Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells.

PubMed

Luan, Ying; Dai, Hai-Li; Yang, Dan; Zhu, Lin; Gao, Tie-Lei; Shao, Hong-Jiang; Peng, Xue; Jin, Zhan-Feng

2012-01-01

Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID(50)), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

Combination of RNA interference and virus receptor trap exerts additive antiviral activity in coxsackievirus B3-induced myocarditis in mice.

PubMed

Stein, Elisabeth A; Pinkert, Sandra; Becher, Peter Moritz; Geisler, Anja; Zeichhardt, Heinz; Klopfleisch, Robert; Poller, Wolfgang; Tschöpe, Carsten; Lassner, Dirk; Fechner, Henry; Kurreck, Jens

2015-02-15

Coxsackievirus B3 (CVB3) is a major heart pathogen against which no therapy exists to date. The potential of a combination treatment consisting of a proteinaceous virus receptor trap and an RNA interference-based component to prevent CVB3-induced myocarditis was investigated. A soluble variant of the extracellular domain of the coxsackievirus-adenovirus receptor (sCAR-Fc) was expressed from an adenoviral vector and 2 short hairpin RNAs (shRdRp2.4) directed against CVB3 were delivered by an adeno-associated virus (AAV) vector. Cell culture experiments revealed additive antiviral activity of the combined application. In a CVB3-induced mouse myocarditis model, both components applied individually significantly reduced inflammation and viral load in the heart. The combination exerted an additive antiviral effect and reduced heart pathology. Hemodynamic measurement revealed that infection with CVB3 resulted in impaired heart function, as illustrated by a drastically reduced cardiac output and impaired contractility and relaxation. Treatment with either sCAR-Fc or shRdRp2.4 significantly improved these parameters. Importantly, the combination of both components led to a further significant improvement of heart function. Combination of sCAR-Fc and shRdRp2.4 exerted additive effects and was significantly more effective than either of the single treatments in inhibiting CVB3-induced myocarditis and preventing cardiac dysfunction. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand.

PubMed

Yuan, Ji; Cheung, Paul K M; Zhang, Huifang M; Chau, David; Yang, Decheng

2005-02-01

Coxsackievirus B3 (CVB3) is the most common causal agent of viral myocarditis, but existing drug therapies are of limited value. Application of small interfering RNA (siRNA) in knockdown of gene expression is an emerging technology in antiviral gene therapy. To investigate whether RNA interference (RNAi) can protect against CVB3 infection, we evaluated the effects of RNAi on viral replication in HeLa cells and murine cardiomyocytes by using five CVB3-specific siRNAs targeting distinct regions of the viral genome. The most effective one is siRNA-4, targeting the viral protease 2A, achieving a 92% inhibition of CVB3 replication. The specific RNAi effects could last at least 48 h, and cell viability assay revealed that 90% of siRNA-4-pretreated cells were still alive and lacked detectable viral protein expression 48 h postinfection. Moreover, administration of siRNAs after viral infection could also effectively inhibit viral replication, indicating its therapeutic potential. Further evaluation by combination found that no enhanced inhibitory effects were observed when siRNA-4 was cotransfected with each of the other four candidates. In mutational analysis of the mechanisms of siRNA action, we found that siRNA functions by targeting the positive strand of virus and requires a perfect sequence match in the central region of the target, but mismatches were more tolerated near the 3' end than the 5' end of the antisense strand. These findings reveal an effective target for CVB3 silencing and provide a new possibility for antiviral intervention.

Coxsackievirus B4 Can Infect Human Peripheral Blood-Derived Macrophages

PubMed Central

Alidjinou, Enagnon Kazali; Sané, Famara; Trauet, Jacques; Copin, Marie-Christine; Hober, Didier

2015-01-01

Beyond acute infections, group B coxsackieviruses (CVB) are also reported to play a role in the development of chronic diseases, like type 1 diabetes. The viral pathogenesis mainly relies on the interplay between the viruses and innate immune response in genetically-susceptible individuals. We investigated the interaction between CVB4 and macrophages considered as major players in immune response. Monocyte-derived macrophages (MDM) generated with either M-CSF or GM-CSF were inoculated with CVB4, and infection, inflammation, viral replication and persistence were assessed. M-CSF-induced MDM, but not GM-CSF-induced MDM, can be infected by CVB4. In addition, enhancing serum was not needed to infect MDM in contrast with parental monocytes. The expression of viral receptor (CAR) mRNA was similar in both M-CSF and GM-CSF MDM. CVB4 induced high levels of pro-inflammatory cytokines (IL-6 and TNFα) in both MDM populations. CVB4 effectively replicated and persisted in M-CSF MDM, but IFNα was produced in the early phase of infection only. Our results demonstrate that CVB4 can replicate and persist in MDM. Further investigations are required to determine whether the interaction between the virus and MDM plays a role in the pathogenesis of CVB-induced chronic diseases. PMID:26610550

Coxsackievirus B4 Can Infect Human Peripheral Blood-Derived Macrophages.

PubMed

Alidjinou, Enagnon Kazali; Sané, Famara; Trauet, Jacques; Copin, Marie-Christine; Hober, Didier

2015-11-24

Beyond acute infections, group B coxsackieviruses (CVB) are also reported to play a role in the development of chronic diseases, like type 1 diabetes. The viral pathogenesis mainly relies on the interplay between the viruses and innate immune response in genetically-susceptible individuals. We investigated the interaction between CVB4 and macrophages considered as major players in immune response. Monocyte-derived macrophages (MDM) generated with either M-CSF or GM-CSF were inoculated with CVB4, and infection, inflammation, viral replication and persistence were assessed. M-CSF-induced MDM, but not GM-CSF-induced MDM, can be infected by CVB4. In addition, enhancing serum was not needed to infect MDM in contrast with parental monocytes. The expression of viral receptor (CAR) mRNA was similar in both M-CSF and GM-CSF MDM. CVB4 induced high levels of pro-inflammatory cytokines (IL-6 and TNFα) in both MDM populations. CVB4 effectively replicated and persisted in M-CSF MDM, but IFNα was produced in the early phase of infection only. Our results demonstrate that CVB4 can replicate and persist in MDM. Further investigations are required to determine whether the interaction between the virus and MDM plays a role in the pathogenesis of CVB-induced chronic diseases.

Novel [(biphenyloxy)propyl]isoxazole derivatives for inhibition of human rhinovirus 2 and coxsackievirus B3 replication.

PubMed

Makarov, Vadim A; Riabova, Olga B; Granik, Vladimir G; Wutzler, Peter; Schmidtke, Michaela

2005-04-01

During this study, novel biphenyl derivatives were synthesized and tested for antiviral activity. A new method based on the Suzuki coupling reaction has been established for the synthesis of these polysubstituted chain systems. In parallel with cytotoxicity, the antiviral activity of biphenyl derivatives has been determined in cytopathic effect (CPE)-inhibitory assays with the pleconaril-resistant coxsackievirus B3 (CVB3) strain Nancy, human rhinovirus 2 (HRV-2) and 14 (HRV-14) and in plaque reduction assays with the pleconaril-sensitive human isolate CVB3 97-927 in HeLa cells. Based on the results from these investigations the selectivity index (SI) was determined as the ratio of the 50% cytotoxic concentration to the 50% inhibitory concentration. The new method based on the Suzuki coupling reaction includes the condensation of 2,6-dimethyl-4-bromophenol with pentyne chloride by means of potassium carbonate and potassium iodide in N-methylpyrrolidone-2 and yields 5-bromo-1,3-dimethyl-2-(4-pentynyloxy)benzene. Its condensation with methylacetaldoxime results in 3-methylisoxazole derivatives. The following reaction with different benzeneboronic acids by means of tetrakis(triphenylphosphine)-palladium(0) finally yields the corresponding derivatives. Several of the novel synthesized derivatives demonstrated a good antiviral activity on CVB3 (SI > 2 to > 37.5) and a strong anti-HRV-2 activity (SI > 50 to > 200). In contrast, none of the compounds inhibited the HRV-14-induced CPE. These results indicate that [(biphenyloxy)propyl]isoxazole derivatives are potential inhibitors of HRV-2 and CVB3 replication, and make them promising agents for the specific treatment of these virus infections.

Heat shock protein 70 promotes coxsackievirus B3 translation initiation and elongation via Akt-mTORC1 pathway depending on activation of p70S6K and Cdc2.

