechanisms. Using fluorescence microscopy, we observed that uptake of 5-([4,6-dichlorotriazin-2-yl] amino)-fluorescein hydrochloride-Celite complex-labeled Saccharomyces cerevisiae β-glucan by RAW macrophages was substantially reduced in the presence of cytochalasin D, which antagonizes actin-mediated internalization pathways, but not by treatment with nystatin, which blocks caveolar uptake. Interestingly, β-glucan-induced NF-κB translocation, which is necessary for inflammatory activation, and tumor necrosis factor alpha production were both normal in the presence of cytochalasin D, despite defective internalization of β-glucan particles following actin disruption. Dectin-1, a major β-glucan receptor on macrophages, colocalized to phagocytic cups on macrophages and exhibited tyrosine phosphorylation after challenge with β-glucan particles. Dectin-1 localization and other membrane markers were not affected by treatment with cytochalasin D. Furthermore, dectin-1 receptors rather than Toll-like receptor 2 receptors were shown to be necessary for both efficient internalization of β-glucan particles and cytokine release in response to the fungal cell wall component. PMID:16177305
Structural Mechanisms of Plant Glucan Phosphatases in Starch Metabolism
Meekins, David A.; Vander Kooi, Craig W.; Gentry, Matthew S.
2016-01-01
Glucan phosphatases are a recently discovered class of enzymes that dephosphorylate starch and glycogen, thereby regulating energy metabolism. Plant genomes encode for two glucan phosphatases called Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2) that regulate starch metabolism by selectively dephosphorylating glucose moieties within starch glucan chains. Recently, the structures of both SEX4 and LSF2 were determined, with and without phosphoglucan products bound, revealing the mechanism for their unique activities. This review explores the structural and enzymatic features of the plant glucan phosphatases and outlines how they are uniquely adapted for carrying out their cellular functions. We outline the physical mechanisms employed by SEX4 and LSF2 to interact with starch glucans: SEX4 binds glucan chains via a continuous glucan binding platform comprised of its Dual Specificity Phosphatase (DSP) domain and Carbohydrate Binding Module (CBM) while LSF2 utilizes Surface Binding Sites (SBSs). SEX4 and LSF2 both contain a unique network of aromatic residues in their catalytic DSP domains that serve as glucan engagement platforms and are unique to the glucan phosphatases. We also discuss the phosphoglucan substrate specificities inherent to SEX4 and LSF2 and outline structural features within the active site that govern glucan orientation. This review defines the structural mechanism of the plant glucan phosphatases with respect to phosphatases, starch metabolism, and protein-glucan interaction; thereby providing a framework for their applications in both agricultural and industrial settings. PMID:26934589
Zhang, Zhongshan; Wang, Xiaomei; Li, Jingfen; Wang, Guozhi; Mao, Genxiang
2016-03-01
In this study, the optimization of the extraction conditions of polysaccharide from 'Anji Baicha' (Camellia sinensis (L.) O. Kuntze) (AP) was investigated by response surface methodology (RSM). Three main independent variables (extraction temperature, time, ratio of water to raw material) were taken into consideration. And then the free radical scavenging activities of the sample were investigated including scavenging effects of superoxide and hydroxyl radicals. The RSM analysis showed good correspondence between experimental and predicted values.. The optimal condition to obtain the highest yield of AP was determined as follows: temperature 76.79 °C, time 2.48 h, ratio of water to material 22.53 mL/g. For the free radical scavenging activity, the IC50 values of Vc and AP were 7.78 and 83.25 μg/mL. And for the scavenging effect on hydroxyl radical, that of AP and Vc were 1.80 and 1.69 mg/mL. AP showed excellent antioxidant activity. This exhibited AP had a good potential for antioxidant. The purification and structure needs to be study in further. Copyright © 2015 Elsevier B.V. All rights reserved.
Oliveira, Rodrigo Juliano; Salles, Maria José Sparça; da Silva, Ariane Fernanda; Kanno, Tatiane Yumi Nakamura; Lourenço, Ana Carolina Dos Santos; Leite, Véssia da Silva; Matiazi, Hevenilton José; Pesarini, João Renato; Ribeiro, Lúcia Regina; Mantovani, Mário Sérgio
2013-09-01
Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1), cyclophosphamide (Group 2), Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.
Zhang, Mei; Zhu, Lin; Cui, Steve W; Wang, Qi; Zhou, Ting; Shen, Hengsheng
2011-01-01
Fractionation and purification of mushroom polysaccharides is a critical process for mushroom clinical application. After a hot-water treatment, the crude Pleurotus geesteranus (PG) was further fractionated into four fractions (PG-1, -2, -3, -4) using gradient precipitation with water and ammonia sulphate. By controlling the initial polymer concentration and ratio of solvents, this process produced PG fractions with high chemical uniformity and narrow Mw distribution without free proteins. Structurally, PG-1 and PG-2 are pure homopolysaccharide mainly composed of glucose; and PG-3 and PG-4 are heteropolysaccharide-protein complexes. PG-2, a high M(w) fraction mainly composed of glucose presented significant cytotoxicity at the concentration of 200 and 100 μg/ml to human breast cancer cells. Here, we report a new mushroom polysaccharides extraction and fractionation method, with which we produced four fractions of PG with PG-2 appearing effective anti-tumour activity. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Xu, Yaqin; Cai, Fei; Yu, Zeyuan; Zhang, Ling; Li, Xingguo; Yang, Yu; Liu, Gaijie
2016-03-01
Pressurised water extraction (PWE) of polysaccharides from blackcurrant fruits was investigated using a response surface methodology (RSM). The optimal conditions for PWE were: time 51min, pressure 1.6MPa, and temperature 52°C. Under these conditions, the experimental yield of Ribes nigrum L. polysaccharides (RNLP) was 11.68±0.12%, which closely agreed with the predicted value (11.77%). After preliminary purification with D4006 macroporous resin, RNLP I was obtained and its chemical characterisation was undertaken by GC, HPLC, and IR spectroscopy. RNLP I was composed of rhamnose, arabinose, xylose, mannose, galactose, and glucose with a molar ratio of 2.89:14.82:1.02:1.00:2.53:6.39 and its molecular weight was 1.49×10(4)kDa. The antioxidant activity of RNLP I was evaluated by free radical scavenging assays and a reducing power assay in vitro. RNLP I showed strong DPPH and superoxide radical scavenging activities and reducing power. Copyright © 2015 Elsevier Ltd. All rights reserved.
