Sample records for b2 g1 g2

  1. Determination of aflatoxins B1, B2, G1 and G2 in spices using a multifunctional column clean-up.

    PubMed

    Akiyama, H; Goda, Y; Tanaka, T; Toyoda, M

    2001-10-12

    A rapid and simple method using a multifunctional column, which contains lipophilic and charged active sites, was developed to analyse aflatoxins B1, B2, G1 and G2 in various spices, such as red pepper and nutmeg. After extraction by acetonitrile:water (9:1) and clean-up using MultiSep #228 column, the aflatoxins and aflatoxin-TFA derivatives are determined using LC with fluorescence detection. Recoveries of each aflatoxin B1, B2, G1 and G2 spiked to red pepper, white pepper, black pepper, nutmeg and tear grass at the level of 10 ng/g were over 80-85% in all instances. The minimum detectable concentration for aflatoxins in red pepper was 0.5 ng/g.

  2. The Vaporization of B2O3(l) to B2O3(g) and B2O2(g)

    NASA Technical Reports Server (NTRS)

    Jacobson, Nathan S.; Myers, Dwight L.

    2011-01-01

    The vaporization of B2O3 in a reducing environment leads to formation of both B2O3(g) and B2O2(g). While formation of B2O3(g) is well understood, many questions about the formation of B2O2(g) remain. Previous studies using B(s) + B2O3(l) have led to inconsistent thermodynamic data. In this study, it was found that after heating, B(s) and B2O3(l) appear to separate and variations in contact area likely led to the inconsistent vapor pressures of B2O2(g). To circumvent this problem, an activity of boron is fixed with a two-phase mixture of FeB and Fe2B. Both second and third law enthalpies of formation were measured for B2O2(g) and B2O3(g). From these the enthalpies of formation at 298.15 K are calculated to be -479.9 +/- 41.5 kJ/mol for B2O2(g) and -833.4 +/- 13.1 kJ/mol for B2O3(g). Ab initio calculations to determine the enthalpies of formation of B2O2(g) and B2O3(g) were conducted using the W1BD composite method and show good agreement with the experimental values.

  3. Optimization of chromatographic conditions for determination of aflatoxin B1, B2, G1 and G2 by using liquid chromatography-mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Ramadhaningtyas, Dillani Putri; Aryana, Nurhani; Aristiawan, Yosi; Styarini, Dyah

    2017-11-01

    The optimization of instrument condition and chromatographic separation for analysis of aflatoxin B1, B2, G1 and G2 using liquid chromatography tandem with mass spectrometer detector was conducted in the aim to provide more accurate and reliable analysis results. The aflatoxin known to be serious threat for human health as it is classified as the carcinogenic compounds. The aflatoxin B1, B2, G1 and G2 were selected due to its extensive contamination in various agricultural commodities. The best chromatographic separation was obtained using C-18 column with gradient elution of solvent 5 mM ammonium acetate and 0.1% formic acid in methanol at 7 minutes runtime analysis. The linearity of the detector showed satisfied results as the coefficient determination found to be 0.9994, 0.9996, 0.9998 and 0.9987 for aflatoxin B1, G1, B2, and G2 respectively in the range concentration from 1 to 20 ng/g. The quantifier ion selected for the aflatoxin B1, B2, G1 and G2 was m/z 285.1, 259, 243 and 313 respectively. The instrument precision at these quantifier ions also showed satisfied result with %RSD was around 3.4 to 6.8%. The optimized method present in this study can be used for further sample analysis.

  4. OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

    PubMed

    Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

    2014-10-14

    There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Aflatoxin (B1 , B2 , G1 , and G2 ) contamination in rice of Mexico and Spain, from local sources or imported.

    PubMed

    Suárez-Bonnet, Elena; Carvajal, Magda; Méndez-Ramírez, Ignacio; Castillo-Urueta, Pável; Cortés-Eslava, Josefina; Gómez-Arroyo, Sandra; Melero-Vara, José María

    2013-11-01

    Rice is an important cereal but it is often contaminated with aflatoxins (AFs). The purpose of this study was to identify and quantify AF (B1 , B2 , G1 , and G2 ) in 67 rice samples cultivated in Mexico and Spain, and from imported crops collected in 2008 and 2009. The methodology was validated, the rice samples were concentrated and purified with immunoaffinity columns and were quantified by high-pressure liquid chromatography (HPLC). The average total AF (AFt) in the Spanish rice was 37.3 μg/kg, the range was from 1.6 to 1383 μg/kg, the most contaminated samples being from San Juan de Aznalfarache, Sevilla (AFt = 138.6 μg/kg), from Tortosa, Tarragona (AFt = 104.6 μg/kg), and Calasparra, Murcia (AFt = 103.9 μg/kg). The rice imported from France to Spain had AFt of 26.6 μg/kg and from Pakistan AFt of 18.4 μg/kg, showing less AF contamination than the local one. The rice which originated from Mexico contained (AFt = 16.9 μg/kg), and those imported from the United States (AFt = 14.4 μg/kg) and Uruguay (AFt = 15.6 μg/kg). The imported rice had better quality in terms of the presence of AFs. © 2013 Institute of Food Technologists®

  6. D1((2)B2g) to D0((2)Au) Fluorescence from the Matrix-Isolated Perylene Cation Following Laser Excitation into the D5(2)B3g) and D2 ((2)B3g) Electronic States

    NASA Technical Reports Server (NTRS)

    Chillier, Xavier D. F.; Stone, Bradley M.; Joblin, Christine; Salama, Farid; Allamandola, Louis J.; DeVincenzi, Donald L. (Technical Monitor)

    2001-01-01

    Fluorescence spectra of the perylene cation, pumped by direct laser excitation via the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) and D(sub 5)(2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transitions, are presented. Direct excitation into the D5 or D2 states is followed by rapid non-radiative relaxation to D1 that, in turn,relaxes radiatively. Excitation spectroscopy across the D(sub 2)((2)B(sub 3g)) (left arrow) D(sub 0)((2)A(sub u)) transition near 730 nm shows that site splitting plays little or no role in determining the spectral substructure in the ion spectra. Tentative assignments for ground state vibrational frequencies are made by comparison of spectral intervals with calculated normal mode frequencies.

  7. Excitation of O 2(a 1Δ g, b 1Σ g+) and I( 2P 1/2) by energy transfer from I 2(A, A' 3Π 1,2u) in solid rare gases

    NASA Astrophysics Data System (ADS)

    Böhling, R.; Becker, A. C.; Minaev, B. F.; Seranski, K.; Schurath, U.

    1990-04-01

    O 2a 1Δ g, b 1Σ g+ → X 3Σ g- and I 2P 1/22P 3/4 fluorescence occurs in I 2/O 2-doped rare gas matrices when I 2 is excited with visible laser light. O 2(a 1Δ g) and I( 2P 1/2) are populated independently by near-resonant energy transfer from the metastable triplet states of I 2. The doublet splitting of the O 2a→X band, which peaks at 7879 and 7863 cm -1 in argon, is interpreted as sensitized emission from O 2 trapped in distinct nearest neighbour positions of the donor 3I 2. Annealing reverses the intensity of the doublet, showing that the sites can be interconverted. It is suggested that the a→X emission rate is enhanced by the sensitizer, causing a lifetime reduction of the a 1Δ g state from 79 s in pure argon to 21 and 3±1 s next to I 2. The long-lived O 2(a 1Δ g) state is the precursor of I 2-sensitized emission from O 2(b 1Σ g+). The lifetime of O 2(b 1Σ g+) is reduced from 24.5 ms in pure argon to 17±1 ms in the presence of I 2.

  8. O2(b1Σg+, v = 0, 1) Relative Yield in O(1D) + O2 Energy Transfer

    NASA Astrophysics Data System (ADS)

    Kostko, O.; Raj, S.; Campbell, K. M.; Pejakovic, D. A.; Slanger, T. G.; Kalogerakis, K. S.

    2012-04-01

    Energy transfer from excited O(1D) atoms to ground-state O2(X3Σg-) leads to production of O2 in the first two vibrational levels of the O2(b1Σg+) state: O(1D) + O2 → O(3P ) + O2(b1Σg+, v = 0, 1). Subsequent radiative decay of O2(b1Σg+, v = 0, 1) to the ground state results in the Atmospheric Band emission, a prominent feature of the terrestrial airglow. The relative yield for production of O2(b1Σg+, v = 0, 1) in the above process, k1/k0, is an important parameter in modeling of the observed O2 Atmospheric Band emission intensities. In the laboratory experiments, the output of a pulsed fluorine laser at 157 nm is used to photodissociate molecular oxygen in an O2/N2 mixture flowing through a heated gas cell. Photodissociation of O2 produces a ground-state O(3P ) atom and an excited O(1D) atom. O(1D) rapidly transfers energy to the remaining O2 to produce O2(b1Σg+, v = 0, 1). The populations of O2(b1Σg+, v = 0, 1) are monitored by observing emissions in the O2(b-X) 0-0 and 1-0 bands at 762 and 688 nm, respectively. The value of k1/k0 is extracted from the time-dependent O2(b1Σg+, v = 0, 1) fluorescence signals using computer simulations. We find that production of v = 1 is substantially larger than that of v = 0. We will present measurements on k1/k0 and its temperature dependence, and discuss the significance of these and other relevant laboratory measurements on the interpretation of the O2 Atmospheric Band emission. This work was supported by the US National Science Foundation (NSF) Aeronomy Program under grant AGS-0937317. The fluorine laser was purchased under grant ATM-0216583 from the NSF Major Research Instrumentation Program. The participation of Sumana Raj and Kendrick M. Campbell was supported by a Research Experiences for Undergraduates (REU) site, co-funded by the Division of Physics of the NSF and the Department of Defense in partnership with the NSF REU program (PHY-1002892).

  9. New analytical techniques for mycotoxins in complex organic matrices. [Aflatoxins B1, B2, G1, and G2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bicking, M.K.L.

    1982-07-01

    Air samples are collected for analysis from the Ames Solid Waste Recovery System. The high level of airborne fungi within the processing area is of concern due to the possible presence of toxic mycotoxins, and carcinogenic fungal metabolites. An analytical method has been developed to determine the concentration of aflatoxins B1, B2, G1, and G2 in the air of the plant which produces Refuse Derived Fuel (RDF). After extraction with methanol, some components in the matrix are precipitated by dissolving the sample in 30% acetonitrile/chloroform. An aliquot of this solution is injected onto a Styragel column where the sample componentsmore » undergo simultaneous size exclusion and reverse phase partitioning. Additional studies have provided a more thorough understanding of solvent related non-exclusion effects on size exclusion gels. The Styragel column appears to have a useable lifetime of more than six months. After elution from Styragel, the sample is diverted to a second column containing Florisil which has been modified with oxalic acid and deactivated with water. Aflatoxins are eluted with 5% water/acetone. After removal of this solvent, the sample is dissolved in 150 ..mu..L of a spotting solvent and the entire sample applied to a thin layer chromatography (TLC) plate using a unique sample applicator developed here. The aflatoxins on the TLC plate are analyzed by laser fluorescence. A detection limit of 10 pg is possible for aflatoxin standards using a nitrogen laser as the excitation source. Sample concentrations are determined by comparing with an internal standard, a specially synthesized aflatoxin derivative. In two separate RDF samples, aflatoxin B1 was found at levels of 6.5 and 17.0 ppB. The analytical method has also proven useful in the analysis of contaminated corn and peanut meal samples. 42 figures, 8 tables.« less

  10. Broad-spectrum immunoaffinity cleanup for the determination of aflatoxins B1, B2, G1, G2, M1, M2 in Ophiocordyceps sinensis and its pharmaceutical preparations by ultra performance liquid chromatography tandem mass spectrometry.

    PubMed

    Sun, Shujuan; Xie, Jie; Peng, Tao; Shao, Bing; Zhu, Kui; Sun, Yuanze; Yao, Kai; Gu, Qiang; Zhang, Jing; Fan, Chunlin; Chen, Ying; Jiang, Haiyang

    2017-11-15

    An ultra performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) method was developed and validated for the simultaneous determination of aflatoxins B 1 , B 2 , G 1 , G 2 , M 1 and M 2 (AFB 1 , AFB 2 , AFG 1 , AFG 2 , AFM 1 and AFM 2 ) in Ophiocordyceps sinensis and its pharmaceutical preparations. A rapid and reliable immunoaffinity column containing a broad-spectrum monoclonal antibody for six aflatoxins was used for sample cleanup. Under the optimized conditions, the home-made immunoaffinity column capacity were about 315, 319, 292, 102, 444 and 369ng/mL gel for AFB 1 , AFB 2 , AFG 1 , AFG 2 , AFM 1 and AFM 2 , respectively. Recoveries for all tested aflatoxins ranged from 79.28% to 103.42% with relative standard deviation less than 8%. The limits of quantitation were in the range of 0.008-0.045μg/kg. Among 31 real samples analyzed, one sample was contaminated with AFB 1 , AFB 2 and AFM 1 at levels of 0.483, 0.068 and 0.104μg/kg, respectively. The established method is simple, accurate, and can be effectively used to determine the aflatoxins in Ophiocordyceps sinensis and its pharmaceutical preparations. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Study of Infrared Emission Spectroscopy for the B1Δg-A1Πu and B'1Σg+-A1Πu Systems of C2

    NASA Astrophysics Data System (ADS)

    Tang, Jian; Chen, Wang; Kawaguchi, Kentarou; Bernath, Peter F.

    2016-06-01

    Recently, we carried out the perturbation analysis of C_2 spectra and identified forbidden singlet-triplet intersystem transitions, which aroused further interest in other C_2 spectra for the many low-lying electronic states of this fundamental molecule. In 1988, the B1Δg-A1Πu and B'1Σg+-A1Πu band systems were discovered by Douay et al., who observed eight bands of the B1Δg-A1Πu system with v up to 5 for the B1Δg state and six bands of the B'1Σg+-A1Πu system with v up to 3 for the B'1Σg+ state in the Fourier transform infrared emission spectra of hydrocarbon discharges. In the work presented here, we identified twenty-four bands of the two systems, among which the B'1Σg+ v = 4 and the B1Δg v = 6, 7 and 8 vibrational levels involved in nine bands were studied for the first time. A direct global analysis with Dunham parameters was carried out satisfactorily for the B1Δg-A1Πu system except for a small perturbation in the B1Δg v = 6 level. The calculated rovibrational term energies up to B1Δg v = 12 showed that the level crossing between the B1Δg and d3Πg states is responsible for many of the prominent perturbations in the Swan system observed previously. Nineteen lines of the B1Δg-a3Πu forbidden transitions were identified and the off-diagonal spin-orbit interaction constant AdB between d3Πg and B1Δg was derived as 8.3(1) wn. For the B'1Σg+-A1Πu system, only individual band analyses for each vibrational level in the B'1Σg+ state could be done satisfactorily and Dunham parameters obtained from these effective parameters showed that the anharmonic vibrational constant ω_e x_e is anomalously small (nearly zero). Inspection of the RKR potential curves for the B'1Σg+ and X1Σg+ states revealed that an avoided crossing may occur around 30000 wn, which is responsible for the anomalous molecular constants in these two states. W. Chen, K. Kawaguchi, P. F. Bernath, and J. Tang, J. Chem. Phys., 141, 064317 (2015) M. Douay, R. Nietmann and P. F. Bernath

  12. Observation of the spin-orbit components of the 3B 2g( 3A 2g) ground state in the system Ni 2+:MgF 2 by fluorescence line narrowing

    NASA Astrophysics Data System (ADS)

    Tonucci, R. J.; Jacobsen, S. M.; Yen, W. M.

    1990-10-01

    Using a tunable narrow-band infrared laser, we demonstrate for the first time infrared-fluorescnece line narrowing in the system Ni 2+:MgF 2. High-resolution emission spectra were obtained by pumping the lowest spin-orbit component B 3 ( 3T 2g) (orthorhombic notation with octahedral notation in parentheses) of the 3T 2g multiplet and observing the B 3( 3T 2g)→B 1, A, B 2( 3A 2g) luminescent transitions at low temperature. By tuning the narrow-band laser over the B 3( 3T 2g) band, resonant and non-resonant fluorescence were obtained which narrowed with respect to the inhomogeneously broadened profile, and additional lines were observed. The spectra can be understood in terms of a simultaneous excitation of two different subsets of Ni 2+ ions which have their B 2( 3A 2g)→B 3( 3T 2g) and A( 3A 2g)→B 3( 3T 2g) transitions in resonance with the laser. The A( 3A 2g) and B 1( 3A 2g) spin-orbit components of the ground-state multiplet lie 1.9 cm -1 and 6.5 cm -1 above the B 2( 3A 2g) ground state, respectively, at 2 K.

  13. O2(b1∑+g) relaxation in active medium of oxygen-iodine laser

    NASA Astrophysics Data System (ADS)

    Tolstov, G. I.; Zagidullin, M. V.; Khvatov, N. A.; Medvedkov, I. A.; Mikheyev, P. A.

    2018-04-01

    Rate constants for the removal of O2 b1∑+g by collisions with O2, N2, CO2 and H2O have been determined at temperature 297 K. O2(b1 ∑+g) was excited by pulses from a tunable dye laser, and the deactivation kinetics were followed by observing the temporal behavior of the b1∑+g - X3∑-g fluorescence. The removal rate constants for CO2, N2 and H2O were not strongly dependent on temperature, and could be represented by the expressions kCO2=(1.8+/-0.05)×10-16 kN2=(2.2 +/- 0.2)×10-15, and kH2O=(6.12+/-0.67)×10-12 cm3 molecule-1 s-1. Rate constant for O2(b1∑+ ) removal by O2(X), being orders of magnitude lower, represented by the fitted expression kO2=(3.67 +/- 0.06)×10-17 cm3 molecule-1 s-1. All of the rate constants measured at room temperature were found to be in good agreement with previously reported values.

  14. Determination of O2(a1 delta g) and O2(b1 sigma+ g) yields in the reaction O + ClO --> Cl + O2: implications for photochemistry in the atmosphere of Venus

    NASA Technical Reports Server (NTRS)

    Leu, M. T.; Yung, Y. L.

    1987-01-01

    A discharge flow apparatus with chemiluminescence detector has been used to study the reaction O + ClO --> Cl + O2, where O2 = O2(a1 delta g) or O2(b1 sigma+ g). The measured quantum yields for producing O2(a1 delta g) and O2(b1 sigma+ g) in the above reaction are less than 2.5 x 10(-2) and equal to (4.4 +/- 1.1) x 10(-4), respectively. The observed O2(a1 delta g) airglow of Venus cannot be explained in the context of standard photochemistry using our experimental results and those reported in recent literature. The possibility of an alternative source of O atoms derived from SO2 photolysis in the mesosphere of Venus is suggested.

  15. Temperature Dependence of O2(b1Σ ^+g, v = 0 and 1) Relative Yield in O(1D) + O2 Energy Transfer

    NASA Astrophysics Data System (ADS)

    Kostko, O.; Raj, S.; Campbell, K.; Pejakovic, D. A.; Kalogerakis, K.

    2011-12-01

    Energy transfer from excited O(1D) atoms to ground-state O2(X3Σ ^-g) leads to production of O2 in the first two vibrational levels of the O2 (b1Σ ^+g) state: O(1D) + O2 -> O(3P) + O2(b1Σ ^+g, v = 0, 1). Subsequent radiative decay of O2(b1Σ ^+g, v = 0, 1) to the ground state results in the Atmospheric Band emission, a prominent feature of the terrestrial airglow. The relative yield for production of O2(b1Σ ^+g, v = 0 and 1) in the above process, k1/k0, is an important parameter in modeling of the observed Atmospheric Band emission intensities. Recent measurements at room temperature have shown that production of O2(b1Σ ^+g, v = 1) dominates that of O2(b1Σ ^+g, v = 0), with k1/k0 having a value of approximately 3.5 [1]. In the laboratory experiments, the output of a pulsed fluorine laser at 157 nm is used to photodissociate molecular oxygen in an O2/N2 mixture flowing through a heated gas cell. Photodissociation of O2 produces a ground-state O(3P) atom and an excited O(1D) atom. O(1D) rapidly transfers energy to the remaining O2 to produce O2(b1Σ ^+g, v = 0, 1). The populations of O2(b1Σ ^+g, v = 0 and 1) are monitored by observing emissions in the O2(b--X) 0--0 and 1--0 bands at 762 and 688 nm, respectively. The value of k1/k0 is extracted from the time-dependent O2(b1Σ ^+g, v = 0 and 1) fluorescence signals using computer simulations. We will present measurements on the temperature dependence of k1/k0 and discuss their atmospheric significance. This work was supported by the US National Science Foundation (NSF) Aeronomy Program under grant AGS-0937317. The fluorine laser was purchased under grant ATM-0216583 from the NSF Major Research Instrumentation Program. S. Raj and K. M. Campbell participated in a Research Experiences for Undergraduates (REU) site, co-funded by the Division of Physics of the NSF and the Department of Defense in partnership with the NSF REU program under grant PHY-1002892. [1] K. S. Kalogerakis, D. A. Pejaković, R. A. Copeland, T. G

  16. An evaluation of the rate of absorption of solar radiation in the O2(X3Sigma-g - b1Sigma-g) transition

    NASA Technical Reports Server (NTRS)

    Mlynczak, Martin G.

    1993-01-01

    The rate at which molecular oxygen absorbs radiation in the O2(X3Sigma-g - b1Sigma-g) transition is calculated using a line-by-line radiative transfer model. This rate is critical to the determination of the population of the O2(b1Sigma-g) state required for studies of the O2(b1Sigma-g - X3Sigma-g) dayglow, the O2(a1Delta-g - X3Sigma-g) dayglow, and possibly the rates of oxidation of H2 and N2O. Previous evaluations of this rate (which is sometimes called the g-factor) have significantly overestimated its value. The rate is tabulated as a function of altitude, pressure, and solar zenith angle.

  17. IRE1α links Nck1 deficiency to attenuated PTP1B expression in HepG2 cells.

    PubMed

    Li, Hui; Li, Bing; Larose, Louise

    2017-08-01

    PTP1B, a prototype of the non-receptor subfamily of the protein tyrosine phosphatase superfamily, plays a key role in regulating intracellular signaling from various receptor and non-receptor protein tyrosine kinases. Previously, we reported that silencing Nck1 in human hepatocellular carcinoma HepG2 cells enhances basal and growth factor-induced activation of the PI3K-Akt pathway through attenuating PTP1B expression. However, the underlying mechanism by which Nck1 depletion represses PTP1B expression remains unclear. In this study, we found that silencing Nck1 attenuates PTP1B expression in HepG2 cells through down-regulation of IRE1α. Indeed, we show that silencing Nck1 in HepG2 cells leads to decreased IRE1α expression and signaling. Accordingly, IRE1α depletion using siRNA in HepG2 cells enhances PI3K-dependent basal and growth factor-induced Akt activation, reproducing the effects of silencing Nck1 on activation of this pathway. In addition, depletion of IRE1α also leads to reduced PTP1B expression, which was rescued by ectopic expression of IRE1α in Nck1-depleted cells. Mechanistically, we found that silencing either Nck1 or IRE1α in HepG2 cells decreases PTP1B mRNA levels and stability. However, despite miR-122 levels, a miRNA targeting PTP1B 3' UTR and inducing PTP1B mRNA degradation in HepG2 cells, are increased in both Nck1- and IRE1α-depleted HepG2 cells, a miR-122 antagomir did not rescue PTP1B expression in these cells. Overall, this study highlights an important role for Nck1 in fine-tuning IRE1α expression and signaling that regulate PTP1B expression and subsequent activation of the PI3K-Akt pathway in HepG2 cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. [Determination of aflatoxin B1, B2, G1, G2 in armeniacae semen amarum by high-performance liquid chromatography-tandem mass spectrometry].

    PubMed

    Zheng, Run-Sheng; Xu, Hui; Wang, Wen-Li; Zhan, Ruo-Ting; Chen, Wei-Wen

    2013-10-01

    A simple, rapid and cost-effective high-performance liquid chromatography-tandem mass spectrometry (LC-MS/ MS) method was established for simultaneous determination of aflatoxins (AFB1, AFB2, AFG1, AFG2) in Armeniacae Semen Amarum and the application was performance in 11 samples collected from different markets, medical stores and hospitals. The sample was extracted with 84% acetonitrile/water and 250 microL extraction was directly injected into a LC-MS/MS system without further purification procedure after being redissolved with methanol. The LC separation was performed on a C18 column with a linear gradient elution program of 4 mmol x L(-1) NH4 Ac-0.1% formic acid solution and menthol as the mobile phase. Selected reaction monitoring (SRM) was used for selective determination of the four aflatoxins on a triple quadruple mass spectrometer, which was operated in positive ionization modes. All the four aflatoxins showed a good linear relationship with r > 0.999 0, the average recoveries were between 87.88% and 102.9% and the matrix effect was ranged from 90.71% to 99.30% in low, intermediate and high levels. Furthermore, the higher recovery was obtained by the method reported in this study, comparing to the cleanup procedure with the Mycosep 226 purification column. Eleven samples collected were detected and the contamination levels of the AFB1 were between 1.590-2.340 microg x kg(-1) and the AF (B1 + B2 + G1 + G2) was ranged from 2.340 to 3.340 microg x kg(-1). In summary, the developed method was suitable to detect and screen AFB1, AFB2, AFG1, AFG2 in Armeniacae Semen Amarum.

  19. O2(b1Σg+) Quenching by O2, CO2, H2O, and N2 at Temperatures of 300-800 K.

    PubMed

    Zagidullin, M V; Khvatov, N A; Medvedkov, I A; Tolstov, G I; Mebel, A M; Heaven, M C; Azyazov, V N

    2017-10-05

    Rate constants for the removal of O 2 (b 1 Σ g + ) by collisions with O 2 , N 2 , CO 2 , and H 2 O have been determined over the temperature range from 297 to 800 K. O 2 (b 1 Σ g + ) was excited by pulses from a tunable dye laser, and the deactivation kinetics were followed by observing the temporal behavior of the b 1 Σ g + -X 3 Σ g - fluorescence. The removal rate constants for CO 2 , N 2 , and H 2 O were not strongly dependent on temperature and could be represented by the expressions k CO2 = (1.18 ± 0.05) × 10 -17 × T 1.5 × exp[Formula: see text], k N2 = (8 ± 0.3) × 10 -20 × T 1.5 × exp[Formula: see text], and k H2O = (1.27 ± 0.08) × 10 -16 × T 1.5 × exp[Formula: see text] cm 3 molecule -1 s -1 . Rate constants for O 2 (b 1 Σ g + ) removal by O 2 (X), being orders of magnitude lower, demonstrated a sharp increase with temperature, represented by the fitted expression k O2 = (7.4 ± 0.8) × 10 -17 × T 0.5 × exp[Formula: see text] cm 3 molecule -1 s -1 . All of the rate constants measured at room temperature were found to be in good agreement with previously reported values.

  20. A soluble form of IL-13 receptor alpha 1 promotes IgG2a and IgG2b production by murine germinal center B cells.

    PubMed

    Poudrier, J; Graber, P; Herren, S; Gretener, D; Elson, G; Berney, C; Gauchat, J F; Kosco-Vilbois, M H

    1999-08-01

    A functional IL-13R involves at least two cell surface proteins, the IL-13R alpha 1 and IL-4R alpha. Using a soluble form of the murine IL-13R alpha 1 (sIL-13R), we reveal several novel features of this system. The sIL-13R promotes proliferation and augmentation of Ag-specific IgM, IgG2a, and IgG2b production by murine germinal center (GC) B cells in vitro. These effects were enhanced by CD40 signaling and were not inhibited by an anti-IL4R alpha mAb, a result suggesting other ligands. In GC cell cultures, sIL-13R also promoted IL-6 production, and interestingly, sIL-13R-induced IgG2a and IgG2b augmentation was absent in GC cells isolated from IL-6-deficient mice. Furthermore, the effects of the sIL-13R molecule were inhibited in the presence of an anti-IL-13 mAb, and preincubation of GC cells with IL-13 enhanced the sIL-13R-mediated effects. When sIL-13R was injected into mice, it served as an adjuvant-promoting production to varying degrees of IgM and IgG isotypes. We thus propose that IL-13R alpha 1 is a molecule involved in B cell differentiation, using a mechanism that may involve regulation of IL-6-responsive elements. Taken together, our data reveal previously unknown activities as well as suggest that the ligand for the sIL-13R might be a component of the IL-13R complex or a counterstructure yet to be defined.

  1. Nuclease digestion and mass spectrometric characterization of oligodeoxyribonucleotides containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG cisplatin intrastrand cross-links.

    PubMed

    Williams, Renee T; Nalbandian, Jenifer N; Tu, Audrey; Wang, Yinsheng

    2013-05-01

    The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, toward the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with (15)N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5' or 3' terminus revealed that the dinucleotide carries a terminal 5' phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. The Kinetics of G2 and M Transitions Regulated by B Cyclins

    PubMed Central

    Huang, Yehong; Sramkoski, R. Michael; Jacobberger, James W.

    2013-01-01

    B cyclins regulate G2-M transition. Because human somatic cells continue to cycle after reduction of cyclin B1 (cycB1) or cyclin B2 (cycB2) by RNA interference (RNAi), and because cycB2 knockout mice are viable, the existence of two genes should be an optimization. To explore this idea, we generated HeLa BD™ Tet-Off cell lines with inducible cyclin B1- or B2-EGFP that were RNAi resistant. Cultures were treated with RNAi and/or doxycycline (Dox) and bromodeoxyuridine. We measured G2 and M transit times and 4C cell accumulation. In the absence of ectopic B cyclin expression, knockdown (kd) of either cyclin increased G2 transit. M transit was increased by cycB1 kd but decreased by cycB2 depletion. This novel difference was further supported by time-lapse microscopy. This suggests that cycB2 tunes mitotic timing, and we speculate that this is through regulation of a Golgi checkpoint. In the presence of endogenous cyclins, expression of active B cyclin-EGFPs did not affect G2 or M phase times. As previously shown, B cyclin co-depletion induced G2 arrest. Expression of either B cyclin-EGFP completely rescued knockdown of the respective endogenous cyclin in single kd experiments, and either cyclin-EGFP completely rescued endogenous cyclin co-depletion. Most of the rescue occurred at relatively low levels of exogenous cyclin expression. Therefore, cycB1 and cycB2 are interchangeable for ability to promote G2 and M transition in this experimental setting. Cyclin B1 is thought to be required for the mammalian somatic cell cycle, while cyclin B2 is thought to be dispensable. However, residual levels of cyclin B1 or cyclin B2 in double knockdown experiments are not sufficient to promote successful mitosis, yet residual levels are sufficient to promote mitosis in the presence of the dispensible cyclin B2. We discuss a simple model that would explain most data if cyclin B1 is necessary. PMID:24324638

  3. Characterization of the Critical Amino Acids of an Aspergillus parasiticus Cytochrome P-450 Monooxygenase Encoded by ordA That Is Involved in the Biosynthesis of Aflatoxins B1, G1, B2, and G2

    PubMed Central

    Yu, Jiujiang; Chang, Perng-Kuang; Ehrlich, Kenneth C.; Cary, Jeffrey W.; Montalbano, Beverly; Dyer, John M.; Bhatnagar, Deepak; Cleveland, Thomas E.

    1998-01-01

    The conversion of O-methylsterigmatocystin (OMST) and dihydro-O-methylsterigmatocystin to aflatoxins B1, G1, B2, and G2 requires a cytochrome P-450 type of oxidoreductase activity. ordA, a gene adjacent to the omtA gene, was identified in the aflatoxin-biosynthetic pathway gene cluster by chromosomal walking in Aspergillus parasiticus. The ordA gene was a homolog of the Aspergillus flavus ord1 gene, which is involved in the conversion of OMST to aflatoxin B1. Complementation of A. parasiticus SRRC 2043, an OMST-accumulating strain, with the ordA gene restored the ability to produce aflatoxins B1, G1, B2, and G2. The ordA gene placed under the control of the GAL1 promoter converted exogenously supplied OMST to aflatoxin B1 in Saccharomyces cerevisiae. In contrast, the ordA gene homolog in A. parasiticus SRRC 2043, ordA1, was not able to carry out the same conversion in the yeast system. Sequence analysis revealed that the ordA1 gene had three point mutations which resulted in three amino acid changes (His-400→Leu-400, Ala-143→Ser-143, and Ile-528→Tyr-528). Site-directed mutagenesis studies showed that the change of His-400 to Leu-400 resulted in a loss of the monooxygenase activity and that Ala-143 played a significant role in the catalytic conversion. In contrast, Ile-528 was not associated with the enzymatic activity. The involvement of the ordA gene in the synthesis of aflatoxins G1, and G2 in A. parasiticus suggests that enzymes required for the formation of aflatoxins G1 and G2 are not present in A. flavus. The results showed that in addition to the conserved heme-binding and redox reaction domains encoded by ordA, other seemingly domain-unrelated amino acid residues are critical for cytochrome P-450 catalytic activity. The ordA gene has been assigned to a new cytochrome P-450 gene family named CYP64 by The Cytochrome P450 Nomenclature Committee. PMID:9835571

  4. Overview of Shipyard coast line with Piers G1, G2, G3, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Overview of Shipyard coast line with Piers G-1, G-2, G-3, G-4, and G-5 in view, view facing east-southeast - U.S. Naval Base, Pearl Harbor, Pier & Quay Walls, Entrance to Dry Dock No. 2 & Repair Wharfs, east & west sides of Dry Dock No. 2 & west side of Dry Dock No. 3, Pearl City, Honolulu County, HI

  5. Determination of O2(a1Delta g) and O2(b1Sigma + g) yields in the reaction O + ClO yields Cl + O2 - Implications for photochemistry in the atmosphere of Venus

    NASA Technical Reports Server (NTRS)

    Leu, Ming-Taun; Yung, Yuk L.

    1987-01-01

    A discharge flow apparatus with a chemiluminescence detector was used to investigate the reaction O + ClO yields Cl + O2(asterisk), where O2(asterisk) = O2(a1Delta g) or O2(b1Sigma + g). It is found that the observed O2(a1Delta g) airglow of Venus cannot be explained in the framework of standard photochemistry using the experimental results obtained here and those reported in the recent literature. The possibility of an alternative source of O atoms derived from SO2 photolysis in the Venus mesosphere is suggested.

  6. Potential energy and dipole moment surfaces of the triplet states of the O2(X3Σg-) - O2(X3Σg-,a1Δg,b1Σg+) complex

    NASA Astrophysics Data System (ADS)

    Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C.

    2017-08-01

    We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O2-O2, relevant for the theoretical description of collision-induced absorption in the forbidden X3Σg- → a1Δg and X3Σg- → b1Σg+ bands at 7883 cm-1 and 13 122 cm-1, respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O2-O2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].

  7. Potential energy and dipole moment surfaces of the triplet states of the O2(X3Σg-) - O2(X3Σg-,a1Δg,b1Σg+) complex.

    PubMed

    Karman, Tijs; van der Avoird, Ad; Groenenboom, Gerrit C

    2017-08-28

    We compute four-dimensional diabatic potential energy surfaces and transition dipole moment surfaces of O 2 -O 2 , relevant for the theoretical description of collision-induced absorption in the forbidden X 3 Σ g -  → a 1 Δ g and X 3 Σ g -  → b 1 Σ g + bands at 7883 cm -1 and 13 122 cm -1 , respectively. We compute potentials at the multi-reference configuration interaction (MRCI) level and dipole surfaces at the MRCI and complete active space self-consistent field (CASSCF) levels of theory. Potentials and dipole surfaces are transformed to a diabatic basis using a recent multiple-property-based diabatization algorithm. We discuss the angular expansion of these surfaces, derive the symmetry constraints on the expansion coefficients, and present working equations for determining the expansion coefficients by numerical integration over the angles. We also present an interpolation scheme with exponential extrapolation to both short and large separations, which is used for representing the O 2 -O 2 distance dependence of the angular expansion coefficients. For the triplet ground state of the complex, the potential energy surface is in reasonable agreement with previous calculations, whereas global excited state potentials are reported here for the first time. The transition dipole moment surfaces are strongly dependent on the level of theory at which they are calculated, as is also shown here by benchmark calculations at high symmetry geometries. Therefore, ab initio calculations of the collision-induced absorption spectra cannot become quantitatively predictive unless more accurate transition dipole surfaces can be computed. This is left as an open question for method development in electronic structure theory. The calculated potential energy and transition dipole moment surfaces are employed in quantum dynamical calculations of collision-induced absorption spectra reported in Paper II [T. Karman et al., J. Chem. Phys. 147, 084307 (2017)].

  8. Intron retention and transcript chimerism conserved across mammals: Ly6g5b and Csnk2b-Ly6g5b as examples

    PubMed Central

    2013-01-01

    Background Alternative splicing (AS) is a major mechanism for modulating gene expression of an organism, allowing the synthesis of several structurally and functionally distinct mRNAs and protein isoforms from a unique gene. Related to AS is the Transcription Induced Chimerism (TIC) or Tandem Chimerism, by which chimeric RNAs between adjacent genes can be found, increasing combinatorial complexity of the proteome. The Ly6g5b gene presents particular behaviours in its expression, involving an intron retention event and being capable to form RNA chimera transcripts with the upstream gene Csnk2b. We wanted to characterise these events more deeply in four tissues in six different mammals and analyse their protein products. Results While canonical Csnk2b isoform was widely expressed, Ly6g5b canonical isoform was less ubiquitous, although the Ly6g5b first intron retained transcript was present in all the tissues and species analysed. Csnk2b-Ly6g5b chimeras were present in all the samples analysed, but with restricted expression patterns. Some of these chimeric transcripts maintained correct structural domains from Csnk2b and Ly6g5b. Moreover, we found Csnk2b, Ly6g5b, and Csnk2b-Ly6g5b transcripts that present exon skipping, alternative 5' and 3' splice site and intron retention events. These would generate truncated or aberrant proteins whose role remains unknown. Some chimeric transcripts would encode CSNK2B proteins with an altered C-terminus, which could affect its biological function broadening its substrate specificity. Over-expression of human CSNK2B, LY6G5B, and CSNK2B-LY6G5B proteins, show different patterns of post-translational modifications and cell distribution. Conclusions Ly6g5b intron retention and Csnk2b-Ly6g5b transcript chimerism are broadly distributed in tissues of different mammals. PMID:23521802

  9. B2 and G2 Toda systems on compact surfaces: A variational approach

    NASA Astrophysics Data System (ADS)

    Battaglia, Luca

    2017-01-01

    We consider the B2 and G2 Toda systems on a compact surface (Σ, g), namely, systems of two Liouville-type PDEs coupled with a matrix of coefficients A = ( a i j ) = 2 - 1 - 2 2 ) or (2 - 1 - 3 2) . We attack the problem using variational techniques, following the previous work [Battaglia, L. et al., Adv. Math. 285, 937-979 (2015)] concerning the A2 Toda system, namely, the case A = 2 - 1 - 1 2 ) . We get the existence and multiplicity of solutions as long as χ(Σ) ≤ 0 and a generic choice of the parameters. We also extend some of the results to the case of general systems.

  10. Yields of O2(b 1 Sigma g +) from reactions of HO2. [in planetary atmospheres

    NASA Technical Reports Server (NTRS)

    Keyser, L. F.; Choo, K. Y.; Leu, M. T.

    1985-01-01

    The production of O2(b 1 Sigma g +) has been monitored for several reactions of the HO2 radical at 300 K using a discharge-flow apparatus with resonance fluorescence and chemiluminescence detection. In all cases, the resulting quantum efficiencies were found to be less than 0.03. O2(b) was observed when F atoms were added to H2O2 in the gas phase. The signal strengths of O2(b) were proportional to initial concentrations of HO2 formed by the F + H2O2 reaction. Observed /O2(b)/, /HO2/, and /OH/ vs /F/0 were analyzed using a simple three-step mechanism and a more complete computer simulation with 22 reaction steps. The results indicate that the F + HO2 reaction yields O2(b) with an efficiency of (3.6 + or - 1.4) x 10 to the -3rd. Yields from the O + OH2 reaction were less than 0.02, indicating that this reaction cannot be a major source of the O2(b) emission observed in the earth's nightglow.

  11. Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice.

    PubMed

    Perez, Elizabeth M; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

    2017-03-21

    Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year.

  12. TRAF1 knockdown alleviates palmitate-induced insulin resistance in HepG2 cells through NF-κB pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Wanlu; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, 19 Qixiu Road, Nantong 226001, Jiangsu Province; Tang, Zhuqi

    High-fat diet (HFD) and inflammation are key contributors to insulin resistance (IR) and Type 2 diabetes mellitus (T2DM). With HFD, plasma free fatty acids (FFAs) can activate the nuclear factor-κB (NF-κB) in target tissues, then initiate negative crosstalk between FFAs and insulin signaling. However, the molecular link between IR and inflammation remains to be identified. We here reported that tumor necrosis factor receptor-associated factor 1 (TRAF1), an adapter in signal transduction, was involved in the onset of IR in hepatocytes. TRAF1 was significantly up-regulated in insulin-resistant liver tissues and palmitate (PA)-treated HepG2 cells. In addition, we showed that depletion ofmore » TRAF1 led to inhibition of the activity of NF-κB. Given the fact that the activation of NF-κB played a facilitating role in IR, the phosphorylation of Akt and GSK3β was also analyzed. We found that depletion of TRAF1 markedly reversed PA-induced attenuation of the phosphorylation of Akt and GSK3β in the cells. The accumulation of lipid droplets in hepatocyte and expression of two key gluconeogenic enzymes, PEPCK and G6Pase, were also determined and found to display a similar tendency with the phosphorylation of Akt and GSK3β. Glucose uptake assay indicated that knocking down TRAF1 blocked the effect of PA on the suppression of glucose uptake. These data implicated that TRAF1 knockdown might alleviate PA-induced IR in HepG2 cells through NF-κB pathway. - Highlights: • TRAF1 accelerated PA-induced IR in HepG2 cells mediated through NF-κB signaling. • Knockdown of TRAF1 alleviated PA-induced IR in HepG2 cells. • Knockdown of TRAF1 alleviated PA-induced lipid accumulation in HepG2 cells. • Knockdown of TRAF1 reversed PA-induced suppression of glucose uptake in HepG2 cells. • Knockdown of TRAF1 reversed PA-induced gluconeogenesis in HepG2 cells.« less

  13. Uncoupling of the ITIM receptor G6b-B from the tyrosine phosphatases Shp1 and Shp2 disrupts platelet homeostasis in mice.

    PubMed

    Geer, Mitchell J; van Geffen, Johanna P; Gopalasingam, Piraveen; Vögtle, Timo; Smith, Christopher W; Heising, Silke; Kuijpers, Marijke J E; Tullemans, Bibian M E; Jarvis, Gavin E; Eble, Johannes A; Jeeves, Mark; Overduin, Michael; Heemskerk, Johan W M; Mazharian, Alexandra; Senis, Yotis A

    2018-06-11

    The immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing receptor G6b-B has emerged as a key regulator of platelet homeostasis. However, it remains unclear how it mediates its effects. Tyrosine phosphorylation of the ITIM and immunoreceptor tyrosine-based switch motif (ITSM) within the cytoplasmic tail of G6b-B provides a docking site for SH2 domain-containing protein-tyrosine phosphatases Shp1 and Shp2, which are also critical regulators of platelet production and function. In this study, we investigate the physiological consequences of uncoupling G6b-B from Shp1 and Shp2. To address this, we generated a transgenic mouse model expressing a mutant form of G6b-B in which tyrosine (Y) residues 212 and 238 within the ITIM and ITSM were mutated to phenylalanine (F), respectively. Mice homozygous for the mutation (G6b-B diY/F) were macrothrombocytopenic, due to a reduction in platelet production, had large clusters of megakaryocytes and myelofibrosis at sites of hematopoiesis, similar to that observed in G6b knockout (G6b KO) mice. Platelets from G6b-B diY/F mice were hypo-responsive to collagen, due to a significant reduction in expression of the immunoreceptor tyrosine-based activation motif (ITAM)-containing collagen receptor complex GPVI-FcR γ-chain, and thrombin, that could be partially rescued by co-stimulating the platelets with ADP. In contrast, platelets from G6b-B diY/F, G6b KO and megakaryocyte-specific Shp2 KO mice were hyper-responsive to antibody-mediated cross-linking of the hemi-ITAM-containing podoplanin receptor CLEC-2, suggesting that G6b-B inhibits CLEC-2-mediated platelet activation through Shp2. Findings from this study demonstrate that G6b-B must engage with Shp1 and Shp2 in order to mediate its regulatory effects on platelet homeostasis. Copyright © 2018 American Society of Hematology.

  14. Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice

    PubMed Central

    Perez, Elizabeth M.; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

    2017-01-01

    Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that EBV glycoprotein(s)-based VLPs have excellent immunogenicity, and represent a potentially safe vaccine that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year. PMID:27926486

  15. [Pseudolaric acid B induces G2/M arrest and inhibits invasion and migration in HepG2 hepatoma cells].

    PubMed

    Li, Shuai; Guo, Lianyi

    2018-01-01

    Objective To investigate the mechanisms of pseudolaric acid B (PAB) blocks cell cycle and inhibits invasion and migration in human hepatoma HepG2 cells. Methods The proliferation effect of PAB on HepG2 cells was evaluated by MTT assay. The effect of PAB on the cell cycle of HepG2 cells was analyzed by flow cytometry. Immunofluorescence cytochemical staining was applied to observe the effect of PAB on the α-tubulin polymerization and expression in HepG2 cells. Transwell TM chamber invasion assay and wound healing assay were performed to detect the influence of PAB on the migration and invasion ability of HepG2 cells. Western blotting was used to determine the expressions of α-tubulin, E-cadherin and MMP-9 in HepG2 cells after treated with PAB. Results PAB inhibited the proliferation of HepG2 cells in a dose-dependent manner and blocked the cell cycle in G2/M phase. PAB significantly changed the polymerization and decreased the expression of α-tubulin. The capacities of invasion and migration of HepG2 cells treated by PAB were significantly depressed. The protein levels of α-tubulin and MMP-9 decreased while the E-cadherin protein level increased. Conclusion PAB can inhibits the proliferation of HepG2 cells by down-regulating the expression of α-tubulin and influencing its polymerization, arresting HepG2 cells in G2/M phase. Meanwhile, PAB also can inhibit the invasion and migration of HepG2 cells by lowering cytoskeleton α-tubulin and MMP-9, and increasing E-cadherin.

  16. On the origin of the system PSR B 1757-24/SNR G 5.4-1.2

    NASA Astrophysics Data System (ADS)

    Gvaramadze, V. V.

    2004-03-01

    A scenario for the origin of the system PSR B 1757-24/supernova remnant (SNR) G 5.4-1.2 is proposed. It is suggested that both objects are the remnants of a supernova (SN) that exploded within a pre-existing bubble blown-up by a runaway massive star (the SN progenitor) during the final (Wolf-Rayet) phase of its evolution. This suggestion implies that (a) the SN blast centre was significantly offset from the geometric centre of the wind-blown bubble (i.e. from the centre of the future SNR), (b) the bubble was surrounded by a massive wind-driven shell, and (c) the SN blast wave was drastically decelerated by the interaction with the shell. Therefore, one can understand how the relatively young and low-velocity pulsar PSR B 1757-24 was able to escape from the associated SNR G 5.4-1.2 and why the inferred vector of pulsar transverse velocity does not point away from the geometric centre of the SNR. A possible origin of the radio source G 5.27-0.9 (located between PSR B 1757-24 and the SNR G 5.4-1.2) is proposed. It is suggested that G 5.27-0.9 is a lobe of a low Mach number (≃1.7) jet of gas outflowing from the interior of G 5.4-1.2 through the hole bored in the SNR's shell by the escaping pulsar. It is also suggested that the non-thermal emission of the comet-shaped pulsar wind nebula originates in the vicinity of the termination shock and in the cylindric region of subsonically moving shocked pulsar wind. The role of magnetized wind-driven shells (swept-up during the Wolf-Rayet phase from the ambient interstellar medium with the regular magnetic field) in formation of elongated axisymmetric SNRs is discussed.

  17. Protein Tyrosine Phosphatase 1B Inhibition and Glucose Uptake Potentials of Mulberrofuran G, Albanol B, and Kuwanon G from Root Bark of Morus alba L. in Insulin-Resistant HepG2 Cells: An In Vitro and In Silico Study.

    PubMed

    Paudel, Pradeep; Yu, Ting; Seong, Su Hui; Kuk, Eun Bi; Jung, Hyun Ah; Choi, Jae Sue

    2018-05-22

    Type II diabetes mellitus (T2DM) is the most common form of diabetes and has become a major health problem across the world. The root bark of Morus alba L. is widely used in Traditional Chinese Medicine for treatment and management of diabetes. The aim of the present study was to evaluate the enzyme inhibitory potentials of three principle components, mulberrofuran G ( 1 ), albanol B ( 2 ), and kuwanon G ( 3 ) in M. alba root bark against diabetes, establish their enzyme kinetics, carry out a molecular docking simulation, and demonstrate the glucose uptake activity in insulin-resistant HepG2 cells. Compounds 1 ⁻ 3 showed potent mixed-type enzyme inhibition against protein tyrosine phosphatase 1B (PTP1B) and α-glucosidase. In particular, molecular docking simulations of 1 ⁻ 3 demonstrated negative binding energies in both enzymes. Moreover, 1 ⁻ 3 were non-toxic up to 5 µM concentration in HepG2 cells and enhanced glucose uptake significantly and decreased PTP1B expression in a dose-dependent manner in insulin-resistant HepG2 cells. Our overall results depict 1 ⁻ 3 from M. alba root bark as dual inhibitors of PTP1B and α-glucosidase enzymes, as well as insulin sensitizers. These active constituents in M. alba may potentially be utilized as an effective treatment for T2DM.

  18. Nuclease Digestion and Mass Spectrometric Characterization of Oligodeoxyribonucleotides Containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG Cisplatin Intrastrand Cross-links

    PubMed Central

    Williams, Renee T.; Nalbandian, Jenifer; Tu, Audrey; Wang, Yinsheng

    2013-01-01

    Background The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, towards the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. Methods We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with 15N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). Results 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5′ or 3′ terminus revealed that the dinucleotide carries a terminal 5′ phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. Results The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. PMID:23266768

  19. The H,G_1,G_2 photometric system with scarce observational data

    NASA Astrophysics Data System (ADS)

    Penttilä, A.; Granvik, M.; Muinonen, K.; Wilkman, O.

    2014-07-01

    The H,G_1,G_2 photometric system was officially adopted at the IAU General Assembly in Beijing, 2012. The system replaced the H,G system from 1985. The 'photometric system' is a parametrized model V(α; params) for the magnitude-phase relation of small Solar System bodies, and the main purpose is to predict the magnitude at backscattering, H := V(0°), i.e., the (absolute) magnitude of the object. The original H,G system was designed using the best available data in 1985, but since then new observations have been made showing certain features, especially near backscattering, to which the H,G function has troubles adjusting to. The H,G_1,G_2 system was developed especially to address these issues [1]. With a sufficient number of high-accuracy observations and with a wide phase-angle coverage, the H,G_1,G_2 system performs well. However, with scarce low-accuracy data the system has troubles producing a reliable fit, as would any other three-parameter nonlinear function. Therefore, simultaneously with the H,G_1,G_2 system, a two-parameter version of the model, the H,G_{12} system, was introduced [1]. The two-parameter version ties the parameters G_1,G_2 into a single parameter G_{12} by a linear relation, and still uses the H,G_1,G_2 system in the background. This version dramatically improves the possibility to receive a reliable phase-curve fit to scarce data. The amount of observed small bodies is increasing all the time, and so is the need to produce estimates for the absolute magnitude/diameter/albedo and other size/composition related parameters. The lack of small-phase-angle observations is especially topical for near-Earth objects (NEOs). With these, even the two- parameter version faces problems. The previous procedure with the H,G system in such circumstances has been that the G-parameter has been fixed to some constant value, thus only fitting a single-parameter function. In conclusion, there is a definitive need for a reliable procedure to produce

  20. Cardiovascular effects of anti-G suit inflation at 1 and 2 G.

    PubMed

    Montmerle, Stéphanie; Linnarsson, Dag

    2005-06-01

    We sought to determine to which pressure a full-coverage anti-G suit needs to be inflated in order to obtain the same stroke volume during a brief exposure to twice the normal gravity (2 G) as that at 1 G without anti-G suit inflation. Nine sitting subjects were studied at normal (1 G) and during 20 s of exposure to 2 G. They wore anti-G suits, which were inflated at both G-levels to the following target pressures: 0, 70, 140 and 210 mmHg. Stroke volume was computed from cardiac output, which was measured by rebreathing. Heart rate and mean arterial pressure at heart level were recorded. Inflation to 70 mmHg compensated for the decrease in stroke volume and cardiac output caused by hypergravity. Mean arterial pressure at heart level was comparable at 1 G and at 2 G and increased gradually and similarly with inflation (P<0.001) at both gravity levels. Thus, anti-G suits act by increasing both preload and afterload but the two effects counteract each other in terms of cardiac output, so that cardiac output at 2 G is maintained at its 1 G level. This effect is reached already at 70 mmHg of inflation. Greater inflation pressure further increases mean arterial pressure at heart level and compensates for the increased difference in hydrostatic pressure between heart and head in moderate hypergravity.

  1. Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

    PubMed

    Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

    2016-11-01

    Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G 0 /G 1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Comprehensive phenotypic analysis of knockout mice deficient in cyclin G1 and cyclin G2

    PubMed Central

    Ohno, Shouichi; Ikeda, Jun-ichiro; Naito, Yoko; Okuzaki, Daisuke; Sasakura, Towa; Fukushima, Kohshiro; Nishikawa, Yukihiro; Ota, Kaori; Kato, Yorika; Wang, Mian; Torigata, Kosuke; Kasama, Takashi; Uchihashi, Toshihiro; Miura, Daisaku; Yabuta, Norikazu; Morii, Eiichi; Nojima, Hiroshi

    2016-01-01

    Cyclin G1 (CycG1) and Cyclin G2 (CycG2) play similar roles during the DNA damage response (DDR), but their detailed roles remain elusive. To investigate their distinct roles, we generated knockout mice deficient in CycG1 (G1KO) or CycG2 (G2KO), as well as double knockout mice (DKO) deficient in both proteins. All knockouts developed normally and were fertile. Generation of mouse embryonic fibroblasts (MEFs) from these mice revealed that G2KO MEFs, but not G1KO or DKO MEFs, were resistant to DNA damage insults caused by camptothecin and ionizing radiation (IR) and underwent cell cycle arrest. CycG2, but not CycG1, co-localized with γH2AX foci in the nucleus after γ-IR, and γH2AX-mediated DNA repair and dephosphorylation of CHK2 were delayed in G2KO MEFs. H2AX associated with CycG1, CycG2, and protein phosphatase 2A (PP2A), suggesting that γH2AX affects the function of PP2A via direct interaction with its B’γ subunit. Furthermore, expression of CycG2, but not CycG1, was abnormal in various cancer cell lines. Kaplan–Meier curves based on TCGA data disclosed that head and neck cancer patients with reduced CycG2 expression have poorer clinical prognoses. Taken together, our data suggest that reduced CycG2 expression could be useful as a novel prognostic marker of cancer. PMID:27982046

  3. The 590 cm-1 B_1g feature in underdoped Bi_2Sr_2CaCu_2O_8+δ

    NASA Astrophysics Data System (ADS)

    Hewitt, Kevin C.; Wang, N. L.; Irwin, J. C.; Pooke, D. M.; Pantoja, A. E.; Trodahl, H. J.

    1999-05-01

    Raman scattering studies have been performed on underdoped Bi_2Sr_2CaCu_2O_8+δ. In single crystals underdoped by oxygen removal, a 590 cm-1 peak is observed in the B_1g spectrum. The feature is observed to soften in frequency by 3.8% with isotopic exchange of ^16O by ^18O. In contrast, the 590 cm-1 peak is not observed in crystals underdoped by Y substitution which suggests that it corresponds to a disorder induced vibrational mode. We have also found that underdoping leads to a depletion of low energy spectral weight from regions of the Fermi surface located near the Brillouin zone axes.

  4. Fucosterol activates the insulin signaling pathway in insulin resistant HepG2 cells via inhibiting PTP1B.

    PubMed

    Jung, Hyun Ah; Bhakta, Himanshu Kumar; Min, Byung-Sun; Choi, Jae Sue

    2016-10-01

    Insulin resistance is a characteristic feature of type 2 diabetes mellitus (T2DM) and is characterized by defects in insulin signaling. This study investigated the modulatory effects of fucosterol on the insulin signaling pathway in insulin-resistant HepG2 cells by inhibiting protein tyrosine phosphatase 1B (PTP1B). In addition, molecular docking simulation studies were performed to predict binding energies, the specific binding site of fucosterol to PTP1B, and to identify interacting residues using Autodock 4.2 software. Glucose uptake was determined using a fluorescent D-glucose analogue and the glucose tracer 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxyglucose, and the signaling pathway was detected by Western blot analysis. We found that fucosterol enhanced insulin-provoked glucose uptake and conjointly decreased PTP1B expression level in insulin-resistant HepG2 cells. Moreover, fucosterol significantly reduced insulin-stimulated serine (Ser307) phosphorylation of insulin receptor substrate 1 (IRS1) and increased phosphorylation of Akt, phosphatidylinositol-3-kinase, and extracellular signal- regulated kinase 1 at concentrations of 12.5, 25, and 50 µM in insulin-resistant HepG2 cells. Fucosterol inhibited caspase-3 activation and nuclear factor kappa B in insulin-resistant hepatocytes. These results suggest that fucosterol stimulates glucose uptake and improves insulin resistance by downregulating expression of PTP1B and activating the insulin signaling pathway. Thus, fucosterol has potential for development as an anti-diabetic agent.

  5. Nonadiabatic couplings in the collisional removal of O(2)(b (1)Sigma(g) (+),v) by O(2).

    PubMed

    Dayou, F; Hernández, M I; Campos-Martínez, J; Hernández-Lamoneda, R

    2010-01-28

    The effect of nonadiabatic couplings on the collisional removal of O(2)(b (1)Sigma(g) (+),v) by O(2)(X (3)Sigma(g) (-), v=0) is investigated. Two-dimensional adiabatic and quasidiabatic potential energy surfaces for the excited dimer states and the corresponding nonadiabatic radial couplings have been computed by means of ab initio calculations. Alternately, a two-state theoretical model, based on the Landau-Zener and Rosen-Zener-Demkov assumptions, has been employed to derive analytical forms for the nonadiabatic couplings and an adiabatic-to-diabatic transformation only depending on a reduced set of adiabatic energy terms. Compared to the ab initio results, the predictions of the model are found to be highly accurate. Quantum dynamics calculations for the removal of the first ten vibrational states of O(2)(b (1)Sigma(g) (+),v) indicate a clear dominant contribution of the vibration-electronic relaxation mechanism relative to the vibration-translation energy transfer. Although the present reduced-dimensionality model precludes any quantitative comparison with experiments, it is found that the removal probabilities for v=1-3 are qualitatively consistent with the experimental observations, once the vibrational structure of the fragments is corrected with spectroscopical terms. Besides, the model served to show how the computation of the adiabatic PESs just at the crossing seam was sufficient to describe the nonadiabatic dynamics related to a given geometrical arrangement. This implies considerable savings in the calculations which will eventually allow for larger accuracy in the ab initio calculations as well as higher dimensional treatments.

  6. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  7. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  8. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  9. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  10. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It is not required that the total deductions, or the total amount of any deduction, to which section 642(g) is...

  11. Effects of 2.0-g 1.75-g and 1.5-g Hypergravity on Pregnancy Outcome in Rats (Rattus norvegicus)

    NASA Technical Reports Server (NTRS)

    Mills, Nicole A.; Baer, Lisa A.; Ronca, April E.

    2001-01-01

    In 1995, ten pregnant female rats were launched on the Space Shuttle (STS-70) on Gestational day(G) 11 of their 22-day pregnancy as part of the NASA/NIH.Rodent (R)2 Experiment. Following landing on G20, fetuses were harvested from half of the dams, while the remaining five dams underwent birth. Spaceflight did not interrupt pregnancy, alter litter sizes, or affect body weights or gender ratios of the fetuses or neonates. In the present study we used the NASA/NIH.R2 experimental paradigm to analyze the effects of hypergravity on pregnancy outcome. On G10, time-bred Sprague-Dawley rat dams were assigned to either G20 or Birth conditions, then further assigned to Hypergravity (HG) 2.0-g, HG 1.75-g, HG 1.5-g, Rotational Control (RC, 1.03), or Stationary Control (SC, 1.0-g) treatments. Dams were exposed to continuous centrifugation from G11 through G20, with brief daily stops for animal health checks and maintenance. For both the G20 and Birth dams, comparable litter sizes and litter gender ratios were observed across gravity conditions. However, centrifugation-exposed (HG and RC) fetuses and neonates showed significantly lower body masses (p less than 0.05) relative to SC offspring. HG 2.0-g offspring weighed significantly less than those in all other gravity conditions (p less than 0.05). The observed reductions in offspring body mass at 1.5-g and 1.75-g, can be attributed to the rotational component of centrifugation, rather than to increased gravitational load, whereas 2.0-g hypergravity exposure further exacerbated the gravity centrifugation effect on offspring body mass. Pregnant dams exposed to centrifugation weighed significantly less than SC dams (p less than 0.05), suggesting that centrifugation effects on maternal body mass may contribute to reduced size of the developing offspring. These findings are consistent with previous reports of non-pregnant adult animals suggesting that, whereas spaceflight has virtually no effect on body mass, centrifugation is

  12. Collisional relaxation of O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) by atmospherically relevant species

    NASA Astrophysics Data System (ADS)

    Pejaković, Dušan A.; Campbell, Zachary; Kalogerakis, Konstantinos S.; Copeland, Richard A.; Slanger, Tom G.

    2011-09-01

    Laboratory measurements are reported of the rate coefficient for collisional removal of O2(X^3Σ _g^ -, υ = 1) by O(3P), and the rate coefficients for removal of O2(a1Δg, υ = 1) by O2, CO2, and O(3P). A two-laser method is employed, in which the pulsed output of the first laser at 285 nm photolyzes ozone to produce oxygen atoms and O2(a1Δg, υ = 1), and the output of the second laser detects O2(a1Δg, υ = 1) via resonance-enhanced multiphoton ionization. The kinetics of O2(X^3Σ _g^ -, υ = 1) + O(3P) relaxation is inferred from the temporal evolution of O2(a1Δg, υ = 1), an approach enabled by the rapid collision-induced equilibration of the O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) populations in the system. The measured O2(X^3Σ _g^ -, υ = 1) + O(3P) rate coefficient is (2.9 ± 0.6) × 10-12 cm3 s-1 at 295 K and (3.4 ± 0.6) × 10-12 cm3 s-1 at 240 K. These values are consistent with the previously reported result of (3.2 ± 1.0) × 10-12 cm3 s-1, which was obtained at 315 K using a different experimental approach [K. S. Kalogerakis, R. A. Copeland, and T. G. Slanger, J. Chem. Phys. 123, 194303 (2005)]. For removal of O2(a1Δg, υ = 1) by O(3P), the upper limits for the rate coefficient are 4 × 10-13 cm3 s-1 at 295 K and 6 × 10-13 cm3 s-1 at 240 K. The rate coefficient for removal of O2(a1Δg, υ = 1) by O2 is (5.6 ± 0.6) × 10-11 cm3 s-1 at 295 K and (5.9 ± 0.5) × 10-11 cm3 s-1 at 240 K. The O2(a1Δg, υ = 1) + CO2 rate coefficient is (1.5 ± 0.2) × 10-14 cm3 s-1 at 295 K and (1.2 ± 0.1) × 10-14 cm3 s-1 at 240 K. The implications of the measured rate coefficients for modeling of atmospheric emissions are discussed.

  13. Calibration of mass and conventional mass of weights 2 kg, 1 kg, 200 g, 50 g, 1 g and 200 mg

    NASA Astrophysics Data System (ADS)

    Becerra, Luis Omar; Peña, Luis Manuel; Escalante Vargas, Boris; Cori Almonte, Luz; Martín Quiroga Rojas, Aldo; Bermúdez Coronel, Álvaro; Escobar Soto, Jhon J.; Naula, Wilson; Florencio, Arnaldo; Lourdes Valenzuela, María; Ramos Alfaro, Olman; Prenda Peña, Marcela

    2018-01-01

    This report describes the results of a supplementary comparison between SIM NMIs, which was carried out to evaluate the consistency of the measurements of calibration in high accuracy mass standards using the normalized error criteria (2 kg, 1 kg, 200 g, 50 g, 1 g and 200 mg). The supplementary comparison was carried out from April 2012 to July 2013. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  14. Study of infrared emission spectroscopy for the B{sup 1}Δ{sub g}–A{sup 1}Π{sub u} and B{sup ′1}Σ{sub g}{sup +}–A{sup 1}Π{sub u} systems of C{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Wang, E-mail: sc19321@s.okayama-u.ac.jp, E-mail: okakent@okayama-u.ac.jp, E-mail: pbernath@odu.edu; Kawaguchi, Kentarou, E-mail: sc19321@s.okayama-u.ac.jp, E-mail: okakent@okayama-u.ac.jp, E-mail: pbernath@odu.edu; Tang, Jian, E-mail: jtang@okayama-u.ac.jp

    Thirteen bands for the B{sup 1}Δ{sub g}–A{sup 1}Π{sub u} system and eleven bands for the B{sup ′1}Σ{sub g}{sup +}–A{sup 1}Π{sub u} system of C{sub 2} were identified in the Fourier transform infrared emission spectra of hydrocarbon discharges. The B{sup ′1}Σ{sub g}{sup +} v = 4 and the B{sup 1}Δ{sub g} v = 6, 7, and 8 vibrational levels involved in nine bands were studied for the first time. A direct global analysis with Dunham parameters was carried out satisfactorily for the B{sup 1}Δ{sub g}–A{sup 1}Π{sub u} system except for a small perturbation in the B{sup 1}Δ{sub g} v = 6more » level. The calculated rovibrational term energies up to B{sup 1}Δ{sub g} v = 12 showed that the level crossing between the B{sup 1}Δ{sub g} and d{sup 3}Π{sub g} states is responsible for many of the prominent perturbations in the Swan system observed previously. Nineteen forbidden transitions of the B{sup 1}Δ{sub g}–a{sup 3}Π{sub u} transition were identified and the off-diagonal spin-orbit interaction constant A{sub dB} between d{sup 3}Π{sub g} and B{sup 1}Δ{sub g} was derived as 8.3(1) cm{sup −1}. For the B{sup ′1}Σ{sub g}{sup +}–A{sup 1}Π{sub u} system, only individual band analyses for each vibrational level in the B′{sup 1}Σ{sub g}{sup +} state could be done satisfactorily and Dunham parameters obtained from these effective parameters showed that the anharmonic vibrational constant ω{sub e}x{sub e} is anomalously small (nearly zero). Inspection of the RKR (Rydberg-Klein-Rees) potential curves for the B{sup ′1}Σ{sub g}{sup +} and X{sup 1}Σ{sub g}{sup +} states revealed that an avoided crossing or nearly avoided crossing may occur around 30 000 cm{sup −1}, which is responsible for the anomalous molecular constants in these two states.« less

  15. Enniatin A1, enniatin B1 and beauvericin on HepG2: Evaluation of toxic effects.

    PubMed

    Juan-García, Ana; Ruiz, María-José; Font, Guillermina; Manyes, Lara

    2015-10-01

    Hepatotoxicity of three Fusarium mycotoxins, beauvericin (BEA) and two enniatins (ENNs) ENN A1 and ENN B1, in hepatocarcinoma cells (HepG2) were evaluated and compared. Concentrations used were 1.5 and 3 μM at 24, 48 and 72 h for each mycotoxin. Flow cytometry was used to examine enniatins effects on cell proliferation, to characterize the cell cycle phase where the cells blocked and to study the mitochondria role in ENNs-induced apoptosis. ENN B1 treated cells showed a time dependent G1 blockade at both concentrations used. ENN A1 and BEA decreased the apoptotic-necrotic percentage of cells comparing to control and disrupted the MMP as observed by TMRM and ToPro-3 fluorochromes signal. It is proposed a decreasing mycotoxin order by number of effects as follows: BEA > ENN B1 > ENN A1, with 47, 20 and 16%, respectively out of all situations compared. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Extreme ultraviolet spectroscopy of G191-B2B - Direct observation of ionization edges

    NASA Technical Reports Server (NTRS)

    Wilkinson, Erik; Green, James C.; Cash, Webster

    1992-01-01

    We present the first spectrum of the hot, DA white dwarf G191-B2B (wd 0501 + 527) between 200 and 330 A. The spectrum, which has about 2 A resolution, was obtained with a sounding rocket-borne, grazing incidence spectrograph. The spectrum shows no evidence of He II, the expected primary opacity source in this wavelength region. Three ionization edges and one absorption feature were observed and are suggestive of O III existing in the photosphere of G191-B2B. Also noted is a broad spectral depression that may result from Fe VI in the photosphere.

  17. Experimental and theoretical investigation of homogeneous gaseous reaction of CO2(g) + nH2O(g) + nNH3(g) → products (n = 1, 2).

    PubMed

    Li, Zhuangjie; Zhang, Baoquan

    2012-09-13

    Decreasing CO2 emissions into the atmosphere is key for reducing global warming. To facilitate the CO2 emission reduction efforts, our laboratory conducted experimental and theoretical investigations of the homogeneous gaseous reaction of CO2(g) + nH2O(g) + nNH3(g) → (NH4)HCO3(s)/(NH4)2CO3(s) (n = 1 and 2) using Fourier transform infrared attenuated total reflectance (FTIR-ATR) spectroscopy and ab initio molecular orbital theory. Our FTIR-ATR experimental results indicate that (NH4)2CO3(s) and (NH4)HCO3(s) are formed as aerosol particulate matter when carbon dioxide reacts with ammonia and water in the gaseous phase at room temperature. Ab initio study of this chemical system suggested that the reaction may proceed through formation of NH3·H2O(g), NH3·CO2(g), and CO2·H2O(g) complexes. Subsequent complexes, NH3·H2O·CO2 and (NH3)2·H2O·CO2, can be formed by adding gaseous reactants to the NH3·H2O(g), NH3·CO2(g), and CO2·H2O(g) complexes, respectively. The NH3·H2O·CO2 and (NH3)2·H2O·CO2 complexes can then be rearranged to produce (NH4)HCO3 and (NH4)2CO3 as final products via a transition state, and the NH3 molecule acts as a medium accepting and donating hydrogen atoms in the rearrangement process. Our computational results also reveal that the presence of an additional water molecule can reduce the activation energy of the rearrangement process. The high activation energy predicted in the present work suggests that the reaction is kinetically not favored, and our experimental observation of (NH4)HCO3(s) and (NH4)2CO3(s) may be attributed to the high concentrations of reactants increasing the reaction rate of the title reactions in the reactor.

  18. High resolution spectral analysis of oxygen. I. Isotopically invariant Dunham fit for the X(3)Σ(g)(-), a(1)Δ(g), b(1)Σ(g)(+) states.

    PubMed

    Yu, Shanshan; Miller, Charles E; Drouin, Brian J; Müller, Holger S P

    2012-07-14

    We have developed a simultaneous global fit to the MW, THz, infrared, visible, and UV transitions of all six oxygen isotopologues, (16)O(16)O, (16)O(17)O, (16)O(18)O, (17)O(17)O, (17)O(18)O, (18)O(18)O, with the objective of predicting all transitions below the O((3)P) + O((3)P) dissociation threshold as well as the B(3)Σ(u) (-) state from O((3)P)+O((1)D) within state-of-the-art experimental uncertainty. Here, we report an isotopically invariant Dunham fit for the lowest three electronic states, X(3)Σ(g)(-), a(1)Δ(g), and b(1)Σ(g)(+). Experimental transition frequencies involving these three states of all six O(2) isotopologues were critically reviewed and incorporated into the analysis. For the (16)O(16)O isotopologue, experimental data sample vibrational states v = 0-31 for X(3)Σ(g)(-), v = 0-10 for a(1)Δ(g), and v = 0-12 for b(1)Σ(g)(+). To the best of our knowledge, this is the first analysis that simultaneously fits spectra from all six O(2) isotopologues.

  19. Real Lives, Relevant Texts: A Survey of B2G Children's Counternarratives

    ERIC Educational Resources Information Center

    Davis, Danné E.

    2017-01-01

    In recent years, natal males' assertions of being girls born in the wrong body have been unwelcome in elementary scholastic contexts. Several reasons call for individuals who teach or plan to teach young children to know about boy-to-girl (B2G) performance counternarratives. First, there is increasing visibility of B2G lives among elementary…

  20. Association of Interleukin-2-330T/G and Interleukin-10-1082A/G Genetic Polymorphisms with B-Cell Non-Hodgkin Lymphoma in a Cohort of Egyptians.

    PubMed

    Abdel Rahman, Hala Aly; Khorshied, Mervat Mamdooh; Reda Khorshid, Ola Mohamed; Mourad, Heba Mahmoud

    2018-05-25

    Polymorphisms in the interleukin (IL)-2 and IL-10 genes are known to be associated with susceptibility to different immune-dysregulated disorders and cancers such as non-Hodgkin lymphoma (NHL). To explore the possible association between IL-2-330T/G and IL-10-1082A/G single-nucleotide polymorphisms and the susceptibility to B-cell NHL (B-NHL) in Egyptians, we conducted a case-control study. Genotyping of the studied genetic variations was done for 100 B-NHL patients as well as 100 age- and sex-matched healthy controls. The IL-2 variant allele occurred at a significantly higher rate in patients than controls and was associated with susceptibility to B-NHL [odds ratio (OR): 1.91, 95% confidence interval (CI): 1.28-2.85]. It was also associated with advanced performance status score. IL-2 polymorphism conferred an almost threefold increased risk of diffuse large B-cell lymphoma (OR: 2.64, 95% CI: 1.35-5.15) and a fourfold increased risk of indolent subtypes (OR: 4.34, 95% CI: 1.20-15.7). The distribution of IL-10-1082A/G genotypes in our patients was close to that of the controls. Co-inheritance of the variant genotypes of IL-2 and the common genotype of IL-10 conferred an almost sixfold increased risk (OR: 5.75, 95% CI: 1.39-23.72), while co-inheritance of the variant genotypes of IL-2 and IL-10 conferred fivefold increased risk of B-NHL (OR: 5.43, 95% CI: 1.44-20.45). The variant genotypes of IL-2-330T/G and IL-10-1082A/G had no effect on the disease-free survival of B-NHL patients. The present study highlights the possible involvement of the IL-2-330T/G genetic polymorphism in the susceptibility to B-NHL in Egypt, especially indolent subtypes. Moreover, IL-10-1082A/G is not a molecular susceptibility marker for B-NHL in Egyptians.

  1. The association between PAI-1 -675 4G/5G polymorphism and type 2 diabetes mellitus.

    PubMed

    Chen, L; Li, S-Y; Liu, M

    2017-08-15

    In this study, we aimed to analyze the association between plasminogen activator inhibitor 1 (PAI-1) -675 4G/5G polymorphism and type 2 diabetes mellitus (T2DM) risk. We included in 187 T2DM patients and 186 heathy controls between 2014 and 2017 from Tianjin Gong An Hospital, China. All patients and controls were ethnically Chinese Han population. The primers and polymerase chain reaction (PCR) conditions were performed. Results from this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in four genetic models. Additionally, PAI-1 -675 4G/5G polymorphism was not associated with clinical and laboratory characteristics, such as age, gender, body mass index, systolic blood pressure, diastolic blood pressure, total cholesterol, triglycerides, and HbA1c. In conclusion, this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in this population.

  2. KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

    PubMed Central

    Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

    2012-01-01

    CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

  3. Long-range magnetic order in the Heisenberg pyrochlore antiferromagnets G d2G e2O7 and G d2P t2O7 synthesized under high pressure

    NASA Astrophysics Data System (ADS)

    Li, X.; Cai, Y. Q.; Cui, Q.; Lin, C. J.; Dun, Z. L.; Matsubayashi, K.; Uwatoko, Y.; Sato, Y.; Kawae, T.; Lv, S. J.; Jin, C. Q.; Zhou, J.-S.; Goodenough, J. B.; Zhou, H. D.; Cheng, J.-G.

    2016-12-01

    G d2S n2O7 and G d2T i2O7 have been regarded as good experimental realizations of the classical Heisenberg pyrochlore antiferromagnet with dipolar interaction. The former was found to adopt the Palmer-Chalker state via a single, first-order transition at TN≈1 K , while the latter enters a distinct, partially ordered state through two successive transitions at TN 11 K and TN 2= 0.75 K . To shed more light on their distinct magnetic ground states, we have synthesized two more gadolinium-based pyrochlore oxides, G d2G e2O7 and G d2P t2O7 , under high-pressure conditions and performed detailed characterizations via x-ray powder diffraction, dc and ac magnetic susceptibility, and specific heat measurements down to 100 mK. We found that both compounds enter a long-range antiferromagnetically ordered state through a single, first-order transition at TN= 1.4 K for G d2G e2O7 and TN= 1.56 K for G d2P t2O7 , with the specific heat anomaly similar to that of G d2S n2O7 rather than G d2T i2O7 . Interestingly, the low-temperature magnetic specific heat values of both G d2G e2O7 and G d2P t2O7 were found to follow nicely the T3 dependence as expected for a three-dimensional antiferromagnet with gapless spin-wave excitations. We have rationalized the enhancement of TN in terms of the reduced Gd-Gd distances for the chemically pressurized G d2G e2O7 and the addition of extra superexchange pathways through the empty Pt -eg orbitals for G d2P t2O7 . Our current study has expanded the family of gadolinium-based pyrochlores and permits us to achieve a better understanding of their distinct magnetic properties in a more comprehensive perspective.

  4. Linoleic acid-menthyl ester reduces the secretion of apolipoprotein B100 in HepG2 cells.

    PubMed

    Inoue, Nao; Yamano, Naomi; Sakata, Kotaro; Arao, Keisuke; Kobayashi, Takashi; Nagao, Toshihiro; Shimada, Yuji; Nagao, Koji; Yanagita, Teruyoshi

    2009-01-01

    The effect of linoleic acid-menthyl ester (LAME) on lipid metabolism were assessed in HepG2 cells. It is well known that high level of apolipoprotein (apo) B100 in the serum is risk for atherosclerosis. Although linoleic acid (LA) treatment and LA plus L-mentol treatment increased apo B100 secretion, LAME treatment significantly decreased apo B100 secretion in HepG2 cells compared with control medium. The hypolipidemic effect of LAME was attributable to the suppression of triglyceride synthesis in HepG2 cells. It is also known that the risk of coronary heart disease is negatively related to the concentration of serum apo A-1. In the present study, LAME treatment increased apo A-1 secretion as compared with LA treatment in HepG2 cells. These results suggest that mentyl-esterification of fatty acids may be beneficial in anti-atherogenic dietary therapy.

  5. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2

    PubMed Central

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E.; Chen, Shuang; Bodie, Wesley W.; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A.; Kramer, Lora B.; Dent, Paul

    2011-01-01

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138+ cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138+ primary samples, but spared normal CD138− and CD34+ cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G0/G1 arrest and increased apoptosis in all cell-cycle phases, including G0/G1. To determine whether this regimen is active against quiescent G0/G1 MM cells, cells were cultured in low-serum medium to enrich the G0/G1 population. G0/G1–enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G0/G1–enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G0) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst+), low pyronin Y (PY)–staining (2N Hst+/PY−) G0 population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition. PMID:21911831

  6. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

    PubMed

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

    2011-11-10

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

  7. Reactions of small negative ions with O2(a 1[Delta]g) and O2(X 3[Sigma]g-)

    NASA Astrophysics Data System (ADS)

    Midey, Anthony; Dotan, Itzhak; Seeley, J. V.; Viggiano, A. A.

    2009-02-01

    The rate constants and product ion branching ratios were measured for the reactions of various small negative ions with O2(X 3[Sigma]g-) and O2(a 1[Delta]g) in a selected ion flow tube (SIFT). Only NH2- and CH3O- were found to react with O2(X) and both reactions were slow. CH3O- reacted by hydride transfer, both with and without electron detachment. NH2- formed both OH-, as observed previously, and O2-, the latter via endothermic charge transfer. A temperature study revealed a negative temperature dependence for the former channel and Arrhenius behavior for the endothermic channel, resulting in an overall rate constant with a minimum at 500 K. SF6-, SF4-, SO3- and CO3- were found to react with O2(a 1[Delta]g) with rate constants less than 10-11 cm3 s-1. NH2- reacted rapidly with O2(a 1[Delta]g) by charge transfer. The reactions of HO2- and SO2- proceeded moderately with competition between Penning detachment and charge transfer. SO2- produced a SO4- cluster product in 2% of reactions and HO2- produced O3- in 13% of the reactions. CH3O- proceeded essentially at the collision rate by hydride transfer, again both with and without electron detachment. These results show that charge transfer to O2(a 1[Delta]g) occurs readily if the there are no restrictions on the ion beyond the reaction thermodynamics. The SO2- and HO2- reactions with O2(a) are the only known reactions involving Penning detachment besides the reaction with O2- studied previously [R.S. Berry, Phys. Chem. Chem. Phys., 7 (2005) 289-290].