PubMed

Wang, Fengping; Qiu, Ye; Zhang, Huifang M; Hanson, Paul; Ye, Xin; Zhao, Guangze; Xie, Ronald; Tong, Lei; Yang, Decheng

2017-07-01

We previously demonstrated that coxsackievirus B3 (CVB3) infection upregulated heat shock protein 70 (Hsp70) and promoted CVB3 multiplication. Here, we report the underlying mechanism by which Hsp70 enhances viral RNA translation. By using an Hsp70-overexpressing cell line infected with CVB3, we found that Hsp70 enhanced CVB3 VP1 translation at two stages. First, Hsp70 induced upregulation of VP1 translation at the initiation stage via upregulation of internal ribosome entry site trans-acting factor lupus autoantigen protein and activation of eIF4E binding protein 1, a cap-dependent translation suppressor. Second, we found that Hsp70 increased CVB3 VP1 translation by enhancing translation elongation. This was mediated by the Akt-mammalian target of rapamycin complex 1 signal cascade, which led to the activation of eukaryotic elongation factor 2 via p70S6K- and cell division cycle protein 2 homolog (Cdc2)-mediated phosphorylation and inactivation of eukaryotic elongation factor 2 kinase. We also determined the position of Cdc2 in this signal pathway, indicating that Cdc2 is regulated by mammalian target of rapamycin complex 1. This signal transduction pathway was validated using a number of specific pharmacological inhibitors, short interfering RNAs (siRNAs) and a dominant negative Akt plasmid. Because Hsp70 is a central component of the cellular network of molecular chaperones enhancing viral replication, these data may provide new strategies to limit this viral infection. © 2017 John Wiley & Sons Ltd.

The Impact of Juvenile Coxsackievirus Infection on Cardiac Progenitor Cells and Postnatal Heart Development

PubMed Central

Sin, Jon; Puccini, Jenna M.; Huang, Chengqun; Konstandin, Mathias H.; Gilbert, Paul E.; Sussman, Mark A.; Gottlieb, Roberta A.; Feuer, Ralph

2014-01-01

Coxsackievirus B (CVB) is an enterovirus that most commonly causes a self-limited febrile illness in infants, but cases of severe infection can manifest in acute myocarditis. Chronic consequences of mild CVB infection are unknown, though there is an epidemiologic association between early subclinical infections and late heart failure, raising the possibility of subtle damage leading to late-onset dysfunction, or chronic ongoing injury due to inflammatory reactions during latent infection. Here we describe a mouse model of juvenile infection with a subclinical dose of coxsackievirus B3 (CVB3) which showed no evident symptoms, either immediately following infection or in adult mice. However following physiological or pharmacologically-induced cardiac stress, juvenile-infected adult mice underwent cardiac hypertrophy and dilation indicative of progression to heart failure. Evaluation of the vasculature in the hearts of adult mice subjected to cardiac stress showed a compensatory increase in CD31+ blood vessel formation, although this effect was suppressed in juvenile-infected mice. Moreover, CVB3 efficiently infected juvenile c-kit+ cells, and cardiac progenitor cell numbers were reduced in the hearts of juvenile-infected adult mice. These results suggest that the exhausted cardiac progenitor cell pool following juvenile CVB3 infection may impair the heart's ability to increase capillary density to adapt to increased load. PMID:25079373

N-Terminomics TAILS Identifies Host Cell Substrates of Poliovirus and Coxsackievirus B3 3C Proteinases That Modulate Virus Infection.

PubMed

Jagdeo, Julienne M; Dufour, Antoine; Klein, Theo; Solis, Nestor; Kleifeld, Oded; Kizhakkedathu, Jayachandran; Luo, Honglin; Overall, Christopher M; Jan, Eric

2018-04-15

Enteroviruses encode proteinases that are essential for processing of the translated viral polyprotein. In addition, viral proteinases also target host proteins to manipulate cellular processes and evade innate antiviral responses to promote replication and infection. Although some host protein substrates of enterovirus proteinases have been identified, the full repertoire of targets remains unknown. We used a novel quantitative in vitro proteomics-based approach, termed t erminal a mine i sotopic l abeling of s ubstrates (TAILS), to identify with high confidence 72 and 34 new host protein targets of poliovirus and coxsackievirus B3 (CVB3) 3C proteinases (3C pro s) in HeLa cell and cardiomyocyte HL-1 cell lysates, respectively. We validated a subset of candidate substrates that are targets of poliovirus 3C pro in vitro including three common protein targets, phosphoribosylformylglycinamidine synthetase (PFAS), hnRNP K, and hnRNP M, of both proteinases. 3C pro -targeted substrates were also cleaved in virus-infected cells but not noncleavable mutant proteins designed from the TAILS-identified cleavage sites. Knockdown of TAILS-identified target proteins modulated infection both negatively and positively, suggesting that cleavage by 3C pro promotes infection. Indeed, expression of a cleavage-resistant mutant form of the endoplasmic reticulum (ER)-Golgi vesicle-tethering protein p115 decreased viral replication and yield. As the first comprehensive study to identify and validate functional enterovirus 3C pro substrates in vivo , we conclude that N-terminomics by TAILS is an effective strategy to identify host targets of viral proteinases in a nonbiased manner. IMPORTANCE Enteroviruses are positive-strand RNA viruses that encode proteases that cleave the viral polyprotein into the individual mature viral proteins. In addition, viral proteases target host proteins in order to modulate cellular pathways and block antiviral responses in order to facilitate virus infection

N-Terminomics TAILS Identifies Host Cell Substrates of Poliovirus and Coxsackievirus B3 3C Proteinases That Modulate Virus Infection

PubMed Central

Jagdeo, Julienne M.; Dufour, Antoine; Klein, Theo; Solis, Nestor; Kleifeld, Oded; Kizhakkedathu, Jayachandran; Luo, Honglin; Overall, Christopher M.

2018-01-01

ABSTRACT Enteroviruses encode proteinases that are essential for processing of the translated viral polyprotein. In addition, viral proteinases also target host proteins to manipulate cellular processes and evade innate antiviral responses to promote replication and infection. Although some host protein substrates of enterovirus proteinases have been identified, the full repertoire of targets remains unknown. We used a novel quantitative in vitro proteomics-based approach, termed terminal amine isotopic labeling of substrates (TAILS), to identify with high confidence 72 and 34 new host protein targets of poliovirus and coxsackievirus B3 (CVB3) 3C proteinases (3Cpros) in HeLa cell and cardiomyocyte HL-1 cell lysates, respectively. We validated a subset of candidate substrates that are targets of poliovirus 3Cpro in vitro including three common protein targets, phosphoribosylformylglycinamidine synthetase (PFAS), hnRNP K, and hnRNP M, of both proteinases. 3Cpro-targeted substrates were also cleaved in virus-infected cells but not noncleavable mutant proteins designed from the TAILS-identified cleavage sites. Knockdown of TAILS-identified target proteins modulated infection both negatively and positively, suggesting that cleavage by 3Cpro promotes infection. Indeed, expression of a cleavage-resistant mutant form of the endoplasmic reticulum (ER)-Golgi vesicle-tethering protein p115 decreased viral replication and yield. As the first comprehensive study to identify and validate functional enterovirus 3Cpro substrates in vivo, we conclude that N-terminomics by TAILS is an effective strategy to identify host targets of viral proteinases in a nonbiased manner. IMPORTANCE Enteroviruses are positive-strand RNA viruses that encode proteases that cleave the viral polyprotein into the individual mature viral proteins. In addition, viral proteases target host proteins in order to modulate cellular pathways and block antiviral responses in order to facilitate virus infection

PAR-1 contributes to the innate immune response during viral infection

PubMed Central

Antoniak, Silvio; Owens, A. Phillip; Baunacke, Martin; Williams, Julie C.; Lee, Rebecca D.; Weithäuser, Alice; Sheridan, Patricia A.; Malz, Ronny; Luyendyk, James P.; Esserman, Denise A.; Trejo, JoAnn; Kirchhofer, Daniel; Blaxall, Burns C.; Pawlinski, Rafal; Beck, Melinda A.; Rauch, Ursula; Mackman, Nigel

2013-01-01

Coagulation is a host defense system that limits the spread of pathogens. Coagulation proteases, such as thrombin, also activate cells by cleaving PARs. In this study, we analyzed the role of PAR-1 in coxsackievirus B3–induced (CVB3-induced) myocarditis and influenza A infection. CVB3-infected Par1–/– mice expressed reduced levels of IFN-β and CXCL10 during the early phase of infection compared with Par1+/+ mice that resulted in higher viral loads and cardiac injury at day 8 after infection. Inhibition of either tissue factor or thrombin in WT mice also significantly increased CVB3 levels in the heart and cardiac injury compared with controls. BM transplantation experiments demonstrated that PAR-1 in nonhematopoietic cells protected mice from CVB3 infection. Transgenic mice overexpressing PAR-1 in cardiomyocytes had reduced CVB3-induced myocarditis. We found that cooperative signaling between PAR-1 and TLR3 in mouse cardiac fibroblasts enhanced activation of p38 and induction of IFN-β and CXCL10 expression. Par1–/– mice also had decreased CXCL10 expression and increased viral levels in the lung after influenza A infection compared with Par1+/+ mice. Our results indicate that the tissue factor/thrombin/PAR-1 pathway enhances IFN-β expression and contributes to the innate immune response during single-stranded RNA viral infection. PMID:23391721

New Coxsackievirus 2Apro and 3Cpro protease antibodies for virus detection and discovery of pathogenic mechanisms.