Plants with elevated levels of glucan
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pauly, Markus; Kraemer, Florian J.; Hake, Sarah
The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.
Nitschke, Jörg; Modick, Hendrik; Busch, Ekkehard; von Rekowski, Reimund Wantoch; Altenbach, Hans-Josef; Mölleken, Helga
2011-07-15
Mushroom β-glucans are known for their activity as biological response modifiers and anticarcinogenic agents. β-1,3-1,6 Branched glucans with a triple helix tertiary structure are recognised as the most potent ones. In the present work, a colorimetric method for β-1,3-1,6-glucan quantification based on the dye Congo red is introduced. This method is specific for β-glucans with a triple helix. The β-1,3-1,6-glucan content of mycelia and fruiting bodies from various mushrooms was determined and compared with the total β-1,3-glucan content, measured by a fluorimetric method. The results show equal amounts of β-1,3-1,6- and total β-1,3-glucans in the analysed species but obvious differences between mycelia and fruiting bodies. On the average, 3% of mycelia and 8% of fruiting body dry mass consist of β-1,3-1,6-glucans. The average percentage of β-1,3-1,6-glucans in the total β-1,3-glucan content differs between mycelia (46%) and fruiting bodies (87%). Copyright © 2011 Elsevier Ltd. All rights reserved.
Bhagwat, Arvind A.; Mithöfer, Axel; Pfeffer, Philip E.; Kraus, Christine; Spickers, Nicole; Hotchkiss, Arland; Ebel, Jürgen; Keister, Donald L.
1999-01-01
The cyclic β-(1→3),β-(1→6)-d-glucan synthesis locus of Bradyrhizobium japonicum is composed of at least two genes, ndvB and ndvC. Mutation in either gene affects glucan synthesis, as well as the ability of the bacterium to establish a successful symbiotic interaction with the legume host soybean (Glycine max). B. japonicum strain AB-14 (ndvB::Tn5) does not synthesize β-glucans, and strain AB-1 (ndvC::Tn5) synthesizes a cyclic β-glucan lacking β-(1→6)-glycosidic bonds. We determined that the structure of the glucan synthesized by strain AB-1 is cyclodecakis-(1→3)-β-d-glucosyl, a cyclic β-(1→3)-linked decasaccharide in which one of the residues is substituted in the 6 position with β-laminaribiose. Cyclodecakis-(1→3)-β-d-glucosyl did not suppress the fungal β-glucan-induced plant defense response in soybean cotyledons and had much lower affinity for the putative membrane receptor protein than cyclic β-(1→3),β-(1→6)-glucans produced by wild-type B. japonicum. This is consistent with the hypothesis presented previously that the wild-type cyclic β-glucans may function as suppressors of a host defense response. PMID:10069844
Braünlich, Paula Marie; Inngjerdingen, Kari Tvete; Inngjerdingen, Marit; Johnson, Quinton; Paulsen, Berit Smestad; Mabusela, Wilfred
2018-01-01
Artemisia afra (Jacq. Ex. Willd), is an indigenous plant in South Africa and other parts of the African continent, where it is used as traditional medicine mostly for respiratory conditions. The objective of this study was to investigate the structural features of the polysaccharides from the leaves of this plant, as well as the biological activities of the polysaccharide fractions against the complement assay. Leaves of Artemisia afra were extracted sequentially with organic solvents (dichloromethane and methanol), 50% aqueous ethanol, and water at 50 and 100°C respectively. The polysaccharide extracts were fractionated by ion exchange chromatography and the resulting fractions were tested for biological activity against the complement fixation assay. Active fractions were further fractionated using gel filtration. Monosaccharide compositions and linkage analyses were determined for the relevant fractions. Polysaccharides were shown to be of the pectin type, and largely contain arabinogalactan, rhamnogalacturonan and homogalacturonan structural features. The presence of arabinogalactan type II features as suggested by methylation analysis was further confirmed by the ready precipitation of the relevant polysaccharides with the Yariv reagent. An unusual feature of some of these polysaccharides was the presence of relatively high levels of xylose as one of its monosaccharide constituents. Purified polysaccharide fractions were shown to possess higher biological activity than the selected standard in the complement assay. Digestion of these polysaccharides with an endo-polygalacturonase enzyme resulted in polymers with lower molecular weights as expected, but still with biological activity which exceeded that of the standard. Thus on the basis of these studies it may be suggested that immunomodulating properties probably contribute significantly to the health-promoting effects of this medicinal plant. Copyright © 2017 Elsevier B.V. All rights reserved.
Effect of barley β-glucan addition as a fat replacer on muffin quality.
Onacik-Gür, Sylwia; Żbikowska, Anna; Kapler, Ewa; Kowalska, Hanna
2016-01-01
The aim of this study was to perform the partial replacement of bakery fat with barley β-glucan in muffins and to determine its effect on the physical properties of products. Most shortenings used in the industry are solid fats rich in saturated fatty acids and often trans fatty isomers, which are nutritionally unfavorable. Dough and baked muffins were used as the research material. Five muffin recipes were prepared: control (K0%) with 16% fat content in the total dough weight, with fat content decreased by 10% (PG10%), 15% (PG15%), 20% (PG20%) and 25% (PG25%). β-glucan was used as a fat replacer in the 1:4 ratio. The parameters determining the physical characteristics and sensory attributes were measured, compared and statistically analyzed using a principal component analysis (PCA) method. Although the partial replacement of shortening with barley β-glucan is possible, it may negatively influence the physical properties of dough (aeration) and baked products (volume, density). It has been observed that increasing the content of this fat replacer enlarges the pores of the crumb. The textural properties of muffins with a fat content decreased by 20% are most similar to the control. Moreover, it has been shown that the overall sensory quality goes down when the amount of fat replacer in the muffin recipe is increased. However, adding β-glucan to products in which fat content was decreased by 10% did not influence significantly the typical taste. Despite the adverse effect of β-glucan on the physical and sensorial properties, it was found to be reasonable to use it even in small amounts (up to 10%) to increase the nutritional value of products.