  8. Enzymatic Formation of G-Group Aflatoxins and Biosynthetic Relationship between G- and B-Group Aflatoxins

    PubMed Central

    Yabe, Kimiko; Nakamura, Miki; Hamasaki, Takashi

    1999-01-01

    We detected biosynthetic activity for aflatoxins G1 and G2 in cell extracts of Aspergillus parasiticus NIAH-26. We found that in the presence of NADPH, aflatoxins G1 and G2 were produced from O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin, respectively. No G-group aflatoxins were produced from aflatoxin B1, aflatoxin B2, 5-methoxysterigmatocystin, dimethoxysterigmatocystin, or sterigmatin, confirming that B-group aflatoxins are not the precursors of G-group aflatoxins and that G- and B-group aflatoxins are independently produced from the same substrates (O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin). In competition experiments in which the cell-free system was used, formation of aflatoxin G2 from dihydro-O-methylsterigmatocystin was suppressed when O-methylsterigmatocystin was added to the reaction mixture, whereas aflatoxin G1 was newly formed. This result indicates that the same enzymes can catalyze the formation of aflatoxins G1 and G2. Inhibition of G-group aflatoxin formation by methyrapone, SKF-525A, or imidazole indicated that a cytochrome P-450 monooxygenase may be involved in the formation of G-group aflatoxins. Both the microsome fraction and a cytosol protein with a native mass of 220 kDa were necessary for the formation of G-group aflatoxins. Due to instability of the microsome fraction, G-group aflatoxin formation was less stable than B-group aflatoxin formation. The ordA gene product, which may catalyze the formation of B-group aflatoxins, also may be required for G-group aflatoxin biosynthesis. We concluded that at least three reactions, catalyzed by the ordA gene product, an unstable microsome enzyme, and a 220-kDa cytosol protein, are involved in the enzymatic formation of G-group aflatoxins from either O-methylsterigmatocystin or dihydro-O-methylsterigmatocystin. PMID:10473388

  9. The selectivity of conantokin-G for ion channel inhibition of NR2B subunit-containing NMDA receptors is regulated by amino acid residues in the S2 region of NR2B

    PubMed Central

    Sheng, Zhenyu; Liang, Zhong; Geiger, James H.; Prorok, Mary; Castellino, Francis J.

    2009-01-01

    The conantokins are short, naturally-occurring peptides that inhibit ion flow through N-methyl-D-aspartate receptor (NMDAR) channels. One member of this peptide family, conantokin-G (con-G), specifically antagonizes NR2B-containing NMDAR channels, whereas other known conantokins are less selective inhibitors with regard to the nature of the NR2 subunit of the NMDAR complex. In order to define the molecular determinants of NR2B that govern con-G selectivity, we evaluated the ability of con-G to inhibit NMDAR ion channels expressed in human embryonic kidney (HEK)293 cells transfected with NR1, in combination with various NR2A/2B chimeras and point mutants, by electrophysiology using cells voltage-clamped in the whole cell configuration. We found that a variant of the con-G-insensitive subunit, NR2A, in which the 158 residues comprising the S2 peptide segment (E657-I814) were replaced by the corresponding S2 region of NR2B (E658-I815), results in receptors that are highly sensitive to inhibition by con-G. Of the 22 amino acids that are different between the NR2A-S2 and the NR2B-S2 regions, exchange of one of these, M739 of NR2B for the equivalent K738 of NR2A, was sufficient to completely import the inhibitory activity of con-G into NR1b/NR2A-containing NMDARs. Some reinforcement of this effect was found by substitution of a second amino acid, K755 of NR2B for Y754 of NR2A. The discovery of the molecular determinants of NR2B selectivity with con-G has implications for the design of subunit-selective neurobiological probes and drug therapies, in addition to advancing our understanding of NR2B- versus NR2A-mediated neurological processes. PMID:19427876

  10. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with type 2 diabetes risk

    PubMed Central

    Zhao, Luqian; Huang, Ping

    2013-01-01

    A number of studies were performed to assess the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and susceptibility to type 2 diabetes (T2DM). However, the results were inconsistent and inconclusive. In the present study, the possible association was investigated by a meta-analysis. Eligible articles were identified for the period up to June 2013. Pooled odds ratios (OR) with 95% confidence intervals (CI) were appropriately derived from random-effects models or fixed-effects models. Fourteen case-control studies with a total of 2487 cases and 3538 controls were eligible. In recessive model, PAI-1 4G/5G polymorphism was associated with T2DM risk (OR = 1.23; 95% CI 1.07-1.41; P = 0.004). In the subgroup analysis by ethnicity, a significant association was found among Asians (OR = 1.27; 95% CI 1.08-1.51; P = 0.005). This meta-analysis suggested that PAI-1 4G/5G polymorphism may be associated with T2DM development. PMID:24040470

  11. Association of MMP-1 -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population.

    PubMed

    Lepetsos, Panagiotis; Pampanos, Andreas; Kanavakis, Emmanouil; Tzetis, Maria; Korres, Dimitrios; Papavassiliou, Athanasios G; Efstathopoulos, Nicolaos

    2014-09-01

    Osteoarthritis is the most common form of arthritis with still unknown pathogenic etiology and considerable contribution of genetic factors. One of the mechanisms of cartilage degradation in osteoarthritis is enzymatic proteolysis of the extracellular matrix by metalloproteinases. MMP-1, produced by chondrocytes and synovial cells, is a major proteinase of the MMPs family. The present study aims at evaluating the association of MMP1 gene -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population. One hundred fifty five patients with primary symptomatic knee osteoarthritis participated in the study along with 139 controls. Genotypes were determined using PCR-RLFP technique. Allelic and genotypic frequencies were compared between both study groups. There was no significant association between MMP1 -1607 1G/2G polymorphism and knee osteoarthritis, in crude analysis; however, after multiple logistic regression analysis, 1G/2G was associated with reduced odds of knee osteoarthritis by 75% in males, compared to genotypes 1G/1G + 2G/2G, adjusting for age and BMI (adjusted OR: 0.25, 95% CI: 0.069, 0.910, p = 0.035). The present study shows that MMP1 -1607 1G/2G (rs1799750) polymorphism might be a risk factor for knee osteoarthritis susceptibility in the Greek population. Further investigations are needed to confirm this association in the pathogenesis of osteoarthritis. © 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  12. 26 CFR 1.860G-2T - Other rules (temporary).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

  13. 26 CFR 1.860G-2T - Other rules (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

  14. ELECTRON IMPACT DISSOCIATION X {sup 1}{Sigma}{sup +} {sub g} {yields} b {sup 3}{Sigma} {sub u} {sup +} AND EXCITATIONS X {sup 1}{Sigma}{sup +} {sub g} {yields} a {sup 3}{Sigma} {sub g} {sup +} AND X {sup 1}{Sigma}{sup +} {sub g} {yields} B {sup 1}{Sigma} {sub u} {sup +} OF MOLECULAR HYDROGEN IN NONTHERMAL ASTROPHYSICAL PLASMAS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ki, Dae-Han; Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr

    We investigate the electronic transitions X {sup 1}{Sigma}{sup +} {sub g} {yields} b {sup 3}{Sigma} {sub u} {sup +}, X {sup 1}{Sigma}{sup +} {sub g} {yields} a {sup 3}{Sigma} {sub g} {sup +}, and X {sup 1}{Sigma}{sup +} {sub g} {yields} B {sup 1}{Sigma} {sub u} {sup +} of molecular hydrogen by studying electron impacts in astrophysical Lorentzian plasmas. Useful fitting formulae for the X {sup 1}{Sigma}{sup +} {sub g} {yields} b {sup 3}{Sigma} {sub u} {sup +}, X {sup 1}{Sigma}{sup +} {sub g} {yields} a {sup 3}{Sigma} {sub g} {sup +}, and X {sup 1}{Sigma}{sup +} {sub g} {yields}more » B {sup 1}{Sigma} {sub u} {sup +} excitation cross sections are employed in order to obtain the electronic excitation rate coefficients of H{sub 2} as functions of the spectral index and temperature. In low-temperature regions, it is found that the excitation rate coefficients R{sub b{sup 3}{Sigma}{sub u{sup {sub +}}}}, R{sub a{sup 3}{Sigma}{sub g{sup {sub +}}}}, and R{sub B{sub {sup 1}{Sigma}{sub u{sup {sub +}}}}} of H{sub 2} in non-Maxwellian plasmas are smaller than those in Maxwellian plasmas. However, in high-temperature regions, the excitation rate coefficients of H{sub 2} in non-Maxwellian plasmas are greater than those in Maxwellian plasmas. It is also shown that the X {sup 1}{Sigma}{sup +} {sub g} {yields} b {sup 3}{Sigma} {sub u} {sup +} excitation rate coefficient is the main contributor in low-temperature regions. In contrast, it is found that the X {sup 1}{Sigma}{sup +} {sub g} {yields} B {sup 1}{Sigma} {sub u} {sup +} electronic excitation is dominant in high-temperature regions.« less

  15. Possible detection of an emission feature near 584 A in the direction of G191-B2B

    NASA Technical Reports Server (NTRS)

    Green, James; Bowyer, Stuart; Jelinsky, Patrick

    1990-01-01

    A possible spectral emission feature is reported in the direction of the nearby hot white dwarf G191-B2B at 581.5 + or - 6 A with a significance of 3.8 sigma. This emission has been identified as He I 584.3 A. The emission cannot be due to local geocoronal emission or interplanetary backscatter of solar He I 584 A emission because the feature is not detected in a nearby sky exposure. Possible sources for this emission are examined, including the photosphere of G191-B2B, the comparison star G191-B2A, and a possible nebulosity near or around G191-B2B. The parameters required to explain the emission are derived for each case. All of these explanations require unexpected physical conditions; hence we believe this result must receive confirming verification despite the statistical likelihood of the detection.

  16. PLK1 Activation in Late G2 Sets Up Commitment to Mitosis.

    PubMed

    Gheghiani, Lilia; Loew, Damarys; Lombard, Bérangère; Mansfeld, Jörg; Gavet, Olivier

    2017-06-06

    Commitment to mitosis must be tightly coordinated with DNA replication to preserve genome integrity. While we have previously established that the timely activation of CyclinB1-Cdk1 in late G2 triggers mitotic entry, the upstream regulatory mechanisms remain unclear. Here, we report that Polo-like kinase 1 (Plk1) is required for entry into mitosis during an unperturbed cell cycle and is rapidly activated shortly before CyclinB1-Cdk1. We determine that Plk1 associates with the Cdc25C1 phosphatase and induces its phosphorylation before mitotic entry. Plk1-dependent Cdc25C1 phosphosites are sufficient to promote mitotic entry, even when Plk1 activity is inhibited. Furthermore, we find that activation of Plk1 during G2 relies on CyclinA2-Cdk activity levels. Our findings thus elucidate a critical role for Plk1 in CyclinB1-Cdk1 activation and mitotic entry and outline how CyclinA2-Cdk, an S-promoting factor, poises cells for commitment to mitosis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Aurora-B/AIM-1 Regulates the Dynamic Behavior of HP1α at the G2–M Transition

    PubMed Central

    2006-01-01

    Heterochromatin protein 1 (HP1) plays an important role in heterochromatin formation and undergoes large-scale, progressive dissociation from heterochromatin in prophase cells. However, the mechanisms regulating the dynamic behavior of HP1 are poorly understood. In this study, the role of Aurora-B was investigated with respect to the dynamic behavior of HP1α. Mammalian Aurora-B, AIM-1, colocalizes with HP1α to the heterochromatin in G2. Depletion of Aurora-B/AIM-1 inhibited dissociation of HP1α from the chromosome arms at the G2–M transition. In addition, depletion of INCENP led to aberrant cellular localization of Aurora-B/AIM-1, but it did not affect heterochromatin targeting of HP1α. It was proposed in the binary switch hypothesis that phosphorylation of histone H3 at Ser-10 negatively regulates the binding of HP1α to the adjacent methylated Lys-9. However, Aurora-B/AIM-1-mediated phosphorylation of H3 induced dissociation of the HP1α chromodomain but not of the intact protein in vitro, indicating that the center and/or C-terminal domain of HP1α interferes with the effect of H3 phosphorylation on HP1α dissociation. Interestingly, Lys-9 methyltransferase SUV39H1 is abnormally localized together along the metaphase chromosome arms in Aurora-B/AIM-1–depleted cells. In conclusion, these results showed that Aurora-B/AIM-1 is necessary for regulated histone modifications involved in binding of HP1α by the N terminus of histone H3 during mitosis. PMID:16687578

  18. Activation of farnesoid X receptor promotes triglycerides lowering by suppressing phospholipase A2 G12B expression.

    PubMed

    Liu, Qingli; Yang, Meng; Fu, Xuekun; Liu, Renzhong; Sun, Caijun; Pan, Haobo; Wong, Chi-Wai; Guan, Min

    2016-11-15

    As a novel mediator of hepatic very low-density lipoproteins (VLDL) secretion, phospholipase A2 G12B (PLA2G12B) is transcriptionally regulated by hepatocyte nuclear factor-4 alpha (HNF-4α). Farnesoid X receptor (FXR) plays a critical role in maintaining bile acids and triglycerides (TG) homeostasis. Here we report that FXR regulates serum TG level in part through PLA2G12B. Activation of FXR by chenodeoxycholic acid (CDCA) or GW4064 significantly decreased PLA2G12B expression in HepG2 cells. PLA2G12B expression was transcriptionally repressed due to an FXR-mediated up-regulation of small heterodimer partner (SHP) which functionally suppresses HNF-4α activity. We found that hepatic PLA2G12B expression was suppressed and serum TG level reduced in high fat diet mice treated with CDCA. Concurrently, CDCA treatment lowered hepatic VLDL-TG secretion. Our data demonstrate that activation of FXR promotes TG lowering, not only by decreasing de novo lipogenesis but also reducing hepatic secretion of TG-rich VLDL particles in part through suppressing PLA2G12B expression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. The Association of PSR B1757-24 and the SNR G5.4-1.2

    NASA Astrophysics Data System (ADS)

    Gvaramadze, V. V.

    The association of PSR B1757-24 and the supernova remnant (SNR) G5.4-1.2 was recently questioned by Thorsett et al. (2002) on the basis of proper motion measurements of the pulsar and the "incorrect" orientation of the vector of pulsar transverse velocity (inferred from the orientation of the cometary-shaped pulsar wind nebula). We show, however, that the association could be real if both objects are the remnants of an off-centered cavity supernova explosion.

  20. Atmospherically Related Studies of O(D-1) and O2 (b'Sigma(sub g, sup +)

    NASA Technical Reports Server (NTRS)

    Slanger, Tom G.

    1998-01-01

    For the third year of the grant, we propose to investigate the (beta)'(Sigma)(sub g, sup +). Our earlier value of 0.77 +/- 0.23, which has been used for a long time, should be updated, and the error limits reduced. Current measurements in J. Barker's group at the University of Michigan have assigned a value closer to 0.9, and we will conduct a new evaluation. The goals of this project are to investigate various aspects of the photochemistry of O('D) and O2(beta)'(Sigma)(sub g, sup +) that are of relevance to the photochemistry and energy balance of the terrestrial atmosphere. Over the last six months, we have obtained new sky spectra data files from the Keck telescope via Don Osterbrock at UC Santa Cruz, and now 120 hours of data have been accumulated. Thus, we have been able to make large signal/noise improvements of the O2(b'(Sigma)(sub g, sup +) - X(sup 3)(Sigma)(Sub g, sup -) Atmospheric Band data that we are collecting.

  1. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  2. Human IgG2- and IgG4-expressing memory B cells display enhanced molecular and phenotypic signs of maturity and accumulate with age.

    PubMed

    de Jong, Britt G; IJspeert, Hanna; Marques, Lemelinda; van der Burg, Mirjam; van Dongen, Jacques Jm; Loos, Bruno G; van Zelm, Menno C

    2017-10-01

    The mechanisms involved in sequential immunoglobulin G (IgG) class switching are still largely unknown. Sequential IG class switching is linked to higher levels of somatic hypermutation (SHM) in vivo, but it remains unclear if these are generated temporally during an immune response or upon activation in a secondary response. We here aimed to uncouple these processes and to distinguish memory B cells from primary and secondary immune responses. SHM levels and IgG subclasses were studied with 454 pyrosequencing on blood mononuclear cells from young children and adults as models for primary and secondary immunological memory. Additional sequencing and detailed immunophenotyping with IgG subclass-specific antibodies was performed on purified IgG + memory B-cell subsets. In both children and adults, SHM levels were higher in transcripts involving more downstream-located IGHG genes (esp. IGHG2 and IGHG4). In adults, SHM levels were significantly higher than in children, and downstream IGHG genes were more frequently utilized. This was associated with increased frequencies of CD27 + IgG + memory B cells, which contained higher levels of SHM, more IGHG2 usage, and higher expression levels of activation markers than CD27 - IgG + memory B cells. We conclude that secondary immunological memory accumulates with age and these memory B cells express CD27, high levels of activation markers, and carry high SHM levels and frequent usage of IGHG2. These new insights contribute to our understanding of sequential IgG subclass switching and show a potential relevance of using serum IgG2 levels or numbers of IgG2-expressing B cells as markers for efficient generation of memory responses.

  3. Spreading of HIV-1 subtype G and envB/gagG recombinant strains among injecting drug users in Lisbon, Portugal.

    PubMed

    Esteves, Aida; Parreira, Ricardo; Piedade, João; Venenno, Teresa; Franco, Margarida; Germano de Sousa, José; Patrício, Luis; Brum, Paula; Costa, António; Canas-Ferreira, Wanda F

    2003-06-01

    We have evaluated the genetic diversity of HIV-1 strains infecting injecting drug users (IDUs) in Lisbon, Portugal. Heteroduplex mobility assay and/or phylogenetic analysis revealed that env (C2V3C3 or gp41) subtype B is present in 63.7% of the 135 viral samples studied, followed by subtypes G (23.7%), A (6.7%), F (5.2%), and D (0.7%). Similar analysis of gag (p24/p7) performed on 91 of the specimens demonstrated that 49.5% of the infections were caused by subtype G viruses; other gag subtypes identified were B (39.5%), F (3.3%), A and D (1.1.% each), and the recombinant circulating form CRF02_AG (5.5%). Discordant env/gag sub-types were detected in 34.1% of the strains and may reflect the presence of dual infections and/or recombinant viruses. The presumptive B/G recombinant form was highly predominant (21 of 31). The genetic pattern of HIV-1 subtype B and G strains is suggestive of multiple introductions and recombination episodes and of a longstanding presence of both subtypes in the country. C2V3C3 amino acid sequences from IDU-derived subtype G viruses presented highly significant signatures, which distinguish the variants from this transmission group. The unusually high prevalence of subtype G sequences (34.1%), independent of the geographic origin of the infected individuals, makes this IDU HIV-1 epidemic unique.

  4. HAER COLO,30LAKWD.V,2G (sheet 1 of 1) Glenn L. Martin ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HAER COLO,30-LAKWD.V,2G- (sheet 1 of 1) - Glenn L. Martin Company, Titan Missile Test Facilities, Cold Flow Laboratory Building B, Waterton Canyon Road & Colorado Highway 121, Lakewood, Jefferson County, CO

  5. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  6. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  7. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  8. Hetero-oligomeric Complex between the G Protein-coupled Estrogen Receptor 1 and the Plasma Membrane Ca2+-ATPase 4b*

    PubMed Central

    Tran, Quang-Kim; VerMeer, Mark; Burgard, Michelle A.; Hassan, Ali B.; Giles, Jennifer

    2015-01-01

    The new G protein-coupled estrogen receptor 1 (GPER/GPR30) plays important roles in many organ systems. The plasma membrane Ca2+-ATPase (PMCA) is essential for removal of cytoplasmic Ca2+ and for shaping the time courses of Ca2+-dependent activities. Here, we show that PMCA and GPER/GPR30 physically interact and functionally influence each other. In primary endothelial cells, GPER/GPR30 agonist G-1 decreases PMCA-mediated Ca2+ extrusion by promoting PMCA tyrosine phosphorylation. GPER/GPR30 overexpression decreases PMCA activity, and G-1 further potentiates this effect. GPER/GPR30 knockdown increases PMCA activity, whereas PMCA knockdown substantially reduces GPER/GPR30-mediated phosphorylation of the extracellular signal-related kinase (ERK1/2). GPER/GPR30 co-immunoprecipitates with PMCA with or without treatment with 17β-estradiol, thapsigargin, or G-1. Heterologously expressed GPER/GPR30 in HEK 293 cells co-localizes with PMCA4b, the main endothelial PMCA isoform. Endothelial cells robustly express the PDZ post-synaptic density protein (PSD)-95, whose knockdown reduces the association between GPER/GPR30 and PMCA. Additionally, the association between PMCA4b and GPER/GPR30 is substantially reduced by truncation of either or both of their C-terminal PDZ-binding motifs. Functionally, inhibition of PMCA activity is significantly reduced by truncation of GPER/GPR30's C-terminal PDZ-binding motif. These data strongly indicate that GPER/GPR30 and PMCA4b form a hetero-oligomeric complex in part via the anchoring action of PSD-95, in which they constitutively affect each other's function. Activation of GPER/GPR30 further inhibits PMCA activity through tyrosine phosphorylation of the pump. These interactions represent cross-talk between Ca2+ signaling and GPER/GPR30-mediated activities. PMID:25847233

  9. Hetero-oligomeric Complex between the G Protein-coupled Estrogen Receptor 1 and the Plasma Membrane Ca2+-ATPase 4b.

    PubMed

    Tran, Quang-Kim; VerMeer, Mark; Burgard, Michelle A; Hassan, Ali B; Giles, Jennifer

    2015-05-22

    The new G protein-coupled estrogen receptor 1 (GPER/GPR30) plays important roles in many organ systems. The plasma membrane Ca(2+)-ATPase (PMCA) is essential for removal of cytoplasmic Ca(2+) and for shaping the time courses of Ca(2+)-dependent activities. Here, we show that PMCA and GPER/GPR30 physically interact and functionally influence each other. In primary endothelial cells, GPER/GPR30 agonist G-1 decreases PMCA-mediated Ca(2+) extrusion by promoting PMCA tyrosine phosphorylation. GPER/GPR30 overexpression decreases PMCA activity, and G-1 further potentiates this effect. GPER/GPR30 knockdown increases PMCA activity, whereas PMCA knockdown substantially reduces GPER/GPR30-mediated phosphorylation of the extracellular signal-related kinase (ERK1/2). GPER/GPR30 co-immunoprecipitates with PMCA with or without treatment with 17β-estradiol, thapsigargin, or G-1. Heterologously expressed GPER/GPR30 in HEK 293 cells co-localizes with PMCA4b, the main endothelial PMCA isoform. Endothelial cells robustly express the PDZ post-synaptic density protein (PSD)-95, whose knockdown reduces the association between GPER/GPR30 and PMCA. Additionally, the association between PMCA4b and GPER/GPR30 is substantially reduced by truncation of either or both of their C-terminal PDZ-binding motifs. Functionally, inhibition of PMCA activity is significantly reduced by truncation of GPER/GPR30's C-terminal PDZ-binding motif. These data strongly indicate that GPER/GPR30 and PMCA4b form a hetero-oligomeric complex in part via the anchoring action of PSD-95, in which they constitutively affect each other's function. Activation of GPER/GPR30 further inhibits PMCA activity through tyrosine phosphorylation of the pump. These interactions represent cross-talk between Ca(2+) signaling and GPER/GPR30-mediated activities. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Some Arguments in Support of the Association of PSR B1706-44 with the Supernova Remnant G343.1-2.3

    NASA Astrophysics Data System (ADS)

    Bock, D. C.-J.; Gvaramadze, V. V.

    We present some arguments in support of the association of the pulsar PSR B1706-44 with the supernova remnant G343.1-2.3, based on the idea that these objects could be the result of a supernova explosion within a mushroom-like cavity (created by the supernova progenitor wind breaking out of the parent molecular cloud). We suggest that in addition to the known bright "half" of G343.1-2.3 there should exist a more extended and weaker component, such that the actual shape of G343.1 2.3 is similar to that of the well-known SNR VRO 42.05.01. We have found such a component in archival radio data.

  11. Ab initio and transition state theory study of the OH + HO2 → H2O + O2(3Σg-)/O2(1Δg) reactions: yield and role of O2(1Δg) in H2O2 decomposition and in combustion of H2.

    PubMed

    Monge-Palacios, M; Sarathy, S Mani

    2018-02-07

    Reactions of hydroxyl (OH) and hydroperoxyl (HO 2 ) are important for governing the reactivity of combustion systems. We performed post-CCSD(T) ab initio calculations at the W3X-L//CCSD = FC/cc-pVTZ level to explore the triplet ground-state and singlet excited-state potential energy surfaces of the OH + HO 2 → H 2 O + O 2 ( 3 Σ g - )/O 2 ( 1 Δ g ) reactions. Using microcanonical and multistructural canonical transition state theories, we calculated the rate constant for the triplet and singlet channels over the temperature range 200-2500 K, represented by k(T) = 3.08 × 10 12 T 0.07  exp(1151/RT) + 8.00 × 10 12 T 0.32  exp(-6896/RT) and k(T) = 2.14 × 10 6 T 1.65  exp(-2180/RT) in cm 3 mol -1 s -1 , respectively. The branching ratios show that the yield of singlet excited oxygen is small (<0.5% below 1000 K). To ascertain the importance of singlet oxygen channel, our new kinetic information was implemented into the kinetic model for hydrogen combustion recently updated by Konnov (Combust. Flame, 2015, 162, 3755-3772). The updated kinetic model was used to perform H 2 O 2 thermal decomposition simulations for comparison against shock tube experiments performed by Hong et al. (Proc. Combust. Inst., 2013, 34, 565-571), and to estimate flame speeds and ignition delay times in H 2 mixtures. The simulation predicted a larger amount of O 2 ( 1 Δ g ) in H 2 O 2 decomposition than that predicted by Konnov's original model. These differences in the O 2 ( 1 Δ g ) yield are due to the use of a higher ab initio level and a more sophisticated methodology to compute the rate constant than those used in previous studies, thereby predicting a significantly larger rate constant. No effect was observed on the rate of the H 2 O 2 decomposition and on the flame speeds and ignition delay times of different H 2 -oxidizer mixtures. However, if the oxidizer is seeded with O 3 , small differences appear in the flame speed. Given that O 2 ( 1 Δ g ) is much more reactive than O

  12. Interaction of the PA2G4 (EBP1) protein with ErbB-3 and regulation of this binding by heregulin

    PubMed Central

    Yoo, J-Y; Wang, X W; Rishi, A K; Lessor, T; Xia, X-M; Gustafson, T A; Hamburger, A W

    2000-01-01

    The processes by which ErbB-3, an inactive tyrosine kinase, exerts its biological effects are poorly understood. Using the yeast two-hybrid system, we have isolated an ErbB-3 binding protein (Ebp1) that interacts with the juxtamembrane domain of ErbB-3. This protein is identical to that predicted to be encoded for by the human PA2G4 gene. Ebp1 is the human homologue of a previously identified cell cycle-regulated mouse protein p38-2G4. Two transcripts of ebp1 mRNA (1.7 and 2.2 kb) were detected in several normal human organs. The interaction of Ebp1 with ErbB-3 was examined in vitro and in vivo. The first 15 amino acids of the juxtamembrane domain of ErbB-3 were essential for Ebp1 binding in vitro. Treatment of AU565 cells with the ErbB-3 ligand heregulin resulted in dissociation of Ebp1 from ErbB-3. Ebp1 translocated from the cytoplasm into the nucleus following heregulin stimulation. These findings suggest that Ebp1 may be a downstream member of an ErbB-3-regulated signal transduction pathway. © 2000 Cancer Research Campaign PMID:10682683

  13. Topical herpes simplex virus 2 (HSV-2) vaccination with human papillomavirus vectors expressing gB/gD ectodomains induces genital-tissue-resident memory CD8+ T cells and reduces genital disease and viral shedding after HSV-2 challenge.

    PubMed

    Çuburu, Nicolas; Wang, Kening; Goodman, Kyle N; Pang, Yuk Ying; Thompson, Cynthia D; Lowy, Douglas R; Cohen, Jeffrey I; Schiller, John T

    2015-01-01

    No herpes simplex virus 2 (HSV-2) vaccine has been licensed for use in humans. HSV-2 glycoproteins B (gB) and D (gD) are targets of neutralizing antibodies and T cells, but clinical trials involving intramuscular (i.m.) injection of HSV-2 gB and gD in adjuvants have not been effective. Here we evaluated intravaginal (ivag) genetic immunization of C57BL/6 mice with a replication-defective human papillomavirus pseudovirus (HPV PsV) expressing HSV-2 gB (HPV-gB) or gD (HPV-gD) constructs to target different subcellular compartments. HPV PsV expressing a secreted ectodomain of gB (gBsec) or gD (gDsec), but not PsV expressing a cytoplasmic or membrane-bound form, induced circulating and intravaginal-tissue-resident memory CD8(+) T cells that were able to secrete gamma interferon (IFN-γ) and tumor necrosis factor alpha (TNF-α) as well as moderate levels of serum HSV neutralizing antibodies. Combined immunization with HPV-gBsec and HPV-gDsec (HPV-gBsec/gDsec) vaccines conferred longer survival after vaginal challenge with HSV-2 than immunization with HPV-gBsec or HPV-gDsec alone. HPV-gBsec/gDsec ivag vaccination was associated with a reduced severity of genital lesions and lower levels of viral shedding in the genital tract after HSV-2 challenge. In contrast, intramuscular vaccination with a soluble truncated gD protein (gD2t) in alum and monophosphoryl lipid A (MPL) elicited high neutralizing antibody titers and improved survival but did not reduce genital lesions and viral shedding. Vaccination combining ivag HPV-gBsec/gDsec and i.m. gD2t-alum-MPL improved survival and reduced genital lesions and viral shedding. Finally, high levels of circulating HSV-2-specific CD8(+) T cells, but not serum antibodies, correlated with reduced viral shedding. Taken together, our data underscore the potential of HPV PsV as a platform for a topical mucosal vaccine to control local manifestations of primary HSV-2 infection. Genital herpes is a highly prevalent chronic disease caused by

  14. Topical Herpes Simplex Virus 2 (HSV-2) Vaccination with Human Papillomavirus Vectors Expressing gB/gD Ectodomains Induces Genital-Tissue-Resident Memory CD8+ T Cells and Reduces Genital Disease and Viral Shedding after HSV-2 Challenge

    PubMed Central

    Çuburu, Nicolas; Wang, Kening; Goodman, Kyle N.; Pang, Yuk Ying; Thompson, Cynthia D.; Lowy, Douglas R.; Cohen, Jeffrey I.

    2014-01-01

    ABSTRACT No herpes simplex virus 2 (HSV-2) vaccine has been licensed for use in humans. HSV-2 glycoproteins B (gB) and D (gD) are targets of neutralizing antibodies and T cells, but clinical trials involving intramuscular (i.m.) injection of HSV-2 gB and gD in adjuvants have not been effective. Here we evaluated intravaginal (ivag) genetic immunization of C57BL/6 mice with a replication-defective human papillomavirus pseudovirus (HPV PsV) expressing HSV-2 gB (HPV-gB) or gD (HPV-gD) constructs to target different subcellular compartments. HPV PsV expressing a secreted ectodomain of gB (gBsec) or gD (gDsec), but not PsV expressing a cytoplasmic or membrane-bound form, induced circulating and intravaginal-tissue-resident memory CD8+ T cells that were able to secrete gamma interferon (IFN-γ) and tumor necrosis factor alpha (TNF-α) as well as moderate levels of serum HSV neutralizing antibodies. Combined immunization with HPV-gBsec and HPV-gDsec (HPV-gBsec/gDsec) vaccines conferred longer survival after vaginal challenge with HSV-2 than immunization with HPV-gBsec or HPV-gDsec alone. HPV-gBsec/gDsec ivag vaccination was associated with a reduced severity of genital lesions and lower levels of viral shedding in the genital tract after HSV-2 challenge. In contrast, intramuscular vaccination with a soluble truncated gD protein (gD2t) in alum and monophosphoryl lipid A (MPL) elicited high neutralizing antibody titers and improved survival but did not reduce genital lesions and viral shedding. Vaccination combining ivag HPV-gBsec/gDsec and i.m. gD2t-alum-MPL improved survival and reduced genital lesions and viral shedding. Finally, high levels of circulating HSV-2-specific CD8+ T cells, but not serum antibodies, correlated with reduced viral shedding. Taken together, our data underscore the potential of HPV PsV as a platform for a topical mucosal vaccine to control local manifestations of primary HSV-2 infection. IMPORTANCE Genital herpes is a highly prevalent chronic

  15. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Income from Sources Without the United States § 1.904(g)-2 Recapture...

  16. Targeting human prostate cancer with 111In-labeled D2B IgG, F(ab')2 and Fab fragments in nude mice with PSMA-expressing xenografts.

    PubMed

    Lütje, Susanne; van Rij, Catharina M; Franssen, Gerben M; Fracasso, Giulio; Helfrich, Wijnand; Eek, Annemarie; Oyen, Wim J; Colombatti, Marco; Boerman, Otto C

    2015-01-01

    D2B is a new monoclonal antibody directed against an extracellular domain of prostate-specific membrane antigen (PSMA), which is overexpressed in prostate cancer. The potential of D2B IgG, and F(ab')2 and Fab fragments of this antibody for targeting prostate cancer was determined in mice bearing subcutaneous prostate cancer xenografts. The optimal time point for imaging was determined in biodistribution and microSPECT imaging studies with (111)In-D2B IgG, (111)In-capromab pendetide, (111)In-D2B F(ab')2 and (111)In-D2B Fab fragments in mice with PSMA-expressing LNCaP and PSMA-negative PC3 tumors at several time points after injection. All (111)In-labeled antibody formats specifically accumulated in the LNCaP tumors, with highest uptake of (111)In-D2B IgG and (111)In-capromab pendetide at 168 h p.i. (94.8 ± 19.2% injected dose per gram (ID/g) and 16.7 ± 2.2% ID/g, respectively), whereas uptake of (111)In-D2B F(ab')2 and (111)In-D2B Fab fragments peaked at 24 h p.i. (12.1 ± 3.0% ID/g and 15.1 ± 2.9% ID/g, respectively). Maximum LNCaP tumor-to-blood ratios were 13.0 ± 2.3 (168 h p.i.), 6.2 ± 0.7 (24 h p.i.), 23.0 ± 4.0 (24 h p.i.) and 4.5 ± 0.6 (168 h p.i.) for (111)In-D2B IgG, (111)In-F(ab')2, (111)In-Fab and (111)In-capromab pendetide, respectively. LNCaP tumors were clearly visualized with microSPECT with all antibody formats. This study demonstrates the feasibility of D2B IgG, F(ab')2 and Fab fragments for targeting PSMA-expressing prostate cancer xenografts. Copyright © 2014 John Wiley & Sons, Ltd.

  17. A Novel Polysaccharide Conjugate from Bullacta exarata Induces G1-Phase Arrest and Apoptosis in Human Hepatocellular Carcinoma HepG2 Cells.

    PubMed

    Liao, Ningbo; Sun, Liang; Chen, Jiang; Zhong, Jianjun; Zhang, Yanjun; Zhang, Ronghua

    2017-03-01

    Bullacta exarata has been consumed in Asia, not only as a part of the normal diet, but also as a traditional Chinese medicine with liver- and kidney-benefitting functions. Several scientific investigations involving extraction of biomolecules from this mollusk and pharmacological studies on their biological activities have been carried out. However, little is known regarding the antitumor properties of polysaccharides from B. exarata , hence the polysaccharides from B. exarata have been investigated here. One polysaccharide conjugate BEPS-IA was isolated and purified from B. exarata . It mainly consisted of mannose and glucose in a molar ratio of 1:2, with an average molecular weight of 127 kDa. Thirteen general amino acids were identified to be components of the protein-bound polysaccharide. Methylation and NMR studies revealed that BEPS-IA is a heteropolysaccharide consisting of 1,4-linked-α-d-Glc, 1,6-linked-α-d-Man, 1,3,6-linked-α-d-Man, and 1-linked-α-d-Man residue, in a molar ratio of 6:1:1:1. In order to test the antitumor activity of BEPS-IA, we investigated its effect against the growth of human hepatocellular carcinoma cells HepG2 in vitro. The result showed that BEPS-IA dose-dependently exhibited an effective HepG2 cells growth inhibition with an IC 50 of 112.4 μg/mL. Flow cytometry analysis showed that BEPS-IA increased the populations of both apoptotic sub-G1 and G1 phase. The result obtained from TUNEL assay corroborated apoptosis which was shown in flow cytometry. Western blot analysis suggested that BEPS-IA induced apoptosis and growth inhibition were associated with up-regulation of p53, p21 and Bax, down-regulation of Bcl-2. These findings suggest that BEPS-IA may serve as a potential novel dietary agent for hepatocellular carcinoma.

  18. Do serum angiopoietin-1, angiopoietin-2, and their receptor Tie-2 and 4G/5G variant of PAI-1 gene have a role in the pathogenesis of preeclampsia?

    PubMed

    Kamal, Manal; El-Khayat, Waleed

    2011-10-01

    To evaluate whether serum angiogenesis markers such as angiopoietins (Ang-1, Ang-2) and their receptor (Tie-2) are altered in women with preeclampsia. We also performed genotyping to determine if the 4G/5G genotypes of -675 PAI-1 gene may play a role in the pathogenesis of preeclampsia. Sixty-eight pregnant women with preeclampsia were compared to 35 normotensive pregnant women and 24 normotensive nonpregnant women in a cross-sectional study. Using enzyme-linked immunosorbent assay, levels of serum Ang-1 and Ang-2, and Tie-2 were measured. A single base pair insertion/deletion 4G/5G polymorphism of the PAI-1 gene was determined by polymerase chain reaction. Serum levels of Ang-1 and Tie-2 were significantly different among the study groups (P = 0.001 and P = 0.025, respectively) being lower in the preeclamptic group. Positive significant correlation was found between Ang-2 and Tie-2, (r = 0.26, P = 0.024). The frequency of the genotypes (4G/5G, 4G/4G, and 5G/5G) differed among the groups (P = 0.001). Also, the mean of systolic and diastolic blood pressures differed significantly according to the PAI-1 genotype being higher in those bearing the 4G allele; P = 0.04 and P = 0.023, respectively. Sera Ang-1 and Ang-2, and Tie-2 as well as variants of 4G/5G of PAI-1 polymorphism have positive implications in the pathogenesis of preeclampsia.

  19. Increased expression of cyclin B1 mRNA coincides with diminished G{sub 2}-phase arrest in irradiated HeLa cells treated with staurosporine or caffeine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernhard, E.J.; Maity, A.; McKenna, W.G.

    1994-12-01

    The irradiation of cells results in delayed progression through the G{sub 2} phase of the cell cycle. Treatment of irradiated HeLa cells with caffeine greatly reduces the G{sub 2}-phase delay, while caffeine does not alter progression of cells through the cell cycle in unirradiated cells. In this report we demonstrate that treatment of HeLa cells with the kinase inhibitor staurosporine, but not with the inhibitor H7, also results in a reduction of the G{sub 2}-phase arrest after irradiation. Cell cycle progression in unirradiated cells is unaffected by 4.4 nM (2ng/ml) staurosporine, which releases the radiation-induced G{sub 2}-phase arrest. In HeLamore » cells, the G{sub 2}-phase delay after irradiation in S phase is accompanied by decreased expression of cyclin B1 mRNA. Coincident with the reduction in G{sub 2}-phase delay, we observed an increase in cyclin B1 mRNA accumulation in irradiated, staurosporine-treated cells compared to cells treated with irradiation alone. Caffeine treatment of irradiated HeLa cells also resulted in an elevation in the levels of cyclin B1 message. These results support the hypothesis that diminished cyclin B1 mRNA levels influence G{sub 2}-phase arrest to some degree. The findings that both staurosporine and caffeine treatments reverse the depression in cyclin B1 expression suggest that these two compounds may act on a common pathway of cell cycle control in response to radiation injury. 33 refs., 6 figs.« less

  20. Towards G2G: Systems of Technology Database Systems

    NASA Technical Reports Server (NTRS)

    Maluf, David A.; Bell, David

    2005-01-01

    We present an approach and methodology for developing Government-to-Government (G2G) Systems of Technology Database Systems. G2G will deliver technologies for distributed and remote integration of technology data for internal use in analysis and planning as well as for external communications. G2G enables NASA managers, engineers, operational teams and information systems to "compose" technology roadmaps and plans by selecting, combining, extending, specializing and modifying components of technology database systems. G2G will interoperate information and knowledge that is distributed across organizational entities involved that is ideal for NASA future Exploration Enterprise. Key contributions of the G2G system will include the creation of an integrated approach to sustain effective management of technology investments that supports the ability of various technology database systems to be independently managed. The integration technology will comply with emerging open standards. Applications can thus be customized for local needs while enabling an integrated management of technology approach that serves the global needs of NASA. The G2G capabilities will use NASA s breakthrough in database "composition" and integration technology, will use and advance emerging open standards, and will use commercial information technologies to enable effective System of Technology Database systems.

  1. Ionic-liquid-based dispersive liquid-liquid microextraction combined with magnetic solid-phase extraction for the determination of aflatoxins B1 , B2 , G1 , and G2 in animal feeds by high-performance liquid chromatography with fluorescence detection.

    PubMed

    Zhao, Jiao; Zhu, Yan; Jiao, Yang; Ning, Jinyan; Yang, Yaling

    2016-10-01

    A novel two-step extraction technique combining ionic-liquid-based dispersive liquid-liquid microextraction with magnetic solid-phase extraction was developed for the preconcentration and separation of aflatoxins in animal feedstuffs before high-performance liquid chromatography coupled with fluorescence detection. In this work, ionic liquid 1-octyl-3-methylimidazolium hexafluorophosphate was used as the extractant in dispersive liquid-liquid microextraction, and hydrophobic pelargonic acid modified Fe 3 O 4 magnetic nanoparticles as an efficient adsorbent were applied to retrieve the aflatoxins-containing ionic liquid. Notably, the target of magnetic nanoparticles was the ionic liquid rather than the aflatoxins. Because of the rapid mass transfer associated with the dispersive liquid-liquid microextraction and magnetic solid phase steps, fast extraction could be achieved. The main parameters affecting the extraction recoveries of aflatoxins were investigated and optimized. Under the optimum conditions, vortexing at 2500 rpm for 1 min in the dispersive liquid-liquid microextraction and magnetic solid-phase extraction and then desorption by sonication for 2 min with acetonitrile as eluent. The recoveries were 90.3-103.7% with relative standard deviations of 3.2-6.4%. Good linearity was observed with correlation coefficients ranged from 0.9986 to 0.9995. The detection limits were 0.632, 0.087, 0.422 and 0.146 ng/mL for aflatoxins B 1 , B2, G1, and G2, respectively. The results were also compared with the pretreatment method carried out by conventional immunoaffinity columns. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C), in determining the...

  3. IL-27 induces the production of IgG1 by human B cells.

    PubMed

    Boumendjel, Amel; Tawk, Lina; Malefijt, René de Waal; Boulay, Vera; Yssel, Hans; Pène, Jérôme

    2006-12-01

    It has been reported that IL-27 specifically induces the production of IgG2a by mouse B cells and inhibits IL-4-induced IgG1 synthesis. Here, we show that human naïve cord blood expresses a functional IL-27 receptor, consisting of the TCCR and gp130 subunits, although at lower levels as compared to naïve and memory splenic B cells. IL-27 does not induce proliferative responses and does not increase IgG1 production by CD19(+)CD27(+) memory B cells. However, it induces a low, but significant production of IgG1 by naïve CD19(+)CD27(-)IgD(+)IgG(-) spleen and cord blood B cells, activated via CD40, whereas it has no effect on the production of the other IgG subclasses. In addition, IL-27 induces the differentiation of a population of B cells that express high levels of CD38, in association with a down-regulation of surface IgD expression, and that are surface IgG(+/int), CD20(low), CD27(high), indicating that IL-27 promotes isotype switching and plasma cell differentiation of naive B cells. However, as compared to the effects of IL-21 and IL-10, both switch factors for human IgG1 and IgG3, those of IL-27 are modest and regulate exclusively the production of IgG1. Finally, although IL-27 has no effect on IL-4 and anti-CD40-induced Cepsilon germline promoter activity, it up-regulates IL-4-induced IgE production by naive B cells. These results point to a partial redundancy of switch factors regulating the production of IgG1 in humans, and furthermore indicate the existence of a common regulation of the human IgG1and murine IgG2a isotypes by IL-27.

  4. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  5. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 9 2011-04-01 2011-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  6. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 9 2014-04-01 2014-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  7. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  8. Assessment of G3(MP2)//B3 theory including a pseudopotential for molecules containing first-, second-, and third-row representative elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rocha, Carlos Murilo Romero; Morgon, Nelson Henrique; Custodio, Rogério, E-mail: roger@iqm.unicamp.br

    2013-11-14

    G3(MP2)//B3 theory was modified to incorporate compact effective potential (CEP) pseudopotentials, providing a theoretical alternative referred to as G3(MP2)//B3-CEP for calculations involving first-, second-, and third-row representative elements. The G3/05 test set was used as a standard to evaluate the accuracy of the calculated properties. G3(MP2)//B3-CEP theory was applied to the study of 247 standard enthalpies of formation, 104 ionization energies, 63 electron affinities, 10 proton affinities, and 22 atomization energies, comprising 446 experimental energies. The mean absolute deviations compared with the experimental data for all thermochemical results presented an accuracy of 1.4 kcal mol{sup −1} for G3(MP2)//B3 and 1.6more » kcal mol{sup −1} for G3(MP2)//B3-CEP. Approximately 75% and 70% of the calculated properties are found with accuracy between ±2 kcal mol{sup −1} for G3(MP2)//B3 and G3(MP2)//B3-CEP, respectively. Considering a confidence interval of 95%, the results may oscillate between ±4.2 kcal mol{sup −1} and ±4.6 kcal mol{sup −1}, respectively. The overall statistical behavior indicates that the calculations using pseudopotential present similar behavior with the all-electron theory. Of equal importance to the accuracy is the CPU time, which was reduced by between 10% and 40%.« less

  9. Th1/Th2 cytokine profiles in G+/G- bacteremia in pediatric hematology/oncology patients.

    PubMed

    Tang, Yongmin; Liao, Chan; Xu, Xiaojun; Song, Hua; Shi, Shuwen; Yang, Shilong

    2012-01-01

    Early diagnosis of infection and appropriate choice of antibiotics are essential not only to improve the prognosis of the patients but also to prevent from the abuse of the antibiotics in hematology/oncology children at the time of neutropenia after intensive chemotherapy. We evaluated the quantification of Th1/Th2 cytokines with flow cytometry bead assay (CBA) in 145 hospitalized febrile hematology/oncology children with positive blood culture to seek for a rapid diagnostic method to determine the type of infection. IL-4, IL-6, IL-10, TNF-α, and IFN-γ levels from both G- and G+ bacteremia groups were significantly higher than those of controls (P < 0.001). The median levels of IL-6, IL-10, TNF-α of Group G- were 525.4, 96.0, and 6.9 pg/ml, respectively, significantly higher than those of Group G+ (150.0, 22.6, and 4.5 pg/ml, respectively, P < 0.001). According to the different degrees of increased IL-6 and IL-10 levels, we named the G- bacterial infection related cytokine profile G- BIRCP and the G+ BIRCP. The specificity and sensitivity of BIRCP prediction for G- and G+ bacteria cultures were 60.2% and 75.4%, 66.8% and 70.1%, respectively. Similar therapeutic efficacy was achieved between BIRCP-based and broad-spectrum antibiotics groups (86.1% vs. 89.3%, P > 0.05), which was significantly increased as compared with that (65.5%, P < 0.05) of empirical group. These results showed the promising use of the IL-6/IL-10/TNF-α determination with CBA technology for the early and rapid diagnosis, evaluation of G+/G- bacteremia in pediatric hematology/oncology patients. Copyright © 2011 Wiley Periodicals, Inc.

  10. 1 MVA HTS-2G Generator for Wind Turbines

    NASA Astrophysics Data System (ADS)

    Kovalev, K. L.; Poltavets, V. N.; Ilyasov, R. I.; Verzhbitsky, L. G.; Kozub, S. S.

    2017-10-01

    The calculation, design simulations and design performance of 1 MVA HTS-2G (second-generation high-temperature superconductor) Generator for Wind Turbines were done in 2013-2014 [1]. The results of manufacturing and testing of 1 MVA generator are presented in the article. HTS-2G field coils for the rotor were redesigned, fabricated and tested. The tests have shown critical current of the coils, 41-45 A (self field within the ferromagnetic core, T = 77 K), which corresponds to the current of short samples at self field. Application of the copper inner frame on the pole has improved internal cooling conditions of HTS coil windings and reduced the magnetic field in the area, thereby increased the critical current value. The original construction of the rotor with a rotating cryostat was developed, which decreases the thermal in-flow to the rotor. The stator of 1 MW HTS-2G generator has been manufactured. In order to improve the specific weight of the generator, the wave (harmonic drive) multiplier was used, which provides increasing RPM from 15 RPM up to 600 RPM. The total mass of the multiplier and generator is significantly smaller compared to traditional direct-drive wind turbines generators [2-7]. Parameters of the multiplier and generator were chosen based on the actual parameters of wind turbines, namely: 15 RPM, power is 1 MVA. The final test of the assembled synchronous generator with HTS-2G field coils for Wind Turbines with output power 1 MVA was completed during 2015.

  11. Loss of G2 subunit of vacuolar-type proton transporting ATPase leads to G1 subunit upregulation in the brain

    PubMed Central

    Kawamura, Nobuyuki; Sun-Wada, Ge-Hong; Wada, Yoh

    2015-01-01

    Vacuolar-type ATPase (V-ATPase) is a primary proton pump with versatile functions in various tissues. In nerve cells, V-ATPase is required for accumulation of neurotransmitters into secretory vesicles and subsequent release at the synapse. Neurons express a specific isoform (G2) of the G subunit of V-ATPase constituting the catalytic sector of the enzyme complex. Using gene targeting, we generated a mouse lacking functional G2 (G2 null), which showed no apparent disorders in architecture and behavior. In the G2-null mouse brain, a G1 subunit isoform, which is ubiquitously expressed in neuronal and non-neuronal tissues, accumulated more abundantly than in wild-type animals. This G1 upregulation was not accompanied by an increase in mRNA. These results indicate that loss of function of neuron-specific G2 isoform was compensated by an increase in levels of the G1 isoform without apparent upregulation of the G1 mRNA. PMID:26353914

  12. Expansion of blood IgG4+ B, TH2, and regulatory T cells in patients with IgG4-related disease.

    PubMed

    Heeringa, Jorn J; Karim, A Faiz; van Laar, Jan A M; Verdijk, Robert M; Paridaens, Dion; van Hagen, P Martin; van Zelm, Menno C

    2018-05-01

    IgG 4 -related disease (IgG 4 -RD) is a systemic fibroinflammatory condition affecting various organs and has a diverse clinical presentation. Fibrosis and accumulation of IgG 4 + plasma cells in tissue are hallmarks of the disease, and IgG 4 -RD is associated with increased IgG 4 serum levels. However, disease pathogenesis is still unclear, and these cellular and molecular parameters are neither sensitive nor specific for the diagnosis of IgG 4 -RD. Here we sought to develop a flow cytometric gating strategy to reliably identify blood IgG 4 + B cells to study their cellular and molecular characteristics and investigate their contribution in disease pathogenesis. Sixteen patients with histologically confirmed IgG 4 -RD, 11 patients with sarcoidosis, and 30 healthy subjects were included for 11-color flow cytometric analysis of peripheral blood for IgG 4 -expressing B cells and T H subsets. In addition, detailed analysis of activation markers and chemokine receptors was performed on IgG 4 -expressing B cells, and IgG 4 transcripts were analyzed for somatic hypermutations. Cellular and molecular analyses revealed increased numbers of blood IgG 4 + memory B cells in patients with IgG 4 -RD. These cells showed reduced expression of CD27 and CXCR5 and increased signs of antibody maturation. Furthermore, patients with IgG 4 -RD, but not patients with sarcoidosis, had increased numbers of circulating plasmablasts and CD21 low B cells, as well as T H 2 and regulatory T cells, indicating a common disease pathogenesis in patients with IgG 4 -RD. These results provide new insights into the dysregulated IgG 4 response in patients with IgG 4 -RD. A specific "peripheral lymphocyte signature" observed in patients with IgG 4 -RD, could support diagnosis and treatment monitoring. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  13. A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

    PubMed Central

    Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

  14. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis.

    PubMed

    Zhang, Tengyue; Pang, Chong; Li, Ningdong; Zhou, Elaine; Zhao, Kanxing

    2013-01-02

    Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene

  15. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis

    PubMed Central

    2013-01-01

    Background Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Methods Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Results Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). Conclusions The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10

  16. [Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

    PubMed

    Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

    2018-02-01

    Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

  17. Immunocytochemical localization of the ovine immunoglobulins IgA, IgG1, IgG1A and IgG2: effect of gastro-intestinal parasitism in the sheep

    PubMed Central

    Curtain, C. C.; Anderson, N.

    1971-01-01

    A study has been made of the immunocytochemical localization of IgG1, IgG2, IgG1A and IgA in the alimentary tract and associated lymph nodes of parasitized and parasite-free sheep. No immunoglobulin-containing cells were found in the abomasal mucosa of the parasite-free sheep. On the other hand, large numbers of IgG1 and IgG1A-containing cells were found in the lamina propria and at the base of the villi of the abomasum of the parasitized sheep. IgG1, IgG1A, and IgA-containing cells were found in mucosal sections from the jejunum and ileum of both parasitized and parasite-free sheep, the number of IgG1A-containing cells being sifnificantly greater in the former than in the latter. This increase was considered to be of some importance since the IgG1A subclass appears to be involved in the allergic response of the sheep to intestinal parasites. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5FIG. 6FIG. 7 PMID:4924939

  18. Mesospheric ionization and O2 1Delta(g) depletion

    NASA Technical Reports Server (NTRS)

    Spear, K. A.; Solomon, S.

    1987-01-01

    Observations of O2 1Delta(g) emission during solar proton events reveal large depletions below 80 and near 90 km. The lower-altitude depletions are believed to be due to odd hydrogen production and associated depletion of ozone, but the mechanism producing the depletion near 90 km has not yet been established. In this paper, it is proposed that an exothermic charge exchange reaction between O2(+) and O2 1Delta(g) is likely to be responsible for these high-altitude depletions. In particular, it is shown that the vertical structure of the observed change in airglow emission is consistent with this mechanism.

  19. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... States § 1.904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall... increased. As provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account...

  20. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... States § 1.904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall... increased. As provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account...

  1. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  2. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  3. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  4. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a) In...

  5. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  6. β2-adrenoceptor blockage induces G1/S phase arrest and apoptosis in pancreatic cancer cells via Ras/Akt/NFκB pathway.

    PubMed

    Zhang, Dong; Ma, Qingyong; Wang, Zheng; Zhang, Min; Guo, Kun; Wang, Fengfei; Wu, Erxi

    2011-11-26

    Smoking and stress, pancreatic cancer (PanCa) risk factors, stimulate nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and catecholamines production respectively. NNK and catecholamine bind the β-adrenoceptors and induce PanCa cell proliferation; and we have previously suggested that β-adrenergic antagonists may suppress proliferation and invasion and stimulate apoptosis in PanCa. To clarify the mechanism of apoptosis induced by β2-adrenergic antagonist, we hypothesize that blockage of the β2-adrenoceptor could induce G1/S phase arrest and apoptosis and Ras may be a key player in PanCa cells. The β1 and β2-adrenoceptor proteins were detected on the cell surface of PanCa cells from pancreatic carcinoma specimen samples by immunohistochemistry. The β2-adrenergic antagonist ICI118,551 significantly induced G1/S phase arrest and apoptosis compared with the β1-adrenergic antagonist metoprolol, which was determined by the flow cytometry assay. β2-adrenergic antagonist therapy significantly suppressed the expression of extracellular signal-regulated kinase, Akt, Bcl-2, cyclin D1, and cyclin E and induced the activation of caspase-3, caspase-9 and Bax by Western blotting. Additionally, the β2-adrenergic antagonist reduced the activation of NFκB in vitro cultured PanCa cells. The blockage of β2-adrenoceptor markedly induced PanCa cells to arrest at G1/S phase and consequently resulted in cell death, which is possibly due to that the blockage of β2-adrenoceptor inhibited NFκB, extracellular signal-regulated kinase, and Akt pathways. Therefore, their upstream molecule Ras may be a key factor in the β2-adrenoceptor antagonist induced G1/S phase arrest and apoptosis in PanCa cells. The new pathway discovered in this study may provide an effective therapeutic strategy for PanCa.

  7. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall recapture... provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account with respect to...

  8. G2 Flywheel Module Design

    NASA Technical Reports Server (NTRS)

    Jensen, Ralph H.; Dever, Timothy P.

    2006-01-01

    Design of a flywheel module, designated the G2 module, is described. The G2 flywheel is a 60,000 RPM, 525 W-hr, 1 kW system designed for a laboratory environment; it will be used for component testing and system demonstrations, with the goal of applying flywheels to aerospace energy storage and integrated power and attitude control (IPACS) applications. G2 has a modular design, which allows for new motors, magnetic bearings, touchdown bearings, and rotors to be installed without a complete redesign of the system. This design process involves several engineering disciplines, and requirements are developed for the speed, energy storage, power level, and operating environment. The G2 rotor system consists of a multilayer carbon fiber rim with a titanium hub on which the other components mount, and rotordynamics analysis is conducted to ensure rigid and flexible rotor modes are controllable or outside of the operating speed range. Magnetic bearings are sized using 1-D magnetic circuit analysis and refined using 3-D finite element analysis. The G2 magnetic bearing system was designed by Texas A&M and has redundancy which allows derated operation after the loss of some components, and an existing liquid cooled two pole permanent magnet motor/generator is used. The touchdown bearing system is designed with a squeeze film damper system allowing spin down from full operating speed in case of a magnetic bearing failure. The G2 flywheel will enable module level demonstrations of component technology, and will be a key building block in system level attitude control and IPACS demonstrations.

  9. Hexokinase 1 is required for glucose-induced repression of bZIP63, At5g22920, and BT2 in Arabidopsis

    DOE PAGES

    Kunz, Sabine; Gardestrom, Per; Pesquet, Edouard; ...

    2015-07-14

    Simple sugars, like glucose (Glc) and sucrose (Suc), act as signals to modulate the expression of hundreds of genes in plants. Frequently, however, it remains unclear whether this regulation is induced by the sugars themselves or by their derivatives generated in the course of carbohydrate (CH) metabolism. In the present study, we tested the relevance of different CH metabolism and allocation pathways affecting expression patterns of five selected sugar-responsive genes ( bZIP63, At5g22920, BT2, MGD2, and TPS9) in Arabidopsis thaliana. In general, the expression followed diurnal changes in the overall sugar availability. However, under steady growth conditions, this response wasmore » hardly impaired in the mutants for CH metabolizing/ transporting proteins ( adg1, sex1, sus1-4, sus5/6, and tpt2), including also hexokinase1 (HXK1) loss- and gain-of-function plants— gin2.1 and oe3.2, respectively. In addition, transgenic plants carrying pbZIP63::GUS showed no changes in reporter-gene-expression when grown on sugar under steady-state conditions. In contrast, short-term treatments of agar-grown seedlings with 1% Glc or Suc induced pbZIP63::GUS repression, which became even more apparent in seedlings grown in liquid media. Subsequent analyses of liquid-grown gin2.1 and oe3.2 seedlings revealed that Glc -dependent regulation of the five selected genes was not affected in gin2.1, whereas it was enhanced in oe3.2 plants for bZIP63, At5g22920, and BT. The sugar treatments had no effect on ATP/ADP ratio, suggesting that changes in gene expression were not linked to cellular energy status. Altogether, the data suggest that HXK1 does not act as Glc sensor controlling bZIP63, At5g22920, and BT2 expression, but it is nevertheless required for the production of a downstream metabolic signal regulating their expression« less

  10. Hexokinase 1 is required for glucose-induced repression of bZIP63, At5g22920, and BT2 in Arabidopsis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kunz, Sabine; Gardestrom, Per; Pesquet, Edouard

    Simple sugars, like glucose (Glc) and sucrose (Suc), act as signals to modulate the expression of hundreds of genes in plants. Frequently, however, it remains unclear whether this regulation is induced by the sugars themselves or by their derivatives generated in the course of carbohydrate (CH) metabolism. In the present study, we tested the relevance of different CH metabolism and allocation pathways affecting expression patterns of five selected sugar-responsive genes ( bZIP63, At5g22920, BT2, MGD2, and TPS9) in Arabidopsis thaliana. In general, the expression followed diurnal changes in the overall sugar availability. However, under steady growth conditions, this response wasmore » hardly impaired in the mutants for CH metabolizing/ transporting proteins ( adg1, sex1, sus1-4, sus5/6, and tpt2), including also hexokinase1 (HXK1) loss- and gain-of-function plants— gin2.1 and oe3.2, respectively. In addition, transgenic plants carrying pbZIP63::GUS showed no changes in reporter-gene-expression when grown on sugar under steady-state conditions. In contrast, short-term treatments of agar-grown seedlings with 1% Glc or Suc induced pbZIP63::GUS repression, which became even more apparent in seedlings grown in liquid media. Subsequent analyses of liquid-grown gin2.1 and oe3.2 seedlings revealed that Glc -dependent regulation of the five selected genes was not affected in gin2.1, whereas it was enhanced in oe3.2 plants for bZIP63, At5g22920, and BT. The sugar treatments had no effect on ATP/ADP ratio, suggesting that changes in gene expression were not linked to cellular energy status. Altogether, the data suggest that HXK1 does not act as Glc sensor controlling bZIP63, At5g22920, and BT2 expression, but it is nevertheless required for the production of a downstream metabolic signal regulating their expression« less

  11. Elevated Plasma Moxifloxacin Concentrations and SLCO1B1 g.−11187G>A Polymorphism in Adults with Pulmonary Tuberculosis

    PubMed Central

    Gelfond, Jon; Johnson-Pais, Teresa L.; Engle, Melissa; Peloquin, Charles A.; Johnson, John L.; Sizemore, Erin E.; Mac Kenzie, William R.

    2018-01-01

    ABSTRACT Moxifloxacin exhibits concentration-dependent prolongation of human QTc intervals and bactericidal activity against Mycobacterium tuberculosis. However, moxifloxacin plasma concentrations are variable between patients. We evaluated whether human gene polymorphisms affect moxifloxacin plasma concentrations in tuberculosis patients from two geographic regions. We enrolled a convenience sample of 49 adults with drug-sensitive pulmonary tuberculosis from Africa and the United States enrolled in two treatment trials of moxifloxacin as part of multidrug therapy. Pharmacokinetic parameters were evaluated by noncompartmental techniques. Human single-nucleotide polymorphisms of transporter genes were evaluated by analysis of covariance (ANCOVA) on moxifloxacin exposure and the peak (maximum) concentration (Cmax). The moxifloxacin area under the concentration-time curve from 0 to 24 h (AUC0–24) and Cmax were significantly increased by the drug milligram-per-kilogram dosage and the genotype of variant g.−11187G>A in the SLCO1B1 gene (rs4149015) but not by geographic region. The median moxifloxacin AUC0–24 was 46% higher and the median Cmax was 30% higher in 4 (8%) participants who had the SLCO1B1 g.−11187 AG genotype than in 45 participants who had the wild-type GG genotype (median AUC0–24 from the model, 34.4 versus 23.6 μg · h/ml [P = 0.005, ANCOVA]; median Cmax from the model, 3.5 versus 2.7 μg/ml [P = 0.009, ANCOVA]). Because moxifloxacin exhibits concentration-dependent prolongation of human QTc intervals and prolonged QTc intervals are associated with cardiac arrhythmia, further study is needed to evaluate the risk associated with the SLCO1B1 g.−11187G>A variant. (This study has been registered at ClinicalTrials.gov under identifier NCT00164463.) PMID:29463526

  12. 26 CFR 1.860G-2 - Other rules.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2 Other rules. (a) Obligations principally... interests in real property and related assets that would be considered to be permitted investments if the... that are not real estate mortgages; and (D) The release is not within 2 years of the startup day. (9...

  13. The extraction of the spin structure function, g2 (and g1) at low Bjorken x

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ndukum, Luwani Z.

    2015-08-01

    The Spin Asymmetries of the Nucleon Experiment (SANE) used the Continuous Electron Beam Accelerator Facility at Jefferson Laboratory in Newport News, VA to investigate the spin structure of the proton. The experiment measured inclusive double polarization electron asymmetries using a polarized electron beam, scattered off a solid polarized ammonia target with target polarization aligned longitudinal and near transverse to the electron beam, allowing the extraction of the spin asymmetries A1 and A2, and spin structure functions g1 and g2. Polarized electrons of energies of 4.7 and 5.9 GeV were used. The scattered electrons were detected by a novel, non-magnetic arraymore » of detectors observing a four-momentum transfer range of 2.5 to 6.5 GeV*V. This document addresses the extraction of the spin asymmetries and spin structure functions, with a focus on spin structure function, g2 (and g1) at low Bjorken x. The spin structure functions were measured as a function of x and W in four Q square bins. A full understanding of the low x region is necessary to get clean results for SANE and extend our understanding of the kinematic region at low x.« less

  14. The First CERN Muon g-2 Experiment

    NASA Astrophysics Data System (ADS)

    Garwin, Richard

    2014-03-01

    The Summary of the 16 June 1965 publication of this experiment in Il Nuovo Cimento reads, ``The anomalous part of the gyromagnetic ratio, a ≡ 1/2 (g-2) of the muon has been measured by determining the precession θ = aω0B- t for 100 MeV/c muons as a function of storage time t in a known static magnetic field of the form B = B0(1 +ay +by2 + cy3 + dy4) . The result is aexp = (1162 +/- 5) . 10-6 compared with the theoretical value ath = α/2 π + 0.76α22 = 1165 . 10-6. This agreement shows that the muon obeys standard quantum electrodynamics down to distances ~ 0.1 fermi. Details are given of the methods used to store muons for ~ 103 turns in the field, and of measuring techniques and precautions necessary to achieve the final accuracy. Some of the methods of orbit analysis, magnet construction shimming and measurement, polarization analysis, and digital timing electronics may be of more general interest.'' The paper is available in full at http://www.fas.org/rlg/060065%20Nuovo%20Cimento.pdf The authors valued highly the presentation of experimental details, which will be the emphasis of this talk, recounting the motivation of choices made with the tools and technology of that era. In collaboration with G. Charpak, F. J. M. Farley, T. Mueller, J. C. Sens, and A. Zichichi.

  15. Detection of H-alpha emission in the hot white dwarf G191-B2B

    NASA Astrophysics Data System (ADS)

    Reid, Neill; Wegner, Gary

    1988-12-01

    High-resolution spectra of G191-B2B, the hottest known DA white dwarf were obtained which reveal emission in the core of the H-alpha line. The observations show little variation in the line profile over a period of four days, ruling out line-doubling in a close binary as an explanation. The observed emission cannot be due to a nearby red dwarf companion, while the absence of any spatially extended emission argues against either a planetary nebula remnant or local ionization of the interstellar medium. The determination of the systemic velocity, using the companion red dwarf G191-B2A, is 5 + or - 2 km/s and shows that both the H-alpha emission and the high-excitation species observed in the ultraviolet are redshifted by 19 + or - 3 km/s, suggesting a photospheric origin. The low redshift implies a mass of 0.45 solar mass for this hot white dwarf, although the uncertainties in the effective temperature and parallax permit masses in the range 0.29 to 0.60 solar mass.

  16. Neisseria meningitidis Group A IgG1 and IgG2 Subclass Immune Response in African Children Aged 12–23 Months Following Meningococcal Vaccination

    PubMed Central

    Holme, Daniel; Findlow, Helen; Sow, Samba O.; Idoko, Olubukola T.; Preziosi, Marie-Pierre; Carlone, George; Plikaytis, Brian D.; Borrow, Ray

    2015-01-01

    Background. A group A meningococcal conjugate vaccine, PsA-TT, was licensed in 2010 and was previously studied in a phase 2 clinical trial to evaluate its safety and immunogenicity in African children 12–23 months of age. Methods. Subjects received either PsA-TT; meningococcal group A, C, W, Y polysaccharide vaccine (PsACWY); or Haemophilus influenzae type b conjugate vaccine (Hib-TT). Forty weeks following primary vaccination, the 3 groups were further randomized to receive either PsA-TT, one-fifth dose of PsACWY, or Hib-TT. Group A–specific immunoglobulin G (IgG) subclass response was characterized using an enzyme-linked immunosorbent assay. Results. The predominant IgG subclass response, regardless of vaccine, was IgG1. One month following primary vaccination, the geometric mean concentrations (GMCs) of IgG1 and IgG2 in the PsA-TT group were 21.73 µg/mL and 6.27 µg/mL, whereas in the PsACWY group the mean GMCs were 2.01 µg/mL and 0.97 µg/mL, respectively (P < .0001). Group A–specific IgG1 and IgG2 GMCs remained greater in the PsA-TT group than in the PsACWY group 40 weeks following primary vaccination (P < .0001). One week following revaccination, those given 2 doses of PsA-TT had the greatest IgG1 and IgG2 GMCs of 125.23 µg/mL and 36.12 µg/mL, respectively (P = .0008), and demonstrated a significant increase in IgG1:IgG2 mean ratio, indicative of the T-cell–dependent response associated with conjugate vaccines. Conclusions. Vaccination of African children aged 12–24 months with either PsA-TT or PsACWY elicited a predominantly IgG1 response. The IgG1:IgG2 mean ratio decreased following successive vaccination with PsACWY, indicating a shift toward IgG2, suggestive of the T-cell–independent immune response commonly associated with polysaccharide antigens. Clinical Trials Registration. SRCTN78147026. PMID:26553689

  17. An Investigation of Hierachical Protein Recruitment to the Inhibitory Platelet Receptor, G6B-b

    PubMed Central

    Coxon, Carmen H.; Sadler, Amanda J.; Huo, Jiandong; Campbell, R. Duncan

    2012-01-01

    Platelet activation is regulated by both positive and negative signals. G6B-b is an inhibitory platelet receptor with an immunoreceptor tyrosine-based inhibitory motif (ITIM) and an immunoreceptor tyrosine-based switch motif (ITSM). The molecular basis of inhibition by G6B-b is currently unknown but thought to involve the SH2 domain-containing tyrosine phosphatase SHP-1. Here we show that G6B-b also associates with SHP-2, as well as SHP-1, in human platelets. Using a number of biochemical approaches, we found these interactions to be direct and that the tandem SH2 domains of SHP-2 demonstrated a binding affinity for G6B-b 100-fold higher than that of SHP-1. It was also observed that while SHP-1 has an absolute requirement for phosphorylation at both motifs to bind, SHP-2 can associate with G6B-b when only one motif is phosphorylated, with the N-terminal SH2 domain and the ITIM being most important for the interaction. A number of other previously unreported SH2 domain-containing proteins, including Syk and PLCγ2, also demonstrated specificity for G6B-b phosphomotifs and may serve to explain the observation that G6B-b remains inhibitory in the absence of both SHP-1 and SHP-2. In addition, the presence of dual phosphorylated G6B-b in washed human platelets can reduce the EC50 for both CRP and collagen. PMID:23185356

  18. FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation.

    PubMed

    Roth, Martin; Bonev, Boyan; Lindsay, Jennefer; Lea, Robert; Panagiotaki, Niki; Houart, Corinne; Papalopulu, Nancy

    2010-05-01

    FoxG1 is a conserved transcriptional repressor that plays a key role in the specification, proliferation and differentiation of the telencephalon, and is expressed from the earliest stages of telencephalic development through to the adult. How the interaction with co-factors might influence the multiplicity and diversity of FoxG1 function is not known. Here, we show that interaction of FoxG1 with TLE2, a Xenopus tropicalis co-repressor of the Groucho/TLE family, is crucial for regulating the early activity of FoxG1. We show that TLE2 is co-expressed with FoxG1 in the ventral telencephalon from the early neural plate stage and functionally cooperates with FoxG1 in an ectopic neurogenesis assay. FoxG1 has two potential TLE binding sites: an N-terminal eh1 motif and a C-terminal YWPMSPF motif. Although direct binding seems to be mediated by the N-terminal motif, both motifs appear important for functional synergism. In the neurogenesis assay, mutation of either motif abolishes functional cooperation of TLE2 with FoxG1, whereas in the forebrain deletion of both motifs renders FoxG1 unable to induce the ventral telencephalic marker Nkx2.1. Knocking down either FoxG1 or TLE2 disrupts the development of the ventral telencephalon, supporting the idea that endogenous TLE2 and FoxG1 work together to specify the ventral telencephalon.

  19. FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation

    PubMed Central

    Roth, Martin; Bonev, Boyan; Lindsay, Jennefer; Lea, Robert; Panagiotaki, Niki; Houart, Corinne; Papalopulu, Nancy

    2010-01-01

    FoxG1 is a conserved transcriptional repressor that plays a key role in the specification, proliferation and differentiation of the telencephalon, and is expressed from the earliest stages of telencephalic development through to the adult. How the interaction with co-factors might influence the multiplicity and diversity of FoxG1 function is not known. Here, we show that interaction of FoxG1 with TLE2, a Xenopus tropicalis co-repressor of the Groucho/TLE family, is crucial for regulating the early activity of FoxG1. We show that TLE2 is co-expressed with FoxG1 in the ventral telencephalon from the early neural plate stage and functionally cooperates with FoxG1 in an ectopic neurogenesis assay. FoxG1 has two potential TLE binding sites: an N-terminal eh1 motif and a C-terminal YWPMSPF motif. Although direct binding seems to be mediated by the N-terminal motif, both motifs appear important for functional synergism. In the neurogenesis assay, mutation of either motif abolishes functional cooperation of TLE2 with FoxG1, whereas in the forebrain deletion of both motifs renders FoxG1 unable to induce the ventral telencephalic marker Nkx2.1. Knocking down either FoxG1 or TLE2 disrupts the development of the ventral telencephalon, supporting the idea that endogenous TLE2 and FoxG1 work together to specify the ventral telencephalon. PMID:20356955

  20. Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osabe, Makoto; Sugatani, Junko; Global COE Program, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka

    Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2more » cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation.« less

  1. Investigation of Non-Covalent Interactions of Aflatoxins (B1, B2, G1, G2, and M1) with Serum Albumin

    PubMed Central

    Poór, Miklós; Bálint, Mónika; Hetényi, Csaba; Gődér, Beatrix; Kunsági-Máté, Sándor; Lemli, Beáta

    2017-01-01

    Aflatoxins are widely spread mycotoxins produced mainly by Aspergillus species. Consumption of aflatoxin-contaminated foods and drinks causes serious health risks for people worldwide. It is well-known that the reactive epoxide metabolite of aflatoxin B1 (AFB1) forms covalent adducts with serum albumin. However, non-covalent interactions of aflatoxins with human serum albumin (HSA) are poorly characterized. Thus, in this study the complex formation of aflatoxins was examined with HSA applying spectroscopic and molecular modelling studies. Our results demonstrate that aflatoxins form stable complexes with HSA as reflected by binding constants between 2.1 × 104 and 4.5 × 104 dm3/mol. A binding free energy value of −26.90 kJ mol−1 suggests a spontaneous binding process between AFB1 and HSA at room-temperature, while the positive entropy change of 55.1 JK−1 mol−1 indicates a partial decomposition of the solvation shells of the interacting molecules. Modeling studies and investigations with site markers suggest that Sudlow’s Site I of subdomain IIA is the high affinity binding site of aflatoxins on HSA. Interaction of AFB1 with bovine, porcine, and rat serum albumins was also investigated. Similar stabilities of the examined AFB1-albumin complexes were observed suggesting the low species differences of the albumin-binding of aflatoxins. PMID:29068381

  2. Modulation of intracellular Ca(2+) via alpha(1B)-adrenoreceptor signaling molecules, G alpha(h) (transglutaminase II) and phospholipase C-delta 1.

    PubMed

    Kang, Sung Koo; Kim, Dae Kyong; Damron, Derek S; Baek, Kwang Jin; Im, Mie-Jae

    2002-04-26

    We characterized the alpha(1B)-adrenoreceptor (alpha(1B)-AR)-mediated intracellular Ca(2+) signaling involving G alpha(h) (transglutaminase II, TGII) and phospholipase C (PLC)-delta 1 using DDT1-MF2 cell. Expression of wild-type TGII and a TGII mutant lacking transglutaminase activity resulted in significant increases in a rapid peak and a sustained level of intracellular Ca(2+) concentration ([Ca(2+)](i)) in response to activation of the alpha(1B)-AR. Expression of a TGII mutant lacking the interaction with the receptor or PLC-delta 1 substantially reduced both the peak and sustained levels of [Ca(2+)](i). Expression of TGII mutants lacking the interaction with PLC-delta 1 resulted in a reduced capacitative Ca(2+) entry. Reduced expression of PLC-delta 1 displayed a transient elevation of [Ca(2+)](i) and a reduction in capacitative Ca(2+) entry. Expression of the C2-domain of PLC-delta 1, which contains the TGII interaction site, resulted in reduction of the alpha(1B)-AR-evoked peak increase in [Ca(2+)](i), while the sustained elevation in [Ca(2+)](i) and capacitative Ca(2+) entry remained unchanged. These findings demonstrate that stimulation of PLC-delta 1 via coupling of the alpha(1B)-AR with TGII evokes both Ca(2+) release and capacitative Ca(2+) entry and that capacitative Ca(2+) entry is mediated by the interaction of TGII with PLC-delta 1.

  3. CYP2E1 overexpression inhibits microsomal Ca2+-ATPase activity in HepG2 cells.

    PubMed

    Caro, Andres A; Evans, Kerry L; Cederbaum, Arthur I

    2009-01-31

    Cytochrome P450 2E1 (CYP2E1) is a microsomal enzyme that generates reactive oxygen species during its catalytic cycle. We previously found an important role for calcium in CYP2E1-potentiated injury in HepG2 cells. The possibility that CYP2E1 may oxidatively damage and inactivate the microsomal Ca2+-ATPase in intact liver cells was evaluated, in order to explain why calcium is elevated during CYP2E1 toxicity. Microsomes were isolated by differential centrifugation from two liver cell line: E47 cells (HepG2 cells transfected with the pCI neo expression vector containing the human CYP2E1 cDNA, which overexpress active microsomal CYP2E1), and control C34 cells (HepG2 cells transfected with the pCI neo expression vector alone, which do not express significantly any cytochrome P450). The Ca2+-dependent ATPase activity was determined by measuring the accumulation of inorganic phosphate from ATP hydrolysis. CYP2E1 overexpression produced a 45% decrease in Ca2+-dependent ATPase activity (8.6 nmol Pi/min/mg protein in C34 microsomes versus 4.7 nmol Pi/min/mg protein in microsomes). Saturation curves with Ca2+ or ATP showed that CYP2E1 overexpression produced a decrease in Vmax but did not affect the Km for either Ca2+ or ATP. The decrease in activity was not associated with a decrease in SERCA protein levels. The ATP-dependent microsomal calcium uptake was evaluated by fluorimetry using fluo-3 as the fluorogenic probe. Calcium uptake rate in E47 microsomes was 28% lower than in C34 microsomes. Treatment of E47 cells with 2mM N-acetylcysteine prevented the decrease in microsomal Ca2+-ATPase found in E47 cells. These results suggest that CYP2E1 overexpression produces a decrease in microsomal Ca2+-ATPase activity in HepG2 cells mediated by reactive oxygen species. This may contribute to elevated cytosolic calcium and to CYP2E1-potentiated injury.

  4. A first detection of singlet to triplet conversion from the 1 1B u- to the 1 3A g state and triplet internal conversion from the 1 3A g to the 1 3B u state in carotenoids: dependence on the conjugation length

    NASA Astrophysics Data System (ADS)

    Rondonuwu, Ferdy S.; Watanabe, Yasutaka; Fujii, Ritsuko; Koyama, Yasushi

    2003-07-01

    Subpicosecond time-resolved absorption spectra were recorded in the visible region for a set of photosynthetic carotenoids having different numbers of conjugated double bonds ( n), which include neurosporene ( n=9), spheroidene ( n=10), lycopene ( n=11), anhydrorhodovibrin ( n=12) and spirilloxanthin ( n=13). Singular-value decomposition and global fitting of the spectral-data matrices lead us to a branched relaxation scheme including both (1) the singlet internal conversion in the sequence of 1 1B u+ → 1 1B u- → 2 1A g- → 1 1A g-(ground), and (2) the singlet-to-triplet conversion of 1 1B u- → 1 3A g followed by triplet internal conversion of 1 3A g1 3B u.