PubMed

Laitinen, Olli H; Svedin, Emma; Kapell, Sebastian; Hankaniemi, Minna M; Larsson, Pär G; Domsgen, Erna; Stone, Virginia M; Määttä, Juha A E; Hyöty, Heikki; Hytönen, Vesa P; Flodström-Tullberg, Malin

2018-05-01

Enteroviruses (EVs), such as the Coxsackie B-viruses (CVBs), are common human pathogens, which can cause severe diseases including meningitis, myocarditis and neonatal sepsis. EVs encode two proteases (2A pro and 3C pro ), which perform the proteolytic cleavage of the CVB polyprotein and also cleave host cell proteins to facilitate viral replication. The 2A pro cause direct damage to the infected heart and tools to investigate 2A pro and 3C pro expression may contribute new knowledge on virus-induced pathologies. Here, we developed new antibodies to CVB-encoded 2A pro and 3C pro ; Two monoclonal 2A pro antibodies and one 3C pro antibody were produced. Using cells infected with selected viruses belonging to the EV A, B and C species and immunocytochemistry, we demonstrate that the 3C pro antibody detects all of the EV species B (EV-B) viruses tested and that the 2A pro antibody detects all EV-B viruses apart from Echovirus 9. We furthermore show that the new antibodies work in Western blotting, immunocyto- and immunohistochemistry, and flow cytometry to detect CVBs. Confocal microscopy demonstrated the expression kinetics of 2A pro and 3C pro , and revealed a preferential cytosolic localization of the proteases in CVB3 infected cells. In summary, the new antibodies detect proteases that belong to EV species B in cells and tissue using multiple applications. Copyright © 2018 Elsevier B.V. All rights reserved.

Divergent Requirement for a DNA Repair Enzyme during Enterovirus Infections.

PubMed

Maciejewski, Sonia; Nguyen, Joseph H C; Gómez-Herreros, Fernando; Cortés-Ledesma, Felipe; Caldecott, Keith W; Semler, Bert L

2015-12-29

Viruses of the Enterovirus genus of picornaviruses, including poliovirus, coxsackievirus B3 (CVB3), and human rhinovirus, commandeer the functions of host cell proteins to aid in the replication of their small viral genomic RNAs during infection. One of these host proteins is a cellular DNA repair enzyme known as 5' tyrosyl-DNA phosphodiesterase 2 (TDP2). TDP2 was previously demonstrated to mediate the cleavage of a unique covalent linkage between a viral protein (VPg) and the 5' end of picornavirus RNAs. Although VPg is absent from actively translating poliovirus mRNAs, the removal of VPg is not required for the in vitro translation and replication of the RNA. However, TDP2 appears to be excluded from replication and encapsidation sites during peak times of poliovirus infection of HeLa cells, suggesting a role for TDP2 during the viral replication cycle. Using a mouse embryonic fibroblast cell line lacking TDP2, we found that TDP2 is differentially required among enteroviruses. Our single-cycle viral growth analysis shows that CVB3 replication has a greater dependency on TDP2 than does poliovirus or human rhinovirus replication. During infection, CVB3 protein accumulation is undetectable (by Western blot analysis) in the absence of TDP2, whereas poliovirus protein accumulation is reduced but still detectable. Using an infectious CVB3 RNA with a reporter, CVB3 RNA could still be replicated in the absence of TDP2 following transfection, albeit at reduced levels. Overall, these results indicate that TDP2 potentiates viral replication during enterovirus infections of cultured cells, making TDP2 a potential target for antiviral development for picornavirus infections. Picornaviruses are one of the most prevalent groups of viruses that infect humans and livestock worldwide. These viruses include the human pathogens belonging to the Enterovirus genus, such as poliovirus, coxsackievirus B3 (CVB3), and human rhinovirus. Diseases caused by enteroviruses pose a major problem

Hsp70-1: upregulation via selective phosphorylation of heat shock factor 1 during coxsackieviral infection and promotion of viral replication via the AU-rich element.

PubMed

Qiu, Ye; Ye, Xin; Hanson, Paul J; Zhang, Huifang Mary; Zong, Jeff; Cho, Brian; Yang, Decheng

2016-03-01

Coxsackievirus B3 (CVB3) is the primary pathogen of viral myocarditis. Upon infection, CVB3 exploits the host cellular machineries, such as chaperone proteins, to benefit its own infection cycles. Inducible heat shock 70-kDa proteins (Hsp70s) are chaperone proteins induced by various cellular stress conditions. The internal ribosomal entry site (IRES) within Hsp70 mRNA allows Hsp70 to be translated cap-independently during CVB3 infection when global cap-dependent translation is compromised. The Hsp70 protein family contains two major members, Hsp70-1 and Hsp70-2. This study showed that Hsp70-1, but not Hsp70-2, was upregulated during CVB3 infection both in vitro and in vivo. Then a novel mechanism of Hsp70-1 induction was revealed in which CaMKIIγ is activated by CVB3 replication and leads to phosphorylation of heat shock factor 1 (HSF1) specifically at Serine 230, which enhances Hsp70-1 transcription. Meanwhile, phosphorylation of Ser230 induces translocation of HSF1 from the cytoplasm to nucleus, thus blocking the ERK1/2-mediated phosphorylation of HSF1 at Ser307, a negative regulatory process of Hsp70 transcription, further contributing to Hsp70-1 upregulation. Finally, we demonstrated that Hsp70-1 upregulation, in turn, stabilizes CVB3 genome via the AU-rich element (ARE) harbored in the 3' untranslated region of CVB3 genomic RNA.

Heterogeneous Nuclear Ribonucleoprotein M Facilitates Enterovirus Infection

PubMed Central

Jagdeo, Julienne M.; Dufour, Antoine; Fung, Gabriel; Luo, Honglin; Kleifeld, Oded; Overall, Christopher M.

2015-01-01

ABSTRACT Picornavirus infection involves a dynamic interplay of host and viral protein interactions that modulates cellular processes to facilitate virus infection and evade host antiviral defenses. Here, using a proteomics-based approach known as TAILS to identify protease-generated neo-N-terminal peptides, we identify a novel target of the poliovirus 3C proteinase, the heterogeneous nuclear ribonucleoprotein M (hnRNP M), a nucleocytoplasmic shuttling RNA-binding protein that is primarily known for its role in pre-mRNA splicing. hnRNP M is cleaved in vitro by poliovirus and coxsackievirus B3 (CVB3) 3C proteinases and is targeted in poliovirus- and CVB3-infected HeLa cells and in the hearts of CVB3-infected mice. hnRNP M relocalizes from the nucleus to the cytoplasm during poliovirus infection. Finally, depletion of hnRNP M using small interfering RNA knockdown approaches decreases poliovirus and CVB3 infections in HeLa cells and does not affect poliovirus internal ribosome entry site translation and viral RNA stability. We propose that cleavage of and subverting the function of hnRNP M is a general strategy utilized by picornaviruses to facilitate viral infection. IMPORTANCE Enteroviruses, a member of the picornavirus family, are RNA viruses that cause a range of diseases, including respiratory ailments, dilated cardiomyopathy, and paralysis. Although enteroviruses have been studied for several decades, the molecular basis of infection and the pathogenic mechanisms leading to disease are still poorly understood. Here, we identify hnRNP M as a novel target of a viral proteinase. We demonstrate that the virus subverts the function of hnRNP M and redirects it to a step in the viral life cycle. We propose that cleavage of hnRNP M is a general strategy that picornaviruses use to facilitate infection. PMID:25926642

Divergent Requirement for a DNA Repair Enzyme during Enterovirus Infections

PubMed Central

Maciejewski, Sonia; Nguyen, Joseph H. C.; Gómez-Herreros, Fernando; Cortés-Ledesma, Felipe; Caldecott, Keith W.