Raish, Mohammad
2017-04-01
The polysaccharide extract of Momordica charantia has various biological activities; however, its effect on endothelial dysfunction in myocardial infarction remains unclear. To elucidate this, myocardial infarction was induced in rats using isoproterenol (ISP). Pretreatment with M. charantia polysaccharides (MCP; 150 or 300mg/kg) for 25days significantly inhibited increases in heart weight, the heart-weight-to-body-weight ratio, and infarction size, and ameliorated the increased serum levels of aspartate transaminase, creatine kinase, lactate dehydrogenase, total cholesterol, triglycerides, very-low-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol. In addition, MCP enhanced the activity of superoxide dismutase, catalase, and non-protein sulfhydryls, and decreased the level of lipid peroxidation. Moreover, MCP pretreatment downregulated the expression of proinflammatory cytokines (tumor necrosis factor alpha, interleukin (IL)-6, and IL-10), inflammatory markers (nitric oxide, myeloperoxidase, and inducible nitric oxide synthase), and apoptotic markers (caspase-3 and BAX), and upregulated Bcl-2 expression. Pretreatment with MCP reduced myonecrosis, edema, and inflammatory cell infiltration, and restored cardiomyocytes architecture. This myocardial protective effect could be related to the enhancement of the antioxidant defense system through the nuclear factor kappa B (NF-kB) pathways, and to anti-apoptosis through regulation of Bax, caspase-3, and Bcl-2. Copyright © 2017 Elsevier B.V. All rights reserved.
Marine Polysaccharides in Pharmaceutical Applications: An Overview
Laurienzo, Paola
2010-01-01
The enormous variety of polysaccharides that can be extracted from marine plants and animal organisms or produced by marine bacteria means that the field of marine polysaccharides is constantly evolving. Recent advances in biological techniques allow high levels of polysaccharides of interest to be produced in vitro. Biotechnology is a powerful tool to obtain polysaccharides from a variety of micro-organisms, by controlling the growth conditions in a bioreactor while tailoring the production of biologically active compounds. Following an overview of the current knowledge on marine polysaccharides, with special attention to potential pharmaceutical applications and to more recent progress on the discovering of new polysaccharides with biological appealing characteristics, this review will focus on possible strategies for chemical or physical modification aimed to tailor the final properties of interest. PMID:20948899
Bortolussi, R; Ferrier, P
1980-04-01
The protective value of antibody to the K1 capsular polysaccharide antigen of Escherichia coli was investigated in a newborn rat model of E. coli K1 infection. Pregnant rats were immunized intravenously with E. coli, and the agglutinating titer to meningococcal group B polysaccharide, which is identical to K1 polysaccharide, was measured in the serum of rats and their offspring. Convalescent serum from rat mothers showed an increased antibody titer in animals injected twice but not once with E. coli K1. Although no agglutinating antibody was detected in the serum of rat pups, animals suckled by mothers having a meningococcal group B agglutinating titer of 1:8 or greater had reduced infection and mortality rates after intraperitoneal injection with E. coli K1 compared with animals suckled by mothers having a low titer of agglutinating antibody (P less than 0.05). In addition, greater protection could be conferred on rat sucklings by oral supplementation with a horse serum rich in antibody to meningococcal group B polysaccharide, suggesting that antibody was abosorbed from the gastrointestinal tract and by itself could be protective. These studies demonstrated that antibody to the capsular polysaccharide of E. coli K1 altered the severity of E. coli K1 infection. Final clearance of bacteria from the blood appeared to await the maturation of other host defense systems in the newborn rat.
Dutta, Sayantani; Bhattacharjee, Paramita
2015-07-01
Black pepper (Piper nigrum L.), the King of Spices is the most popular spice globally and its active ingredient, piperine, is reportedly known for its therapeutic potency. In this work, enzyme-assisted supercritical carbon dioxide (SC-CO2) extraction of black pepper oleoresin was investigated using α-amylase (from Bacillus licheniformis) for enhanced yield of piperine-rich extract possessing good combination of phytochemical properties. Optimization of the extraction parameters (without enzyme), mainly temperature and pressure, was conducted in both batch and continuous modes and the optimized conditions that provided the maximum yield of piperine was in the batch mode, with a sample size of 20 g of black pepper powder (particle diameter 0.42 ± 0.02 mm) at 60 °C and 300 bar at 2 L/min of CO2 flow. Studies on activity of α-amylase were conducted under these optimized conditions in both batch and continuous modes, with varying amounts of lyophilized enzyme (2 mg, 5 mg and 10 mg) and time of exposure of the enzyme to SC-CO2 (2.25 h and 4.25 h). The specific activity of the enzyme increased by 2.13 times when treated in the continuous mode than in the batch mode (1.25 times increase). The structural changes of the treated enzymes were studied by (1)H NMR analyses. In case of α-amylase assisted extractions of black pepper, both batch and continuous modes significantly increased the yields and phytochemical properties of piperine-rich extracts; with higher increase in batch mode than in continuous. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
A mini-review of chemical and biological properties of polysaccharides from Momordica charantia.
Zhang, Fan; Lin, Lihua; Xie, Jianhua
2016-11-01
Recently, isolation and characterization of bioactive polysaccharides from natural resources have attracted increasing interest. Momordica charantia L. (M. charantia), belongs to the Curcubitaceae family, which is widely distributed in the tropical and subtropical regions of the world, and has been used as herbal medicine and a vegetable for thousands of years. M. charantia polysaccharides, as major active ingredients of M. charantia, have attracted a great deal of attention because of their various biological activities, such as antitumor, immunomodulation, antioxidant, anti-diabetes, radioprotection, and hepatoprotection. The present review provides the most complete summary of the research progress on the polysaccharides isolated from M. charantia, including the extraction, separation, physical-chemical properties, structural characteristics, and bioactivities during the last ten years. This review also provides a foundation for the further development and application in the field of M. charantia polysaccharides. Copyright © 2016 Elsevier B.V. All rights reserved.
Nato, F; Mazie, J C; Fournier, J M; Slizewicz, B; Sagot, N; Guibourdenche, M; Postic, D; Riou, J Y
1991-01-01
Polyclonal and monoclonal antibodies against capsular polysaccharides of Neisseria meningitidis serogroups A, B, and C were produced in order to develop immunological reagents allowing both the detection of soluble antigens during meningococcal meningitis and antigenic serogrouping of N. meningitidis cultures. The performance characteristics of monoclonal and polyclonal antibody latex reagents were compared. For the detection of soluble polysaccharide antigen, polyclonal antibody latex reagent was selected for N. meningitidis A and C. The latex reagent prepared with polyclonal antibodies against N. meningitidis B could not detect capsular polysaccharide even at 1 mg/ml. The monoclonal antibody B latex reagent which detected 100 ng of polysaccharide per ml was therefore chosen. For the serogroup identification of N. meningitidis, the use of a confirmatory test results in an overall specificity of 100% with polyclonal or monoclonal antibody latex reagents. PMID:1909346
Mechanistic Insights into Glucan Phosphatase Activity against Polyglucan Substrates*
Meekins, David A.; Raththagala, Madushi; Auger, Kyle D.; Turner, Benjamin D.; Santelia, Diana; Kötting, Oliver; Gentry, Matthew S.; Vander Kooi, Craig W.