  5. Morin impedes Yap nuclear translocation and fosters apoptosis through suppression of Wnt/β-catenin and NF-κB signaling in Mst1 overexpressed HepG2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perumal, NaveenKumar; Perumal, MadanKumar; Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas 75390

    Recent clinical and experimental evidences strongly acclaim Yes-associated protein (Yap), a key oncogenic driver in liver carcinogenesis, as a therapeutic target. Of the known multiple schemes to inhibit Yap activity, activation of Mammalian Sterile 20-like Kinase 1 (Mst1), an upstream regulator of Yap, appears to be a promising one. In this study, we hypothesize that morin, a bioflavonoid, mediates its anti-cancer effect through the activation of Mst1/hippo signaling in liver cancer cells. To test this hypothesis, both full length Mst1 (F-Mst1) and kinase active N-terminal Mst1 (N-Mst1)-overexpressed HepG2 cells were used. Exposure of F-Mst1 overexpressed HepG2 cells to morin activatedmore » Mst1 by caspase-3 cleavage and thereby inhibited Yap nuclear translocation and fostered apoptosis. Morin suppressed NF-κB p65 and Wnt/β-catenin signaling through Mst1 activation via cleavage and phosphorylation, leading to cell death. Annexin-V/PI staining further confirmed the induction of apoptosis in morin treated F-Mst1 overexpressed cells. The present study shows that morin targets cell survival molecules such as NF-κB p65 and β-catenin through activation of hippo signaling. Therefore, morin could be considered as a potential anti-cancer agent against liver cancer. - Highlights: • Morin induced cytotoxicity in cultured HepG2 cells. • Morin activated hippo pathway via Mst1 activation in transfected HepG2 cells. • Morin suppressed Wnt/β-catenin signaling and induced G0/G1 cell cycle arrest. • Morin inhibited NF-κB signaling through Mst1 activation in transfected HepG2 cells. • Morin potentiates apoptosis through Mst1-JNK-caspase mediated mechanism in HepG2 cells.« less

  6. A Benzothiazole Derivative (5g) Induces DNA Damage And Potent G2/M Arrest In Cancer Cells.

    PubMed

    Hegde, Mahesh; Vartak, Supriya V; Kavitha, Chandagirikoppal V; Ananda, Hanumappa; Prasanna, Doddakunche S; Gopalakrishnan, Vidya; Choudhary, Bibha; Rangappa, Kanchugarakoppal S; Raghavan, Sathees C

    2017-05-31

    Chemically synthesized small molecules play important role in anticancer therapy. Several chemical compounds have been reported to damage the DNA, either directly or indirectly slowing down the cancer cell progression by causing a cell cycle arrest. Direct or indirect reactive oxygen species formation causes DNA damage leading to cell cycle arrest and subsequent cell death. Therefore, identification of chemically synthesized compounds with anticancer potential is important. Here we investigate the effect of benzothiazole derivative (5g) for its ability to inhibit cell proliferation in different cancer models. Interestingly, 5g interfered with cell proliferation in both, cell lines and tumor cells leading to significant G2/M arrest. 5g treatment resulted in elevated levels of ROS and subsequently, DNA double-strand breaks (DSBs) explaining observed G2/M arrest. Consistently, we observed deregulation of many cell cycle associated proteins such as CDK1, BCL2 and their phosphorylated form, CyclinB1, CDC25c etc. Besides, 5g treatment led to decreased levels of mitochondrial membrane potential and activation of apoptosis. Interestingly, 5g administration inhibited tumor growth in mice without significant side effects. Thus, our study identifies 5g as a potent biochemical inhibitor to induce G2/M phase arrest of the cell cycle, and demonstrates its anticancer properties both ex vivo and in vivo.

  7. Immunostimulatory CpG-oligonucleotides induce functional high affinity IL-2 receptors on B-CLL cells: costimulation with IL-2 results in a highly immunogenic phenotype.

    PubMed

    Decker, T; Schneller, F; Kronschnabl, M; Dechow, T; Lipford, G B; Wagner, H; Peschel, C

    2000-05-01

    CpG-oligodeoxynucleotides (CpG-ODN) have been shown to induce proliferation, cytokine production, and surface molecule regulation in normal and malignant human B cells. In the present study, we investigated the potential of CpG-ODN to induce functional high-affinity receptors in leukemic and normal B cells and the effects of costimulation with IL-2 on proliferation, cytokine secretion, and surface molecule regulation. Highly purified B cells from B-CLL patients and normal controls were stimulated with CpG-ODN with or without IL-2. Expression of CD25 was determined using FACS, and the presence of high-affinity IL-2 receptors was determined by scatchard analysis. Costimulatory effects of IL-2 and CpG-ODN were investigated using proliferation assays, ELISA (IL-6, TNF-alpha), and FACS analysis (CD80, CD86 expression). Reactivity of autologous and allogeneic T cells toward activated B-CLL cells was determined in mixed lymphocyte reactions and Interferon-gamma Elispot assays. The CpG-ODN DSP30 caused a significantly stronger induction of the IL-2 receptor alpha chain in malignant as compared with normal B cells (p = 0.03). This resulted in the expression of functional high-affinity IL-2 receptors in B-CLL cells, but fewer numbers of receptors with less affinity were expressed in normal B cells. Although addition of IL-2 to CpG-ODN-stimulated cells augmented proliferation in both normal B cells and B-CLL cells, no costimulatory effect on cytokine production or surface molecule expression could be observed in normal B cells. In contrast, TNF-alpha and IL-6 production was increased in B-CLL cells, and the expression of CD80 and CD86 was further enhanced when IL-2 was used as a costimulus. Autologous and allogeneic immune recognition of B-CLL cells stimulated with CpG-ODN and IL-2 was increased compared with B-CLL cells stimulated with CpG-ODN alone. Stimulation of B-CLL cells with CpG-ODN and IL-2 might be an attractive strategy for potential immunotherapies for B

  8. Crew Training - STS-30/61B (Zero-G)

    NASA Image and Video Library

    1985-08-21

    KC-135 inflight training of the STS-30/61B Crew for suit donning doffing and Zero-G orientation for Rudolfo Neri, Astronaut Mary Cleave, and Ricardo Peralta, Backup Neri. 1. Astronaut Cleave, Mary - Zero-G 2. Neri, Rodolfo - Zero-G 3. Peralta, Ricard - Zero-G

  9. KINETIC ENERGY DISTRIBUTION OF H(1s) FROM H{sub 2} X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g} EXCITATION AND LIFETIMES AND TRANSITION PROBABILITIES OF a {sup 3}{Sigma}{sup +} {sub g}(v, J)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu Xianming; Johnson, Paul V.; Malone, Charles P.

    Dissociative excitation of molecular hydrogen plays an important role in the heating of outer planet upper thermospheres. This paper addresses the role of one of the triplet states involved in the process. H{sub 2} excited to the a {sup 3}{Sigma}{sup +} {sub g} state, or higher triplet-ungerade states, is dissociated via the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} continuum. The kinetic energy distribution of H(1s) produced from direct X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g}(v, J) excitation by electrons is investigated by an accurate theoretical evaluation of spontaneous transition probabilities ofmore » the a {sup 3}{Sigma}{sup +} {sub g}(v, J)-b {sup 3}{Sigma}{sup +} {sub u} continuum transition. It is shown that the X {sup 1}{Sigma}{sup +} {sub g}(0)-a {sup 3}{Sigma}{sup +} {sub g}(v, J) excitation primarily produces H(1s) atoms with kinetic energies lower than 2 eV. In addition to the continuum a {sup 3}{Sigma}{sup +} {sub g}(v, J)-b {sup 3}{Sigma}{sup +} {sub u} transition probabilities, spontaneous emission lifetimes of the a {sup 3}{Sigma}{sup +} {sub g}(v, J) (v = 0-20, J {<=} 14) levels have been calculated by considering both the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} and a {sup 3}{Sigma}{sup +} {sub g}-c {sup 3}{Pi} {sub u} transitions. The calculated lifetimes show a moderately strong rotational dependence, and the lifetimes for the J = 0 rotational level of the low v levels agree well with previous calculations and experimental measurements. Calculations of the a {sup 3}{Sigma}{sup +} {sub g}-b {sup 3}{Sigma}{sup +} {sub u} continuum emission spectra from electron impact X {sup 1}{Sigma}{sup +} {sub g}-a {sup 3}{Sigma}{sup +} {sub g} excitation are included.« less

  10. KrasG12D-Induced IKK2/β/NF-κB Activation by IL-1α and p62 Feedforward Loops Is Required for Development of Pancreatic Ductal Adenocarcinoma

    PubMed Central

    Ling, Jianhua; Kang, Ya’an; Zhao, Ruiying; Xia, Qianghua; Lee, Dung-Fang; Chang, Zhe; Li, Jin; Peng, Bailu; Fleming, Jason B.; Wang, Huamin; Liu, Jinsong; Lemischka, Ihor R.; Hung, Mien-Chie; Chiao, Paul J.

    2012-01-01

    SUMMARY Constitutive Kras and NF-κB activation is identified as signature alterations in pancreatic ductal adenocarcinoma (PDAC). However, how NF-κB is activated in PDAC is not yet understood. Here, we report that pancreas-targeted IKK2/β inactivation inhibited NF-κB activation and PDAC development in KrasG12D and KrasG12D;Ink4a/ArfF/F mice, demonstrating a mechanistic link between IKK2/β and KrasG12D in PDAC inception. Our findings reveal that KrasG12D-activated AP-1 induces IL-1α, which, in turn, activates NF-κB and its target genes IL-1α and p62, to initiate IL-1α/p62 feedforward loops for inducing and sustaining NF-κB activity. Furthermore, IL-1α overexpression correlates with Kras mutation, NF-κB activity, and poor survival in PDAC patients. Therefore, our findings demonstrate the mechanism by which IKK2/β/NF-κB is activated by KrasG12D through dual feedforward loops of IL-1α/p62. PMID:22264792

  11. Monomeric ephrinB2 binding induces allosteric changes in Nipah virus G that precede its full activation.

    PubMed

    Wong, Joyce J W; Young, Tracy A; Zhang, Jiayan; Liu, Shiheng; Leser, George P; Komives, Elizabeth A; Lamb, Robert A; Zhou, Z Hong; Salafsky, Joshua; Jardetzky, Theodore S

    2017-10-03

    Nipah virus is an emergent paramyxovirus that causes deadly encephalitis and respiratory infections in humans. Two glycoproteins coordinate the infection of host cells, an attachment protein (G), which binds to cell surface receptors, and a fusion (F) protein, which carries out the process of virus-cell membrane fusion. The G protein binds to ephrin B2/3 receptors, inducing G conformational changes that trigger F protein refolding. Using an optical approach based on second harmonic generation, we show that monomeric and dimeric receptors activate distinct conformational changes in G. The monomeric receptor-induced changes are not detected by conformation-sensitive monoclonal antibodies or through electron microscopy analysis of G:ephrinB2 complexes. However, hydrogen/deuterium exchange experiments confirm the second harmonic generation observations and reveal allosteric changes in the G receptor binding and F-activating stalk domains, providing insights into the pathway of receptor-activated virus entry.Nipah virus causes encephalitis in humans. Here the authors use a multidisciplinary approach to study the binding of the viral attachment protein G to its host receptor ephrinB2 and show that monomeric and dimeric receptors activate distinct conformational changes in G and discuss implications for receptor-activated virus entry.

  12. Structure and stability of small Li2 +(X2Σ+ g )-Xen (n = 1-6) clusters

    NASA Astrophysics Data System (ADS)

    Saidi, Sameh; Ghanmi, Chedli; Berriche, Hamid

    2014-04-01

    We have studied the structure and stability of the Li2 +(X2Σ+ g )Xe n ( n = 1-6) clusters for special symmetry groups. The potential energy surfaces of these clusters, are described using an accurate ab initio approach based on non-empirical pseudopotential, parameterized l-dependent polarization potential and analytic potential forms for the Li+Xe and Xe-Xe interactions. The pseudopotential technique has reduced the number of active electrons of Li2 +(X2Σ+ g )-Xe n ( n = 1-6) clusters to only one electron, the Li valence electron. The core-core interactions for Li+Xe are included using accurate CCSD(T) potential fitted using the analytical form of Tang and Toennies. For the Xe-Xe potential interactions we have used the analytical form of Lennard Jones (LJ6 - 12). The potential energy surfaces of the Li2 +(X2Σ+ g )Xe n ( n = 1-6) clusters are performed for a fixed distance of the Li2 +(X2Σ+ g ) alkali dimer, its equilibrium distance. They are used to extract information on the stability of the Li2 +(X2Σ+ g Xe n ( n = 1-6) clusters. For each n, the stability of the different isomers is examined by comparing their potential energy surfaces. Moreover, we have determined the quantum energies ( D 0), the zero-point-energies (ZPE) and the ZPE%. To our best knowledge, there are neither experimental nor theoretical works realized for the Li2 +(X2Σ+ g Xe n ( n = 1-6) clusters, our results are presented for the first time.

  13. Nonadiabatic dynamics of O(1D) + N2(X1Σg+) → O(3P) + N2(X1Σg+) on three coupled potential surfaces: symmetry, Coriolis, spin-orbit, and Renner-Teller effects.

    PubMed

    Defazio, Paolo; Gamallo, Pablo; Petrongolo, Carlo

    2012-02-07

    We present the spin-orbit (SO) and Renner-Teller (RT) quantum dynamics of the spin-forbidden quenching O((1)D) + N(2)(X(1)Σ(g)(+)) → O((3)P) + N(2)(X(1)Σ(g)(+)) on the N(2)O X(1)A', ã(3)A", and b(3)A' coupled PESs. We use the permutation-inversion symmetry, propagate coupled-channel (CC) real wavepackets, and compute initial-state-resolved probabilities and cross sections σ(j(0)) for the ground vibrational and the first two rotational states of N(2), j(0) = 0 and 1. Labeling symmetry angular states by j and K, we report selection rules for j and for the minimum K value associated with any electronic state, showing that ã(3)A" is uncoupled in the centrifugal-sudden (CS) approximation at j(0) = 0. The dynamics is resonance-dominated, the probabilities are larger at low K, σ(j(0)) decrease with the collision energy and increase with j(0), and the CS σ(0) is lower than the CC one. The nonadiabatic interactions play different roles on the quenching dynamics, because the X(1)A'-b(3)A' SO effects are those most important while the ã(3)A"-b(3)A' RT ones are negligible.

  14. Two new competing pathways establish the threshold for cyclin-B-Cdk1 activation at the meiotic G2/M transition.

    PubMed

    Hiraoka, Daisaku; Aono, Ryota; Hanada, Shin-Ichiro; Okumura, Eiichi; Kishimoto, Takeo

    2016-08-15

    Extracellular ligands control biological phenomena. Cells distinguish physiological stimuli from weak noise stimuli by establishing a ligand-concentration threshold. Hormonal control of the meiotic G2/M transition in oocytes is essential for reproduction. However, the mechanism for threshold establishment is unclear. In starfish oocytes, maturation-inducing hormones activate the PI3K-Akt pathway through the Gβγ complex of heterotrimeric G-proteins. Akt directly phosphorylates both Cdc25 phosphatase and Myt1 kinase, resulting in activation of cyclin-B-Cdk1, which then induces meiotic G2/M transition. Here, we show that cyclin-B-Cdk1 is partially activated after subthreshold hormonal stimuli, but this triggers negative feedback, resulting in dephosphorylation of Akt sites on Cdc25 and Myt1, thereby canceling the signal. We also identified phosphatase activity towards Akt substrates that exists independent of stimuli. In contrast to these negative regulatory activities, an atypical Gβγ-dependent pathway enhances PI3K-Akt-dependent phosphorylation. Based on these findings, we propose a model for threshold establishment in which hormonal dose-dependent competition between these new pathways establishes a threshold; the atypical Gβγ-pathway becomes predominant over Cdk-dependent negative feedback when the stimulus exceeds this threshold. Our findings provide a regulatory connection between cell cycle and signal transduction machineries. © 2016. Published by The Company of Biologists Ltd.

  15. Role of polyamines at the G1/S boundary and G2/M phase of the cell cycle.

    PubMed

    Yamashita, Tomoko; Nishimura, Kazuhiro; Saiki, Ryotaro; Okudaira, Hiroyuki; Tome, Mayuko; Higashi, Kyohei; Nakamura, Mizuho; Terui, Yusuke; Fujiwara, Kunio; Kashiwagi, Keiko; Igarashi, Kazuei

    2013-06-01

    The role of polyamines at the G1/S boundary and in the G2/M phase of the cell cycle was studied using synchronized HeLa cells treated with thymidine or with thymidine and aphidicolin. Synchronized cells were cultured in the absence or presence of α-difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, plus ethylglyoxal bis(guanylhydrazone) (EGBG), an inhibitor of S-adenosylmethionine decarboxylase. When polyamine content was reduced by treatment with DFMO and EGBG, the transition from G1 to S phase was delayed. In parallel, the level of p27(Kip1) was greatly increased, so its mechanism was studied in detail. Synthesis of p27(Kip1) was stimulated at the level of translation by a decrease in polyamine levels, because of the existence of long 5'-untranslated region (5'-UTR) in p27(Kip1) mRNA. Similarly, the transition from the G2/M to the G1 phase was delayed by a reduction in polyamine levels. In parallel, the number of multinucleate cells increased by 3-fold. This was parallel with the inhibition of cytokinesis due to an unusual distribution of actin and α-tubulin at the M phase. Since an association of polyamines with chromosomes was not observed by immunofluorescence microscopy at the M phase, polyamines may have only a minor role in structural changes of chromosomes at the M phase. In general, the involvement of polyamines at the G2/M phase was smaller than that at the G1/S boundary. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. High resolution spectral analysis of oxygen. IV. Energy levels, partition sums, band constants, RKR potentials, Franck-Condon factors involving the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g} and b{sup 1}Σ{sub g}{sup +} states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Shanshan, E-mail: shanshan.yu@jpl.nasa.gov; Drouin, Brian J.; Miller, Charles E.

    We have updated the isotopically invariant Dunham fit of O{sub 2} with newly reported literature transitions to derive (1) the energy levels, partition sums, band-by-band molecular constants, and RKR potentials for the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g}, and b{sup 1}Σ{sub g}{sup +} states of the six O{sub 2} isotopologues: {sup 16}O{sup 16}O, {sup 16}O{sup 17}O, {sup 16}O{sup 18}O, {sup 17}O{sup 17}O, {sup 17}O{sup 18}O, and {sup 18}O{sup 18}O; (2) Franck-Condon factors for their a{sup 1}Δ{sub g}−X{sup 3}Σ{sub g}{sup −}, b{sup 1}Σ{sub g}{sup +}−X{sup 3}Σ{sub g}{sup −}, and a{sup 1}Δ{sub g}−b{sup 1}Σ{sub g}{sup +} band systems. This new spectroscopicmore » parameterization characterizes all known transitions within and between the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g}, and b{sup 1}Σ{sub g}{sup +} states within experimental uncertainty and can be used for accurate predictions of as yet unmeasured transitions. All of these results are necessary to provide a consistent linelist of all transitions which will be reported in a followup paper.« less

  17. Expression of programmed cell death1 in T follicular helper cells is regulated by prostaglandin E2 secreted by HBV-infected HepG2.2.1.5 cells.

    PubMed

    Sui, Zhefeng; Shi, Ying; Gao, Zhiling; Yang, Deguang; Wang, Zhihao

    2017-06-01

    The present study aimed to investigate the distribution of T follicular helper (Tfh)-cell subsets in patients with hepatitis B virus (HBV) and determine the underlying mechanism of HBV regulation of Tfh cells. The frequency of peripheral blood Tfh subsets was analyzed using flow cytometry. The expression level of programmed cell death‑1 (PD‑1) and prostaglandin E2 (PGE2) was quantified using reverse transcription‑quantitative polymerase chain reaction and western blotting. The PGE2 level in culture supernatant was detected using enzyme‑linked immunosorbent assay. A Transwell chamber was used to co‑culture Tfh cells with HepG2 and HepG2.2.1.5. The percentage of inducible T‑cell costimulator (ICOS)+ and total Tfh cells was high at the immune activation (IA) group; however, it was reduced in the immune tolerance (IT), responders with HBsAg seroconversion (RP) and healthy control (HC) groups. The percentage of PD‑1+ Tfh cells was significantly higher in IA and IT compared with RP and HC. The ratio of PD‑1+/total Tfh cells was positively correlated with the load of HBV DNA; therefore, this ratio may act as an indicator for HBV replication. The expression level of PD‑1 in Tfh cells was higher in the HepG2.2.1.5 co‑cultured group compared with the HepG2 group, this may be due to the high PGE2 expression level in HBV‑infected HepG2.2.1.5 cells. The findings of the present study revealed an imbalanced distribution of PD‑1+ Tfh cells in patients with HBV at different immune phases. Additionally, HBV may upregulate the expression of PD‑1 in Tfh cells by promoting HepG2.2.1.5 to secret PGE2. Identifying the effect of HBV on Tfh‑cell subsets is crucial for improving immuno-based therapy for HBV.

  18. NF-κB and JNK mediated apoptosis and G0/G1 arrest of HeLa cells induced by rubiarbonol G, an arborinane-type triterpenoid from Rubia yunnanensis.

    PubMed

    Zeng, Guang-Zhi; Wang, Zhe; Zhao, Li-Mei; Fan, Jun-Ting; Tan, Ning-Hua

    2018-06-28

    Rubia yunnanensis is a medicinal plant mainly grown in Yunnan province in Southwest China, and its root named "Xiaohongshen" has been used as a herb in Yunnan for the treatment of cancers. Three major types of chemical components, Rubiaceae-type cyclopeptides, quinones, and triterpenoids, were identified from R. yunnanensis, in which some of compounds including rubiarbonol G (RG), a unique arboriane-type triterpenoid, showed cytotoxicity on cancer cells. But the cytotoxic mechanism of RG has not been reported. To investigate the cytotoxic mechanism of RG on cancer cells. RG was evaluated its cytotoxicity on 7 cancer cell lines by the SRB assay, and detected the effect on apoptosis and cell cycle arrest by Annexin V-FITC/PI apoptosis assay and DNA contents analysis. The expression and activity of apoptosis and cell cycle related proteins were also investigated by western blot and caspase activity assay. Furthermore, the effect of RG on NF-κB signaling was also tested by luciferase assay, western blot, and immunofluorescence staining. RG showed potent cytotoxicity on 7 human cancer cell lines, whose activity was attributed to apoptosis induction and G 0 /G 1 arrest in HeLa cells. Results from the mechanism study showed that RG promoted the activation of ERK1/2 and JNK pathway in MAPK family, which in turn increased the expression of p53, thereby triggering the G 0 /G 1 arrest through p53/p21/cyclin D1 signaling. Moreover, RG-mediated JNK activation down-regulated the expression of the anti-apoptotic protein Bcl-2, which caused the release of cytochrome c to the cytosol and activated the cleavage of caspase cascade and poly(ADP-ribose) polymerase, thereby inducing apoptosis in HeLa cells. In addition, RG was also found to inhibit the activation of NF-κB signaling by down-regulating the expression and attenuating the translocation to nucleus of NF-κB p65, by which the down-stream p53, cyclin D1, Bcl-2, and caspases were regulated, thereby triggering apoptosis and G

  19. Liposomal gD Ectodomain (gD1-306) Vaccine Protects Against HSV2 Genital or Rectal Infection of Female and Male Mice

    PubMed Central

    Olson, K.; Macias, P.; Hutton, S.; Ernst, W. A.; Fujii, G.; Adler-Moore, J. P.

    2009-01-01

    Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD1-306 vaccine (L-gD1-306-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD1-306-HD containing 60μg gD1-306-HD and 15μg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P≤0.0003 vs control liposomes; P=0.06 vs L-gD1-306-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD1-306-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P≤0.007). L-gD1-306-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD264-285-HD/MPL (male BALB/c, P≤0.001; female BALB/c and male C57BL/6, P=0.06). Mice given L-gD1-306-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD1-306-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-γ compared to IL-4 (P≤0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD1-306–HD vaccine can protect both male and female mice against intrarectal HSV2 challenge. PMID:19835825

  20. Visualizing Vpr-Induced G2 Arrest and Apoptosis

    PubMed Central

    Murakami, Tomoyuki; Aida, Yoko

    2014-01-01

    Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1) with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2). The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to characterize the

  1. Theoretical study of hyperfine coupling constants and electron spin g factors for X2Σ diatomics from Groups 1 and 2

    NASA Astrophysics Data System (ADS)

    Bruna, Pablo J.; Grein, Friedrich

    The ESR parameters of the cations Be 2 + , Mg 2 + , Ca 2 + , BeMg + , BeCa + , MgCa + and the mixed radicals ZBe, ZMg, ZCa (Z = Li, Na, K), all having a X 2 Σu + (1 σg 2 1 σu )/X 2 Sigma + (1 σ2 2 σ) ground state, have been studied theoretically. The A iso and A dip constants have been calculated with UHF, CISD, MP2, B3LYP, PW91PW91 wavefunctions, and 6-311+G(2df) basis sets. The electron spin g factors (magnetic moment μs) have been evaluated from correlated (MRDCI) wavefunctions, using a Hamiltonian based on Breit-Pauli theory with perturbation expansions up to second order, and 6-311+ G(2d) basis sets. As expected for s-rich radicals, the hyperfine spectra are governed by the A iso terms. Both Δg|| and Δg Υ̂values are negative, but Δg|| lies close to zero. For Δg Υ̂, the coupling with 1 2 Π(u) dominates the sum-over-states expansions. Although the singly occupied MOs (SOMO) are mostly of s character, the | Δg Υ̂| are relatively large, up to 5200 ppm for cationic, and up to 7850 ppm for neutral radicals. These large values are caused by low excitation energies and high magnetic transition moments, the latter due to the fact that the σ*( s - s ) SOMO has the same nodal properties as a p σorbital. Of the radicals considered here, an ESR spectrum is available only for Mg2+. Our theoretical A iso of-287 MHz reproduces well the matrix result (-291 MHz). Calculated values of-10 ppm for Deltag|| and of-1280 ppm for Deltag Υ̂give an average < Δg> =-860 ppm that lies within the experimental range of-600( ±300) ppm in Ne, and of-1300( ±500) ppm in Ar matrices.

  2. Geological studies of the COST nos. G-1 and G-2 wells, United States North Atlantic outer continental shelf

    USGS Publications Warehouse

    Scholle, Peter A.; Wenkam, Chiye R.

    1982-01-01

    The COST Nos. G-1 and G-2 wells (fig. 1) are the second and third deep stratigraphic test wells drilled in the North Atlantic Outer Continental Shelf of the United States. COST No. G-1 was drilled in the Georges Bank basin to a total depth of 16,071 ft (4,898 m). G-1 bottomed in phyllite, slate, and metaquartzite overlain by weakly metamorphosed dolomite, all of Cambrian age. From approximately 15,600 to 12,400 ft (4,755 to 3,780 m) the strata are Upper Triassic(?), Lower Jurassic(?), and Middle Jurassic, predominantly red shales, sandstones, and conglomerates. Thin, gray Middle Jurassic beds of shale, sandstone, limestone, and dolomite occur from 12,400 to 9,900 ft (3,780 to 3,018 m). From 9,900 to 1,030 ft (3,018 to 314 m) are coarse-grained unconsolidated sands and loosely cemented sandstones, with beds of gray shale, lignite, and coal. The microfossils indicate the rocks are Upper Jurassic from 10,100 ft (3,078 m) up to 5,400 ft (1,646 m) and Cretaceous from that depth to 1,030 ft (314 m). No younger or shallower rocks were recovered in the drilling at the COST No. G-1 site, but an Eocene limestone is inferred to be disconformable over Santonian strata. The Jurassic strata of the COST No. G-1 well were deposited in shallow marine, marginal marine, and nonmarine environments, which changed to a dominantly shallow marine but still nearshore environment in the Cretaceous. The COST No. G-2 well was drilled 42 statute miles {68 km) east of the G-1 site, still within the Georges Bank basin, to a depth of 21,874 ft (6,667 m). The bottom 40 ft (12 m) of salt and anhydrite is overlain by approximately 7,000 ft {2,134 m) of Upper Triassic{?), Lower Jurassic{?) and Middle Jurassic dolomite, limestone, and interbedded anhydrite from 21,830 to 13,615 ft (6,654 to 4,153 m). From 13,500 to 9,700 ft (4,115 to 2,957 m) are Middle Jurassic limestones with interbedded sandstone. From 9,700 to 4,000 ft (2,957 to 1,219 m) are Upper Jurassic and Cretaceous interbedded sandstones and

  3. Osthole induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma HepG2 cells.

    PubMed

    Chao, Xu; Zhou, Xiaojun; Zheng, Gang; Dong, Changhu; Zhang, Wei; Song, Xiaomei; Jin, Tianbo

    2014-05-01

    Osthole [7-methoxy-8-(3-methyl-2-butenyl) coumarin] isolated from the fruit of Cnidium monnieri (L.) Cuss, one of the commonly used Chinese medicines listed in the Shennong's Classic of Materia Medica in the Han Dynasty, had remarkable antiproliferative activity against human hepatocellular carcinoma HepG2 cells in culture. This study evaluated the effects of osthole on cell growth, nuclear morphology, cell cycle distribution, and expression of apoptosis-related proteins in HepG2 cells. Cytotoxic activity of osthole was determined by the MTT assay at various concentrations ranging from 0.004 to 1.0 µmol/ml in HepG2 cells. Cell morphology was assessed by Hoechst staining and fluorescence microscopy. Apoptosis and cell-cycle distribution was determined by annexin V staining and flow cytometry. Apoptotic protein levels were assessed by Western blot. Osthole exhibited significant inhibition of the survival of HepG2 cells and the half inhibitory concentration (IC₅₀) values were 0.186, 0.158 and 0.123 µmol/ml at 24, 48 and 72 h, respectively. Cells treated with osthole at concentrations of 0, 0.004, 0.02, 0.1 and 0.5 μmol/ml showed a statistically significant increase in the G2/M fraction accompanied by a decrease in the G0/G1 fraction. The increase of apoptosis induced by osthole was correlated with down-regulation expression of anti-apoptotic Bcl-2 protein and up-regulation expression of pro-apoptotic Bax and p53 proteins. Osthole had significant growth inhibitory activity and the pro-apoptotic effect of osthole is mediated through the activation of caspases and mitochondria in HepG2 cells. Results suggest that osthole has promising therapeutic potential against hepatocellular carcinoma.

  4. Prediction and identification of potential immunodominant epitopes in glycoproteins B, C, E, G, and I of herpes simplex virus type 2.

    PubMed

    Pan, Mingjie; Wang, Xingsheng; Liao, Jianmin; Yin, Dengke; Li, Suqin; Pan, Ying; Wang, Yao; Xie, Guangyan; Zhang, Shumin; Li, Yuexi

    2012-01-01

    Twenty B candidate epitopes of glycoproteins B (gB2), C (gC2), E (gE2), G (gG2), and I (gI2) of herpes simplex virus type 2 (HSV-2) were predicted using DNAstar, Biosun, and Antheprot methods combined with the polynomial method. Subsequently, the biological functions of the peptides were tested via experiments in vitro. Among the 20 epitope peptides, 17 could react with the antisera to the corresponding parent proteins in the EIA tests. In particular, five peptides, namely, gB2(466-473) (EQDRKPRN), gC2(216-223) (GRTDRPSA), gE2(483-491) (DPPERPDSP), gG2(572-579) (EPPDDDDS), and gI2(286-295) (CRRRYRRPRG) had strong reaction with the antisera. All conjugates of the five peptides with the carrier protein BSA could stimulate mice into producing antibodies. The antisera to these peptides reacted strongly with the corresponding parent glycoproteins during the Western Blot tests, and the peptides reacted strongly with the antibodies against the parent glycoproteins during the EIA tests. The antisera against the five peptides could neutralize HSV-2 infection in vitro, which has not been reported until now. These results suggest that the immunodominant epitopes screened using software algorithms may be used for virus diagnosis and vaccine design against HSV-2.

  5. [Biological contamination by micromycetes in dried Boletus edulis: research of aflatoxin B1, B2 G1, G2 and ochratoxin A].

    PubMed

    Lorini, C; Rossetti, F; Palazzoni, S; Comodo, N; Bonaccorsi, G

    2008-01-01

    Aim of this survey is to identify those filamentous fungi which parasite Boletus edulis and its group and check the potential presence of secondary metabolites, specifically aflatoxin B1, total aflatoxins and ochratoxin A, in order to assess the risk to consumers' health. Forty samples of dried Boletus edulis, collected by two food industries which distribute the product in many Italian regions, have been analysed. The sampling plan has been conducted from November 2005 to March 2006, collecting 50 g from each commercial category of dried Boletus edulis available in the factory at the time of sampling. All the samples have been tested by visual macroscopic and stereoscopic assays; for some samples--those referred to commercial category presumably at higher risk--we have performed cultural assays as well, typization of isolated micromycetes, extraction and quantification of aflatoxins and ochratoxin A. Mycotoxin detection has been made by HPLC, using the UNI EN 14123 and UNI EN 14132 standard methods, respectively applied to aflatoxins determination in peanuts, pistachios, figs and paprika and to ochratoxin A in barley and coffee. Non pathogenic micromycetes, common in food products, have been frequently observed in cultural assays, while Aspergillus flavus and Aspergillus niger have been found in some samples. However the concentration of aflatoxins was always under the quantification limit. The survey confirm that, if the cold chain is kept throughout the process and the distribution, Boletus edulis and analogue mycetes are not a favourable substratum for the growth and the development of moulds.

  6. HIV-1 evades virus-specific IgG2 and IgA class switching by targeting systemic and intestinal B cells via long-range intercellular conduits

    PubMed Central

    Xu, Weifeng; Santini, Paul A.; Sullivan, John S.; He, Bing; Shan, Meimei; Ball, Susan C.; Dyer, Wayne B.; Ketas, Thomas J.; Chadburn, Amy; Cohen-Gould, Leona; Knowles, Daniel M.; Chiu, April; Sanders, Rogier W.; Chen, Kang; Cerutti, Andrea

    2009-01-01

    Contact-dependent communication between immune cells generates protection, but also facilitates viral spread. We found that macrophages formed long-range actin-propelled conduits in response to negative factor (Nef), a human immunodeficiency virus type-1 (HIV-1) protein with immunosuppressive functions. Conduits attenuated immunoglobulin G2 (IgG2) and IgA class switching in systemic and intestinal lymphoid follicles by shuttling Nef from infected macrophages to B cells through a guanine exchange factor-dependent pathway involving the amino-terminal anchor, central core and carboxy-terminal flexible loop of Nef. By showing stronger virus-specific IgG2 and IgA responses in patients harboring Nef-deficient virions, our data suggest that HIV-1 exploits intercellular highways as a “Trojan horse” to deliver Nef to B cells and evade humoral immunity systemically and at mucosal sites of entry. PMID:19648924

  7. Synthesis and biological activity of novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives

    PubMed Central

    El-Sawy, Eslam R.; Ebaid, Manal S.; Abo-Salem, Heba M.; El-Hallouty, Salwa; Kassem, Emad M.; Mandour, Adel H.

    2013-01-01

    A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a–g and 11a–g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a–g and 7a–g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a–g, and 11a–g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively. PMID:25685501

  8. Synthesis and biological activity of novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives.

    PubMed

    El-Sawy, Eslam R; Ebaid, Manal S; Abo-Salem, Heba M; El-Hallouty, Salwa; Kassem, Emad M; Mandour, Adel H

    2014-05-01

    A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a-g and 11a-g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a-g and 7a-g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a-g, and 11a-g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively.

  9. VCC-1 over-expression inhibits cisplatin-induced apoptosis in HepG2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Zhitao; Lu, Xiao; Zhu, Ping

    Highlights: Black-Right-Pointing-Pointer VCC-1 is hypothesized to be associated with carcinogenesis. Black-Right-Pointing-Pointer Levels of VCC-1 are increased significantly in HCC. Black-Right-Pointing-Pointer Over-expression of VCC-1 could promotes cellular proliferation rate. Black-Right-Pointing-Pointer Over-expression of VCC-1 inhibit the cisplatin-provoked apoptosis in HepG2 cells. Black-Right-Pointing-Pointer VCC-1 plays an important role in control the tumor growth and apoptosis. -- Abstract: Vascular endothelial growth factor-correlated chemokine 1 (VCC-1), a recently described chemokine, is hypothesized to be associated with carcinogenesis. However, the molecular mechanisms by which aberrant VCC-1 expression determines poor outcomes of cancers are unknown. In this study, we found that VCC-1 was highly expressed in hepatocellularmore » carcinoma (HCC) tissue. It was also associated with proliferation of HepG2 cells, and inhibition of cisplatin-induced apoptosis of HepG2 cells. Conversely, down-regulation of VCC-1 in HepG2 cells increased cisplatin-induced apoptosis of HepG2 cells. In summary, these results suggest that VCC-1 is involved in cisplatin-induced apoptosis of HepG2 cells, and also provides some evidence for VCC-1 as a potential cellular target for chemotherapy.« less

  10. Robust G2 pausing of adult stem cells in Hydra.

    PubMed

    Buzgariu, Wanda; Crescenzi, Marco; Galliot, Brigitte

    2014-01-01

    Hydra is a freshwater hydrozoan polyp that constantly renews its two tissue layers thanks to three distinct stem cell populations that cannot replace each other, epithelial ectodermal, epithelial endodermal, and multipotent interstitial. These adult stem cells, located in the central body column, exhibit different cycling paces, slow for the epithelial, fast for the interstitial. To monitor the changes in cell cycling in Hydra, we established a fast and efficient flow cytometry procedure, which we validated by confirming previous findings, as the Nocodazole-induced reversible arrest of cell cycling in G2/M, and the mitogenic signal provided by feeding. Then to dissect the cycling and differentiation behaviors of the interstitial stem cells, we used the AEP_cnnos1 and AEP_Icy1 transgenic lines that constitutively express GFP in this lineage. For the epithelial lineages we used the sf-1 strain that rapidly eliminates the fast cycling cells upon heat-shock and progressively becomes epithelial. This study evidences similar cycling patterns for the interstitial and epithelial stem cells, which all alternate between the G2 and S-phases traversing a minimal G1-phase. We also found interstitial progenitors with a shorter G2 that pause in G1/G0. At the animal extremities, most cells no longer cycle, the epithelial cells terminally differentiate in G2 and the interstitial progenitors in G1/G0. At the apical pole ~80% cells are post-mitotic differentiated cells, reflecting the higher density of neurons and nematocytes in this region. We discuss how the robust G2 pausing of stem cells, maintained over weeks of starvation, may contribute to regeneration. Copyright © 2014 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

  11. Eukaryotic Initiation Factor eIFiso4G1 and eIFiso4G2 Are Isoforms Exhibiting Distinct Functional Differences in Supporting Translation in Arabidopsis*

    PubMed Central

    Gallie, Daniel R.

    2016-01-01

    The eukaryotic translation initiation factor (eIF) 4G is required during protein synthesis to promote the assembly of several factors involved in the recruitment of a 40S ribosomal subunit to an mRNA. Although many eukaryotes express two eIF4G isoforms that are highly similar, the eIF4G isoforms in plants, referred to as eIF4G and eIFiso4G, are highly divergent in size, sequence, and domain organization but both can interact with eIF4A, eIF4B, eIF4E isoforms, and the poly(A)-binding protein. Nevertheless, eIF4G and eIFiso4G from wheat exhibit preferences in the mRNAs they translate optimally. For example, mRNA containing the 5′-leader (called Ω) of tobacco mosaic virus preferentially uses eIF4G in wheat germ lysate. In this study, the eIF4G isoform specificity of Ω was used to examine functional differences of the eIF4G isoforms in Arabidopsis. As in wheat, Ω-mediated translation was reduced in an eif4g null mutant. Loss of the eIFiso4G1 isoform, which is similar in sequence to wheat eIFiso4G, did not substantially affect Ω-mediated translation. However, loss of the eIFiso4G2 isoform substantially reduced Ω-mediated translation. eIFiso4G2 is substantially divergent from eIFiso4G1 and is present only in the Brassicaceae, suggesting a recent evolution. eIFiso4G2 isoforms exhibit sequence-specific differences in regions representing partner protein and RNA binding sites. Loss of any eIF4G isoform also resulted in a substantial reduction in reporter transcript level. These results suggest that eIFiso4G2 appeared late in plant evolution and exhibits more functional similarity with eIF4G than with eIFiso4G1 during Ω-mediated translation. PMID:26578519

  12. Fumosorinone, a novel PTP1B inhibitor, activates insulin signaling in insulin-resistance HepG2 cells and shows anti-diabetic effect in diabetic KKAy mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Zhi-Qin; College of Pharmaceutical Sciences, key laboratory of pharmaceutical quality control of Hebei province, Hebei University, Baoding 071002; Liu, Ting

    Insulin resistance is a characteristic feature of type 2 diabetes mellitus (T2DM) and is characterized by defects in insulin signaling. Protein tyrosine phosphatase 1B (PTP1B) is a key negative regulator of the insulin signaling pathways, and its increased activity and expression are implicated in the pathogenesis of insulin resistance. Therefore, the inhibition of PTP1B is anticipated to become a potential therapeutic strategy to treat T2DM. Fumosorinone (FU), a new natural product isolated from insect fungi Isaria fumosorosea, was found to inhibit PTP1B activity in our previous study. Herein, the effects of FU on insulin resistance and mechanism in vitro andmore » in vivo were investigated. FU increased the insulin-provoked glucose uptake in insulin-resistant HepG2 cells, and also reduced blood glucose and lipid levels of type 2 diabetic KKAy mice. FU decreased the expression of PTP1B both in insulin-resistant HepG2 cells and in liver tissues of diabetic KKAy mice. Furthermore, FU increased the phosphorylation of IRβ, IRS-2, Akt, GSK3β and Erk1/2 in insulin-resistant HepG2 cells, as well as the phosphorylation of IRβ, IRS-2, Akt in liver tissues of diabetic KKAy mice. These results showed that FU increased glucose uptake and improved insulin resistance by down-regulating the expression of PTP1B and activating the insulin signaling pathway, suggesting that it may possess antidiabetic properties. - Highlights: • Fumosorinone is a new PTP1B inhibitor isolated from insect pathogenic fungi. • Fumosorinone attenuated the insulin resistance both in vitro and in vivo. • Fumosorinone decreased the expression of PTP1B both in vitro and in vivo. • Fumosorinone activated the insulin signaling pathway both in vitro and in vivo.« less

  13. Liposomal gD ectodomain (gD1-306) vaccine protects against HSV2 genital or rectal infection of female and male mice.

    PubMed

    Olson, K; Macias, P; Hutton, S; Ernst, W A; Fujii, G; Adler-Moore, J P

    2009-12-11

    Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD(1-306) vaccine (L-gD(1-306)-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD(1-306)-HD containing 60 microg gD(1-306)-HD and 15 microg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P< or =0.0003 vs. control liposomes; P=0.06 vs. L-gD(1-306)-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD(1-306)-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P< or =0.007). L-gD(1-306)-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD(264-285)-HD/MPL (male BALB/c, PgD(1-306)-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD(1-306)-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-gamma compared to IL-4 (P< or =0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD(1-306)-HD vaccine can protect both male and female mice against intrarectal HSV2 challenge.

  14. Measuring the performance of G2G services in Iran

    NASA Astrophysics Data System (ADS)

    Zarei, Behrouz; Safdari, Maryam

    To highlight the growth of e-government and the importance of its services it is essential to evaluate the performance of the service delivery to customers. Research indicates that traditional performance indexes are not suitable for this evaluation; moreover, it is noticeable that the e-government services are intangible and invisible. Among different e-government services, measurement of quality government to government (G2G) services has been less attractive for researchers while crucial for government policy-makers. This calls for a better understanding of the specific needs of users of these services in order to provide appropriate type and level of services that meets those needs. In this paper, the performance of the G2G services is measured in the Iranian context. For this purpose, SERVQUAL, which is a well-known method for assessing service quality, is employed. This study proposes and tests a five-factor of SERVQUAL instrument to explain user satisfaction and gap analysis, between expectations and perceptions of its customers, consisting thirty ministries and main governmental organizations. Based on a Chi-square test, factor analysis, gap analysis and correlations, it is concluded the gap between expectations and perceptions of G2G customers is significant and customer satisfaction of G2G services is at low level.

  15. The MCP-1 Gene A-2518G Polymorphism Confers an Increased Risk of Vascular Complications in Type 2 Diabetes Mellitus Patients.

    PubMed

    Xu, Jin; Liao, Yun-Fei; Zhou, Wei-Ping; Ming, Hua-Li; Wang, Qing-Hai

    2015-08-01

    We aimed to evaluate the correlation of the monocyte chemoattractant protein 1 (MCP-1) A-2518G polymorphism with type 2 diabetes mellitus (T2DM) and vascular complications in T2DM, to aid in understanding its role in pathogenesis. A total of 150 T2DM patients and 50 healthy controls (group A) were enrolled. The T2DM patients were divided into three groups based on the absence of complications (group B) presence of microvascular disease (group C) or macrovascular disease (group D). DNA of all enrolled subjects was genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for the MCP-1 A-2518G polymorphism. Serum MCP-1 levels were measured by an enzyme-linked immunosorbent assay (ELISA). Participants in group D had increased serum MCP-1 levels relative to group B, group C, and group A (all p<0.01). Compared with group A, the frequencies of the MCP-1 A-2518G G/G genotype and G allele were significantly higher in group C and group D (all p<0.05). In contrast to group B, group C had higher frequencies of the G/G genotype and G allele, while group D had higher G allele frequencies (all p<0.05). Logistic regression analysis showed that lower body-mass index (BMI) and free cholesterol (FC), as well as higher high-density lipoprotein cholesterol (HDL-C) levels may be the protective factors for T2DM, while higher levels of triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and G/G genotype frequency were independent risk factors for T2DM. Our data indicates a correlation between the MCP-1 A-2518G polymorphism with macrovascular complications in T2DM patients; lower BMI and FC, as well as higher HDL-C levels may be the protective factors for T2DM, while higher levels of TG, LDL-C, and G/G genotype frequency were independent risk factors for T2DM.

  16. In brown adipocytes, adrenergically induced β{sub 1}-/β{sub 3}-(G{sub s})-, α{sub 2}-(G{sub i})- and α{sub 1}-(G{sub q})-signalling to Erk1/2 activation is not mediated via EGF receptor transactivation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yanling; Fälting, Johanna M.; Mattsson, Charlotte L.

    2013-10-15

    Brown adipose tissue is unusual in that the neurotransmitter norepinephrine influences cell destiny in ways generally associated with effects of classical growth factors: regulation of cell proliferation, of apoptosis, and progression of differentiation. The norepinephrine effects are mediated through G-protein-coupled receptors; further mediation of such stimulation to e.g. Erk1/2 activation is in cell biology in general accepted to occur through transactivation of the EGF receptor (by external or internal pathways). We have examined here the significance of such transactivation in brown adipocytes. Stimulation of mature brown adipocytes with cirazoline (α{sub 1}-adrenoceptor coupled via G{sub q}), clonidine (α{sub 2} via G{submore » i}) or CL316243 (β{sub 3} via G{sub s}) or via β{sub 1}-receptors significantly activated Erk1/2. Pretreatment with the EGF receptor kinase inhibitor AG1478 had, remarkably, no significant effect on Erk1/2 activation induced by any of these adrenergic agonists (although it fully abolished EGF-induced Erk1/2 activation), demonstrating absence of EGF receptor-mediated transactivation. Results with brown preadipocytes (cells in more proliferative states) were not qualitatively different. Joint stimulation of all adrenoceptors with norepinephrine did not result in synergism on Erk1/2 activation. AG1478 action on EGF-stimulated Erk1/2 phosphorylation showed a sharp concentration–response relationship (IC{sub 50} 0.3 µM); a minor apparent effect of AG1478 on norepinephrine-stimulated Erk1/2 phosphorylation showed nonspecific kinetics, implying caution in interpretation of partial effects of AG1478 as reported in other systems. Transactivation of the EGF receptor is clearly not a universal prerequisite for coupling of G-protein coupled receptors to Erk1/2 signalling cascades. - Highlights: • In brown adipocytes, norepinephrine regulates proliferation, apoptosis, differentiation. • EGF receptor transactivation is supposed to

  17. The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2.

    PubMed

    Saito, Motoki; Ishikawa, Fuyuki

    2002-09-20

    Although mammalian MBD3 contains the mCpG-binding domain (MBD) and is highly homologous with the authentic mCpG-binding protein MBD2, it was reported that the protein does not bind to mCpG specifically. Using recombinant human wild type and mutant MBD3 proteins, we demonstrated that atypical amino acids found in MBD3 MBD, namely, His-30 and Phe-34, are responsible for the inability of MBD3 to bind to mCpG. Interestingly, although H30K/F34Y MBD3 mutant protein binds to mCpG efficiently in vitro, it was not localized at the mCpG-rich pericentromeric regions in mouse cells. We also showed that Y34F MBD2b MBD, which possesses not the mCpG-specific DNA-binding activity but the nonspecific DNA-binding activity, was localized at the pericentromeric regions. These results suggested that the mCpG-specific DNA-binding activity is largely dispensable, and another factor(s) is required for the localization of MBD proteins in vivo. MBD3 was identified as a component of the NuRD/Mi2 complex that shows chromatin remodeling and histone deacetylase activities. We demonstrated that MBD3 MBD is necessary and sufficient for binding to HDAC1 and MTA2, two components of the NuRD/Mi2 complex. It was therefore suggested that mCpG-binding-defective MBD3 has evolutionarily conserved its MBD because of the secondary role played by the MBD in protein-protein interactions.

  18. Induction of Apoptosis by Berberine in Hepatocellular Carcinoma HepG2 Cells via Downregulation of NF-κB.

    PubMed

    Li, Min; Zhang, Mao; Zhang, Zhi-Lang; Liu, Ning; Han, Xiao-Yu; Liu, Qin-Cheng; Deng, Wei-Jun; Liao, Cai-Xian

    2017-01-26

    Hepatocellular carcinoma (HCC) is highly resistant to traditional chemotherapeutic approaches, which causes difficulty in the development of effective drugs for the treatment of HCC. Berberine, a major ingredient of Rhizoma coptidis, is a natural alkaloid used in traditional Chinese medicine. Berberine exhibits potent antitumor activity against HCC due to its high efficiency and low toxicity. In the present study, we found that berberine sensitized HepG cells to NF-κB-mediated apoptosis. Berberine exhibited a significant antiproliferation effect on the HepG2 cells and promoted apoptosis. Both qRT-PCR and immunofluorescence staining revealed that berberine reduced the NF-κB p65 levels in HepG2 cells. Moreover, p65 overexpression rescued berberine-induced cell proliferation and prevented HepG2 cells from undergoing apoptosis. These results suggest that berberine inhibits the growth of HepG2 cells by promoting apoptosis through the NF-κB p65 pathway.

  19. Electronegative L5-LDL induces the production of G-CSF and GM-CSF in human macrophages through LOX-1 involving NF-κB and ERK2 activation.

    PubMed

    Yang, Tzu-Ching; Chang, Po-Yuan; Kuo, Tzu-Ling; Lu, Shao-Chun

    2017-12-01

    Circulating levels of granulocyte colony-stimulating factor (G-CSF) and granulocyte macrophage colony-stimulating factor (GM-CSF) are associated with the severity of acute myocardial infarction (AMI). However, what causes increases in G-CSF and GM-CSF is unclear. In this study, we investigated whether L5-low-density lipoprotein (LDL), a mildly oxidized LDL from AMI, can induce G-CSF and GM-CSF production in human macrophages. L1-LDL and L5-LDL were isolated through anion-exchange chromatography from AMI plasma. Human macrophages derived from THP-1 and peripheral blood mononuclear cells were treated with L1-LDL, L5-LDL, or copper-oxidized LDL (Cu-oxLDL) and G-CSF and GM-CSF protein levels in the medium were determined. In addition, the effects of L5-LDL on G-CSF and GM-CSF production were tested in lectin-type oxidized LDL receptor-1 (LOX-1), CD36, extracellular signal-regulated kinase (ERK) 1, and ERK2 knockdown THP-1 macrophages. L5-LDL but not L1-LDL or Cu-oxLDL significantly induced production of G-CSF and GM-CSF in macrophages. In vitro oxidation of L1-LDL and L5-LDL altered their ability to induce G-CSF and GM-CSF, suggesting that the degree of oxidation is critical for the effects. Knockdown and antibody neutralization experiments suggested that the effects were caused by LOX-1. In addition, nuclear factor (NF)-κB and ERK1/2 inhibition resulted in marked reductions of L5-LDL-induced G-CSF and GM-CSF production. Moreover, knockdown of ERK2, but not ERK1, hindered L5-LDL-induced G-CSF and GM-CSF production. The results indicate that L5-LDL, a naturally occurring mild oxidized LDL, induced G-CSF and GM-CSF production in human macrophages through LOX-1, ERK2, and NF-κB dependent pathways. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Anti-cancer Activity of Osmanthus matsumuranus Extract by Inducing G2/M Arrest and Apoptosis in Human Hepatocellular Carcinoma Hep G2 Cells

    PubMed Central

    Jin, Soojung; Park, Hyun-Jin; Oh, You Na; Kwon, Hyun Ju; Kim, Jeong-Hwan; Choi, Yung Hyun; Kim, Byung Woo

    2015-01-01

    Background: Osmanthus matsumuranus, a species of Oleaceae, is found in East Asia and Southeast Asia. The bioactivities of O. matsumuranus have not yet been fully understood. Here, we studied on the molecular mechanisms underlying anti-cancer effect of ethanol extract of O. matsumuranus (EEOM). Methods: Inhibitory effect of EEOM on cell growth and proliferation was determined by WST assay in various cancer cells. To investigate the mechanisms of EEOM-mediated cytotoxicity, HepG2 cells were treated with various concentration of EEOM and analyzed the cell cycle arrest and apoptosis induction by flow cytometry, Western blot analysis, 4,6-diamidino-2-phenylindole (DAPI) staining and DNA fragmentation. Results: EEOM showed the cytotoxic activities in a dose-dependent manner in various cancer cell lines but not in normal cells, and HepG2 cells were most susceptible to EEOM-induced cytotoxicity. EEOM induced G2/M arrest in HepG2 cells associated with decreased expression of cyclin-dependent kinase 1 (CDK1), cyclin A and cylcin B, and increased expression of phospho-checkpoint kinase 2, p53 and CDK inhibitor p21. Immunofluorescence staining showed that EEOM-treated HepG2 increased doublet nuclei and condensed actin, resulting in cell rounding. Furthermore, EEOM-mediated apoptosis was determined by Annexin V staining, chromatin condensation and DNA fragmentation. EEOM caused upregulation of FAS and Bax, activation of caspase-3, -8, -9, and fragmentation of poly ADP ribose polymerase. Conclusions: These results suggest that EEOM efficiently inhibits proliferation of HepG2 cells by inducing both G2/M arrest and apoptosis via intrinsic and extrinsic pathways, and EEOM may be used as a cancer chemopreventive agent in the food or nutraceutical industry. PMID:26734586

  1. The effect of α2-δ and other accessory subunits on expression and properties of the calcium channel α1G

    PubMed Central

    Dolphin, A C; Wyatt, C N; Richards, J; Beattie, R E; Craig, P; Lee, J-H; Cribbs, L L; Volsen, S G; Perez-Reyes, E

    1999-01-01

    The effect has been examined of the accessory α2-δ and β subunits on the properties of α1G currents expressed in monkey COS-7 cells and Xenopus oocytes. In immunocytochemical experiments, the co-expression of α2-δ increased plasma membrane localization of expressed α1G and conversely, the heterologous expression of α1G increased immunostaining for endogenous α2-δ, suggesting an interaction between the two subunits. Heterologous expression of α2-δ together with α1G in COS-7 cells increased the amplitude of expressed α1G currents by about 2-fold. This finding was confirmed in the Xenopus oocyte expression system. The truncated δ construct did not increase α1G current amplitude, or increase its plasma membrane expression. This indicates that it is the exofacial α2 domain that is involved in the enhancement by α2-δ. β1b also produced an increase of functional expression of α1G, either in the absence or the presence of heterologously expressed α2-δ, whereas the other β subunits had much smaller effects. None of the accessory subunits had any marked influence on the voltage dependence or kinetics of the expressed α1G currents. These results therefore suggest that α2-δ and β1b interact with α1G to increase trafficking of, or stabilize, functional α1G channels expressed at the plasma membrane. PMID:10432337

  2. Mapping regions of Epstein-Barr virus (EBV) glycoprotein B (gB) important for fusion function with gH/gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Plate, Aileen E.; Reimer, Jessica J.; Jardetzky, Theodore S.

    Glycoproteins gB and gH/gL are required for entry of Epstein-Barr virus (EBV) into cells, but the role of each glycoprotein and how they function together to mediate fusion is unclear. Analysis of the functional homology of gB from the closely related primate gammaherpesvirus, rhesus lymphocryptovirus (Rh-LCV), showed that EBV gB could not complement Rh gB due to a species-specific dependence between gB and gL. To map domains of gB required for this interaction, we constructed a panel of EBV/Rh gB chimeric proteins. Analysis showed that insertion of Rh gB from residues 456 to 807 restored fusion function of EBV gBmore » with Rh gH/gL, suggesting this region of gB is important for interaction with gH/gL. Split YFP bimolecular complementation (BiFC) provided evidence of an interaction between EBV gB and gH/gL. Together, our results suggest the importance of a gB-gH/gL interaction in EBV-mediated fusion with B cells requiring the region of EBV gB from 456 to 807.« less

  3. NF-κB mediates the antiproliferative and proapoptotic effects of bergamot juice in HepG2 cells.

    PubMed

    Ferlazzo, Nadia; Cirmi, Santa; Russo, Marina; Trapasso, Elena; Ursino, Maria Rita; Lombardo, Giovanni Enrico; Gangemi, Sebastiano; Calapai, Gioacchino; Navarra, Michele

    2016-02-01

    Among cancers, hepatocellular carcinoma is one of the commonest worldwide, and its incidence is increasing around the world. A lot of evidence underlines that natural substances usually consumed in the diet can have an important role in the prevention of cancer. In this study we investigated the molecular mechanisms underlying the antiproliferative activity of Citrus bergamia (bergamot) juice (BJ) in human hepatocellular carcinoma HepG2 cells. HepG2 cells were exposed to BJ and then cell proliferation, cell cycle progression, apoptosis and NF-κB nuclear translocation were evaluated. Here we present results demonstrating that BJ reduced the growth rate of human hepatocellular carcinoma HepG2 cells in a time- and concentration-dependent manner, by a mechanism involving the activation of apoptotic machinery via both intrinsic and extrinsic pathways. Moreover, BJ increased expression of P53 and P21 proteins that may be responsible for the HepG2 cell cycle arrest in G2 phase. In addition, BJ reduced NF-κB nuclear translocation. Our data demonstrate the ability of BJ in reducing the growth of HepG2 cells, revealing its mechanism of action and suggesting a promising role as anticancer drugs. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Study of collisional deactivation of O{sub 2}(b{sup 1}{Sigma}{sub g}{sup +}) molecules in a hydrogen-oxygen mixture at high temperatures using laser-induced gratings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kozlov, D. N., E-mail: dnk@kapella.gpi.ru; Kobtsev, V. D.; Stel'makh, O. M.

    2013-07-15

    Collisional deactivation of O{sub 2}(b{sup 1}{Sigma}{sub g}{sup +}) molecules resonantly excited by a 10 ns pulse of laser radiation with a wavelength of 762 nm in H{sub 2}/O{sub 2} mixtures is experimentally studied. The radiation intensity and hence the molecule excitation efficiency have a spatially periodic modulation that leads to the formation of laser-induced gratings (LIGs) of the refractive index. The study of LIG temporal evolution allows collisional relaxation rates of molecular excited states and gas temperature to be determined. In this work, the b{sup 1}{Sigma}{sub g}{sup +} state of O{sub 2} molecules deactivation rates are measured in a 4.3more » vol % H{sub 2} mixture at the number density of 2 amg in the temperature range 291-850 K. The physical deactivation is shown to dominate in the collisions of H{sub 2} with O{sub 2}(b{sup 1}{Sigma}{sub g}{sup +}) and O{sub 2}(a{sup 1}{Delta}{sub g}) up to temperatures of 780-790 K at time delays up to 10 {mu}s after the excitation pulse. The parameters of the obtained temperature dependence of the (b{sup 1}{Sigma}{sub g}{sup +} state deactivation rate agree well with the data of independent measurements performed earlier at lower temperatures (200-400 K). Tunable diode laser absorption spectroscopy is used to measure the temperature dependence of the number density of the H{sub 2}O molecules which appear as the mixture, as the result of the dark gross reaction with O{sub 2} molecules in the ground state, O{sub 2} + 2H{sub 2} {yields} 2H{sub 2}O. The measurements show that this reaction results in complete transformation of H{sub 2} into H{sub 2}O at temperatures of 790-810 K.« less

  5. LASER APPLICATIONS AND OTHER TOPICS IN QUANTUM ELECTRONICS: An optical boiler generating singlet oxygen O2 (a1Δg)

    NASA Astrophysics Data System (ADS)

    Lipatov, N. I.; Biryukov, A. S.; Gulyamova, E. S.

    2008-12-01

    An ecologically perfect generator of singlet oxygen O2 (a1Δg) is proposed which fundamentally differs from existing singlet-oxygen generators. Excited O2 (a1Δg) molecules are generated due to interaction of the O2 (X3Σ-g) molecules with a quasi-monochromatic field, which is supplied from an external source to a closed volume — an optical boiler containing oxygen. It is shown that, by pumping continuously the optical boiler by the light field of power ~3×105 W, it is possible to accumulate up to 40% of singlet oxygen (O2(b1Σ+g)) + (O2 (a1Δg)) in the boiler volume during ~10-2 s.

  6. The extreme ultraviolet spectrum of G191 - B2B and the ionization of the local interstellar medium

    NASA Technical Reports Server (NTRS)

    Green, James; Jelinsky, Patrick; Bowyer, Stuart

    1990-01-01

    The measurement of the extreme ultraviolet spectrum of the nearby hot white dwarf G191 - B2B is reported. The results are used to derive interstellar neutral column densities of 1.6 + or - 0.2 x 10 to the 18th/sq cm and 9.8 + 2.8 or - 2.6 x 10 to the 16th/sq cm for H I and He I, respectively. This ratio of neutral hydrogen to neutral helium indicates that the ionization of hydrogen along the line of sight is less than about 30 percent unless significant helium ionization is present. The scenario in which the hydrogen is highly ionized and the helium is neutral is ruled out by this observation.

  7. The G protein Gi1 exhibits basal coupling but not preassembly with G protein-coupled receptors.

    PubMed

    Bondar, Alexey; Lazar, Josef

    2017-06-09

    The G i/o protein family transduces signals from a diverse group of G protein-coupled receptors (GPCRs). The observed specificity of G i/o -GPCR coupling and the high rate of G i/o signal transduction have been hypothesized to be enabled by the existence of stable associates between G i/o proteins and their cognate GPCRs in the inactive state (G i/o -GPCR preassembly). To test this hypothesis, we applied the recently developed technique of two-photon polarization microscopy (2PPM) to Gα i1 subunits labeled with fluorescent proteins and four GPCRs: the α 2A -adrenergic receptor, GABA B , cannabinoid receptor type 1 (CB 1 R), and dopamine receptor type 2. Our experiments with non-dissociating mutants of fluorescently labeled Gα i1 subunits (exhibiting impaired dissociation from activated GPCRs) showed that 2PPM is capable of detecting GPCR-G protein interactions. 2PPM experiments with non-mutated fluorescently labeled Gα i1 subunits and α 2A -adrenergic receptor, GABA B , or dopamine receptor type 2 receptors did not reveal any interaction between the G i1 protein and the non-stimulated GPCRs. In contrast, non-stimulated CB 1 R exhibited an interaction with the G i1 protein. Further experiments revealed that this interaction is caused solely by CB 1 R basal activity; no preassembly between CB 1 R and the G i1 protein could be observed. Our results demonstrate that four diverse GPCRs do not preassemble with non-active G i1 However, we also show that basal GPCR activity allows interactions between non-stimulated GPCRs and G i1 (basal coupling). These findings suggest that G i1 interacts only with active GPCRs and that the well known high speed of GPCR signal transduction does not require preassembly between G proteins and GPCRs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Human rotavirus strains circulating in Venezuela after vaccine introduction: predominance of G2P[4] and reemergence of G1P[8].

    PubMed

    Vizzi, Esmeralda; Piñeros, Oscar A; Oropeza, M Daniela; Naranjo, Laura; Suárez, José A; Fernández, Rixio; Zambrano, José L; Celis, Argelia; Liprandi, Ferdinando

    2017-03-21

    Rotavirus (RV) is the most common cause of severe childhood diarrhea worldwide. Despite Venezuela was among the first developing countries to introduce RV vaccines into their national immunization schedules, RV is still contributing to the burden of diarrhea. Concerns exist about the selective pressure that RV vaccines could exert on the predominant types and/or emergence of new strains. To assess the impact of RV vaccines on the genotype distribution 1 year after the vaccination was implemented, a total of 912 fecal specimens, collected from children with acute gastroenteritis in Caracas from February 2007 to April 2008, were screened, of which 169 (18.5%) were confirmed to be RV positive by PAGE. Rotavirus-associated diarrhea occurred all year-round, although prevailed during the coolest and driest months among unvaccinated children under 24 months old. Of 165 RV strains genotyped for G (VP7) and P (VP4) by seminested multiplex RT-PCR, 77 (46.7%) were G2P[4] and 63 (38.2%) G1P[8]. G9P[8], G3P[8] and G2P[6] were found in a lower proportion (7.3%). Remarkable was also the detection of <5% of uncommon combinations (G8P[14], G8P[4], G1P[4] and G4P[4]) and 3.6% of mixed infections. A changing pattern of G/P-type distribution was observed during the season studied, with complete predominance of G2P[4] from February to June 2007 followed by its gradual decline and the reemergence of G1P[8], predominant since January 2008. Phylogenetic analysis of VP7 and VP4 genes revealed a high similarity among G2P[4] and global strains belonging to G2-II and P[4]-V lineages. The amino acid substitution 96D → N, related with reemergence of the G2 genotype elsewhere, was observed. The G1P[8] strains from Caracas were grouped into the lineages G1-I and P[8]-III, along with geographically remote G1P[8] rotaviruses, but they were rather distant from Rotarix ® vaccine and pre-vaccine strains. Unique amino acid substitutions observed on neutralization domains of the VP7 sequence from

  9. 5-brane webs for 5d N = 1 G 2 gauge theories

    NASA Astrophysics Data System (ADS)

    Hayashi, Hirotaka; Kim, Sung-Soo; Lee, Kimyeong; Yagi, Futoshi

    2018-03-01

    We propose 5-brane webs for 5d N = 1 G 2 gauge theories. From a Higgsing of the SO(7) gauge theory with a hypermultiplet in the spinor representation, we construct two types of 5-brane web configurations for the pure G 2 gauge theory using an O5-plane or an \\tilde{O5} -plane. Adding flavors to the 5-brane web for the pure G 2 gauge theory is also discussed. Based on the obtained 5-brane webs, we compute the partition functions for the 5d G 2 gauge theories using the recently suggested topological vertex formulation with an O5-plane, and we find agreement with known results.

  10. ANT2 expression under hypoxic conditions produces opposite cell-cycle behavior in 143B and HepG2 cancer cells.

    PubMed

    Chevrollier, Arnaud; Loiseau, Dominique; Gautier, Fabien; Malthièry, Yves; Stepien, Georges

    2005-01-01

    Under hypoxic conditions, mitochondrial ATP production ceases, leaving cells entirely dependent on their glycolytic metabolism. The cytoplasmic and intramitochondrial ATP/ADP ratios, partly controlled by the adenine nucleotide translocator (ANT), are drastically modified. In dividing and growing cells that have a predominantly glycolytic metabolism, the ANT isoform 2, which has kinetic properties allowing ATP import into mitochondria, is over-expressed in comparison to control cells. We studied the cellular metabolic and proliferative response to hypoxia in two transformed human cell lines with different metabolic backgrounds: HepG2 and 143B, and in their rho(o) derivatives, i.e., cells with no mitochondrial DNA. Transformed 143B and rho(o) cells continued their proliferation whereas HepG2 cells, with a more differentiated phenotype, arrested their cell-cycle at the G(1)/S checkpoint. Hypoxia induced an increase in glycolytic activity, correlated to an induction of VEGF and hexokinase II (HK II) expression. Thus, according to their tumorigenicity, transformed cells may adopt one of two distinct behaviors to support hypoxic stress, i.e., proliferation or quiescence. Our study links the constitutive glycolytic activity and ANT2 expression levels of transformed cells with the loss of cell-cycle control after oxygen deprivation. ATP import by ANT2 allows cells to maintain their mitochondrial integrity while acquiring insensitivity to any alterations in the proteins involved in oxidative phosphorylation. This loss of cell dependence on oxidative metabolism is an important factor in the development of tumors.

  11. Inactivation of Toluene 2-Monooxygenase in Burkholderia cepacia G4 by Alkynes

    PubMed Central

    Yeager, Chris M.; Bottomley, Peter J.; Arp, Daniel J.; Hyman, Michael R.

    1999-01-01

    High concentrations of acetylene (10 to 50% [vol/vol] gas phase) were required to inhibit the growth of Burkholderia cepacia G4 on toluene, while 1% (vol/vol) (gas phase) propyne or 1-butyne completely inhibited growth. Low concentrations of longer-chain alkynes (C5 to C10) were also effective inhibitors of toluene-dependent growth, and 2- and 3-alkynes were more potent inhibitors than their 1-alkyne counterparts. Exposure of toluene-grown B. cepacia G4 to alkynes resulted in the irreversible loss of toluene- and o-cresol-dependent O2 uptake activities, while acetate- and 3-methylcatechol-dependent O2 uptake activities were unaffected. Toluene-dependent O2 uptake decreased upon the addition of 1-butyne in a concentration- and time-dependent manner. The loss of activity followed first-order kinetics, with apparent rate constants ranging from 0.25 min−1 to 2.45 min−1. Increasing concentrations of toluene afforded protection from the inhibitory effects of 1-butyne. Furthermore, oxygen, supplied as H2O2, was required for inhibition by 1-butyne. These results suggest that alkynes are specific, mechanism-based inactivators of toluene 2-monooxygenase in B. cepacia G4, although the simplest alkyne, acetylene, was relatively ineffective compared to longer alkynes. Alkene analogs of acetylene and propyne—ethylene and propylene—were not inactivators of toluene 2-monooxygenase activity in B. cepacia G4 but were oxidized to their respective epoxides, with apparent Ks and Vmax values of 39.7 μM and 112.3 nmol min−1 mg of protein−1 for ethylene and 32.3 μM and 89.2 nmol min−1 mg of protein−1 for propylene. PMID:9925593

  12. Evaluation of hepatitis B virus replication and proteomic analysis of HepG2.2.15 cell line after cyclosporine A treatment.

    PubMed

    Xie, Hai-Yang; Xia, Wei-Liang; Zhang, Chun-Chao; Wu, Li-Ming; Ji, Hao-Feng; Cheng, Yu; Zheng, Shu-Sen

    2007-07-01

    The effect of cyclosporine A (CsA) on hepatitis B virus (HBV) replication was investigated, and proteomics expression differentiation after CsA treatment was studied in order to provide clues to explore the effect of CsA on HBV replication. Methyl thiazolyl tetrazolium (MTT) assay was used to evaluate the cytotoxicity of CsA. The HBV replication level in the HBV genomic DNA transfected HepG2.2.15 cell line was determined by an ELISA analysis of hepatitis B surface antigens (HBsAg) and Hepatitis B e antigens (HBeAg) in culture supernatant, while the intracellular HBV DNA replication level was analyzed by slot blot hybridization. Two-dimensional electrophoresis was used to investigate the alteration of protein expression in HepG2.2.15 after CsA treatment in vitro. The differentially-expressed proteins were identified by Matrix-assisted laser desorption/ionization-time of flight mass spectrometry combined with an online database search. CsA was able to inhibit the expression of HBsAg, HBeAg, and HBV DNA replication in vitro in a dose-dependent manner. A proteomics analysis indicated that the expression of 17 proteins changed significantly in the CsA treatment group compared to the control group. Eleven of the 17 proteins were identified, including the overexpression of eukaryotic translation initiation factors (eIF) 3k, otubain 1, 14.3.3 protein, eIF2-1 alpha, eIF5A, and the tyrosine 3/tryptophan 5-mono-oxygenase activation protein in CsA-treated HepG2.2.15 cells. The downregulation of the ferritin light subunit, erythrocyte cytosolic protein of 51 kDa (ECP-51), stathmin 1/oncoprotein, adenine phosphoribosyl-transferase, and the position of a tumor protein, translationally controlled 1, was shifted, suggesting it had undergone posttranslational modifications. Our study identified the inhibitory effect of CsA on HBV replication, and found that a group of proteins may be responsible for this inhibitory effect.

  13. Anti-hepatitis B virus activity of Boehmeria nivea leaf extracts in human HepG2.2.15 cells

    PubMed Central

    WEI, JINGCHEN; LIN, LIANKU; SU, XIAOJIAN; QIN, SHAOYAN; XU, QING; TANG, ZUNIAN; DENG, YAN; ZHOU, YUEHAN; HE, SONGQING

    2014-01-01

    Boehmeria nivea (Linn.) Gaudich of the Urticaceae family is a perennial ratoon herbal plant, the root of which is used in traditional Chinese medicine and possesses a variety of pharmacological properties. The 20% ethanol Boehmeria nivea root extract was shown to exert an anti-hepatitis B virus (HBV) effect in vitro and in vivo; however, whether the Boehmeria nivea leaf (BNL) extract possesses similar properties has not been determined. In this study, we aimed to investigate the anti-HBV effects of the BNL extract in HepG2.2.15 cells transfected with human HBV DNA. Our results demonstrated that the secretion of HBsAg and HBeAg was reduced in HepG2.2.15 cells treated with the BNL extract, without any recorded cytotoxic effects. In addition, the chloroform fraction (CF) and ethyl acetate fraction (EAF) of BNL were shown to be more potent compared to the other fractions: CF (100 mg/l) inhibited the secretion of HBsAg by 94.00±1.78% [inhibitory concentration 50 (IC50) = 20.92 mg/l] and that of HBeAg by 100.19±0.35% (IC50=19.67 mg/l) after 9 days of treatment. Similarly, EAF (200 mg/l) inhibited the secretion of HBsAg by 89.95±2.26% (IC50=39.90 mg/l) and that of HBeAg by 98.90±1.42% (IC50=36.45 mg/l). Furthermore, we observed that the content of HBV DNA in the medium secreted by the HepG2.2.15 cells was significantly decreased under CF (100 mg/l) or EAF (200 mg/l) treatment. Thus, we concluded that the BNL extracts exhibited anti-HBV activity, with CF and EAF being the most potent among the fractions. PMID:24649087

  14. Anti-hepatitis B virus activity of Boehmeria nivea leaf extracts in human HepG2.2.15 cells.

    PubMed

    Wei, Jingchen; Lin, Lianku; Su, Xiaojian; Qin, Shaoyan; Xu, Qing; Tang, Zunian; Deng, Yan; Zhou, Yuehan; He, Songqing

    2014-01-01

    Boehmeria nivea (Linn.) Gaudich of the Urticaceae family is a perennial ratoon herbal plant, the root of which is used in traditional Chinese medicine and possesses a variety of pharmacological properties. The 20% ethanol Boehmeria nivea root extract was shown to exert an anti-hepatitis B virus (HBV) effect in vitro and in vivo ; however, whether the Boehmeria nivea leaf (BNL) extract possesses similar properties has not been determined. In this study, we aimed to investigate the anti-HBV effects of the BNL extract in HepG2.2.15 cells transfected with human HBV DNA. Our results demonstrated that the secretion of HBsAg and HBeAg was reduced in HepG2.2.15 cells treated with the BNL extract, without any recorded cytotoxic effects. In addition, the chloroform fraction (CF) and ethyl acetate fraction (EAF) of BNL were shown to be more potent compared to the other fractions: CF (100 mg/l) inhibited the secretion of HBsAg by 94.00±1.78% [inhibitory concentration 50 (IC 50 ) = 20.92 mg/l] and that of HBeAg by 100.19±0.35% (IC 50 =19.67 mg/l) after 9 days of treatment. Similarly, EAF (200 mg/l) inhibited the secretion of HBsAg by 89.95±2.26% (IC 50 =39.90 mg/l) and that of HBeAg by 98.90±1.42% (IC 50 =36.45 mg/l). Furthermore, we observed that the content of HBV DNA in the medium secreted by the HepG2.2.15 cells was significantly decreased under CF (100 mg/l) or EAF (200 mg/l) treatment. Thus, we concluded that the BNL extracts exhibited anti-HBV activity, with CF and EAF being the most potent among the fractions.

  15. Demonstration of IgG Subclass (IgG1 and IgG3) in Immuno-Related Hemocytopenia.

    PubMed

    Shao, Yuanyuan; Qi, Xiao; Fu, Rong; Liu, Hui; Wang, Yihao; Ding, Shaoxue; Wang, Huaquan; Li, Lijuan; Shao, Zonghong

    2018-06-01

    Immuno-related hemocytopenia (IRH) is defined as idiopathic cytopenia of undetermined significance (ICUS) patients with autoantibodies. In our previous studies, we found that IgG1 levels were increased in IRH patients and might cause the destruction of hematopoietic cells. In this study, we analyzed IgG subclasses in 30 IRH patients (male:female = 13:17, median age 32 years, range 18 - 56), 15 IRH remission patients (IRH-R) (male:female = 6:9, median age 34, range 20 - 52) and 20 normal controls (male:female = 8:12, median age 27, range 24 - 36) by Cytometric Bead Array, Flow Cytometry and Immunohistochemical staining. Levels of IgG1/IgG3 in the bone marrow supernatant of IRH patents, as well as the proportion of CD5+ B lymphocytes and Th2 cells (CD3+CD8-IL-4+) were higher than those of IRH-R patients and normal controls, and IgG1 levels had a positive correlation with the proportion of Th2 cells. In IRH patients, IgG1 and IgG3 were positive on nucleated erythrocytes and granulocytes, which were negative in IRH-R patients and healthy controls and had inverse correlations with hematopoietic function. Using immunohistochemical staining, IgG1 were also detected on bone marrow biopsies of IRH patients. The results indicated that IgG1 and IgG3 autoantibodies in IRH patients might play a key role in the IRH pathogenesis and in the abnormal immune function of IRH patients.

  16. IgG2 deficiency in sickle cell anaemia.

    PubMed

    Natta, C L; Outschoorn, I M

    1984-08-01

    8 patients with known sickle cell anaemia were studied immunologically. The concentrations of the main immunoglobulin classes, IgG and IgA, were significantly higher than the levels in 11 normal age- and sex-matched black subjects (P less than 0.01). IgM levels were not significantly different in the two groups. There was a heterogeneity in the interaction of the IgG subclasses with Protein A, with low levels of IgG2. The IgG2:IgG1 ratios varied from 1:3.8 to 1:6 (normals 1:3). In 4 patients the absolute levels of IgG2 as measured by radial immunodiffusion were lower than normal, thus confirming the chromatographic ratios. Since specific antibody is often restricted to a single subclass, the levels of IgG subclasses may be related to recurrent bacterial infections in these patients.

  17. Joint effect of MCP-1 genotype GG and MMP-1 genotype 2G/2G increases the likelihood of developing pulmonary tuberculosis in BCG-vaccinated individuals.

    PubMed

    Ganachari, Malathesha; Ruiz-Morales, Jorge A; Gomez de la Torre Pretell, Juan C; Dinh, Jeffrey; Granados, Julio; Flores-Villanueva, Pedro O

    2010-01-25

    We previously reported that the -2518 MCP-1 genotype GG increases the likelihood of developing tuberculosis (TB) in non-BCG-vaccinated Mexicans and Koreans. Here, we tested the hypothesis that this genotype, alone or together with the -1607 MMP-1 functional polymorphism, increases the likelihood of developing TB in BCG-vaccinated individuals. We conducted population-based case-control studies of BCG-vaccinated individuals in Mexico and Peru that included 193 TB cases and 243 healthy tuberculin-positive controls from Mexico and 701 TB cases and 796 controls from Peru. We also performed immunohistochemistry (IHC) analysis of lymph nodes from carriers of relevant two-locus genotypes and in vitro studies to determine how these variants may operate to increase the risk of developing active disease. We report that a joint effect between the -2518 MCP-1 genotype GG and the -1607 MMP-1 genotype 2G/2G consistently increases the odds of developing TB 3.59-fold in Mexicans and 3.9-fold in Peruvians. IHC analysis of lymph nodes indicated that carriers of the two-locus genotype MCP-1 GG MMP-1 2G/2G express the highest levels of both MCP-1 and MMP-1. Carriers of these susceptibility genotypes might be at increased risk of developing TB because they produce high levels of MCP-1, which enhances the induction of MMP-1 production by M. tuberculosis-sonicate antigens to higher levels than in carriers of the other two-locus MCP-1 MMP-1 genotypes studied. This notion was supported by in vitro experiments and luciferase based promoter activity assay. MMP-1 may destabilize granuloma formation and promote tissue damage and disease progression early in the infection. Our findings may foster the development of new and personalized therapeutic approaches targeting MCP-1 and/or MMP-1.

  18. Joint Effect of MCP-1 Genotype GG and MMP-1 Genotype 2G/2G Increases the Likelihood of Developing Pulmonary Tuberculosis in BCG-Vaccinated Individuals

    PubMed Central

    Ganachari, Malathesha; Ruiz-Morales, Jorge A.; Gomez de la Torre Pretell, Juan C.; Dinh, Jeffrey; Granados, Julio; Flores-Villanueva, Pedro O.