2015-01-01

ABSTRACT Viruses of the Enterovirus genus of picornaviruses, including poliovirus, coxsackievirus B3 (CVB3), and human rhinovirus, commandeer the functions of host cell proteins to aid in the replication of their small viral genomic RNAs during infection. One of these host proteins is a cellular DNA repair enzyme known as 5′ tyrosyl-DNA phosphodiesterase 2 (TDP2). TDP2 was previously demonstrated to mediate the cleavage of a unique covalent linkage between a viral protein (VPg) and the 5′ end of picornavirus RNAs. Although VPg is absent from actively translating poliovirus mRNAs, the removal of VPg is not required for the in vitro translation and replication of the RNA. However, TDP2 appears to be excluded from replication and encapsidation sites during peak times of poliovirus infection of HeLa cells, suggesting a role for TDP2 during the viral replication cycle. Using a mouse embryonic fibroblast cell line lacking TDP2, we found that TDP2 is differentially required among enteroviruses. Our single-cycle viral growth analysis shows that CVB3 replication has a greater dependency on TDP2 than does poliovirus or human rhinovirus replication. During infection, CVB3 protein accumulation is undetectable (by Western blot analysis) in the absence of TDP2, whereas poliovirus protein accumulation is reduced but still detectable. Using an infectious CVB3 RNA with a reporter, CVB3 RNA could still be replicated in the absence of TDP2 following transfection, albeit at reduced levels. Overall, these results indicate that TDP2 potentiates viral replication during enterovirus infections of cultured cells, making TDP2 a potential target for antiviral development for picornavirus infections. PMID:26715620

Endoplasmic Reticulum Stress Aggravates Viral Myocarditis by Raising Inflammation Through the IRE1-Associated NF-κB Pathway.

PubMed

Zha, Xi; Yue, Yan; Dong, Ning; Xiong, Sidong

2015-08-01

Viral myocarditis, which is mostly caused by coxsackievirus infection, is characterized by myocardial inflammation. Abnormal endoplasmic reticulum (ER) stress participates in many heart diseases, but its role in viral myocarditis remains unsolved. We investigated the influence of ER stress in coxsackievirus B3 (CVB3)-induced viral myocarditis by dynamically detecting its activation in CVB3-infected hearts, analyzing its association with myocarditis severity, and exploring its impact on disease development by modulating the strength of ER stress with the chemical activator tunicamycin (Tm) or the inhibitor tauroursodeoxycholic acid (TUDCA). The underlying signal pathway of ER stress in CVB3-induced myocarditis was also deciphered. We found that myocardial expression of Grp78 and Grp94, 2 ER stress markers, was significantly increased after CVB3 infection and positively correlated with myocarditis severity. Consistently, Tm-augmented ER stress obviously aggravated myocarditis, as shown by more severe myocardial inflammation, reduced cardiac function, and a lower survival rate, whereas TUDCA decreased ER stress and obviously alleviated myocarditis. This pathologic effect of ER stress could be attributed to increased levels of proinflammatory cytokine (interleukin [IL]-6, IL-12, tumor necrosis factor-alpha, and monocyte chemoattractant protein-1) production through the IRE1-associated nuclear factor-κB (NF-kB) pathway. ER stress accentuated CVB3-induced myocardial inflammation through the IRE1-associated NF-κB pathway. This study may help us understand the role of ER stress in viral myocarditis and promote the development of corresponding therapeutic strategies based on manipulating ER stress. Copyright © 2015 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Activation of the 2-5OAS/RNase L pathway in CVB1 or HAV/18f infected FRhK-4 cells does not require induction of OAS1 or OAS2 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kulka, Michael, E-mail: michael.kulka@fda.hhs.go; Calvo, Mona S., E-mail: mona.calvo@fda.hhs.go; Ngo, Diana T., E-mail: diana.ngo@fda.hhs.go

2009-05-25

The latent, constitutively expressed protein RNase L is activated in coxsackievirus and HAV strain 18f infected FRhK-4 cells. Endogenous oligoadenylate synthetase (OAS) from uninfected and virus infected cell extracts synthesizes active forms of the triphosphorylated 2-5A oligomer (the only known activator of RNase L) in vitro and endogenous 2-5A is detected in infected cell extracts. However, only the largest OAS isoform, OAS3, is readily detected throughout the time course of infection. While IFNbeta treatment results in an increase in the level of all three OAS isoforms in FRhK-4 cells, IFNbeta pretreatment does not affect the temporal onset or enhancement ofmore » RNase L activity nor inhibit virus replication. Our results indicate that CVB1 and HAV/18f activate the 2-5OAS/RNase L pathway in FRhK-4 cells during permissive infection through endogenous levels of OAS, but contrary to that reported for some picornaviruses, CVB1 and HAV/18f replication is insensitive to this activated antiviral pathway.« less

[Effects of Chinese herbal compound for supplementing qi and activating blood circulation on actin, Cx43 expressions and gap junctional intercellular communication functions of myocardial cells in patients with Coxsackie virus B 3 viral myocarditis].

PubMed

Zhang, Ming-xue; He, Wei; Gu, Ping

2010-08-01

To observe the effect of Chinese herbal compound for supplementing qi and activating blood circulation (CHC) on the gap junctional intercellular communication (GJIC) function of myocardial cells in patients with Coxsackie virus B 3 (CVB3) viral myocarditis. Expressions of actin and connexin43 (Cx43) in myocardial cells of patients arranged in three groups (the normal control group, the viral infected group and the CHC treated group) were detected by immunohistochemical method; the fluorescence photobleaching recovery rate of cells was detected by laser scanning confocal microscope. As compared with the viral infected group, the expressions of actin and Cx43 were increased and the GJIC function was improved in the CHC treated group. CHC could antagonize viral injury on skeleton protein, and repair the structure of gap junction channel to improve the GJIC function of myocardial cells after being attacked by CVB3.

The Transcriptome of Rhabdomyosarcoma Cells Infected with Cytolytic and Non-Cytolytic Variants of Coxsackievirus B2 Ohio-1

PubMed Central

Sävneby, Anna; Luthman, Johannes; Nordenskjöld, Fabian; Andersson, Björn

2016-01-01

The transcriptomes of cells infected with lytic and non-lytic variants of coxsackievirus B2 Ohio-1 (CVB2O) were analyzed using next generation sequencing. This approach was selected with the purpose of elucidating the effects of lytic and non-lytic viruses on host cell transcription. Total RNA was extracted from infected cells and sequenced. The resulting reads were subsequently mapped against the human and CVB2O genomes. The amount of intracellular RNA was measured, indicating lower proportions of human RNA in the cells infected with the lytic virus compared to the non-lytic virus after 48 hours. This may be explained by reduced activity of the cellular transcription/translation machinery in lytic enteroviral replication due to activities of the enteroviral proteases 2A and/or 3C. Furthermore, differential expression in the cells infected with the two virus variants was identified and a number of transcripts were singled out as possible answers to the question of how the viruses interact with the host cells, resulting in lytic or non-lytic infections. PMID:27760161

Animal model of alcoholic pancreatitis: role of viral infections.

PubMed

Jerrells, Thomas R; Chapman, Nora; Clemens, Dahn L

2003-11-01

Pancreatitis is clearly associated with alcohol abuse, but only a relatively small percentage of people who abuse alcohol develops obvious pancreatitis. These observations have led to the concept that the development of alcoholic pancreatitis requires cofactors. Although diet and smoking have been studied, a clear cofactor has not been identified. The study results presented in this paper were obtained to determine whether viral infection of the pancreas would be a cofactor for alcoholic pancreatitis similar to the role of hepatitis virus infections in the development of alcoholic liver disease. To test this hypothesis, mice were fed ethanol with a liquid diet protocol and infected with coxsackievirus B3 (CVB3). It was found that consumption of alcohol alone did not result in pancreatitis as determined by serum levels of amylase or histologic changes in the pancreas. Two strains of CVB3 that are tropic for the pancreas were used; a virulent and an avirulent strain. Infection of alcohol-fed animals with the virulent CVB3 strain 28 resulted in a more severe pancreatitis than the pancreatitis noted in control animals. Alcohol-fed mice infected with the avirulent strain (GA) showed severe pancreatitis, whereas the infection of control mice did not result in obvious pathologic effects in the pancreas. This model allows mechanistic studies to define the role of viral infection as a cofactor for alcoholic pancreatitis.