2015-01-01
Glucan phosphatases are central to the regulation of starch and glycogen metabolism. Plants contain two known glucan phosphatases, Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2), which dephosphorylate starch. Starch is water-insoluble and reversible phosphorylation solubilizes its outer surface allowing processive degradation. Vertebrates contain a single known glucan phosphatase, laforin, that dephosphorylates glycogen. In the absence of laforin, water-soluble glycogen becomes insoluble, leading to the neurodegenerative disorder Lafora Disease. Because of their essential role in starch and glycogen metabolism glucan phosphatases are of significant interest, yet a comparative analysis of their activities against diverse glucan substrates has not been established. We identify active site residues required for specific glucan dephosphorylation, defining a glucan phosphatase signature motif (CζAGΨGR) in the active site loop. We further explore the basis for phosphate position-specific activity of these enzymes and determine that their diverse phosphate position-specific activity is governed by the phosphatase domain. In addition, we find key differences in glucan phosphatase activity toward soluble and insoluble polyglucan substrates, resulting from the participation of ancillary glucan-binding domains. Together, these data provide fundamental insights into the specific activity of glucan phosphatases against diverse polyglucan substrates. PMID:26231210
Aerosolization of Particulate (1→3)-β-d-Glucan from Moldy Materials▿
Seo, Sung-Chul; Reponen, Tiina; Levin, Linda; Borchelt, Tiffany; Grinshpun, Sergey A.
2008-01-01
Mold-damaged building materials may contain biologically active agents, such as (1→3)-β-d-glucan, allergens, and mycotoxins, which have been associated with adverse health effects. The release of these components from contaminated surfaces into the air is not well understood. The purpose of this study was to characterize the release of particulate (1→3)-β-d-glucan from the surface of artificially mold-contaminated materials. Aspergillus versicolor and Stachybotrys chartarum were grown on malt extract agar (MEA), white ceiling tiles, and a wall-papered gypsum board for 1 and 6 months. The (1→3)-β-d-glucan on the surfaces of moldy materials and in air samples collected from these materials was analyzed by the Limulus amebocyte lysate assay. The aerosolization ratio was defined as the amount of (1→3)-β-d-glucan in the air divided by the amount on the surface. The results showed that the aerosolization of particulate (1→3)-β-d-glucan was influenced mainly by the type of material and the fungal species. For A. versicolor, the aerosolization ratios of particulate (1→3)-β-d-glucan released from the three types of material were not significantly different. However, the ratios for S. chartarum released from ceiling tiles and gypsum board were significantly higher than the ratios for this organism released from MEA (P < 0.001) and were comparable to those for A. versicolor. These findings indicate that the use of MEA in aerosolization experiments is likely to underestimate the release of S. chartarum particles from building materials. These results provide important background information for design of future laboratory or animal experiments, as well as for interpretation of field measurement data. PMID:18065630
Shah, Asima; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Gani, Adil; Masoodi, Farooq Ahmad; Wani, Idrees Ahmed; Wani, Sajad Mohd; Gani, Asir
2015-01-01
This paper reports the characterization and potential antioxidant activity of β-D-glucan isolated from barley treated with γ-rays. The β-D-glucan was irradiated with 0, 2, 4 and 8 kGy by gamma ray. The samples were characterized by Fourier transform-infrared spectroscopy, gel permeation chromatography (GPC) and quantitative estimation by Megazyme β-D-glucan assay kit. The average molecular weight of non-irradiated β-D-glucan was 177 kDa that decreased to 79 kDa at 8 kGy. Antioxidant activity was evaluated by five complementary assays including DPPH, lipid peroxidation, reducing power, metal chelating ability and oxidative DNA damage assays. Further, the antiproliferative potential of irradiated β-D-glucan was tested against three human cancer cell lines including Colo-205, T47D and MCF7 using MTT assay. Irradiated β-D-glucan exhibited dose dependent cancer cell growth inhibition. In conclusion, the present study demonstrates that irradiation leads to the formation of low molecular weight β-D-glucan with enhanced antioxidant and antiproliferative activities. Copyright © 2014 Elsevier B.V. All rights reserved.
Lipid oxidation induced oxidative degradation of cereal beta-glucan.
Wang, Yu-Jie; Mäkelä, Noora; Maina, Ndegwa Henry; Lampi, Anna-Maija; Sontag-Strohm, Tuula
2016-04-15
In food systems, lipid oxidation can cause oxidation of other molecules. This research for the first time investigated oxidative degradation of β-glucan induced by lipid oxidation using an oil-in-water emulsion system which simulated a multi-phased aqueous food system containing oil and β-glucan. Lipid oxidation was monitored using peroxide value and hexanal production while β-glucan degradation was evaluated by viscosity and molecular weight measurements. The study showed that while lipid oxidation proceeded, β-glucan degradation occurred. Emulsions containing β-glucan, oil and ferrous ion showed significant viscosity and molecular weight decrease after 1 week of oxidation at room temperature. Elevated temperature (40°C) enhanced the oxidation reactions causing higher viscosity drop. In addition, the presence of β-glucan appeared to retard the hexanal production in lipid oxidation. The study revealed that lipid oxidation may induce the degradation of β-glucan in aqueous food systems where β-glucan and lipids co-exist. Copyright © 2015 Elsevier Ltd. All rights reserved.
Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels
Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.
2014-01-01
Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cline, K.; Wade, M.; Albersheim, P.