    2010-01-01

    We previously reported that the – 2518 MCP-1 genotype GG increases the likelihood of developing tuberculosis (TB) in non-BCG-vaccinated Mexicans and Koreans. Here, we tested the hypothesis that this genotype, alone or together with the – 1607 MMP-1 functional polymorphism, increases the likelihood of developing TB in BCG-vaccinated individuals. We conducted population-based case-control studies of BCG-vaccinated individuals in Mexico and Peru that included 193 TB cases and 243 healthy tuberculin-positive controls from Mexico and 701 TB cases and 796 controls from Peru. We also performed immunohistochemistry (IHC) analysis of lymph nodes from carriers of relevant two-locus genotypes and in vitro studies to determine how these variants may operate to increase the risk of developing active disease. We report that a joint effect between the – 2518 MCP-1 genotype GG and the – 1607 MMP-1 genotype 2G/2G consistently increases the odds of developing TB 3.59-fold in Mexicans and 3.9-fold in Peruvians. IHC analysis of lymph nodes indicated that carriers of the two-locus genotype MCP-1 GG MMP-1 2G/2G express the highest levels of both MCP-1 and MMP-1. Carriers of these susceptibility genotypes might be at increased risk of developing TB because they produce high levels of MCP-1, which enhances the induction of MMP-1 production by M. tuberculosis-sonicate antigens to higher levels than in carriers of the other two-locus MCP-1 MMP-1 genotypes studied. This notion was supported by in vitro experiments and luciferase based promoter activity assay. MMP-1 may destabilize granuloma formation and promote tissue damage and disease progression early in the infection. Our findings may foster the development of new and personalized therapeutic approaches targeting MCP-1 and/or MMP-1. PMID:20111728

  19. CYP2E1 immunoglobulin G4 subclass antibodies after desflurane anesthesia

    PubMed Central

    Batistaki, Chrysanthi; Michalopoulos, George; Matsota, Paraskevi; Nomikos, Tzortzis; Kalimeris, Konstantinos; Riga, Maria; Nakou, Maria; Kostopanagiotou, Georgia

    2014-01-01

    AIM: To investigate CYP2E1 IgG4 autoantibody levels and liver biochemical markers in adult patients after anesthesia with desflurane. METHODS: Forty patients who were > 18 years old and undergoing elective surgery under general anesthesia with desflurane were studied. Alpha-glutathione-S-transferase (αGST) and IgG4 antibodies against CYP2E1 were measured preoperatively and 96 h postoperatively, as well as complete blood count, prothrombin time (PT), activated partial thromboplastin time (aPTT), international normalized ratio (INR), aspartate aminotransferase (SGOT), alanine aminotransferase (SGPT), g-glutamyl-transpeptidase (gGT), alkaline phosphatase, total serum proteins, albumin and bilirubin. A separate group of 8 patients who received regional anesthesia was also studied for calibration of the methodology used for CYP2E1 IgG4 and αGST measurements. Student’s t-test and the Mann-Whitney U test were used for comparison of the continuous variables, and Fisher’s exact test was used for the categorical variables. All tests were two-tailed, with statistical significance set as P < 0.05. RESULTS: None of the patients developed postoperative liver dysfunction, and all patients were successfully discharged from the hospital. No statistically significant difference was observed regarding liver function tests (SGOT, SGPT, γGT, bilirubin, INR), αGST and CYP2E1 IgG4, before and after exposure to desflurane. After dividing patients into two subgroups based on whether or not they had received general anesthesia in the past, no significant difference in the levels of CYP2E1 IgG4 was observed at baseline or 96 h after desflurane administration (P = 0.099 and P = 0.051, respectively). Alpha-GST baseline levels and levels after the intervention also did not differ significantly between these two subgroups (P > 0.1). The mean αGST differences were statistically elevated in men by 2.15 ng/mL compared to women when adjusted for BMI, duration of anesthesia, number of times

  20. Quantitation of CYP1A1 and 1B1 mRNA in polycyclic aromatic hydrocarbon-treated human T-47D and HepG2 cells by a modified bDNA assay using fluorescence detection.

    PubMed

    Wu, Susan J; Spink, David C; Spink, Barbara C; Kaminsky, Laurence S

    2003-01-15

    The quantitation of mRNA, essential for assessing mechanisms of enzyme regulation, is normally carried out using reverse transcriptase-polymerase chain reaction (RT-PCR). An alternative method uses a signal-amplification nucleic acid probe assay, which measures RNA directly by the QuantiGene Expression Kit and incorporates branched DNA technology from Bayer and luminometer-based readings of a chemilumigenic alkaline phosphatase substrate. To broaden the utility of this assay, we investigated substitution of a fluorescent substrate, 2'-(2-benzothiazol)-6'-hydroxybenzothiazole phosphate and a fluorometer, and applied the method to quantitation of CYP1A1 and 1B1 mRNA in human T-47D and HepG2 cells following induction by benzo[a]pyrene (B[a]P) and dibenzo[a,h]anthracene (DB[a,h]A). The fluorescence response increased linearly for 200 min without photobleaching and increased linearly (r2=0.997) up to at least 0.2 microg total RNA. The data revealed that at 0.5 and 1.0 microM inducing agent, the induction of CYP1A1 mRNA in HepG2 cells by DB[a,h]A exceeded that by B[a]P by 18- and 6-fold, respectively. In T-47D cells B[a]P induced CYP1A1 mRNA by 23-fold and CYP1B1 mRNA by 3.9-fold. A B[a]P cocontaminant in the environment, arsenite, did not affect B[a]P-induced levels of CYP1A1 or 1B1 mRNA in these cells. The modified analytical system provides a rapid-throughput, reproducible, and less labor-intensive method than RT-PCR for quantifying cellular mRNA levels.

  1. The D/H Ratio in Interstellar Gas towards G191-B2B from STIS Echelle Observations

    NASA Astrophysics Data System (ADS)

    Sahu, M. S.; Landsman, W. B.; Bruhweiler, F. C.; Gull, T. R.; Bowers, C. A.; Lindler, D.; Feggans, K.; Barstow, M. A.; Hubeny, I.; Holberg, J. B.

    1999-05-01

    We present STIS echelle observations of interstellar D i and H i Lyα and N i (1199.5, 1200.2 and 1200.7 Angstroms), C ii 1334.5 Angstroms, C(*) ii 1335.7 Angstroms, O i 1302 Angstroms, Si ii (1190, 1193, 1260, 1304 and 1526 Angstroms), Si iii 1206.5 Angstroms, Al ii 1670.8 Angstroms, S ii 1259.5 Angstroms and Fe ii 1608.5 Angstroms in the line of sight to the nearby (69 pc) hot, white dwarf (WD) G191-B2B. Compared to the GHRS study of G191-B2B by Vidal-Madjar et al. 1998 (VM98), the STIS E140H spectra have a higher velocity resolution (3 km s(-1) ), better S/N (between 20 to 50) and broader wavelength coverage (1150 to 1700 Angstroms). We use the Barstow & Hubeny stratified non-LTE model atmosphere calculations which include the effects of line-blanketing from more than 9x10(6) atomic transitions (mainly Ni and Fe), both to determine the NLTE shape of the stellar Lyalpha profile and to estimate the contamination of the interstellar lines by WD photospheric lines. The interstellar N i 1200.7 Angstroms, Si ii 1193 & 1304 Angstroms and Fe ii lines show no contamination by WD photospheric lines and are given more weight in our analysis. VM98 reported three components while we detect only two velocity components in all the interstellar species observed: one at ~ 8.5 km s(-1) and one at ~ 19.3 km s(-1) which we identify as the LIC component. Using the NLTE stellar Lyα profile and a total column density of N(H i) ~ 2 x 10(18) cm(-2) for both components (consistent with EUVE observations), we derive confidence contours. We find the D/H ratio with 2sigma confidence limits to lie within 1.77+/-0.2x10(-5) . This value is consistent with the value of (D/H)LIC = 1.6+/-0.1x10(-5) determined towards Capella (Linsky et al. 1995). The STIS data provide no evidence for local or cloud-to-cloud variation in the D/H ratio as suggested by VM98. Re-analysis of the GHRS data and comparison to the STIS data is in progress.

  2. Isolation and characterization of rabbit anti-m3 2,2,7G antibodies.

    PubMed Central

    Luhrmann, R; Appel, B; Bringmann, P; Rinke, J; Reuter, R; Rothe, S; Bald, R

    1982-01-01

    Antibodies specific for intact 2,2,7-trimethylguanosine (m3 2,2,7G) were induced by immunization of rabbits with a nucleoside-human serum albumen (HSA) conjugate. Competition radioimmunoassay showed that the antibody distinguishes well between intact m3 2,2,7G and its alkali-hydrolysed form (m3 2,2,7G*). Antibody specificity is largely dependent on the presence of all three methyl groups in m3 2,2,7G: none of the less extensively methylated nucleosides m7G, m2G and m2 2,2G is able to compete efficiently with the homologous hapten. Little or no competition was observed with m1G, m1A, m6A, m5U and each of the four unmodified ribonucleosides. Binding studies with nucleoplasmic RNAs from Ehrlich ascites cells suggest that the antibody reacts specifically with the m3 2,2,7G-containing cap structure of the small nuclear U-RNAs (U-snRNAs). Thus the antibody should be a valuable tool for studying the role of the 5'-terminal regions of the U-snRNAs of eucaryotic cells. Images PMID:7155893

  3. Antioxidant and anticancer activity of Artemisia princeps var. orientalis extract in HepG2 and Hep3B hepatocellular carcinoma cells.

    PubMed

    Choi, Eun-Jeong; Kim, Gun-Hee

    2013-10-01

    The aim of the present study was to investigate antioxidant and the anticancerigen activity of a methanol extract from Artemisia princeps var. orientalis (APME), a well-known traditional herbal medicine in Asia, in hepatocellular cancer cells. To evaluate the antioxidant activity of APME, reactive oxygen species (ROS) and the antioxidant enzymes, superoxide dismutase (SOD) and catalase were investigated in HepG2 cells exposed to APME (5, 100, and 200 µg/mL) for 72 h. Then, to evaluate the anticancer activity of APME, we investigated the proliferation and apoptosis induction of HepG2 and Hep3B cells exposed to APME (1-200 µg/mL) for 24, 48, and 72 h. APME dose-dependently reduced the generation of ROS in the presence of H2O2 compared with control cells. Furthermore, it increased catalase and SOD activity. Moreover, APME inhibited cell proliferation in a dose- and time-dependent manner, but at concentrations lower than 100 µg/mL, the inhibition was less dose-dependent than time-dependent. HepG2 and Hep3B cells exposed to 5, 100, and 200 µg/mL APME for 72 h underwent cell cycle arrest and apoptosis. Exposure to APME resulted in a significant increase in the number of cells in G1 phase and a decrease in the G2/M phase cell population. In addition, APME induced P53 expression of HepG2 cells in a dose-dependent manner, and played a role in the downregulation of Bcl-2 and upregulation of Bax in both HepG2 and Hep3B cells. These results indicate the potential role of APME as an antioxidant and anticancerigen agent in hepatocarcinoma cell lines.

  4. Antioxidant and anticancer activity of Artemisia princeps var. orientalis extract in HepG2 and Hep3B hepatocellular carcinoma cells

    PubMed Central

    Choi, Eun-Jeong

    2013-01-01

    Objective The aim of the present study was to investigate antioxidant and the anticancerigen activity of a methanol extract from Artemisia princeps var. orientalis (APME), a well-known traditional herbal medicine in Asia, in hepatocellular cancer cells. Methods To evaluate the antioxidant activity of APME, reactive oxygen species (ROS) and the antioxidant enzymes, superoxide dismutase (SOD) and catalase were investigated in HepG2 cells exposed to APME (5, 100, and 200 µg/mL) for 72 h. Then, to evaluate the anticancer activity of APME, we investigated the proliferation and apoptosis induction of HepG2 and Hep3B cells exposed to APME (1-200 µg/mL) for 24, 48, and 72 h. Results APME dose-dependently reduced the generation of ROS in the presence of H2O2 compared with control cells. Furthermore, it increased catalase and SOD activity. Moreover, APME inhibited cell proliferation in a dose- and time-dependent manner, but at concentrations lower than 100 µg/mL, the inhibition was less dose-dependent than time-dependent. HepG2 and Hep3B cells exposed to 5, 100, and 200 µg/mL APME for 72 h underwent cell cycle arrest and apoptosis. Exposure to APME resulted in a significant increase in the number of cells in G1 phase and a decrease in the G2/M phase cell population. In addition, APME induced P53 expression of HepG2 cells in a dose-dependent manner, and played a role in the downregulation of Bcl-2 and upregulation of Bax in both HepG2 and Hep3B cells. Conclusions These results indicate the potential role of APME as an antioxidant and anticancerigen agent in hepatocarcinoma cell lines. PMID:24255577

  5. TLR3 dsRNA agonist inhibits growth and invasion of HepG2.2.15 HCC cells.

    PubMed

    Chen, Li; Xu, Yu-Yin; Zhou, Jia-Ming; Wu, Yuan-Yuan; E, Qun; Zhu, Yuan-Yuan

    2012-07-01

    Toll-like receptor 3 (TLR3) is a pattern-recognizing receptor that is involved in immune signaling and plays a crucial role in survival by being able to recognize various viral components including double-stranded RNA (dsRNA). TLR3 expression and function in cancer cells are not well understood. In this study, we investigated whether TLR3 agonist dsRNA (BM-06) can inhibit proliferation and invasion, and promote apoptosis in HepG2.2.15 cells. HepG2.2.15 cells secreting hepatitis B virus (HBV) were treated with BM-06 and poly(I:C). Western blot analysis and PCR were employed to determine pharmacodynamic changes in biomarkers relevant to TLR3 signaling. Cell proliferation, invasion and apoptosis were analyzed by CCK-8 assay, transwell assay and flow cytometry. The expression of HBsAg, and HBcAg was observed by immunohistochemistry. Compared with untreated cells, pharmacological NF-κB activity of the TLR3 pathway by BM-06 (1.734-fold) or poly(I:C) (1.377-fold) was induced. By western blot analysis, we found that dsRNA induced TLR3-activated HepG2.2.15 cells which expressed NF-κB levels predominantly in the cytoplasmic fraction but fewer signals in the nucleus. BM-06 inhibited the proliferation, invasion and secretion of HBV, and induced apoptosis in HepG2.2.15 cells. In addition, the antitumor effects of BM-06 were superior to poly(I:C). Pharmacological activation of the TLR3 pathway by BM-06 can inhibit HepG2.2.15 cell growth.

  6. Oxygen consumption during cold exposure at 2.1 G in rats adapted to hypergravic fields

    NASA Technical Reports Server (NTRS)

    Horowitz, J.; Patterson, S.; Monson, C.

    1985-01-01

    The thermoregulation ability of rats exposed to various gravitational fields is examined. Male Sprague-Dawley rats were exposed to 22 C and 1 G, and 9 C and 2.1 G in experiment one, 1 G, 2.4 G, 5.8 G and 22 + or - 1.5 C in experiment two, and 1 G, 19-22 C, and 5 C in experiment three. It is observed that the core temperature in the control rats was 36.8 + or 0.4 C at 22C and 30.8 + or - 0.6 C at 9 C, and oxygen consumption dropped from 37 + or - 0.3 C core temperature at 22 C, 36.4 + or - 0.3 C at 9 C, 0.4 oxygen consumption was 8.18 + or - 0.9 ml/min at 22 C, and 14.2 + or - 0.4 ml/min at 9 C. The data from experiment two reveal that tail temperature in the control rats peaked at 2.4 G and at 5.8 G for the acclimated rats, and in experiment three a greater decrease in core temperature is detected in the 2.1-G rats. It is noted that prior acclimation to 2.1 G enhances the thermoregulation ability when exposed to the cold.

  7. TeV γ-ray observations of the young synchrotron-dominated SNRs G1.9+0.3 and G330.2+1.0 with H.E.S.S.

    NASA Astrophysics Data System (ADS)

    H.E.S.S. Collaboration; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Cui, Y.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Méhault, J.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; Wilhelmi, E. de Oña; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Arribas, M. Paz; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. de los; Rieger, F.; Rob, L.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Vuillaume, T.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; Weitzel, Q.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zabalza, V.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

    2014-06-01

    The non-thermal nature of the X-ray emission from the shell-type supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0 is an indication of intense particle acceleration in the shock fronts of both objects. This suggests that the SNRs are prime candidates for very-high-energy (VHE; E > 0.1 TeV) γ-ray observations. G1.9+0.3, recently established as the youngest known SNR in the Galaxy, also offers a unique opportunity to study the earliest stages of SNR evolution in the VHE domain. The purpose of this work is to probe the level of VHE γ-ray emission from both SNRs and use this to constrain their physical properties. Observations were conducted with the H.E.S.S. (High Energy Stereoscopic System) Cherenkov Telescope Array over a more than six-year period spanning 2004-2010. The obtained data have effective livetimes of 67 h for G1.9+0.3 and 16 h for G330.2+1.0. The data are analysed in the context of the multiwavelength observations currently available and in the framework of both leptonic and hadronic particle acceleration scenarios. No significant γ-ray signal from G1.9+0.3 or G330.2+1.0 was detected. Upper limits (99 per cent confidence level) to the TeV flux from G1.9+0.3 and G330.2+1.0 for the assumed spectral index Γ = 2.5 were set at 5.6 × 10-13 cm-2 s-1 above 0.26 TeV and 3.2 × 10-12 cm-2 s-1 above 0.38 TeV, respectively. In a one-zone leptonic scenario, these upper limits imply lower limits on the interior magnetic field to BG1.9 ≳ 12 μG for G1.9+0.3 and to BG330 ≳ 8 μG for G330.2+1.0. In a hadronic scenario, the low ambient densities and the large distances to the SNRs result in very low predicted fluxes, for which the H.E.S.S. upper limits are not constraining.

  8. Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

    PubMed Central

    Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

    2014-01-01

    The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

  9. Identification of a novel antisense long non-coding RNA PLA2G16-AS that regulates the expression of PLA2G16 in pigs.

    PubMed

    Liu, Pengliang; Jin, Long; Zhao, Lirui; Long, Keren; Song, Yang; Tang, Qianzi; Ma, Jideng; Wang, Xun; Tang, Guoqing; Jiang, Yanzhi; Zhu, Li; Li, Xuewei; Li, Mingzhou

    2018-05-31

    Natural antisense transcripts (NATs) are widely present in mammalian genomes and act as pivotal regulator molecules to control gene expression. However, studies on the NATs of pigs are relatively rare. Here, we identified a novel antisense transcript, designated PLA2G16-AS, transcribed from the phospholipase A2 group XVI locus (PLA2G16) in the porcine genome, which is a well-known regulatory molecule of fat deposition. PLA2G16-AS and PLA2G16 were dominantly expressed in porcine adipose tissue, and were differentially expressed between Tibetan pigs and Rongchang pigs. In addition, PLA2G16-AS has a weak sequence conservation among different vertebrates. PLA2G16-AS was also shown to form an RNA-RNA duplex with PLA2G16, and to regulate PLA2G16 expression at the mRNA level. Moreover, the overexpression of PLA2G16-AS increased the stability of PLA2G16 mRNA in porcine cells. We envision that our findings of a NAT for a regulatory gene associated with lipolysis might further our understanding of the molecular regulation of fat deposition. Copyright © 2017. Published by Elsevier B.V.

  10. Herpesvirus gB: A Finely Tuned Fusion Machine

    PubMed Central

    Cooper, Rebecca S.; Heldwein, Ekaterina E.

    2015-01-01

    Enveloped viruses employ a class of proteins known as fusogens to orchestrate the merger of their surrounding envelope and a target cell membrane. Most fusogens accomplish this task alone, by binding cellular receptors and subsequently catalyzing the membrane fusion process. Surprisingly, in herpesviruses, these functions are distributed among multiple proteins: the conserved fusogen gB, the conserved gH/gL heterodimer of poorly defined function, and various non-conserved receptor-binding proteins. We summarize what is currently known about gB from two closely related herpesviruses, HSV-1 and HSV-2, with emphasis on the structure of the largely uncharted membrane interacting regions of this fusogen. We propose that the unusual mechanism of herpesvirus fusion could be linked to the unique architecture of gB. PMID:26690469

  11. G-actin provides substrate-specificity to eukaryotic initiation factor 2α holophosphatases

    PubMed Central

    Chen, Ruming; Rato, Cláudia; Yan, Yahui; Crespillo-Casado, Ana; Clarke, Hanna J; Harding, Heather P; Marciniak, Stefan J; Read, Randy J; Ron, David

    2015-01-01

    Dephosphorylation of eukaryotic translation initiation factor 2a (eIF2a) restores protein synthesis at the waning of stress responses and requires a PP1 catalytic subunit and a regulatory subunit, PPP1R15A/GADD34 or PPP1R15B/CReP. Surprisingly, PPP1R15-PP1 binary complexes reconstituted in vitro lacked substrate selectivity. However, selectivity was restored by crude cell lysate or purified G-actin, which joined PPP1R15-PP1 to form a stable ternary complex. In crystal structures of the non-selective PPP1R15B-PP1G complex, the functional core of PPP1R15 made multiple surface contacts with PP1G, but at a distance from the active site, whereas in the substrate-selective ternary complex, actin contributes to one face of a platform encompassing the active site. Computational docking of the N-terminal lobe of eIF2a at this platform placed phosphorylated serine 51 near the active site. Mutagenesis of predicted surface-contacting residues enfeebled dephosphorylation, suggesting that avidity for the substrate plays an important role in imparting specificity on the PPP1R15B-PP1G-actin ternary complex. DOI: http://dx.doi.org/10.7554/eLife.04871.001 PMID:25774600

  12. Base-Displaced Intercalated Conformation of the 2-Amino-3-methylimidazo[4,5-f]quinoline N2-dG DNA Adduct Positioned at the Nonreiterated G1 in the NarI Restriction Site

    PubMed Central

    2016-01-01

    The conformation of an N2-dG adduct arising from the heterocyclic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a potent food mutagen, was determined in 5′-d(C1T2C3X4G5C6G7C8C9A10T11C12)-3′:5′-d(G13A14T15G16G17C18G19C20C21G22A23G24)-3′; X = N2-dG-IQ, in which the modified nucleotide X4 corresponds to G1 in the 5′-d(G1G2CG3CC)-3′ NarI restriction endonuclease site. Circular dichroism (CD) revealed blue shifts relative to the unmodified duplex, consistent with adduct-induced twisting, and a hypochromic effect for the IQ absorbance in the near UV region. NMR revealed that the N2-dG-IQ adduct adopted a base-displaced intercalated conformation in which the modified guanine remained in the anti conformation about the glycosidic bond, the IQ moiety intercalated into the duplex, and the complementary base C21 was displaced into the major groove. The processing of the N2-dG-IQ lesion by hpol η is sequence-dependent; when placed at the reiterated G3 position, but not at the G1 position, this lesion exhibits a propensity for frameshift replication [Choi, J. Y., et al. (2006) J. Biol. Chem., 281, 25297–25306]. The structure of the N2-dG-IQ adduct at the nonreiterated G1 position was compared to that of the same adduct placed at the G3 position [Stavros, K. M., et al. (2014) Nucleic Acids Res., 42, 3450–3463]. CD indicted minimal spectral differences between the G1 vs G3N2-dG-IQ adducts. NMR indicated that the N2-dG-IQ adduct exhibited similar base-displaced intercalated conformations at both the G1 and G3 positions. This result differed as compared to the corresponding C8-dG-IQ adducts placed at the same positions. The C8-dG-IQ adduct adopted a minor groove conformation when placed at position G1 but a base-displaced intercalated conformation when placed at position G3 in the NarI sequence. The present studies suggest that differences in lesion bypass by hpol η may be mediated by differences in the 3′-flanking sequences, perhaps modulating the ability

  13. Iron abundance in the hot DA white dwarfs Feige 24 and G191 B2B

    NASA Technical Reports Server (NTRS)

    Vennes, Stephane; Chayer, Pierre; Thorstensen, John R.; Bowyer, Stuart; Shipman, Harry L.

    1992-01-01

    Attention is given to model calculations of the far- and extreme-UV line spectra of highly ionized Fe species (Fe IV, Fe V, and Fe VI) for hot high-gravity H-rich stars. A spectral analysis of 31 hr of exposure of the DA white dwarf Feige 24 with IUE in the echelle mode reveals the presence of Fe with an abundance relative to H by number of (5-10) x 10 exp -6 with an uncertainty dominated by the determination of stellar parameters. An analysis of IUE data from the white dwarf G191 B2B results in a similar Fe abundance if this star shares similar atmospheric parameters (Teff, g) with Feige 24. Fe is thus the second most abundant photospheric element in hot DA white dwarfs.

  14. CD22 x Siglec-G double-deficient mice have massively increased B1 cell numbers and develop systemic autoimmunity.

    PubMed

    Jellusova, Julia; Wellmann, Ute; Amann, Kerstin; Winkler, Thomas H; Nitschke, Lars

    2010-04-01

    CD22 and Siglec-G are inhibitory coreceptors for BCR-mediated signaling. Although CD22-deficient mice show increased calcium signaling in their conventional B2 cells and a quite normal B cell maturation, Siglec-G-deficient mice have increased calcium mobilization just in B1 cells and show a large expansion of the B1 cell population. Neither CD22-deficient, nor Siglec-G-deficient mice on a pure C57BL/6 or BALB/c background, respectively, develop autoimmunity. Using Siglec-G x CD22 double-deficient mice, we addressed whether Siglec-G and CD22 have redundant functions. Siglec-G x CD22 double-deficient mice show elevated calcium responses in both B1 cells and B2 cells, increased serum IgM levels and an enlarged population of B1 cells. The enlargement of B1 cell numbers is even higher than in Siglecg(-/-) mice. This expansion seems to happen at the expense of B2 cells, which are reduced in absolute cell numbers, but show an activated phenotype. Furthermore, Siglec-G x CD22 double-deficient mice show a diminished immune response to both thymus-dependent and thymus-independent type II Ags. In contrast, B cells from Siglec-G x CD22 double-deficient mice exhibit a hyperproliferative response to stimulation with several TLR ligands. Aged Siglec-G x CD22 double-deficient mice spontaneously develop anti-DNA and antinuclear autoantibodies. These resulted in a moderate form of immune complex glomerulonephritis. These results show that Siglec-G and CD22 have partly compensatory functions and together are crucial in maintaining the B cell tolerance.

  15. Patient-Specific Neutralizing Antibody Responses to Herpes Simplex Virus Are Attributed to Epitopes on gD, gB, or Both and Can Be Type Specific

    PubMed Central

    Huang, Zhen-Yu; Gallagher, John R.; Lin, Yixin; Lou, Huan; Whitbeck, J. Charles; Wald, Anna; Cohen, Gary H.; Eisenberg, Roselyn J.

    2015-01-01

    ABSTRACT Herpes simplex virus 1 (HSV-1) and HSV-2 infect many humans and establish a latent infection in sensory ganglia. Although some infected people suffer periodic recurrences, others do not. Infected people mount both cell-mediated and humoral responses, including the production of virus-neutralizing antibodies (Abs) directed at viral entry glycoproteins. Previously, we examined IgGs from 10 HSV-seropositive individuals; all neutralized virus and were directed primarily against gD or gD+gB. Here, we expand our studies and examine 32 additional sera from HSV-infected individuals, 23 of whom had no recurrent disease. Using an Octet RED96 system, we screened all 32 serum samples directly for both glycoprotein binding and competition with known neutralizing anti-gD and -gB monoclonal Abs (MAbs). On average, the recurrent cohort exhibited higher binding to gD and gB and had higher neutralization titers. There were similar trends in the blocking of MAbs to critical gD and gB epitopes. When we depleted six sera of Abs to specific glycoproteins, we found different types of responses, but always directed primarily at gD and/or gB. Interestingly, in one dual-infected person, the neutralizing response to HSV-2 was due to gD2 and gB2, whereas HSV-1 neutralization was due to gD1 and gB1. In another case, virus neutralization was HSV-1 specific, with the Ab response directed entirely at gB1, despite this serum blocking type-common anti-gD and -gB neutralizing MAbs. These data are pertinent in the design of future HSV vaccines since they demonstrate the importance of both serotypes of gD and gB as immunogens. IMPORTANCE We previously showed that people infected with HSV produce neutralizing Abs directed against gD or a combination of gD+gB (and in one case, gD+gB+gC, which was HSV-1 specific). In this more extensive study, we again found that gD or gD+gB can account for the virus neutralizing response and critical epitopes of one or both of these proteins are represented in

  16. Patient-Specific Neutralizing Antibody Responses to Herpes Simplex Virus Are Attributed to Epitopes on gD, gB, or Both and Can Be Type Specific.

    PubMed

    Cairns, Tina M; Huang, Zhen-Yu; Gallagher, John R; Lin, Yixin; Lou, Huan; Whitbeck, J Charles; Wald, Anna; Cohen, Gary H; Eisenberg, Roselyn J

    2015-09-01

    Herpes simplex virus 1 (HSV-1) and HSV-2 infect many humans and establish a latent infection in sensory ganglia. Although some infected people suffer periodic recurrences, others do not. Infected people mount both cell-mediated and humoral responses, including the production of virus-neutralizing antibodies (Abs) directed at viral entry glycoproteins. Previously, we examined IgGs from 10 HSV-seropositive individuals; all neutralized virus and were directed primarily against gD or gD+gB. Here, we expand our studies and examine 32 additional sera from HSV-infected individuals, 23 of whom had no recurrent disease. Using an Octet RED96 system, we screened all 32 serum samples directly for both glycoprotein binding and competition with known neutralizing anti-gD and -gB monoclonal Abs (MAbs). On average, the recurrent cohort exhibited higher binding to gD and gB and had higher neutralization titers. There were similar trends in the blocking of MAbs to critical gD and gB epitopes. When we depleted six sera of Abs to specific glycoproteins, we found different types of responses, but always directed primarily at gD and/or gB. Interestingly, in one dual-infected person, the neutralizing response to HSV-2 was due to gD2 and gB2, whereas HSV-1 neutralization was due to gD1 and gB1. In another case, virus neutralization was HSV-1 specific, with the Ab response directed entirely at gB1, despite this serum blocking type-common anti-gD and -gB neutralizing MAbs. These data are pertinent in the design of future HSV vaccines since they demonstrate the importance of both serotypes of gD and gB as immunogens. We previously showed that people infected with HSV produce neutralizing Abs directed against gD or a combination of gD+gB (and in one case, gD+gB+gC, which was HSV-1 specific). In this more extensive study, we again found that gD or gD+gB can account for the virus neutralizing response and critical epitopes of one or both of these proteins are represented in sera of naturally

  17. Itinerant G-type antiferromagnetic order in SrCr2As2

    NASA Astrophysics Data System (ADS)

    Das, Pinaki; Sangeetha, N. S.; Lindemann, George R.; Heitmann, T. W.; Kreyssig, A.; Goldman, A. I.; McQueeney, R. J.; Johnston, D. C.; Vaknin, D.

    2017-07-01

    Neutron-diffraction and magnetic susceptibility studies of polycrystalline SrCr2As2 reveal that this compound is an itinerant G-type antiferromagnet below the Néel temperature TN = 590(5) K with the Cr magnetic moments aligned along the tetragonal c axis. The system remains tetragonal to the lowest measured temperature (˜12 K). The lattice parameter ratio c /a and the magnetic moment saturate at about the same temperature below ˜200 K, indicating a possible magnetoelastic coupling. The ordered moment μ =1.9 (1 ) μB /Cr , measured at T =12 K, is significantly reduced compared to its localized value (4 μB /Cr ) due to the itinerant character brought about by hybridization between the Cr 3 d and As 4 p orbitals.

  18. New observation and combined analysis of the Cs{sub 2} 0{sub g}{sup −}, 0{sub u}{sup +}, and 1{sub g} states at the asymptotes 6S{sub 1/2} + 6P{sub 1/2} and 6S{sub 1/2} + 6P{sub 3/2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ma, Jie; Liu, Wenliang; Wu, Jizhou

    2014-12-28

    We report on new observations of the photoassociation spectroscopy of ultracold cesium molecules using a highly sensitive detection technique and a combined analysis with all observed electronic states. The technique is achieved by directly modulating the frequency of the trapping lasers of a magneto-optical trap. New observations of the Cs{sub 2}0{sub g}{sup −}, 0{sub u}{sup +}, and 1{sub g} states at the asymptotes 6S{sub 1/2} + 6P{sub 1/2} and 6S{sub 1/2} + 6P{sub 3/2} are reported. The spectral range is extended to the red detuning of 112 cm{sup −1} below the 6S{sub 1/2} + 6P{sub 3/2} dissociation limit. Dozens ofmore » vibrational levels of the ultracold Cs{sub 2}0{sub g}{sup −}, 0{sub u}{sup +}, and 1{sub g} states are observed for the first time. The available experimental binding energies of these states are analyzed simultaneously in a framework of the generalized LeRoy–Bernstein theory and the almost degenerate perturbation theory by Marinescu and Dalgarno [Phys. Rev. A: At., Mol., Opt. Phys. 52, 311 (1995)]. The unique atomic-related parameter c{sub 3} governing the dispersion forces of all the molecular states is estimated as (10.29 ± 0.05) a.u.« less

  19. Cell cycle G2/M arrest through an S phase-dependent mechanism by HIV-1 viral protein R.

    PubMed

    Li, Ge; Park, Hyeon U; Liang, Dong; Zhao, Richard Y

    2010-07-07

    Cell cycle G2 arrest induced by HIV-1 Vpr is thought to benefit viral proliferation by providing an optimized cellular environment for viral replication and by skipping host immune responses. Even though Vpr-induced G2 arrest has been studied extensively, how Vpr triggers G2 arrest remains elusive. To examine this initiation event, we measured the Vpr effect over a single cell cycle. We found that even though Vpr stops the cell cycle at the G2/M phase, but the initiation event actually occurs in the S phase of the cell cycle. Specifically, Vpr triggers activation of Chk1 through Ser345 phosphorylation in an S phase-dependent manner. The S phase-dependent requirement of Chk1-Ser345 phosphorylation by Vpr was confirmed by siRNA gene silencing and site-directed mutagenesis. Moreover, downregulation of DNA replication licensing factors Cdt1 by siRNA significantly reduced Vpr-induced Chk1-Ser345 phosphorylation and G2 arrest. Even though hydroxyurea (HU) and ultraviolet light (UV) also induce Chk1-Ser345 phosphorylation in S phase under the same conditions, neither HU nor UV-treated cells were able to pass through S phase, whereas vpr-expressing cells completed S phase and stopped at the G2/M boundary. Furthermore, unlike HU/UV, Vpr promotes Chk1- and proteasome-mediated protein degradations of Cdc25B/C for G2 induction; in contrast, Vpr had little or no effect on Cdc25A protein degradation normally mediated by HU/UV. These data suggest that Vpr induces cell cycle G2 arrest through a unique molecular mechanism that regulates host cell cycle regulation in an S-phase dependent fashion.

  20. Supersymmetric M3-branes and G2 manifolds

    NASA Astrophysics Data System (ADS)

    Cvetič, M.; Gibbons, G. W.; Lü, H.; Pope, C. N.

    2002-01-01

    We obtain a generalisation of the original complete Ricci-flat metric of G2 holonomy on R4×S 3 to a family with a nontrivial parameter λ. For generic λ the solution is singular, but it is regular when λ={-1,0,+1}. The case λ=0 corresponds to the original G2 metric, and λ={-1,1} are related to this by an S3 automorphism of the SU(2) 3 isometry group that acts on the S3× S3 principal orbits. We then construct explicit supersymmetric M3-brane solutions in D=11 supergravity, where the transverse space is a deformation of this class of G2 metrics. These are solutions of a system of first-order differential equations coming from a superpotential. We also find M3-branes in the deformed backgrounds of new G2 holonomy metrics that include one found by A. Brandhuber, J. Gomis, S. Gubser and S. Gukov, and show that they also are supersymmetric.

  1. Menadione induces G2/M arrest in gastric cancer cells by down-regulation of CDC25C and proteasome mediated degradation of CDK1 and cyclin B1

    PubMed Central

    Lee, Min Ho; Cho, Yoonjung; Kim, Do Hyun; Woo, Hyun Jun; Yang, Ji Yeong; Kwon, Hye Jin; Yeon, Min Ji; Park, Min; Kim, Sa-Hyun; Moon, Cheol; Tharmalingam, Nagendran; Kim, Tae Ue; Kim, Jong-Bae

    2016-01-01

    Menadione (vitamin K3) has been reported to induce apoptotic cell death and growth inhibition in various types of cancer cells. However, involvement of menadione in cell cycle control has not been considered in gastric cancer cells yet. In the current study, we have investigated whether menadione is involved in the cell cycle regulation and suppression of growth in gastric cancer cells. In the cell cycle analysis, we found that menadione induced G2/M cell cycle arrest in AGS cells. To elucidate the underlying mechanism, we investigated the cell cycle regulatory molecules involved in the G2/M cell cycle transition. After 24 h of menadione treatment, the protein level of CDK1, CDC25C and cyclin B1 in AGS cells was decreased in a menadione dose-dependent manner. In the time course experiment, the protein level of CDC25C decreased in 6 h, and CDK1and cyclin B1 protein levels began to decrease after 18 h of menadione treatment. We found that mRNA level of CDC25C decreased by menadione treatment in 6 h. Menadione did not have an influence on mRNA level of CDK1 and cyclin B1 though the protein levels were decreased. However, the decreased protein levels of CDK1 and cyclin B1 were recovered by inhibition of proteasome. Collectively, these results suggest that menadione inhibits growth of gastric cancer cells by reducing expression of CDC25C and promoting proteasome mediated degradation of CDK1 and cyclin B1 thereby blocking transition of the cell cycle from G2 phase to M phase. PMID:28077999

  2. Tributyltin induces a G2/M cell cycle arrest in human amniotic cells via PP2A inhibition-mediated inactivation of the ERK1/2 cascades.

    PubMed

    Zhang, Yali; Guo, Zonglou; Xu, Lihong

    2014-03-01

    The molecular mechanisms underlying the cell cycle alterations induced by tributyltin (TBT), a highly toxic environmental contaminant, remain elusive. In this study, cell cycle progression and some key regulators in G2/M phase were investigated in human amniotic cells treated with TBT. Furthermore, protein phosphatase (PP) 2A and the ERK cascades were examined. The results showed that TBT caused a G2/M cell cycle arrest that was accompanied by a decrease in the total cdc25C protein level and an increase in the p-cdc2 level in the nucleus. TBT caused a decrease in PP2A activity and inhibited the ERK cascade by inactivating Raf-1, resulting in the dephosphorylation of MEK1/2, ERK1/2, and c-Myc. Taken together, TBT leads to a G2/M cell cycle arrest in FL cells, an increase in p-cdc2 and a decrease in the levels of total cdc25C protein, which may be caused by the PP2A inhibition-mediated inactivation of the ERK1/2 cascades. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. 11 CFR 104.4 - Independent expenditures by political committees (2 U.S.C. 434(b), (d), and (g)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Independent expenditures by political... GENERAL REPORTS BY POLITICAL COMMITTEES AND OTHER PERSONS (2 U.S.C. 434) § 104.4 Independent expenditures by political committees (2 U.S.C. 434(b), (d), and (g)). (a) Regularly scheduled reporting. Every...

  4. 5-Aminouracil treatment. A method for estimating G2.

    PubMed

    Socher, S H; Davidson, D

    1971-02-01

    Treatment of Vicia faba lateral roots with a range of concentrations of 5-aminouracil (5-AU) indicate that cells are stopped at a particular point in interphase. The timing of the fall in mitotic index suggests that cells are held at the S - G(2) transition. When cells are held at this point, treatments with 5-AU can be used to estimate the duration of G(2) + mitosis/2 of proliferating cells. Treatment with 5-AU can also be used to demonstrate the presence of subpopulations of dividing cells that differ in their G(2) duration. Using this method, 5-AU-induced inhibition, we have confirmed that in V. faba lateral roots there are two populations of dividing cells: (a) a fast-dividing population, which makes up approximately 85% of the proliferating cell population and has a G(2) + mitosis/2 duration of 3.3 hr, and (b) a slow-dividing population, which makes up approximately 15% of dividing cells and has a G(2) duration in excess of 12 hr. These estimates are similar to those obtained from percentage labeled mitosis (PLM) curves after incorporation of thymidine-(3)H.

  5. Activation of G-protein coupled estrogen receptor inhibits the proliferation of cervical cancer cells via sustained activation of ERK1/2.

    PubMed

    Zhang, Qiong; Wu, Yuan-Zhe; Zhang, Yan-Mei; Ji, Xiao-Hong; Hao, Qun

    2015-04-01

    Cervical cancer is one of the most common gynaecological women cancer and suggested to be modulated by estrogenic signals. G protein-coupled receptor (GPER), a seven-transmembrane G protein-coupled receptor, has been reported to regulate the cell proliferation of various cancers. But there is no study investigating the effects of GPER on the progression of cervical cancer. In the present study, we revealed for the first time that GPER was also highly expressed in various human cervical cancer cells. Activation of GPER via its specific agonist G-1 induced G2/M cell cycle arrest and down regulation of cyclin B via a time dependent manner. Furthermore, G-1 treatment induced sustained activation of extracellular-signal-regulated kinases (ERK)1/2 via epidermal growth factor receptor (EGFR) signals. Both inhibitors of ERK1/2 and EGFR significantly abolished G-1-induced suppression of cell proliferation and down regulation of cyclin B. Generally, our study revealed that GPER is highly expressed in human cervical cancer cells and its activation inhibits cell proliferation via EGFR/ERK1/2 signals. It suggested that G-1 can be considered as a potential new pharmacological tool to reduce the growth of cervical cancer. Copyright © 2015 John Wiley & Sons, Ltd.

  6. The K2-ESPRINT project. VI. K2-105 b, a hot Neptune around a metal-rich G-dwarf

    NASA Astrophysics Data System (ADS)

    Narita, Norio; Hirano, Teruyuki; Fukui, Akihiko; Hori, Yasunori; Dai, Fei; Yu, Liang; Livingston, John; Ryu, Tsuguru; Nowak, Grzegorz; Kuzuhara, Masayuki; Sato, Bun'ei; Takeda, Yoichi; Albrecht, Simon; Kudo, Tomoyuki; Kusakabe, Nobuhiko; Palle, Enric; Ribas, Ignasi; Tamura, Motohide; Van Eylen, Vincent; Winn, Joshua N.

    2017-04-01

    We report on the confirmation that the candidate transits observed for the star EPIC 211525389 are due to a short-period Neptune-sized planet. The host star, located in K2 campaign field 5, is a metal-rich ([Fe/H] = 0.26 ± 0.05) G-dwarf (Teff = 5430 ± 70 K and log g = 4.48 ± 0.09), based on observations with the High Dispersion Spectrograph (HDS) on the Subaru 8.2 m telescope. High spatial resolution AO imaging with HiCIAO on the Subaru telescope excludes faint companions near the host star, and the false positive probability of this target is found to be <10-6 using the open source vespa code. A joint analysis of transit light curves from K2 and additional ground-based multi-color transit photometry with MuSCAT on the Okayama 1.88 m telescope gives an orbital period of P = 8.266902 ± 0.000070 d and consistent transit depths of Rp/R⋆ ∼ 0.035 or (Rp/R⋆)2 ∼ 0.0012. The transit depth corresponds to a planetary radius of R_p = 3.59_{-0.39}^{+0.44} R_{\\oplus }, indicating that EPIC 211525389 b is a short-period Neptune-sized planet. Radial velocities of the host star, obtained with the Subaru HDS, lead to a 3 σ upper limit of 90 M⊕ (0.00027 M⊙) on the mass of EPIC 211525389 b, confirming its planetary nature. We expect this planet, newly named K2-105 b, to be the subject of future studies to characterize its mass, atmosphere, and spin-orbit (mis)alignment, as well as investigate the possibility of additional planets in the system.

  7. THE GALACTIC CENTER CLOUD G2 AND ITS GAS STREAMER

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pfuhl, Oliver; Gillessen, Stefan; Eisenhauer, Frank

    2015-01-10

    We present new, deep near-infrared SINFONI @ VLT integral field spectroscopy of the gas cloud G2 in the Galactic Center, from late 2013 August, 2014 April, and 2014 July. G2 is visible in recombination line emission. The spatially resolved kinematic data track the ongoing tidal disruption. The cloud reached minimum distance to the MBH of 1950 Schwarzschild radii. As expected for an observation near the pericenter passage, roughly half of the gas in 2014 is found at the redshifted, pre-pericenter side of the orbit, while the other half is at the post-pericenter, blueshifted side. We also present an orbital solutionmore » for the gas cloud G1, which was discovered a decade ago in L'-band images when it was spatially almost coincident with Sgr A*. The orientation of the G1 orbit in the three angles is almost identical to that of G2, but it has a lower eccentricity and smaller semi-major axis. We show that the observed astrometric positions and radial velocities of G1 are compatible with the G2 orbit, assuming that (1) G1 was originally on the G2 orbit preceding G2 by 13 yr, and (2) a simple drag force acted on it during pericenter passage. Taken together with the previously described tail of G2, which we detect in recombination line emission and thermal broadband emission, we propose that G2 may be a bright knot in a much more extensive gas streamer. This matches purely gaseous models for G2, such as a stellar wind clump or the tidal debris from a partial disruption of a star.« less

  8. G protein-coupled estrogen receptor (GPER) mediates NSCLC progression induced by 17β-estradiol (E2) and selective agonist G1.

    PubMed

    Liu, Changyu; Liao, Yongde; Fan, Sheng; Tang, Hexiao; Jiang, Zhixiao; Zhou, Bo; Xiong, Jing; Zhou, Sheng; Zou, Man; Wang, Jianmiao

    2015-04-01

    Estrogen classically drives lung cancer development via estrogen receptor β (ERβ). However, fulvestrant, an anti-estrogen-based endocrine therapeutic treatment, shows limited effects for non-small cell lung cancer (NSCLC) in phase II clinical trials. G protein-coupled estrogen receptor (GPER), a third estrogen receptor that binds to estrogen, has been found to be activated by fulvestrant, stimulating the progression of breast, endometrial, and ovarian cancers. We here demonstrated that cytoplasm-GPER (cGPER) (80.49 %) and nucleus-GPER (53.05 %) were detected by immunohistochemical analysis in NSCLC samples. cGPER expression was related to stages IIIA-IV, lymph node metastasis, and poorly differentiated NSCLC. Selective agonist G1 and 17β-estradiol (E2) promoted the GPER-mediated proliferation, invasion, and migration of NSCLC cells. Additionally, in vitro administration of E2 and G1 increased the number of tumor nodules, tumor grade, and tumor index in a urethane-induced adenocarcinoma model. Importantly, the pro-tumorigenic effects of GPER induced by E2 were significantly reduced by co-administering the GPER inhibitor G15 and the ERβ inhibitor fulvestrant, as compared to administering fulvestrant alone both in vitro and in vivo. Moreover, the phosphorylation of MAPK and Akt was involved in E2/G1-induced GPER activation. In conclusion, our results indicated that a pro-tumor function of GPER exists that mediated E2-/G1-dependent NSCLC progression and showed better efficiency regarding the co-targeting of GPER and ERβ, providing a rationale for further investigation of anti-estrogen clinical therapy.

  9. Itinerant G-type antiferromagnetic order in SrCr 2 As 2

    DOE PAGES

    Das, Pinaki; Sangeetha, N. S.; Lindemann, George R.; ...

    2017-07-07

    Here, neutron-diffraction and magnetic susceptibility studies of polycrystalline SrCr 2As 2 reveal that this compound is an itinerant G-type antiferromagnet below the Néel temperature T N = 590(5) K with the Cr magnetic moments aligned along the tetragonal c axis. The system remains tetragonal to the lowest measured temperature (~12 K). The lattice parameter ratio c/a and the magnetic moment saturate at about the same temperature below ~200 K, indicating a possible magnetoelastic coupling. The ordered moment μ = 1.9(1B/Cr, measured at T = 12 K, is significantly reduced compared to its localized value (4μ B/Cr) due to themore » itinerant character brought about by hybridization between the Cr 3d and As 4p orbitals.« less

  10. Itinerant G-type antiferromagnetic order in SrCr 2 As 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Das, Pinaki; Sangeetha, N. S.; Lindemann, George R.

    Here, neutron-diffraction and magnetic susceptibility studies of polycrystalline SrCr 2As 2 reveal that this compound is an itinerant G-type antiferromagnet below the Néel temperature T N = 590(5) K with the Cr magnetic moments aligned along the tetragonal c axis. The system remains tetragonal to the lowest measured temperature (~12 K). The lattice parameter ratio c/a and the magnetic moment saturate at about the same temperature below ~200 K, indicating a possible magnetoelastic coupling. The ordered moment μ = 1.9(1B/Cr, measured at T = 12 K, is significantly reduced compared to its localized value (4μ B/Cr) due to themore » itinerant character brought about by hybridization between the Cr 3d and As 4p orbitals.« less

  11. Deuterium Abundance Toward G191-B2B: Results from the Far Ultraviolet Spectroscopic Explorer (FUSE) Mission

    NASA Technical Reports Server (NTRS)

    Lemoine, M.; Vidal-Madjar, A.; Hebrard, G.; Desert, J.-M.; Ferlet, R.; LecavelierdesEtangs, A.; Howk, J. C.; Andre, M.; Blair, W. P.; Friedman, S. D.; hide

    2002-01-01

    High-resolution spectra of the hot white dwarf G191-B2B covering the wavelength region 905-1187A were obtained with the Far Ultraviolet Spectroscopic Explorer (FUSE). This data was used in conjunction with existing high-resolution Hubble Space Telescope STIS observations to evaluate the total H(sub I), D(sub I), O(sub I) and N(sub I) column densities along the line of sight. Previous determinations of N(D(sub I)) based upon GHRS (Goddard High Resolution Spectrograph) and STIS (Space Telescope Imaging Spectrograph) observations were controversial due to the saturated strength of the D(sub I) Lyman alpha line. In the present analysis the column density of D(sub I) has been measured using only the unsaturated Lyman beta and Lyman gamma lines observed by FUSE. A careful inspection of possible systematic uncertainties tied to the modeling of the stellar continuum or to the uncertainties in the FUSE instrumental character series has been performed. The column densities derived are: log N(D(sub I)) = 13.40+/-0.07, log N(O(sub I)) = 14.86+/-0.07, and log N(N(sub I)) = 13.87+/-0.07 quoted with 2sigma, uncertainties. The measurement of the H(sub I) column density by profile fitting of the Lyman alpha line has been found to be unsecure. If additional weak hot interstellar components are added to the three detected clouds along the line of sight, the H(sub I)) column density can be reduced quite significantly, even though the signal-to-noise ratio and spectral resolution at Lyman alpha are excellent. The new estimate of N(H(sub I)) toward G191-B2B reads: logN(H (sub I)) = 18.18+/-0.18 (2sigma uncertainty), so that the average (D/H) ratio on the line of sight is: (D/H)= 1.66(+0.9/-0.6) x 10(exp -5) (2sigma uncertainty).

  12. Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

    PubMed

    Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

    2017-01-01

    Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

  13. Rate Coefficient for Collisional Removal of O2(X3Σ ^-g, v = 1) with O Atoms at 240 K

    NASA Astrophysics Data System (ADS)

    Pejaković, D. A.; Campbell, Z.; Kalogerakis, K. S.; Copeland, R. A.; Slanger, T. G.

    2004-12-01

    -12 cm3s-1 [2]. Interestingly, removal of O2(a1Δ g, v = 1) by O(3P) is about five times less efficient than removal of O2(X3Σ ^-g, v = 1). The rate coefficient for O2(a1Δ g, v = 1) removal by O2 is in the range 5--6 × 10-11 cm3s-1 and is nearly temperature independent in the region 296--240 K. The removal by CO2 is about 3000 times slower than removal by O2 and nearly independent on temperature. Implications of the results for atmospheric modeling will be discussed. This work is supported by the NASA Geospace Sciences Program under grant NAG5-13002. Participation of Z. Campbell was made possible through the NSF Research Experience for Undergraduates Program under grant PHY-0353745. [1] M. G. Mlynczak, D. K. Zhou, M. Lopez-Puertas, G. Zaragoza, and J. M. Russell, Geophys. Res. Lett. 26, 63 (1999). [2] Konstantinos S. Kalogerakis, Richard A. Copeland, and Tom G. Slanger, Eos. Trans. AGU 82(47), Fall Meet. Suppl., Abstract SA41B-0728, 2001.

  14. 10 CFR 2.700 - Scope of subpart G.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Scope of subpart G. 2.700 Section 2.700 Energy NUCLEAR... Formal Adjudications § 2.700 Scope of subpart G. The provisions of this subpart apply to and supplement... authorization for high-level radioactive waste repository noticed under §§ 2.101(f)(8) or 2.105(a)(5...

  15. MEK-ERK inhibition corrects the defect in VLDL assembly in HepG2 cells: potential role of ERK in VLDL-ApoB100 particle assembly.

    PubMed

    Tsai, Julie; Qiu, Wei; Kohen-Avramoglu, Rita; Adeli, Khosrow

    2007-01-01

    Hepatic VLDL assembly is defective in HepG2 cells, resulting in the secretion of immature triglyceride-poor LDL-sized apoB particles. We investigated the mechanisms underlying defective VLDL assembly in HepG2 and have obtained evidence implicating the MEK-ERK pathway. HepG2 cells exhibited considerably higher levels of the ERK1/2 mass and activity compared with primary hepatocytes. Inhibition of ERK1/2 using the MEK1/MEK2 inhibitor, U0126 (but not the inactive analogue) led to a significant increase in apoB secretion. In the presence of oleic acid, ERK1/2 inhibition caused a major shift in the lipoprotein distribution with a majority of particles secreted as VLDL, an effect independent of insulin. In contrast, overexpression of constitutively active MEK1 decreased apoB and large VLDL secretion. MEK1/2 inhibition significantly increased both cellular and microsomal TG mass, and mRNA levels for DGAT-1 and DGAT-2. In contrast to ERK, modulation of the PI3-K pathway or inhibition of the p38 MAP kinase, had no effect on lipoprotein density profile. Modulation of the MEK-ERK pathway in primary hamster hepatocytes led to changes in apoB secretion and altered the density profile of apoB-containing lipoproteins. Inhibition of the overactive ras-MEK-ERK pathway in HepG2 cells can correct the defect in VLDL assembly leading to the secretion of large, VLDL-sized particles, similar to primary hepatocytes, implicating the MEK-ERK cascade in VLDL assembly in the HepG2 model. Modulation of this pathway in primary hepatocytes also regulates apoB secretion and appears to alter the formation of VLDL-1 sized particles.

  16. Physalis angulata induced G2/M phase arrest in human breast cancer cells.

    PubMed

    Hsieh, Wen-Tsong; Huang, Kuan-Yuh; Lin, Hui-Yi; Chung, Jing-Gung

    2006-07-01

    Physalis angulata (PA) is employed in herbal medicine around the world. It is used to treat diabetes, hepatitis, asthma and malaria in Taiwan. We have evaluated PA as a cancer chemopreventive agent in vitro by studying the role of PA in regulation of proliferation, cell cycle and apoptosis in human breast cancer cell lines. PA inhibited cell proliferation and induced G2/M arrest and apoptosis in human breast cancer MAD-MB 231 and MCF-7 cell lines. In this study, under treatment with various concentrations of PA in MDA-MB 231 cell line, we checked mRNA levels for cyclin A and cyclin B1 and the protein levels of cyclin A and cyclin B1, Cdc2 (cyclin-dependent kinases), p21(waf1/cip1) and P27(Kip1) (cyclin-dependent kinase inhibitors), Cdc25C, Chk2 and Wee1 kinase (cyclin-dependent kinase relative factors) in cell cycle G2/M phase. From those results, we determined that PA arrests MDA-MB 231 cells at the G2/M phase by (i) inhibiting synthesis or stability of mRNA and their downstream protein levels of cyclin A and cyclin B1, (ii) increasing p21(waf1/cip1) and P27(kip1) levels, (iii) increasing Chk2, thus causing an increase in Cdc25C phosphorylation/inactivation and inducing a decrease in Cdc2 levels and an increase in Wee1 level. According to the results obtained, PA appears to possess anticarcinogenic properties; these results suggest that the effect of PA on the levels of phosphorylated/inactivated Cdc25C are mediated by Chk2 activation, at least in part, via p21(waf1/cip1) and P27(kip1) cyclin-dependent kinase inhibitors pathway to arrest cells at G2/M phase in breast cancer carcinoma cells.

  17. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis

    PubMed Central

    Pasta, Linda; Pasta, Francesca

    2015-01-01

    AIM: To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. METHODS: All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. RESULTS: Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ2 > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ2 = 39.3; P < 0.000 and χ2 = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. CONCLUSION: MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing

  18. PAI-1 4G-4G and MTHFR 677TT in non-hepatitis C virus/hepatitis B virus-related liver cirrhosis.

    PubMed

    Pasta, Linda; Pasta, Francesca

    2015-12-18

    To evaluate the different roles of thrombophilia in patients with and without viral etiology. The thrombophilic genetic factors (THRGFs), PAI-1 4G-4G, MTHFR 677TT, V Leiden 506Q and prothrombin 20210A, were studied as risk factors in 1079 patients with liver cirrhosis (LC), enrolled from January 2000 to January 2014. All Caucasian LC patients consecutively observed in a fourteen-year period were included; the presence of portal vein thrombosis (PVT) and Budd Chiari syndrome (BCS) was registered. The differences between the proportions of each THRGF with regard to the presence or absence of viral etiology and the frequencies of the THRGF genotypes with those predicted in a population by the Hardy-Weinberg equilibrium were registered. Four hundred and seventeen/one thousand and seventy-six patients (38.6%) showed thrombophilia: 217 PAI-1 4G-4G, 176 MTHFR C677TT, 71 V Leiden factor and 41 prothrombin G20210 A, 84 with more than 1 THRGF; 350 presented with no viral liver cirrhosis (NVLC) and 729 with, called viral liver cirrhosis (VLC), of whom 56 patients were hepatitis C virus + hepatitis B virus. PAI-1 4G-4G, MTHFR C677TT, the presence of at least one TRHGF and the presence of > 1 THRGF, were statistically more frequent in patients with NVLC vs patients with VLC: All χ (2) > 3.85 and P < 0.05. Patients with PVT and/or BCS with at least one TRHGF were 189/352 (53.7%). The Hardy-Weinberg of PAI-1 and MTHFR 677 genotypes deviated from that expected from a population in equilibrium in patients with NVLC (respectively χ (2) = 39.3; P < 0.000 and χ (2) = 27.94; P < 0.05), whereas the equilibrium was respected in VLC. MTHFR 677TT was nearly twofold and PAI-1 4G-4G more than threefold more frequently found in NVLC vs patients with VLC; the Hardy-Weinberg equilibrium of these two polymorphisms confirms this data in NVLC. We suggest that PAI-1 4G-4G and MTHFR 677TT could be considered as factors of fibrosis and thrombosis mechanisms, increasing the inflammation response

  19. Influence of environmental pH on G2-phase arrest caused by ionizing radiation.

    PubMed

    Park, Heon Joo; Lee, Sang Hwa; Chung, HyunSook; Rhee, Yun Hee; Lim, Byung Uk; Ha, Sung Whan; Griffin, Robert J; Lee, Hyung Sik; Song, Chang Won; Choi, Eun Kyung

    2003-01-01

    We investigated the effects of an acidic environment on the G2/M-phase arrest, apoptosis, clonogenic death, and changes in cyclin B1-CDC2 kinase activity caused by a 4-Gy irradiation in RKO.C human colorectal cancer cells in vitro. The time to reach peak G2/M-phase arrest after irradiation was delayed in pH 6.6 medium compared to that in pH 7.5 medium. Furthermore, the radiation-induced G2/M-phase arrest decayed more slowly in pH 6.6 medium than in pH 7.5 medium. Finally, there was less radiation-induced apoptosis and clonogenic cell death in pH 6.6 medium than in pH 7.5 medium. It appeared that the prolongation of G2-phase arrest after irradiation in the acidic environment allowed for greater repair of radiation-induced DNA damage, thereby decreasing the radiation-induced cell death. The prolongation of G2-phase arrest after irradiation in the acidic pH environment appeared to be related at least in part to a prolongation of the phosphorylation of CDC2, which inhibited cyclin B1-CDC2 kinase activity.

  20. ROSAT EUV and soft X-ray studies of atmospheric composition and structure in G191-B2B

    NASA Technical Reports Server (NTRS)

    Barstow, M. A.; Fleming, T. A.; Finley, D. S.; Koester, D.; Diamond, C. J.

    1993-01-01

    Previous studies of the hot DA white dwarf GI91-B2B have been unable to determine whether the observed soft X-ray and EUV opacity arises from a stratified hydrogen and helium atmosphere or from the presence of trace metals in the photosphere. New EUV and soft X-ray photometry of this star, made with the ROSAT observatory, when analyzed in conjunction with the earlier data, shows that the stratified models cannot account for the observed fluxes. Consequently, we conclude that trace metals must be a substantial source of opacity in the photosphere of G191-B2B.

  1. High-throughput screening and stability optimization of anti-streptavidin IgG1 and IgG2 formulations.

    PubMed

    Alekseychyk, Larysa; Su, Cheng; Becker, Gerald W; Treuheit, Michael J; Razinkov, Vladimir I

    2014-10-01

    Selection of a suitable formulation that provides adequate product stability is an important aspect of the development of biopharmaceutical products. Stability of proteins includes not only resistance to chemical modifications but also conformational and colloidal stabilities. While chemical degradation of antibodies is relatively easy to detect and control, propensity for conformational changes and/or aggregation during manufacturing or long-term storage is difficult to predict. In many cases, the formulation factors that increase one type of stability may significantly decrease another type under the same or different conditions. Often compromise is necessary to minimize the adverse effects of an antibody formulation by careful optimization of multiple factors responsible for overall stability. In this study, high-throughput stress and characterization techniques were applied to 96 formulations of anti-streptavidin antibodies (an IgG1 and an IgG2) to choose optimal formulations. Stress and analytical methods applied in this study were 96-well plate based using an automated liquid handling system to prepare the different formulations and sample plates. Aggregation and clipping propensity were evaluated by temperature and mechanical stresses. Multivariate regression analysis of high-throughput data was performed to find statistically significant formulation factors that alter measured parameters such as monomer percentage or unfolding temperature. The results of the regression models were used to maximize the stabilities of antibodies under different formulations and to find the optimal formulation space for each molecule. Comparison of the IgG1 and IgG2 data indicated an overall greater stability of the IgG1 molecule under the conditions studied. The described method can easily be applied to both initial preformulation screening and late-stage formulation development of biopharmaceutical products. © 2014 Society for Laboratory Automation and Screening.

  2. Human immunodeficiency virus type 1 Vpr induces cell cycle G2 arrest through Srk1/MK2-mediated phosphorylation of Cdc25.

    PubMed

    Huard, Sylvain; Elder, Robert T; Liang, Dong; Li, Ge; Zhao, Richard Y

    2008-03-01

    Human immunodeficiency virus type 1 (HIV-1) Vpr induces cell cycle G(2) arrest in fission yeast (Schizosaccharomyces pombe) and mammalian cells, suggesting the cellular pathway(s) targeted by Vpr is conserved among eukaryotes. Our previous studies in fission yeast demonstrated that Vpr induces G(2) arrest in part through inhibition of Cdc25, a Cdc2-specific phosphatase that promotes G(2)/M transition. The goal of this study was to further elucidate molecular mechanism underlying the inhibitory effect of Vpr on Cdc25. We show here that, similar to the DNA checkpoint controls, expression of vpr promotes subcellular relocalization of Cdc25 from nuclear to cytoplasm and thereby prevents activation of Cdc2 by Cdc25. Vpr-induced nuclear exclusion of Cdc25 appears to depend on the serine/threonine phosphorylation of Cdc25 and the presence of Rad24/14-3-3 protein, since amino acid substitutions of the nine possible phosphorylation sites of Cdc25 with Ala (9A) or deletion of the rad24 gene abolished nuclear exclusion induced by Vpr. Interestingly, Vpr is still able to promote Cdc25 nuclear export in mutants defective in the checkpoints (rad3 and chk1/cds1), the kinases that are normally required for Cdc25 phosphorylation and nuclear exclusion of Cdc25, suggesting that others kinase(s) might modulate phosphorylation of Cdc25 for the Vpr-induced G(2) arrest. We report here that this kinase is Srk1. Deletion of the srk1 gene blocks the nuclear exclusion of Cdc25 caused by Vpr. Overexpression of srk1 induces cell elongation, an indication of cell cycle G(2) delay, in a similar fashion to Vpr; however, no additive effect of cell elongation was observed when srk1 and vpr were coexpressed, indicating Srk1 and Vpr are likely affecting the cell cycle G(2)/M transition through the same cellular pathway. Immunoprecipitation further shows that Vpr and Srk1 are part of the same protein complex. Consistent with our findings in fission yeast, depletion of the MK2 gene, a human homologue

  3. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  4. Electrochemical Hydroxylation of C3-C12 n-Alkanes by Recombinant Alkane Hydroxylase (AlkB) and Rubredoxin-2 (AlkG) from Pseudomonas putida GPo1.

    PubMed

    Tsai, Yi-Fang; Luo, Wen-I; Chang, Jen-Lin; Chang, Chun-Wei; Chuang, Huai-Chun; Ramu, Ravirala; Wei, Guor-Tzo; Zen, Jyh-Myng; Yu, Steve S-F

    2017-08-21

    An unprecedented method for the efficient conversion of C 3 -C 12 linear alkanes to their corresponding primary alcohols mediated by the membrane-bound alkane hydroxylase (AlkB) from Pseudomonas putida GPo1 is demonstrated. The X-ray absorption spectroscopy (XAS) studies support that electrons can be transferred from the reduced AlkG (rubredoxin-2, the redox partner of AlkB) to AlkB in a two-phase manner. Based on this observation, an approach for the electrocatalytic conversion from alkanes to alcohols mediated by AlkB using an AlkG immobilized screen-printed carbon electrode (SPCE) is developed. The framework distortion of AlkB-AlkG adduct on SPCE surface might create promiscuity toward gaseous substrates. Hence, small alkanes including propane and n-butane can be accommodated in the hydrophobic pocket of AlkB for C-H bond activation. The proof of concept herein advances the development of artificial C-H bond activation catalysts.

  5. Heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(s)

    NASA Technical Reports Server (NTRS)

    Leu, Ming-Taun; Timonen, Raimo S.; Keyser, Leon F.; Yung, Yuk L.

    1995-01-01

    The heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) (eq 1) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(S) (eq 2) were investigated over the temperature range 223-296 K in a flow-tube reactor coupled to a quadrupole mass spectrometer. Either a chemical ionization mass spectrometer (CIMS) or an electron-impact ionization mass spectrometer (EIMS) was used to provide suitable detection sensitivity and selectivity. In order to mimic atmospheric conditions, partial pressures of HNO3 and N2O5 in the range 6 x 10(exp -8) - 2 x 10(exp -6) Torr were used. Granule sizes and surface roughness of the solid NaCl substrates were determined by using a scanning electron microscope. For dry NaCl substrates, decay rates of HNO3 were used to obtain gamma(1) = 0.013 +/- 0.004 (1sigma) at 296 K and > 0.008 at 223 K, respectively. The error quoted is the statistical error. After all corrections were made, the overall error, including systematic error, was estimated to be about a factor of 2. HCl was found to be the sole gas-phase product of reaction 1. The mechanism changed from heterogeneous reaction to predominantly physical adsorption when the reactor was cooled from 296 to 223 K. For reaction 2 using dry salts, gamma(2) was found to be less than 1.0 x 10(exp -4) at both 223 and 296 K. The gas-phase reaction product was identified as ClNO2 in previous studies using an infrared spectrometer. An enhancement in reaction probability was observed if water was not completely removed from salt surfaces, probably due to the reaction of N2O5(g) + H2O(s) yields 2HNO3(g). Our results are compared with previous literature values obtained using different experimental techniques and conditions. The implications of the present results for the enhancement of the hydrogen chloride column density in the lower stratosphere after the El Chichon volcanic eruption and for the chemistry of HCl and HNO3 in the marine troposphere are discussed.

  6. Cytotoxic effects of 2-methoxyestradiol in the hepatocellular carcinoma cell line HepG2.

    PubMed

    El Naga, Reem N Abou; El-Demerdash, Ebtehal; Youssef, Samar S; Abdel-Naim, Ashraf B; El-Merzabani, Mahmoud

    2009-01-01

    The study was designed to examine the potential cytotoxicity of 2-methoxyestradiol (2ME2), a natural 17beta-estradiol metabolite, in hepatocellular carcinoma and the possible underlying mechanisms for this cytotoxicity. The cell line HepG2 was treated with different concentrations of 2ME2 for 48 and 72 h. Using the sulforhodamine B assay, HepG2 was sensitive to the cytotoxic effect of 2ME2. 2ME2 induced cell arrest at the G(2)/M phase and a significant high percentage of apoptotic cells compared to the control group. Also, 2ME2 induced a significant increase in caspase 9 enzymatic activity after 48 and 72 h of treatment compared with control values. The DNA laddering was observed only in cells treated for 72 h. Furthermore, 2ME2 induced a significant decrease in the expression levels of vascular endothelial growth factor (VEGF) gene compared to the control values. 2ME2 exerts cytotoxic activity in the HepG2 cell line by preferential cell blocking at the G(2)/M phase as well as induction of apoptosis as evidenced by increased caspase 9 enzymatic activity and observed DNA laddering in 2ME2-treated HepG2 cells. In addition, a reduction in hypervascularity is an important postulated mechanism as indicated by the significant reduction in the expression of VGEF, one of the most important angiogenic factors.

  7. The Cak1p Protein Kinase Is Required at G(1)/S and G(2)/M in the Budding Yeast Cell Cycle

    PubMed Central

    Sutton, A.; Freiman, R.

    1997-01-01

    The CAK1 gene encodes the major CDK-activating kinase (CAK) in budding yeast and is required for activation of Cdc28p for cell cycle progression from G(2) to M phase. Here we describe the isolation of a mutant allele of CAK1 in a synthetic lethal screen with the Sit4 protein phosphatase. Analysis of several different cak1 mutants shows that although the G(2) to M transition appears most sensitive to loss of Cak1p function, Cak1p is also required for activation of Cdc28p for progression from G(1) into S phase. Further characterization of these mutants suggests that, unlike the CAK identified from higher eukaryotes, Cak1p of budding yeast may not play a role in general transcription. Finally, although Cak1 protein levels and in vitro protein kinase activity do not fluctuate during the cell cycle, at least a fraction of Cak1p associates with higher molecular weight proteins, which may be important for its in vivo function. PMID:9286668

  8. Draft Genome Sequences of Two Kocuria Isolates, K. salsicia G1 and K. rhizophila G2, Isolated from a Slaughterhouse in Denmark

    PubMed Central

    Herschend, Jakob; Raghupathi, Prem K.; Røder, Henriette L.; Sørensen, Søren J.

    2016-01-01

    We report here the draft genome sequences of Kocuria salsicia G1 and Kocuria rhizophila G2, which were isolated from a meat chopper at a small slaughterhouse in Denmark. The two annotated genomes are 2.99 Mb and 2.88 Mb in size, respectively. PMID:27034479

  9. Heteromerization of G2A and OGR1 enhances proton sensitivity and proton-induced calcium signals.

    PubMed

    Huang, Ya-Han; Su, Yeu-Shiuan; Chang, Chung-Jen; Sun, Wei-Hsin

    2016-12-01

    Proton-sensing G-protein-coupled receptors (GPCRs; OGR1, GPR4, G2A, TDAG8), with full activation at pH 6.4 ∼ 6.8, are important to pH homeostasis, immune responses and acid-induced pain. Although G2A mediates the G13-Rho pathway in response to acid, whether G2A activates Gs, Gi or Gq proteins remains debated. In this study, we examined the response of this fluorescence protein-tagged OGR1 family to acid stimulation in HEK293T cells. G2A did not generate detectable intracellular calcium or cAMP signals or show apparent receptor redistribution with moderate acid (pH ≥ 6.0) stimulation but reduced cAMP accumulation under strong acid stimulation (pH ≤ 5.5). Surprisingly, coexpression of OGR1- and G2A-enhanced proton sensitivity and proton-induced calcium signals. This alteration is attributed to oligomerization of OGR1 and G2A. The oligomeric potential locates receptors at a specific site, which leads to enhanced proton-induced calcium signals through channels.

  10. Induction of G1 and G2/M cell cycle arrests by the dietary compound 3,3'-diindolylmethane in HT-29 human colon cancer cells.

    PubMed

    Choi, Hyun Ju; Lim, Do Young; Park, Jung Han Yoon

    2009-05-29

    3,3'-Diindolylmethane (DIM), an indole derivative produced in the stomach after the consumption of broccoli and other cruciferous vegetables, has been demonstrated to exert anti-cancer effects in both in vivo and in vitro models. We have previously determined that DIM (0 - 30 micromol/L) inhibited the growth of HT-29 human colon cancer cells in a concentration-dependent fashion. In this study, we evaluated the effects of DIM on cell cycle progression in HT-29 cells. HT-29 cells were cultured with various concentrations of DIM (0 - 30 micromol/L) and the DNA was stained with propidium iodide, followed by flow cytometric analysis. [3H]Thymidine incorporation assays, Western blot analyses, immunoprecipitation and in vitro kinase assays for cyclin-dependent kinase (CDK) and cell division cycle (CDC)2 were conducted. The percentages of cells in the G1 and G2/M phases were dose-dependently increased and the percentages of cells in S phase were reduced within 12 h in DIM-treated cells. DIM also reduced DNA synthesis in a dose-dependent fashion. DIM markedly reduced CDK2 activity and the levels of phosphorylated retinoblastoma proteins (Rb) and E2F-1, and also increased the levels of hypophosphorylated Rb. DIM reduced the protein levels of cyclin A, D1, and CDK4. DIM also increased the protein levels of CDK inhibitors, p21CIP1/WAF1 and p27KIPI. In addition, DIM reduced the activity of CDC2 and the levels of CDC25C phosphatase and cyclin B1. Here, we have demonstrated that DIM induces G1 and G2/M phase cell cycle arrest in HT-29 cells, and this effect may be mediated by reduced CDK activity.

  11. Terpenoids from Curcuma wenyujin increased glucose consumption on HepG2 cells.

    PubMed

    Zhou, Chang-Xin; Zhang, Li-Sha; Chen, Fei-Fei; Wu, Hao-Shu; Mo, Jian-Xia; Gan, Li-She

    2017-09-01

    Thirty four terpenoids, including two new cadinane-type sesquiterpenoids containing conjugated aromatic-ketone moieties, curcujinone A (1) and curcujinone B (2), were isolated from 95% ethanol extract of the root tubers of Curcuma wenyujin. Their structures were determined by spectroscopic methods, especially 2D NMR and HRMS techniques. The relative and absolute configurations of 1 and 2 were identified by quantum chemical DFT and TDDFT calculations of the 13 C NMR chemical shifts, ECD spectra, and specific optical rotations. All compounds and extracts were evaluated for their anti-diabetic activities with a glucose consumption model on HepG2 Cells. The petroleum fraction CWP (10μg/mL) and compounds curcumenol (4), 7α,11α-epoxy-5β-hydroxy-9-guaiaen-8-one (5), curdione (17), (1S, 4S, 5S 10S)-germacrone (18), zederone (20), a mixture of curcumanolide A (25) and curcumanolide B (26), gajutsulactone B (27), and wenyujinin C (30) showed promising activities with over 45% increasing of glucose consumption at 10μM. Copyright © 2017. Published by Elsevier B.V.

  12. Towards a Standardized Line List for G 191-B2B and other DA Type Objects

    NASA Astrophysics Data System (ADS)

    Preval, S. P.; Barstow, M. A.; Holberg, J. B.; Dickinson, N. J.

    2013-01-01

    We present a comprehensive analysis of the far UV spectrum of G 191-B2B over the range of 900-1700Å using co-added data from the FUSE and STIS archives. While previous identifications made by Holberg et al. (2003) are reaffirmed in this work, it is found that many previously unidentified lines can now be attributed to Fe, Ni, and a few lighter metals. Future work includes extending this detailed analysis to a wider range of DA objects, in the expectation that a more complete analysis of their atmospheres can be realised.

  13. UPSS and G2

    NASA Technical Reports Server (NTRS)

    Dito, Scott J.

    2014-01-01

    The Universal Propellant Servicing System (UPSS) is a dedicated mobile launcher propellant delivery method that will minimize danger and complexity in order to allow vehicles to be serviced and ultimately launched from a variety of locations previously not seen fit for space launch. The UPPS/G2 project is the development of a model, simulation, and ultimately a working application that will control and monitor the cryogenic fluid delivery to the rocket for testing purposes. To accomplish this, the project is using the programming language/environment Gensym G2. The environment is an all-inclusive application that allows development, testing, modeling, and finally operation of the unique application through graphical and programmatic methods. We have learned G2 through classes and trial-and-error, and are now in the process of building the application that will soon be able to be tested on apparatuses here at Kennedy Space Center, and eventually on the actual unit. The UPSS will bring near-autonomous control of launches to those that need it, as well it will be a great addition to NASA and KSC's operational viability and the opportunity to bring space launches to parts of the world, and in time constraints, once not thought possible.

  14. Differential Ubiquitin Binding by the Acidic Loops of Ube2g1 and Ube2r1 Enzymes Distinguishes Their Lys-48-ubiquitylation Activities*

    PubMed Central

    Choi, Yun-Seok; Lee, Yun-Ju; Lee, Seo-Yeon; Shi, Lei; Ha, Jung-Hye; Cheong, Hae-Kap; Cheong, Chaejoon; Cohen, Robert E.; Ryu, Kyoung-Seok

    2015-01-01

    The ubiquitin E2 enzymes, Ube2g1 and Ube2r1, are able to synthesize Lys-48-linked polyubiquitins without an E3 ligase but how that is accomplished has been unclear. Although both E2s contain essential acidic loops, only Ube2r1 requires an additional C-terminal extension (184–196) for efficient Lys-48-ubiquitylation activity. The presence of Tyr-102 and Tyr-104 in the Ube2g1 acidic loop enhanced both ubiquitin binding and Lys-48-ubiquitylation and distinguished Ube2g1 from the otherwise similar truncated Ube2r11–183 (Ube2r1C). Replacement of Gln-105–Ser-106–Gly-107 in the acidic loop of Ube2r1C (Ube2r1CYGY) by the corresponding residues from Ube2g1 (Tyr-102–Gly-103–Tyr-104) increased Lys-48-ubiquitylation activity and ubiquitin binding. Two E2∼UB thioester mimics (oxyester and disulfide) were prepared to characterize the ubiquitin binding activity of the acidic loop. The oxyester but not the disulfide derivative was found to be a functional equivalent of the E2∼UB thioester. The ubiquitin moiety of the Ube2r1CC93S-[15N]UBK48R oxyester displayed two-state conformational exchange, whereas the Ube2r1CC93S/YGY-[15N]UBK48R oxyester showed predominantly one state. Together with NMR studies that compared UBK48R oxyesters of the wild-type and the acidic loop mutant (Y102G/Y104G) forms of Ube2g1, in vitro ubiquitylation assays with various mutation forms of the E2s revealed how the intramolecular interaction between the acidic loop and the attached donor ubiquitin regulates Lys-48-ubiquitylation activity. PMID:25471371

  15. Intensity measurements for the /2, O/ gamma-band of O2, b 1Sigma-g/+/ - X 3Sigma-g/-/

    NASA Technical Reports Server (NTRS)

    Miller, J. H.; Giver, L. P.; Boese, R. W.

    1976-01-01

    Line intensities for the P sub P and P sub Q branches of the (2-O) vibrational band of the magnetic dipole electronic transition for the oxygen red system at 6280 A were measured, and the sum of the R sub R and R sub Q branch intensities was taken. A large number of repetitive spectral scans were required for accuracy, because of low absorption values even at optical path lengths from 300 to 600 m. A total of 557 individual measurements of P-branch lines yielded an intensity value for the P-branches, and equivalent widths for 24 spectral scans yielded an intensity value for the R-branch. R-branch to P-branch intensity ratios were taken for the A-band, B-band, and gamma-band (respectively, O-O at 7620 A, 1-O at 6880 A, and 2-O at 6280 A). Intensities for some rotational lines are found, and effects of combined rotation-vibration interaction are probed.

  16. Muon g-2

    Science.gov Websites

    Related Links A Key Contribution from Brookhaven Laboratory The Big Move Muon Department Facebook g-2 on is filled with an invisible sea of virtual particles that -in accordance with the laws of quantum presence and nature of these virtual particles with particle beams traveling in a magnetic field. The Muon

  17. Effect of Cu(2+)-complexation on the scavenging ability of chrysin towards photogenerated singlet molecular oxygen (O2((1g)). Possible biological implications.