Enhanced enteroviral infectivity via viral protease-mediated cleavage of Grb2-associated binder 1

PubMed Central

Deng, Haoyu; Fung, Gabriel; Shi, Junyan; Xu, Suowen; Wang, Chen; Yin, Meimei; Hou, Jun; Zhang, Jingchun; Jin, Zheng-Gen; Luo, Honglin

2015-01-01

Coxsackievirus B3 (CVB3), an important human causative pathogen for viral myocarditis, pancreatitis, and meningitis, has evolved different strategies to manipulate the host signaling machinery to ensure successful viral infection. We previously revealed a crucial role for the ERK1/2 signaling pathway in regulating viral infectivity. However, the detail mechanism remains largely unknown. Grb2-associated binder 1 (GAB1) is an important docking protein responsible for intracellular signaling assembly and transduction. In this study, we demonstrated that GAB1 was proteolytically cleaved after CVB3 infection at G175 and G436 by virus-encoded protease 2Apro, independent of caspase activation. Knockdown of GAB1 resulted in a significant reduction of viral protein expression and virus titers. Moreover, we showed that virus-induced cleavage of GAB1 is beneficial to viral growth as the N-terminal proteolytic product of GAB1 (GAB1-N1–174) further enhances ERK1/2 activation and promotes viral replication. Our results collectively suggest that CVB3 targets host GAB1 to generate a GAB1-N1–174 fragment that enhances viral infectivity, at least in part, via activation of the ERK pathway. The findings in this study suggest a novel mechanism that CVB3 employs to subvert the host signaling and facilitate consequent viral replication.—Deng, H., Fung, G., Shi, J., Xu, S., Wang, C., Yin, M., Hou, J., Zhang, J., Jin, Z.-G., Luo, H. Enhanced enteroviral infectivity via viral protease-mediated cleavage of Grb2-associated binder 1. PMID:26183772

Carvedilol has stronger anti-inflammation and anti-virus effects than metoprolol in murine model with coxsackievirus B3-induced viral myocarditis.

PubMed

Wang, Dan; Chen, Yiming; Jiang, Jianbin; Zhou, Aihua; Pan, Lulu; Chen, Qi; Qian, Yan; Chu, Maoping; Chen, Chao

2014-09-01

This study aims to compare the effects of carvedilol and metoprolol in alleviating viral myocarditis (VMC) induced by coxsackievirus B3 (CVB3) in mice. A total of 116 Balb/c mice were included in this study. Ninety-six mice were inoculated intraperitoneally with CVB3 to induce VMC. The CVB3 inoculated mice were evenly divided into myocarditis group (n=32), carvedilol group (n=32) and metoprolol group (n=32). Twenty mice (control group) were inoculated intraperitoneally with normal saline. Hematoxylin and eosin staining and histopathologic scoring were used to investigate the effects of carvedilol and metoprolol on myocardial histopathologic changes on days 3 and 5. In addition, serum cTn-I levels, cytokine levels and virus titers were determined using chemiluminescence immunoassay, enzyme-linked immunosorbent assay and plaque assay, respectively, on days 3 and 5. Finally, the levels of phosphorylated p38MAPK were studied using immunohistochemical staining and Western blotting on day 5. Carvedilol had a stronger effect than metoprolol in reducing the pathological scores of VMC induced by CVB3. Both carvedilol and metoprolol reduced the levels of cTn-I, but the effect of carvedilol was stronger. Carvedilol and metoprolol decreased the levels of myocardial pro-inflammatory cytokines and increased the expression of anti-inflammatory cytokine, with the effects of carvedilol being stronger than those of metoprolol. Carvedilol had a stronger effect in reducing myocardial virus concentration compared with metoprolol. Carvedilol was stronger than metoprolol in decreasing the levels of myocardial phosphorylated p38MAPK. In conclusion, carvedilol was more potent than metoprolol in ameliorating myocardial lesions in VMC, probably due to its stronger modulation of the balance between pro- and anti-inflammatory cytokines by inhibiting the activation of p38MAPK pathway through β1- and β2-adrenoreceptors. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of mutations on active site conformation and dynamics of RNA-dependent RNA polymerase from Coxsackievirus B3.

PubMed

Shen, Hujun; Deng, Mingsen; Zhang, Yachao

2017-10-01

Recent crystal structures of RNA-dependent RNA polymerase (3D pol ) from Coxsackievirus B3 (CVB3) revealed that a tyrosine mutation at Phe364 (F364Y) resulted in structures with open active site whereas a hydrophobic mutation at Phe364 (F364A) led to conformations with closed active site. Besides, the crystal structures showed that the F364W mutation had no preference between the open and closed active sites, similar to wild-type. In this paper, we present a molecular dynamics (MD) study on CVB3 3D pol in order to address some important questions raised by experiments. First, MD simulations of F364Y and F364A were carried out to explore how these mutations at Phe364 influence active site dynamics and conformations. Second, MD simulations of wild-type and mutants were performed to discover the connection between active site dynamics and polymerase function. MD simulations reveal that the effect of mutations on active site dynamics is associated with the interaction between the structural motifs A and D in CVB3 3D pol . Interestingly, we discover that the active site state is influenced by the formation of a hydrogen bond between backbone atoms of Ala231 (in motif A) and Ala358 (in motif D), which has never been revealed before. Copyright © 2017 Elsevier Inc. All rights reserved.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Protection Against Type 1 Diabetes Upon Coxsackievirus B4 Infection and iNKT-Cell Stimulation

PubMed Central

Ghazarian, Liana; Diana, Julien; Beaudoin, Lucie; Larsson, Pär G.; Puri, Raj K.; van Rooijen, Nico; Flodström-Tullberg, Malin; Lehuen, Agnès

2013-01-01

Invariant natural killer T (iNKT) cells belong to the innate immune system and exercise a dual role as potent regulators of autoimmunity and participate in responses against different pathogens. They have been shown to prevent type 1 diabetes development and to promote antiviral responses. Many studies in the implication of environmental factors on the etiology of type 1 diabetes have suggested a link between enteroviral infections and the development of this disease. This study of the pancreatropic enterovirus Coxsackievirus B4 (CVB4) shows that although infection accelerated type 1 diabetes development in a subset of proinsulin 2–deficient NOD mice, the activation of iNKT cells by a specific agonist, α-galactosylceramide, at the time of infection inhibited the disease. Diabetes development was associated with the infiltration of pancreatic islets by inflammatory macrophages, producing high levels of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α and activation of anti-islet T cells. On the contrary, macrophages infiltrating the islets after CVB4 infection and iNKT-cell stimulation expressed a number of suppressive enzymes, among which indoleamine 2,3-dioxygenase was sufficient to inhibit anti-islet T-cell response and to prevent diabetes. This study highlights the critical interaction between virus and the immune system in the acceleration or prevention of type 1 diabetes. PMID:23894189

Clinical characteristics and molecular epidemiology of Enterovirus infection in infants <3 months in a referral paediatric hospital of Barcelona.

PubMed

Rodà, Diana; Pérez-Martínez, Esther; Cabrerizo, María; Trallero, Gloria; Martínez-Planas, Aina; Luaces, Carles; García-García, Juan-José; Muñoz-Almagro, Carmen; Launes, Cristian

2015-11-01

Enterovirus (EV) infection is common in infants, but the information with regard to the molecular epidemiology and the associations between types and clinical variables is very scarce. This study includes 195 children <3 months old with fever, attended from March 2010 to December 2012 in an emergency department of a tertiary paediatric hospital in whom EV infection was confirmed by real-time PCR in blood and/or cerebrospinal fluid. Clinical and epidemiological data was prospectively collected. In 152 (77.9 %) patients, EVs could be typed. The most common type was Echovirus-5 (E5; 32, 21.1 %), followed by Echovirus-11 (E11; 18, 11.8 %), Echovirus-21 and Echovirus-25 (E21, E25; 11 each one, 7.2 %) and Coxsackievirus-B4 (CVB4; 6, 6.6 %). The majority of types appeared in spring, but E5 and E25 were found mainly during summer (p < 0.01). E21 was associated with high-grade fever (p < 0.01); E5 with exanthema (p = 0.03) and CVB4 tended to cause meningitis more often than the other types (p = 0.07). The most common EV types were Echovirus-5 and Echovirus-11. Some significant associations between types and epidemiologic and clinical findings were observed. What is Known-What is New • Enteroviruses cause a normally benign illness in young infants, except in some cases. • The molecular epidemiology of Enterovirus infection is not well known in European countries. • This study describes a large number of infants with Enterovirus infection and shows the seasonality of different types, and their associations with epidemiologic and clinical variables.

Pathogenesis of coxsackievirus B2 in mice: characterization of clinical isolates of the coxsackievirus B2 from patients with myocarditis and aseptic meningitis in Korea.