1978-01-01
A ..beta..-glucan isolated from the mycelial walls of Phytophthora megasperma var. sojae and a glucan purified from yeast extract stimulate the accumulation of phytoalexins in red kidney bean, Phaseolus vulgaris, and stimulate the accumulation of the phytoalexin, rishitin, in potato tubers, Solanum tuberosum. Treatment of kidney bean cotyledons with the glucan elicitors resulted in the accumulation of at least five fungistatic compounds. These compounds migrate during thin layer chromatography identically to the fungistatic compounds which accumulate in kidney beans which have been inoculated with Colletotrichum lindemuthianum, a fungal pathogen of kidney beans. Potatoes accumulate as much as 29 micrograms ofmore » rishitin per gram fresh weight following exposure to the glucan from Phytophthora megasperma va. sojae and as much as 19.5 micrograms of rishitin per gram fresh weight following exposure to yeast glucan.« less
Pinilla, V; Luu, B
1999-08-01
The water-soluble crude extract prepared from Imperata cylindrica (Beauv.) was investigated for its immunomodulating activity. A set of polysaccharides with high molecular weights has been isolated by fractionation using gel filtration and anion-exchange chromatography. Each step of purification was monitored by bioassays. The presence of six monosaccharides has been established by chemical analysis. Quantitative analysis showed that the ratio of these monosaccharides differed from one polysaccharide to another. The crude extract as well as some of the purified polysaccharides enhance the proliferation of murine splenocytes.
Xylan extraction from pretreated sugarcane bagasse using alkaline and enzymatic approaches.
Sporck, Daniele; Reinoso, Felipe A M; Rencoret, Jorge; Gutiérrez, Ana; Del Rio, José C; Ferraz, André; Milagres, Adriane M F
2017-01-01
New biorefinery concepts are necessary to drive industrial use of lignocellulose biomass components. Xylan recovery before enzymatic hydrolysis of the glucan component is a way to add value to the hemicellulose fraction, which can be used in papermaking, pharmaceutical, and food industries. Hemicellulose removal can also facilitate subsequent cellulolytic glucan hydrolysis. Sugarcane bagasse was pretreated with an alkaline-sulfite chemithermomechanical process to facilitate subsequent extraction of xylan by enzymatic or alkaline procedures. Alkaline extraction methods yielded 53% (w/w) xylan recovery. The enzymatic approach provided a limited yield of 22% (w/w) but produced the xylan with the lowest contamination with lignin and glucan components. All extracted xylans presented arabinosyl side groups and absence of acetylation. 2D-NMR data suggested the presence of O -methyl-glucuronic acid and p -coumarates only in enzymatically extracted xylan. Xylans isolated using the enzymatic approach resulted in products with molecular weights (Mw) lower than 6 kDa. Higher Mw values were detected in the alkali-isolated xylans. Alkaline extraction of xylan provided a glucan-enriched solid readily hydrolysable with low cellulase loads, generating hydrolysates with a high glucose/xylose ratio. Hemicellulose removal before enzymatic hydrolysis of the cellulosic fraction proved to be an efficient manner to add value to sugarcane bagasse biorefining. Xylans with varied yield, purity, and structure can be obtained according to the extraction method. Enzymatic extraction procedures produce high-purity xylans at low yield, whereas alkaline extraction methods provided higher xylan yields with more lignin and glucan contamination. When xylan extraction is performed with alkaline methods, the residual glucan-enriched solid seems suitable for glucose production employing low cellulase loadings.
Ji, Sen-Lin; Liu, Rui; Ren, Meng-Fei; Li, Huan-Jun; Xu, Jun-Wei
2015-01-01
This study aimed to improve polysaccharide production by engineering the biosynthetic pathway in Ganoderma lucidum through the overexpression of the homologous UDP glucose pyrophosphorylase (UGP) gene. The effects of UGP gene overexpression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production, and transcription levels of 3 genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), UGP, and α-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in G. lucidum overexpressing the UGP gene were 24.32 mg/100 mg dry weight and 1.66 g/L, respectively, which were higher by 42% and 36% than those of the wild-type strain. The transcription levels of PGM, UGP, and GLS were up-regulated by 1.6, 2.6, and 2.4-fold, respectively, in the engineered strain, suggesting that increased polysaccharide biosynthesis may result from a higher expression of those genes.
Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H
1990-04-01
Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.
Li, Tingting; Yang, Yan; Liu, Yanfang; Zhou, Shuai; Yan, Meng Qiu; Wu, Di; Zhang, Jingsong; Tang, Chuanhong
2015-11-01
Nine polysaccharide fractions were obtained from the fruiting bodies, submerged mycelia, and solid state fermented products of Phellinus baumii using different concentrations of ethanol precipitation. The chemical characteristics and in vitro immunological activities of the nine polysaccharide fractions were compared and studied. Results indicated that the fractions precipitated with 50% ethanol had higher yields of polysaccharides and submerged mycelia contributed to high extraction yields of polysaccharides and possessed higher polysaccharide contents. HPSEC-MALLS-RI analysis showed that the molecular weight (Mw) of polysaccharide fractions from these three materials decreased with the increasing of precipitated ethanol concentration. The Mw of fruiting body polysaccharide fractions ranged from 1.98×10(4)Da to 1.89×10(6)Da. Large-molecular-weight polysaccharides (from 2.11×10(6)Da to 2.01×10(7)Da) were found in submerged mycelia. Some lower-molecular-weight polysaccharide components were found in solid fermented products. Different culture methods contributed to significant differences in monosaccharide components and molar ratios. The 50% ethanol precipitated fractions exhibited more complexity on monosaccharide compositions comparing with fractions precipitated with 30% and 70% ethanol. Polysaccharide fractions derived from submerged mycelia exhibited higher macrophages stimulation activities. Submerged culture was found to be a suitable method to prepare active polysaccharides because of its short culture span and reasonable cost. Copyright © 2015 Elsevier B.V. All rights reserved.
Radioprotective effect of orally administered beta-d-glucan derived from Saccharomyces cerevisiae.
Liu, Fang; Wang, Zhuanzi; Liu, Jia; Li, Wenjian
2018-04-21
The present study was to evaluate the in vivo radioprotective effect of oral administration of Saccharomyces cerevisiae-derived-beta-d-glucan (S. cerevisiae-BG) and to investigate the protective mechanism. The results demonstrated that oral pretreatment with 350 mg/kg S. cerevisiae-BG once daily for 14 consecutive days significantly increased the survival rate of mice from 6 Gy X-rays irradiation. At the 30th day after irradiation, cellularity and the percentage of hematopoietic stem/progenitor cells in bone marrow (BM) of surviving mice were increased by S. cerevisiae-BG. Further studies showed that S. cerevisiae-BG decreased BM cell DNA damage and improved BM cell cycle progress in irradiated mice. And the reactive oxygen species (ROS) levels in BM cells of irradiated mice were also decreased by S. cerevisiae-BG. These results indicated that oral S. cerevisiae-BG exhibited obviously radioprotective effect in mice and the protective effect may be attributed to the polysaccharide's hematopoiesis-modulating action and free radical scavenging property. S. cerevisiae-BG protects BM cells from radiation damage through scavenging BM cell ROS, mitigating BM cell DNA damage and improving cell cycle progress, and thus mitigated myelosuppression induced by irradiation and stimulated hematopoiesis, ultimately increased the survival of radiated mice. Copyright © 2018. Published by Elsevier B.V.