    PubMed

    Muñoz, Vanesa A; Ferrari, Gabriela V; Montaña, M Paulina; Miskoski, Sandra; García, Norman A

    2016-09-01

    Visible-light irradiation of aqueous-ethanolic solutions of Riboflavin (Rf) in the individual presence of the flavone chrysin (Chr) and its complex with Cu(2+) ([Chr2Cu]; 2:1 L:M) generates singlet molecular oxygen O2((1g), that concomitantly interact with both flavone derivatives. Overall (kt) and reactive (kr) rate constants in the order of 10(7)M(-1)s(-1) were determined for the process. Metal chelation greatly enhances the scavenging ability of [Chr2Cu] towards O2((1g) through a mechanism dominated, in >80%, by the physical component. In this way, practically all O2((1g) is deactivated by the complex without significant loss of the quencher. The isolated flavone quenches O2((1g) in a prevailing reactive fashion. The very low value exhibited by [Chr2Cu] for the kr/kt ratio constitutes a positive quality for antioxidative protectors in biological media, where elevated local concentration and high reactivity of significant molecules make them initial targets for O2((1g) aggression. Finally, two interesting properties in the field of free radicals scavenging by [Chr2Cu] must be mentioned. In first place metal chelation itself, in the obvious sense of free metal ion withdrawal from the oxidizable medium, prevents the initiation of a free radical-mediated oxidation processes through mechanisms of Fenton or lipid peroxidation. In addition, the incorporation of Cu adds to [Chr2Cu] the ability of a free radical scavenger, already described for similar Cu-chelate compounds. This collection of beneficial properties positions the complex as a remarkably promising bioprotector towards ROS-mediated oxidation. A quantification of the efficiency on the initial anti-oxidative effect exerted by Chr and [Chr2Cu] towards tryptophan was carried out. The amino acid is an archetypal molecular model, commonly employed to monitor oxidative degradation of proteinaceous media. It was efficiently photoprotected against O2((1g)-mediated photooxidation by [Chr2Cu

  18. Genotype and environment effects on the contents of vitamins B1, B2, B3, and B6 in wheat grain.

    PubMed

    Shewry, Peter R; Van Schaik, Frank; Ravel, Catherine; Charmet, Gilles; Rakszegi, Mariann; Bedo, Zoltan; Ward, Jane L

    2011-10-12

    The total contents of thiamine (vitamin B1), riboflavin (B2), and pyridoxine (B6) and the bioavailable forms of niacin (B3) were determined on wholemeal flours of 24 winter wheat varieties grown on four sites (United Kingdom, Poland, France, and Hungary) in 2007 and of two spring varieties grown on the same sites with the exception of Poland. The contents of vitamins B1 (5.53-13.55 μg/g dw), B2 (0.77-1.40 μg/g dw), and B6 (1.27-2.97 μg/g dw) were within the ranges reported previously, while the content of bioavailable vitamin B3 (0.16-1.74 μg/g dw) was about 10-15% of the total contents of vitamin B3 reported in previous studies. Strong correlations were observed between the contents of vitamins B1, B3, and B6, and partitioning of the variance in the contents of these three B vitamins showed that between 48 and 70% was accounted for by the environment. By contrast, the content of vitamin B2 was not correlated with the contents of other B vitamins, and 73% of the variance was ascribed to the error term, which suggests that this trait may be influenced by genotype × environment interactions. Whereas the contents of vitamins B1, B3, and B6 were correlated positively with the mean temperature from heading to harvest (r > 0.8), the content of vitamin B2 was positively correlated with precipitation during the 3 months prior to heading. These results are discussed in relation to the development of new wheat varieties with enhanced health benefits.

  19. Regeneration of eye tissues is modulated by altered levels of gravity at 1g, 2g, and in microgravity during spaceflight

    NASA Astrophysics Data System (ADS)

    Grigoryan, Eleonora; Almeida, Eduardo; Mitashov, Victor

    The pursuit of human space exploration requires detailed knowledge of microgravity-related changes in fundamental biological processes, and their effects on health. Normal regeneration of organs and tissues is one such fundamental process that allows maintenance of vitality and function of living organisms. Animal models of tissue regeneration include the newt (Pleurodeles waltl, Urodela) eye, which has been extensively used by our team in Russian Bion and Foton microgravity experiments since 1985, and in recent NASA 2.5 meter diameter centrifuge hypergravity experiments. In total, these experiments allow us to draw several broad conclusions: Newt lens regeneration is significantly altered in microgravity and hypergravity relative to 1g controls. Lenses formed in microgravity are larger and more developed than those regenerated in 1g controls; Microgravity alterations of lens regeneration can persist after spaceflight, and continue to affect repeated removal and regeneration of the lens after return to 1g; Microgravity increases the numbers of early stage regenerative proliferating BrdU-labeled cells in dorsal iris progenitors and in the lens regenerate. Regeneration under hypergravity conditions at 2g inhibits lens regeneration, and often causes retinal detachment. Molecular mechanisms regulating lens regeneration rate include FGF2 signaling, (a key pathway for eye tissue development and regeneration), and an expression of stress-related proteins - HSPs. In conclusion, regeneration of lens and other eye tissues in the newt is sensitive to, and regulated by the level of gravity mechanotransduction and developmental signaling pathways, with microgravity favoring stem cell progenitor proliferation, and gravity at 1g promoting terminal differentiation, while hypergravity at 2g often causes damage of delicate regenerating tissues.

  20. Analysis of canine herpesvirus gB, gC and gD expressed by a recombinant vaccinia virus.

    PubMed

    Xuan, X; Kojima, A; Murata, T; Mikami, T; Otsuka, H

    1997-01-01

    The genes encoding the canine herpesvirus (CHV) glycoprotein B (gB), gC and gD homologues have been reported already. However, products of these genes have not been identified yet. Previously, we have identified three CHV glycoproteins, gp 145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gB, gC or gD, the putative genes of gB, gC, and gD of CHV were inserted into the thymidine kinase gene of vaccinia virus LC16mO strain under the control of the early-late promoter for the vaccinia virus 7.5-kilodalton polypeptide. We demonstrated here that gp145/112, gp80 and gp47 were the translation products of the CHV gB, gC and gD genes, respectively. The antigenic authenticity of recombinant gB, gC and gD were confirmed by a panel of MAbs specific for each glycoprotein produced in CHV-infected cells. Immunization of mice with these recombinants produced high titers of neutralizing antibodies against CHV. These results suggest that recombinant vaccinia viruses expressing CHV gB, gC and gD may be useful to develop a vaccine to control CHV infection.

  1. G{sub 2}-MSSM: An M theory motivated model of particle physics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Acharya, Bobby S.; Bobkov, Konstantin; Kane, Gordon L.

    2008-09-15

    We continue our study of the low energy implications of M theory vacua on G{sub 2}-manifolds, undertaken in B. S. Acharya, K. Bobkov, G. L. Kane, P. Kumar, and J. Shao, Phys. Rev. D 76, 126010 (2007); B. Acharya, K. Bobkov, G. Kane, P. Kumar, and D. Vaman, Phys. Rev. Lett. 97, 191601 (2006), where it was shown that the moduli can be stabilized and a TeV scale generated, with the Planck scale as the only dimensionful input. A well-motivated phenomenological model, the G{sub 2}-MSSM, can be naturally defined within the above framework. In this paper, we study some ofmore » the important phenomenological features of the G{sub 2}-MSSM. In particular, the soft supersymmetry breaking parameters and the superpartner spectrum are computed. The G{sub 2}-MSSM generically gives rise to light gauginos and heavy scalars with wino lightest supersymmetric particles when one tunes the cosmological constant. Electroweak symmetry breaking is present but fine-tuned. The G{sub 2}-MSSM is also naturally consistent with precision gauge coupling unification. The phenomenological consequences for cosmology and collider physics of the G{sub 2}-MSSM will be reported in more detail soon.« less

  2. Excited singlet molecular O2 (1Δg) is generated enzymatically from excited carbonyls in the dark

    PubMed Central

    Mano, Camila M.; Prado, Fernanda M.; Massari, Júlio; Ronsein, Graziella E.; Martinez, Glaucia R.; Miyamoto, Sayuri; Cadet, Jean; Sies, Helmut; Medeiros, Marisa H. G.; Bechara, Etelvino J. H.; Di Mascio, Paolo

    2014-01-01

    In mammalian tissues, ultraweak chemiluminescence arising from biomolecule oxidation has been attributed to the radiative deactivation of singlet molecular oxygen [O2 (1Δg)] and electronically excited triplet carbonyl products involving dioxetane intermediates. Herein, we describe evidence of the generation of O2 (1Δg) in aqueous solution via energy transfer from excited triplet acetone. This involves thermolysis of 3,3,4,4-tetramethyl-1,2-dioxetane, a chemical source, and horseradish peroxidase-catalyzed oxidation of 2-methylpropanal, as an enzymatic source. Both sources of excited carbonyls showed characteristic light emission at 1,270 nm, directly indicative of the monomolecular decay of O2 (1Δg). Indirect analysis of O2 (1Δg) by electron paramagnetic resonance using the chemical trap 2,2,6,6-tetramethylpiperidine showed the formation of 2,2,6,6-tetramethylpiperidine-1-oxyl. Using [18O]-labeled triplet, ground state molecular oxygen [18O2 (3Σg-)], chemical trapping of 18O2 (1Δg) with disodium salt of anthracene-9,10-diyldiethane-2,1-diyl disulfate yielding the corresponding double-[18O]-labeled 9,10-endoperoxide, was detected through mass spectrometry. This corroborates formation of O2 (1Δg). Altogether, photoemission and chemical trapping studies clearly demonstrate that chemically and enzymatically nascent excited carbonyl generates 18O2 (1Δg) by triplet-triplet energy transfer to ground state oxygen O2 (3Σg−), and supports the long formulated hypothesis of O2 (1Δg) involvement in physiological and pathophysiological events that might take place in tissues in the absence of light. PMID:25087485

  3. Cyclin B Proteolysis and the Cyclin-dependent Kinase Inhibitor rum1p Are Required for Pheromone-induced G1 Arrest in Fission Yeast

    PubMed Central

    Stern, Bodo; Nurse, Paul

    1998-01-01

    The blocking of G1 progression by fission yeast pheromones requires inhibition of the cyclin-dependent kinase cdc2p associated with the B-cyclins cdc13p and cig2p. We show that cyclosome-mediated degradation of cdc13p and cig2p is necessary for down-regulation of B-cyclin–associated cdc2p kinase activity and for phermone-induced G1 arrest. The cyclin-dependent kinase inhibitor rum1p is also required to maintain this G1 arrest; it binds both cdc13p and cig2p and is specifically required for cdc13p proteolysis. We propose that rum1p acts as an adaptor targeting cdc13p for degradation by the cyclosome. In contrast, the cig2p–cdc2p kinase can be down-regulated, and the cyclin cig2p can be proteolyzed independently of rum1p. We suggest that pheromone signaling inhibits the cig2p–cdc2p kinase, bringing about a transient G1 arrest. As a consequence, rum1p levels increase, thus inhibiting and inducing proteolysis of the cdc13p–cdc2p kinase; this is necessary to maintain G1 arrest. We have also shown that pheromone-induced transcription occurs only in G1 and is independent of rum1p. PMID:9614176

  4. Measurement of the Proton Spin Structure Function g1(x,Q2) for Q2 from 0.15 to 1.6 GeV2 with CLAS

    NASA Astrophysics Data System (ADS)

    Fatemi, R.; Skabelin, A. V.; Burkert, V. D.; Crabb, D.; Vita, R. De; Kuhn, S. E.; Minehart, R.; Adams, G.; Anciant, E.; Anghinolfi, M.; Asavapibhop, B.; Audit, G.; Auger, T.; Avakian, H.; Bagdasaryan, H.; Ball, J. P.; Barrow, S.; Battaglieri, M.; Beard, K.; Bektasoglu, M.; Bellis, M.; Bertozzi, W.; Bianchi, N.; Biselli, A. S.; Boiarinov, S.; Bonner, B. E.; Bosted, P. E.; Bouchigny, S.; Bradford, R.; Branford, D.; Brooks, W. K.; Butuceanu, C.; Calarco, J. R.; Carman, D. S.; Carnahan, B.; Cetina, C.; Ciciani, L.; Clark, R.; Cole, P. L.; Coleman, A.; Connelly, J.; Cords, D.; Corvisiero, P.; Crannell, H.; Cummings, J. P.; de Sanctis, E.; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Dharmawardane, K. V.; Dhuga, K. S.; Djalali, C.; Dodge, G. E.; Doughty, D.; Dragovitsch, P.; Dugger, M.; Dytman, S.; Eckhause, M.; Egiyan, H.; Egiyan, K. S.; Elouadrhiri, L.; Empl, A.; Eugenio, P.; Farhi, L.; Feuerbach, R. J.; Freyberger, A.; Ficenec, J.; Forest, T. A.; Frolov, V.; Funsten, H.; Gaff, S. J.; Garçon, M.; Gavalian, G.; Gilad, S.; Gilfoyle, G. P.; Giovanetti, K. L.; Girard, P.; Gordon, C. I.; Griffioen, K. A.; Guidal, M.; Guillo, M.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hancock, D.; Hardie, J.; Heddle, D.; Heimberg, P.; Hersman, F. W.; Hicks, K.; Hicks, R. S.; Holtrop, M.; Hu, J.; Hyde-Wright, C. E.; Ilieva, Y.; Ito, M. M.; Jenkins, D.; Joo, K.; Keith, C.; Kelley, J. H.; Kellie, J. D.; Khandaker, M.; Kim, K. Y.; Kim, K.; Kim, W.; Klein, A.; Klein, F. J.; Klimenko, A. V.; Klusman, M.; Kossov, M.; Koubarovski, V.; Kramer, L. H.; Kuang, Y.; Kuhn, J.; Lachniet, J.; Laget, J. M.; Lawrence, D.; Li, Ji; Livingston, K.; Longhi, A.; Lukashin, K.; Major, W.; Manak, J. J.; Marchand, C.; McAleer, S.; McNabb, J. W.; Mecking, B. A.; Mehrabyan, S.; Mestayer, M. D.; Meyer, C. A.; Mikhailov, K.; Mirazita, M.; Miskimen, R.; Morand, L.; Morrow, S. A.; Muccifora, V.; Mueller, J.; Mutchler, G. S.; Napolitano, J.; Nasseripour, R.; Nelson, S. O.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niyazov, R. A.; Nozar, M.; O'Brien, J. T.; O'Rielly, G. V.; Osipenko, M.; Park, K.; Pasyuk, E.; Peterson, G.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Polli, E.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Prok, Y.; Protopopescu, D.; Qin, L. M.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Ritchie, B. G.; Rock, S. E.; Ronchetti, F.; Rossi, P.; Rowntree, D.; Rubin, P. D.; Sabatié, F.; Sabourov, K.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Sargsyan, M.; Schumacher, R. A.; Seely, M.; Serov, V. S.; Sharabian, Y. G.; Shaw, J.; Simionatto, S.; Smith, E. S.; Smith, T.; Smith, L. C.; Sober, D. I.; Sorrel, L.; Spraker, M.; Stavinsky, A.; Stepanyan, S.; Stoler, P.; Strauch, S.; Taiuti, M.; Taylor, S.; Tedeschi, D. J.; Thoma, U.; Thompson, R.; Todor, L.; Tur, C.; Ungaro, M.; Vineyard, M. F.; Vlassov, A. V.; Wang, K.; Weinstein, L. B.; Weller, H.; Weygand, D. P.; Whisnant, C. S.; Wolin, E.; Wood, M. H.; Yegneswaran, A.; Yun, J.; Zhang, B.; Zhao, J.; Zhou, Z.

    2003-11-01

    Double-polarization asymmetries for inclusive ep scattering were measured at Jefferson Lab using 2.6 and 4.3GeV longitudinally polarized electrons incident on a longitudinally polarized NH3 target in the CLAS detector. The polarized structure function g1(x,Q2) was extracted throughout the nucleon resonance region and into the deep inelastic regime, for Q2=0.15 1.64 GeV2. The contributions to the first moment Γ1(Q2)=∫g1(x,Q2) dx were determined up to Q2=1.2 GeV2. Using a parametrization for g1 in the unmeasured low x regions, the complete first moment was estimated over this Q2 region. A rapid change in Γ1 is observed for Q2<1 GeV2, with a sign change near Q2=0.3 GeV2, indicating dominant contributions from the resonance region. At Q2=1.2 GeV2 our data are below the perturbative QCD evolved scaling value.

  5. Effect of gemfibrozil on apolipoprotein B secretion and diacylglycerol acyltransferase activity in human hepatoblastoma (HepG2) cells.

    PubMed

    Zhu, Daming; Ganji, Shobha H; Kamanna, Vaijinath S; Kashyap, Moti L

    2002-10-01

    The mechanism of action of a widely used drug gemfibrozil to reduce triglycerides (TG) and apolipoprotein B (apo B) is incompletely understood. Using human hepatoblastoma (HepG2) cells, we examined the effect of gemfibrozil on apo B secretion and TG synthesis catalyzed by diacylglycerol acyltransferase (DGAT), primary processes associated with the secretion of LDL. Gemfibrozil significantly decreased apo B secretion by HepG2 cells. It decreased oleate-induced stimulation of apo B secretion, suggesting that gemfibrozil-mediated inhibition of apo B secretion may be dependent on the synthesis of TG catalyzed by DGAT. Pre-incubation of HepG2 cells with gemfibrozil (200-400 micromol/l for 48 h) significantly inhibited microsomal DGAT activity. When added directly to the DGAT assay system containing control microsomes, gemfibrozil significantly inhibited the activity of DGAT by 14-25%. Gemfibrozil (200-400 micromol/l) inhibited TG synthesis by 47-50% as measured by the incorporation of 3H-oleic acid into TG. The data indicate that gemfibrozil inhibits DGAT activity resulting in decreased synthesis of TG and its availability for apo B lipidation rendering it susceptible to intracellular apo B degradation leading to the decreased secretion. These in-vitro data suggest a novel additional mechanism by which gemfibrozil lowers plasma TG and atherogenic apo B lipoproteins in dyslipidemic patients.

  6. SH2 domain-containing inositol 5-phosphatase (SHIP2) regulates de-novo lipogenesis and secretion of apoB100 containing lipoproteins in HepG2 cells.

    PubMed

    Gorgani-Firuzjaee, Sattar; Khatami, Shohreh; Adeli, Khosrow; Meshkani, Reza

    2015-09-04

    Hepatic de-novo lipogenesis and production of triglyceride rich VLDL are regulated via the phosphoinositide 3-kinase cascade, however, the role of a negative regulator of this pathway, the SH2 domain-containing inositol 5-phosphatase (SHIP2) in this process, remains unknown. In the present study, we investigated the molecular link between SHIP2 expression and metabolic dyslipidemia using overexpression or suppression of SHIP2 gene in HepG2 cells. The results showed that overexpression of the wild type SHIP2 gene (SHIP2-WT) led to a higher total lipid content (28%) compared to control, whereas overexpression of the dominant negative SHIP2 gene (SHIP2-DN) reduced total lipid content in oleate treated cells by 40%. Overexpression of SHIP2-WT also led to a significant increase in both secretion of apoB100 containing lipoproteins and de-novo lipogenesis, as demonstrated by an enhancement in secreted apoB100 and MTP expression, increased intra and extracellular triglyceride levels and enhanced expression of lipogenic genes such as SREBP1c, FAS and ACC. On the other hand, overexpression of the SHIP2-DN gene prevented oleate-induced de-novo lipogenesis and secretion of apoB100 containing lipoproteins in HepG2 cells. Collectively, these findings suggest that SHIP2 expression level is a key determinant of hepatic lipogenesis and lipoprotein secretion, and its inhibition could be considered as a potential target for treatment of dyslipidemia. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Black soybean seed coat polyphenols prevent B(a)P-induced DNA damage through modulating drug-metabolizing enzymes in HepG2 cells and ICR mice.

    PubMed

    Zhang, Tianshun; Jiang, Songyan; He, Chao; Kimura, Yuki; Yamashita, Yoko; Ashida, Hitoshi

    2013-04-15

    Black soybean seed coat is a rich source of polyphenols that have been reported to have various physiological functions. The present study investigated the potential protective effects of polyphenolic extracts from black soybean seed coat on DNA damage in human hepatoma HepG2 cells and ICR mice. The results from micronucleus (MN) assay revealed that black soybean seed coat extract (BE) at concentrations up to 25μg/mL was non-genotoxic. It is noteworthy that BE (at 4.85μg/mL) and its main components, procyanidins (PCs) and cyanidin 3-glucoside (C3G), at 10μM significantly reduced the genotoxic effect induced by benzo[a]pyrene [B(a)P]. To obtain insights into the underlying mechanism, we investigated BE and its main components on drug-metabolizing enzyme expression. The results of this study demonstrate that BE and its main components, PCs and C3G, down-regulated B(a)P-induced cytochrome P4501A1 (CYP1A1) expression by inhibiting the transformation of aryl hydrocarbon receptor. Moreover, they increased expression of detoxifying defense enzymes, glutathione S-transferases (GSTs) via increasing the binding of nuclear factor-erythroid-2-related factor 2 to antioxidant response elements. Collectively, we found that PCs and C3G, which are the main active compounds of BE, down-regulated CYP1A1 and up-regulated GST expression to protect B(a)P-induced DNA damage in HepG2 cells and ICR mice effectively. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. The P-type ATPase CtpG preferentially transports Cd2+ across the Mycobacterium tuberculosis plasma membrane.

    PubMed

    López, Marcela; Quitian, Laudy-Viviana; Calderón, Martha-Nancy; Soto, Carlos-Y

    2018-04-01

    P 1B -type ATPases are involved in heavy metal transport across the plasma membrane. Some Mycobacterium tuberculosis P-type ATPases are induced during infection, suggesting that this type of transporter could play a critical role in mycobacterial survival. To date, the ion specificity of M. tuberculosis heavy metal-transporting P 1B -ATPases is not well understood. In this work, we observed that, although divalent heavy metal cations such as Cu 2+ , Co 2+ , Ni 2+ , Zn 2+ Cd 2+ and Pb 2+ stimulate the ATPase activity of the putative P 1B -type ATPase CtpG in the plasma membrane, whole cells of M. smegmatis expressing CtpG only tolerate high levels of Cd 2+ and Cu 2+ . As indicator of the catalytic constant, Michaelis-Menten kinetics showed that CtpG embedded in the mycobacterial cell membrane has a V max /K m ratio 7.4-fold higher for Cd 2+ than for Cu 2+ ions. Thus, although CtpG can accept different substrates in vitro, this P-type ATPase transports Cd 2+ more efficiently than other heavy metal cations across the mycobacterial plasma membrane.

  9. Fabrication of flower-like direct Z-scheme β-Bi2O3/g-C3N4 photocatalyst with enhanced visible light photoactivity for Rhodamine B degradation

    NASA Astrophysics Data System (ADS)

    Zhang, Liping; Wang, Guohong; Xiong, Zhenzhong; Tang, Hua; Jiang, Chuanjia

    2018-04-01

    A combined hydrothermal-calcination approach is developed to synthesize hierarchical β-Bi2O3/g-C3N4 direct Z-scheme photocatalyst with enhanced visible light photoactivity for Rhodamine B (RhB) degradation. First, Bi2O2CO3 microflowers were hydrothermally prepared using Bi(NO3)3·5H2O as feedstocks, and then a series of β-Bi2O3/g-C3N4 direct Z-scheme photocatalysts were synthesized via a facile calcination method using Bi2O2CO3 and g-C3N4 as precursors. The samples were systematically characterized by various characterization technologies including X-ray diffraction, scanning and transmission electron microscopes, Fourier transform infrared spectroscopy and N2 absorption-desorption equipment. It was found that the g-C3N4 content in the precursors played a key role in affecting the photocatalytic activity of the final products. The β-Bi2O3/g-C3N4 heterojunction exhibited higher photocatalytic activity than single active components (β-Bi2O3 and g-C3N4), indicating the presence of a synergistic effect between two active components in β-Bi2O3/g-C3N4 heterojunction. Among all as-prepared catalysts, the 70 wt.% g-C3N4/Bi2O2CO3 exhibits the highest activity for RhB degradation, and the apparent reaction rate constant k (42.2 × 10-3 min-1) is 3.1 and 1.7 times as high as that of pure β-Bi2O3 (13.5 × 10-3 min-1) and g-C3N4 (25.2 × 10-3 min-1), respectively. The enhanced photocatalytic performance of β-Bi2O3/g-C3N4 heterostructure photocatalysts is mainly due to the high surface area, closely contacted interfaces between the β-Bi2O3 and g-C3N4 component, and the formation of direct Z-scheme structure in the β-Bi2O3/g-C3N4 composites.

  10. Two zebrafish G2A homologs activate multiple intracellular signaling pathways in acidic environment.

    PubMed

    Ichijo, Yuta; Mochimaru, Yuta; Azuma, Morio; Satou, Kazuhiro; Negishi, Jun; Nakakura, Takashi; Oshima, Natsuki; Mogi, Chihiro; Sato, Koichi; Matsuda, Kouhei; Okajima, Fumikazu; Tomura, Hideaki

    2016-01-01

    Human G2A is activated by various stimuli such as lysophosphatidylcholine (LPC), 9-hydroxyoctadecadienoic acid (9-HODE), and protons. The receptor is coupled to multiple intracellular signaling pathways, including the Gs-protein/cAMP/CRE, G12/13-protein/Rho/SRE, and Gq-protein/phospholipase C/NFAT pathways. In the present study, we examined whether zebrafish G2A homologs (zG2A-a and zG2A-b) could respond to these stimuli and activate multiple intracellular signaling pathways. We also examined whether histidine residue and basic amino acid residue in the N-terminus of the homologs also play roles similar to those played by human G2A residues if the homologs sense protons. We found that the zG2A-a showed the high CRE, SRE, and NFAT activities, however, zG2A-b showed only the high SRE activity under a pH of 8.0. Extracellular acidification from pH 7.4 to 6.3 ameliorated these activities in zG2A-a-expressing cells. On the other hand, acidification ameliorated the SRE activity but not the CRE and NFAT activities in zG2A-b-expressing cells. LPC or 9-HODE did not modify any activity of either homolog. The substitution of histidine residue at the 174(th) position from the N-terminus of zG2A-a to asparagine residue attenuated proton-induced CRE and NFAT activities but not SRE activity. The substitution of arginine residue at the 32nd position from the N-terminus of zG2A-a to the alanine residue also attenuated its high and the proton-induced CRE and NFAT activities. On the contrary, the substitution did not attenuate SRE activity. The substitution of the arginine residue at the 10th position from the N-terminus of zG2A-b to the alanine residue also did not attenuate its high or the proton-induced SRE activity. These results indicate that zebrafish G2A homologs were activated by protons but not by LPC and 9-HODE, and the activation mechanisms of the homologs were similar to those of human G2A. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. In vitro synthesis and processing of herpes simplex virus type 2 gG-2, using cell-free transcription and translation systems.

    PubMed Central

    Weldon, S K; Su, H K; Fetherston, J D; Courtney, R J

    1990-01-01

    Translation of in vitro-synthesized herpes simplex virus type 2 (HSV-2) gG-2 mRNA in a reticulocyte lysate system was used to study the processing of HSV-2 gG-2. In the presence of canine pancreatic microsomal membranes, a single species that is protected from trypsin digestion was detected. This product comigrates with the 104,000-Mr (104K) high mannose intermediate seen in HSV-2-infected-cell lysates. Endo-beta-N-acetylglucosaminidase H treatment of the in vitro-synthesized 104K protein yielded a single product migrating at 100 K. The 72K and 31K cleavage products of gG-2 were not observed in the in vitro system. These data show that the molecular weight of the nonglycosylated form of the gG-2 protein is 100,000 and that the cotranslational processing of this protein in the endoplasmic reticulum yields the 104K high-mannose intermediate. Images PMID:2154614

  12. Effects of dietary CLA supplementation, parity and different concentrate levels before calving on immunoglobulin G1, G2 and M concentrations in dairy cows.

    PubMed

    Eger, Melanie; Horn, Jana; Hussen, Jamal; Schuberth, Hans-Joachim; Scharf, Maria; Meyer, Ulrich; Dänicke, Sven; Bostedt, Hartwig; Breves, Gerhard

    2017-10-01

    Peripartal dairy cows exhibit a higher susceptibility for infectious diseases, which might be linked to the negative energy balance occurring at the onset of lactation. A dietary supplementation of conjugated linoleic acids (CLA) may reduce milk fat yield and subsequently lower the energy deficit. The utilization of immunoglobulins (Ig) for colostrogenesis might impair humoral immunity in peripartal dairy cows; therefore this study investigated the effects of a CLA supplement, parity and different dietary energy levels on plasma and colostrum IgG1, IgG2 and IgM levels in dairy cows and their calves. Blood samples were collected from 64 cows from 21days before until 56days after parturition and colostrum samples for the first 3days of lactation. Plasma immunoglobulin concentrations of 19 calves were determined before colostrum uptake. Neither plasma IgG1, nor IgG2 levels were affected by CLA or dietary energy level. However, immunoglobulin levels were affected by parity. Heifers possessed the lowest IgG1 concentrations. IgG2 concentrations were highest in cows with 2 lactations prior to parturition and in heifers after parturition. Plasma IgM levels were characterized by a sharp decrease 3days prior to parturition and were scarcely affected by the feeding regimen or parity. Generally, immunoglobulin levels appear to be mostly independent from the peripartal energy balance of the cows and are not influenced by dietary CLA. However, pronounced differences among parities for IgG1 and IgG2 were revealed which should be further evaluated. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

    PubMed

    Frøystein, N A; Sletten, E

    1991-03-01

    The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

  14. Contribution of ethanol-tolerant xylanase G2 from Aspergillus oryzae on Japanese sake brewing.

    PubMed

    Sato, Yuichiro; Fukuda, Hisashi; Zhou, Yan; Mikami, Shigeaki

    2010-12-01

    We purified three xylanase isozymes (XynF1, XynF3 and XynG2) from a solid-state Aspergillus oryzae RIB128 culture using chromatography. The results of our sake-brewing experiment, in which we used exogenously supplemented enzymes, revealed that only XynG2 improved the alcohol yield and the material utilization. The alcohol yield of the XynG2 batch displayed an increase of 4.4% in comparison to the control, and the amount of sake cake decreased by 4.6%. The contribution of XynG2 was further confirmed through our brewing experiment in which we used the yeast heterogeneously expressing fungal xylanase isozymes. Interestingly XynG1, an enzyme with a XynG2-like sequence that is more vulnerable to ethanol, did not improve the sake-mash fermentation. The stability of XynG2 in ethanol was prominent, and it retained most of its original activity after we exposed it to 80% ethanol for 30min, whereas the stability of the other isozymes in ethanol, including XynG1, was much lower (20-25% ethanol). We concluded, therefore, that the improvement of material utilization achieved with XynG2 is primarily attributable to its characteristically high stability in ethanol, thereby, effectively degrading rice endosperm cell walls under high-alcohol conditions such as a sake-mash environment. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Can the BMS Algorithm Decode Up to \\lfloor \\frac{d_G-g-1}{2}\\rfloor Errors? Yes, but with Some Additional Remarks

    NASA Astrophysics Data System (ADS)

    Sakata, Shojiro; Fujisawa, Masaya

    It is a well-known fact [7], [9] that the BMS algorithm with majority voting can decode up to half the Feng-Rao designed distance dFR. Since dFR is not smaller than the Goppa designed distance dG, that algorithm can correct up to \\lfloor \\frac{d_G-1}{2}\\rfloor errors. On the other hand, it has been considered to be evident that the original BMS algorithm (without voting) [1], [2] can correct up to \\lfloor \\frac{d_G-g-1}{2}\\rfloor errors similarly to the basic algorithm by Skorobogatov-Vladut. But, is it true? In this short paper, we show that it is true, although we need a few remarks and some additional procedures for determining the Groebner basis of the error locator ideal exactly. In fact, as the basic algorithm gives a set of polynomials whose zero set contains the error locators as a subset, it cannot always give the exact error locators, unless the syndrome equation is solved to find the error values in addition.

  16. Aryl hydrocarbon receptor activation and CYP1A induction by cooked food-derived carcinogenic heterocyclic amines in human HepG2 cell lines.

    PubMed

    Sekimoto, Masashi; Sumi, Haruna; Hosaka, Takuomi; Umemura, Takashi; Nishikawa, Akiyoshi; Degawa, Masakuni

    2016-11-01

    The ability of nine cooked food-derived heterocyclic aromatic amines (HCAs), such as 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1), 3-amino-1-methyl-5H-pyrido[4,3-b]indole (Trp-P-2), 2-amino-6-methylpyrido[12-a:3',2'-d]imidazole (Glu-P-1), 2-amino-pyrido[12-a:3',2'-d]imidazole hydrochloride (Glu-P-2), 2-amino-9H-pyrido[2,3-b]indole (AαC), 2-amino-3-methyl-9H-pyrido[2,3-b]indole (MeAαC), 2-amino-3-methylimidazo[4,5-f]quinolone (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) and 2-amino-1-methyl-6-phenyl-1H-imidazo[4,5-b]pyridine (PhIP), to activate human aryl hydrocarbon receptor (hAhR) was examined using a HepG2-A10 cell line, which has previously established from human hepatocarcinoma-derived HepG2 cells for use in hAhR-based luciferase reporter gene assays. Trp-P-1, Trp-P-2, AαC, MeAαC, IQ and MeIQx showed a definite ability to induce not only luciferase (hAhR activation) in HepG2-A10 cells but also cytochrome P450 (CYP)1A1/1A2 mRNAs in HepG2 cells, while such the ability of Glu-P-1, Glu-P-2, and PhIP was very low. In addition, all the HCAs examined, especially MeAαC and MeIQx, had a definite capacity for inhibiting the activity of ethoxyresorfin O-deethylase (CYP1As, especially CYP1A1). The present findings demonstrate that all the HCAs examined have the ability to activate hAhR and its target genes, and further confirm that these HCAs become good substrates for human CYP1A subfamily enzyme(s). Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Sterigmatocystin induces G1 arrest in primary human esophageal epithelial cells but induces G2 arrest in immortalized cells: key mechanistic differences in these two models.

    PubMed

    Wang, Juan; Huang, Shujuan; Xing, Lingxiao; Cui, Jinfeng; Tian, Ziqiang; Shen, Haitao; Jiang, Xiujuan; Yan, Xia; Wang, Junling; Zhang, Xianghong

    2015-11-01

    Sterigmatocystin (ST), a mycotoxin commonly found in food and feed commodities, has been classified as a "possible human carcinogen." Our previous studies suggested that ST exposure might be a risk factor for esophageal cancer and that ST may induce DNA damage and G2 phase arrest in immortalized human esophageal epithelial cells (Het-1A). To further confirm and explore the cellular responses of ST in human esophageal epithelia, we comparatively evaluated DNA damage, cell cycle distribution and the relative mechanisms in primary cultured human esophageal epithelial cells (EPC), which represent a more representative model of the in vivo state, and Het-1A cells. In this study, we found that ST could induce DNA damage in both EPC and Het-1A cells but led to G1 phase arrest in EPC cells and G2 phase arrest in Het-1A cells. Furthermore, our results indicated that the activation of the ATM-Chk2 pathway was involved in ST-induced G1 phase arrest in EPC cells, whereas the p53-p21 pathway activation in ST-induced G2 phase arrest in Het-1A cells. Studies have demonstrated that SV40 large T-antigen (SV40LT) may disturb cell cycle progression by inactivating some of the proteins involved in the G1/S checkpoint. Het-1A is a non-cancerous epithelial cell line immortalized by SV40LT. To evaluate the possible perturbation effect of SV40LT on ST-induced cell cycle disturbance in Het-1A cells, we knocked down SV40LT of Het-1A cells with siRNA and found that under this condition, ST-induced G2 arrest was significantly attenuated, whereas the proportion of cells in the G1 phase was significantly increased. Furthermore, SV40LT-siRNA also inhibited the activation of the p53-p21 signaling pathway induced by ST. In conclusion, our data indicated that ST could induce DNA damage in both primary cultured and immortalized esophageal epithelial cells. In primary human esophageal epithelial cells, ST induced DNA damage and then triggered the ATM-Chk2 pathway, resulting in G1 phase arrest

  18. PAI-1 4G/5G polymorphism contributes to cancer susceptibility: evidence from meta-analysis.

    PubMed

    Wang, Shangqian; Cao, Qiang; Wang, Xiaoxiang; Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I(2) test. Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03-1.18, I(2) = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06-1.39, I(2) = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04-1.18, I(2) = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09-1.59, I(2) = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04-1.21, I(2) = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05-1.21, I(2) = 25.3%). The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer.

  19. Preparation of three-dimensional macroporous chitosan-gelatin B microspheres and HepG2-cell culture.

    PubMed

    Huang, Fang; Cui, Long; Peng, Cheng-Hong; Wu, Xu-Bo; Han, Bao-San; Dong, Ya-Dong

    2016-12-01

    Chitosan-gelatin B microspheres with an open, interconnected, highly macroporous (100-200 µm) structure were prepared via a three-step protocol combining freeze-drying with an electrostatic and ionic cross-linking method. Saturated tripolyphosphate ethanol solution (85% ethanol) was chosen as the crosslinking agent to prevent destruction of the porous structure and to improve the biostability of the chitosan-gelatin B microspheres, with N-(3-dimethylaminopropyl)-N'-ethyl-carbodiimide/N-hydroxysuccinimide as a second crosslinking agent to react with gelatin A and fixed chitosan-gelatin B microspheres to attain improved biocompatibility. Water absorption of the three-dimensional macroporous chitosan-gelatin B microspheres (3D-P-CGMs) was 12.84, with a porosity of 85.45%. In vitro lysozyme degradation after 1, 3, 5, 7, 10, 14, and 21 days showed improved biodegradation in the 3D-P-CGMs. The morphology of human hepatoma cell lines (HepG2 cells) cultured on the 3D-P-CGMs was spherical, unlike that of cells cultured under traditional two-dimensional conditions. Scanning electron microscopy and paraffin sections were used to confirm the porous structure of the 3D-P-CGMs. HepG2 cells were able to migrate inside through the pore. Cell proliferation and levels of albumin and lactate dehydrogenase suggested that the 3D-P-CGMs could provide a larger specific surface area and an appropriate microenvironment for cell growth and survival. Hence, the 3D-P-CGMs are eminently suitable as macroporous scaffolds for cell cultures in tissue engineering and cell carrier studies. Copyright © 2014 John Wiley & Sons, Ltd. Copyright © 2014 John Wiley & Sons, Ltd.

  20. VizieR Online Data Catalog: NLTE spectral analysis of white dwarf G191-B2B (Rauch+, 2013)

    NASA Astrophysics Data System (ADS)

    Rauch, T.; Werner, K.; Bohlin, R.; Kruk, J. W.

    2013-08-01

    In the framework of the Virtual Observatory, the German Astrophysical Virtual Observatory developed the registered service TheoSSA. It provides easy access to stellar spectral energy distributions (SEDs) and is intended to ingest SEDs calculated by any model-atmosphere code. In case of the DA white dwarf G191-B2B, we demonstrate that the model reproduces not only its overall continuum shape but also the numerous metal lines exhibited in its ultraviolet spectrum. (3 data files).

  1. 76 FR 6629 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-07

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Forms 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of Homeland...

  2. Expression of progesterone receptor B is associated with G0/G1 arrest of the cell cycle and growth inhibition in NIH3T3 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Horiuchi, Shinji; Kato, Kiyoko; Suga, Shin

    2005-05-01

    Previously, we found a significant reduction of progesterone receptor B (PR-B) expression levels in the Ras-mediated NIH3T3 cell transformation, and re-expression of exogenous PR-B eliminated the tumorigenic potential. We hypothesized that this reduction is of biological significance in cell transformation. In the present study, we determined the correlation between PR-B expression and cell cycle progression. In synchronized NIH3T3 cells, we found an increase in PR-B protein and p27 CDK inhibitor levels in the G0/G1 phase and a reduction due to redistribution in the S and G2/M phases. The MEK inhibitor or cAMP stimulation arrested NIH3T3 cells in the G0/G1 phasemore » of the cell cycle. The expression of PR-B and p27 CDK inhibitors was up-regulated by treatment with both the MEK inhibitor and cAMP. Treatment of synchronized cells with a PKA inhibitor in the presence of 1% calf serum resulted in a significant reduction in both PR-B and p27 levels. The decrease in the PR-B levels caused by anti-sense oligomers or siRNA corresponded to the reduction in p27 levels. PR-B overexpression by adenovirus infection induced p27 and suppressed cell growth. Finally, we showed that PR-B modulation involved in the regulation of NIH3T3 cell proliferation was independent of nuclear estrogen receptor (ER) activity but dependent on non-genomic ER activity.« less

  3. Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.

    PubMed

    Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi

    2003-04-01

    Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.

  4. Galactomannan from Schizolobium amazonicum seed and its sulfated derivatives impair metabolism in HepG2 cells.

    PubMed

    Cunha de Padua, Monique Meyenberg; Suter Correia Cadena, Silvia Maria; de Oliveira Petkowicz, Carmen Lucia; Martinez, Glaucia Regina; Rodrigues Noleto, Guilhermina

    2017-08-01

    This study evaluated the effects of native galactomannan from Schizolobium amazonicum seeds and its sulfated forms on certain metabolic parameters of HepG2 cells. Aqueous extraction from S. amazonicum seeds furnished galactomannan with 3.2:1 Man:Gal ratio (SAGM) and molar mass of 4.34×10 5 g/mol. The SAGM fraction was subjected to sulfation using chlorosulfonic acid to obtain SAGMS1 and SAGMS2 with DS of 0.4 and 0.6, respectively. Cytotoxicity of SAGM, SAGMS1, and SAGMS2 was evaluated in human hepatocellular carcinoma cells (HepG2). After 72h, SAGM decreased the viability of HepG2 cells by 50% at 250μg/mL, while SAGMS1 reduced it by 30% at the same concentration. SAGM, SAGMS1, and SAGMS2 promoted a reduction in oxygen consumption and an increase in lactate production in non-permeabilized HepG2 cells after 72h of treatment. These results suggest that SAGM, SAGMS1, and SAGMS2 could be recognized by HepG2 cells and might trigger alterations that impair its survival. These effects could be implicated in the modification of the oxidative phosphorylation process in HepG2 cells and activation of the glycolytic pathway. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. An overactivated ATR/CHK1 pathway is responsible for the prolonged G2 accumulation in irradiated AT cells

    NASA Technical Reports Server (NTRS)

    Wang, Xiang; Khadpe, Jay; Hu, Baocheng; Iliakis, George; Wang, Ya

    2003-01-01

    Induction of checkpoint responses in G1, S, and G2 phases of the cell cycle after exposure of cells to ionizing radiation (IR) is essential for maintaining genomic integrity. Ataxia telangiectasia mutated (ATM) plays a key role in initiating this response in all three phases of the cell cycle. However, cells lacking functional ATM exhibit a prolonged G2 arrest after IR, suggesting regulation by an ATM-independent checkpoint response. The mechanism for this ataxia telangiectasia (AT)-independent G2-checkpoint response remains unknown. We report here that the G2 checkpoint in irradiated human AT cells derives from an overactivation of the ATR/CHK1 pathway. Chk1 small interfering RNA abolishes the IR-induced prolonged G2 checkpoint and radiosensitizes AT cells to killing. These results link the activation of ATR/CHK1 with the prolonged G2 arrest in AT cells and show that activation of this G2 checkpoint contributes to the survival of AT cells.

  6. 26 CFR 1.860G-1 - Definition of regular and residual interests.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-1... or the amount of income from permitted investments (as defined in § 1.860G-2(g)); or (B) The timing... interest is affected by defaults on qualified mortgages and permitted investments, unanticipated expenses...

  7. 26 CFR 1.860G-1 - Definition of regular and residual interests.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-1... or the amount of income from permitted investments (as defined in § 1.860G-2(g)); or (B) The timing... interest is affected by defaults on qualified mortgages and permitted investments, unanticipated expenses...

  8. 26 CFR 1.860G-1 - Definition of regular and residual interests.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-1... or the amount of income from permitted investments (as defined in § 1.860G-2(g)); or (B) The timing... interest is affected by defaults on qualified mortgages and permitted investments, unanticipated expenses...

  9. 26 CFR 1.860G-1 - Definition of regular and residual interests.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-1... or the amount of income from permitted investments (as defined in § 1.860G-2(g)); or (B) The timing... interest is affected by defaults on qualified mortgages and permitted investments, unanticipated expenses...

  10. Inhibition of lipolysis in the novel transgenic quail model overexpressing G0/G1 switch gene 2 in the adipose tissue during feed restriction.

    PubMed

    Shin, Sangsu; Choi, Young Min; Han, Jae Yong; Lee, Kichoon

    2014-01-01

    In addition to the issue of obesity in humans, the production of low-fat meat from domestic animals is important in the agricultural industry to satisfy consumer demand. Understanding the regulation of lipolysis in adipose tissue could advance our knowledge to potentially solve both issues. Although the G0/G1 switch gene 2 (G0S2) was recently identified as an inhibitor of adipose triglyceride lipase (ATGL) in vitro, its role in vivo has not been fully clarified. This study was conducted to investigate the role of G0S2 gene in vivo by using two independent transgenic quail lines during different energy conditions. Unexpectedly, G0S2 overexpression had a negligible effect on plasma NEFA concentration, fat cell size and fat pad weight under ad libitum feeding condition when adipose lipolytic activity is minimal. A two-week feed restriction in non-transgenic quail expectedly caused increased plasma NEFA concentration and dramatically reduced fat cell size and fat pad weight. Contrary, G0S2 overexpression under a feed restriction resulted in a significantly less elevation of plasma NEFA concentration and smaller reductions in fat pad weights and fat cell size compared to non-transgenic quail, demonstrating inhibition of lipolysis and resistance to loss of fat by G0S2. Excessive G0S2 inhibits lipolysis in vivo during active lipolytic conditions, such as food restriction and fasting, suggesting G0S2 as a potential target for treatment of obesity. In addition, transgenic quail are novel models for studying lipid metabolism and mechanisms of obesity.

  11. Theoretical Study of the B(sup 3) Sigma(sup -, sub u) - X(sup3)Sigma(sub g, sup -) and B"(sup 3)Pi(sub u) - X(sup 3)Sigma(sub g, sup -) Band Systems of S(sub 2)

    NASA Technical Reports Server (NTRS)

    Pradhan, Atul D.; Partridge, Harry; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    Multireference configuration-interaction (MRCI) wavefunctions and potential energy curves have been calculated for the X(sup 3)Sigma(sub g,sup -), B(sup 3)Sigma(sub u, Sup -) and B"(sup 3)Pi((sub u) states of S(sub 2) using correlation consistent Gaussian basis sets. These wavefunctions are utilized to compute the the transition dipole moments of the B(sup 3)Sigma(sub g, sup -) - X(sup 3) Sigma(sub g, sup -) and B"(sup 3)Pi(sub u) - X(sup 3)Sigma(sub g, sup -) systems. Oscillator strengths, transition probabilities, and radiative lifetimes are computed for the X-B system and comparison is made with experimental data.

  12. G2 phase-specific proteins of HeLa cells.

    PubMed Central

    Al-Bader, A A; Orengo, A; Rao, P N

    1978-01-01

    The objective of this study was to determine if HeLa cells irreversibly arrested in G2 phase of the cell cycle by a brief exposure to a nitrosourea compound were deficient in certain proteins when compared with G2-synchronized cells. Total cellular proteins of G2-synchronized, G2-arrested, and S phase-synchronized cells were compared by two-dimensional polyacrylamide gel electrophoresis. The S phase cells differed from the G2-synchronized and G2-arrested cells by the absence of about 35 and 25 protein spots, respectively, of a total of nearly 150. At least nine protein spots in the molecular weight range of 4--5 X 10(4) that were present in the G2-synchronized cells were absent in both the G2-arrested and the S phase cells. Thus, these studies suggest that the missing proteins are probably necessary for the transition of cells from G2 phase to mitosis. Supplying the missing proteins to the G2-arrested cells by fusion with G2-synchronized cells facilitated the entry of the former into mitosis. Images PMID:282623

  13. 16 CFR Appendix G2 to Part 305 - Furnaces- Electric

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Furnaces- Electric G2 Appendix G2 to Part... LABELING RULEâ) Appendix G2 to Part 305—Furnaces— Electric Furnace type Range of annual fuel utilization efficiencies (AFUEs) Low High Electric Furnaces—All Capacities 100.0 100.0 [78 FR 8377, Feb. 6, 2013] ...

  14. G-quadruplex induced stabilization by 2′-deoxy-2′-fluoro-d-arabinonucleic acids (2′F-ANA)

    PubMed Central

    Peng, Chang Geng; Damha, Masad J.

    2007-01-01

    The impact of 2′-deoxy-2′-fluoroarabinonucleotide residues (2′F-araN) on different G-quadruplexes derived from a thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), an anti-HIV phosphorothioate aptamer PS-d(T2G4T2) and a DNA telomeric sequence d(G4T4G4) via UV thermal melting (Tm) and circular dichroism (CD) experiments has been investigated. Generally, replacement of deoxyguanosines that adopt the anti conformation (anti-guanines) with 2′F-araG can stabilize G-quartets and maintain the quadruplex conformation, while replacement of syn-guanines with 2′F-araG is not favored and results in a dramatic switch to an alternative quadruplex conformation. It was found that incorporation of 2′F-araG or T residues into a thrombin-binding DNA G-quadruplex stabilizes the complex (ΔTm up to ∼+3°C/2′F-araN modification); 2′F-araN units also increased the half-life in 10% fetal bovine serum (FBS) up to 48-fold. Two modified thrombin-binding aptamers (PG13 and PG14) show an approximately 4-fold increase in binding affinity to thrombin, as assessed via a nitrocellulose filter binding assay, both with increased thermal stability (∼1°C/2′F-ANA modification increase in Tm) and nuclease resistance (4–7-fold) as well. Therefore, the 2′-deoxy-2′-fluoro-d-arabinonucleic acid (2′F-ANA) modification is well suited to tune (and improve) the physicochemical and biological properties of naturally occurring DNA G-quartets. PMID:17636049

  15. Identification of drugs and drug metabolites as substrates of multidrug resistance protein 2 (MRP2) using triple-transfected MDCK-OATP1B1-UGT1A1-MRP2 cells

    PubMed Central

    Fahrmayr, C; König, J; Auge, D; Mieth, M; Fromm, MF

    2012-01-01

    BACKGROUND AND PURPOSE The coordinate activity of hepatic uptake transporters [e.g. organic anion transporting polypeptide 1B1 (OATP1B1)], drug-metabolizing enzymes [e.g. UDP-glucuronosyltransferase 1A1 (UGT1A1)] and efflux pumps (e.g. MRP2) is a crucial determinant of drug disposition. However, limited data are available on transport of drugs (e.g. ezetimibe, etoposide) and their glucuronidated metabolites by human MRP2 in intact cell systems. EXPERIMENTAL APPROACH Using monolayers of newly established triple-transfected MDCK-OATP1B1-UGT1A1-MRP2 cells as well as MDCK control cells, single- (OATP1B1) and double-transfected (OATP1B1-UGT1A1, OATP1B1-MRP2) MDCK cells, we therefore studied intracellular concentrations and transcellular transport after administration of ezetimibe or etoposide to the basal compartment. KEY RESULTS Intracellular accumulation of ezetimibe was significantly lower in MDCK-OATP1B1-UGT1A1-MRP2 triple-transfected cells compared with all other cell lines. Considerably higher amounts of ezetimibe glucuronide were found in the apical compartment of MDCK-OATP1B1-UGT1A1-MRP2 monolayers compared with all other cell lines. Using HEK cells, etoposide was identified as a substrate of OATP1B1. Intracellular concentrations of etoposide equivalents (i.e. parent compound plus metabolites) were affected only to a minor extent by the absence or presence of OATP1B1/UGT1A1/MRP2. In contrast, apical accumulation of etoposide equivalents was significantly higher in monolayers of both cell lines expressing MRP2 (MDCK-OATP1B1-MRP2, MDCK-OATP1B1-UGT1A1-MRP2) compared with the single-transfected (OATP1B1) and the control cell line. CONCLUSIONS AND IMPLICATIONS Ezetimibe glucuronide is a substrate of human MRP2. Moreover, etoposide and possibly also its glucuronide are substrates of MRP2. These data demonstrate the functional interplay between transporter-mediated uptake, phase II metabolism and export by hepatic proteins involved in drug disposition. PMID:21923755

  16. Computational repositioning of ethno medicine elucidated gB-gH-gL complex as novel anti herpes drug target

    PubMed Central

    2013-01-01

    Background Herpes viruses are important human pathogens that can cause mild to severe lifelong infections with high morbidity. They remain latent in the host cells and can cause recurrent infections that might prove fatal. These viruses are known to infect the host cells by causing the fusion of viral and host cell membrane proteins. Fusion is achieved with the help of conserved fusion machinery components, glycoproteins gB, heterodimer gH-gL complex along with other non-conserved components. Whereas, another important glycoprotein gD without which viral entry to the cell is not possible, acts as a co-activator for the gB-gH-gL complex formation. Thus, this complex formation interface is the most promising drug target for the development of novel anti-herpes drug candidates. In the present study, we propose a model for binding of gH-gL to gB glycoprotein leading from pre to post conformational changes during gB-gH-gL complex formation and reported the key residues involved in this binding activity along with possible binding site locations. To validate the drug targetability of our proposed binding site, we have repositioned some of the most promising in vitro, in vivo validated anti-herpes molecules onto the proposed binding site of gH-gL complex in a computational approach. Methods Hex 6.3 standalone software was used for protein-protein docking studies. Arguslab 4.0.1 and Accelrys® Discovery Studio 3.1 Visualizer softwares were used for semi-flexible docking studies and visualizing the interactions respectively. Protein receptors and ethno compounds were retrieved from Protein Data Bank (PDB) and Pubchem databases respectively. Lipinski’s Filter, Osiris Property Explorer and Lazar online servers were used to check the pharmaceutical fidelity of the drug candidates. Results Through protein-protein docking studies, it was identified that the amino acid residues VAL342, GLU347, SER349, TYR355, SER388, ASN395, HIS398 and ALA387 of gH-gL complex play an active

  17. PAI-1 4G/5G Polymorphism Contributes to Cancer Susceptibility: Evidence from Meta-Analysis

    PubMed Central

    Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    Background The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. Methods A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I2 test. Results Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03–1.18, I2 = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06–1.39, I2 = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04–1.18, I2 = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09–1.59, I2 = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04–1.21, I2 = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05–1.21, I2 = 25.3%). Conclusions The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer. PMID:23437240

  18. Evaluation and identification of hepatitis B virus entry inhibitors using HepG2 cells overexpressing a membrane transporter NTCP.

    PubMed

    Iwamoto, Masashi; Watashi, Koichi; Tsukuda, Senko; Aly, Hussein Hassan; Fukasawa, Masayoshi; Fujimoto, Akira; Suzuki, Ryosuke; Aizaki, Hideki; Ito, Takayoshi; Koiwai, Osamu; Kusuhara, Hiroyuki; Wakita, Takaji

    2014-01-17

    Hepatitis B virus (HBV) entry has been analyzed using infection-susceptible cells, including primary human hepatocytes, primary tupaia hepatocytes, and HepaRG cells. Recently, the sodium taurocholate cotransporting polypeptide (NTCP) membrane transporter was reported as an HBV entry receptor. In this study, we established a strain of HepG2 cells engineered to overexpress the human NTCP gene (HepG2-hNTCP-C4 cells). HepG2-hNTCP-C4 cells were shown to be susceptible to infection by blood-borne and cell culture-derived HBV. HBV infection was facilitated by pretreating cells with 3% dimethyl sulfoxide permitting nearly 50% of the cells to be infected with HBV. Knockdown analysis suggested that HBV infection of HepG2-hNTCP-C4 cells was mediated by NTCP. HBV infection was blocked by an anti-HBV surface protein neutralizing antibody, by compounds known to inhibit NTCP transporter activity, and by cyclosporin A and its derivatives. The infection assay suggested that cyclosporin B was a more potent inhibitor of HBV entry than was cyclosporin A. Further chemical screening identified oxysterols, oxidized derivatives of cholesterol, as inhibitors of HBV infection. Thus, the HepG2-hNTCP-C4 cell line established in this study is a useful tool for the identification of inhibitors of HBV infection as well as for the analysis of the molecular mechanisms of HBV infection. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Downlink power distributions for 2G and 3G mobile communication networks.

    PubMed

    Colombi, Davide; Thors, Björn; Persson, Tomas; Wirén, Niklas; Larsson, Lars-Eric; Jonsson, Mikael; Törnevik, Christer

    2013-12-01

    Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, downlink output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90th percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below.

  20. Low doses of GM-CSF (molgramostim) and G-CSF (filgrastim) after cyclophosphamide (4 g/m2) enhance the peripheral blood progenitor cell harvest: results of two randomized studies including 120 patients

    PubMed Central

    Quittet, Philippe; Ceballos, Patrice; Lopez, Ernesto; Lu, Zhao-Yang; Latry, Pascal; Becht, Catherine; Legouffe, Eric; Fegueux, Nathalie; Exbrayat, Carole; Pouessel, Damien; Rouillé, Valérie; Daures, Jean-Pierre; Klein, Bernard; Rossi, Jean-François

    2006-01-01

    The use of a combination of G-CSF and GM-CSF to G-CSF alone, after cyclophosphamide (4g/m2) was compared in 2 randomized phase III studies, including 120 patients. In study A, 60 patients received 5 × 2 μg/kg/day of G-CSF and GM-CSF compared to 5 μg/kg/day of G-CSF. In study B, 60 patients received 2.5 × 2 μg/kg/day G-CSF and GM-CSF compared to G-CSF alone (5 μg/kg/day). With the aim to collect at least 5 × 106/kg CD34 cells in a maximum of 3 large volume leukapherisis (LK), 123 LK were performed in study A, showing significant higher number of patients reaching 10 × 106/kg CD34 cells (21/29 in G+GM-CSF arm vs 11/27 in G-CSF arm, P= .00006). In study B, 109 LK were performed, with similar results (10/27 vs 15/26, P= .003). In both the study, the total harvest of CD34 cells/kg was 2-fold higher in G-CSF plus GM-CSF group (18.3 × 106 in study A and 15.85 × 106 in study B) than in G-CSF group (9 × 106 in study A and 8.1 × 106 in study B), a difference particularly seen in multiple myeloma, with no significant difference in terms of mobilized myeloma cells between G-CSF and GM-CSF groups. PMID:16883311

  1. Immunization with a Vaccine Combining Herpes Simplex Virus 2 (HSV-2) Glycoprotein C (gC) and gD Subunits Improves the Protection of Dorsal Root Ganglia in Mice and Reduces the Frequency of Recurrent Vaginal Shedding of HSV-2 DNA in Guinea Pigs Compared to Immunization with gD Alone ▿

    PubMed Central

    Awasthi, Sita; Lubinski, John M.; Shaw, Carolyn E.; Barrett, Shana M.; Cai, Michael; Wang, Fushan; Betts, Michael; Kingsley, Susan; DiStefano, Daniel J.; Balliet, John W.; Flynn, Jessica A.; Casimiro, Danilo R.; Bryan, Janine T.; Friedman, Harvey M.

    2011-01-01

    Attempts to develop a vaccine to prevent genital herpes simplex virus 2 (HSV-2) disease have been only marginally successful, suggesting that novel strategies are needed. Immunization with HSV-2 glycoprotein C (gC-2) and gD-2 was evaluated in mice and guinea pigs to determine whether adding gC-2 to a gD-2 subunit vaccine would improve protection by producing antibodies that block gC-2 immune evasion from complement. Antibodies produced by gC-2 immunization blocked the interaction between gC-2 and complement C3b, and passive transfer of gC-2 antibody protected complement-intact mice but not C3 knockout mice against HSV-2 challenge, indicating that gC-2 antibody is effective, at least in part, because it prevents HSV-2 evasion from complement. Immunization with gC-2 also produced neutralizing antibodies that were active in the absence of complement; however, the neutralizing titers were higher when complement was present, with the highest titers in animals immunized with both antigens. Animals immunized with the gC-2-plus-gD-2 combination had robust CD4+ T-cell responses to each immunogen. Multiple disease parameters were evaluated in mice and guinea pigs immunized with gC-2 alone, gD-2 alone, or both antigens. In general, gD-2 outperformed gC-2; however, the gC-2-plus-gD-2 combination outperformed gD-2 alone, particularly in protecting dorsal root ganglia in mice and reducing recurrent vaginal shedding of HSV-2 DNA in guinea pigs. Therefore, the gC-2 subunit antigen enhances a gD-2 subunit vaccine by stimulating a CD4+ T-cell response, by producing neutralizing antibodies that are effective in the absence and presence of complement, and by blocking immune evasion domains that inhibit complement activation. PMID:21813597

  2. 76 FR 24910 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-03

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Forms G- 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of...

  3. Effects of 2 G on adiposity, leptin, lipoprotein lipase, and uncoupling protein-1 in lean and obese Zucker rats

    NASA Technical Reports Server (NTRS)

    Warren, L. E.; Horwitz, B. A.; Hamilton, J. S.; Fuller, C. A.

    2001-01-01

    Male Zucker rats were exposed to 2 G for 8 wk to test the hypothesis that the leptin regulatory pathway contributes to recovery from effects of 2 G on feeding, growth, and nutrient partitioning. After initial hypophagia, body mass-independent food intake of the lean rats exposed to 2 G surpassed that of the lean rats maintained at 1 G, but food intake of the obese rats exposed to 2 G remained low. After 8 wk at 2 G, body mass and carcass fat were less in both genotypes. Leptin and percent fat were lower in lean rats exposed to 2 G vs. 1 G but did not differ in obese rats exposed to 2 G vs. 1 G. Although exposure to 2 G did not alter uncoupling protein-1 levels, it did elicit white fat pad-specific changes in lipoprotein lipase activity in obese but not lean rats. We conclude that 2 G affects both genotypes but that the lean Zucker rats recover their food intake and growth rate and retain "normal" lipoprotein lipase activity to a greater degree than do the obese rats, emphasizing the importance of a functional leptin regulatory pathway in this acclimation.

  4. Activation of p21-Dependent G1/G2 Arrest in the Absence of DNA Damage as an Antiapoptotic Response to Metabolic Stress

    PubMed Central

    Hoeferlin, L. Alexis; Oleinik, Natalia V.; Krupenko, Natalia I.

    2011-01-01

    The folate enzyme, FDH (10-formyltetrahydrofolate dehydrogenase, ALDH1L1), a metabolic regulator of proliferation, activates p53-dependent G1 arrest and apoptosis in A549 cells. In the present study, we have demonstrated that FDH-induced apoptosis is abrogated upon siRNA knockdown of the p53 downstream target PUMA. Conversely, siRNA knockdown of p21 eliminated FDH-dependent G1 arrest and resulted in an early apoptosis onset. The acceleration of FDH-dependent apoptosis was even more profound in another cell line, HCT116, in which the p21 gene was silenced through homologous recombination (p21−/− cells). In contrast to A549 cells, FDH caused G2 instead of G1 arrest in HCT116 p21+/+ cells; such an arrest was not seen in p21-deficient (HCT116 p21−/−) cells. In agreement with the cell cycle regulatory function of p21, its strong accumulation in nuclei was seen upon FDH expression. Interestingly, our study did not reveal DNA damage upon FDH elevation in either cell line, as judged by comet assay and the evaluation of histone H2AX phosphorylation. In both A549 and HCT116 cell lines, FDH induced a strong decrease in the intracellular ATP pool (2-fold and 30-fold, respectively), an indication of a decrease in de novo purine biosynthesis as we previously reported. The underlying mechanism for the drop in ATP was the strong decrease in intracellular 10-formyltetrahydrofolate, a substrate in two reactions of the de novo purine pathway. Overall, we have demonstrated that p21 can activate G1 or G2 arrest in the absence of DNA damage as a response to metabolite deprivation. In the case of FDH-related metabolic alterations, this response delays apoptosis but is not sufficient to prevent cell death. PMID:22593801

  5. Antibodies to the Central Conserved Region of Respiratory Syncytial Virus (RSV) G Protein Block RSV G Protein CX3C-CX3CR1 Binding and Cross-Neutralize RSV A and B Strains0

    PubMed Central

    Choi, Youngjoo; Mason, Caleb S.; Jones, Les P.; Crabtree, Jackelyn; Jorquera, Patricia A.

    2012-01-01

    Abstract Respiratory syncytial virus (RSV) is a primary cause of severe lower respiratory tract disease in infants, young children, and the elderly worldwide, and despite decades of effort, there remains no safe and effective vaccine. RSV modifies the host immune response during infection by CX3C chemokine mimicry adversely affecting pulmonary leukocyte chemotaxis and CX3CR1+ RSV-specific T-cell responses. In this study we investigated whether immunization of mice with RSV G protein polypeptides from strain A2 could induce antibodies that block G protein–CX3CR1 interactions of both RSV A and B strains. The results show that mice immunized with RSV A2 G polypeptides generate antibodies that block binding of RSV A2 and B1 native G proteins to CX3CR1, and that these antibodies effectively cross-neutralize both A and B strains of RSV. These findings suggest that vaccines that induce RSV G protein–CX3CR1 blocking antibodies may provide a disease intervention strategy in the efforts to develop safe and efficacious RSV vaccines. PMID:22551066

  6. Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

    PubMed Central

    Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

    2014-01-01

    G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

  7. BRN 3.1 Knockouts Affect the Vestibular, Autonomic, and Circadian Rhythm Responses to 2G Exposure

    NASA Technical Reports Server (NTRS)

    Murakami, D. M.; Erkman, L.; Rosenfeld, M. G.; Fuller, C. A.

    1999-01-01

    Our previous studies have demonstrated that 2G exposure via centrifugation significantly attenuated the daily mean and circadian rhythm amplitude of rat body temperature (Tb), heart rate, and activity (Act). In addition, 2G exposure activates neural responses in several vestibular, autonomic, and circadian nuclei. Although we have characterized the effect of 2G on an animal's physiological, neuronal, and behavioral responses, it will be important to understand the underlying neural and physiological mechanisms that mediate those responses. For example, the vestibular responses, proprioceptive feedback, or fluid shifts may be the critical factors that mediate the responses to 2G. As a first step to understand the relative importance of these different response pathways to altered gravitational fields, this study examined the contribution of the vestibular system by utilizing an animal model from molecular biology. Brain 3.1 (Bm 3.1) is a POU domain homeobox gene involved in the normal development of the vestibular and auditory system. Brn 3.1 deletion results in a loss of hair cells in the otoliths, semicircular canals, and cochlea. As a result mice with a Brn 3.1 deletion do not have a functioning vestibular or auditory system. The BRN 3.1 knockout mouse could be a very useful animal model for isolating the role of the vestibular system in mediating the physiological responses to 2G exposure. Therefore, this study compared the effect of 2G exposure via centrifugation between Brn 3.1 knockout (KO) versus Wildtype (W) mice.

  8. IgG Antibody Responses to Recombinant gp120 Proteins, gp70V1/V2 Scaffolds, and a CyclicV2 Peptide in Thai Phase I/II Vaccine Trials Using Different Vaccine Regimens.

    PubMed

    Karasavvas, Nicos; Karnasuta, Chitraporn; Savadsuk, Hathairat; Madnote, Sirinan; Inthawong, Dutsadee; Chantakulkij, Somsak; Rittiroongrad, Surawach; Nitayaphan, Sorachai; Pitisuttithum, Punnee; Thongcharoen, Prasert; Siriyanon, Vinai; Andrews, Charla A; Barnett, Susan W; Tartaglia, James; Sinangil, Faruk; Francis, Donald P; Robb, Merlin L; Michael, Nelson L; Ngauy, Viseth; de Souza, Mark S; Paris, Robert M; Excler, Jean-Louis; Kim, Jerome H; O'Connell, Robert J

    2015-11-01

    RV144 correlates of risk analysis showed that IgG antibodies to gp70V1V2 scaffolds inversely correlated with risk of HIV acquisition. We investigated IgG antibody responses in RV135 and RV132, two ALVAC-HIV prime-boost vaccine trials conducted in Thailand prior to RV144. Both trials used ALVAC-HIV (vCP1521) at 0, 1, 3, and 6 months and HIV-1 gp120MNgD and gp120A244gD in alum (RV135) or gp120SF2 and gp120CM235 in MF59 (RV132) at 3 and 6 months. We assessed ELISA binding antibodies to the envelope proteins (Env) 92TH023, A244gD and MNgD, cyclicV2, and gp70V1V2 CaseA2 (subtype B) and 92TH023 (subtype CRF01_AE), and Env-specific IgG1 and IgG3. Antibody responses to gp120 A244gD, MNgD, and gp70V1V2 92TH023 scaffold were significantly higher in RV135 than in RV132. Antibodies to gp70V1V2 CaseA2 were detected only in RV135 vaccine recipients and IgG1 and IgG3 antibody responses to A244gD were significantly higher in RV135. IgG binding to gp70V1V2 CaseA2 and CRF01_AE scaffolds was higher with the AIDSVAX(®)B/E boost but both trials showed similar rates of antibody decline post-vaccination. MF59 did not result in higher IgG antibody responses compared to alum with the antigens tested. However, notable differences in the structure of the recombinant proteins and dosage used for immunizations may have contributed to the magnitude and specificity of IgG induced by the two trials.

  9. Requirement of ClC-3 in G0/G1 to S Phase Transition Induced by IGF-1 via ERK1/2-Cyclins Cascade in Multiple Myeloma Cells.

    PubMed

    Du, Yu; Tu, Yong-Sheng; Tang, Yong-Bo; Huang, Yun-Ying; Zhou, Fang-Min; Tian, Tian; Li, Xiao-Yan

    2018-06-01

    ClC-3 is involved in the proliferation and migration of several cancer cells. However, ClC-3 expression and its role of cell-cycle control in multiple myeloma (MM) has not yet been investigated. MM cells were treated with different concentrations of IGF (30, 100, 300 ng/mL), and their proliferation was examined by CCK-8. The effects of ClC-3 on cell cycle progression was detected by flow cytometry. Western blot was used to analyze the relative levels of ClC3, CD138, P21, P27, CDK, p-Erk1/2, and t-Erk1/2 protein expression. Transfection of RPMI8226 with gpClC-3 cDNA and siRNA alters the expression of ClC-3. We compared the expression of ClC-3 in primary myeloma cells and in MM cell lines (U266 and RPMI8266) with that in normal plasma cells (PCs) from normal subjects and found that myeloma cells from patients and MM cell lines had significantly higher expression of ClC-3. Additionally, silencing of ClC-3 with the small interfering RNA (siRNA) that targets human ClC-3 decreased proliferation of RPMI8226 after IGF-1 treatment and slowed cell cycle progression from G0/G1 to S phase, which was associated with diminished phosphorylation of ERK1/2, down-expression of cyclin E, cyclin D1 and up-regulation of p27 and p21. By contrast, overexpression of ClC-3 potentiated cell proliferation induced by IGF-1, raised the percentage of S phase cells, enhanced phosphorylation of ERK1/2, downregulated p27 and p21 and upregulated cyclin E and cyclin D1. ClC-3 accelerated G0/G1 to S phase transition in the cell cycle by modulating ERK1/2 kinase activity and expression of G1/S transition related proteins, making ClC-3 an attractive therapeutic target in MM.

  10. Downregulation of human paraoxonase 1 (PON1) by organophosphate pesticides in HepG2 cells.

    PubMed

    Medina-Díaz, Irma Martha; Ponce-Ruiz, Néstor; Ramírez-Chávez, Bryana; Rojas-García, Aurora Elizabeth; Barrón-Vivanco, Briscia S; Elizondo, Guillermo; Bernal-Hernández, Yael Y

    2017-02-01

    Paraoxonase 1 (PON1) is a calcium-dependent esterase synthesized primarily in the liver and secreted into the plasma where it is associated with high-density lipoproteins (HDL). PON1 hydrolyzes and detoxifies some toxic metabolites of organophosphorus compounds (OPs) such as methyl parathion and chlorpyrifos. Thus, PON1 activity and expression levels are important for determining susceptibility against OPs poisoning. Some studies have demonstrated that OPs can modulate gene expression through interactions with nuclear receptors. In this study, we evaluated the effects of methyl parathion and chlorpyrifos on the modulation of PON1 in Human Hepatocellular Carcinoma (HepG2) cells by real-time PCR, PON1 activity assay, and western blot. The results showed that the treatments with methyl parathion and chlorpyrifos decreased PON1 mRNA and immunoreactive protein and increased inflammatory cytokines in HepG2 cells. The effects of methyl parathion and chlorpyrifos on the downregulation of PON1 gene expression in HepG2 cells may provide evidence of OPs cytotoxicity related to oxidative stress and an inflammatory response. A decrease in the expression of the PON1 gene may increase the susceptibility to OPs intoxication and the risk of diseases related to inflammation and oxidative stress. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 490-500, 2017. © 2016 Wiley Periodicals, Inc.

  11. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  12. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  13. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  14. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  15. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  16. 12 CFR 563g.2 - Offering circular requirement.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Offering circular requirement. 563g.2 Section 563g.2 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.2 Offering circular requirement. (a) General. No savings association shall offer or sell, directly...

  17. Stellar Laboratories II. New Zn Iv and Zn v Oscillator Strengths and Their Validation in the Hot White Dwarfs G191-B2B and RE0503-289

    NASA Technical Reports Server (NTRS)

    Rauch, T.; Werner, K.; Quinet, P.; Kruk, J. W.

    2014-01-01

    Context. For the spectral analysis of high-resolution and high-signal-to-noise (SN) spectra of hot stars, state-of-the-art non-local thermodynamic equilibrium (NLTE) model atmospheres are mandatory. These are strongly dependent on the reliability of the atomic data that is used for their calculation. In a recent analysis of the ultraviolet (UV) spectrum of the DA-type white dwarf G191B2B,21 Zn iv lines were newly identified. Because of the lack of Zn iv data, transition probabilities of the isoelectronic Ge vi were adapted for a first, coarse determination of the photospheric Zn abundance.Aims. Reliable Zn iv and Zn v oscillator strengths are used to improve the Zn abundance determination and to identify more Zn lines in the spectra of G191B2B and the DO-type white dwarf RE 0503289. Methods. We performed new calculations of Zn iv and Zn v oscillator strengths to consider their radiative and collisional bound-bound transitions in detail in our NLTE stellar-atmosphere models for the analysis of the Zn iv v spectrum exhibited in high-resolution and high-SN UV observations of G191B2B and RE 0503289. Results. In the UV spectrum of G191B2B, we identify 31 Zn iv and 16 Zn v lines. Most of these are identified for the first time in any star. We can reproduce well almost all of them at log Zn 5.52 0.2 (mass fraction, about 1.7 times solar). In particular, the Zn iv Zn v ionization equilibrium, which is a very sensitive Teff indicator, is well reproduced with the previously determined Teff 60 000 2000 K and log g 7.60 0.05. In the spectrum of RE 0503289, we identified 128 Zn v lines for the first time and determined log Zn 3.57 0.2 (155 times solar). Conclusions. Reliable measurements and calculations of atomic data are a pre-requisite for stellar-atmosphere modeling. Observed Zn iv and Zn v line profiles in two white dwarf (G191B2B and RE 0503289) ultraviolet spectra were well reproduced with our newly calculated oscillator strengths. This allowed us to determine the

  18. Nickel chloride (NiCl2) in hepatic toxicity: apoptosis, G2/M cell cycle arrest and inflammatory response

    PubMed Central

    Guo, Hongrui; Cui, Hengmin; Fang, Jing; Zuo, Zhicai; Deng, Junliang; Wang, Xun; Zhao, Ling; Chen, Kejie; Deng, Jie

    2016-01-01

    Up to now, the precise mechanism of Ni toxicology is still indistinct. Our aim was to test the apoptosis, cell cycle arrest and inflammatory response mechanism induced by NiCl2 in the liver of broiler chickens. NiCl2 significantly increased hepatic apoptosis. NiCl2 activated mitochondria-mediated apoptotic pathway by decreasing Bcl-2, Bcl-xL, Mcl-1, and increasing Bax, Bak, caspase-3, caspase-9 and PARP mRNA expression. In the Fas-mediated apoptotic pathway, mRNA expression levels of Fas, FasL, caspase-8 were increased. Also, NiCl2 induced ER stress apoptotic pathway by increasing GRP78 and GRP94 mRNA expressions. The ER stress was activated through PERK, IRE1 and ATF6 pathways, which were characterized by increasing eIF2α, ATF4, IRE1, XBP1 and ATF6 mRNA expressions. And, NiCl2 arrested G2/M phase cell cycle by increasing p53, p21 and decreasing cdc2, cyclin B mRNA expressions. Simultaneously, NiCl2 increased TNF-α, IL-1β, IL-6, IL-8 mRNA expressions through NF-κB activation. In conclusion, NiCl2 induces apoptosis through mitochondria, Fas and ER stress-mediated apoptotic pathways and causes cell cycle G2/M phase arrest via p53-dependent pathway and generates inflammatory response by activating NF-κB pathway. PMID:27824316

  19. Stellar laboratories. II. New Zn iv and Zn v oscillator strengths and their validation in the hot white dwarfs G191-B2B and RE 0503-289

    NASA Astrophysics Data System (ADS)

    Rauch, T.; Werner, K.; Quinet, P.; Kruk, J. W.

    2014-04-01

    Context. For the spectral analysis of high-resolution and high-signal-to-noise (S/N) spectra of hot stars, state-of-the-art non-local thermodynamic equilibrium (NLTE) model atmospheres are mandatory. These are strongly dependent on the reliability of the atomic data that is used for their calculation. In a recent analysis of the ultraviolet (UV) spectrum of the DA-type white dwarf G191-B2B, 21 Zn iv lines were newly identified. Because of the lack of Zn iv data, transition probabilities of the isoelectronic Ge vi were adapted for a first, coarse determination of the photospheric Zn abundance. Aims: Reliable Zn iv and Zn v oscillator strengths are used to improve the Zn abundance determination and to identify more Zn lines in the spectra of G191-B2B and the DO-type white dwarf RE 0503-289. Methods: We performed new calculations of Zn iv and Zn v oscillator strengths to consider their radiative and collisional bound-bound transitions in detail in our NLTE stellar-atmosphere models for the analysis of the Zn iv - v spectrum exhibited in high-resolution and high-S/N UV observations of G191-B2B and RE 0503-289. Results: In the UV spectrum of G191-B2B, we identify 31 Zn iv and 16 Zn v lines. Most of these are identified for the first time in any star. We can reproduce well almost all of them at log Zn = -5.52 ± 0.2 (mass fraction, about 1.7 times solar). In particular, the Zn iv / Zn v ionization equilibrium, which is a very sensitive Teff indicator, is well reproduced with the previously determined and log g = 7.60 ± 0.05. In the spectrum of RE 0503-289, we identified 128 Zn v lines for the first time and determined log Zn = -3.57 ± 0.2 (155 times solar). Conclusions: Reliable measurements and calculations of atomic data are a pre-requisite for stellar-atmosphere modeling. Observed Zn iv and Zn v line profiles in two white dwarf (G191-B2B and RE 0503-289) ultraviolet spectra were well reproduced with our newly calculated oscillator strengths. This allowed us to

  20. Dose rate, mitotic cycle duration, and sensitivity of cell transitions from G1 $Yields$ S and G2 $Yields$ M to protracted gamma radiation in root meristems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Evans, L.S.; Hof, J.V.

    1975-11-01

    Experiments were designed to determine the relative radiosensitivity of the cell transition points of G1 $Yields$ S and G2 $Yields$ M in root meristems of several plant species. Label and mitotic indices and microspectrophotometry were used to measure the proportions of cells in each mitotic cycle stage in root meristems after protracted gamma radiation. The criterion of radiosensitivity was the dose rate needed to produce a tissue with less than 1 percent cells in S and none in M after 3 days of continuous exposure. The results show that DNA is the primary radiation target in proliferative root meristems andmore » that the cycle duration stipulates the time interval of vulnerability. In each species, nonrandom reproducible cell proportions were established with 2C:4C:8C amounts of nuclear DNA after 3 days of exposure. Roots of Helianthus annuus, Crepis capillaris, and Tradescantia clone 02 had 80 percent cells with a 2C amount of DNA and 20 percent had a 4C amount of DNA. In these species the transition point of G1 $Yields$ S was more radiosensitive than G2 $Yields$ M. Roots of Pisum sativum and Triticum aestivum had cell proportions at 2C:4C:8C amounts of DNA in frequencies of 0.10 to 0.20:0.40 to 0.60:0.30 to 0.40. In these two species 0.30 to 0.40 cells underwent radiation-induced endoreduplication that resulted from a rapid inhibition of cell transit from G2 $Yields$ M and a slower impairment of G1 $Yields$ S. Cells increased from 2C to 4C and from 4C to 8C amounts of DNA during irradiation. The proportions of nuclei with 2C:4C:8C amounts of DNA were dependent in part upon the relative radiosensitivity of the G1 $Yields$ S and G2 $Yields$ M control points. The data show the relative radiosensitivity of the transition points from G1 $Yields$ S and from G2 $Yields$ M was species specific and unrelated to the cycle duration and mean nuclear DNA content of the plant species. (auth)« less

  1. Enhanced Access to the Dark Triplet States of 7Li 2 through New Singlet-Triplet A1Σ +u ˜ b3Π u Perturbation Window Levels: Perturbation-Facilitated Optical-Optical Double Resonance Study of the 2 3Σ +g State

    NASA Astrophysics Data System (ADS)

    Lazarov, Guenadiy; Lyyra, A. Marjatta; Li, Li

    2001-01-01

    Two new pairs of singlet-triplet A1Σ+u ∼ b3Πu mixed levels of 7Li2 have been observed and used here as 'window' levels in cw perturbation-facilitated optical-optical double-resonance (PFOODR) experiments. Previously, only one b3Πu vibrational level, v = 19, was known to mix with the singlet A1Σ+uv = 13 level, resulting in three perturbed A ∼ b pairs [L. Li, T. An, T.-J. Whang, A. M. Lyyra, W. C. Stwalley, R. W. Field, and R. A. Bernheim, J. Chem. Phys. 96, 3342 (1992)]. The scarcity of window levels and the resulting difficulty in accessing the dark triplet states of Li2 is caused by the weak spin-orbit interaction of Li2. The two new mixed b3Πuv = 15 and 22 levels reported here enhance access to the dark triplet state manifold through expansion of the Franck-Condon overlap factor range. Furthermore, the earlier range of accessible rotational levels, N = 5, 7, and 10, is now expanded to include N = 8 and N = 16, thereby allowing for more reliable determination of the excited triplet states rotational structure. To demonstrate the importance of the new A1Σ+u ∼ b3Πu mixed levels, we have studied the 23Σ+g state by cw PFOODR fluorescence excitation spectroscopy. New molecular constants and RKR potential curve have been determined. As previously reported [L. Li, G. Lazarov, and A. M. Lyyra, J. Mol. Spectrosc. 191, 387 (1998)], the 23Σ+g state interacts with the repulsive 13Πg state by L-uncoupling and predissociates. We show that some 23Πg levels predissociate accidentally by the 13Πg state via the 23Σ+g state through L-uncoupling.