PubMed

Hong, Jiyoung; Kang, Bunghak; Yeo, Sanggu; Jee, Youngmee; Park, Jae-Hak

2017-12-31

Group B coxsackieviruses (CVBs) are a group of common human pathogens producing various clinical symptoms. Although the virology of CVB is well known, there is limited information on viral pathogenesis and the relationship between clinical symptoms and viral phenotype, particularly for CVB type 2 (CVB2). In 2004 in Korea, two CVB2 strains were isolated: CB2/04/279 from stool of an acute myocarditis patient with heart failure and CB2/04/243 from an aseptic meningitis patient. In this study, a high degree of homology was observed between the CB2/04/279 and CB2/04/243 full genome sequences. The two Korean CVB2 isolates had 93.1% homology compared to 82.1%-82.5% nucleotide sequence identity with the cardiovirulence-associated reference CVB strain Ohio-1 (CVB/O). CVB2-induced pathogenesis was analyzed, focusing on virus-induced pathology of various tissues in 4-week-old BALB/c inbred male mice. Myocarditis developed and extensive pancreatic inflammation was observed in all mice infected with CB2/04/279 or CVB/O, but not in animals infected with CB2/04/243. This is the first report of the full-genomic sequence and pathogenesis of the CVB2 strain isolated from an acute myocarditis patient in Korea.

Human Gut-On-A-Chip Supports Polarized Infection of Coxsackie B1 Virus In Vitro

PubMed Central

Papafragkou, Efstathia; Weaver, James C.; Ferrante, Thomas C.; Bahinski, Anthony; Elkins, Christopher A.; Kulka, Michael; Ingber, Donald E.

2017-01-01

Analysis of enterovirus infection is difficult in animals because they express different virus receptors than humans, and static cell culture systems do not reproduce the physical complexity of the human intestinal epithelium. Here, using coxsackievirus B1 (CVB1) as a prototype enterovirus strain, we demonstrate that human enterovirus infection, replication and infectious virus production can be analyzed in vitro in a human Gut-on-a-Chip microfluidic device that supports culture of highly differentiated human villus intestinal epithelium under conditions of fluid flow and peristalsis-like motions. When CVB1 was introduced into the epithelium-lined intestinal lumen of the device, virions entered the epithelium, replicated inside the cells producing detectable cytopathic effects (CPEs), and both infectious virions and inflammatory cytokines were released in a polarized manner from the cell apex, as they could be detected in the effluent from the epithelial microchannel. When the virus was introduced via a basal route of infection (by inoculating virus into fluid flowing through a parallel lower ‘vascular’ channel separated from the epithelial channel by a porous membrane), significantly lower viral titers, decreased CPEs, and delayed caspase-3 activation were observed; however, cytokines continued to be secreted apically. The presence of continuous fluid flow through the epithelial lumen also resulted in production of a gradient of CPEs consistent with the flow direction. Thus, the human Gut-on-a-Chip may provide a suitable in vitro model for enteric virus infection and for investigating mechanisms of enterovirus pathogenesis. PMID:28146569

Emodin inhibits coxsackievirus B3 replication via multiple signalling cascades leading to suppression of translation.

PubMed

Zhang, Huifang M; Wang, Fengping; Qiu, Ye; Ye, Xin; Hanson, Paul; Shen, Hongxing; Yang, Decheng

2016-02-15

CVB3 (coxsackievirus 3) is a primary causal agent of viral myocarditis. Emodin is a natural compound isolated from certain plant roots. In the present study, we found that emodin inhibited CVB3 replication in vitro and in mice, and now we report an unrecognized mechanism by which emodin inhibits CVB3 replication through suppression of viral protein translation via multiple pathways. On one hand, emodin treatment inhibited Akt/mTOR (mammalian target of rapamycin) signalling and activated 4EBP1 (eukaryotic initiation factor 4R-binding protein 1), leading to suppression of translation initiation of ribosomal protein L32 encoded by a 5'-TOP (terminal oligopyrimidine) mRNA. On the other hand, emodin treatment differentially regulated multiple signal cascades, including Akt/mTORC1/p70(S6K) (p70 S6 kinase), ERK1/2 (extracellular-signal-regulated kinase 1/2)/p90(RSK) (p90 ribosomal S6 kinase) and Ca(2+)/calmodulin, leading to activation of eEF2K (eukaryotic elongation factor 2 kinase) and subsequent inactivation of eEF2 (eukaryotic elongation factor 2), resulting in inhibition of CVB3 VP1 (viral protein 1) synthesis. These data imply that eEF2K is a major factor mediating cross-talk of different arms of signalling cascades in this signal network. This notion was verified by either overexpressing eEF2K or treating the cells with siRNAs or eEF2K inhibitor A484954. We showed further that the emodin-induced decrease in p70(S6K) phosphorylation plays a dominant positive role in activation of eEF2K and in turn in conferring the antiviral effect of emodin. This finding was further solidified by expressing constitutively active and dominant-negative Akt. Collectively, our data reveal that emodin inhibits viral replication through impairing translational machinery and suppression of viral translation elongation. © 2016 Authors; published by Portland Press Limited.

Genotyping of enteroviruses isolated in Kenya from pediatric patients using partial VP1 region.

PubMed

Opanda, Silvanos M; Wamunyokoli, Fred; Khamadi, Samoel; Coldren, Rodney; Bulimo, Wallace D

2016-01-01

Enteroviruses (EV) are responsible for a wide range of clinical diseases in humans. Though studied broadly in several regions of the world, the genetic diversity of human enteroviruses (HEV) circulating in the sub-Saharan Africa remains under-documented. In the current study, we molecularly typed 61 HEV strains isolated in Kenya between 2008 and 2011 targeting the 3'-end of the VP1 gene. Viral RNA was extracted from the archived isolates and part of the VP1 gene amplified by RT-PCR, followed by sequence analysis. Twenty-two different EV types were detected. Majority (72.0 %) of these belonged to Enterovirus B species followed by Enterovirus D (21.3 %) and Enterovirus A (6.5 %). The most frequently detected types were Enterovirus-D68 (EV-D68), followed by Coxsackievirus B2 (CV-B2), CV-B1, CV-B4 and CV-B3. Phylogenetic analyses of these viruses revealed that Kenyan CV-B1 isolates were segregated among sequences of global CV-B1 strains. Conversely, the Kenyan CV-B2, CV-B3, CV-B4 and EV-D68 strains generally grouped together with those detected from other countries. Notably, the Kenyan EV-D68 strains largely clustered with sequences of global strains obtained between 2008 and 2010 than those circulating in recent years. Overall, our results indicate that HEV strains belonging to Enterovirus D and Enterovirus B species pre-dominantly circulated and played a significant role in pediatric respiratory infection in Kenya, during the study period. The Kenyan CV-B1 strains were genetically divergent from those circulating in other countries. Phylogenetic clustering of Kenyan EV-D68 strains with sequences of global strains circulating between 2008 and 2010 than those obtained in recent years suggests a high genomic variability associated with the surface protein encoding VP1 gene in these enteroviruses.

Comparative RNAi screening reveals host factors involved in enterovirus infection of polarized endothelial monolayers.

PubMed

Coyne, Carolyn B; Bozym, Rebecca; Morosky, Stefanie A; Hanna, Sheri L; Mukherjee, Amitava; Tudor, Matthew; Kim, Kwang Sik; Cherry, Sara

2011-01-20

Enteroviruses, including coxsackievirus B (CVB) and poliovirus (PV), can access the CNS through the blood brain barrier (BBB) endothelium to cause aseptic meningitis. To identify cellular components required for CVB and PV infection of human brain microvascular endothelial cells, an in vitro BBB model, we performed comparative RNAi screens and identified 117 genes that influenced infection. Whereas a large proportion of genes whose depletion enhanced infection (17 of 22) were broadly antienteroviral, only 46 of the 95 genes whose depletion inhibited infection were required by both CVB and PV and included components of cell signaling pathways such as adenylate cyclases. Downregulation of genes including Rab GTPases, Src tyrosine kinases, and tyrosine phosphatases displayed specificity in their requirement for either CVB or PV infection. These findings highlight the pathways hijacked by enteroviruses for entry and replication in the BBB endothelium, a specialized and clinically relevant cell type for these viruses. Copyright © 2011 Elsevier Inc. All rights reserved.

Molecular epidemiology of enterovirus and parechovirus infections according to patient age over a 4-year period in Spain.