Afolabi, Olakunle Bamikole; Oloyede, Omotade Ibidun; Agunbiade, Shadrack Oludare
2018-05-01
The current study was designed to evaluate the various antioxidant potentials and inhibitory effects of phenolic-rich leaf extracts of Bridelia ferruginea (BF) on the in vitro activities of some key enzymes involved in the metabolism of carbohydrates. In this study, BF leaf free and bound phenolic-rich extracts were used. We quantified total phenolic and flavonoid contents, and evaluated several antioxidant activities using assays for ferric reducing antioxidant power, total antioxidant activity (phosphomolybdenum reducing ability), 1,1-diphenyl-2-picrylhydrazyl and thiobarbituric acid reactive species. Also, extracts were tested for their ability to inhibit α-amylase and α-glucosidase activity. The total phenolic and total flavonoid contents in the free phenolic extract of BF were significantly greater than in the bound phenolic extract. Also, all the antioxidant activities considered were significantly greater in the free phenolic extract than in the bound phenolic extract. In the same vein, the free phenolic-rich extract had a significantly higher percentage inhibition against α-glucosidase activity (IC 50 = 28.5 µg/mL) than the bound phenolic extract (IC 50 = 340.0 µg/mL). On the contrary, the free phenolic extract (IC 50 = 210.0 µg/mL) had significantly lower inhibition against α-amylase than the bound phenolic-rich extract (IC 50 = 190.0 µg/mL). The phenolic-rich extracts of BF leaves showed antioxidant potentials and inhibited two key carbohydrate-metabolizing enzymes in vitro. Copyright © 2018 Shanghai Changhai Hospital. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.
2018-03-01
Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.
de O Moreira, Isabela; Passos, Thaís S; Chiapinni, Claudete; Silveira, Gabrielle K; Souza, Joana C M; Coca-Vellarde, Luis Guillermo; Deliza, Rosires; de Lima Araújo, Kátia G
2012-02-01
Phycobiliproteins are coloured proteins produced by cyanobacteria, which have several applications because of their colour properties. However, there is no available information about the colour stability of phycobiliproteins from Nostoc sp. in food systems. The aim of this work was to study the colour stability of a purple-coloured phycobiliprotein-rich extract from the cyanobacterium Nostoc PCC9205 in acidic solutions and yogurt. Variations of pH for Nostoc PCC9205 extract have shown stability for the L* (lightness) and a* (redness) indexes in the range 1.0-7.0. The b* index (blueness), however, increased at pH values below 4.0, indicating loss of the blue colour. The Nostoc PCC9205 extract was used as colorant in yogurt (pH 4.17) stored for 60 days. Instrumental colour analysis showed no changes for the L* and a* indexes during storage, whereas the b* index changed after 20 days of storage. A multiple comparison test showed colour instability after 20 days of storage. A hedonic scale test performed on the 60th day of storage showed acceptability of the product. The red component of the phycobiliprotein-rich extract from Nostoc PCC9205 presented an improved stability in acidic media and yogurt compared with the blue component of this extract. Copyright © 2011 Society of Chemical Industry.
Mechanisms of antimelanoma effect of oat β-glucan supported by electroporation.
Choromanska, Anna; Lubinska, Sandra; Szewczyk, Anna; Saczko, Jolanta; Kulbacka, Julita
2018-06-06
There are still not specified mechanisms how beta-glucan molecules are transported into cells. Supposing, beta-glucan toxicity against tumor cells may be related to the overexpression of the transporter responsible for the transport of glucose molecules in the cells. In this case, glucans - polymers composed of glucose units are much more up-taken by tumor than normal cells. Increased GLUT1 (Glucose Transporter Type 1) expression has been demonstrated earlier in malignant melanomas. GLUT1 expression promotes glucose uptake and cell growth in that cells. Also, in human melanoma tissues a significant correlation between GLUT1 expression and mitotic activity was found. The aim of the study was to verify if oat β-glucan (OβG) is delivered into cells by GLUT-1 membrane protein. To check it out we blocked GLUT1 transporters by an inhibitor WZB117 and then we investigated cells viability with and without reversible electroporation (EP). The obtained results bring us to elucidate the mechanism of transport of the OβG into the cells is GLUT-1 dependent and moreover can be supported by EP method. Copyright © 2018. Published by Elsevier B.V.