  2. Quantitative trait locus mapping in mice identifies phospholipase Pla2g12a as novel atherosclerosis modifier.

    PubMed

    Nicolaou, Alexandros; Northoff, Bernd H; Sass, Kristina; Ernst, Jana; Kohlmaier, Alexander; Krohn, Knut; Wolfrum, Christian; Teupser, Daniel; Holdt, Lesca M

    2017-10-01

    In a previous work, a female-specific atherosclerosis risk locus on chromosome (Chr) 3 was identified in an intercross of atherosclerosis-resistant FVB and atherosclerosis-susceptible C57BL/6 (B6) mice on the LDL-receptor deficient (Ldlr -/- ) background. It was the aim of the current study to identify causative genes at this locus. We established a congenic mouse model, where FVB.Chr3 B6/B6 mice carried an 80 Mb interval of distal Chr3 on an otherwise FVB.Ldlr -/- background, to validate the Chr3 locus. Candidate genes were identified using genome-wide expression analyses. Differentially expressed genes were validated using quantitative PCRs in F0 and F2 mice and their functions were investigated in pathophysiologically relevant cells. Fine-mapping of the Chr3 locus revealed two overlapping, yet independent subloci for female atherosclerosis susceptibility: when transmitted by grandfathers to granddaughters, the B6 risk allele increased atherosclerosis and downregulated the expression of the secreted phospholipase Pla2g12a (2.6 and 2.2 fold, respectively); when inherited by grandmothers, the B6 risk allele induced vascular cell adhesion molecule 1 (Vcam1). Down-regulation of Pla2g12a and up-regulation of Vcam1 were validated in female FVB.Chr3 B6/B6 congenic mice, which developed 2.5 greater atherosclerotic lesions compared to littermate controls (p=0.039). Pla2g12a was highly expressed in aortic endothelial cells in vivo, and knocking-down Pla2g12a expression by RNAi in cultured vascular endothelial cells or macrophages increased their adhesion to ECs in vitro. Our data establish Pla2g12a as an atheroprotective candidate gene in mice, where high expression levels in ECs and macrophages may limit the recruitment and accumulation of these cells in nascent atherosclerotic lesions. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Gravitational force modulates G2/M phase exit in mechanically unloaded myoblasts

    PubMed Central

    Benavides Damm, Tatiana; Franco-Obregón, Alfredo; Egli, Marcel

    2013-01-01

    Prolonged spaceflight gives rise to muscle loss and reduced strength, a condition commonly referred to as space atrophy. During exposure to microgravity, skeletal muscle myoblasts are mechanically unloaded and respond with attenuated cell proliferation, slowed cell cycle progression, and modified protein expression. To elucidate the underlying mechanisms by which muscle mass declines in response to prolonged microgravity exposure, we grew C2C12 mouse muscle cells under conditions of simulated microgravity (SM) and analyzed their proliferative capacity, cell cycle progression, and cyclin B and D expression. We demonstrated that the retarded cell growth observed in SM was correlated with an approximate 16 h delay in G2/M phase progression, where cells accumulated specifically between the G2 checkpoint and the onset of anaphase, concomitantly with a positive expression for cyclin B. The effect was specific for gravitational mechanical unloading as cells grown under conditions of hypergravity (HG, 4 g) for similar durations of time exhibited normal proliferation and normal cell cycle progression. Our results show that SM and HG exert phenomenological distinct responses over cell cycle progression. The deficits of SM can be restored by terrestrial gravitational force, whereas the effects of HG are indistinguishable from the 1 g control. This suggests that the mechanotransduction apparatus of cells responds differently to mechanical unloading and loading. PMID:23974110

  4. BRCA1 and its phosphorylation involved in caffeine-inhibitable event upstream of G2 checkpoint

    NASA Astrophysics Data System (ADS)

    Li, Ning; Zhang, Hong; Wang, Yanling; Hao, Jifang

    2010-07-01

    Caffeine, which specifically inhibits ATM/ATR kinases, efficiently abrogates the ionizing radiation (IR)-induced G2 arrest and increases the sensitivity of various tumor cells to IR. Mechanisms for the effect of caffeine remain to be elucidated. As a target of ATM/ATR kinases, BRCA1 becomes activated and phosphorylated in response to IR. Thus, in this work, we investigated the possible role of BRCA1 in the effect of caffeine on G2 checkpoint and observed how BRCA1 phosphorylation was regulated in this process. For these purposes, the BRCA1 protein level and the phosphorylation states were analyzed by Western blotting by using an antibody against BRCA1 and phospho-specific antibodies against Ser-1423 and Ser-1524 residues in cells exposed to a combination of IR and caffeine. The results showed that caffeine down-regulated IR-induced BRCA1 expression and specifically abolished BRCA1 phosphorylation of Ser-1524, which was followed by an override of G2 arrest by caffeine. In addition, the ability of BRCA1 to transactivate p21 may be required for MCF-7 but not necessary for Hela response to caffeine. These data suggest that BRCA1 may be a potential target of caffeine. BRCA1 and its phosphorylation are most likely to be involved in the caffeine-inhibitable event upstream of G2 arrest.

  5. The Amino Terminus of Herpes Simplex Virus 1 Glycoprotein K (gK) Is Required for gB Binding to Akt, Release of Intracellular Calcium, and Fusion of the Viral Envelope with Plasma Membranes.

    PubMed

    Musarrat, Farhana; Jambunathan, Nithya; Rider, Paul J F; Chouljenko, V N; Kousoulas, K G

    2018-03-15

    Previously, we have shown that the amino terminus of glycoprotein K (gK) binds to the amino terminus of gB and that deletion of the amino-terminal 38 amino acids of gK prevents herpes simplex virus 1 (HSV-1) infection of mouse trigeminal ganglia after ocular infection and virus entry into neuronal axons. Recently, it has been shown that gB binds to Akt during virus entry and induces Akt phosphorylation and intracellular calcium release. Proximity ligation and two-way immunoprecipitation assays using monoclonal antibodies against gB and Akt-1 phosphorylated at S473 [Akt-1(S473)] confirmed that HSV-1(McKrae) gB interacted with Akt-1(S473) during virus entry into human neuroblastoma (SK-N-SH) cells and induced the release of intracellular calcium. In contrast, the gB specified by HSV-1(McKrae) gKΔ31-68, lacking the amino-terminal 38 amino acids of gK, failed to interact with Akt-1(S473) and induce intracellular calcium release. The Akt inhibitor miltefosine inhibited the entry of McKrae but not the gKΔ31-68 mutant into SK-N-SH cells. Importantly, the entry of the gKΔ31-68 mutant but not McKrae into SK-N-SH cells treated with the endocytosis inhibitors pitstop-2 and dynasore hydrate was significantly inhibited, indicating that McKrae gKΔ31-68 entered via endocytosis. These results suggest that the amino terminus of gK functions to regulate the fusion of the viral envelope with cellular plasma membranes. IMPORTANCE HSV-1 glycoprotein B (gB) functions in the fusion of the viral envelope with cellular membranes during virus entry. Herein, we show that a deletion in the amino terminus of glycoprotein K (gK) inhibits gB binding to Akt-1(S473), the release of intracellular calcium, and virus entry via fusion of the viral envelope with cellular plasma membranes. Copyright © 2018 American Society for Microbiology.

  6. Clockwork graviton contributions to muon g -2

    NASA Astrophysics Data System (ADS)

    Hong, Deog Ki; Kim, Du Hwan; Shin, Chang Sub

    2018-02-01

    The clockwork mechanism for gravity introduces a tower of massive graviton modes, clockwork gravitons, with a very compressed mass spectrum, whose interaction strengths are much stronger than those of massless gravitons. In this work, we compute the lowest order contributions of the clockwork gravitons to the anomalous magnetic moment, g -2 , of muon in the context of an extra dimensional model with a five-dimensional Planck mass, M5. We find that the total contributions are rather insensitive to the detailed model parameters and are determined mostly by the value of M5. To account for the current muon g -2 anomaly, M5 should be around 0.2 TeV, and the size of the extra dimension has to be quite large, l5≳10-7 m . For M5≳1 TeV , the clockwork graviton contributions are too small to explain the current muon g -2 anomaly. We also compare the clockwork graviton contributions with other extra dimensional models such as Randall-Sundrum models or large extra dimensional models. We find that the leading contributions in the small curvature limit are universal, but the cutoff-independent subleading contributions vary for different background geometries and the clockwork geometry gives the smallest subleading contributions.

  7. Rapid immunization effects of a new type of 60 μg hepatitis B vaccine compared with traditional 20 μg hepatitis B vaccines in adults.

    PubMed

    Wang, Huai; Cai, Binyu; Rao, Delong; Liu, Min; Li, Yabin; Liang, Xiaofeng; Cui, Fuqiang; Zhang, Guomin; Wang, Fuzhen; Pang, Xinghuo; Nie, Li; Qiu, Qian; Wu, Jiang; Li, Liqiu; Huang, Fang; Zhang, Wei

    2016-11-01

    The widely recommended standard schedule of hepatitis B vaccine for adults is months 0, 1 and 6, which takes 6 months to complete. Rapid completion of one vaccination schedule is important to adults because of its low compliance with follow-up doses. A new type of 60 μg Hepatitis B vaccine, made by Shenzhen Kangtai Biological Products Co., LTD., is originally recommended for low or non-responders. The objective of this clinical trial was to test whether this 60 μg hepatitis B vaccine could be used in primary immune population and what is its level of immunogenicity and safety compared with other hepatitis B vaccines. This is a 2-center randomized controlled study. A total of 1169 healthy adults aged between 25 and 55 who tested negative for HBsAg, anti-HBs, and anti-HBc were eligible for the study and were enrolled from relatively fixed and stable sites, such as villages, schools and large enterprises et al in Xuanhua county in Hebei province and Huaibei county in Anhui province. They were randomized to group A (20 μg Engerix-B® with 0, 1, 6 month intervals), group B (20 μg Kangtai hepatitis B vaccine with 0, 1, 6 month intervals), group C (60 μg Kangtai hepatitis B vaccine with 0, 2 month intervals) and group D (20 μg Huabei hepatitis B vaccine made by recombinant DNA techniques in CHO cell with 0, 1, 6 month intervals). In group A, B and D, every study object's blood sample was collected in the second month after their final injection to test the anti-HBs levels; while in group C, the blood sample was collected in the second month after the first and the second injection to test the anti-HBs levels. Adverse events were collected after each dose to assess the vaccines' safety. The seroprotection rates were 93.17%, 97.23%, 93.54% and 98.98% respectively and the geometric mean titers (GMTs) were 1033.38 mIU/ml, 600.75 mIU/ml, 265.69 mIU/ml and 1627.05 mIU/ml in group A,B,C and D respectively. The difference of seroprotection rate among the 4

  8. Microwave Observations and Modeling of O2 (1-delta(sub g)) and O3 Diurnal Variation in the Mesosphere

    NASA Technical Reports Server (NTRS)

    Sandor, Brad J.; Clancy, R. Todd; Rusch, David W.; Randall, Cora E.; Eckman, Richard S.; Siskind, David S.; Muhleman, Duane O.

    1997-01-01

    The first microwave measurements of an electronically excited molecular species in the Earth's atmosphere are presented. Local thermodynamic equilibrium (LTE) rotational line emission from mesospheric O2(1-del(sub g)) was observed at a frequency of 255.01794 GHz (lambda is approx. 1.2 mm), employing the National Radio Astronomy Observatory (NRAO) millimeter facility at Kitt Peak, Arizona (32 N, 111 W). The pressure broadened line shapes of the O2(1-del(sub g)) spectra, which were obtained in January and April 1992 and in January and November 1993, are inverted to retrieve O2(1-del(sub g)) mixing profiles over the 50-70 km altitude region. The observed daytime abundances exceed ozone abundances in the lower mesosphere, which are separately retrieved with coincident O3 spectral line (249.7886 GHz) observations. The January and November 1993 observations are binned into 20-60 min time intervals to study O2(1-del(sub g)) diurnal behavior. Derived abundances of O2(1-del(sub g)) between 50 and 70 km for the four observation dates are 9%, 31%, 3%, and 26%, respectively, each +/- 10% higher than predicted, based on the simple photochemistry of lower mesospheric O2(1-del(sub g)). Modeled variation of [O2(1-del(sub g))] with time of day agrees with observed variation in that the observed difference between model and data abundances is constant throughout the daylight hours of each observation date. Model underprediction Of [02(lAg)] is consistent with similar model underprediction of mesospheric [O3]. A perturbation to the photochemical model that forces decreased ozone chemical loss brings brings both model [O3] and [O2(1-del(sub g))] into agreement with the observations. O2(1-del(sub g)) abundances derived from these 1.2 mm observations agree with [O2(1-del(sub g))] values derived from comparable SME observations of the 1.27 micrometers emission, with assumption of a 3880 sec O2(1-del(sub g)) radiative lifetime. The 6800 sec O2(1-del(sub g)) radiative lifetime proposed by

  9. Crambescin C1 Exerts a Cytoprotective Effect on HepG2 Cells through Metallothionein Induction

    PubMed Central

    Roel, María; Rubiolo, Juan A.; Ternon, Eva; Thomas, Olivier P.; Vieytes, Mercedes R.; Botana, Luis M.

    2015-01-01

    The Mediterranean marine sponge Crambe crambe is the source of two families of guanidine alkaloids known as crambescins and crambescidins. Some of the biological effects of crambescidins have been previously reported while crambescins have undergone little study. Taking this into account, we performed comparative transcriptome analysis to examine the effect of crambescin-C1 (CC1) on human tumor hepatocarcinoma cells HepG2 followed by validation experiments to confirm its predicted biological activities. We report herein that, while crambescin-A1 has a minor effect on these cells, CC1 protects them against oxidative injury by means of metallothionein induction even at low concentrations. Additionally, at high doses, CC1 arrests the HepG2 cell cycle in G0/G1 and thus inhibits tumor cell proliferation. The findings presented here provide the first detailed approach regarding the different effects of crambescins on tumor cells and provide a basis for future studies on other possible cellular mechanisms related to these bioactivities. PMID:26225985

  10. DNA damage during the G0/G1 phase triggers RNA-templated, Cockayne syndrome B-dependent homologous recombination

    PubMed Central

    Wei, Leizhen; Nakajima, Satoshi; Böhm, Stefanie; Bernstein, Kara A.; Shen, Zhiyuan; Tsang, Michael; Levine, Arthur S.; Lan, Li

    2015-01-01

    Damage repair mechanisms at transcriptionally active sites during the G0/G1 phase are largely unknown. To elucidate these mechanisms, we introduced genome site-specific oxidative DNA damage and determined the role of transcription in repair factor assembly. We find that KU and NBS1 are recruited to damage sites independent of transcription. However, assembly of RPA1, RAD51C, RAD51, and RAD52 at such sites is strictly governed by active transcription and requires both wild-type Cockayne syndrome protein B (CSB) function and the presence of RNA in the G0/G1 phase. We show that the ATPase activity of CSB is indispensable for loading and binding of the recombination factors. CSB counters radiation-induced DNA damage in both cells and zebrafish models. Taken together, our results have uncovered a novel, RNA-based recombination mechanism by which CSB protects genome stability from strand breaks at transcriptionally active sites and may provide insight into the clinical manifestations of Cockayne syndrome. PMID:26100862

  11. DNA damage during the G0/G1 phase triggers RNA-templated, Cockayne syndrome B-dependent homologous recombination.

    PubMed

    Wei, Leizhen; Nakajima, Satoshi; Böhm, Stefanie; Bernstein, Kara A; Shen, Zhiyuan; Tsang, Michael; Levine, Arthur S; Lan, Li

    2015-07-07

    Damage repair mechanisms at transcriptionally active sites during the G0/G1 phase are largely unknown. To elucidate these mechanisms, we introduced genome site-specific oxidative DNA damage and determined the role of transcription in repair factor assembly. We find that KU and NBS1 are recruited to damage sites independent of transcription. However, assembly of RPA1, RAD51C, RAD51, and RAD52 at such sites is strictly governed by active transcription and requires both wild-type Cockayne syndrome protein B (CSB) function and the presence of RNA in the G0/G1 phase. We show that the ATPase activity of CSB is indispensable for loading and binding of the recombination factors. CSB counters radiation-induced DNA damage in both cells and zebrafish models. Taken together, our results have uncovered a novel, RNA-based recombination mechanism by which CSB protects genome stability from strand breaks at transcriptionally active sites and may provide insight into the clinical manifestations of Cockayne syndrome.

  12. Mangiferin induces cell cycle arrest at G2/M phase through ATR-Chk1 pathway in HL-60 leukemia cells.

    PubMed

    Peng, Z G; Yao, Y B; Yang, J; Tang, Y L; Huang, X

    2015-05-12

    This study aimed to determine the effect of mangiferin on the cell cycle in HL-60 leukemia cells and expression of the cell cycle-regulatory genes Wee1, Chk1 and CDC25C and to further investigate the molecular mechanisms of the antileukemic action of mangiferin. The inhibitory effect of mangiferin on HL-60 leukemia cell proliferation was determined by the MTT assay. The impact of mangiferin on the HL-60 cell cycle was evaluated by flow cytometry. After the cells were treated with different concentrations of mangiferin, the expression levels of Wee1, Chk1 and CDC25C mRNA were determined by RT-PCR, and Western blot was used to evaluate the expression levels of cdc25c, cyclin B1, and Akt proteins. The inhibition of HL-60 cell growth by mangiferin was dose- and time-dependent. After treatment for 24 h, cells in G2/M phase increased, and G2/M phase arrest appeared with increased mRNA expression of Wee1, Chk1 and CDC25C. Mangiferin inhibited Chk1 and cdc25c mRNA expression at high concentrations and induced Wee1 mRNA expression in a dose-dependent manner. It significantly inhibited ATR, Chk1, Wee1, Akt, and ERK1/2 phosphorylation but increased cdc2 and cyclin B1 phosphorylation. Furthermore, mangiferin reduced cdc25c, cyclin B1, and Akt protein levels while inducing Wee1 protein expression. It also antagonized the phosphorylation effect of vanadate on ATR, and the phosphorylation effect of EGF on Wee1. These findings indicated that mangiferin inhibits cell cycle progression through the ATR-Chk1 stress response DNA damage pathway, leading to cell cycle arrest at G2/M phase in leukemia cells.

  13. Critical Elements of Vehicle-to-Grid (V2G) Economics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Steward, Darlene M.

    This report explores the critical elements of V2G economics. Section 2 summarizes the elements and costs of a V2G system. Section 3 describes V2G revenue-generating services and the business cases for providing these services. Section 4 notes real-world V2G applications. Section 5 lists concerns related to V2G. Section 6 concludes and summarizes V2G cost and revenue elements.

  14. Chalcones suppress fatty acid-induced lipid accumulation through a LKB1/AMPK signaling pathway in HepG2 cells.

    PubMed

    Zhang, Tianshun; Yamamoto, Norio; Ashida, Hitoshi

    2014-06-01

    Excessive lipid accumulation in the liver has been proposed to cause hyperlipidemia, diabetes and fatty liver disease. 4-Hydroxyderricin (4HD), xanthoangelol (XAG), cardamonin (CAR) and flavokawain B (FKB) are chalcones that have exhibited various biological effects against obesity, inflammation, and diabetes; however, little is known about the inhibitory effects of these chalcones on fatty liver disease. In the present study, we investigated the ability of 4HD, XAG, CAR, and FKB to reduce lipid accumulation in hepatocytes. When HepG2 cells were treated with a mixture of fatty acids (FAs; palmitic acid : oleic acid = 1 : 2 ratio), significant lipid accumulation was observed. Under the same experimental conditions, addition of chalcones at 5 μM significantly suppressed the FA-induced lipid accumulation. We found that the expression of sterol regulatory element-binding protein-1 (SREBP-1), a key molecule involved in lipogenesis, was decreased in these chalcone-treated cells. We also found that these chalcones increased the expression of peroxisome proliferator-activated receptor α (PPARα), which is involved in FA oxidation. Moreover, these chalcones increased phosphorylation of AMP-activated protein kinase (AMPK) and liver kinase B1 (LKB1), upstream regulators of SREBP-1 and PPARα. We confirmed that an AMPK inhibitor, compound C, reversed chalcone-induced changes in SREBP-1 and PPARα expression in the HepG2 cells. Collectively, we found that 4HD, XAG, CAR, and XAG attenuated lipid accumulation through activation of the LKB1/AMPK signaling pathway in HepG2 cells.

  15. Parkin induces G2/M cell cycle arrest in TNF-α-treated HeLa cells.

    PubMed

    Lee, Min Ho; Cho, Yoonjung; Jung, Byung Chul; Kim, Sung Hoon; Kang, Yeo Wool; Pan, Cheol-Ho; Rhee, Ki-Jong; Kim, Yoon Suk

    2015-08-14

    Parkin is a known tumor suppressor. However, the mechanism by which parkin acts as a tumor suppressor remains to be fully elucidated. Previously, we reported that parkin expression induces caspase-dependent apoptotic cell death in TNF-α-treated HeLa cells. However, at that time, we did not consider the involvement of parkin in cell cycle control. In the current study, we investigated whether parkin is involved in cell cycle regulation and suppression of cancer cell growth. In our cell cycle analyses, parkin expression induced G2/M cell cycle arrest in TNF-α-treated HeLa cells. To elucidate the mechanism(s) by which parkin induces this G2/M arrest, we analyzed cell cycle regulatory molecules involved in the G2/M transition. Parkin expression induced CDC2 phosphorylation which is known to inhibit CDC2 activity and cause G2/M arrest. Cyclin B1, which is degraded during the mitotic transition, accumulated in response to parkin expression, thereby indicating parkin-induced G2/M arrest. Next, we established that Myt1, which is known to phosphorylate and inhibit CDC2, increased following parkin expression. In addition, we found that parkin also induces increased Myt1 expression, G2/M arrest, and reduced cell viability in TNF-α-treated HCT15 cells. Furthermore, knockdown of parkin expression by parkin-specific siRNA decreased Myt1 expression and phosphorylation of CDC2 and resulted in recovered cell viability. These results suggest that parkin acts as a crucial molecule causing cell cycle arrest in G2/M, thereby suppressing tumor cell growth. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. The structure, stability, and infrared spectrum of B 2N, B 2N +, B 2N -, BO, B 2O and B 2N 2.

    NASA Astrophysics Data System (ADS)

    Martin, J. M. L.; François, J. P.; Gijbels, R.

    1992-05-01

    The structure, infrared spectrum, and heat of formation of B 2N, B 2N -, BO, and B 2O have been studied ab initio. B 2N is very stable; B 2O even more so. B 2N, B 2N -, B 2O, and probably B 2N + have symmetric linear ground-state structures; for B 2O, an asymmetric linear structure lies about 12 kcal/mol above the ground state. B 2N +, B 2N - and B 2O have intense asymmetric stretching frequencies, predicted near 870, 1590 and 1400 cm -1, respectively. Our predicted harmonic frequencies and isotopic shifts for B 2O confirm the recent experimental identification by Andrews and Burkholder. Absorptions at 1889.5 and 1998.5 cm -1 in noble-gas trapped boron nitride vapor belong the BNB and BNBN ( 3Π), respectively; a tentative assignment of 882.5 cm -1 to BNB + is proposed. Total atomization energies Σ De (Σ D0) are computed (accuracy ±2 kcal/mol) as: BO 193.1 (190.4), B 2O 292.5 (288.7), B 2N 225.0 (250.3) kcal/mol. The ionization potential and electron affinity of B 2N are predicted to be 8.62±0.1 and 3.34±0.1 eV. The MP4-level additivity approximations involved in G1 theory results in errors on the order of 1 kcal/mol in the Σ De values.

  17. Disorder of G2-M Checkpoint Control in Aniline-Induced Cell Proliferation in Rat Spleen.

    PubMed

    Wang, Jianling; Wang, Gangduo; Khan, M Firoze

    2015-01-01

    Aniline, a toxic aromatic amine, is known to cause hemopoietic toxicity both in humans and animals. Aniline exposure also leads to toxic response in spleen which is characterized by splenomegaly, hyperplasia, fibrosis and the eventual formation of tumors on chronic in vivo exposure. Previously, we have shown that aniline exposure leads to iron overload, oxidative DNA damage, and increased cell proliferation, which could eventually contribute to a tumorigenic response in the spleen. Despite our demonstration that cell proliferation was associated with deregulation of G1 phase cyclins and increased expression of G1 phase cyclin-dependent kinases (CDKs), molecular mechanisms, especially the regulation of G2 phase and contribution of epigenetic mechanisms in aniline-induced splenic cellular proliferation remain largely unclear. This study therefore, mainly focused on the regulation of G2 phase in an animal model preceding a tumorigenic response. Male Sprague-Dawley rats were given aniline (0.5 mmol/kg/day) in drinking water or drinking water only (controls) for 30 days, and expression of G2 phase cyclins, CDK1, CDK inhibitors and miRNAs were measured in the spleen. Aniline treatment resulted in significant increases in cell cycle regulatory proteins, including cyclins A, B and CDK1, particularly phosphor-CDK1, and decreases in CDK inhibitors p21 and p27, which could promote the splenocytes to go through G2/M transition. Our data also showed upregulation of tumor markers Trx-1 and Ref-1 in rats treated with aniline. More importantly, we observed lower expression of miRNAs including Let-7a, miR-15b, miR24, miR-100 and miR-125, and greater expression of CDK inhibitor regulatory miRNAs such as miR-181a, miR-221 and miR-222 in the spleens of aniline-treated animals. Our findings suggest that significant increases in the expression of cyclins, CDK1 and aberrant regulation of miRNAs could lead to an accelerated G2/M transition of the splenocytes, and potentially to a

  18. Cutting edge: IL-21 is a switch factor for the production of IgG1 and IgG3 by human B cells.

    PubMed

    Pène, Jérôme; Gauchat, Jean-François; Lécart, Sandrine; Drouet, Elodie; Guglielmi, Paul; Boulay, Vera; Delwail, Adriana; Foster, Don; Lecron, Jean-Claude; Yssel, Hans

    2004-05-01

    IL-21 is a cytokine that regulates the activation of T and NK cells and promotes the proliferation of B cells activated via CD40. In this study, we show that rIL-21 strongly induces the production of all IgG isotypes by purified CD19(+) human spleen or peripheral blood B cells stimulated with anti-CD40 mAb. Moreover, it was found to specifically induce the production of IgG(1) and IgG(3) by CD40-activated CD19(+)CD27(-) naive human B cells. Although stimulation of CD19(+) B cells via CD40 alone induced gamma 1 and gamma 3 germline transcripts, as well as the expression of activation-induced cytidine deaminase, only stimulation with both anti-CD40 mAb and rIL-21 resulted in the production of S gamma/S mu switch circular DNA. These results show that IL-21, in addition to promoting growth and differentiation of committed B cells, is a specific switch factor for the production of IgG(1) and IgG(3).

  19. Induction of Fas receptor and Fas ligand by nodularin is mediated by NF-{kappa}B in HepG2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feng Gong, E-mail: gong-feng@northwestern.edu; Anong Biotech Institute, Tianjin; Li Ying

    Nodularin is a natural toxin with multiple features, including inhibitor of protein phosphatases 1 and 2A as well as tumor initiator and promoter. One unique feature of nodularin is that this chemical is a hepatotoxin. It can accumulate into the liver after contact and lead to severe damage to hepatocyte, such as apoptosis. Fas receptor (Fas) and Fas ligand (FasL) system is a critical signaling network triggering apoptosis. In current study, we investigated whether nodularin can induce Fas and FasL expression in HepG2 cell, a well used in vitro model for the study of human hepatocytes. Our data showed nodularinmore » induced Fas and FasL expression, at both mRNA and protein level, in a time- and dose-dependent manner. We also found nodularin induced apoptosis at the concentration and incubation time that Fas and FasL were significantly induced. Neutralizing antibody to FasL reduced nodularin-induced apoptosis. Further studies demonstrated that nodularin promoted nuclear translocation and activation of p65 subunit of NF-{kappa}B. By applying siRNA targeting p65, which knocked down p65 in HepG2 cells, we successfully impaired the activation of NF-{kappa}B by nodularin. In these p65 knockdown cells, we observed that Fas and FasL expression and apoptosis induced by nodularin were significantly reduced. These findings suggest the induction of Fas and FasL expression and thus cell apoptosis in HepG2 cells by nodularin is mediated through NF-{kappa}B pathway.« less

  20. Primary cilium suppression by SREBP1c involves distortion of vesicular trafficking by PLA2G3

    PubMed Central

    Gijs, Hannah Laura; Willemarck, Nicolas; Vanderhoydonc, Frank; Khan, Niamat Ali; Dehairs, Jonas; Derua, Rita; Waelkens, Etienne; Taketomi, Yoshitaka; Murakami, Makoto; Agostinis, Patrizia; Annaert, Wim; Swinnen, Johannes V.

    2015-01-01

    Distortion of primary cilium formation is increasingly recognized as a key event in many human pathologies. One of the underlying mechanisms involves aberrant activation of the lipogenic transcription factor sterol regulatory element–binding protein 1c (SREBP1c), as observed in cancer cells. To gain more insight into the molecular pathways by which SREBP1c suppresses primary ciliogenesis, we searched for overlap between known ciliogenesis regulators and targets of SREBP1. One of the candidate genes that was consistently up-regulated in cellular models of SREBP1c-induced cilium repression was phospholipase A2 group III (PLA2G3), a phospholipase that hydrolyzes the sn-2 position of glycerophospholipids. Use of RNA interference and a chemical inhibitor of PLA2G3 rescued SREBP1c-induced cilium repression. Cilium repression by SREBP1c and PLA2G3 involved alterations in endosomal recycling and vesicular transport toward the cilium, as revealed by aberrant transferrin and Rab11 localization, and was largely mediated by an increase in lysophosphatidylcholine and lysophosphatidylethanolamine levels. Together these findings indicate that aberrant activation of SREBP1c suppresses primary ciliogenesis by PLA2G3-mediated distortion of vesicular trafficking and suggest that PLA2G3 is a novel potential target to normalize ciliogenesis in SREBP1c-overexpressing cells, including cancer cells. PMID:25904332

  1. Jaceosidin, isolated from dietary mugwort (Artemisia princeps), induces G2/M cell cycle arrest by inactivating cdc25C-cdc2 via ATM-Chk1/2 activation.

    PubMed

    Lee, Jong-Gyu; Kim, Ji-Hyun; Ahn, Ji-Hye; Lee, Kyung-Tae; Baek, Nam-In; Choi, Jung-Hye

    2013-05-01

    Jaceosidin, a flavonoid derived from Artemisia princeps (Japanese mugwort), has been shown to inhibit the growth of several human cancer cells, However, the exact mechanism for the cytotoxic effect of jaceosidin is not completely understood. In this study, we investigated the molecular mechanism involved in the antiproliferative effect of jaceosidin in human endometrial cancer cells. We demonstrated that jaceosidin is a more potent inhibitor of cell growth than cisplatin in human endometrial cancer cells. In contrast, jaceosidin-induced cytotoxicity in normal endometrial cells was lower than that observed for cisplatin. Jaceosidin induced G2/M phase cell cycle arrest and modulated the levels of cyclin B and p-Cdc2 in Hec1A cells. Knockdown of p21 using specific siRNAs partially abrogated jaceosidin-induced cell growth inhibition. Additional mechanistic studies revealed that jaceosidin treatment resulted in an increase in phosphorylation of Cdc25C and ATM-Chk1/2. Ku55933, an ATM inhibitor, reversed jaceosidin-induced cell growth inhibition, in part. Moreover, jaceosidin treatment resulted in phosphorylation of ERK, and pretreatment with the ERK inhibitor, PD98059, attenuated cell growth inhibition by jaceosidin. These data suggest that jaceosidin, isolated from Japanese mugwort, modulates the ERK/ATM/Chk1/2 pathway, leading to inactivation of the Cdc2-cyclin B1 complex, followed by G2/M cell cycle arrest in endometrial cancer cells. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Influence of the Cyclooxygenase-2 Gene -765G/C and -1195G/A Polymorphisms on Development of Ischemic Stroke.

    PubMed

    Wu, Guangliang; Cai, Haiyan; Cai, Haobin; Chen, Zhao; Tan, Lei; Qin, Xiurong; Cai, Yefeng

    2016-09-01

    Many studies have investigated the association between the cyclooxygenase-2 (COX-2) gene polymorphism and ischemic stroke. However, results of these studies still remain controversial. To better explain the association between COX-2 polymorphisms (-765G/C and -1195G/A) and ischemic stroke risk, a meta-analysis was performed. Relevant studies were identified from 4 Chinese databases (Chinese Biological Medical Literature database, Chinese National Knowledge Infrastructure database, Chongqing VIP database, and Chinese WANFANG database), PUBMED and EMBASE prior to December 2015. The strength of association between COX-2 polymorphism and ischemic stroke was evaluated by the odds ratio (OR) with 95% confidence interval (CI). Inconsistency index (I(2)) and the Cochran's Q statistic were used to check heterogeneity. Publication bias was evaluated by funnel plots and Egger's regression test. A total of 4086 ischemic stroke cases and 4747 controls were identified. Significant association between COX-2 -765G/C polymorphism and the risk of ischemic stroke was found in Brazilians and the African-Americans. The OR of (CC+GC versus GG) for the Brazilians and African-Americans were (6.328, 95% CI = 2.295-17.448) and (1.644, 95% CI = 1.060-2.551). In addition, the recessive model of the Brazilians gave an OR of 3.621 (95% CI: 1.519-8.630). Furthermore, the (GC versus GG) and the allele model of the African-Americans were (OR: 1.615, 95% CI = 1.015-2.572) and (OR: 1.422, 95% CI = 1.033-1.957). Significant association was also observed for COX-2 -1195G/A polymorphism in the subtypes of small vessel disease (SVD) of ischemic stroke. Our study suggests that COX-2 -765G/C and -1195G/A polymorphisms may contribute to susceptibility of ischemic stroke, specifically in Brazilians and the African-Americans, and those of SVD. Copyright © 2016 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  3. 21 CFR 520.1696b - Penicillin G powder.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Penicillin G powder. 520.1696b Section 520.1696b... DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.1696b Penicillin G powder. (a) Specifications. Each gram of powder contains penicillin G potassium equivalent to 1.54 million units of...

  4. 21 CFR 520.1696b - Penicillin G powder.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Penicillin G powder. 520.1696b Section 520.1696b... DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.1696b Penicillin G powder. (a) Specifications. Each gram of powder contains penicillin G potassium equivalent to 1.54 million units of...

  5. Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2*

    PubMed Central

    Woodfolk, Judith A.; Glesner, Jill; Wright, Paul W.; Kepley, Christopher L.; Li, Mi; Himly, Martin; Muehling, Lyndsey M.; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D.; Pomés, Anna

    2016-01-01

    Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4+ T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. PMID:26644466

  6. Geniposide promotes autophagy to inhibit insulin resistance in HepG2 cells via P62/NF-κB/GLUT-4

    PubMed Central

    Jiang, Hongwei; Ma, Yujin; Yan, Junqiang; Liu, Jie; Li, Liping

    2017-01-01

    Insulin resistance (IR) is known to be an important factor, which can lead to the onset of type 2 diabetes. Autophagy is a cellular process, which sequesters senescent or damaged proteins in autophagosomes for recycling of their products. Insulin and intracellular molecules, including mammalian target of rapamycin (mTOR), are well-known inhibitors of autophagy. In patients with type 2 diabetes, the expression levels of glucose transporter 4 (GLUT-4) in skeletal muscles are significantly decreased, indicating decreased glucose-processing ability. Geniposide is an iridoid compound isolated from Gardenia jasminoides Ellis. Previously, it was reported that geniposide significantly promoted glucose uptake. In the present study, a HepG2 cell model of IR was constructed to determine whether geniposide can promote autophagy to inhibit insulin resistance in HepG2 cells via P62/nuclear factor (NF)-κB/GLUT-4. Cell proliferation was analyzed by performing an MTT assay, and the mRNA expression levels of NF-κB and GLUT-4 were assessed using semi-quantitative polymerase chain reaction and immunohistochemical staining. In addition, the protein levels of GLUT-4, P62 and phosphorylated-P65 were assessed by western blotting. The expression of GLUT-4 was initially increased following geniposide treatment, decreasing in time to its lowest level at 8 h. The expression levels of NF-κB and GLUT-4 in the IR cells treated with and without geniposide were significantly different, compared with those in the control group. Geniposide promoted autophagy in the IR HepG2 cells and significantly improved IR in the HepG2 cells, which may be associated with the dynamic regulation of the P62/NF-κB/GLUT-4 pathway. PMID:28944847

  7. Polyphyllin G exhibits antimicrobial activity and exerts anticancer effects on human oral cancer OECM-1 cells by triggering G2/M cell cycle arrest by inactivating cdc25C-cdc2.

    PubMed

    Cai, Xiaoqing; Guo, Lele; Pei, Fei; Chang, Xiaoyun; Zhang, Rui

    2018-04-15

    Plant natural products have long been considered to be important sources of bioactive molecules. A large number of antimicrobial and anticancer agents have been isolated form plants. In the present study we evaluated the antimicrobial and anticancer activity of a plant derived secondery metabolite, Polyphyllin G. The results of antibacterial assays showed that Polyphyllin G prevented the growth of both Gram-positive and Gram-negative bacteria with minimum inhibitory concentrations (MICs) ranging from 13.1 to 78 μg/ml. Antifungal activity measured as inhibition of mycelium growth ranged between 38.32 and 56.50%. Further Polyphyllin G was also evaluated against a panel of cancer cell lines. The IC 50 of Polyphyllin G ranged from 10 to 65 μM. However the IC 50 of Polyphyllin G was found to be comparatively high (120 μM) against the normal FR2 cancer cell line. The lowest IC 50 of 10 μM was found against the oral cancer cell line OECM-1. Therefore further studies were carried out on this cell line only. Our results indicated that Polyphyllin G induced cell arrest in oral cancer OECM-1 cells by inactivation of cdc25C-cdc22 via ATM-Chk 1/2 stimulation. Therefore, we propose that Polyphyllin G might prove a lead molecule in the management of oral cancers and at the same time may prevent the growth of opportunistic microbes. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Status of the semileptonic B decays and muon g-2 in general 2HDMs with right-handed neutrinos

    NASA Astrophysics Data System (ADS)

    Iguro, Syuhei; Omura, Yuji

    2018-05-01

    In this paper, we study the extended Standard Model (SM) with an extra Higgs doublet and right-handed neutrinos. If the symmetry to distinguish the two Higgs doublets is not assigned, flavor changing neutral currents (FCNCs) involving the scalars are predicted even at the tree level. We investigate the constraints on the FCNCs at the one-loop level, and especially study the semileptonic B meson decays, e.g. B → D (∗) τ ν and B → K (∗) ll processes, where the SM predictions are more than 2 σ away from the experimental results. We also consider the flavor-violating couplings involving right-handed neutrinos and discuss if the parameters to explain the excesses of the semileptonic B decays can resolve the discrepancy in the anomalous muon magnetic moment. Based on the analysis, we propose the smoking-gun signals of our model at the LHC.

  9. FTO promotes SREBP1c maturation and enhances CIDEC transcription during lipid accumulation in HepG2 cells.

    PubMed

    Chen, Ao; Chen, Xiaodong; Cheng, Shiqiang; Shu, Le; Yan, Meiping; Yao, Lun; Wang, Binyu; Huang, Shuguang; Zhou, Lei; Yang, Zaiqing; Liu, Guoquan

    2018-05-01

    The fat mass and obesity-associated (FTO) gene is tightly related to body weight and fat mass, and plays a pivotal role in regulating lipid accumulation in hepatocytes. However, the mechanisms underlying its function are poorly understood. Sterol regulatory element binding protein-1c (SREBP1c) is a transcription factor that regulates lipogenesis. Cell death-inducing DFFA (DNA fragmentation factor-α)-like effector c (CIDEC) plays a crucial role in lipid droplets (LDs) size controlling and lipid accumulation. In this report, we first observed that FTO overexpression in HepG2 cells resulted in an increase of lipogenesis and up-regulation of SREBP1c and CIDEC, two key regulatory factors in lipogenesis. In contrast, FTO knockdown in HepG2 cells resulted in a decrease of lipogenesis and down-regulation of SREBP1c and CIDEC expression. Moreover, SREBP1c knockdown resulted in a decrease of lipogenesis in HepG2 cells with FTO overexpression. In addition, FTO demethylation defect mutant presented less transcription of the key genes, and less nuclear translocation and maturation of SREBP1c. Further investigation demonstrated that overexpression of SREBP1c in HepG2 cells also promoted high CIDEC expression. Luciferase reporter assays showed that SREBP1c significantly stimulated CIDEC gene promoter activity. Finally, CIDEC knockdown reduced SREBP1c-induced lipogenesis. In conclusion, our studies suggest that FTO increased the lipid accumulation in hepatocytes by increasing nuclear translocation of SREBP1c and SREBP1c maturation, thus improving the transcriptional activity of LD-associated protein CIDEC. Our studies may provide new mechanistic insight into nonalcoholic fatty liver disease (NAFLD) mediated by FTO. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  10. HBV X Protein induces overexpression of HERV-W env through NF-κB in HepG2 cells.

    PubMed

    Liu, Cong; Liu, Lijuan; Wang, Xiuling; Liu, Youyi; Wang, Miao; Zhu, Fan

    2017-12-01

    Human endogenous retrovirus W family (HERV-W) envelope (env) at chromosome 7 is highly expressed in the placenta and possesses fusogenic activity in trophoblast development. HERV-W env has been found to be overexpressed in some cancers and immune diseases. Viral transactivators can induce the overexpression of HERV-W env in human cell lines. Hepatitis B virus X protein (HBx) is believed to be a multifunctional oncogenic protein. Here, we reported that HBx could increase the promoter activity of HERV-W env and upregulate the mRNA levels of non-spliced and spliced HERV-W env and also its protein in human hepatoma HepG2 cells. Interestingly, we found that the inhibition of nuclear factor κB (NF-κB) using shRNA targeting NF-κB/p65 or PDTC (an inhibitor of NF-κB) could attenuate the upregulation of HERV-W env induced by HBx. These suggested that HBx might upregulate the expression of HERV-W env through NF-κB in HepG2 cells. This study might provide a new insight in HBV-associated liver diseases including HCC.

  11. α-Methyl artoflavanocoumarin from Juniperus chinensis exerts anti-diabetic effects by inhibiting PTP1B and activating the PI3K/Akt signaling pathway in insulin-resistant HepG2 cells.

    PubMed

    Jung, Hee Jin; Seong, Su Hui; Ali, Md Yousof; Min, Byung-Sun; Jung, Hyun Ah; Choi, Jae Sue

    2017-12-01

    Diabetes mellitus is one of the greatest global health issues and much research effort continues to be directed toward identifying novel therapeutic agents. Insulin resistance is a challenging integrally related topic and molecules capable of overcoming it are of considerable therapeutic interest in the context of type 2 diabetes mellitus (T2DM). Protein tyrosine phosphatase 1B (PTP1B) negatively regulates insulin signaling transduction and is regarded a novel therapeutic target in T2DM. Here, we investigated the inhibitory effect of α-methyl artoflavanocoumarin (MAFC), a natural flavanocoumarin isolated from Juniperus chinensis, on PTP1B in insulin-resistant HepG2 cells. MAFC was found to potently inhibit PTP1B with an IC 50 of 25.27 ± 0.14 µM, and a kinetics study revealed MAFC is a mixed type PTP1B inhibitor with a K i value of 13.84 µM. Molecular docking simulations demonstrated MAFC can bind to catalytic and allosteric sites of PTP1B. Furthermore, MAFC significantly increased glucose uptake and decreased the expression of PTP1B in insulin-resistant HepG2 cells, down-regulated the phosphorylation of insulin receptor substrate (IRS)-1 (Ser307), and dose-dependently enhanced the protein levels of IRS-1, phosphorylated phosphoinositide 3-kinase (PI3K), Akt, and ERK1. These results suggest that MAFC from J. chinensis has therapeutic potential in T2DM by inhibiting PTP1B and activating insulin signaling pathways.

  12. Photocatalytic decomposition of N2O over TiO2/g-C3N4 photocatalysts heterojunction

    NASA Astrophysics Data System (ADS)

    Kočí, K.; Reli, M.; Troppová, I.; Šihor, M.; Kupková, J.; Kustrowski, P.; Praus, P.

    2017-02-01

    TiO2/g-C3N4 photocatalysts with the various TiO2/g-C3N4 weight ratios from 1:2 to 1:6 were fabricated by mechanical mixing in water suspension followed by calcination. Pure TiO2 was prepared by thermal hydrolysis and pure g-C3N4 was prepared from commercial melamine by thermal annealing at 620 °C. All the nanocomposites were characterized by X-ray powder diffraction, UV-vis diffuse reflectance spectroscopy, Raman spectroscopy, infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, photoelectrochemical measurements and nitrogen physisorption. The prepared mixtures along with pure TiO2 and g-C3N4 were tested for the photocatalytic decomposition of nitrous oxide under UVC (λ = 254 nm), UVA (λ = 365 nm) and Vis (λ > 400 nm) irradiation. The TiO2/g-C3N4 nanocomposites showed moderate improvement compared to pure g-C3N4 but pure TiO2 proved to be a better photocatalyst under UVC irradiation. However, under UVA irradiation conditions, the photocatalytic activity of TiO2/g-C3N4 (1:2) nanocomposite exhibited an increase compared to pure TiO2. Nevertheless, further increase of g-C3N4 amount leads/led to a decrease in reactivity. These results are suggesting the nanocomposite with the optimal weight ratio of TiO2 and g-C3N4 have shifted absorption edge energy towards longer wavelengths and decreased the recombination rate of charge carriers compared to pure g-C3N4. This is probably due to the generation of heterojunction on the TiO2/g-C3N4 interface.

  13. IgG1 memory B cells keep the memory of IgE responses.

    PubMed

    He, Jin-Shu; Subramaniam, Sharrada; Narang, Vipin; Srinivasan, Kandhadayar; Saunders, Sean P; Carbajo, Daniel; Wen-Shan, Tsao; Hidayah Hamadee, Nur; Lum, Josephine; Lee, Andrea; Chen, Jinmiao; Poidinger, Michael; Zolezzi, Francesca; Lafaille, Juan J; Curotto de Lafaille, Maria A

    2017-09-21

    The unique differentiation of IgE cells suggests unconventional mechanisms of IgE memory. IgE germinal centre cells are transient, most IgE cells are plasma cells, and high affinity IgE is produced by the switching of IgG1 cells to IgE. Here we investigate the function of subsets of IgG1 memory B cells in IgE production and find that two subsets of IgG1 memory B cells, CD80 + CD73 + and CD80 - CD73 - , contribute distinctively to the repertoires of high affinity pathogenic IgE and low affinity non-pathogenic IgE. Furthermore, repertoire analysis indicates that high affinity IgE and IgG1 plasma cells differentiate from rare CD80 + CD73 + high affinity memory clones without undergoing further mutagenesis. By identifying the cellular origin of high affinity IgE and the clonal selection of high affinity memory B cells into the plasma cell fate, our findings provide fundamental insights into the pathogenesis of allergies, and on the mechanisms of antibody production in memory B cell responses.IgE is an important mediator of protective immunity as well as allergic reaction, but how high affinity IgE antibodies are produced in memory responses is not clear. Here the authors show that IgE can be generated via class-switch recombination in IgG1 memory B cells without additional somatic hypermutation.

  14. Towards generalized mirror symmetry for twisted connected sum G 2 manifolds

    NASA Astrophysics Data System (ADS)

    Braun, Andreas P.; Del Zotto, Michele

    2018-03-01

    We revisit our construction of mirror symmetries for compactifications of Type II superstrings on twisted connected sum G 2 manifolds. For a given G 2 manifold, we discuss evidence for the existence of mirror symmetries of two kinds: one is an autoequivalence for a given Type II superstring on a mirror pair of G 2 manifolds, the other is a duality between Type II strings with different chiralities for another pair of mirror manifolds. We clarify the role of the B-field in the construction, and check that the corresponding massless spectra are respected by the generalized mirror maps. We discuss hints towards a homological version based on BPS spectroscopy. We provide several novel examples of smooth, as well as singular, mirror G 2 backgrounds via pairs of dual projecting tops. We test our conjectures against a Joyce orbifold example, where we reproduce, using our geometrical methods, the known mirror maps that arise from the SCFT worldsheet perspective. Along the way, we discuss non-Abelian gauge symmetries, and argue for the generation of the Affleck-Harvey-Witten superpotential in the pure SYM case.

  15. (2 + 1) resonant enhanced multiphoton ionization of H2 via the E,F 1Sigma(+)g state

    NASA Technical Reports Server (NTRS)

    Rudolph, H.; Lynch, D. L.; Dixit, S. N.; Mckoy, V.; Huo, Winifred M.

    1987-01-01

    In this paper, the results of ab initio calculations of photoelectron angular distributions and vibrational branching ratios for the (2 + 1) resonant enhanced multiphoton ionization (REMPI) of H2 via the E,F 1Sigma(+)g state are reported, and these are compared with the experimental data of Anderson et al. (1984). These results show that the observed non-Franck-Condon behavior is predominantly due to the R dependence of the transition matrix elements, and to a lesser degree to the energy dependence. This work presents the first molecular REMPI study employing a correlated wave function to describe the Rydberg-valence mixing in the resonant intermediate state.

  16. Infant HIV Type 1 gp120 Vaccination Elicits Robust and Durable Anti-V1V2 Immunoglobulin G Responses and Only Rare Envelope-Specific Immunoglobulin A Responses

    PubMed Central

    Fouda, Genevieve G.; Cunningham, Coleen K.; McFarland, Elizabeth J.; Borkowsky, William; Muresan, Petronella; Pollara, Justin; Song, Lin Ye; Liebl, Brooke E.; Whitaker, Kaylan; Shen, Xiaoying; Vandergrift, Nathan A.; Overman, R. Glenn; Yates, Nicole L.; Moody, M. Anthony; Fry, Carrie; Kim, Jerome H.; Michael, Nelson L.; Robb, Merlin; Pitisuttithum, Punnee; Kaewkungwal, Jaranit; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Liao, Hua-Xin; Haynes, Barton F.; Montefiori, David C.; Ferrari, Guido; Tomaras, Georgia D.; Permar, Sallie R.

    2015-01-01

    Background Infant responses to vaccines can be impeded by maternal antibodies and immune system immaturity. It is therefore unclear whether human immunodeficiency virus type 1 (HIV-1) vaccination would elicit similar responses in adults and infants. Method HIV-1 Env–specific antibody responses were evaluated in 2 completed pediatric vaccine trials. In the Pediatric AIDS Clinical Trials Group (PACTG) 230 protocol, infants were vaccinated with 4 doses of Chiron rgp120 with MF59 (n = 48), VaxGen rgp120 with aluminum hydroxide (alum; n = 49), or placebo (n = 19) between 0 and 20 weeks of age. In PACTG 326, infants received 4 doses of ALVAC-HIV-1/AIDSVAX B/B with alum (n = 9) or placebo (n = 13) between 0 and 12 weeks of age. Results By 52 weeks of age, the majority of maternally acquired antibodies had waned and vaccine Env-specific immunoglobulin G (IgG) responses in vaccinees were higher than in placebo recipients. Chiron vaccine recipients had higher and more-durable IgG responses than VaxGen vaccine recipients or ALVAC/AIDSVAX vaccinees, with vaccine-elicited IgG responses still detectable in 56% of recipients at 2 years of age. Remarkably, at peak immunogenicity, the concentration of anti-V1V2 IgG, a response associated with a reduced risk of HIV-1 acquisition in the RV144 adult vaccine trial, was 22-fold higher in Chiron vaccine recipients, compared with RV144 vaccinees. Conclusion As exemplified by the Chiron vaccine regimen, vaccination of infants against HIV-1 can induce robust, durable Env-specific IgG responses, including anti-V1V2 IgG. PMID:25170104

  17. Antigenic Determinants of the Bilobal Cockroach Allergen Bla g 2.

    PubMed

    Woodfolk, Judith A; Glesner, Jill; Wright, Paul W; Kepley, Christopher L; Li, Mi; Himly, Martin; Muehling, Lyndsey M; Gustchina, Alla; Wlodawer, Alexander; Chapman, Martin D; Pomés, Anna

    2016-01-29

    Bla g 2 is a major indoor cockroach allergen associated with the development of asthma. Antigenic determinants on Bla g 2 were analyzed by mutagenesis based on the structure of the allergen alone and in complex with monoclonal antibodies that interfere with IgE antibody binding. The structural analysis revealed mechanisms of allergen-antibody recognition through cation-π interactions. Single and multiple Bla g 2 mutants were expressed in Pichia pastoris and purified. The triple mutant K132A/K251A/F162Y showed an ∼100-fold reduced capacity to bind IgE, while preserving the native molecular fold, as proven by x-ray crystallography. This mutant was still able to induce mast cell release. T-cell responses were assessed by analyzing Th1/Th2 cytokine production and the CD4(+) T-cell phenotype in peripheral blood mononuclear cell cultures. Although T-cell activating capacity was similar for the KKF mutant and Bla g 2 based on CD25 expression, the KKF mutant was a weaker inducer of the Th2 cytokine IL-13. Furthermore, this mutant induced IL-10 from a non-T-cell source at higher levels that those induced by Bla g 2. Our findings demonstrate that a rational design of site-directed mutagenesis was effective in producing a mutant with only 3 amino acid substitutions that maintained the same fold as wild type Bla g 2. These residues, which were involved in IgE antibody binding, endowed Bla g 2 with a T-cell modulatory capacity. The antigenic analysis of Bla g 2 will be useful for the subsequent development of recombinant allergen vaccines. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Integral cross sections for the direct excitation of the A 3 (sigma) u +, B 3 (pi) g, W 3 (delta) u, B' 3 (sigma) u -, a' 1 (sigma) u -, a 1 (pi) g, w 1 (delta) u, and C 3 (pi) u electronic states in

    NASA Technical Reports Server (NTRS)

    Johnson, P. V.; Malone, C. P.; Kanik, I.

    2005-01-01

    Integral cross sections for electron impact excitation out of the ground state (X 1(sigma)g +) to the A 3(sigma)u +, B 3(pi)g, W 3(delta)u, B' 3(sigma)u -, a' 1(sigma)u -, a 1(pi)g, w 1(delta)u, and states in N2 are reported at incident energies ranging between 10 and 100 eV. These data have been derived by integrating differential cross sections previously reported by this group. New differential cross section measurements for the a 1(pi)g state at 200 eV are also presented to extend the range of the reported integral cross sections for this state, which is responsible for the emissions of the Lyman-Birge-Hopfield band system (a 1(pi)g (rightwards arrow) X 1(sigma)g +). The present results are compared and critically evaluated against existing cross sec In general, the present cross sections are smaller than previous results at low impact energies from threshold through the excitation function peak regions. These lower cross sections have potentially significant implications on our understanding of UV emissions in the atmospheres of Earth and Titan.

  19. Nonadiabatic dynamics of O({sup 1}D) + N{sub 2}(X{sup 1}{Sigma}{sub g}{sup +}){yields}O({sup 3}P) + N{sub 2}(X{sup 1}{Sigma}{sub g}{sup +}) on three coupled potential surfaces: Symmetry, Coriolis, spin-orbit, and Renner-Teller effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Defazio, Paolo; Gamallo, Pablo; Petrongolo, Carlo

    2012-02-07

    We present the spin-orbit (SO) and Renner-Teller (RT) quantum dynamics of the spin-forbidden quenching O({sup 1}D) + N{sub 2}(X{sup 1}{Sigma}{sub g}{sup +}){yields}O({sup 3}P) + N{sub 2}(X{sup 1}{Sigma}{sub g}{sup +}) on the N{sub 2}O X-tilde{sup 1}A{sup '}, a-tilde{sup 3}A', and b-tilde{sup 3}A{sup '} coupled PESs. We use the permutation-inversion symmetry, propagate coupled-channel (CC) real wavepackets, and compute initial-state-resolved probabilities and cross sections {sigma}{sub j0} for the ground vibrational and the first two rotational states of N{sub 2}, j{sub 0}= 0 and 1. Labeling symmetry angular states by j and K, we report selection rules for j and for the minimum Kmore » value associated with any electronic state, showing that a-tilde{sup 3}A' is uncoupled in the centrifugal-sudden (CS) approximation at j{sub 0}= 0. The dynamics is resonance-dominated, the probabilities are larger at low K, {sigma}{sub j0} decrease with the collision energy and increase with j{sub 0}, and the CS {sigma}{sub 0} is lower than the CC one. The nonadiabatic interactions play different roles on the quenching dynamics, because the X-tilde{sup 1}A{sup '}-b-tilde{sup 3}A{sup '} SO effects are those most important while the a-tilde{sup 3}A'-b-tilde{sup 3}A{sup '} RT ones are negligible.« less

  20. ON THE EXPANSION RATE, AGE, AND DISTANCE OF THE SUPERNOVA REMNANT G266.21.2 (Vela Jr.)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Allen, G. E.; Chow, K.; DeLaney, T.

    An analysis of Chandra ACIS data for two relatively bright and narrow portions of the northwestern rim of G266.21.2 (a.k.a. RX J0852.0-4622 or Vela Jr.) reveal evidence of a radial displacement of 2.40 ± 0.56 arcsec between 2003 and 2008. The corresponding expansion rate (0.42 ± 0.10 arcsec yr{sup –1} or 13.6% ± 4.2% kyr{sup –1}) is about half the rate reported for an analysis of XMM-Newton data from a similar, but not identical, portion of the rim over a similar, but not identical, time interval (0.84 ± 0.23 arcsec yr{sup –1}). If the Chandra rate is representative of the remnant as amore » whole, then the results of a hydrodynamic analysis suggest that G266.21.2 is between 2.4 and 5.1 kyr old if it is expanding into a uniform ambient medium (whether or not it was produced by a Type Ia or Type II event). If the remnant is expanding into the material shed by a steady stellar wind, then the age could be as much as 50% higher. The Chandra expansion rate and a requirement that the shock speed be greater than or equal to 1000 km s{sup –1} yields a lower limit on the distance of 0.5 kpc. An analysis of previously published distance estimates and constraints suggests G266.21.2 is no further than 1.0 kpc. This range of distances is consistent with the distance to the nearer of two groups of material in the Vela Molecular Ridge (0.7 ± 0.2 kpc) and to the Vel OB1 association (0.8 kpc)« less

  1. Reduced carriership of 4G allele of plasminogen activator inhibitor-1 4G/5G polymorphism in very young survivors of myocardial infarction.

    PubMed

    Rallidis, Loukianos S; Gialeraki, Argyri; Merkouri, Efrosyni; Liakos, George; Dagres, Nikolaos; Sionis, Dimitrios; Travlou, Anthi; Lekakis, John; Kremastinos, Dimitrios T

    2010-05-01

    There are limited and controversial data regarding the impact of 4G/5G polymorphism of the plasminogen activator inhibitor-1 (PAI-1) gene in the pathogenesis of premature myocardial infarction (MI). We explored whether 4G/5G polymorphism of the PAI-1 gene is associated with the development of MI 2 +/- 3.4 years). The control group consisted of 140 healthy individuals matched with cases for age and sex, without a family history of premature coronary heart disease. 4G/5G polymorphism of PAI-1 was tested with polymerase chain reaction and reverse hybridization. 4G allele carriers (4G/4G and 4G/5G genotypes) of PAI-1 were less frequent in patients than in controls (69.6 vs. 83.6%, P = 0.007). 4G carriership of the polymorphism of PAI-1 was associated with lower risk for acute MI (odds ratio 0.45, 95% confidence interval 0.23-0.88, P = 0.02) after adjusting for major cardiovascular risk factors. Patients possessing the 4G allele had higher PAI-1 plasma levels (32.2 +/- 25 vs. 22.2 +/- 11.3 ng/ml, P = 0.006) but lower lipoprotein(a) levels (10.1 [2.1-29.9] vs. 15.3 [8.2-57.1] mg/dl, P = 0.03) compared to 5G/5G homozygotes. Our data indicate that the 4G allele of the PAI-1 4G/5G polymorphism is less frequent among survivors of MI at very young age compared with matched controls.

  2. 16 CFR Appendix G2 to Part 305 - Furnaces-Electric

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Furnaces-Electric G2 Appendix G2 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Furnaces—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

  3. 16 CFR Appendix G2 to Part 305 - Furnaces-Electric

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Furnaces-Electric G2 Appendix G2 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Furnaces—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

  4. 16 CFR Appendix G2 to Part 305 - Furnaces-Electric

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Furnaces-Electric G2 Appendix G2 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Furnaces—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

  5. 16 CFR Appendix G2 to Part 305 - Furnaces-Electric

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Furnaces-Electric G2 Appendix G2 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING... Part 305—Furnaces—Electric Manufacturer's rated heating capacities (Btu's/hr.) Range of annual fuel...

  6. Metabolomic effects of CeO2, SiO2 and CuO metal oxide nanomaterials on HepG2 cells

    EPA Science Inventory

    To better assess potential hepatotoxicity of nanomaterials, human liver HepG2 cells were exposed for 3 days to five different CeO2 (either 30 or 100 μg/ml), 3 SiO2 based (30 μg/ml) or 1 CuO (3 μg/ml) nanomaterials with dry primary particle sizes ranging from 15 to 213 nm. Metabol...

  7. A Herpes Simplex Virus 2 (HSV-2) gD Mutant Impaired for Neural Tropism Is Superior to an HSV-2 gD Subunit Vaccine To Protect Animals from Challenge with HSV-2.

    PubMed

    Wang, Kening; Goodman, Kyle N; Li, Daniel Y; Raffeld, Mark; Chavez, Mayra; Cohen, Jeffrey I

    2016-01-01

    A recent phase 3 trial with soluble herpes simplex virus 2 (HSV-2) glycoprotein D (gD2t) in adjuvant failed to show protection against genital herpes. We postulated that live attenuated HSV-2 would provide more HSV antigens for induction of virus-specific antibodies and cellular immunity than would gD2t. We previously reported an HSV-2 mutant, HSV2-gD27, in which the nectin-1 binding domain of gD2 is altered so that the virus is impaired for infecting neural cells, but not epithelial cells, in vitro and is impaired for infecting dorsal root ganglia in mice (K. Wang, J. D. Kappel, C. Canders, W. F. Davila, D. Sayre, M. Chavez, L. Pesnicak, and J. I. Cohen, J Virol 86:12891-12902, 2012, doi:10.1128/JVI.01055-12). Here we report that the mutations in HSV2-gD27 were stable when the virus was passaged in cell culture and during acute infection of mice. HSV2-gD27 was attenuated in mice when it was inoculated onto the cornea, intramuscularly (i.m.), intravaginally, and intracranially. Vaccination of mice i.m. with HSV2-gD27 provided better inhibition of challenge virus replication in the vagina than when the virus was used to vaccinate mice intranasally or subcutaneously. Comparison of i.m. vaccinations with HSV2-gD27 versus gD2t in adjuvant showed that HSV2-gD27 induced larger reductions of challenge virus replication in the vagina and reduced latent viral loads in dorsal root ganglia but induced lower serum neutralizing antibody titers than those obtained with gD2t in adjuvant. Taken together, our data indicate that a live attenuated HSV-2 vaccine impaired for infection of neurons provides better protection from vaginal challenge with HSV-2 than that obtained with a subunit vaccine, despite inducing lower titers of HSV-2 neutralizing antibodies in the serum. Genital herpes simplex is one of the most prevalent sexually transmitted diseases. Though HSV-2 disease is usually mild, it can be life threatening in neonates and immunocompromised persons. In addition, genital

  8. Selective cytotoxicity of PAMAM G5 core–PAMAM G2.5 shell tecto-dendrimers on melanoma cells

    PubMed Central

    Schilrreff, Priscila; Mundiña-Weilenmann, Cecilia; Romero, Eder Lilia; Morilla, Maria Jose

    2012-01-01

    Background The controlled introduction of covalent linkages between dendrimer building blocks leads to polymers of higher architectural order known as tecto-dendrimers. Because of the few simple steps involved in their synthesis, tecto-dendrimers could expand the portfolio of structures beyond commercial dendrimers, due to the absence of synthetic drawbacks (large number of reaction steps, excessive monomer loading, and lengthy chromatographic separations) and structural constraints of high-generation dendrimers (reduction of good monodispersity and ideal dendritic construction due to de Gennes dense-packing phenomenon). However, the biomedical uses of tecto-dendrimers remain unexplored. In this work, after synthesizing saturated shell core–shell tecto-dendrimers using amine-terminated polyamidoamine (PAMAM) generation 5 (G5) as core and carboxyl-terminated PAMAM G2.5 as shell (G5G2.5 tecto-dendrimers), we surveyed for the first time the main features of their interaction with epithelial cells. Methods Structural characterization of G5G2.5 was performed by polyacrylamide gel electrophoresis, matrix-assisted laser desorption time-of-flight mass spectrometry, and microscopic techniques; their hydrodynamic size and Z-potential was also determined. Cellular uptake by human epidermal keratinocytes, colon adenocarcinoma, and epidermal melanoma (SK-Mel-28) cells was determined by flow cytometry. Cytotoxicity was determined by mitochondrial activity, lactate dehydrogenase release, glutathione depletion, and apoptosis/necrosis measurement. Results The resultant 60%–67% saturated shell, 87,000-dalton G5G2.5 (mean molecular weight) interacted with cells in a significantly different fashion in comparison to their building blocks and to its closest counterpart, PAMAM G6.5. After being actively taken up by epithelial cells, G5G2.5 caused cytotoxicity only on SK-Mel-28 cells, including depletion of intracellular glutathione and fast necrosis that was manifested above 5 μM G5

  9. Muon g-2 Experiment Shimming

    ScienceCinema

    Kiburg, Brendan

    2018-01-16

    The Muon g-2 experiment at Fermilab will use as its primary instrument a 52-foot-wide electromagnet that creates a precise magnetic field. In this video, Fermilab's Brendan Kiburg explains the lengthy process of finely "shimming" that magnetic field into shape.

  10. The BTNL2 G16071A gene polymorphism increases granulomatous disease susceptibility

    PubMed Central

    Tong, Xiang; Ma, Yao; Niu, Xundong; Yan, Zhipeng; Liu, Sitong; Peng, Bo; Peng, Shifeng; Fan, Hong

    2016-01-01

    Abstract Objective: The butyrophilin-like 2 (BTNL2) G16071A gene polymorphism has been implicated in the susceptibility to granulomatous diseases, but the results were inconclusive. The objective of the current study was to precisely explore the relationship between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility by the meta-analysis including false-positive report probability (FPRP) test. Methods: A systematic literature search in the PubMed, Embase, and Wanfang databases, China National Knowledge Internet, and commercial Internet search engines was conducted to identify studies published up to April 1, 2016. The odds ratio (OR) with 95% confidence interval (CI) was used to assess the effect size. Statistical analysis was conducted using the STATA 12.0 software and FPRP test sheet. Results: In total, all 4324 cases and 4386 controls from 14 eligible studies were included in the current meta-analysis. By the overall meta-analysis, we found a significant association between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility (A vs G: OR = 1.25, 95% CI = 1.07–1.45, P = 0.005). The meta-regression analyses showed that a large proportion of the between-study heterogeneity was significantly attributed to the ethnicity (A vs G, P = 0.013) and the types of granulomatous diseases (A vs G, P = 0.002). By the subgroup meta-analysis, the BTNL2 G16071A gene polymorphism was associated with granulomatous disease susceptibility in Caucasians (A vs G: OR = 1.37, 95% CI = 1.18–1.58, P < 0.001). Moreover, a significant relationship between the BTNL2 G16071A gene polymorphism and sarcoidosis susceptibility (A vs G: OR = 1.52, 95% CI = 1.39–1.66, P < 0.001) was found. However, to avoid the “false-positive report,” we further investigated the significant associations observed in the present meta-analysis by the FPRP test. Interestingly, the results of FPRP test indicated that the BTNL2

  11. Enhanced expression of rat hepatic CYP2B1/2B2 and 2E1 by pyridine: differential induction kinetics and molecular basis of expression.

    PubMed

    Kim, H; Putt, D; Reddy, S; Hollenberg, P F; Novak, R F

    1993-11-01

    Expression of the cytochrome P450 (CYP) 2B subfamily in rat and rabbit hepatic tissues after pyridine (PY) treatment has been examined, and the molecular basis for enhanced 2B1/2B2 expression has been determined. P450 expression was monitored using metabolic activity, sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblot analyses, and the identity of the proteins was confirmed through N-terminus microsequence analysis. PY caused a dose-dependent elevation of hepatic CYP2B1/B2B levels in rats, which ranged from 4- to 22-fold over the dosing regimen of 100 to 400 mg PY/kg/day, for 3 days, respectively. PY at low dose failed to induce CYP2B in rabbit hepatic tissue, suggesting a species-dependent response in 2B expression. Anti-2B1 IgG addition to PY-induced microsomes inhibited benzphetamine N-demethylase activity by only approximately 15%, in sharp contrast to the approximately 73% inhibition observed for phenobarbital-induced microsomes, suggesting the induction of other form(s) of P450 having benzphetamine N-demethylase activity. Northern blot analysis revealed that PY treatment increased 2B1 and 2B2 poly(A)+ RNA levels approximately 69- and approximately 34-fold, respectively, whereas the 2E1 poly(A)+ RNA levels failed to increase. The results of this study show that PY induces CYP2B1/2B2 and that induction is species-dependent and kinetically distinguishable from 2E1 induction. Moreover, 2B1/2B2 induction occurs as a result of elevated mRNA levels associated with either transcriptional activation or mRNA stabilization, and it differs from the mechanism of hepatic 2E1 induction by PY.

  12. Involvement of enniatins-induced cytotoxicity in human HepG2 cells.

    PubMed

    Juan-García, Ana; Manyes, Lara; Ruiz, María-José; Font, Guillermina

    2013-04-12

    Enniatins (ENNs) are mycotoxins found in Fusarium fungi and they appear in nature as mixtures of cyclic depsipeptides. The ability to form ionophores in the cell membrane is related to their cytotoxicity. Changes in ion distribution between inner and outer phases of the mitochondria affect to their metabolism, proton gradient, and chemiosmotic coupling, so a mitochondrial toxicity analysis of enniatins is highly recommended because they host the homeostasis required for cellular survival. Two ENNs, ENN A and ENN B on hepatocarcinoma cells (HepG2) at 1.5 and 3 μM and three exposure times (24, 48 and 72 h) were studied. Flow cytometry was used to examine their effects on cell proliferation, to characterize at which phase of the cell cycle progression the cells were blocked and to study the role of the mitochondrial in ENNs-induced apoptosis. In conclusion, apoptosis induction on HepG2 cells allowed to compare cytotoxic effects caused by both ENNs, A and B. It is reported the possible mechanism observed in MMP changes, cell cycle analysis and apoptosis/necrosis, identifying ENN B more toxic than ENN A. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  13. Exploring a Link Between NF-KB and G2/M Cell Cycle Arrest in Breast Cancer Cells

    DTIC Science & Technology

    2005-04-01

    studies with esophageal squamous cell carcinom a lines have shown that IR induced p21waf1/ ciP ’ and a G2 cell cycle arrest that could als o be...i AD Award Number : DAMD17-02-1-062 3 TITLE : Exploring a Link Between NF-KB and G 2 /M Cell Cycle Arres t in Breast Cancer Cell s PRINCIPAL...Mar 2005 ) 4 . TITLE AND SUBTITL E Exploring a Link Between NF-kB and G 2 /M Cell Cycle Arres t in Breast Cancer Cells 5. FUND/NG NUMBERS DAMD17-02-1

  14. Black TiO2 nanobelts/g-C3N4 nanosheets Laminated Heterojunctions with Efficient Visible-Light-Driven Photocatalytic Performance

    PubMed Central

    Shen, Liyan; Xing, Zipeng; Zou, Jinlong; Li, Zhenzi; Wu, Xiaoyan; Zhang, Yuchi; Zhu, Qi; Yang, Shilin; Zhou, Wei

    2017-01-01

    Black TiO2 nanobelts/g-C3N4 nanosheets laminated heterojunctions (b-TiO2/g-C3N4) as visible-light-driven photocatalysts are fabricated through a simple hydrothermal-calcination process and an in-situ solid-state chemical reduction approach, followed by the mild thermal treatment (350 °C) in argon atmosphere. The prepared samples are evidently investigated by X-ray diffraction, Fourier transform infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, X-ray photoelectron spectroscopy, N2 adsorption, and UV-visible diffuse reflectance spectroscopy, respectively. The results show that special laminated heterojunctions are formed between black TiO2 nanobelts and g-C3N4 nanosheets, which favor the separation of photogenerated electron-hole pairs. Furthermore, the presence of Ti3+ and g-C3N4 greatly enhance the absorption of visible light. The resultant b-TiO2/g-C3N4 materials exhibit higher photocatalytic activity than that of g-C3N4, TiO2, b-TiO2 and TiO2/g-C3N4 for degradation of methyl orange (95%) and hydrogen evolution (555.8 μmol h−1 g−1) under visible light irradiation. The apparent reaction rate constant (k) of b-TiO2/g-C3N4 is ~9 times higher than that of pristine TiO2. Therefore, the high-efficient laminated heterojunction composites will have potential applications in fields of environment and energy. PMID:28165021

  15. G5G2.5 core-shell tecto-dendrimer specifically targets reactive glia in brain ischemia.

    PubMed

    Murta, Veronica; Schilrreff, Priscila; Rosciszewski, Gerardo; Morilla, Maria Jose; Ramos, Alberto Javier

    2018-03-01

    Secondary neuronal death is a serious stroke complication. This process is facilitated by the conversion of glial cells to the reactive pro-inflammatory phenotype that induces neurodegeneration. Therefore, regulation of glial activation is a compelling strategy to reduce brain damage after stroke. However, drugs have difficulties to access the CNS, and to specifically target glial cells. In the present work, we explored the use core-shell polyamidoamine tecto-dendrimer (G5G2.5 PAMAM) and studied its ability to target distinct populations of stroke-activated glial cells. We found that G5G2.5 tecto-dendrimer is actively engulfed by primary glial cells in a time- and dose-dependent manner showing high cellular selectivity and lysosomal localization. In addition, oxygen-glucose deprivation or lipopolysaccharides exposure in vitro and brain ischemia in vivo increase glial G5G2.5 uptake; not being incorporated by neurons or other cell types. We conclude that G5G2.5 tecto-dendrimer is a highly suitable carrier for targeted drug delivery to reactive glial cells in vitro and in vivo after brain ischemia. © 2017 International Society for Neurochemistry.

  16. Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box.

    PubMed

    Ezcurra, I; Wycliffe, P; Nehlin, L; Ellerström, M; Rask, L

    2000-10-01

    The transcriptional activator ABI3 is a key regulator of gene expression during embryo maturation in crucifers. In monocots, the related VP1 protein regulates the Em promoter synergistically with abscisic acid (ABA). We identified cis-elements in the Brassica napus napin napA promoter mediating regulation by ABI3 and ABA, by analyzing substitution mutation constructs of napA in transgenic tobacco plantlets ectopically expressing ABI3. In transient analysis using particle bombardment of tobacco leaf sections, a tetramer of the distB ABRE (abscisic acid-responsive element) mediated transactivation by ABI3 and ABI3-dependent response to ABA, whereas a tetramer of the composite RY/G complex, containing RY repeats and a G-box, mediated only ABA-independent transactivation by ABI3. Deletion of the conserved B2 and B3 domains of ABI3 abolished transactivation of napA by ABI3. The two domains of ABI3 interact with different cis-elements: B2 is necessary for ABA-independent and ABA-dependent activations through the distB ABRE, whereas B3 interacts with the RY/G complex. Thus B2 mediates the interaction of ABI3 with the protein complex at the ABRE. The regulation of napA by ABI3 differs from Em regulation by VP1, in that the B3 domain of ABI3 is essential for the ABA-dependent regulation of napA.

  17. Zolpidem generalization and antagonism in male and female cynomolgus monkeys trained to discriminate 1.0 or 2.0 g/kg ethanol.

    PubMed

    Helms, Christa M; Rogers, Laura S M; Waters, Courtney A; Grant, Kathleen A

    2008-07-01

    The subtypes of gamma-aminobutyric acid (GABA)(A) receptors mediating the discriminative stimulus effects of ethanol in nonhuman primates are not completely identified. The GABA(A) receptor positive modulator zolpidem has high, intermediate, and low activity at receptors containing alpha(1), alpha(2/3), and alpha(5) subunits, respectively, and partially generalizes from ethanol in several species. The partial inverse agonist Ro15-4513 has the greatest affinity for alpha(4/6)-containing receptors, higher affinity for alpha(5)- and lower, but equal, affinity for alpha(1)- and alpha(2/3)-, containing GABA(A) receptors, and antagonizes the discriminative stimulus effects of ethanol. This study assessed Ro15-4513 antagonism of the generalization of zolpidem from ethanol in male (n = 9) and female (n = 8) cynomolgus monkeys (Macaca fascicularis) trained to discriminate 1.0 g/kg (n = 10) or 2.0 g/kg (n = 7) ethanol (i.g.) from water with a 30-minute pretreatment interval. Zolpidem (0.017 to 5.6 mg/kg, i.m.) completely generalized from ethanol (>or=80% of total session responses on the ethanol-appropriate lever) for 6/7 monkeys trained to discriminate 2.0 g/kg and 4/10 monkeys trained to discriminate 1.0 g/kg ethanol. Zolpidem partially generalized from 1.0 or 2.0 g/kg ethanol in 6/7 remaining monkeys. Ro15-4513 (0.003 to 0.30 mg/kg, i.m., 5-minute pretreatment) shifted the zolpidem dose-response curve to the right in all monkeys showing generalization. Analysis of apparent pK(B) from antagonism tests suggested that the discriminative stimulus effects of ethanol common with zolpidem are mediated by low-affinity Ro15-4513 binding sites. Main effects of sex and training dose indicated greater potency of Ro15-4513 in males and in monkeys trained to discriminate 1.0 g/kg ethanol. Ethanol and zolpidem share similar discriminative stimulus effects most likely through GABA(A) receptors that contain alpha(1) subunits, however, antagonism by Ro15-4513 of zolpidem generalization

  18. Impairment of oxidative phosphorylation increases the toxicity of SYD-1 on hepatocarcinoma cells (HepG2).

    PubMed

    Brandt, Anna Paula; Gozzi, Gustavo Jabor; Pires, Amanda do Rocio Andrade; Martinez, Glaucia Regina; Dos Santos Canuto, André Vinícius; Echevarria, Aurea; Di Pietro, Attilio; Cadena, Sílvia Maria Suter Correia

    2016-08-25

    Toxicity of the SYD-1 mesoionic compound (3-[4-chloro-3-nitrophenyl]-1,2,3-oxadiazolium-5-olate) was evaluated on human liver cancer cells (HepG2) grown in either high glucose (HG) or galactose (GAL) medium, and also on suspended cells kept in HG medium. SYD-1 was able to decrease the viability of cultured HepG2 cells in a dose-dependent manner, as assessed by MTT, LDH release and dye with crystal violet assays, but no effect was observed on suspended cells after 1-40 min of treatment. Respiration analysis was performed after 2 min (suspended cells) or 24 h (cultured cells) of treatment: no change was observed in suspended cells, whereas SYD-1 inhibited as well basal, leak and uncoupled states of the respiration in cultured cells with HG medium. These inhibitions were consistent with the decrease in pyruvate level and increase in lactate level. Even more extended results were obtained with HepG2 cells grown in GAL medium where, additionally, the ATP amount was reduced. Furthermore, SYD-1 appears not to be transported by the main ABC multidrug transporters. These results show that SYD-1 is able to change the metabolism of HepG2 cells, and suggest that its cytotoxicity is related to impairment of mitochondrial metabolism. Therefore, we may propose that SYD-1 is a potential candidate for hepatocarcinoma treatment. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. Glass transition and heat capacities of inorganic glasses: Diminishing change in the heat capacity at T{sub g} for xNa{sub 2}S + (1{minus}x)B{sub 2}S{sub 3} glasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kincs, J.; Cho, J.; Bloyer, D.