PubMed

Cabrerizo, María; Díaz-Cerio, María; Muñoz-Almagro, Carmen; Rabella, Núria; Tarragó, David; Romero, María Pilar; Pena, María José; Calvo, Cristina; Rey-Cao, Sonia; Moreno-Docón, Antonio; Martínez-Rienda, Inés; Otero, Almudena; Trallero, Gloria

2017-03-01

The epidemiology and clinical association of enterovirus (EV) and parechovirus (HPeV) infections, as well as the type-distribution-according-to-age, were determined during a 4-year study period in Spain. During 2010-2013, a total of 21,832 clinical samples were screened for EV and the detection frequency was 6.5% (1,430). Of the total EV-negative samples, only 1,873 samples from 2011 to 2013 were available for HPeV testing. HPeV was detected in 42 (2%) of them. Positive samples were genotyped using PCR and sequencing. EV infections occurred in all age groups of patients: neonates (17%), children 28 days to 2 years (29%), children 2-14 years (40%), and adults (14%). Thirty-four different EV types were identified. HPeV infections were detected exclusively in infants <8 m (70% neonates, P < 0.05). All but one HPeV were HPeV-3. Differences in type frequency detection were found according to age and clinical manifestation. Coxsackievirus (CV)-B4 (61%), CV-B5 (83%), and HPeV-3 (64%) were more frequent in neonates than in older patients (P < 0.05). Echovirus (E)-3 (60%), E-18 (47%), E-25 (62%), CV-A6 (61%), CV-A16 (72%), and EV-71 (75%) were mainly detected in children 28 days to 2 years (P < 0.05), whereas, E-6 (79%), E-20 (88%), and E-30 (85%) were predominant in children >2 years and adults (P < 0.05). Clinically, meningitis was associated with EV (P < 0.01) whereas, encephalitis was more frequent in HPeV-infected patients. CV-B types were associated with myocarditis (90%; P < 0.05) and EV species A with hand-foot-mouth-disease/atypical exanthema (88%; P < 0.05). J. Med. Virol. 89:435-442, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Identification of quinone analogues as potential inhibitors of picornavirus 3C protease in vitro.

PubMed

Jung, Eunhye; Lee, Joo-Youn; Kim, Ho Jeong; Ryu, Chung-Kyu; Lee, Kee-In; Kim, Meehyein; Lee, Chong-Kyo; Go, Yun Young

2018-05-29

Picornaviruses are non-enveloped viruses that represent a large family of positive-sense single-stranded RNA viruses including a number of causative agents of many human and animal diseases such as coxsackievirus B3 (CVB3) and rhinoviruses (HRV). In this study, we performed a high-throughput screening of a compound library composed of ∼6000 small molecules in search of potential picornavirus 3C protease (3C pro ) inhibitors. As results, we identified quinone analogues that effectively inhibited both CVB3 3C pro and HRV 3C pro with IC 50 values in low micromolar range. Together with predicted binding modes of these compounds to the active site of the viral protease, it is implied that structural features of these non-peptidic inhibitors may act as useful scaffold for further anti-picornavirus drug design and development. Copyright © 2018 Elsevier Ltd. All rights reserved.

IFITM3 Restricts Human Metapneumovirus Infection.

PubMed

McMichael, Temet M; Zhang, Yu; Kenney, Adam D; Zhang, Lizhi; Zani, Ashley; Lu, Mijia; Chemudupati, Mahesh; Li, Jianrong; Yount, Jacob S

2018-06-15

Human metapneumovirus (hMPV) utilizes a bifurcated cellular entry strategy, fusing either with the plasma membrane or, after endocytosis, with the endosome membrane. Whether cellular factors restrict or enhance either entry pathway is largely unknown. We found that the interferon-induced transmembrane protein 3 (IFITM3) inhibits hMPV infection to an extent similar to endocytosis-inhibiting drugs, and an IFITM3 variant that accumulates at the plasma membrane in addition to its endosome localization provided increased virus restriction. Mechanistically, IFITM3 blocks hMPV F protein-mediated membrane fusion, and inhibition of infection was reversed by the membrane destabilizing drug amphotericin B. Conversely, we found that infection by some hMPV strains is enhanced by the endosomal protein Toll-like receptor 7 (TLR7), and that IFITM3 retains the ability to restrict hMPV infection even in cells expressing TLR7. Overall, our results identify IFITM3 as an endosomal restriction factor that limits hMPV infection of cells.

Reversible phospho-Smad3 signalling between tumour suppression and fibrocarcinogenesis in chronic hepatitis B infection.

PubMed

Deng, Y-R; Yoshida, K; Jin, Q L; Murata, M; Yamaguchi, T; Tsuneyama, K; Moritoki, Y; Niu, J Q; Matsuzaki, K; Lian, Z-X

2014-04-01

Transforming growth factor (TGF)-β, type I receptor (TβRI) and c-Jun N-terminal kinases (JNK) phosphorylate Smad3 differentially to create 2 isoforms phosphorylated (p) at the COOH-terminus (C) or at the linker region (L) and regulate hepatocytic fibrocarcinogenesis. This study aimed to compare the differences between how hepatitis B virus (HBV) infection affected hepatocytic Smad3 phosphorylated isoforms before and after anti-viral therapy. To clarify the relationship between Smad3 phosphorylation and liver disease progression, we studied 10 random patients in each stage of HBV-related fibrotic liver disease (F1-4) and also 10 patients with HBV-associated HCC. To examine changes in phosphorylated Smad3 signalling before and after anti-HBV therapies, we chose 27 patients with chronic hepatitis B who underwent baseline and follow-up biopsies at 52 weeks from the start of nucleoside analogue treatments (Lamivudine 100 mg daily or Telbivudine 600 mg daily). Fibrosis stage, inflammatory activity and phosphorylated Smad3 positivity in the paired biopsy samples were compared. Hepatocytic pSmad3C signalling shifted to fibrocarcinogenic pSmad3L signalling as the livers progressed from chronic hepatitis B infection to HCC. After nucleoside analogue treatment, serum alanine aminotransferase (ALT) and HBV-DNA levels in 27 patients with HBV-related chronic liver diseases were decreased dramatically. Decrease in HBV-DNA restored pSmad3C signalling in hepatocytes, while eliminating prior fibrocarcinogenic pSmad3L signalling. Oral nucleoside analogue therapies can suppress fibrosis and reduce HCC incidence by successfully reversing phosphorylated Smad3 signalling; even liver disease progressed to cirrhosis in chronic hepatitis B patients. © 2013 British Society for Immunology.

Anti-Factor B and Anti-C3b Autoantibodies in C3 Glomerulopathy and Ig-Associated Membranoproliferative GN

PubMed Central

Marinozzi, Maria Chiara; Roumenina, Lubka T.; Chauvet, Sophie; Hertig, Alexandre; Bertrand, Dominique; Olagne, Jérome; Frimat, Marie; Ulinski, Tim; Deschênes, Georges; Burtey, Stephane; Delahousse, Michel; Moulin, Bruno; Legendre, Christophe

2017-01-01

In C3 glomerulopathy (C3G), the alternative pathway of complement is frequently overactivated by autoantibodies that stabilize the C3 convertase C3bBb. Anti-C3b and anti-factor B (anti-FB) IgG have been reported in three patients with C3G. We screened a cohort of 141 patients with C3G and Ig-associated membranoproliferative GN (Ig-MPGN) for anti-FB and anti-C3b autoantibodies using ELISA. We identified seven patients with anti-FB IgG, three patients with anti-C3b IgG, and five patients with anti-FB and anti-C3b IgG. Of these 15 patients, ten were diagnosed with Ig-MPGN. Among those patients with available data, 92% had a nephrotic syndrome, 64% had AKI, and 67% had a documented infection. Patients negative for anti-C3b and anti-FB IgG had much lower rates of infection (17 [25%] patients with C3G and one [10%] patient with Ig-MPGN). After 48 months, four of 15 (26%) positive patients had developed ESRD or died. All 15 patients had high plasma Bb levels, six (40%) patients had low levels of C3, and nine (60%) patients had high levels of soluble C5b9. In vitro, IgG purified from patients with anti-FB Abs selectively enhanced C3 convertase activity; IgG from patients with anti-C3b/anti-FB Abs enhanced C3 and C5 cleavage. IgG from patients with anti-C3b Abs stabilized C3bBb and perturbed C3b binding to complement receptor 1 but did not perturb binding to factor H. In conclusion, the prevalence of anti-C3b/anti-FB Abs and alternative pathway activation is similar in Ig-MPGN and C3G, suggesting similar pathogenic mechanisms. Identification of the underlying defect in Ig-MPGN could lead to improved treatment. PMID:28096309

Effect of consecutive alternating administration (CAA) of a triple anti-enteroviral combination on Coxsackievirus B1 neuroinfection in mice.