Polysaccharide Nanosystems for Future Progress in Cardiovascular Pathologies
Silva, Amanda Karine Andriola; Letourneur, Didier; Chauvierre, Cédric
2014-01-01
Natural polysaccharides have received a lot of attention in the biomedical field. Indeed, sources of polysaccharides, extracted or produced from plants, bacteria, fungi or algae, are diverse and renewable. Moreover, recent progresses in polysaccharide chemistry and nanotechnologies allow elaborating new dedicated nanosystems. Polysaccharide-based nanosystems may be designed for interacting in several biological processes. In particular, the atherothrombotic pathology is highly concerned by polysaccharide-mediated recognition. Atherothrombotic diseases, regardless of the anatomical localization, remain the main causes of morbidity and mortality in the industrialized world. This review intends to provide an overview on polysaccharide-based nanosystems as drug delivery systems and targeted contrast agents for molecular imaging with an emphasis on the treatment and imaging of cardiovascular pathologies. PMID:24723980
Liu, Peize; Chen, Zhen; Yang, Lijie; Li, Qingbiao; He, Ning
2017-09-26
Polysaccharides and poly-γ-glutamic acid (γ-PGA) are biomacromolecules that have been reported as bioflocculants, and they exhibit high flocculating activity in many industrial applications. Bacillus licheniformis CGMCC 2876 can produce polysaccharide and γ-PGA bioflocculants under different culture conditions. Several key genes are involved in the metabolic pathway of polysaccharides in B. licheniformis, but the impacts of the regulation of these genes on the production of polysaccharide bioflocculants have not been illustrated completely. To increase the bioflocculant production and identify the correlation between the synthesis of polysaccharides and γ-PGA in B. licheniformis, a few key genes were investigated to explore their influence on the synthesis of the bioflocculants. Overexpressing epsB from the eps gene cluster not only improved the bioflocculant crude yield by 13.98% but also enhanced the flocculating activity by 117.92%. The composition of the bioflocculant from the epsB recombinant strain was 28.95% total sugar, 3.464% protein and 44.03% γ-PGA, while in the original strain, these components represented 53.67%, 3.246% and 34.13%, respectively. In combination with an analysis of the transcriptional levels of several key genes involved in γ-PGA synthesis in B. licheniformis, we inferred that epsB played a key role in the synthesis of both polysaccharide and γ-PGA. The bioflocculant production of the epsB recombinant strain was further evaluated during batch fermentation in a 2 L fermenter; the flocculating activity reached 9612.75 U/mL, and the bioflocculant yield reached 10.26 g/L after 72 h, representing increases of 224% and 36.62%, respectively, compared with the original strain. Moreover, we found that the tandem expression of phosphoglucomutase (pgcA) and UTP-glucose-1-phosphate uridylyltransferase (gtaB1) could enhance the crude yield of the bioflocculant by 20.77% and that the overexpression of epsA could enhance the bioflocculant
Akram, Kashif; Shahbaz, Hafiz Muhammad; Kim, Gui-Ran; Farooq, Umar; Kwon, Joong-Ho
2017-02-01
Gamma irradiation was applied to the improved extraction of water-soluble polysaccharides (WSPs) from dried Lentinus edodes. Irradiation provided a dose-dependent increase in extraction yield (0 kGy, 2.01%; 7.5 kGy, 4.03%; 15 kGy, 7.17%) and purity (0 kGy, 78.8%; 7.5 kGy, 83.1%; 15 kGy, 85.6%) of the WSPs from hot-water extraction. The effect of irradiation was evident in the degraded microstructures and reduced molecular weights of the WSPs. However, nuclear magnetic resonance, Fourier-transform infrared, and X-ray diffraction spectroscopic analyses provided comparable structures of WSPs from nonirradiated and irradiated samples. UV-visible spectra showed a dose-dependent decline in intensity, but an improvement in thermal properties of the WSPs from the irradiated mushroom samples was observed. © 2017 Institute of Food Technologists®.
Liu, Yanfang; Zhang, Jingsong; Tang, Qingjiu; Yang, Yan; Guo, Qingbin; Wang, Qi; Wu, Di; Cui, Steve W
2014-01-30
A purified polysaccharide coded as GLP20 was obtained by precipitating a hot-water extract from Ganoderma lucidum fruiting bodies with 20% (V/V) ethanol. Its total carbohydrate content was 95.9%. Structural analysis showed that GLP20 was a β-(1→3)-linked d-glucan with a (1→6)-β-d-glucopyranosyl side-branching unit on every third residue. Cell culture study revealed that GLP20 can significantly increase NO production of RAW264.7 macrophages. The analysis of light scattering and high performance size exclusion chromatography (HPSEC) showed that the molecular weight and polydispersity of GLP20 was 3.75 × 10(6)Da and 1.36, respectively. GLP20 had a rigid chain conformation in aqueous solution. A conformation transition occurred in the alkaline solution with NaOH concentration larger than 0.15M. The transition from ordered structure to single chain happened when GLP20 was heated above 135°C in water solution and was irreversible as demonstrated by differential scanning calorimetry (DSC). GLP20 existed as random coils in DMSO. Copyright © 2013 Elsevier Ltd. All rights reserved.
Strathearn, Katherine E.; Yousef, Gad G.; Grace, Mary H.; Roy, Susan L.; Tambe, Mitali A.; Ferruzzi, Mario G.; Wu, Qing-Li; Simon, James E.; Lila, Mary Ann; Rochet, Jean-Christophe
2014-01-01
Neuropathological evidence indicates that dopaminergic cell death in Parkinson’s disease (PD) involves impairment of mitochondrial complex I, oxidative stress, microglial activation, and the formation of Lewy bodies. Epidemiological findings suggest that the consumption of berries rich in anthocyanins and proanthocyanidins may reduce PD risk. In this study, we investigated whether extracts rich in anthocyanins, proanthocyanidins, or other polyphenols suppress the neurotoxic effects of rotenone in a primary cell culture model of PD. Dopaminergic cell death elicited by rotenone was suppressed by extracts prepared from blueberries, grape seed, hibiscus, blackcurrant, and Chinese mulberry. Extracts rich in anthocyanins and proanthocyanidins exhibited greater neuroprotective activity than extracts rich in other polyphenols, and a number of individual anthocyanins interfered with rotenone neurotoxicity. The blueberry and grape seed extracts rescued rotenone-induced defects in mitochondrial respiration in a dopaminergic cell line, and a purple basal extract attenuated nitrite release from microglial cells stimulated by lipopolysaccharide. These findings suggest that anthocyanin- and proanthocyanidin-rich botanical extracts may alleviate neurodegeneration in PD via enhancement of mitochondrial function. PMID:24502982
Khan, Asma Ashraf; Gani, Adil; Masoodi, F A; Amin, Furheen; Wani, Idrees Ahmed; Khanday, Firdous Ahmad; Gani, Asir
2016-04-20
This study was carried out to evaluate the effect of γ-irradiation (0, 5, 10, 20, 30 & 50kGy) on the structural, functional, antioxidant and antimicrobial properties of yeast β-d-glucan. The samples were characterized by ATR-FTIR, gel permeation chromatography (GPC) and the thermal properties were studied using DSC. There was a decrease in the average molecular weight of β-d-glucan as the irradiation dose increased. The functional properties of irradiated yeast β-d-glucan were largely influenced by the action of gamma radiation like swelling power and viscosity decreases with increase in the irradiation dose while as fat binding capacity, emulsifying properties, foaming properties and bile acid binding capacity shows an increasing trend. All the antioxidant properties carried out using six different assays increased significantly (p≤0.05) in a dose dependent manner. The antibacterial activity of yeast β-d-glucan also showed an increasing trend with increase in the irradiation dose from 5 to 50kDa. Copyright © 2016 Elsevier Ltd. All rights reserved.