    1994-09-01

    The T{sub g}`s and heat capacity functions have been measured for a series of Na{sub 2}S + B{sub 2}S{sub 3} glasses for the first time. Unlike the alkali borates, T{sub g} decreases rapidly as Na{sub 2}S is added to B{sub 2}S{sub 3}. This effect, even in the presence of a rapidly increasing fraction of tetrahedrally coordinated borons, has been associated with the ``over crosslinking`` effect of the sulfide ion. Unlike the borate glasses where each added oxygen produces two tetrahedral borons, the conversion rate for the thioborates is between four and six. This behavior is suggested to result in themore » formation of local tightly-bonded molecular-like structures that exhibit less long-range network bonding than the alkali borite glasses. A a result, T{sub g} decreases with added alkali in alkali thioborates rather than increases as in the alkali borate glasses. The change in heat capacity at T{sub g}, {Delta}C{sub p}(T{sub g}) has been carefully measured and is found to also decrease dramatically as alkali sulfide is added to the glass. Again this effect is opposite to the trends observed for the alkali borate glasses. The decreasing {Delta}C{sub p}(T{sub g}) occurs even in the presence of a decreasing T{sub g}. The authors have tentatively associated the diminishing {Delta}C{sub p}(T{sub g}) values to the decreasing density of the configurational states above T{sub g}. This is attributed to the high coordination number and site specificity caused by the added alkali sulfide. The glassy state heat capacities were analyzed and found to reach {approximately}90% of the classical limiting DuLong-Petit value just below T{sub g} for all glasses. This was used to suggest that the diminishing {Delta}C{sub p}(T{sub g}) values are associated with a unique behavior in the system to become a liquid with very little change in the density of configurational states.« less

  20. Communication: A simple full range analytical potential for H{sub 2} b{sup 3}∑{sub u}{sup +}, H–He {sup 2}∑{sup +}, and He{sub 2} {sup 1}∑{sub g}{sup +}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warnecke, Sascha; Toennies, J. Peter, E-mail: jtoenni@gwdg.de; Tang, K. T.

    The Tang-Toennies potential for the weakly interacting systems H{sub 2} b{sup 3}Σ{sub u}{sup +}, H–He {sup 2}Σ{sup +}, and He{sub 2} {sup 1}Σ{sub g}{sup +} is extended down to the united atom limit of vanishing internuclear distance. A simple analytic expression connects the united atom limiting potential with the Tang-Toennies potential in the well region. The new potential model is compared with the most recent ab initio calculations for all three systems. The agreement is better than 20% (H{sub 2} and He{sub 2}) or comparable with the differences in the available ab initio calculations (H–He) over six orders of magnitudemore » corresponding to the entire range of internuclear distances.« less

  1. Prognostic relevance of aberrant DNA methylation in g1 and g2 pancreatic neuroendocrine tumors.

    PubMed

    Stefanoli, Michele; La Rosa, Stefano; Sahnane, Nora; Romualdi, Chiara; Pastorino, Roberta; Marando, Alessandro; Capella, Carlo; Sessa, Fausto; Furlan, Daniela

    2014-01-01

    The occurrence and clinical relevance of DNA hypermethylation and global hypomethylation in pancreatic neuroendocrine tumours (PanNETs) are still unknown. We evaluated the frequency of both epigenetic alterations in PanNETs to assess the relationship between methylation profiles and chromosomal instability, tumour phenotypes and prognosis. In a well-characterized series of 56 sporadic G1 and G2 PanNETs, methylation-sensitive multiple ligation-dependent probe amplification was performed to assess hypermethylayion of 33 genes and copy number alterations (CNAs) of 53 chromosomal regions. Long interspersed nucleotide element-1 (LINE-1) hypomethylation was quantified by pyrosequencing. Unsupervised hierarchical clustering allowed to identify a subset of 22 PanNETs (39%) exhibiting high frequency of gene-specific methylation and low CNA percentages. This tumour cluster was significantly associated with stage IV (p = 0.04) and with poor prognosis in univariable analysis (p = 0.004). LINE-1 methylation levels in PanNETs were significantly lower than in normal samples (p < 0.01) and were approximately normally distributed. 12 tumours (21%) were highly hypomethylated, showing variable levels of CNA. Interestingly, only 5 PanNETs (9%) were observed to show simultaneously LINE-1 hypomethylation and high frequency of gene-specific methylation. LINE-1 hypomethylation was strongly correlated with advanced stage (p = 0.002) and with poor prognosis (p < 0.0001). In the multivariable analysis, low LINE-1 methylation status and methylation clusters were the only independent significant predictors of outcome (p = 0.034 and p = 0.029, respectively). The combination of global DNA hypomethylation and gene hypermethylation analyses may be useful to define distinct subsets of PanNETs. Both alterations are common in PanNETs and could be directly correlated with tumour progression. © 2014 S. Karger AG, Basel.

  2. Chronic cat allergen exposure induces a TH2 cell-dependent IgG4 response related to low sensitization.

    PubMed

    Renand, Amedee; Archila, Luis D; McGinty, John; Wambre, Erik; Robinson, David; Hales, Belinda J; Thomas, Wayne R; Kwok, William W

    2015-12-01

    In human subjects, allergen tolerance has been observed after high-dose allergen exposure or after completed allergen immunotherapy, which is related to the accumulation of anti-inflammatory IgG4. However, the specific T-cell response that leads to IgG4 induction during chronic allergen exposure remains poorly understood. We sought to evaluate the relationship between cat allergen-specific T-cell frequency, cat allergen-specific IgE and IgG4 titers, and clinical status in adults with cat allergy with and without cat ownership and the cellular mechanism by which IgG4 is produced. Fel d 1-, Fel d 4-, Fel d 7-, and Fel d 8-specific T-cell responses were characterized by CD154 expression after antigen stimulation. In allergic subjects without cat ownership, the frequency of cat allergen (Fel d 1 and Fel d 4)-specific TH2 (sTH2) cells correlates with higher IgE levels and is linked to asthma. Paradoxically, we observed that subjects with cat allergy and chronic cat exposure maintain a high frequency of sTH2 cells, which correlates with higher IgG4 levels and low sensitization. B cells from allergic, but not nonallergic subjects, are able to produce IgG4 after cognate interactions with sTH2 clones and Fel d 1 peptide or the Fel d 1 recombinant protein. These experiments suggest that (1) allergen-experienced B cells with the capacity to produce IgG4 are present in allergic subjects and (2) cat allergen exposure induces an IgG4 response in a TH2 cell-dependent manner. Thus IgG4 accumulation could be mediated by chronic activation of the TH2 response, which in turn drives desensitization. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  3. A three-dimensional in vitro HepG2 cells liver spheroid model for genotoxicity studies.

    PubMed

    Shah, Ume-Kulsoom; Mallia, Jefferson de Oliveira; Singh, Neenu; Chapman, Katherine E; Doak, Shareen H; Jenkins, Gareth J S

    2018-01-01

    The liver's role in metabolism of chemicals makes it an appropriate tissue for toxicity testing. Current testing protocols, such as animal testing and two-dimensional liver cell systems, offer limited resemblance to in vivo liver cell behaviour, in terms of gene expression profiles and metabolic competence; thus, they do not always accurately predict human toxicology. In vitro three-dimensional liver cell models offer an attractive alternative. This study reports on the development of a 3D liver model, using HepG2 cells, by a hanging-drop technique, with a focus on evaluating spheroid growth characteristics and suitability for genotoxicity testing. The cytokinesis-blocked micronucleus assay protocol was adapted to enable micronucleus (MN) detection in the 3D spheroid models. This involved evaluating the difference between hanging vs non-hanging drop positions for dosing of the test agents and comparison of automated Metafer scoring with manual scoring for MN detection in HepG2 spheroids. The initial seeding density, used for all experiments, was 5000 cells/20 μl drop hanging spheroids, harvested on day 4, with >75% cell viability. Albumin secretion (7.8 g/l) and both CYP1A1 and CYP1A2 gene expression were highest in the 3D environment at day 4. Exposure to metabolically activated genotoxicants for 24 h resulted in a 6-fold increase in CYP1A1 enzyme activity (3 μM B[a]P) and a 30-fold increase in CYP1A2 enzyme activity (5 μM PhIP) in 3D hanging spheroids. MN inductions in response to B[a]P or PhIP were 2-fold and 3-fold, respectively, and were greater in 3D hanging spheroids than in 2D format, showing that hanging spheroids are more sensitive to genotoxic agents. HepG2 hanging-drop spheroids are an exciting new alternative system for genotoxicity studies, due to their improved structural and physiological properties, relative to 2D cultures. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

    PubMed Central

    Qiao, Huan; May, James M.

    2013-01-01

    SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

  5. Occurrence of Ochratoxins, Fumonisin B2 , Aflatoxins (B1 and B2 ), and Other Secondary Fungal Metabolites in Dried Date Palm Fruits from Egypt: A Mini-Survey.

    PubMed

    Abdallah, Mohamed F; Krska, Rudolf; Sulyok, Michael

    2018-02-01

    This study was conducted to investigate the natural co-occurrence of 295 fungal and bacterial metabolites in 28 samples of dried date palm fruits collected from different shops distributed in Assiut Governorate, Upper Egypt in 2016. Extraction and quantification of the target analytes were done using the "dilute and shoot" approach followed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis. In total, 30 toxic fungal metabolites were detected. Among these metabolites, 4 types of ochratoxins including ochratoxin type A and B were quantified in 3 samples (11%) with a contamination range from 1.48 to 6070 μg/kg for ochratoxin A and from 0.28 to 692 μg/kg for ochratoxin B. In addition, fumonisin B 2 was observed in 2 (7%) samples with contamination levels ranging from 4.99 to 16.2 μg/kg. The simultaneous detection of fumonisin B 2 in the same contaminated samples with ochratoxins indicates the fungal attack by Aspergillus niger species during storage. Only 1 sample was contaminated with aflatoxin B 1 (14.4 μg/kg) and B 2 (2.44 μg/kg). The highest maximum concentration (90400 μg/kg) was for kojic acid that contaminated 43% of the samples. To the best of the authors' knowledge, this is the first report of the natural co-occurrence of fumonisin B 2 and ochratoxin A and B in addition to a wide range of other fungal metabolites in date palm fruits. Mycotoxins are secondary metabolites produced by different fungi. These metabolites pose a potential risk on human health since they contaminate many food commodities. Among these, date palm fruits which are an integral part of diet in several countries. Therefore, detection of mycotoxins is a prerequisite to insure the safety of food. Here, different types of mycotoxins have been detected in levels that may have health hazard. © 2018 Institute of Food Technologists®.

  6. Disorder of G2-M Checkpoint Control in Aniline-Induced Cell Proliferation in Rat Spleen

    PubMed Central

    Wang, Jianling; Wang, Gangduo; Khan, M. Firoze

    2015-01-01

    Aniline, a toxic aromatic amine, is known to cause hemopoietic toxicity both in humans and animals. Aniline exposure also leads to toxic response in spleen which is characterized by splenomegaly, hyperplasia, fibrosis and the eventual formation of tumors on chronic in vivo exposure. Previously, we have shown that aniline exposure leads to iron overload, oxidative DNA damage, and increased cell proliferation, which could eventually contribute to a tumorigenic response in the spleen. Despite our demonstration that cell proliferation was associated with deregulation of G1 phase cyclins and increased expression of G1 phase cyclin-dependent kinases (CDKs), molecular mechanisms, especially the regulation of G2 phase and contribution of epigenetic mechanisms in aniline-induced splenic cellular proliferation remain largely unclear. This study therefore, mainly focused on the regulation of G2 phase in an animal model preceding a tumorigenic response. Male Sprague-Dawley rats were given aniline (0.5 mmol/kg/day) in drinking water or drinking water only (controls) for 30 days, and expression of G2 phase cyclins, CDK1, CDK inhibitors and miRNAs were measured in the spleen. Aniline treatment resulted in significant increases in cell cycle regulatory proteins, including cyclins A, B and CDK1, particularly phosphor-CDK1, and decreases in CDK inhibitors p21 and p27, which could promote the splenocytes to go through G2/M transition. Our data also showed upregulation of tumor markers Trx-1 and Ref-1 in rats treated with aniline. More importantly, we observed lower expression of miRNAs including Let-7a, miR-15b, miR24, miR-100 and miR-125, and greater expression of CDK inhibitor regulatory miRNAs such as miR-181a, miR-221 and miR-222 in the spleens of aniline-treated animals. Our findings suggest that significant increases in the expression of cyclins, CDK1 and aberrant regulation of miRNAs could lead to an accelerated G2/M transition of the splenocytes, and potentially to a

  7. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 6 2012-04-01 2012-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  8. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 6 2014-04-01 2014-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  9. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 6 2013-04-01 2013-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  10. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 6 2011-04-01 2011-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  11. Anti-hepatocarcinoma effects of resveratrol nanoethosomes against human HepG2 cells

    NASA Astrophysics Data System (ADS)

    Meng, Xiang-Ping; Zhang, Zhen; Chen, Tong-sheng; Wang, Yi-fei; Wang, Zhi-ping

    2017-02-01

    Hepatocarcinoma, a malignant cancer, threaten human life badly. It is a current issue to seek the effective natural remedy from plant to treat cancer due to the resistance of the advanced hepatocarcinoma to chemotherapy. Resveratrol (Res) has been widely investigated with its strong anti-tumor activity. However, its low oral bioavailability restricts its wide application. In this study, we prepared resveratrol nanoethosomes (ResN) via ethanol injection method. The in vitro anti-hepatocarcinoma effects of ResN relative to efficacy of bulk Res were evaluated on proliferation and apoptosis of human HepG2 cells. ResN were spherical vesicles and its particle diameter, zeta potential were (115.8 +/- 1.3) nm and (-12.8 +/- 1.9) mV, respectively. ResN exhibited significant inhibitory effects against human HepG2 cells by MTT assay, and the IC50 value was 49.2 μg/ml (105.4 μg/ml of Res bulk solution). By flow cytometry assay, there was an increase in G2/M phase cells treated with ResN. The results demonstrated ResN could effectively block the G2/M phase of HepG2 cells, which can also enhance the inhibitory effect of Res against HepG2 cells.

  12. Myo1g is an active player in maintaining cell stiffness in B-lymphocytes.

    PubMed

    López-Ortega, O; Ovalle-García, E; Ortega-Blake, I; Antillón, A; Chávez-Munguía, B; Patiño-López, G; Fragoso-Soriano, R; Santos-Argumedo, L

    2016-05-01

    B-lymphocytes are migrating cells that specialize in antigen presentation, antibody secretion, and endocytosis; these processes implicate the modulation of plasma membrane elasticity. Cell stiffness is a force generated by the interaction between the actin-cytoskeleton and the plasma membrane, which requires the participation of several proteins. These proteins include class I myosins, which are now considered to play a role in controlling membrane-cytoskeleton interactions. In this study, we identified the motor protein Myosin 1g (Myo1g) as a mediator of this phenomenon. The absence of Myo1g decreased the cell stiffness, affecting cell adhesion, cell spreading, phagocytosis, and endocytosis in B-lymphocytes. The results described here reveal a novel molecular mechanism by which Myo1g mediates and regulates cell stiffness in B-lymphocytes. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Infant HIV type 1 gp120 vaccination elicits robust and durable anti-V1V2 immunoglobulin G responses and only rare envelope-specific immunoglobulin A responses.

    PubMed

    Fouda, Genevieve G; Cunningham, Coleen K; McFarland, Elizabeth J; Borkowsky, William; Muresan, Petronella; Pollara, Justin; Song, Lin Ye; Liebl, Brooke E; Whitaker, Kaylan; Shen, Xiaoying; Vandergrift, Nathan A; Overman, R Glenn; Yates, Nicole L; Moody, M Anthony; Fry, Carrie; Kim, Jerome H; Michael, Nelson L; Robb, Merlin; Pitisuttithum, Punnee; Kaewkungwal, Jaranit; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Liao, Hua-Xin; Haynes, Barton F; Montefiori, David C; Ferrari, Guido; Tomaras, Georgia D; Permar, Sallie R

    2015-02-15

    Infant responses to vaccines can be impeded by maternal antibodies and immune system immaturity. It is therefore unclear whether human immunodeficiency virus type 1 (HIV-1) vaccination would elicit similar responses in adults and infants. HIV-1 Env-specific antibody responses were evaluated in 2 completed pediatric vaccine trials. In the Pediatric AIDS Clinical Trials Group (PACTG) 230 protocol, infants were vaccinated with 4 doses of Chiron rgp120 with MF59 (n=48), VaxGen rgp120 with aluminum hydroxide (alum; n=49), or placebo (n=19) between 0 and 20 weeks of age. In PACTG 326, infants received 4 doses of ALVAC-HIV-1/AIDSVAX B/B with alum (n=9) or placebo (n=13) between 0 and 12 weeks of age. By 52 weeks of age, the majority of maternally acquired antibodies had waned and vaccine Env-specific immunoglobulin G (IgG) responses in vaccinees were higher than in placebo recipients. Chiron vaccine recipients had higher and more-durable IgG responses than VaxGen vaccine recipients or ALVAC/AIDSVAX vaccinees, with vaccine-elicited IgG responses still detectable in 56% of recipients at 2 years of age. Remarkably, at peak immunogenicity, the concentration of anti-V1V2 IgG, a response associated with a reduced risk of HIV-1 acquisition in the RV144 adult vaccine trial, was 22-fold higher in Chiron vaccine recipients, compared with RV144 vaccinees. As exemplified by the Chiron vaccine regimen, vaccination of infants against HIV-1 can induce robust, durable Env-specific IgG responses, including anti-V1V2 IgG. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. LOFT L2-3 blowdown experiment safety analyses D, E, and G; LOCA analyses H, K, K1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perryman, J.L.; Keeler, C.D.; Saukkoriipi, L.O.

    1978-12-01

    Three calculations using conservative off-nominal conditions and evaluation model options were made using RELAP4/MOD5 for blowdown-refill and RELAP4/MOD6 for reflood for Loss-of-Fluid Test Experiment L2-3 to support the experiment safety analysis effort. The three analyses are as follows: Analysis D: Loss of commercial power during Experiment L2-3; Analysis E: Hot leg quick-opening blowdown valve (QOBV) does not open during Experiment L2-3; and Analysis G: Cold leg QOBV does not open during Experiment L2-3. In addition, the results of three LOFT loss-of-coolant accident (LOCA) analyses using a power of 56.1 MW and a primary coolant system flow rate of 3.6 millionmore » 1bm/hr are presented: Analysis H: Intact loop 200% hot leg break; emergency core cooling (ECC) system B unavailable; Analysis K: Pressurizer relief valve stuck in open position; ECC system B unavailable; and Analysis K1: Same as analysis K, but using a primary coolant system flow rate of 1.92 million 1bm/hr (L2-4 pre-LOCE flow rate). For analysis D, the maximum cladding temperature reached was 1762/sup 0/F, 22 sec into reflood. In analyses E and G, the blowdowns were slower due to one of the QOBVs not functioning. The maximum cladding temperature reached in analysis E was 1700/sup 0/F, 64.7 sec into reflood; for analysis G, it was 1300/sup 0/F at the start of reflood. For analysis H, the maximum cladding temperature reached was 1825/sup 0/F, 0.01 sec into reflood. Analysis K was a very slow blowdown, and the cladding temperatures followed the saturation temperature of the system. The results of analysis K1 was nearly identical to analysis K; system depressurization was not affected by the primary coolant system flow rate.« less

  15. Possible Role of HLA-G, LILRB1 and KIR2DL4 Gene Polymorphisms in Spontaneous Miscarriage.

    PubMed

    Nowak, Izabela; Malinowski, Andrzej; Barcz, Ewa; Wilczyński, Jacek R; Wagner, Marta; Majorczyk, Edyta; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Kuśnierczyk, Piotr

    2016-12-01

    The KIR2DL4 receptor and its ligand HLA-G are considered important for fetal-maternal immune tolerance and successful pregnancy. The absence of a particular variant of KIR2DL4 might be a bad prognostic factor for pregnancy outcome. However, it could be compensated by the presence of the respective LILRB1 allele. Therefore, we investigated the KIR2DL4, LILRB1 and HLA-G polymorphisms in 277 couples with spontaneous abortion and 219 control couples by HRM, PCR-SSP and RFLP methods. We found a protective effect of women's heterozygosity in -716 HLA-G (p = 0.0206) and LILRB1 (p = 0.0131) against spontaneous abortion. Surprisingly, we observed more 9A/10A genotypes of KIR2DL4 gene carriers in the group of male partners from the miscarriage group in comparison to the men from the control group (p = 0.0288). Furthermore, there was no association of women's KIR2DL4 polymorphism with susceptibility to spontaneous abortion. Multivariate analysis indicated that women's -716 HLA-G and LILRB1 and men's KIR2DL4 9A/10A are important in terms of the protection or susceptibility to miscarriage, respectively (p = 0.00968). In conclusion, a woman's heterozygosity in HLA-G and LILRB1 might be an advantage for a success of reproduction, but the partner's heterozygosity in 9A/10A KIR2DL4 alleles might not.

  16. The Arabidopsis domain of unknown function 1218 (DUF1218) containing proteins, MODIFYING WALL LIGNIN-1 and 2 (At1g31720/MWL-1 and At4g19370/MWL-2) function redundantly to alter secondary cell wall lignin content

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mewalal, Ritesh; Mizrachi, Eshchar; Coetzee, Berdine

    DUF1218 is a land plant-specific innovation and has previously been shown to be associated with cell wall biology, vasculature patterning and abiotic/biotic stress response. The Arabidopsis genome encodes 15 members, two of which (At1g31720 and At4g27435) are preferentially expressed in the secondary cell wall depositing inflorescence stems. To further our understanding of the roles of DUF1218-containing proteins in secondary cell wall biology, we functionally characterized At1g31720 (herein referred to as MODIFYING WALL LIGNIN-1 or MWL-1). Since related gene family members may contribute to functional redundancy, we also characterized At4g19370 ( MWL-2), the most closely related gene to MWL-1 in themore » protein family. Subcellular localization revealed that both Arabidopsis proteins are targeted to the cell periphery. The single T-DNA knockout lines, mwl-1 and mwl-2, and independent overexpression lines showed no significant differences in plant growth or changes in total lignin content relative to wild-type (WT) control plants. However, the double homozygous mutant, mwl-1/ mwl-2, had smaller rosettes with a significant decrease in rosette fresh weight and stem height relative to the WT control at four weeks and six weeks, respectively. Moreover, mwl-1/ mwl-2 showed a significant reduction in total lignin content (by ca. 11% relative to WT) and an increase in syringyl/guaiacyl (S/G) monomer ratio relative to the control plants. Lastly, our study has identified two additional members of the DUF1218 family in Arabidopsis as novel contributors to secondary cell wall biology, specifically lignin biosynthesis, and these proteins appear to function redundantly.« less

  17. The Arabidopsis domain of unknown function 1218 (DUF1218) containing proteins, MODIFYING WALL LIGNIN-1 and 2 (At1g31720/MWL-1 and At4g19370/MWL-2) function redundantly to alter secondary cell wall lignin content

    DOE PAGES

    Mewalal, Ritesh; Mizrachi, Eshchar; Coetzee, Berdine; ...

    2016-03-01

    DUF1218 is a land plant-specific innovation and has previously been shown to be associated with cell wall biology, vasculature patterning and abiotic/biotic stress response. The Arabidopsis genome encodes 15 members, two of which (At1g31720 and At4g27435) are preferentially expressed in the secondary cell wall depositing inflorescence stems. To further our understanding of the roles of DUF1218-containing proteins in secondary cell wall biology, we functionally characterized At1g31720 (herein referred to as MODIFYING WALL LIGNIN-1 or MWL-1). Since related gene family members may contribute to functional redundancy, we also characterized At4g19370 ( MWL-2), the most closely related gene to MWL-1 in themore » protein family. Subcellular localization revealed that both Arabidopsis proteins are targeted to the cell periphery. The single T-DNA knockout lines, mwl-1 and mwl-2, and independent overexpression lines showed no significant differences in plant growth or changes in total lignin content relative to wild-type (WT) control plants. However, the double homozygous mutant, mwl-1/ mwl-2, had smaller rosettes with a significant decrease in rosette fresh weight and stem height relative to the WT control at four weeks and six weeks, respectively. Moreover, mwl-1/ mwl-2 showed a significant reduction in total lignin content (by ca. 11% relative to WT) and an increase in syringyl/guaiacyl (S/G) monomer ratio relative to the control plants. Lastly, our study has identified two additional members of the DUF1218 family in Arabidopsis as novel contributors to secondary cell wall biology, specifically lignin biosynthesis, and these proteins appear to function redundantly.« less

  18. The IgG2a antibody response to thyroglobulin is linked to the Igh locus in mouse.

    PubMed

    Kuppers, R C; Epstein, L D; Outschoorn, I M; Rose, N R

    1994-01-01

    The IgG-subclass usage by several strains of mice in the response to immunization with mouse thyroglobulin (mTg) was examined in the experimental autoimmune thyroiditis model. While the subclass usage by most mouse strains was similar, the Ighb allotype-bearing mice consistently produced lower IgG2a levels to mTg. Using CBA-Ighb congenic and recombinant inbred strains of mice, the lower level of IgG2a in the Ighb mouse was mapped to the Igh locus. The regulation of IgG2a appeared to be cis controlled, as the CBA x C57BL/6F1 mouse also produced reduced IgG2a of the Ighb (B6) allotype but not of the Ighj (CBA) allotype.

  19. Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

    2003-08-15

    The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

  20. [Puerariae Lobatae Radix elevated expression levels of OB-R, IRS2, GLUT1 and GLUT2 to regulate glucose metabolism in insulin-resistance HepG2 cells].

    PubMed

    Li, Yu; Luo, Xin-Xin; Yan, Feng-Dong; Wei, Zhang-Bin; Tu, Jun

    2017-05-01

    To observe the anti-hyperglycemic effect of Puerariae Lobatae Radix in hepatocyte insulin resistance(IR) models, and investigate its preliminary molecular mechanism. IR-HepG2 cell model was stably established with 1×10-9 mol•L⁻¹ insulin plus 3.75×10-6 mol•L-1 dexamethasone treatment for 48 h according to optimized protocol in our research group. After IR-HepG2 cells were treated with different concentrations(5%,10% and 15%) of Puerariae Lobatae Radix-containing serum, cell viability was detected by CCK-8 assay; the glucose consumptions in IR-HepG2 cells were separately detected at different time points (12, 15, 18, 21, 24, 30, 36 h) by using glucose oxidase method; intracellular glycogen content was detected by anthrone method; and the protein expression levels of leptin receptor (Ob-R), insulin receptor substrate-2 (IRS2), glucose transporter 1(GLUT1) and GLUT2 were detected by Western blot assay. The results showed that Puerariae Lobatae Radix-containing serum (5%, 10% and 15%) had no significant effect on IR-HepG2 cell viability; 5% and 10% Puerariae Lobatae Radix-containing serum significantly increased glucose consumption of IR-HepG2 cells (P<0.01) at 18, 21 and 24 h; 15% Puerariae Lobatae Radix-containing serum elevated the glucose consumption of IR-HepG2 cells at 15 h (P<0.05), and significantly elevated the glucose consumption at 18, 21, 24 and 30 h (P<0.01) in a dose-dependent manner. The optimized time of anti-hyperglycemic effect was defined as 24 h, and further study showed that Puerariae Lobatae Radix-containing serum could increase intracellular glycogen content after 24 h treatment (P<0.01), and up-regulate IRS2, Ob-R, GLUT1 and GLUT2 protein expression levels. Our results indicated that Puerariae Lobatae Radix-containing serum could achieve the anti-hyperglycemic effect through important PI3K/PDK signaling pathway partially by up-regulating the expression levels of Ob-R and IRS2, GLUT1 and GLUT2 in IR-HepG2 cells, accelerating the glucose

  1. Association of COX-2 Promoter Polymorphisms -765G/C and -1195A/G with Migraine.

    PubMed

    Mozaffari, Elahe; Doosti, Abbas; Arshi, Asghar; Faghani, Mostafa

    2016-12-01

    Migraine is a common debilitating primary headache disorder with current head pain attacks, which contributes to physical activity dysfunctions in chronic pain phase. PGE2 and PGI2 are two important prostaglandins synthesised by COX-2 enzymes, involved in migraine pain signals. COX-2 modulation is essential in treatment and pathogenesis of migraine. This study aimed to investigating the association between COX-2 gene polymorphisms with the risk of migraine susceptibility in migraine patients with related and unrelated parents. This case- control study was based on 100 migraine patients and 100 non-migraine subjects in Bushehr province, Iran in 2013. Genomic DNA of blood samples was extracted and genotyping of COX-2-765G>C (rs20417) and COX-2-1195A>G (rs689466) gene variants was investigated by PCR-RFLP method. Statistical analyses were accomplished using the SPSS software package. There was a significant differences in the frequencies of the COX-2-765G>C and COX-2-1195A>G genotypes between migraine patients and controls ( P ≤0.05). COX-2-765CC , COX-2-765CG , COX-2-1195GG and COX-2-1195AG genotypes can increase the risk of migraine significantly. As the first study in Iran, we are hopeful to achieve greater results about the relevancy of COX-2 gene, migraine and pain signals pathway by repeating these experiments on more samples.

  2. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 2 2012-04-01 2012-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  3. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 2 2014-04-01 2014-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  4. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 2 2011-04-01 2011-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  5. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 2 2013-04-01 2013-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  6. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  7. Precision spectroscopy of the X1Σg+, v=0→1(J=0-2) rovibrational splittings in H2, HD and D2

    NASA Astrophysics Data System (ADS)

    Niu, M. L.; Salumbides, E. J.; Dickenson, G. D.; Eikema, K. S. E.; Ubachs, W.

    2014-06-01

    Accurate experimental values for the vibrational ground tone or fundamental vibrational energy splitting of H2, HD, and D2 are presented. Absolute accuracies of 2×10-4 cm-1 are obtained from Doppler-free laser spectroscopy applied in a collisionless environment. The vibrational splitting frequencies are derived from the combination difference between separate electronic excitations from the X1Σg+, v=0, J and v=1, J vibrational states to a common EF1Σg+, v=0, J state. The present work on rotational quantum states J=1,2 extends the results reported by Dickenson et al. on J=0 [Phys. Rev. Lett. 110 (2013) 193601]. The experimental procedures leading to this high accuracy are discussed in detail. A comparison is made with full ab initio calculations encompassing Born-Oppenheimer energies, adiabatic and non-adiabatic corrections, as well as relativistic corrections and QED-contributions. The present agreement between the experimental results and the calculations provides a stringent test on the application of quantum electrodynamics in molecules. Furthermore, the combined experimental-theoretical uncertainty can be interpreted to provide bounds to new interactions beyond the Standard Model of Physics or fifth forces between hadrons.

  8. Bone Mineral Properties in Growing Col1a2+/G610C Mice, an animal model of Osteogenesis Imperfecta

    PubMed Central

    Masci, Marco; Wang, Min; Imbert, Laurianne; Barnes, Aileen M; Spevak, Lyudmila; Lukashova, Lyudmila; Yihe, Huang; Yan, Ma; Marini, Joan C; Jacobsen, Christina M; Warman, Matthew L; Boskey, Adele L

    2016-01-01

    The Col1a2+/G610C knock-in mouse, models osteogenesis imperfecta in a large old order Amish family (OOA) with type IV OI, caused by a G-to-T transversion at nucleotide 2098, which alters the gly-610 codon in the triple-helical domain of the α2(I) chain of type I collagen. Mineral and matrix properties of the long bones and vertebrae of male Col1a2+/G610C and their wild-type controls (Col1a2+/+), were characterized to gain insight into the role of α2-chain collagen mutations in mineralization. Additionally, we examined the rescuability of the composition by sclerostin inhibition initiated by crossing Col1a2+/G610C with an LRP+/A214V high bone mass allele. At age 10-days, vertebrae and tibia showed few alterations by micro-CT or Fourier transform infrared imaging (FTIRI). At 2-months-of-age, Col1a2+/G610C tibias had 13% fewer secondary trabeculae than Col1a2+/+, these were thinner (11%) and more widely spaced (20%) than those of Col1a2+/+ mice. Vertebrae of Col1a2+/G610C mice at 2-months also had lower bone volume fraction (38%), trabecular number (13%), thickness (13%) and connectivity density (32%) compared to Col1a2+/+. The cortical bone of Col1a2+/G610C tibias at 2-months had 3% higher tissue mineral density compared to Col1a2+/+; Col1a2+/G610C vertebrae had lower cortical thickness (29%), bone area (37%) and polar moment of inertia (38%) relative to Col1a2+/+. FTIRI analysis, which provides information on bone chemical composition at ~ 7 µm-spatial resolution, showed tibias at 10-days, did not differ between genotypes. Comparing identical bone types in Col1a2+/G610C to Col1a2+/+ at 2-months-of-age, tibias showed higher mineral-to-matrix ratio in trabeculae (17%) and cortices (31%). and in vertebral cortices (28%). Collagen maturity was 42% higher at 10-days-of-age in Col1a2+/G610C vertebral trabeculae and in 2-month tibial cortices (12%), vertebral trabeculae (42%) and vertebral cortices (12%). Higher acid-phosphate substitution was noted in 10-day

  9. Identification of O-methylsterigmatocystin as an aflatoxin B1 and G1 precursor in Aspergillus parasiticus.

    PubMed Central

    Bhatnagar, D; McCormick, S P; Lee, L S; Hill, R A

    1987-01-01

    An isolate of Aspergillus parasiticus CP461 (SRRC 2043) produced no detectable aflatoxins, but accumulated O-methylsterigmatocystin (OMST). When sterigmatocystin (ST) was fed to this isolate in a low-sugar medium, there was an increase in the accumulation of OMST, without aflatoxin synthesis. When radiolabeled [14C]OMST was fed to resting mycelia of a non-aflatoxin-, non-ST-, and non-OMST-producing mutant of A. parasiticus AVN-1 (SRRC 163), 14C-labeled aflatoxins B1 and G1 were produced; 10 nmol of OMST produced 7.8 nmol of B1 and 1.0 nmol of G1, while 10 nmol of ST produced 6.4 nmol of B1 and 0.6 nmol of G1. A time course study of aflatoxin synthesis in ST feeding experiments with AVN-1 revealed that OMST is synthesized by the mold during the onset of aflatoxin synthesis. The total amount of aflatoxins recovered from OMST feeding experiments was higher than from experiments in which ST was fed to the resting mycelia. These results suggest that OMST is a true metabolite in the aflatoxin biosynthetic pathway between sterigmatocystin and aflatoxins B1 and G1 and is not a shunt metabolite, as thought previously. PMID:3111363

  10. 11 CFR 105.1 - Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)). 105.1 Section 105.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL DOCUMENT FILING (2 U.S.C. 432(g)) § 105.1 Place of filing; House candidates and their authorized...

  11. 11 CFR 105.1 - Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 11 Federal Elections 1 2011-01-01 2011-01-01 false Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)). 105.1 Section 105.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL DOCUMENT FILING (2 U.S.C. 432(g)) § 105.1 Place of filing; House candidates and their authorized...

  12. Conformational Dynamics Modulate Activation of the Ubiquitin Conjugating Enzyme Ube2g2

    PubMed Central

    2017-01-01

    The ubiquitin conjugating enzyme Ube2g2 together with its cognate E3 ligase gp78 catalyzes the synthesis of lysine-48 polyubiquitin chains constituting signals for the proteasomal degradation of misfolded proteins in the endoplasmic reticulum. Here, we employ NMR spectroscopy in combination with single-turnover diubiquitin formation assays to examine the role of the RING domain from gp78 in the catalytic activation of Ube2g2∼Ub conjugates. We find that approximately 60% of the Ube2g2∼Ub conjugates occupy a closed conformation in the absence of gp78-RING, with the population increasing to 82% upon gp78-RING binding. As expected, strong mutations in the hydrophobic patch residues of the ∼Ub moiety result in Ube2g2∼Ub populating only open states with corresponding loss of the ubiquitin conjugation activity. Less disruptive mutations introduced into the hydrophobic patch of the ∼Ub moiety also destabilize the closed conformational state, yet the corresponding effect on the ubiquitin conjugation activity ranges from complete loss to an enhancement of the catalytic activity. These results present a picture in which Ube2g2’s active site is in a state of continual dynamic flux with the organization of the active site into a catalytically viable conformation constituting the rate-limiting step for a single ubiquitin ligation event. Ube2g2’s function as a highly specific K48-polyubiquitin chain elongator leads us to speculate that this may be a strategy by which Ube2g2 reduces the probability of nonproductive catalytic outcomes in the absence of available substrate. PMID:28884161

  13. The G305 star-forming complex: the central star clusters Danks 1 and Danks 2

    NASA Astrophysics Data System (ADS)

    Davies, Ben; Clark, J. S.; Trombley, Christine; Figer, Donald F.; Najarro, Francisco; Crowther, Paul A.; Kudritzki, Rolf-Peter; Thompson, Mark; Urquhart, James S.; Hindson, Luke

    2012-01-01

    The G305 H II complex (G305.4+0.1) is one of the most massive star-forming structures yet identified within the Galaxy. It is host to many massive stars at all stages of formation and evolution, from embedded molecular cores to post-main-sequence stars. Here, we present a detailed near-infrared analysis of the two central star clusters Danks 1 and Danks 2, using Hubble Space Telescope+NICMOS imaging and Very Large Telescope+ISAAC spectroscopy. We find that the spectrophotometric distance to the clusters is consistent with the kinematic distance to the G305 complex, an average of all measurements giving a distance of 3.8 ± 0.6 kpc. From analysis of the stellar populations and the pre-main-sequence stars, we find that Danks 2 is the elder of the two clusters, with an age of 3+3- 1 Myr. Danks 1 is clearly younger with an age of 1.5+1.5- 0.5 Myr, and is dominated by three very luminous H-rich Wolf-Rayet stars which may have masses ≳100 M⊙. The two clusters have mass functions consistent with the Salpeter slope, and total cluster masses of 8000 ± 1500 and 3000 ± 800 M⊙ for Danks 1 and Danks 2, respectively. Danks 1 is significantly the more compact cluster of the two, and is one of the densest clusters in the Galaxy with log (ρ/M⊙ pc-3) = 5.5+0.5- 0.4. In addition to the clusters, there is a population of apparently isolated Wolf-Rayet stars within the molecular cloud's cavity. Our results suggest that the star-forming history of G305 began with the formation of Danks 2, and subsequently Danks 1, with the origin of the diffuse evolved population currently uncertain. Together, the massive stars at the centre of the G305 region appear to be clearing away what is left of the natal cloud, triggering a further generation of star formation at the cloud's periphery.

  14. HoxB2 binds mutant SOD1 and is altered in transgenic model of ALS.

    PubMed

    Zhai, Jinbin; Lin, Hong; Canete-Soler, Rafaela; Schlaepfer, William W

    2005-09-15

    Mutations in Cu/Zn superoxide dismutase (SOD1) cause approximately 20% of familial amyotrophic lateral sclerosis by a toxic gain of function; however, the precise mechanisms remain unclear. Here, we report the identification of HoxB2, a homeodomain-containing transcription factor, as a G93A mutant SOD1 interactive protein in a yeast two-hybrid screen. We show that HoxB2 co-precipitates and co-localizes with mutant SOD1 in neuronal cell lines, as well as in brain and spinal cord of G93A mutant SOD1 transgenic mice. Mutagenesis further shows that this interaction is mediated by the central homeodomain of HoxB2. In motor neuron-like NSC-34 cells, overexpression of HoxB2 or its homeodomain decreases the insolubility of mutant SOD1 and inhibits G93A or G86R mutant SOD1-induced neuronal cell death. In human and mouse tissues, we show that expression of HoxB2 persists in adult spinal cord and is primarily localized in nuclei of motor neurons. In G93A transgenic mice, HoxB2 co-localizes with mutant SOD1 and is redistributed to perikarya and proximal neurites of motor neurons. In addition, there is progressive accumulation of HoxB2 and mutant SOD1 as punctate inclusions in the neuropil surrounding motor neurons. Taken together, our findings demonstrate that interaction of HoxB2 with mutant SOD1 occurs in motor neurons of G93A mutant SOD1 transgenic mice and suggest that this interaction may modulate the neurotoxicity of mutant SOD1.

  15. Effects of 2G and 3G mobile phones on performance and electrophysiology in adolescents, young adults and older adults.

    PubMed

    Leung, S; Croft, R J; McKenzie, R J; Iskra, S; Silber, B; Cooper, N R; O'Neill, B; Cropley, V; Diaz-Trujillo, A; Hamblin, D; Simpson, D

    2011-11-01

    This study examined sensory and cognitive processing in adolescents, young adults and older adults, when exposed to 2nd (2G) and 3rd (3G) generation mobile phone signals. Tests employed were the auditory 3-stimulus oddball and the N-back. Forty-one 13-15 year olds, forty-two 19-40 year olds and twenty 55-70 year olds were tested using a double-blind cross-over design, where each participant received Sham, 2G and 3G exposures, separated by at least 4 days. 3-Stimulus oddball task: Behavioural: accuracy and reaction time of responses to targets were not affected by exposure. Electrophysiological: augmented N1 was found in the 2G condition (independent of age group). N-back task: Behavioural: the combined groups performed less accurately during the 3G exposure (compared to Sham), with post hoc tests finding this effect separately in the adolescents only. Electrophysiological: delayed ERD/ERS responses of the alpha power were found in both 3G and 2G conditions (compared to Sham; independent of age group). Employing tasks tailored to each individual's ability level, this study provides support for an effect of acute 2G and 3G exposure on human cognitive function. The subtlety of mobile phone effect on cognition in our study suggests that it is important to account for individual differences in future mobile phone research. Copyright © 2011 International Federation of Clinical Neurophysiology. All rights reserved.

  16. Ursolic acid sensitizes cisplatin-resistant HepG2/DDP cells to cisplatin via inhibiting Nrf2/ARE pathway

    PubMed Central

    Wu, Shouhai; Zhang, Tianpeng; Du, Jingsheng

    2016-01-01

    Background Combinations of adjuvant sensitizers with anticancer drugs is a promising new strategy to reverse chemoresistance. Ursolic acid (UA) is one of the natural pentacyclic triterpene compounds known to have many pharmacological characteristics such as anti-inflammatory and anticancer properties. This study investigates whether UA can sensitize hepatocellular carcinoma cells to cisplatin. Materials and methods Cells were transfected with nuclear factor erythroid-2-related factor 2 (Nrf2) small interfering RNA and Nrf2 complementary DNA by using Lipofectin 2000. The cytotoxicity of cells was investigated by Cell Counting Kit 8 assay. Cell apoptosis, cell cycle, reactive oxygen species, and mitochondrial membrane potential were detected by flow cytometry fluorescence-activated cell sorting. The protein level of Nrf2, NAD(P)H quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and heme oxygenase-1 (HO-1) was detected by Western blot analysis. Results The results showed that the reverse index was 2.9- and 9.69-fold by UA of 1.125 μg/mL and 2.25 μg/mL, respectively, for cisplatin to HepG2/DDP cells. UA–cisplatin combination induced cell apoptosis and reactive oxygen species, blocked the cell cycle in G0/G1 phase, and reduced the mitochondrial membrane potential. Mechanistically, UA–cisplatin dramatically decreased the expression of Nrf2 and its downstream genes. The sensibilization of UA–cisplatin combination was diminished in Nrf2 small interfering RNA-transfected HepG2/DDP cells, as well as in Nrf2 complementary DNA-transfected HepG2/DDP cells. Conclusion The results confirmed the sensibilization of UA on HepG2/DDP cells to cisplatin, which was possibly mediated via the Nrf2/antioxidant response element pathway. PMID:27822011

  17. Upgrading cytochrome P450 activity in HepG2 cells co-transfected with adenoviral vectors for drug hepatotoxicity assessment.

    PubMed

    Tolosa, Laia; Donato, M Teresa; Pérez-Cataldo, Gabriela; Castell, José Vicente; Gómez-Lechón, M José

    2012-12-01

    In a number of adverse drug reactions leading to hepatotoxicity, drug metabolism is thought to be involved by the generation of reactive metabolites from non-toxic drugs. The use of hepatoma cell lines, such as HepG2 cell line, for the evaluation of drug-induced hepatotoxicity is hampered by their low cytochrome P450 expression which makes impossible the study of the toxicity produced by bioactivable compounds. Genetically manipulated cells constitute promising tools for hepatotoxicity applications. HepG2 cells were simultaneously transfected with recombinant adenoviruses encoding CYP1A2, CYP2C9 and CYP3A4 to confer them drug-metabolic competence. Upgraded cells (Adv-HepG2) were highly able to metabolize the toxin studied in contrast to the reduced metabolic capacity of HepG2 cells. Aflatoxin B1-induced hepatotoxicity was studied as a proof of concept in metabolically competent and non-competent HepG2 cells by using high content screening technology. Significant differences in mitochondrial membrane potential, intracellular calcium concentration, nuclear morphology and cell viability after treatment with aflatoxin B1 were observed in Adv-HepG2 when compared to HepG2 cells. Rotenone (non bioactivable) and citrate (non hepatotoxic) were analysed as negative controls. This cell model showed to be a suitable hepatic model to test hepatotoxicity of bioactivable drugs and constitutes a valuable alternative for hepatotoxicity testing. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. 47-mG2a: A Mouse IgG2a-Type of PcMab-47 Useful for Detecting Podocalyxin in Esophageal Cancers by Immunohistochemistry.

    PubMed

    Kaneko, Mika K; Itai, Shunsuke; Yamada, Shinji; Kato, Yukinari

    2018-04-09

    Esophageal cancer is one of the highly malignant cancers. It comprises two of the most common histological tumor types: squamous cell carcinoma (SCC) and adenocarcinoma. SCC accounts for about 90% of esophageal cancers. Despite developments in treatment strategies, the prognosis and survival rate remain poor. Podocalyxin (PODXL) is a highly glycosylated type-I transmembrane protein. It is expressed in normal tissues such as kidney, heart, breast, and pancreas. Upregulation of PODXL correlates with tumor progression, invasion, and metastasis. Therefore, this glycoprotein could be a potential biomarker for predicting the prognosis of some cancers, for instance, brain, colorectal, oral, lung, bladder, prostate, and ovarian cancers. We previously developed a specific and sensitive anti-PODXL monoclonal antibody (mAb), PcMab-47 (mouse IgG 1 , kappa) and its mouse IgG 2a -type (47-mG 2a ). We showed their utility in immunohistochemical analysis of oral cancers. Herein, we demonstrate that PcMab-47 and 47-mG 2a can also be used to detect esophageal squamous cell carcinoma (ESCC) with this technique. These two antibodies, respectively, stained 123/130 (94.6%) and 127/130 (97.7%) ESCC cases, indicating that they can detect PODXL with high sensitivity in this carcinoma. Of more than 3+ cases, 47-mG 2a was more effective than PcMab-47, respectively, staining 56/127 (44.1%) and 41/123 (33.3%). Therefore, 47-mG 2a can be used for the detection of PODXL in ESCC using immunohistochemical analysis.

  19. An anti-HIV-1 compound that increases steady-state expression of apoplipoprotein B mRNA-editing enzyme-catalytic polypeptide-like 3G.

    PubMed

    Ejima, Tomohiko; Hirota, Mayuko; Mizukami, Tamio; Otsuka, Masami; Fujita, Mikako

    2011-10-01

    Human apoplipoprotein B mRNA-editing enzyme-catalytic polypeptide-like (APOBEC) 3G (A3G) is an antiviral protein that blocks HIV-1 replication. However, the antiviral activity of A3G is overcome by the HIV-1 protein Vif. This inhibitory function of Vif is related to its ability to degrade A3G in the proteasome. This finding prompted us to examine the activities of 4-(dimethylamino)-2,6-bis[(N-(2-[(2-nitrophenyl)dithio]ethyl)amino)methyl]pyridine (SN-2) and SN-3. We found that 5 µM SN-2 increases the expression of A3G to a level much higher than that observed in the absence of Vif, without affecting the level of Vif expression. The proteasome inhibitor MG-132 increased the level of both A3G and Vif expression. These results demonstrate that A3G is ubiquitinated and degraded in the proteasome by a factor other than Vif, and that SN-2 selectively inhibits these processes. Furthermore, 5 µM SN-2 significantly inhibited the MAGI cell infectivity of wild-type HIV-1. These findings may contribute to the development of a novel anti-HIV-1 drug.

  20. The plasminogen activator inhibitor-1 (PAI-1) gene -844 A/G and -675 4G/5G promoter polymorphism significantly influences plasma PAI-1 levels in women with polycystic ovary syndrome.

    PubMed

    Lin, Sun; Huiya, Zhang; Bo, Liu; Wei, Wei; Yongmei, Guan

    2009-12-01

    Mutations in the plasminogen activator inhibitor-1 (PAI-1) gene, along with increased PAI-1 levels, have been implicated in the pathogenesis of polycystic ovarian syndrome (PCOS). We investigated a possible influence of the promoter polymorphism (-844 A/G and -675 4G/5G) in the PAI-1 gene on plasma PAI-1 levels in 126 PCOS patients and 97 healthy controls. Levels of total testosterone, luteinizing hormone (LH), follicle stimulating hormone (FSH), fasting plasma glucose (FPG), fasting insulin, and PAI-1 were measured, and body mass index (BMI), waist-to-hip ratio (WHR), LH/FSH ratio, and homeostasis model assessment for insulin resistance (HOMA-IR) were calculated. PAI-1 -675 4G/5G and -844 A/G gene polymorphisms were also performed. Total testosterone, fasting insulin, and PAI-1 levels; BMI, LH/FSH, and HOMA-IR were significantly higher in PCOS patients than controls (P < 0.05). The odds ratio of 4G/4G genotype, 4G allele, and the combination genotype of 4G/4G and -844 A/A were 2.49 (95% confidence interval (CI), 1.4-4.44), 2.1 (95% CI, 1.43-3.08), and 2.9 (95% CI, 1.41-5.98), respectively, (P < 0.001). In the PCOS group, the PAI-1 level of the A/A was significantly higher than that of the A/G or G/G genotype, similarly was 4G/4G genotype compared with 4G/5G or 5G/5G genotype. The plasma PAI-1 levels of the combination of the PAI-1 -844 A/A and -675 4G/4G or 4G/5G genotypes, or the coadunation of 4G/4G and -844 non-G/G (A/A + A/G) genotypes were significantly high in PCOS women compared with controls. A trend to a positive interaction between PAI-1 -675 4G/5G and -844 A/G gene polymorphism may elevate plasma PAI-1 levels and hypofibrinolysis, which is probably an important hereditary risk factor in PCOS.

  1. Quark-hadron duality in spin structure functions g1p and g1d

    NASA Astrophysics Data System (ADS)

    Bosted, P. E.; Dharmawardane, K. V.; Dodge, G. E.; Forest, T. A.; Kuhn, S. E.; Prok, Y.; Adams, G.; Amarian, M.; Ambrozewicz, P.; Anghinolfi, M.; Asryan, G.; Avakian, H.; Bagdasaryan, H.; Baillie, N.; Ball, J. P.; Baltzell, N. A.; Barrow, S.; Batourine, V.; Battaglieri, M.; Beard, K.; Bedlinskiy, I.; Bektasoglu, M.; Bellis, M.; Benmouna, N.; Biselli, A. S.; Bonner, B. E.; Bouchigny, S.; Boiarinov, S.; Bradford, R.; Branford, D.; Brooks, W. K.; Bültmann, S.; Burkert, V. D.; Butuceanu, C.; Calarco, J. R.; Careccia, S. L.; Carman, D. S.; Carnahan, B.; Cazes, A.; Chen, S.; Cole, P. L.; Collins, P.; Coltharp, P.; Cords, D.; Corvisiero, P.; Crabb, D.; Crannell, H.; Crede, V.; Cummings, J. P.; Masi, R. De; Devita, R.; Sanctis, E. De; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Deur, A.; Djalali, C.; Donnelly, J.; Doughty, D.; Dragovitsch, P.; Dugger, M.; Dytman, S.; Dzyubak, O. P.; Egiyan, H.; Egiyan, K. S.; Elouadrhiri, L.; Eugenio, P.; Fatemi, R.; Fedotov, G.; Feuerbach, R. J.; Funsten, H.; Garçon, M.; Gavalian, G.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gonenc, A.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guillo, M.; Guler, N.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hafidi, K.; Hakobyan, R. S.; Hardie, J.; Heddle, D.; Hersman, F. W.; Hicks, K.; Hleiqawi, I.; Holtrop, M.; Huertas, M.; Hyde-Wright, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Ito, M. M.; Jenkins, D.; Jo, H. S.; Joo, K.; Juengst, H. G.; Keith, C.; Kellie, J. D.; Khandaker, M.; Kim, K. Y.; Kim, K.; Kim, W.; Klein, A.; Klein, F. J.; Klusman, M.; Kossov, M.; Kramer, L. H.; Kubarovsky, V.; Kuhn, J.; Kuleshov, S. V.; Lachniet, J.; Laget, J. M.; Langheinrich, J.; Lawrence, D.; Li, Ji; Lima, A. C. S.; Livingston, K.; Lu, H.; Lukashin, K.; MacCormick, M.; Manak, J. J.; Markov, N.; McAleer, S.; McKinnon, B.; McNabb, J. W. C.; Mecking, B. A.; Mestayer, M. D.; Meyer, C. A.; Mibe, T.; Mikhailov, K.; Minehart, R.; Mirazita, M.; Miskimen, R.; Mokeev, V.; Morand, L.; Morrow, S. A.; Moteabbed, M.; Mueller, J.; Mutchler, G. S.; Nadel-Turonski, P.; Napolitano, J.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niroula, M. R.; Niyazov, R. A.; Nozar, M.; O'Rielly, G. V.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Paterson, C.; Philips, S. A.; Pierce, J.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Polli, E.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Protopopescu, D.; Qin, L. M.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Ronchetti, F.; Rosner, G.; Rossi, P.; Rowntree, D.; Rubin, P. D.; Sabatié, F.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Schumacher, R. A.; Serov, V. S.; Sharabian, Y. G.; Shaw, J.; Shvedunov, N. V.; Skabelin, A. V.; Smith, E. S.; Smith, L. C.; Sober, D. I.; Stavinsky, A.; Stepanyan, S. S.; Stepanyan, S.; Stokes, B. E.; Stoler, P.; Strauch, S.; Suleiman, R.; Taiuti, M.; Taylor, S.; Tedeschi, D. J.; Thoma, U.; Thompson, R.; Tkabladze, A.; Tkachenko, S.; Todor, L.; Tur, C.; Ungaro, M.; Vineyard, M. F.; Vlassov, A. V.; Weinstein, L. B.; Weygand, D. P.; Williams, M.; Wolin, E.; Wood, M. H.; Yegneswaran, A.; Yun, J.; Zana, L.; Zhang, J.; Zhao, B.; Zhao, Z.

    2007-03-01

    New measurements of the spin structure functions of the proton and deuteron g1p(x,Q2) and g1d(x,Q2) in the nucleon resonance region are compared with extrapolations of target-mass-corrected next-to-leading-order (NLO) QCD fits to higher energy data. Averaged over the entire resonance region (W<2 GeV), the data and QCD fits are in good agreement in both magnitude and Q2 dependence for Q2>1.7 GeV2/c2. This “global” duality appears to result from cancellations among the prominent “local” resonance regions: in particular strong σ3/2 contributions in the Δ(1232) region appear to be compensated by strong σ1/2 contributions in the resonance region centered on 1.5 GeV. These results are encouraging for the extension of NLO QCD fits to lower W and Q2 than have been used previously.

  2. Copresentation of antigen and ligands of Siglec-G induces B cell tolerance independent of CD22.

    PubMed

    Pfrengle, Fabian; Macauley, Matthew S; Kawasaki, Norihito; Paulson, James C

    2013-08-15

    Differentiation of self from nonself is indispensable for maintaining B cell tolerance in peripheral tissues. CD22 and Siglec-G (sialic acid-binding Ig-like lectin G) are two inhibitory coreceptors of the BCR that are implicated in maintenance of tolerance to self Ags. Enforced ligation of CD22 and the BCR by a nanoparticle displaying both Ag and CD22 ligands induces a tolerogenic circuit resulting in apoptosis of the Ag-reactive B cell. Whether Siglec-G also has this property has not been investigated in large part owing to the lack of a selective Siglec-G ligand. In this article, we report the development of a selective high-affinity ligand for Siglec-G and its application as a chemical tool to investigate the tolerogenic potential of Siglec-G. We find that liposomal nanoparticles decorated with Ag and Siglec-G ligand inhibit BCR signaling in both B1 and B2 B cells compared with liposomes displaying Ag alone. Not only is inhibition of B cell activation observed by ligating the BCR with Siglec-G, but robust tolerance toward T-independent and T-dependent Ags is also induced in mice. The ability of Siglec-G to inhibit B cell activation equally in both B1 and B2 subsets is consistent with our observation that Siglec-G is expressed at a relatively constant level throughout numerous B cell subsets. These results suggest that Siglec-G may contribute to maintenance of B cell tolerance toward self Ags in various B cell compartments.

  3. 5-(2-Carboxyethenyl) isatin derivative induces G{sub 2}/M cell cycle arrest and apoptosis in human leukemia K562 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Yao; Zhao, Hong-Ye; Han, Kai-Lin

    2014-08-08

    Highlights: • 5-(2-Carboxyethenyl) isatin derivative (HKL 2H) inhibited K562’s proliferation. • HKL 2H caused the morphology change of G{sub 2}/M phase arrest and typical apoptosis. • HKL 2H induced G2/M cell cycle phase arrest in K562 cells. • HKL 2H induced apoptosis in K562 cells through the mitochondrial pathway. - Abstract: Our previous study successfully identified that the novel isatin derivative (E)-methyl 3-(1-(4-methoxybenzyl)-2,3-dioxoindolin-5-yl) acrylate (HKL 2H) acts as an anticancer agent at an inhibitory concentration (IC{sub 50}) level of 3 nM. In this study, the molecular mechanism how HKL 2H induces cytotoxic activity in the human chronic myelogenous leukemia K562more » cells was investigated. Flow cytometric analysis showed that the cells were arrested in the G{sub 2}/M phase and accumulated subsequently in the sub-G{sub 1} phase in the presence of HKL 2H. HKL 2H treatment down-regulated the expressions of CDK1 and cyclin B but up-regulated the level of phosphorylated CDK1. Annexin-V staining and the classic DNA ladder studies showed that HKL 2H induced the apoptosis of K562 cells. Our study further showed that HKL 2H treatment caused the dissipation of mitochondrial membrane potential, activated caspase-3 and lowered the Bcl-2/Bax ratio in K562 cells, suggesting that the HKL 2H-causing programmed cell death of K562 cells was caused via the mitochondrial apoptotic pathway. Taken together, our data demonstrated that HKL 2H, a 5-(2-carboxyethenyl) isatin derivative, notably induces G{sub 2}/M cell cycle arrest and mitochondrial-mediated apoptosis in K562 cells, indicating that this compound could be a promising anticancer candidate for further investigation.« less

  4. BPS states in N = 2 supersymmetric G2 and F4 models

    NASA Astrophysics Data System (ADS)

    Ahl Laamara, R.; Mellal, O.; Saidi, E. H.

    2017-07-01

    In BPS quiver theory of N = 2 supersymmetric pure gauge models with gauge invariance G, primitive BPS quivers Q0G are of two types: Q0ADE and Q0BCFG. In this study, we first show that Q0ADE have outer-automorphism symmetries inherited from the outer-automorphisms of the Dynkin diagrams of ADE Lie algebras. Then, we extend the usual folding operation of Dynkin diagrams ADE → BCFG to obtain the two following things: (i) relate Q0BCFG quivers and their mutations to the Q0ADE ones and their mutations; and (ii) link the BPS chambers of the N = 2ADE theories with the corresponding BCFG ones. As an illustration of this construction, we derive the BPS and anti-BPS states of the strong chambers QstgG2 and QstgF4 of the 4d N = 2 pure G2 and F4 gauge models.

  5. Bone mineral properties in growing Col1a2(+/G610C) mice, an animal model of osteogenesis imperfecta.

    PubMed

    Masci, Marco; Wang, Min; Imbert, Laurianne; Barnes, Aileen M; Spevak, Lyudmila; Lukashova, Lyudmila; Huang, Yihe; Ma, Yan; Marini, Joan C; Jacobsen, Christina M; Warman, Matthew L; Boskey, Adele L

    2016-06-01

    The Col1a2(+/G610C) knock-in mouse, models osteogenesis imperfecta in a large old order Amish family (OOA) with type IV OI, caused by a G-to-T transversion at nucleotide 2098, which alters the gly-610 codon in the triple-helical domain of the α2(I) chain of type I collagen. Mineral and matrix properties of the long bones and vertebrae of male Col1a2(+/G610C) and their wild-type controls (Col1a2(+/+)), were characterized to gain insight into the role of α2-chain collagen mutations in mineralization. Additionally, we examined the rescuability of the composition by sclerostin inhibition initiated by crossing Col1a2(+/G610C) with an LRP(+/A214V) high bone mass allele. At age 10-days, vertebrae and tibia showed few alterations by micro-CT or Fourier transform infrared imaging (FTIRI). At 2-months-of-age, Col1a2(+/G610C) tibias had 13% fewer secondary trabeculae than Col1a2(+/+), these were thinner (11%) and more widely spaced (20%) than those of Col1a2(+/+) mice. Vertebrae of Col1a2(+/G610C) mice at 2-months also had lower bone volume fraction (38%), trabecular number (13%), thickness (13%) and connectivity density (32%) compared to Col1(a2+/+). The cortical bone of Col1a2(+/G610C) tibias at 2-months had 3% higher tissue mineral density compared to Col1a2(+/+); Col1a2(+/G610C) vertebrae had lower cortical thickness (29%), bone area (37%) and polar moment of inertia (38%) relative to Col1a2(+/+). FTIRI analysis, which provides information on bone chemical composition at ~7μm-spatial resolution, showed tibias at 10-days did not differ between genotypes. Comparing identical bone types in Col1a2(+/G610C) to Col1a2(+/+) at 2-months-of-age, tibias showed higher mineral-to-matrix ratio in trabeculae (17%) and cortices (31%). and in vertebral cortices (28%). Collagen maturity was 42% higher at 10-days-of-age in Col1a2(+/G610C) vertebral trabeculae and in 2-month tibial cortices (12%), vertebral trabeculae (42%) and vertebral cortices (12%). Higher acid-phosphate substitution

  6. Recombinant glycoprotein G analog for determination of specific immunoglobulins to herpes simplex virus type 2 by ELISA.

    PubMed

    Korshun, Ludmila; Vudmaska, Mariya; Moysa, Larissa; Kovtonjuk, Galina; Mikhalap, Svetlana; Ganova, Larissa; Spivak, Nikolay

    2013-12-01

    In order to the detection of type-specific IgG to herpes simplex virus type 2 (HSV-2) in human serum or plasma the recombinant analog of HSV-2 glycoprotein G (gG2) was created. To construct an expression vector the DNA fragment with a sequence identical to immunodominant regions of HSV-2 gG2 was cloned into modified vector pET28a containing of the glutation-S-transferase sequence (pET28-GST). Escherichia coli BL21 (DE3) were transformed with the recombinant plasmid. The target protein was expressed mainly in soluble form. Chromatographic purification of soluble GST-gG2 protein was performed taking into account the features of its primary structure that are 6His-tag and GST-tag. To determine the affinity constant of the specific IgG to GST-gG2 we used the method proposed by Friguet et al. (1985). The affinity constants were within the range of 10(7)-10(8)M(-1) proving their high-affinity. The purified recombinant HSV-2 antigen was used to design a diagnostic ELISA kit, which was evaluated with referent controls and standard panels of sera containing and/or not containing anti-HSV-2 IgG. Comparative evaluation of this kit and the commercially available "HSV-Type 2 IgG-ELISA" (NovaTec, Dietzenbach, Germany) kit was performed. There was no significant difference (P>0.05). It allows to use developed ELISA kit for clinical diagnosis of HSV-2 infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. The Broadly Neutralizing Anti-Human Immunodeficiency Virus Type 1 Antibody 2G12 Recognizes a Cluster of α12 Mannose Residues on the Outer Face of gp120

    PubMed Central

    Scanlan, Christopher N.; Pantophlet, Ralph; Wormald, Mark R.; Ollmann Saphire, Erica; Stanfield, Robyn; Wilson, Ian A.; Katinger, Hermann; Dwek, Raymond A.; Rudd, Pauline M.; Burton, Dennis R.

    2002-01-01

    2G12 is a broadly neutralizing human monoclonal antibody against human immunodeficiency virus type-1 (HIV-1) that has previously been shown to bind to a carbohydrate-dependent epitope on gp120. Here, site-directed mutagenesis and carbohydrate analysis were used to define further the 2G12 epitope. Extensive alanine scanning mutagenesis showed that elimination of the N-linked carbohydrate attachment sequences associated with residues N295, N332, N339, N386, and N392 by N→A substitution produced significant decreases in 2G12 binding affinity to gp120JR-CSF. Further mutagenesis suggested that the glycans at N339 and N386 were not critical for 2G12 binding to gp120JR-CSF. Comparison of the sequences of isolates neutralized by 2G12 was also consistent with a lesser role for glycans attached at these positions. The mutagenesis studies provided no convincing evidence for the involvement of gp120 amino acid side chains in 2G12 binding. Antibody binding was inhibited when gp120 was treated with Aspergillus saitoi mannosidase, Jack Bean mannosidase, or endoglycosidase H, indicating that Manα12Man-linked sugars of oligomannose glycans on gp120 are required for 2G12 binding. Consistent with this finding, the binding of 2G12 to gp120 could be inhibited by monomeric mannose but not by galactose, glucose, or N-acetylglucosamine. The inability of 2G12 to bind to gp120 produced in the presence of the glucose analogue N-butyl-deoxynojirimycin similarly implicated Manα12Man-linked sugars in 2G12 binding. Competition experiments between 2G12 and the lectin cyanovirin for binding to gp120 showed that 2G12 only interacts with a subset of available Manα12Man-linked sugars. Consideration of all the data, together with inspection of a molecular model of gp120, suggests that the most likely epitope for 2G12 is formed from mannose residues contributed by the glycans attached to N295 and N332, with the other glycans playing an indirect role in maintaining epitope conformation

  8. Chemical Synthesis of a 5'-Terminal TMG-Capped Triribonucleotide m(3)(2,2,7)G(5)(')pppAmpUmpA of U1 RNA.

    PubMed

    Sekine, Mitsuo; Kadokura, Michinori; Satoh, Takahiko; Seio, Kohji; Wada, Takeshi; Fischer, Utz; Sumpter, Vicki; Lührmann, Reinhard

    1996-06-26

    The 5'-terminal TMG-capped triribonucleotide, m(3)(2,2,7)G(5)(')pppAmpUmpA, has been synthesized by condensation of an appropriately protected triribonucleotide derivative of ppAmpUmpA with a new TMG-capping reagent. During this total synthesis, it was found that the regioselective 2'-O-methylation of 3',5'-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)-N-(4-monomethoxytrityl)adenosine was achieved by use of MeI/Ag(2)O without affecting the base moiety. A new route to 2-N,2-N-dimethylguanosine from guanosine via a three-step reaction has also been developed by reductive methylation using paraformaldehyde and sodium cyanoborohydride. These key intermediates were used as starting materials for the construction of a fully protected derivative of pAmpUmpA and a TMG-capping reagent of Im-pm(3)(2,2,7)G. The target TMG-capped tetramer, m(3)(2,2,7)G(5)(')pppAmpUmpA, was synthesized by condensation of a partially protected triribonucleotide 5'-terminal diphosphate species, ppA(MMTr)mpUmpA, with Im-pm(3)(2,2,7)G followed by treatment with 80% acetic acid. The structure of m(3)(2,2,7)G(5)(')pppAmpUmpA was characterized by (1)H and (31)P NMR spectroscopy as well as enzymatic assay using snake venom phosphodiesterase, calf intestinal phosphatase, and nuclease P1.

  9. C1473G polymorphism in mouse tryptophan hydroxylase-2 gene in the regulation of the reaction to emotional stress.

    PubMed

    Bazhenova, Ekaterina Y; Bazovkina, Daria V; Kulikova, Elizabeth A; Fursenko, Dariya V; Khotskin, Nikita V; Lichman, Daria V; Kulikov, Alexander V

    2017-02-15

    Neurotransmitter serotonin (5-HT) is involved in the regulation of stress response. Tryptophan hydroxylase-2 (TPH2) is the key enzyme of serotonin (5-HT) synthesis in the brain. C1473G polymorphism in Tph2 gene is the main factor defining the enzyme activity in the brain of laboratory mice. The effect of interaction between C1473G polymorphism and 30min restriction stress on the behavior in the open field test, c-Fos gene expression and 5-HT metabolism in the brain in adult male of B6-1473C and B6-1473G congenic mouse lines with high and low TPH2 activity was investigated. A significant effect of genotype x stress interaction on c-Fos mRNA in the hypothalamus (F 1,21 =10.66, p<0.001) and midbrain (F 1,21 =9.18, p<0.01) was observed. The stress-induced rise of c-Fos mRNA in these structures is more intensive in B6-1473G than in B6-1473C mice. A marked effect of genotype x stress interaction on 5-HT level in the cortex (F 1,18 =9.38, p<0.01) and 5-HIAA/5-HT turnover rate in the hypothalamus (F 1,18 =9.01, p<0.01) was revealed. The restriction significantly decreased 5-HT level in the cortex (p<0.01) and increased 5-HIAA/5-HT rate (p<0.001) in the hypothalamus in B6-1473C mice, but not in B6-1473G mice. The present result is the first experimental evidence that C1473G polymorphism is involved in the regulation of the reaction to emotional stress in mice. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Combustion synthesis of AlB2-Al2O3 composite powders with AlB2 nanowire structures

    NASA Astrophysics Data System (ADS)

    Yang, Pan; Xiao, Guoqing; Ding, Donghai; Ren, Yun; Yang, Shoulei; Lv, Lihua; Hou, Xing

    2018-05-01

    Using of Al and B2O3 powders as starting materials, and Mg-Al alloy as additives, AlB2-Al2O3 composite powders with AlB2 nanowire structures were successfully fabricated via combustion synthesis method in Ar atmosphere at a pressure of 1.5 MPa. The effect of different amount of Mg-Al alloy on the phase compositions and morphology of the combustion products was investigated. The results revealed that AlB2 and Al2O3 increased, whereas Al decreased with the content of Mg-Al alloy increasing. The impurities MgAl2O4 and AlB12 would exist in the sample with adding of 18 wt% Mg-Al alloy. Interestingly, FESEM/TEM/EDS results showed that AlB2 nanowires were observed in the products when the content of Mg-Al alloy is 6 wt% and 12 wt%. The more AlB2 nanowires can be found as the content of Mg-Al alloy increased. And the yield of AlB2 nanowires with the diameter of about 200 nanometers (nm) and the length up to several tens of micrometers (μm) in the combustion product is highest when the content of Mg-Al alloy is 12 wt%. The vapor, such as Mg-Al (g), B2O2 (g), AlO (g) and Al2O (g), produced during the process of combustion synthesis, reacted with each other to yield AlB2 nanowires by vapor-solid (VS) mechanism and the corresponding model was also proposed.

  11. 20(S)-Protopanaxadiol induces apoptosis in human hepatoblastoma HepG2 cells by downregulating the protein kinase B signaling pathway.

    PubMed

    Lu, Zeyuan; Xu, Huali; Yu, Xiaofeng; Wang, Yuchen; Huang, Long; Jin, Xin; Sui, Dayun

    2018-02-01

    Hepatoblastoma is the most common primary liver tumor for children aged <5 years old. 20(S)-Protopanaxadiol (PPD) is a ginsenoside extracted from Pananx quinquefolium L ., which inhibits tumor growth in several cancer cell lines. The purpose of the present study was to assess the anticancer activities of 20(S)-PPD in human hepatoblastoma HepG2 cells. The cytotoxicity of 20(S)-PPD on HepG2 cells was evaluated using an MTT assay. Apoptosis was detected using DAPI staining and flow cytometry. The expression of apoptosis-associated proteins was identified by western blotting. The results demonstrated that 20(S)-PPD inhibited the viability of HepG2 cell in a dose and time-dependent manner. The IC 50 values were 81.35, 73.5, 48.79 µM at 24, 48 and 72 h, respectively. Topical morphological changes of apoptotic body formation following 20(S)-PPD treatment were detected by DAPI staining. The percentage of Annexin V-fluoroscein isothyiocyanate positive cells were 3.73, 17.61, 23.44 and 65.43% in HepG2 cells treated with 0, 40, 50 and 60 µM of 20(S)-PPD, respectively. Furthermore, 20(S)-PPD upregulated the expression of Bax and downregulated the expression of Bcl-2 and also activated caspases-3 and -9, and Poly [ADP-ribose] polymerase cleavage. In addition, 20(S)-PPD inhibited the phosphorylation of protein kinase B (Akt; Ser473). The results indicate that 20(S)-PPD inhibits the viability of HepG2 cells and induces apoptosis in HepG2 cells by inhibiting the phosphoinositide-3-kinase/Akt pathway.

  12. Vasoconstriction induced by G1, a G-protein-coupled oestrogen receptor1 (GPER-1) agonist, in the isolated perfused rat kidney.

    PubMed

    Kurt, Akif Hakan; Buyukafsar, Kansu

    2013-02-28

    Vascular effects of the G protein-coupled oestrogen receptor1 (GPER-1) agonist, G1 (10(-7)-5×10(-6) M), the main oestrogenic hormone, 17β-estradiol (10(-9)-10(-4) M), the NR3A1 agonist, PPT (10(-8)-10(-5) M), the NR3A2 agonist DPN (10(-8)-10(-5) M), and the classical oestrogen receptor blocker but also a GPER agonist, ICI-182780 (10(-8)-3×10(-6) M), were investigated on the perfusion pressure in the isolated rat kidney. To seek cellular mechanisms involved in GPER-1-induced signalling we tested several compounds including the inhibitors of Rho-kinase (ROCK) (Y-27632), tyrosine kinase (genistein), p38MAPK (SB203580), p44/42MAPK (PD98059), protein kinase C (PKC) (GF109203X), Jun-kinase (JNK) (SP600125), phosphatidylinositol-3-kinase (PI3K) (LY294002), Ca(2+) channels (nifedipine), GPER-1 (G15) and epidermal growth factor (EGF) receptor kinase (AG-1478). Moreover, the effect of saponin (50mg/ml) that was used for endothelium removal was explored on G1-elicited vascular action. G1, 17β-estradiol and ICI-182780 but not PPT and DPN induced vasoconstrictions in basal renal perfusion pressure. In contrast, G1 promoted vasodilatation when the perfusion pressure was elevated in advance by phenylephrine. G1-elicited vasoconstriction was not modified by endothelial removal; however, it was markedly inhibited by GPER-1 antagonist, G15. The vasoconstrictor response to G1 was also significantly attenuated by Y-27632, PD98059, SB203580, GF109203X, genistein, AG-1478, and nifedipine, but not LY294002 and SP600125. Western blotting indicated the expression of GPER-1 in renal artery, medulla and cortex of rat kidney. In conclusion, GPER-1 could substantially modulate vascular responses through a variety of signalling pathways including ROCK, PKC, p38 MAPK, p42/44 MAPK, tyrosine kinase, EGF receptor kinase and VOCC but not JNK or PI3K in isolated perfused rat kidney. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Action of caffeine on x-irradiated HeLa cells. V. Identity of the sector of cells that expresses potentially lethal damage in G/sub 1/ and G/sub 2/

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beetham, K.L.; Tolmach, L.J.

    1982-07-01

    When HeLa S3 cells are irradiated in early G/sub 1/ with 4 Gy of 220-kV x rays and are then incubated in growth medium containing up to 5 mM caffeine, survival is reduced (as reported previously), reaching a concentration-dependent plateau. Cell killing presumably occurs as a result of the fixation of a portion of the potentially lethal damage the cells contain. These cells respond to continued treatment with caffeine at concentrations greater than 2 mM during S, but less so than during G/sub 1/. When they reach G/sub 2/ arrest, however, extensive cell killing again occurs (reported previously), presumably alsomore » the result of potentially lethal damage fixation. G/sub 1/-irradiated cultures that are treated with caffeine either continuously at a concentration in the range 1 to 5 mM, or at 10 mM for 8 hr and subsequently with the low concentration, achieve the same survival level in G/sub 2/, provided that the potentially lethal damage is not repaired during G/sub 1/ and S. Repair seems to be completely inhibited in the presence of 3 to 4 mM caffeine. The results indicate that fixation of potentially lethal damage occurs in the same sector of cells in G/sub 1/ and G/sub 2/, suggesting that the same cellular lesion gives rise to cell killing in the two phases.« less

  14. Application and expression of HSV gG1 protein from a recombinant strain.

    PubMed

    Yan, Hua; Yan, Huishen; Huang, Tao; Li, Guocai; Gong, Weijuan; Jiao, Hongmei; Chen, Hongju; Ji, Mingchun

    2010-11-01

    According to the homologous sequence of glycoprotein G1 (gG1) genes from different strains of herpes simplex virus type 1 (HSV-1), a pair of primers was designed to amplify the gG1 gene fragment by PCR. Both the PCR product and the pGEX-4T-1 vector were digested with EcoR I and Sal I. The gG1 gene fragment was subcloned into the digested pGEX-4T-1 vector to construct a recombinant plasmid (pGEX-4T-1-gG1). The resultant plasmid was identified by dual-enzyme digestion and sequence analysis, and then transformed into Escherichia coli BL21 for expression under the induction of isopropyl β-D-1-thiogalactoside (IPTG). The expressed GST-gG1 fragment was detected by SDS-PAGE and purified by affinity chromatography. The properties of GST-gG1 fragment were evaluated by immunoblot analysis. Enzyme-linked immunosorbent assays (ELISAs) based on the GST-gG1 fragment were used for determining IgG or IgM to HSV-1. The GST-gG1 fragment-specific ELISA was also compared with ELISA with whole-HSV-1 antigen and commercial ELISA kits. The gG1-specific IgG and IFN-γ producing CD8+ T cells were induced in mice immunized with the GST-gG1 fragment. These results indicated that the GST-gG1 fragment could be used for replacing whole-virus antigen to detect IgM and IgG to HSV-1 in human sera, which provided a strategy for developing vaccines to protect HSV-1 infection using gG1 fragment. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Comparative Analysis of Glycoprotein B (gB) of Equine Herpesvirus Type 1 and Type 4 (EHV-1 and EHV-4) in Cellular Tropism and Cell-to-Cell Transmission

    PubMed Central

    Spiesschaert, Bart; Osterrieder, Nikolaus; Azab, Walid

    2015-01-01

    Glycoprotein B (gB) plays an important role in alphaherpesvirus cellular entry and acts in concert with gD and the gH/gL complex. To evaluate whether functional differences exist between gB1 and gB4, the corresponding genes were exchanged between the two viruses. The gB4-containing-EHV-1 (EHV-1_gB4) recombinant virus was analyzed for growth in culture, cell tropism, and cell entry rivaling no significant differences when compared to parental virus. We also disrupted a potential integrin-binding motif, which did not affect the function of gB in culture. In contrast, a significant reduction of plaque sizes and growth kinetics of gB1-containing-EHV-4 (EHV-4_gB1) was evident when compared to parental EHV-4 and revertant viruses. The reduction in virus growth may be attributable to the loss of functional interaction between gB and the other envelope proteins involved in virus entry, including gD and gH/gL. Alternatively, gB4 might have an additional function, required for EHV-4 replication, which is not fulfilled by gB1. In conclusion, our results show that the exchange of gB between EHV-1 and EHV-4 is possible, but results in a significant attenuation of virus growth in the case of EHV-4_gB1. The generation of stable recombinant viruses is a valuable tool to address viral entry in a comparative fashion and investigate this aspect of virus replication further. PMID:25654240

  16. Novel angiotensin receptor blocker, azilsartan induces oxidative stress and NFkB-mediated apoptosis in hepatocellular carcinoma cell line HepG2.

    PubMed

    Ahmadian, Elham; Khosroushahi, Ahmad Yari; Eftekhari, Aziz; Farajnia, Safar; Babaei, Hossein; Eghbal, Mohammad Ali

    2018-03-01

    Overexpression of renin angiotensin system (RAS) components and nuclear factor-kappa B (NF-kB) has a key role in various cancers. Blockade of RAS and NF-kB pathway has been suggested to reduce cancer cell proliferation. This study aimed to investigate the role of angiotensin II and NF-kB pathway in liver hepatocellular carcinoma cell line (HepG2) proliferation by using azilsartan (as a novel Ag II antagonist) and Bay 11-7082 (as NF-kB inhibitor). HepG2 cells were treated with different concentrations of azilsartan and Bay 11-7082. Cytotoxicity was determined after 24, 48, and 72?h by MTT assay. Reactive oxygen spices (ROS) generation and cytochrome c release were measured following azilsartan and Bay11- 7082 treatment. Apoptosis was analyzed qualitatively by DAPI staining and quantitatively through flow cytometry methodologies and Bax and Bcl-2 mRNA and protein levels were assessed by real time PCR and ELISA methods, respectively. The cytotoxic effects of different concentration of azilsartan and Bay11- 7082 on HepG2 cells were observed as a reduction in cell viability, increased ROS formation, cytochrome c release and apoptosis induction. These effects were found to correlate with a shift in Bax level and a downward trend in the expression of Bcl-2. These findings suggest that azilsartan and Bay11- 7082 in combination or alone have strong potential as an agent for prevention or treatment of liver cancer after further studies. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  17. Quantitation of Bone Growth Rate Variability in Rats Exposed to Micro-(near zero G) and Macrogravity (2G)

    NASA Technical Reports Server (NTRS)

    Bromage, Timothy G.; Doty, Stephen B.; Smolyar, Igor; Holton, Emily

    1997-01-01

    Our stated primary objective is to quantify the growth rate variability of rat lamellar bone exposed to micro- (near zero G: e.g., Cosmos 1887 & 2044; SLS-1 & SLS-2) and macrogravity (2G). The primary significance of the proposed work is that an elegant method will be established that unequivocally characterizes the morphological consequences of gravitational factors on developing bone. The integrity of this objective depends upon our successful preparation of thin sections suitable for imaging individual bone lamellae, and our imaging and quantitation of growth rate variability in populations of lamellae from individual bone samples.

  18. Comparison of two commercial embryo culture media (SAGE-1 step single medium vs. G1-PLUSTM/G2-PLUSTM sequential media): Influence on in vitro fertilization outcomes and human embryo quality.

    PubMed

    López-Pelayo, Iratxe; Gutiérrez-Romero, Javier María; Armada, Ana Isabel Mangano; Calero-Ruiz, María Mercedes; Acevedo-Yagüe, Pablo Javier Moreno de

    2018-04-26

    To compare embryo quality, fertilization, implantation, miscarriage and clinical pregnancy rates for embryos cultured in two different commercial culture media until D-2 or D-3. In this retrospective study, we analyzed 189 cycles performed in 2016. Metaphase II oocytes were microinjected and allocated into single medium (SAGE 1-STEP, Origio) until transferred, frozen or discarded; or, if sequential media were used, the oocytes were cultured in G1-PLUSTM (Vitrolife) up to D-2 or D-3 and in G2-PLUSTM (Vitrolife) to transfer. On the following day, the oocytes were checked for normal fertilization and on D-2 and D-3 for morphological classification. Statistical analysis was performed using the chi-square and Mann-Whitney tests in PASW Statistics 18.0. The fertilization rates were 70.07% for single and 69.11% for sequential media (p=0.736). The mean number of embryos with high morphological quality (class A/B) was higher in the single medium than in the sequential media: D-2 [class A (190 vs. 107, p<0.001), B (133 vs. 118, p=0.018)]; D-3 [class A (40 vs. 19, p=0.048) but without differences in class B (40 vs. 49)]. Consequently, a higher number of embryos cultured in single medium were frozen: 197 (21.00%) vs. sequential: 102 (11.00%), p<0.001. No differences were found in implantation rates (30.16% vs. 25.57%, p=0.520), clinical pregnancy rates (55.88% vs. 41.05%, p=0.213), or miscarriage rates (14.29% vs. 9.52%, p=0.472). Embryo culture in single medium yields greater efficiency per cycle than in sequential media. Higher embryo quality and quantity were achieved, resulting in more frozen embryos. There were no differences in clinical pregnancy rates.

  19. The discovery of Ni V in the photospheres of the hot DA white dwarfs RE 2214-492 and G191-B2B

    NASA Technical Reports Server (NTRS)

    Holberg, J. B.; Hubeny, I.; Barstow, M. A.; Lanz, T.; Sion, E. M.; Tweedy, R. W.

    1994-01-01

    We have co-added six recently obtained International Ultraviolet Explorer (IUE) echelle spectra of the hot DA white dwarf RE 2214-492 and 10 existing archive spectra of the well-known hot DA, G191-B2B. We find that both stars contain numerous weak features due to Ni V. Nickel is thus the second iron-group element to be found in the spectra of the very hottest DA white dwarfs. In addition to Ni V, we also observe Al III in both stars and present evidence for the possible presence of Ni IV and Fe IV in RE 2214-492. The presence of Ni and Al, together with previously reported elements, will contribute significantly to both the EUV opacity and to the apparent complexity of the UV spectra of these stars. Using Non-Local Thermodynamic Equilibrium (NLTE) model atmospheres we estimate the Ni abundances in RE 2214-492 the G191-B2B to be log(Ni/H) = -5.5 +/- 0.3 and -6.0 +/- 0.3, respectively.

  20. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 11 Federal Elections 1 2012-01-01 2012-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  1. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  2. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 11 Federal Elections 1 2011-01-01 2011-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  3. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 11 Federal Elections 1 2014-01-01 2014-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  4. Epstein-Barr Virus Glycoprotein gB and gHgL Can Mediate Fusion and Entry in trans, and Heat Can Act as a Partial Surrogate for gHgL and Trigger a Conformational Change in gB

    PubMed Central

    Chesnokova, Liudmila S.; Ahuja, Munish K.

    2014-01-01

    ABSTRACT Epstein-Barr virus (EBV) fusion with an epithelial cell requires virus glycoproteins gHgL and gB and is triggered by an interaction between gHgL and integrin αvβ5, αvβ6, or αvβ8. Fusion with a B cell requires gHgL, gp42, and gB and is triggered by an interaction between gp42 and human leukocyte antigen class II. We report here that, like alpha- and betaherpesviruses, EBV, a gammaherpesvirus, can mediate cell fusion if gB and gHgL are expressed in trans. Entry of a gH-null virus into an epithelial cell is possible if the epithelial cell expresses gHgL, and entry of the same virus, which phenotypically lacks gHgL and gp42, into a B cell expressing gHgL is possible in the presence of a soluble integrin. Heat is capable of inducing the fusion of cells expressing only gB, and the proteolytic digestion pattern of gB in virions changes in the same way following the exposure of virus to heat or to soluble integrins. It is suggested that the Gibbs free energy released as a result of the high-affinity interaction of gHgL with an integrin contributes to the activation energy required to cause the refolding of gB from a prefusion to a postfusion conformation. IMPORTANCE The core fusion machinery of herpesviruses consists of glycoproteins gB and gHgL. We demonstrate that as in alpha- and betaherpesvirus, gB and gHgL of the gammaherpesvirus EBV can mediate fusion and entry when expressed in trans in opposing membranes, implicating interactions between the ectodomains of the proteins in the activation of fusion. We further show that heat and exposure to a soluble integrin, both of which activate fusion, result in the same changes in the proteolytic digestion pattern of gB, possibly representing the refolding of gB from its prefusion to its postfusion conformation. PMID:25142593

  5. Molecular structures of citrus flavonoids determine their effects on lipid metabolism in HepG2 cells by primarily suppressing apoB secretion.

    PubMed

    Lin, Yuguang; Vermeer, Mario A; Bos, Wil; van Buren, Leo; Schuurbiers, Eric; Miret-Catalan, Silvia; Trautwein, Elke A

    2011-05-11

    This study investigated the underlying mechanisms of action for blood lipid lowering effects of citrus flavonoids and their methoxylated analogues (n = 19; dose range: 0-100 μM) in HepG2 cells. Cholesterol (CH) and triglyceride (TG) syntheses were assessed by measuring the incorporation of (14)C-acetate and (14)C-glycerol, respectively, whereas apoB secretion was determined by ELISA. Results show that two polymethoxylated citrus flavonoids (PMFs), tangeretin and nobiletin, potently inhibited apoB secretion (IC(50) = 13 and 29 μM, respectively) and modestly inhibited CH synthesis (IC(50) = 49 and 68 μM) and TG synthesis (IC(50) = 14 and 73 μM), without effecting LDL-receptor activity. Other PMFs (e.g., sinensetin) and non-PMFs (e.g., hesperetin and naringenin) had only weak effects on CH and TG syntheses and apoB secretion (IC(50) > 100 μM). The structure-activity analysis indicated that a fully methoxylated A-ring of the flavonoid structure was associated with a potent inhibitory activity on hepatic apoB secretion. In conclusion, this study using HepG2 cells indicates that citrus flavonoids with a fully methoxylated A-ring may lower blood CH and TG concentrations primarily by suppressing hepatic apoB secretion as a main underlying mode of action.

  6. Penicillin-binding protein 1A, 2B, and 2X alterations in Canadian isolates of penicillin-resistant Streptococcus pneumoniae.

    PubMed

    Nichol, Kimberly A; Zhanel, George G; Hoban, Daryl J

    2002-10-01

    Alterations within the penicillin-binding domain of penicillin-binding protein (PBP) genes pbp1a, pbp2b, and pbp2x were determined for 15 Canadian isolates of Streptococcus pneumoniae. All penicillin-nonsusceptible S. pneumoniae isolates showed a variety of PBP 2X substitutions and contained a Thr445-Ala change after the PBP 2B SSN motif. Only isolates for which penicillin MICs were > or =0.5 micro g/ml had PBP 1A alterations near the STMK and SRN motifs. Sequence analysis revealed identical PBP 1A, PBP 2B, and PBP 2X substitution patterns among all isolates for which penicillin MICs were > or =1 micro g/ml.

  7. Penicillin-Binding Protein 1A, 2B, and 2X Alterations in Canadian Isolates of Penicillin-Resistant Streptococcus pneumoniae

    PubMed Central

    Nichol, Kimberly A.; Zhanel, George G.; Hoban, Daryl J.

    2002-01-01

    Alterations within the penicillin-binding domain of penicillin-binding protein (PBP) genes pbp1a, pbp2b, and pbp2x were determined for 15 Canadian isolates of Streptococcus pneumoniae. All penicillin-nonsusceptible S. pneumoniae isolates showed a variety of PBP 2X substitutions and contained a Thr445-Ala change after the PBP 2B SSN motif. Only isolates for which penicillin MICs were ≥0.5 μg/ml had PBP 1A alterations near the STMK and SRN motifs. Sequence analysis revealed identical PBP 1A, PBP 2B, and PBP 2X substitution patterns among all isolates for which penicillin MICs were ≥1 μg/ml. PMID:12234855

  8. G2-structures for N  =  1 supersymmetric AdS4 solutions of M-theory

    NASA Astrophysics Data System (ADS)

    Grigorian, Sergey

    2018-04-01

    We study the N  =  1 supersymmetric solutions of D  =  11 supergravity obtained as a warped product of four-dimensional anti-de Sitter space with a seven-dimensional Riemannian manifold M. Using the octonion bundle structure on M we reformulate the Killing spinor equations in terms of sections of the octonion bundle on M. The solutions then define a single complexified G 2-structure on M or equivalently two real G 2-structures. We then study the torsion of these G 2-structures and the relationships between them.

  9. Conditioned media from (pre)adipocytes stimulate fibrinogen and PAI-1 production by HepG2 hepatoma cells

    PubMed Central

    Faber, D R; Kalkhoven, E; Westerink, J; Bouwman, J J; Monajemi, H M; Visseren, F L J

    2012-01-01

    Background: Obesity is associated with a prothrombotic state, which may contribute to the increased risk of thrombotic events. Objective: To assess the effects of (pre)adipocyte-derived adipokines on fibrinogen, plasminogen activator inhibitor-1 (PAI-1) and tissue factor (TF) production by hepatocytes. Methods: HepG2 hepatocytes were incubated with conditioned media (CM) derived from preadipocytes and adipocytes, which had been untreated or prestimulated with tumor necrosis factor (TNF)-α, interleukin (IL)-1β or IL-6. After 24 h, supernatants and cell lysates were harvested for measurement of fibrinogen, PAI-1 and TF. Results: (Pre)adipocyte CM significantly enhanced the production of PAI-1 by HepG2 cells 2.5- to 4.4-fold. CM from cytokine-stimulated (pre)adipocytes significantly induced fibrinogen secretion 1.5- to 4.2-fold. TF production was not affected by the CM. After specific depletion of TNF-α, IL-1β or IL-6 from the CM, IL-6 was shown to be the most prominent stimulus of fibrinogen secretion and IL-1β of PAI-1 secretion. In addition, fibrinogen, PAI-1 and tissue factor production was evaluated by direct stimulation of HepG2 cells with TNF-α, IL-1β or IL-6. IL-6 enhanced fibrinogen synthesis 4.3-fold (P<0.01), whereas IL-1β induced PAI-1 production 5.0-fold (P<0.01). Gene expression analyses showed that TNF-α and IL-1β stimulate the adipocyte expression of TNF-α, IL-1β and IL-6. Cytokine stimulation of adipocytes may thus have induced an inflammatory response, which may have stimulated fibrinogen and PAI-1 production by HepG2 cells more potently. Conclusions: SGBS (pre)adipocytes release cytokines that increase the production of fibrinogen and PAI-1 by HepG2 cells. IL-6 and IL-1β produced by (pre)adipocytes were the strongest inducers of fibrinogen and PAI-1 secretion, respectively. PMID:23208413

  10. Enantioselective light switch effect of Δ- and Λ-[Ru(phenanthroline)2 dipyrido[3,2-a:2', 3'-c]phenazine]2+ bound to G-quadruplex DNA.

    PubMed

    Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae

    2018-06-01

    The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.

  11. Negative regulation of G2-M by ATR (mei-41)/Chk1(Grapes) facilitates tracheoblast growth and tracheal hypertrophy in Drosophila.

    PubMed

    Kizhedathu, Amrutha; Bagul, Archit V; Guha, Arjun

    2018-04-16

    Imaginal progenitors in Drosophila are known to arrest in G2 during larval stages and proliferate thereafter. Here we investigate the mechanism and implications of G2 arrest in progenitors of the adult thoracic tracheal epithelium (tracheoblasts). We report that tracheoblasts pause in G2 for ~48-56 h and grow in size over this period. Surprisingly, tracheoblasts arrested in G2 express drivers of G2-M like Cdc25/String (Stg). We find that mechanisms that prevent G2-M are also in place in this interval. Tracheoblasts activate Checkpoint Kinase 1/Grapes (Chk1/Grp) in an ATR/mei-41-dependent manner. Loss of ATR/Chk1 led to precocious mitotic entry ~24-32 h earlier. These divisions were apparently normal as there was no evidence of increased DNA damage or cell death. However, induction of precocious mitoses impaired growth of tracheoblasts and the tracheae they comprise. We propose that ATR/Chk1 negatively regulate G2-M in developing tracheoblasts and that G2 arrest facilitates cellular and hypertrophic organ growth. © 2018, Kizhedathu et al.

  12. PPAR{gamma} activates ABCA1 gene transcription but reduces the level of ABCA1 protein in HepG2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mogilenko, Denis A., E-mail: denis@iem.sp.ru; Department of Embryology, St. Petersburg State University, 199034 St. Petersburg; Shavva, Vladimir S.

    Research highlights: {yields} PPAR{gamma} activates ABCA1 gene expression but decreases ABCA1 protein content in human hepatoma cell line HepG2. {yields} Treatment of HepG2 cells with PPAR{gamma} agonist GW1929 leads to dissociation of LXR{beta} from ABCA1-LXR{beta} complex. {yields} Inhibition of protein kinases MEK1/2 abolishes PPAR{gamma}-mediated dissociation of LXR{beta} from ABCA1/LXR{beta} complex. {yields} Activation of PPAR{gamma} leads to increasing of the level of LXR{beta} associated with LXRE within ABCA1 gene promoter. -- Abstract: Synthesis of ABCA1 protein in liver is necessary for high-density lipoproteins (HDL) formation in mammals. Nuclear receptor PPAR{gamma} is known as activator of ABCA1 expression, but details of PPAR{gamma}-mediatedmore » regulation of ABCA1 at both transcriptional and post-transcriptional levels in hepatocytes have not still been well elucidated. In this study we have shown, that PPAR{gamma} activates ABCA1 gene transcription in human hepatoma cells HepG2 through increasing of LXR{beta} binding with promoter region of ABCA1 gene. Treatment of HepG2 cells with PPAR{gamma} agonist GW1929 leads to dissociation of LXR{beta} from ABCA1/LXR{beta} complex and to nuclear translocation of this nuclear receptor resulting in reduction of ABCA1 protein level 24 h after treatment. Inhibition of protein kinases MEK1/2 abolishes PPAR{gamma}-mediated dissociation of LXR{beta} from ABCA1/LXR{beta} complex, but does not block PPAR{gamma}-dependent down-regulation of ABCA1 protein in HepG2 cells. These data suggest that PPAR{gamma} may be important for regulation of the level of hepatic ABCA1 protein and indicate the new interplays between PPAR{gamma}, LXR{beta} and MEK1/2 in regulation of ABCA1 mRNA and protein expression.« less

  13. β2-Adrenergic receptors and G-protein-coupled receptor kinase 2 in rabbit pleural mesothelium.

    PubMed

    Sironi, Chiara; Bodega, Francesca; Armilli, Marta; Porta, Cristina; Zocchi, Luciano; Agostoni, Emilio

    2010-09-30

    Former studies on net rate of liquid absorption from small Ringer or 1% albumin-Ringer hydrothoraces in rabbits indicated that Na+ transport and solute-coupled liquid absorption by mesothelium is increased by pleural liquid dilution, and stimulation of β2-adrenoreceptors (β2AR). In this research we tried to provide molecular evidence for β2AR in visceral and parietal mesothelium of rabbit pleura. Moreover, because prolonged stimulation of β2AR may lead to desensitization mediated by G-protein-coupled receptor kinase 2 (GRK2), we also checked whether GRK2 is expressed in pleural mesothelium. To this end we performed immunoblot assays on total protein extracts from scraped visceral and parietal mesothelium, and from cultured pleural mesothelial cells of rabbits. All three samples showed β2AR and GRK2 specific bands. Copyright 2010 Elsevier B.V. All rights reserved.

  14. Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population.

    PubMed

    Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

    2016-01-01

    Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application "Lekgen" that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy.

  15. Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population

    PubMed Central

    Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

    2016-01-01

    Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application “Lekgen” that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy. PMID:27499796

  16. Poly (N-isopropylacrylamide)-functionalized dendrimer as a thermosensitive nanoplatform for delivering malloapelta B against HepG2 cancer cell proliferation

    NASA Astrophysics Data System (ADS)

    Ngan Le, Phung; Chuong Pham, Dinh; Hai Nguyen, Dai; Quyen Tran, Ngoc; Dimitrov, Vladimir; Ivanov, Petko; Nguyen Xuan, Cuong; Nguyen, Hoai Nam; Khoa Nguyen, Cuu

    2017-06-01

    In recent years, nanocarriers have emerged as effective platforms for delivering several kinds of herbal medicine and naturally bioactive compounds. In this study we developed an outstanding thermosensitive dendritic nanocarrier to efficiently deliver malloapelta B (Mall B), which is a water insoluble bioactive compound isolated from leaves of Mallotus apelta—Vietnamese medicinal plant. The thermosensitive poly(N-isopropylacrylamide) (PNIPAM) polymer-conjugated polyamidoamine (PAMAM) dendrimer copolymer was prepared via Michael reaction. The copolymer structures were confirmed by proton nuclear magnectic resonance (1H NMR). Morphology of the nanocarrier was observered around 70-120 nm by transmission electron microscopy (TEM). Size distributions were measured by dynamic light scattering (DLS) of the nanocarrier and its Mall B-loaded performed at 146.8 nm and 194.5 nm, respectively. The PNIPAM-g-PAMAM-based nanocarrier exhibited higher Mall B loading efficiency (DL  =  59.93  ±  0.19%) and entrapment efficiency (EE  =  89.98  ±  2.06%) as compared to PNIPAM (DL  =  52.54  ±  0.45% and EE  =  66.45  ±  2.78%). In vitro release indicated that approximately 30% amount of the loaded Mall B released at pH 5.5 after 54 h tracking. At the same time, 12.5% amount of the molecules released at pH 7.4.Cytotoxicity assay results showed that the Mall B-loaded nanocarrier significantly inhibited HepG2 cancer cell proliferation. These obtained results indicated that the nanocarrier could solve hydrophobic property of Mall B for further medicine applications.

  17. G protein-coupled estrogen receptor 1 (GPER1)/GPR30 increases ERK1/2 activity through PDZ motif-dependent and -independent mechanisms.

    PubMed

    Gonzalez de Valdivia, Ernesto; Broselid, Stefan; Kahn, Robin; Olde, Björn; Leeb-Lundberg, L M Fredrik

    2017-06-16

    G protein-coupled receptor 30 (GPR30), also called G protein-coupled estrogen receptor 1 (GPER1), is thought to play important roles in breast cancer and cardiometabolic regulation, but many questions remain about ligand activation, effector coupling, and subcellular localization. We showed recently that GPR30 interacts through the C-terminal type I PDZ motif with SAP97 and protein kinase A (PKA)-anchoring protein (AKAP) 5, which anchor the receptor in the plasma membrane and mediate an apparently constitutive decrease in cAMP production independently of G i/o Here, we show that GPR30 also constitutively increases ERK1/2 activity. Removing the receptor PDZ motif or knocking down specifically AKAP5 inhibited the increase, showing that this increase also requires the PDZ interaction. However, the increase was inhibited by pertussis toxin as well as by wortmannin but not by AG1478, indicating that G i/o and phosphoinositide 3-kinase (PI3K) mediate the increase independently of epidermal growth factor receptor transactivation. FK506 and okadaic acid also inhibited the increase, implying that a protein phosphatase is involved. The proposed GPR30 agonist G-1 also increased ERK1/2 activity, but this increase was only observed at a level of receptor expression below that required for the constitutive increase. Furthermore, deleting the PDZ motif did not inhibit the G-1-stimulated increase. Based on these results, we propose that GPR30 increases ERK1/2 activity via two G i/o -mediated mechanisms, a PDZ-dependent, apparently constitutive mechanism and a PDZ-independent G-1-stimulated mechanism. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. SALL2 represses cyclins D1 and E1 expression and restrains G1/S cell cycle transition and cancer-related phenotypes.

    PubMed

    E Hermosilla, Viviana; Salgado, Ginessa; Riffo, Elizabeth; Escobar, David; Hepp, Matías I; Farkas, Carlos; Galindo, Mario; Morín, Violeta; García-Robles, María A; Castro, Ariel F; Pincheira, Roxana

    2018-04-24

    SALL2 is a poorly characterized transcription factor that belongs to the Spalt-like family involved in development. Mutations on SALL2 have been associated with ocular coloboma and cancer. In cancers, SALL2 is deregulated and is proposed as a tumor suppressor in ovarian cancer. SALL2 has been implicated in stemness, cell death, proliferation, and quiescence. However, mechanisms underlying roles of SALL2 related to cancer remain largely unknown. Here, we investigated the role of SALL2 in cell proliferation using mouse embryo fibroblasts (MEFs) derived from Sall2 -/- mice. Compared to Sall2 +/+ MEFs, Sall2 -/- MEFs exhibit enhanced cell proliferation and faster postmitotic progression through G1 and S phases. Accordingly, Sall2 -/- MEFs exhibit higher mRNA and protein levels of cyclins D1 and E1. Chromatin immunoprecipitation and promoter reporter assays showed that SALL2 binds and represses CCND1 and CCNE1 promoters, identifying a novel mechanism by which SALL2 may control cell cycle. In addition, the analysis of tissues from Sall2 +/+ and Sall2 -/- mice confirmed the inverse correlation between expression of SALL2 and G1-S cyclins. Consistent with an antiproliferative function of SALL2, immortalized Sall2 -/- MEFs showed enhanced growth rate, foci formation, and anchorage-independent growth, confirming tumor suppressor properties for SALL2. Finally, cancer data analyses show negative correlations between SALL2 and G1-S cyclins' mRNA levels in several cancers. Altogether, our results demonstrated that SALL2 is a negative regulator of cell proliferation, an effect mediated in part by repression of G1-S cyclins' expression. Our results have implications for the understanding and significance of SALL2 role under physiological and pathological conditions. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

  19. Word Frequency Analysis. MOS: 95B. Skill Levels 1 & 2.

    DTIC Science & Technology

    1981-05-01

    uU N D 1 A C P A C K1 ? G .I A 2 1 A’J Kt I S , 1 K L S 1 BaRp IF S I ~t2iIAED 5. 1.T’ 6 BATTERY 9!j 2 BECAUSE 17 67EI 2 BEHIND 13 IL 2 RE l1󈧱 3 b1...T S :t cTt lIION 5 U It :,4t 5 F L 1%T5 &:, JC.L ME NT 5 ESTIMS4EO 5 F -4 U0 . F- "CL5 UJ 7 "S 5 F-.[377 7i (, ID󈧏CAlN5.C1DEINTS 5 I’%SER71NkG .0

  20. 77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-21

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

  1. Epstein-Barr virus glycoprotein gB and gHgL can mediate fusion and entry in trans, and heat can act as a partial surrogate for gHgL and trigger a conformational change in gB.

    PubMed

    Chesnokova, Liudmila S; Ahuja, Munish K; Hutt-Fletcher, Lindsey M

    2014-11-01

    Epstein-Barr virus (EBV) fusion with an epithelial cell requires virus glycoproteins gHgL and gB and is triggered by an interaction between gHgL and integrin αvβ5, αvβ6, or αvβ8. Fusion with a B cell requires gHgL, gp42, and gB and is triggered by an interaction between gp42 and human leukocyte antigen class II. We report here that, like alpha- and betaherpesviruses, EBV, a gammaherpesvirus, can mediate cell fusion if gB and gHgL are expressed in trans. Entry of a gH-null virus into an epithelial cell is possible if the epithelial cell expresses gHgL, and entry of the same virus, which phenotypically lacks gHgL and gp42, into a B cell expressing gHgL is possible in the presence of a soluble integrin. Heat is capable of inducing the fusion of cells expressing only gB, and the proteolytic digestion pattern of gB in virions changes in the same way following the exposure of virus to heat or to soluble integrins. It is suggested that the Gibbs free energy released as a result of the high-affinity interaction of gHgL with an integrin contributes to the activation energy required to cause the refolding of gB from a prefusion to a postfusion conformation. The core fusion machinery of herpesviruses consists of glycoproteins gB and gHgL. We demonstrate that as in alpha- and betaherpesvirus, gB and gHgL of the gammaherpesvirus EBV can mediate fusion and entry when expressed in trans in opposing membranes, implicating interactions between the ectodomains of the proteins in the activation of fusion. We further show that heat and exposure to a soluble integrin, both of which activate fusion, result in the same changes in the proteolytic digestion pattern of gB, possibly representing the refolding of gB from its prefusion to its postfusion conformation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  2. The fusion loops and membrane proximal region of Epstein-Barr virus glycoprotein B (gB) can function in the context of herpes simplex virus 1 gB when substituted individually but not in combination.

    PubMed

    Zago, Anna; Connolly, Sarah A; Spear, Patricia G; Longnecker, Richard

    2013-01-01

    Among the herpesvirus glycoprotein B (gB) fusion proteins, the hydrophobic content of fusion loops and membrane proximal regions (MPRs) are inversely correlated with each other. We examined the functional importance of the hydrophobicity of these regions by replacing them in herpes simplex virus type 1 gB with corresponding regions from Epstein-Barr virus gB. We show that fusion activity is dependent on the structural context in which the specific loops and MPR sequences exist, rather than a simple hydrophobic relationship. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Polycomb-like proteins link the PRC2 complex to CpG islands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haojie; Liefke, Robert; Jiang, Junyi

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

  4. FOXC2 regulates the G2/M transition of stem cell-rich breast cancer cells and sensitizes them to PLK1 inhibition

    PubMed Central

    Pietilä, Mika; Vijay, Geraldine V.; Soundararajan, Rama; Yu, Xian; Symmans, William F.; Sphyris, Nathalie; Mani, Sendurai A.

    2016-01-01

    Cancer cells with stem cell properties (CSCs) underpin the chemotherapy resistance and high therapeutic failure of triple-negative breast cancers (TNBCs). Even though CSCs are known to proliferate more slowly, they are sensitive to inhibitors of G2/M kinases such as polo-like kinase 1 (PLK1). Understanding the cell cycle regulatory mechanisms of CSCs will help target these cells more efficiently. Herein, we identify a novel role for the transcription factor FOXC2, which is mostly expressed in CSCs, in the regulation of cell cycle of CSC-enriched breast cancer cells. We demonstrate that FOXC2 expression is regulated in a cell cycle-dependent manner, with FOXC2 protein levels accumulating in G2, and rapidly decreasing during mitosis. Knockdown of FOXC2 in CSC-enriched TNBC cells delays mitotic entry without significantly affecting the overall proliferation rate of these cells. Moreover, PLK1 activity is important for FOXC2 protein stability, since PLK1 inhibition reduces FOXC2 protein levels. Indeed, FOXC2 expressing CSC-enriched TNBC cells are sensitive to PLK1 inhibition. Collectively, our findings demonstrate a novel role for FOXC2 as a regulator of the G2/M transition and elucidate the reason for the observed sensitivity of CSC-enriched breast cancer cells to PLK1 inhibitor. PMID:27064522

  5. Downregulation of kinin B1 receptor function by B2 receptor heterodimerization and signaling.

    PubMed

    Zhang, Xianming; Brovkovych, Viktor; Zhang, Yongkang; Tan, Fulong; Skidgel, Randal A

    2015-01-01

    Signaling through the G protein-coupled kinin receptors B1 (kB1R) and B2 (kB2R) plays a critical role in inflammatory responses mediated by activation of the kallikrein-kinin system. The kB2R is constitutively expressed and rapidly desensitized in response to agonist whereas kB1R expression is upregulated by inflammatory stimuli and it is resistant to internalization and desensitization. Here we show that the kB1R heterodimerizes with kB2Rs in co-transfected HEK293 cells and natively expressing endothelial cells, resulting in significant internalization and desensitization of the kB1R response in cells pre-treated with kB2R agonist. However, pre-treatment of cells with kB1R agonist did not affect subsequent kB2R responses. Agonists of other G protein-coupled receptors (thrombin, lysophosphatidic acid) had no effect on a subsequent kB1R response. The loss of kB1R response after pretreatment with kB2R agonist was partially reversed with kB2R mutant Y129S, which blocks kB2R signaling without affecting endocytosis, or T342A, which signals like wild type but is not endocytosed. Co-endocytosis of the kB1R with kB2R was dependent on β-arrestin and clathrin-coated pits but not caveolae. The sorting pathway of kB1R and kB2R after endocytosis differed as recycling of kB1R to the cell surface was much slower than that of kB2R. In cytokine-treated human lung microvascular endothelial cells, pre-treatment with kB2R agonist inhibited kB1R-mediated increase in transendothelial electrical resistance (TER) caused by kB1R stimulation (to generate nitric oxide) and blocked the profound drop in TER caused by kB1R activation in the presence of pyrogallol (a superoxide generator). Thus, kB1R function can be downregulated by kB2R co-endocytosis and signaling, suggesting new approaches to control kB1R signaling in pathological conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Downregulation of kinin B1 receptor function by B2 receptor heterodimerization and signaling

    PubMed Central

    Zhang, Xianming; Brovkovych, Viktor; Zhang, Yongkang; Tan, Fulong; Skidgel, Randal A.

    2014-01-01

    Signaling through the G protein-coupled kinin receptors B1 (kB1R) and B2 (kB2R) plays a critical role in inflammatory responses mediated by activation of the kallikrein-kinin system. The kB2R is constitutively expressed and rapidly desensitized in response to agonist whereas kB1R expression is upregulated by inflammatory stimuli and it is resistant to internalization and desensitization. Here we show that the kB1R heterodimerizes with kB2Rs in co-transfected HEK293 cells and natively expressing endothelial cells, resulting in significant internalization and desensitization of the kB1R response in cells pre-treated with kB2R agonist. However, pre-treatment of cells with kB1R agonist did not affect subsequent kB2R responses. Agonists of other G protein-coupled receptors (thrombin, lysophosphatidic acid) had no effect on a subsequent kB1R response. The loss of kB1R response after pretreatment with kB2R agonist was partially reversed with kB2R mutant Y129S, which blocks kB2R signaling without affecting endocytosis, or T342A, which signals like wild type but is not endocytosed. Co-endocytosis of the kB1R with kB2R was dependent on β-arrestin and clathrin-coated pits but not caveolae. The sorting pathway of kB1R and kB2R after endocytosis differed as recycling of kB1R to the cell surface was much slower than that of kB2R. In cytokine-treated human lung microvascular endothelial cells, pre-treatment with kB2R agonist inhibited kB1R-mediated increase in transendothelial electrical resistance (TER) caused by kB1R stimulation (to generate nitric oxide) and blocked the profound drop in TER caused by kB1R activation in the presence of pyrogallol (a superoxide generator). Thus, kB1R function can be downregulated by kB2R co-endocytosis and signaling, suggesting new approaches to control kB1R signaling in pathological conditions. PMID:25289859

  7. Enhanced visible light photocatalytic H2-production of g-C3N4/WS2 composite heterostructures

    NASA Astrophysics Data System (ADS)

    Akple, Maxwell Selase; Low, Jingxiang; Wageh, S.; Al-Ghamdi, Ahmed. A.; Yu, Jiaguo; Zhang, Jun

    2015-12-01

    As a clean and renewable solar H2-production system to address the increasing global environmental crisis and energy demand, photocatalytic hydrogen production from water splitting using earth abundant materials has received a lot of attention. In this study, WS2-graphitic carbon nitride (g-C3N4) composites were prepared using WO3 and thiourea as precursors through a gas-solid reaction. Different amount of WS2 were loaded on g-C3N4 to form the heterostructures and the composite samples exhibited enhanced photocatalytic activity for H2 production under visible light. The composite sample with 0.01 wt% WS2 exhibited the highest H2-production rate of 101 μmol g-1 h-1, which was even better than that of the Pt-C3N4 sample with the same loading content. The high photocatalytic activity was attributed to the formation of heterojunction between g-C3N4 and WS2 cocatalyst which allowed for effective separation of photogenerated charge carriers. This work showed the possibility for the utilization of low cost WS2 as an efficient cocatalyst to promote the photocatalytic H2 production of g-C3N4.

  8. The 20-hydroxyecdysone-induced signalling pathway in G2/M arrest of Plodia interpunctella imaginal wing cells.

    PubMed

    Siaussat, David; Bozzolan, Françoise; Porcheron, Patrick; Debernard, Stéphane

    2008-05-01

    The mechanisms involved in the control of cellular proliferation by the steroid hormone 20-hydroxyecdysone (20E) in insects are not known. We dissected the 20E signalling pathway responsible for G2/M arrest of imaginal cells from the IAL-PID2 cells of the Indian meal moth Plodia interpunctella. We first used a 5'-3' RACE-based strategy to clone a 4479bp cDNA encoding a putative P. interpunctella HR3 transcription factor named PiHR3. The deduced amino acid sequence of PiHR3 was highly similar to those of HR3 proteins from other lepidopterans, e.g. Manduca sexta and Bombyx mori. Using double-stranded RNA-mediated interference (dsRNAi), we then succeeded in blocking the ability of 20E to induce the expression of PiEcR-B1, PiUSP-2 and PiHR3 genes that encode the P. interpunctella ecdysone receptor B1-isoform, Ultraspiracle-2 isoform, the insect homologue of the vertebrate retinoid X receptor, and the HR3 transcription factor. We showed that inhibiting the 20E induction of PiEcR-B1, PiUSP-2 and PiHR3 mRNAs prevented the decreased expression of B cyclin and consequently the G2/M arrest of IAL-PID2 cells. Using this functional approach, we revealed the participation of EcR, USP and HR3 in a 20E signalling pathway that controls the proliferation of imaginal cells by regulating the expression of B cyclin.

  9. Impacts, Effectiveness and Regional Inequalities of the GeoMIP G1 to G4 Solar Radiation Management Scenarios

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Xiaoyong; Moore, John; Cui, Xuefeng

    We evaluate the regional effectiveness of solar radiation management (SRM) to compensate for simultaneous changes in temperature and precipitation induced by increased greenhouse gas concentrations. We analyze results from multiple earth system models under four Geoengineering Model Intercomparison Project(GeoMIP) experiments with a modified form of the Residual Climate Response approach. Under the solar dimming geoengineering experiments G1(4xCO2) and G2(increasing CO2 by 1% per year), global average temperature is successfully restored to pre-industrial level over 50 years simulations. However, these two SRM experiments also produce a robust global precipitation decrease. The stratospheric aerosol GeoMIP geoengineering experiment, G4 has significantly greater regionalmore » inequality and lower effectiveness for compensating temperature change than G1 and G2. G4 also has significantly larger regional inequality for compensating precipitation change than G1and G2. However, there is no significant difference between precipitation change compensation effectiveness of G4 and G2, though there is much larger across model variability in G4 results. G3 has significant greater regional inequality for compensating temperature change than G1 and G2, and has significant lower effectiveness than G1. The effectiveness of four SRMs to compensate for temperature change is much higher than for precipitation. The large cross-model variation in adjustment percentage of compensated SAT and precipitation change by SRM to achieve optimal compensation effectiveness shed a light on the uncertainty accumulation effect in optimizing compensation effectiveness of SRM.« less

  10. Phaleria macrocarpa (Boerl.) fruit induce G0/G1 and G2/M cell cycle arrest and apoptosis through mitochondria-mediated pathway in MDA-MB-231 human breast cancer cell.

    PubMed

    Kavitha, Nowroji; Ein Oon, Chern; Chen, Yeng; Kanwar, Jagat R; Sasidharan, Sreenivasan

    2017-04-06

    Phaleria macrocarpa (Scheff) Boerl, is a well-known folk medicinal plant in Indonesia. Traditionally, P. macrocarpa has been used to control cancer, impotency, hemorrhoids, diabetes mellitus, allergies, liver and hearth disease, kidney disorders, blood diseases, acne, stroke, migraine, and various skin diseases. The purpose of this study was to determine the in situ cytotoxicity effect P. macrocarpa fruit ethyl acetate fraction (PMEAF) and the underlying molecular mechanism of cell death. MDA-MB-231 cells were incubated with PMEAF for 24h. Cell cycle and viability were examined using flow cytometry analysis. Apoptosis was determined using the Annexin V assay and also by fluorescence microscopy. Apoptosis protein profiling was detected by RayBio® Human Apoptosis Array. The AO/PI staining and flow cytometric analysis of MDA-MB-231 cells treated with PMEAF were showed apoptotic cell death. The cell cycle analysis by flow cytometry analysis revealed that the accumulation of PMEAF treated MDA-MB-231 cells in G 0 /G 1 and G 2 /M-phase of the cell cycle. Moreover, the PMEAF exert cytotoxicity by increased the ROS production in MDA-MB-231 cells consistently stimulated the loss of mitochondrial membrane potential (∆ Ψm ) and induced apoptosis cell death by activation of numerous signalling proteins. The results from apoptosis protein profiling array evidenced that PMEAF stimulated the expression of 9 pro-apoptotic proteins (Bax, Bid, caspase 3, caspase 8, cytochrome c, p21, p27, p53 and SMAC) and suppressed the 4 anti-apoptotic proteins (Bcl-2, Bcl-w, XIAP and survivin) in MDA-MB-231 cells. The results indicated that PMEAF treatment induced apoptosis in MDA-MB-231 cells through intrinsic mitochondrial related pathway with the participation of pro and anti-apoptotic proteins, caspases, G 0 /G 1 and G 2 /M-phases cell cycle arrest by p53-mediated mechanism. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  11. Rate constants for the quenching of metastable O2 (1Sigma g +) molecules

    NASA Technical Reports Server (NTRS)

    Kwang, Y. C.; Leu, M.-T.

    1985-01-01

    The O2 (1Sigma g +) rates for CO2, H2, N2, Cl2, CO, O3, and 2,3 DMB-2 are determined by monitoring the 762-nm emission in a fast-flow-discharge chemiluminescence detection system (Leu, 1984; Leu and Smith, 1981). The results are presented in tables and graphs and briefly characterized. The rate constants (in cu cm/s x 10 to the -16th) are 4600 + or - 500 for CO2, 7000 + or - 300 for H2, 17 + or - 1 for N2, 4.5 + or - 0.8 for Cl2, 45 + or - 5 for CO, 220,000 + or - 30,000 for O3, and 6000 + or - 100 for 2,3 DMB-2. The temperature dependence of the CO2 and O3 quenching reactions at 245-362 K is found to be negligible.

  12. Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes.

    PubMed

    Jarvi, S I; Goto, R M; Gee, G F; Briles, W E; Miller, M M

    1999-01-01

    We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbg1 and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of alpha-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

  13. Plasminogen activator inhibitor-1 5G/5G genotype is a protecting factor preventing posttransplant diabetes mellitus.

    PubMed

    Chang, Horng-Rong; Yang, Shun-Fa; Tsai, Jen-Pi; Hsieh, Ming-Chia; Wu, Sheng-Wen; Tsai, Hui-Ching; Hung, Tung-Wei; Huang, Jun-Huang; Lian, Jong-Da

    2011-01-30

    Plasminogen activator inhibitor 1 (PAI-1) is thought to play a role in the pathogenesis of obesity and insulin resistance. A connection between gestational diabetes mellitus and the functional -675 PAI-1 genotype has been reported. Therefore, we examined the role of the PAI-1 gene polymorphism in kidney transplant recipients. A total of 376 kidney transplant recipients were prospectively screened for posttransplant diabetes mellitus (PTDM). Eighty-one (21.5%) patients were diagnosed with PTDM and the other 295 patients were non-diabetic following kidney transplantation. DNA samples were isolated from the sera and analyzed for the functional -675 4G/5G promoter polymorphisms of the PAI-1 gene. Kidney transplant recipients with PTDM were significantly associated with tacrolimus use (p=0.03), older age (p=0.036), and higher body mass index (p=0.001). The genotype distribution was significantly different between the patients with PTDM (genotype 4G/4G:4G/5G:5G/5G=33.3%:60.5%:6.2%) and those without PTDM (genotype 4G/4G:4G/5G:5G/5G=36.9%:44.1%:19.0%) (p=0.018). Patients with homozygosity for 5G had a significantly lower rate of PTDM (aOR, 0.286, p=0.022) and higher cumulative event-free probability of time to PTDM (log rank test, p=0.0058). Homozygosity for the 5G allele of the PAI-1 gene constitutes a protecting factor for the development of PTDM. Our findings are similar to a previous study on gestational diabetes mellitus, and strongly support a possible genetic role of PAI-1 in the development of PTDM. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Luminescence of the (O{sub 2}(a{sup 1}Δ{sub g})){sub 2} collisional complex in the temperature range of 90-315 K: Experiment and theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zagidullin, M. V., E-mail: marsel@fian.smr.ru; Pershin, A. A., E-mail: anchizh93@gmail.com; Azyazov, V. N., E-mail: azyazov@ssau.ru

    Experimental and theoretical studies of collision induced emission of singlet oxygen molecules O{sub 2}(a{sup 1}Δ{sub g}) in the visible range have been performed. The rate constants, half-widths, and position of peaks for the emission bands of the (O{sub 2}(a{sup 1}Δ{sub g})){sub 2} collisional complex centered around 634 nm (2) and 703 nm (3) have been measured in the temperature range of 90–315 K using a flow-tube apparatus that utilized a gas-liquid chemical singlet oxygen generator. The absolute values of the spontaneous emission rate constants k{sub 2} and k{sub 3} are found to be similar, with the k{sub 3}/k{sub 2} ratiomore » monotonically decreasing from 1.1 at 300 K to 0.96 at 90 K. k{sub 2} slowly decreases with decreasing temperature but a sharp increase in its values is measured below 100 K. The experimental results were rationalized in terms of ab initio calculations of the ground and excited potential energy and transition dipole moment surfaces of singlet electronic states of the (O{sub 2}){sub 2} dimole, which were utilized to compute rate constants k{sub 2} and k{sub 3} within a statistical model. The best theoretical results reproduced experimental rate constants with the accuracy of under 40% and correctly described the observed temperature dependence. The main contribution to emission process (2), which does not involve vibrational excitation of O{sub 2} molecules at the ground electronic level, comes from the spin- and symmetry-allowed 1{sup 1}A{sub g}←{sup 1}B{sub 3u} transition in the rectangular H configuration of the dimole. Alternatively, emission process (3), in which one of the monomers becomes vibrationally excited in the ground electronic state, is found to be predominantly due to the vibronically allowed 1{sup 1}A{sub g}←2{sup 1}A{sub g} transition induced by the asymmetric O–O stretch vibration in the collisional complex. The strong vibronic coupling between nearly degenerate excited singlet states of the dimole makes

  15. EOS MLS Level 1B Data Processing, Version 2.2

    NASA Technical Reports Server (NTRS)

    Perun, Vincent; Jarnot, Robert; Pickett, Herbert; Cofield, Richard; Schwartz, Michael; Wagner, Paul

    2009-01-01

    A computer program performs level- 1B processing (the term 1B is explained below) of data from observations of the limb of the Earth by the Earth Observing System (EOS) Microwave Limb Sounder (MLS), which is an instrument aboard the Aura spacecraft. This software accepts, as input, the raw EOS MLS scientific and engineering data and the Aura spacecraft ephemeris and attitude data. Its output consists of calibrated instrument radiances and associated engineering and diagnostic data. [This software is one of several computer programs, denoted product generation executives (PGEs), for processing EOS MLS data. Starting from level 0 (representing the aforementioned raw data, the PGEs and their data products are denoted by alphanumeric labels (e.g., 1B and 2) that signify the successive stages of processing.] At the time of this reporting, this software is at version 2.2 and incorporates improvements over a prior version that make the code more robust, improve calibration, provide more diagnostic outputs, improve the interface with the Level 2 PGE, and effect a 15-percent reduction in file sizes by use of data compression.

  16. g8: Physics with Linearly-Polarized Photons in Hall B of JLab

    NASA Astrophysics Data System (ADS)

    Cole, Philip L.

    2001-11-01

    The set of experiments forming the g8 run in Hall B took place this past summer (6/4/01-8/13/01) in Hall B of Jefferson Lab. These experiments make use of a beam of linearly-polarized photons produced through coherent bremsstrahlung and represent the first time such a probe has been employed at Jefferson Lab. Several new and upgraded Hall-B beamline devices were commissioned prior to the production running of g8. The scientific purpose of g8 is to improve the understanding of the underlying symmetry of the quark degrees of freedom in the nucleon, the nature of the parity exchange between the incident photon and the target nucleon, and the mechanism of associated strangeness production in electromagnetic reactions. With the high-quality beam of the tagged and collimated linearly-polarized photons and the nearly complete angular coverage of the Hall-B spectrometer, we will extract the differential cross sections and polarization observables for the photoproduction of vector mesons and kaons at photon energies ranging between 1.9 and 2.1 GeV. We collected over 1.2 trillion triggers. After data cuts, we expect to have 500 times the world's data set on rhos and omegas produced via a beam of linearly-polarized photons. A report on the results of the commissioning of the beamline devices and the progress of the analysis of the g8 run will be presented.

  17. Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

    PubMed Central

    Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

    2010-01-01

    Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

  18. Precision spectroscopy of high rotational states in H2 investigated by Doppler-free two-photon laser spectroscopy in the EF 1Σg+-X 1Σg+ system

    NASA Astrophysics Data System (ADS)

    Dickenson, G. D.; Salumbides, E. J.; Niu, M.; Jungen, Ch.; Ross, S. C.; Ubachs, W.

    2012-09-01

    Recently a high precision spectroscopic investigation of the EF1Σg+-X1Σg+ system of molecular hydrogen was reported yielding information on QED and relativistic effects in a sequence of rotational quantum states in the X1Σg+ ground state of the H2 molecule [Salumbides , Phys. Rev. Lett.PRLTAO0031-900710.1103/PhysRevLett.107.043005 107, 043005 (2011)]. The present paper presents a more detailed description of the methods and results. Furthermore, the paper serves as a stepping stone towards a continuation of the previous study by extending the known level structure of the EF1Σg+ state to highly excited rovibrational levels through Doppler-free two-photon spectroscopy. Based on combination differences between vibrational levels in the ground state, and between three rotational branches (O, Q, and S branches) assignments of excited EF1Σg+ levels, involving high vibrational and rotational quantum numbers, can be unambiguously made. For the higher EF1Σg+ levels, where no combination differences are available, calculations were performed using the multichannel quantum defect method, for a broad class of vibrational and rotational levels up to J=19. These predictions were used for assigning high-J EF levels and are found to be accurate within 5 cm-1.

  19. Association between PAI-1 4G/5G polymorphism and diabetic nephropathy: a meta-analysis in the Chinese population.

    PubMed

    Gao, Wen-Feng; Guo, Ying-Bo; Bai, Yu; Ding, Xin-Yu; Yan, Yong-Ji; Wu, Zhen-Qi

    2016-09-01

    Although a number of studies have been conducted on the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and diabetic nephropathy (DN) in Chinese population, this association remains elusive and controversial. To further assess the effects of PAI-1 4G/5G polymorphism on the risk of DN, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure, and Chinese Biology Medicine through November, 2015. Pooled odds ratios (ORs) and 95 % confidence intervals (CIs) were used to assess the strength of the associations. This meta-analysis identified nine studies, including 777 DN cases, 413 healthy controls, and 523 DM controls. In the total analyses, a significantly elevated risk of DN was associated with variants of PAI-1 4G/5G when compared with the healthy group (4G vs. 5G, OR 2.46, 95 % CI 1.45-4.16; 4G/4G vs. 5G/5G, OR 4.32, 95 % CI 1.79-10.39; 4G/4G vs. 4G/5G +5G/5G, OR 2.96, 95 % CI 1.59-5.53; 4G/4G +4G/5G vs. 5G/5G, OR 2.78, 95 % CI 1.34-5.75) and DM group (4G vs. 5G, OR 1.93, 95 % CI 1.28-2.92; 4G/4G vs. 5G/5G, OR 2.99, 95 % CI 1.44-6.21; 4G/4G vs. 4G/5G +5G/5G, OR 2.84, 95 % CI 1.77-4.54). In the subgroup analyses stratified by ethnicity and geographic areas, it revealed the significant results in Chinese Han, in North and South China. This meta-analysis showed that the PAI-1 4G/4G variant, 4G allele might be risk alleles for DN susceptibility in the Chinese population, and further studies in other ethic groups are required for definite conclusions.

  20. Functional Fluorescent Protein Insertions in Herpes Simplex Virus gB Report on gB Conformation before and after Execution of Membrane Fusion

    PubMed Central

    Gallagher, John R.; Atanasiu, Doina; Saw, Wan Ting; Paradisgarten, Matthew J.; Whitbeck, J. Charles; Eisenberg, Roselyn J.; Cohen, Gary H.

    2014-01-01

    Entry of herpes simplex virus (HSV) into a target cell requires complex interactions and conformational changes by viral glycoproteins gD, gH/gL, and gB. During viral entry, gB transitions from a prefusion to a postfusion conformation, driving fusion of the viral envelope with the host cell membrane. While the structure of postfusion gB is known, the prefusion conformation of gB remains elusive. As the prefusion conformation of gB is a critical target for neutralizing antibodies, we set out to describe its structure by making genetic insertions of fluorescent proteins (FP) throughout the gB ectodomain. We created gB constructs with FP insertions in each of the three globular domains of gB. Among 21 FP insertion constructs, we found 8 that allowed gB to remain membrane fusion competent. Due to the size of an FP, regions in gB that tolerate FP insertion must be solvent exposed. Two FP insertion mutants were cell-surface expressed but non-functional, while FP insertions located in the crown were not surface expressed. This is the first report of placing a fluorescent protein insertion within a structural domain of a functional viral fusion protein, and our results are consistent with a model of prefusion HSV gB constructed from the prefusion VSV G crystal structure. Additionally, we found that functional FP insertions from two different structural domains could be combined to create a functional form of gB labeled with both CFP and YFP. FRET was measured with this construct, and we found that when co-expressed with gH/gL, the FRET signal from gB was significantly different from the construct containing CFP alone, as well as gB found in syncytia, indicating that this construct and others of similar design are likely to be powerful tools to monitor the conformation of gB in any model system accessible to light microscopy. PMID:25233449

  1. Distinct Immunoglobulin Class and Immunoglobulin G Subclass Patterns against Ganglioside GQ1b in Miller Fisher Syndrome following Different Types of Infection

    PubMed Central

    Schwerer, Beatrix; Neisser, Andrea; Bernheimer, Hanno

    1999-01-01

    We studied serum antibodies against gangliosides GQ1b and GM1 in 13 patients with Miller Fisher syndrome (MFS) and in 18 patients with Guillain-Barré syndrome (GBS) with cranial nerve involvement. Anti-GQ1b titers were elevated in all patients with MFS cases (immunoglobulin G [IgG] > IgA, IgM), and in 8 of the 18 with GBS. Lower frequencies of increased anti-GM1 titers were observed in MFS patients (3 of 13), as well as in GBS patients (5 of 18). During the course of MFS, anti-GQ1b titers of all Ig classes decreased within 3 weeks after onset. By contrast, anti-GM1 titers (mainly IgM) transiently increased during the course of MFS in five of six patients, suggesting a nonspecific secondary immune response. In patients with MFS following respiratory infections, IgG was the major anti-GQ1b Ig class (six of six patients) and IgG3 was the major subclass (five of six). In contrast, four of five patients with MFS following gastrointestinal infections showed predominance of anti-GQ1b IgA or IgM over IgG and predominance of the IgG2 subclass; anti-GQ1b IgG (IgG3) prevailed in one patient only. These distinct Ig patterns strongly suggest that different infections may trigger different mechanisms of anti-GQ1b production, such as via T-cell-dependent as opposed to T-cell-independent pathways. Thus, the origin of antibodies against GQ1b in MFS may be determined by the type of infectious agent that precipitates the disease. PMID:10225903

  2. G2 Autonomous Control for Cryogenic Delivery Systems

    NASA Technical Reports Server (NTRS)

    Dito, Scott J.

    2014-01-01

    The Independent System Health Management-Autonomous Control (ISHM-AC) application development for cryogenic delivery systems is intended to create an expert system that will require minimal operator involvement and ultimately allow for complete autonomy when fueling a space vehicle in the time prior to launch. The G2-Autonomous Control project is the development of a model, simulation, and ultimately a working application that will control and monitor the cryogenic fluid delivery to a rocket for testing purposes. To develop this application, the project is using the programming language/environment Gensym G2. The environment is an all-inclusive application that allows development, testing, modeling, and finally operation of the unique application through graphical and programmatic methods. We have learned G2 through training classes and subsequent application development, and are now in the process of building the application that will soon be used to test on cryogenic loading equipment here at the Kennedy Space Center Cryogenics Test Laboratory (CTL). The G2 ISHM-AC application will bring with it a safer and more efficient propellant loading system for the future launches at Kennedy Space Center and eventually mobile launches from all over the world.

  3. Restraint of the G2/M Transition by the SR/RRM Family mRNA Shuttling Binding Protein SNXAHRB1 in Aspergillus nidulans

    PubMed Central

    James, Steven W.; Banta, Travis; Barra, James; Ciraku, Lorela; Coile, Clifford; Cuda, Zach; Day, Ryan; Dixit, Cheshil; Eastlack, Steven; Giang, Anh; Goode, James; Guice, Alexis; Huff, Yulon; Humbert, Sara; Kelliher, Christina; Kobie, Julie; Kohlbrenner, Emily; Mwambutsa, Faustin; Orzechowski, Amanda; Shingler, Kristin; Spell, Casey; Anglin, Sarah Lea

    2014-01-01

    Control of the eukaryotic G2/M transition by CDC2/CYCLINB is tightly regulated by protein–protein interactions, protein phosphorylations, and nuclear localization of CDC2/CYCLINB. We previously reported a screen, in Aspergillus nidulans, for extragenic suppressors of nimX2cdc2 that resulted in the identification of the cold-sensitive snxA1 mutation. We demonstrate here that snxA1 suppresses defects in regulators of the CDK1 mitotic induction pathway, including nimX2cdc2, nimE6cyclinB, and nimT23cdc25, but does not suppress G2-arresting nimA1/nimA5 mutations, the S-arresting nimE10cyclinB mutation, or three other G1/S phase mutations. snxA encodes the A. nidulans homolog of Saccharomyces cerevisiae Hrb1/Gbp2; nonessential shuttling messenger RNA (mRNA)-binding proteins belonging to the serine-arginine-rich (SR) and RNA recognition motif (RRM) protein family; and human heterogeneous ribonucleoprotein-M, a spliceosomal component involved in pre-mRNA processing and alternative splicing. snxAHrb1 is nonessential, its deletion phenocopies the snxA1 mutation, and its overexpression rescues snxA1 and ΔsnxA mutant phenotypes. snxA1 and a second allele isolated in this study, snxA2, are hypomorphic mutations that result from decreased transcript and protein levels, suggesting that snxA acts normally to restrain cell cycle progression. SNXAHRB1 is predominantly nuclear, but is not retained in the nucleus during the partially closed mitosis of A. nidulans. We show that the snxA1 mutation does not suppress nimX2 by altering NIMX2CDC2/NIMECYCLINB kinase activity and that snxA1 or ΔsnxA alter localization patterns of NIMECYCLINB at the restrictive temperatures for snxA1 and nimX2. Together, these findings suggest a novel and previously unreported role of an SR/RRM family protein in cell cycle regulation, specifically in control of the CDK1 mitotic induction pathway. PMID:25104516

  4. Development of V2G and G2V Power Profiles and Their Implications on Grid Under Varying Equilibrium of Aggregated Electric Vehicles

    NASA Astrophysics Data System (ADS)

    Jain, Prateek; Jain, Trapti

    2016-04-01

    The objective of this paper is to examine the vehicle-to-grid (V2G) power capability of aggregated electric vehicles (EV) in the manner that they are being adopted by the consumers with their growing infiltration in the vehicles market. The proposed modeling of V2G and grid-to-vehicle (G2V) energy profiles blends the heterogeneous attributes namely, driven mileages, arrival and departure times, travel and parking durations, and speed dependent energy consumption of mobility trends. Three penetration percentages of 25 %, 50 % and 100 % resulting in varied compositions of battery electric vehicle (BEV) and plug-in hybrid electric vehicle (PHEV) in the system, as determined by the consumers' acceptance, have been considered to evaluate the grid capacity for V2G. Distinct charge-discharge powers have been selected as per charging standards to match contemporary vehicles and infrastructure requirements. Charging and discharging approaches have been devised to replicate non-linear characteristics of Li-ion battery. Effects of simultaneous conjunction of V2G and G2V power curves with daily conventional load profile are quantified drawn upon workplace-discharging home-charging scheme. Results demonstrated a marked drop in load and hence in market price during morning hours which is hurriedly overcompensated by the hike during evening hours with rising penetration level and charge-discharge power.

  5. 2G ethanol from the whole sugarcane lignocellulosic biomass.

    PubMed

    Pereira, Sandra Cerqueira; Maehara, Larissa; Machado, Cristina Maria Monteiro; Farinas, Cristiane Sanchez

    2015-01-01

    In the sugarcane industry, large amounts of lignocellulosic residues are generated, which includes bagasse, straw, and tops. The use of the whole sugarcane lignocellulosic biomass for the production of second-generation (2G) ethanol can be a potential alternative to contribute to the economic viability of this process. Here, we conducted a systematic comparative study of the use of the lignocellulosic residues from the whole sugarcane lignocellulosic biomass (bagasse, straw, and tops) from commercial sugarcane varieties for the production of 2G ethanol. In addition, the feasibility of using a mixture of these residues from a selected variety was also investigated. The materials were pretreated with dilute acid and hydrolyzed with a commercial enzymatic preparation, after which the hydrolysates were fermented using an industrial strain of Saccharomyces cerevisiae. The susceptibility to enzymatic saccharification was higher for the tops, followed by straw and bagasse. Interestingly, the fermentability of the hydrolysates showed a different profile, with straw achieving the highest ethanol yields, followed by tops and bagasse. Using a mixture of the different sugarcane parts (bagasse-straw-tops, 1:1:1, in a dry-weight basis), it was possible to achieve a 55% higher enzymatic conversion and a 25% higher ethanol yield, compared to use of the bagasse alone. For the four commercial sugarcane varieties evaluated using the same experimental set of conditions, it was found that the variety of sugarcane was not a significant factor in the 2G ethanol production process. Assessment of use of the whole lignocellulosic sugarcane biomass clearly showed that 2G ethanol production could be significantly improved by the combined use of bagasse, straw, and tops, when compared to the use of bagasse alone. The lower susceptibility to saccharification of sugarcane bagasse, as well as the lower fermentability of its hydrolysates, can be compensated by using it in combination with straw

  6. Curcumin-enhanced chemosensitivity of FDA-approved platinum (II)-based anti-cancer drugs involves downregulation of nuclear endonuclease G and NF-κB as well as induction of apoptosis and G2/M arrest.

    PubMed

    Wang, Ying-Ti; Liu, Hsiao-Sheng; Su, Chun-Li

    2014-05-01

    Curcumin, an active natural compound in turmeric and curry, has been reported to exhibit anti-cancer effect. Cisplatin, carboplatin and oxaliplatin are used to treat various types of cancers. However, acquired resistance and toxicities are observed. Here, the addition of curcumin significantly increased cytotoxicity of the anti-cancer drugs on human colorectal cancer HT-29 cells, producing synergistic (cisplatin and carboplatin) and additivity (oxaliplatin) effects. Treatments in combination with curcumin resulted in a significantly increased induction of apoptosis and occurrence of G2/M arrest. Nuclear apoptosis-inducing factor (AIF), EndoG and NF-κB were elevated by anti-cancer drugs, suggesting the involvement of AIF and EndoG. The addition of curcumin suppressed nuclear AIF and EndoG and reversed anti-cancer drugs-induced NF-κB expression, suggesting the association of EndoG and NF-κB in curcumin-enhanced chemosensitivity. Therefore, the intake of foods rich in curcumin or curcumin-containing supplements should be taken into consideration for patients receiving chemotherapy to optimize the outcome of treatments.

  7. Lupeol induces p53 and cyclin-B-mediated G2/M arrest and targets apoptosis through activation of caspase in mouse skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nigam, Nidhi; Prasad, Sahdeo; George, Jasmine

    2009-04-03

    Lupeol, present in fruits and medicinal plants, is a biologically active compound that has been shown to have various pharmacological properties in experimental studies. In the present study, we demonstrated the modulatory effect of lupeol on 7,12-dimethylbenz[a]anthracene (DMBA)-induced alterations on cell proliferation in the skin of Swiss albino mice. Lupeol treatment showed significant (p < 0.05) preventive effects with marked inhibition at 48, 72, and 96 h against DMBA-mediated neoplastic events. Cell-cycle analysis showed that lupeol-induced G2/M-phase arrest (16-37%) until 72 h, and these inhibitory effects were mediated through inhibition of the cyclin-B-regulated signaling pathway involving p53, p21/WAF1, cdc25C, cdc2,more » and cyclin-B gene expression. Further lupeol-induced apoptosis was observed, as shown by an increased sub-G1 peak (28%) at 96 h, with upregulation of bax and caspase-3 genes and downregulation of anti-apoptotic bcl-2 and survivin genes. Thus, our results indicate that lupeol has novel anti-proliferative and apoptotic potential that may be helpful in designing strategies to fight skin cancer.« less

  8. LLRF System for the Fermilab Muon g-2 and Mu2e Projects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Varghese, P.; Chase, B.

    The Mu2e experiment measures the conversion rate of muons into electrons and the Muon g-2 experiment measures the muon magnetic moment. Both experiments require 53 MHz batches of 8 GeV protons to be re-bunched into 150 ns, 2.5 MHz pulses for extraction to the g-2 target for Muon g-2 and to a delivery ring with a single RF cavity running at 2.36 MHz for Mu2e. The LLRF system for both experiments is implemented in a SOC FPGA board integrated into the existing 53 MHz LLRF system in a VXI crate. The tight timing requirements, the large frequency difference and themore » non-harmonic relationship between the two RF systems provide unique challenges to the LLRF system design to achieve the required phase alignment specifications for beam formation, transfers and beam extinction between pulses. The new LLRF system design for both projects is described and the results of the initial beam commissioning tests for the Muon g-2 experiment are presented.« less

  9. N,N'-di-(m-methylphenyi)-3,6-dimethyl-1,4-dihydro-1,2,4,5-tetrazine-1,4-dicarboamide (ZGDHu-1) suppresses the proliferation of PANC-1 pancreatic cancer cells via apoptosis and G2/M cell cycle arrest.

    PubMed

    Chen, Su-Feng; Xia, Jun; Lv, Ya-Ping; Liu, Jin-Lin; Li, Wan-Xiang; Yu, Xi-Ping; Hu, Wei-Xiao; Zhou, Yong-Lie

    2015-04-01

    Pancreatic cancer is one of the human gastrointestinal malignancies with a high mortality and poor prognosis. Approximately eighty percent of patients are diagnosed with unresectable or metastatic disease. Thus, development of novel chemicals in the treatment of pancreatic cancer is imperative. This study aimed to investigate the anticancer effects of N,N'-di-(m-methylphenyi)-3,6-dimethyl-1,4-dihydro-1,2,4,5-tetrazine-1,4-dicarboamide (ZGDHu-1), a new tetrazine derivative, on the PANC-1 pancreatic cancer cell line and clarify the underlying molecular mechanism. Using an MTT assay, we found that ZGDHu-1 significantly suppressed the proliferation of PANC-1 cells in a time- and dose-dependent manner. Moreover, according to the morphological and flow cytometric analysis, the results indicated that ZGDHu-1 induced PANC-1 cell apoptosis and G2/M cell cycle arrest in a dose-dependent manner. In the western blot analysis, expression of the pro-apoptotic Bax gene was upregulated while the anti-apoptotic Bcl-2 gene was downregulated following treatment with ZGDHu-1. ZGDHu-1 also activated pro-caspase-3 and PARP and increased the expression of NF-κB inhibitor IκB. Furthermore, the expression levels of G2/M regulatory molecules such as cyclin B1 and cdc2 were decreased while that of Chk1 was increased. These results suggested that ZGDHu-1 suppressed the proliferation of pancreatic cancer cells, rendering it a potential therapeutic drug for the treatment of pancreatic cancer.

  10. Sequencing and phylogenetic analysis of the coding region of six common rotavirus strains: evidence for intragenogroup reassortment among co-circulating G1P[8] and G2P[4] strains from the United States.

    PubMed

    Bányai, K; Mijatovic-Rustempasic, S; Hull, J J; Esona, M D; Freeman, M M; Frace, A M; Bowen, M D; Gentsch, J R

    2011-03-01

    The segmented genome of rotaviruses provides an opportunity for rotavirus strains to generate a large genetic diversity through reassortment; however, this mechanism is considered to play little role in the generation of mosaic gene constellations between Wa-like and DS-1-like strains in genes other than the neutralization antigens. A pilot study was undertaken to analyze these two epidemiologically important strains at the genomic level in order to (i) identify intergenogroup reassortment and (ii) to make available additional reference genome sequences of G1P[8] and G2P[4] for future genomics analyses. The full or nearly complete coding region of all 11 genes for 3 G1P[8] (LB2719, LB2758, and LB2771) and 3 G2P[4] (LB2744, LB2764, and LB2772) strains isolated from children hospitalized with severe diarrhea in Long Beach, California, where these strains were circulating at comparable rates during 2005-2006 are described in this study. Based on the full-genome classification system, all G1P[8] strains had a conserved genomic constellation: G1-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-E1-H1 and were mostly identical to the few Wa-like strains whose genome sequences have already been determined. Similarly, the genome sequences of the 3 G2P[4] strains were highly conserved: G2-P[4]-I2-R2-C2-M2-A2-N2-T2-E2-E2-H2 and displayed an overall lesser genetic divergence with reference DS-1-like strains. While intergenogroup reassortment was not seen between the G1P[8] and G2P[4] strains studied here, evidence for intragenogroup reassortment events was identified. Similar studies in the post-rotavirus genomic era will help uncover whether intergenogroup reassortment affecting the backbone genes could play a significant role in any potential vaccine breakthrough events by evading immunity of vaccinated children. Copyright © 2011 Wiley-Liss, Inc.

  11. Individual and combined effects of Aflatoxin B1, Deoxynivalenol and Zearalenone on HepG2 and RAW 264.7 cell lines.

    PubMed

    Zhou, Hongyuan; George, Saji; Hay, Crystal; Lee, Joel; Qian, He; Sun, Xiulan

    2017-05-01

    To understand the combinatorial toxicity of mycotoxins, we measured the effects of individual, binary and tertiary combinations of Aflatoxin B 1 (AFB 1 ), Deoxynivalenol (DON) and Zearalenone (ZEN) on the cell viability and cellular perturbations of HepG2 and RAW 264.7 cells. The nature of mycotoxins interactions was assessed using mathematical modeling (Chou-Talalay). Mechanisms of cytotoxicity were studied using high content screening (HCS) that probed cytotoxicity responses, such as changes in intracellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP), intracellular calcium ([Ca 2+ ] i ) flux, and cell membrane damage. Our results showed that individual cytotoxicity of mycotoxins in a decreasing order was DON>AFB 1 >ZEN. Varying combinations of mycotoxins at differing concentrations showed different types of interactions. Most of the mixtures showed increasing toxic effects-synergism and/or addition while antagonistic effects were observed with combination of AFB 1 +ZEN. Generally, combination of mycotoxins showed significantly increased intracellular ROS production and [Ca 2+ ] i flux, and decreased MMP in both cell lines, showing that the synergistic and additive effects of mycotoxin combination originate from perturbations of multiple cellular functions. Additionally, this study demonstrated the applicability of HCS for gaining mechanistic understanding on the toxicity of individual as well as combinatorial mycotoxins, and also provided scientific bases for formulating regulatory policies. Copyright © 2017. Published by Elsevier Ltd.

  12. L1-mediated retrotransposition of murine B1 and B2 SINEs recapitulated in cultured cells.

    PubMed

    Dewannieux, Marie; Heidmann, Thierry

    2005-06-03

    SINEs are short interspersed nucleotide elements with transpositional activity, present at a high copy number (up to a million) in mammalian genomes. They are 80-400 bp long, non-coding sequences which derive either from the 7SL RNA (e.g. human Alus, murine B1s) or tRNA (e.g. murine B2s) polymerase III-driven genes. We have previously demonstrated that Alus very efficiently divert the enzymatic machinery of the autonomous L1 LINE (long interspersed nucleotide element) retrotransposons to transpose at a high rate. Here we show, using an ex vivo assay for transposition, that both B1 and B2 SINEs can be mobilized by murine LINEs, with the hallmarks of a bona fide retrotransposition process, including target site duplications of varying lengths and integrations into A-rich sequences. Despite different phylogenetic origins, transposition of the tRNA-derived B2 sequences is as efficient as that of the human Alus, whereas that of B1s is 20-100-fold lower despite a similar high copy number of these elements in the mouse genome. We provide evidence, via an appropriate nucleotide substitution within the B1 sequence in a domain essential for its intracellular targeting, that the current B1 SINEs are not optimal for transposition, a feature most probably selected for the host sake in the course of evolution.

  13. The G2 block induced by DNA damage: a caffeine-resistant component independent of Cdc25C, MPM-2 phosphorylation, and H1 kinase activity.

    PubMed

    Barratt, R A; Kao, G; McKenna, W G; Kuang, J; Muschel, R J

    1998-06-15

    Treatment of cells with agents that cause DNA damage often results in a delay in G2. There is convincing evidence showing that inhibition of p34cdc2 kinase activation is involved in the DNA damage-induced G2 delay. In this study, we have demonstrated the existence of an additional pathway, independent of the p34cdc2 kinase activation pathway, that leads to a G2 arrest in etoposide-treated cells. Both the X-ray-induced and the etoposide-induced G2 arrest were associated with inhibition of the p34cdc2 H1 kinase activation pathway as judged by p34cdc2 H1 kinase activity and phosphorylation of cdc25C. Caffeine treatment restored these activities after either of the treatments. However, the etoposide-treated cells did not resume cycling, revealing the presence of an alternative pathway leading to a G2 arrest. To explore the possibility that this additional pathway involved phosphorylation of the MPM-2 epitope that is shared by a large family of mitotic phosphoproteins, we monitored the phosphorylation status of the MPM-2 epitope after DNA damage and after treatment with caffeine. Phosphorylation of the MPM-2 epitope was depressed in both X-ray and etoposide-treated cells, and the depression was reversed by caffeine in both cases. The results indicate that the pathway affecting MPM-2 epitope phosphorylation is involved in the G2 delay caused by DNA damage. However, it is not part of the caffeine-insensitive pathway leading to a G2 block seen in etoposide-treated cells.

  14. A neural network potential energy surface for the NaH2 system and dynamics studies on the H(2S) + NaH(X1Σ+) → Na(2S) + H2(X1Σg+) reaction.

    PubMed

    Wang, Shufen; Yuan, Jiuchuang; Li, Huixing; Chen, Maodu

    2017-08-02

    In order to study the dynamics of the reaction H( 2 S) + NaH(X 1 Σ + ) → Na( 2 S) + H 2 (X 1 Σ g + ), a new potential energy surface (PES) for the ground state of the NaH 2 system is constructed based on 35 730 ab initio energy points. Using basis sets of quadruple zeta quality, multireference configuration interaction calculations with Davidson correction were carried out to obtain the ab initio energy points. The neural network method is used to fit the PES, and the root mean square error is very small (0.00639 eV). The bond lengths, dissociation energies, zero-point energies and spectroscopic constants of H 2 (X 1 Σ g + ) and NaH(X 1 Σ + ) obtained on the new NaH 2 PES are in good agreement with the experiment data. On the new PES, the reactant coordinate-based time-dependent wave packet method is applied to study the reaction dynamics of H( 2 S) + NaH(X 1 Σ + ) → Na( 2 S) + H 2 (X 1 Σ g + ), and the reaction probabilities, integral cross-sections (ICSs) and differential cross-sections (DCSs) are obtained. There is no threshold in the reaction due to the absence of an energy barrier on the minimum energy path. When the collision energy increases, the ICSs decrease from a high value at low collision energy. The DCS results show that the angular distribution of the product molecules tends to the forward direction. Compared with the LiH 2 system, the NaH 2 system has a larger mass and the PES has a larger well at the H-NaH configuration, which leads to a higher ICS value in the H( 2 S) + NaH(X 1 Σ + ) → Na( 2 S) + H 2 (X 1 Σ g + ) reaction. Because the H( 2 S) + NaH(X 1 Σ + ) → Na( 2 S) + H 2 (X 1 Σ g + ) reaction releases more energy, the product molecules can be excited to a higher vibrational state.

  15. Spin dynamics of paramagnetic centers with anisotropic g tensor and spin of 1/2

    NASA Astrophysics Data System (ADS)

    Maryasov, Alexander G.; Bowman, Michael K.

    2012-08-01

    The influence of g tensor anisotropy on spin dynamics of paramagnetic centers having real or effective spin of 1/2 is studied. The g anisotropy affects both the excitation and the detection of EPR signals, producing noticeable differences between conventional continuous-wave (cw) EPR and pulsed EPR spectra. The magnitudes and directions of the spin and magnetic moment vectors are generally not proportional to each other, but are related to each other through the g tensor. The equilibrium magnetic moment direction is generally parallel to neither the magnetic field nor the spin quantization axis due to the g anisotropy. After excitation with short microwave pulses, the spin vector precesses around its quantization axis, in a plane that is generally not perpendicular to the applied magnetic field. Paradoxically, the magnetic moment vector precesses around its equilibrium direction in a plane exactly perpendicular to the external magnetic field. In the general case, the oscillating part of the magnetic moment is elliptically polarized and the direction of precession is determined by the sign of the g tensor determinant (g tensor signature). Conventional pulsed and cw EPR spectrometers do not allow determination of the g tensor signature or the ellipticity of the magnetic moment trajectory. It is generally impossible to set a uniform spin turning angle for simple pulses in an unoriented or 'powder' sample when g tensor anisotropy is significant.

  16. Modulation of HepG2 cell net apolipoprotein B secretion by the citrus polymethoxyflavone, tangeretin.

    PubMed

    Kurowska, Elzbieta M; Manthey, John A; Casaschi, Adele; Theriault, Andre G

    2004-02-01

    The purpose of the present study was to examine the role of tangeretin, a polymethoxylated flavone from citrus fruits, on the regulation of apolipoprotein B (apoB) and lipid metabolism in the human hepatoma cell-line HepG2. The marked reduction in apoB secretion observed in cells incubated with 72.8 microM tangeretin was rapid, apoB-specific, and partly reversible. The reduction also was observed under lipid-rich conditions and found to be insensitive to proteasomal degradation of nascent apoB. We followed our study by examining lipid synthesis and mass. A 24-h exposure of cells to 72.8 microM tangeretin decreased intracellular synthesis of cholesteryl esters, free cholesterol, and TAG by 82, 45, and 64%, respectively; tangeretin also reduced the mass of cellular TAG by 37%. The tangeretin-induced suppression of TAG synthesis and mass were associated with decreased activities of DAG acyltransferase (up to -39.0 +/- 3.0% vs. control) and microsomal triglyceride transfer protein (up to -35.5 +/- 2.5% vs. control). Tangeretin was also found to activate the peroxisome proliferator-activated receptor, a transcription factor with a positive regulatory impact on FA oxidation and TAG availability (up to 36% increase vs. control). The data suggest that tangeretin modulates apoB-containing lipoprotein metabolism through multiple mechanisms.

  17. Solving the muon g -2 anomaly in deflected anomaly mediated SUSY breaking with messenger-matter interactions

    NASA Astrophysics Data System (ADS)

    Wang, Fei; Wang, Wenyu; Yang, Jin Min

    2017-10-01

    We propose to introduce general messenger-matter interactions in the deflected anomaly mediated supersymmetry (SUSY) breaking (AMSB) scenario to explain the gμ-2 anomaly. Scenarios with complete or incomplete grand unified theory (GUT) multiplet messengers are discussed, respectively. The introduction of incomplete GUT mulitiplets can be advantageous in various aspects. We found that the gμ-2 anomaly can be solved in both scenarios under current constraints including the gluino mass bounds, while the scenarios with incomplete GUT representation messengers are more favored by the gμ-2 data. We also found that the gluino is upper bounded by about 2.5 TeV (2.0 TeV) in scenario A and 3.0 TeV (2.7 TeV) in scenario B if the generalized deflected AMSB scenarios are used to fully account for the gμ-2 anomaly at 3 σ (2 σ ) level. Such a gluino should be accessible in the future LHC searches. Dark matter (DM) constraints, including DM relic density and direct detection bounds, favor scenario B with incomplete GUT multiplets. Much of the allowed parameter space for scenario B could be covered by the future DM direct detection experiments.

  18. G 126.1-0.8-14: A molecular shell related to Sh2-187

    NASA Astrophysics Data System (ADS)

    Cichowolski, S.; Pineault, S.; Gamen, R.; Ortega, M. E.; Arnal, E. M.; Suad, L. A.

    2014-10-01

    We present a multi-wavelength study of a region where a well defined molecular shell, named G 126.1-0.8-14, is observed. The distance of G 126.1-0.8-14 is about 1 kpc. Based on HI and CO data we analyze the atomic and molecular gas related to the structure and estimate its main physical properties. From the radio continuum and infrared data we analyze whether the emission associated with G 126.1-0.8-14 has a thermal origin. To disentangle the possible origin of the shell, and given the lack of catalogued O-type stars in the area, we observed with GEMINI the spectra of four OB stars located in projection inside the shell, to get their accurate spectral types and distances. The young HII region Sh2-187 is located onto the densest part of this molecular shell. A search for young stellar object candidates (cYSOs) was made using infrared point source catalogs. Several cYSOs are found spread out onto the shell. Based on all the available data, we discuss the possible origin of G 126.1-0.8-14 as well as its role in the formation of a new generation of stars.

  19. Infinitesimal moduli of G2 holonomy manifolds with instanton bundles

    NASA Astrophysics Data System (ADS)

    de la Ossa, Xenia; Larfors, Magdalena; Svanes, Eirik E.

    2016-11-01

    We describe the infinitesimal moduli space of pairs ( Y, V) where Y is a manifold with G 2 holonomy, and V is a vector bundle on Y with an instanton connection. These structures arise in connection to the moduli space of heterotic string compactifications on compact and non-compact seven dimensional spaces, e.g. domain walls. Employing the canonical G 2 cohomology developed by Reyes-Carrión and Fernández and Ugarte, we show that the moduli space decomposes into the sum of the bundle moduli {H}_{{overset{ěe }{d}}_A}^1(Y,End(V)) plus the moduli of the G 2 structure preserving the instanton condition. The latter piece is contained in {H}_{overset{ěe }{d}θ}^1(Y,TY) , and is given by the kernel of a map overset{ěe }{F} which generalises the concept of the Atiyah map for holomorphic bundles on complex manifolds to the case at hand. In fact, the map overset{ěe }{F} is given in terms of the curvature of the bundle and maps {H}_{overset{ěe }{d}θ}^1(Y,TY) into {H}_{{overset{ěe }{d}}_A}^2(Y,End(V)) , and moreover can be used to define a cohomology on an extension bundle of TY by End( V). We comment further on the resemblance with the holomorphic Atiyah algebroid and connect the story to physics, in particular to heterotic compactifications on ( Y, V) when α' = 0.

  20. The C1473G polymorphism in the Tryptophan hydroxylase-2 gene: involvement in ethanol-related behavior in mice.

    PubMed

    Bazovkina, Darya V; Lichman, Daria V; Kulikov, Alexander V

    2015-03-04

    Tryptophan hydroxylase-2 (Tph2) is the rate limiting enzyme of serotonin synthesis in the brain. The functional (C1473G) polymorphism in the mouse Tph2 gene affecting the enzymatic activity was suspected to be involved in behavioral actions of ethanol (EtOH). Congenic B6-1473C (C/C) and B6-1473G (G/G) lines bred from C57BL/6 mice were not different in EtOH-induced sleep time and hypothermia. B6-1473C mice displayed increased EtOH preference on the second and third days compared to that of the first day, but no differences in this parameter was found across genotypes. Both lines demonstrated the same responsiveness to hypothermic and hypnotic effect of acute EtOH treatment after repeated alcohol exposure. However, acute EtOH administration led to reduction of locomotor activity in B6-1473C, but not in B6-1473G animals and to increase of time spent in the center of open-field arena in B6-1473G, but not in B6-1473C mice. Thus, the present study indicates the involvement of C1473G polymorphism in mTph2 gene in the regulation of EtOH-induced effects on locomotor activity and anxiety-like behavior in mice. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.