Liu, Huan; Zhang, Wei; Dong, Shichao; Song, Liang; Zhao, Shimin; Wu, Chunyan; Wang, Xue; Liu, Fang; Xie, Jiming; Wang, Jinling; Wang, Yuzhen
2015-12-24
Sea buckthorn (Hippophae rhamnoides L.) berries have been traditionally used to treat gastric disorders, cardiovascular problems, and liver injuries in oriental medicinal system. This study aimed to explore the protective effects and mechanisms of the polysaccharide extracts of Sea buckthorn (HRP) berries against lipopolysaccharide (LPS) and d-galactosamine hydrochloride (d-GalN)-induced acute liver failure in mice. HRP was isolated by hot-water extraction and characterized by HPLC and infrared spectrum analysis. The total carbohydrate, uronic acid and protein contents of HRP were measured by a spectrophotometric method. Mice were orally administrated with HRP (50, 100, 200mg/kg) once daily for 14 consecutive days prior to the challenge with LPS (50 μg/kg) and d-GalN (300 mg/kg). Animals of positive control group were intraperitoneally injected with dexamethasone (10mg/kg). Mice were sacrificed at 8h after LPS/d-GalN injection. Pretreatment with HRP significantly inhibited LPS/d-GalN-induced increases in serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, which were accompanied by alleviated liver injuries and reduced production of tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β). HRP was also found to reduce malondialdehyde (MDA) content and to restore superoxide dismutase (SOD) and glutathione peroxidase (GSH-PX) activities. Furthermore, HRP supplementation dose-dependently inhibited the expression of Toll-like receptor 4 (TLR4), phosphorylated extracellular signal-regulated kinase (p-ERK), phosphorylated c-Jun N-terminal kinase (p-JNK), and phosphorylated mitogen activated protein kinase 38 (p-p38 MAPK) in the liver of LPS/d-GalN challenged mice. Pretreatment with HRP also inhibited LPS/d-GalN-induced activation and translocation of nuclear factor-κB (NF-κB). This study indicates that pretreatment with HRP protects against LPS/d-GalN-induced liver injury in mice via suppressing the TLR4-NF-κB signaling pathway. Sea
A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.
Das, Deeplina; Baruah, Rwivoo; Goyal, Arun
2014-08-01
An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.
Recent Advances in Marine Algae Polysaccharides: Isolation, Structure, and Activities.
Xu, Shu-Ying; Huang, Xuesong; Cheong, Kit-Leong
2017-12-13
Marine algae have attracted a great deal of interest as excellent sources of nutrients. Polysaccharides are the main components in marine algae, hence a great deal of attention has been directed at isolation and characterization of marine algae polysaccharides because of their numerous health benefits. In this review, extraction and purification approaches and chemico-physical properties of marine algae polysaccharides (MAPs) are summarized. The biological activities, which include immunomodulatory, antitumor, antiviral, antioxidant, and hypolipidemic, are also discussed. Additionally, structure-function relationships are analyzed and summarized. MAPs' biological activities are closely correlated with their monosaccharide composition, molecular weights, linkage types, and chain conformation. In order to promote further exploitation and utilization of polysaccharides from marine algae for functional food and pharmaceutical areas, high efficiency, and low-cost polysaccharide extraction and purification methods, quality control, structure-function activity relationships, and specific mechanisms of MAPs activation need to be extensively investigated.
Yatawara, Lalani; Wickramasinghe, Susiji; Nagataki, Mitsuru; Takamoto, Misa; Nomura, Haruka; Ikeue, Yasunori; Watanabe, Yoshiya
2009-01-01
The β-glucans derived from yeast cell walls have been reported for having many immunomodulatory activities in vivo and in vitro. In this study, Aureobasidium-derived soluble branched (1,3-1,6) β-glucan (Sophy β-glucan) was checked for natural killer (NK) activity and for the production of IFN-γ and IL-4 in Leishmania amazonensis infection. The main experiment was performed with a group of female C57BL/6 and BALB/c mice, orally supplemented with 5% of Sophy β-glucan and infected with promastogotes of L. amazonensis (1 × 107) into the footpad. Increase in the footpad thickness with time was observed in BALB/c mice in spite of the oral Sophy β-glucan supplement, but it was less in C57BL/6 mice. The difference in overall mean footpad thickness between 'infection only' versus 'infection + glucan' groups was statistically significant (P < 0.001). High NK activity in C57BL/6 than BALB/c mice was observed in 'glucan only' group compared to the control group and also in 'infection + glucan' group compared to 'infection only' group. The difference in the NK activity among these groups was significant (P < 0.05). The IFN-γ level increased at weeks 7 and 8 post-infection in C57BL/6 mice and was significantly high in 'infection + glucan' group compared to the 'infection only' group (P < 0.05). IL-4 levels did not increase up to detectable levels throughout the study. The results led a conclusion that Sophy β-glucan enhances NK activity and cellular immunity in L. amazonensis-infected mice. PMID:19967081
Jing Yan; Kang Min; Liu Jin; Li Jingyu; Tang Anzhou
2015-04-01
To explore the proliferation inhibition and apoptosis of polysaccharides extracts from polysaccharides extracts from Hedyotic diffusa (PEHD) on Human Nasopharyngeal Carcinoma (NPC)cell line CNE2 cells in vitro. CNE2 cells treated with various concentrations of PEHD were detected by MTT assay at 24 h, 48 h, and 72 h. The apoptotic cells were analyzed by flow cytometry with Annexin V/PI staining. The expression levels of Bax, Bcl-2 and caspase-3 protein were examined by Western blotting method. The growth of CNE2 cells were suppressed after treatment with PEHD (P < 0.05), MTT assay showed that the highest cell inhibition rate reached to 76.5%, the inhibition in the doses from 2 to 6 mg/ml showed dose-and-time-dependent. The percent of apoptosis in 4 and 6 mg/ml PEHD treatment groups for 48 h were 31.32%, 46.28%, respectively, and significantly higher than that in control groups, 4.86% (P < 0.01). After the cells being treated with PEHD for 48 h, the expression of Bax and caspase-3 protein increased, and the expression of Bcl-2 protein decreased gradually. PEHD could inhibited the growth of CNE2 cells and was dose-and-time-dependent, the mechanism may involve induction of cell apoptosis, which was associated with the activation of Bax and caspase-3 protein and the down-regulation of Bcl-2 protein expression.