PubMed

Stoyanova, Adelina; Nikolova, Ivanka; Galabov, Angel S

2015-09-01

Currently, clinically effective antivirals for use in the treatment of enteroviral (EV) infections do not exist. The main reason is the development of drug resistance, the principle obstacle in the development of EV infection chemotherapy, based til now on monotherapy. The most important achievement of our previous studies was the development of a novel scheme for in vivo application of a triple combination of EV inhibitors with different modes of action against Coxsackievirus B (CVB) infections in mice. It consists of consecutive alternating administration (CAA) of the substances in the combination. Here, we tested the effect of the triple combination pleconaril, guanidine-HCl, and oxoglaucine (PGO) via CAA in newborn mice infected with a neurotropic strain of CVB1 (20 LD50 per mouse). This combination manifested a considerable protective effect with pleconaril doses of 25-200mg/kg: it decreased mortality rate (protection index, PI, between 31.3% and 67.7%) and increased mean survival time (MST) by 4-6days. Pleconaril monotherapy demonstrated activity similar to that of PGO via CAA, as measured by PI values, but MST values were slightly lower. However, it also greatly suppressed growth of infected suckling mice, especially at 200mg/kg. This toxic effect was avoided with CAA of PGO at pleconaril doses of 25-100mg/kg. Pleconaril monotherapy administered every 3days was ineffective. The PGO with CAA treatment course decreased infectious virus content, whereas pleconaril monotherapy did not. Analysis of drug-sensitivity in brain samples from CVB1 infected mice, based on IC50 (50% inhibitory concentration) values from cell culture experiments, showed that the CAA course counteracted the development of drug resistance to pleconaril and oxoglaucine in the triple PGO combination and increased drug sensitivity. In contrast, pleconaril and oxoglaucine monotherapies resulted in drug resistance. This data clearly proves the effectiveness of the proposed novel approach-the CAA

Characterization of the non-polio enterovirus infections associated with acute flaccid paralysis in South-Western India.

PubMed

Laxmivandana, Rongala; Yergolkar, Prasanna; Gopalkrishna, Varanasi; Chitambar, Shobha D

2013-01-01

Non-polio enteroviruses (NPEVs) have been reported frequently in association with acute flaccid paralysis (AFP) cases during Polio Surveillance Programs (PSPs) worldwide. However, there is limited understanding on the attributes of their infections. This study reports characteristics of NPEVs isolated from AFP cases, investigated during PSPs held in 2009-2010, in Karnataka and Kerala states of south-western India having varied climatic conditions. NPEV cell culture isolates derived from stool specimens that were collected from 422 of 2186 AFP cases (<1-14 years age) and 17 of 41 asymptomatic contacts; and details of all AFP cases/contacts were obtained from National Polio Laboratory, Bangalore. The distribution of NPEV infections among AFP cases and circulation pattern of NPEV strains were determined by statistical analysis of the data. Genotyping of all NPEV isolates was carried out by partial VP1 gene sequencing and phylogenetic analysis. NPEV positive AFP cases were significantly higher in children aged <2 years; with residual paralysis; in summer months; and in regions with relatively hot climate. Genotyping of NPEVs identified predominance of human enteroviruses (HEV)-B species [81.9%-Echoviruses (E): 57.3%; coxsackieviruses (CV) B: 15%; numbered EVs: 8.9%; CVA9: 0.7%] and low levels of HEV-A [14.5%-CVA: 6%; numbered EVs: 8.5%] and HEV-C [3.6%-CVA: 2.6%; numbered EVs: 1%] species, encompassing 63 genotypes. EV76 (6.3%) and each of E3, CVB3 and E9 (4.97%) were found frequently during 2009 while E11 (6.7%), CVB1 (6.1%), E7 (5.1%) and E20 (5.1%) were detected commonly in 2010. A marked proportion of AFP cases from children aged <2 years; presenting with fever; and from north and south interior parts of Karnataka state was detected with E/numbered EVs than that found with CVA/CVB. This study highlights the extensive genetic diversity and diverse circulation patterns of NPEV strains in AFP cases from different populations and climatic conditions.

Halofuginone alleviates acute viral myocarditis in suckling BALB/c mice by inhibiting TGF-β1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Xiao-Hua; Fu, Jia; Sun, Da-Qing, E-mail: daqingsuncd@163.com

2016-04-29

Viral myocarditis (VMC) is an inflammation of heart muscle in infants and young adolescents. This study explored the function of halofuginone (HF) in Coxsackievirus B3 (CVB3) -treated suckling mice. HF-treated animal exhibited higher survival rate, lower heart/body weight, and more decreased blood sugar concentration than CVB3 group. HF also reduced the expressions of interleukin(IL)-17 and IL-23 and the numbers of Th17 cells. Moreover, HF downregulated pro-inflammatory cytokine levels and increased anti-inflammatory cytokine levels. The expressions of transforming growth factor(TGF-β1) and nuclear factor kappa-light-chain-enhancer of activated B (NF-κB) p65/ tumor necrosis factor-α (TNF-α) proteins were decreased by HF as well. Finally,more » the overexpression of TGF-β1 counteracted the protection effect of HF in CVB3-treated suckling mice. In summary, our study suggests HF increases the survival of CVB3 suckling mice, reduces the Th17 cells and pro-inflammatory cytokine levels, and may through downregulation of the TGF-β1-mediated expression of NF-κB p65/TNF-α pathway proteins. These results offer a potential therapeutic strategy for the treatment of VMC. - Highlights: • Halofuginone (HF) increases the survival of suckling BALB/c mice infected with acute CVB3. • HF reduces the expression of Th17 cell markers (IL-17 and IL-23) and the number of CD4{sup +} IL17{sup +} cells. • Pro-inflammatory cytokines levels associated with myocarditis were reduced by HF in CVB3-treated suckling mice. • HF alleviates VMC via inhibition of TGF-β1-mediated NF-κB p65/TNF-α pathway.« less

Dusp3 and Psme3 Are Associated with Murine Susceptibility to Staphylococcus aureus Infection and Human Sepsis

PubMed Central

Yan, Qin; Sharma-Kuinkel, Batu K.; Deshmukh, Hitesh; Tsalik, Ephraim L.; Cyr, Derek D.; Lucas, Joseph; Woods, Christopher W.; Scott, William K.; Sempowski, Gregory D.; Thaden, Joshua; Rude, Thomas H.; Ahn, Sun Hee; Fowler, Vance G.

2014-01-01

Using A/J mice, which are susceptible to Staphylococcus aureus, we sought to identify genetic determinants of susceptibility to S. aureus, and evaluate their function with regard to S. aureus infection. One QTL region on chromosome 11 containing 422 genes was found to be significantly associated with susceptibility to S. aureus infection. Of these 422 genes, whole genome transcription profiling identified five genes (Dcaf7, Dusp3, Fam134c, Psme3, and Slc4a1) that were significantly differentially expressed in a) S. aureus –infected susceptible (A/J) vs. resistant (C57BL/6J) mice and b) humans with S. aureus blood stream infection vs. healthy subjects. Three of these genes (Dcaf7, Dusp3, and Psme3) were down-regulated in susceptible vs. resistant mice at both pre- and post-infection time points by qPCR. siRNA-mediated knockdown of Dusp3 and Psme3 induced significant increases of cytokine production in S. aureus-challenged RAW264.7 macrophages and bone marrow derived macrophages (BMDMs) through enhancing NF-κB signaling activity. Similar increases in cytokine production and NF-κB activity were also seen in BMDMs from CSS11 (C57BL/6J background with chromosome 11 from A/J), but not C57BL/6J. These findings suggest that Dusp3 and Psme3 contribute to S. aureus infection susceptibility in A/J mice and play a role in human S. aureus infection. PMID:24901344

The Correlation Between Interferon Lambda 3 Gene Polymorphisms and Susceptibility to Hepatitis B Virus Infection

PubMed Central

Heidari, Zahra; Moudi, Bita; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad

2016-01-01

Background Cytokines are proteins that mediate innate and adaptive immunity responses. It is hypothesized that interferon lambda 3 (IFNL3) levels can influence the outcome of chronic hepatitis B virus (HBV) infection. Polymorphisms in IFN genes have been associated with response to infection. Objectives This study was carried-out to investigate the association of IFNL3 gene polymorphisms (rs12979860 and rs8099917) with HBV susceptibility, in chronic HBV-infected patients. Patients and Methods In this case-control study, we determined IFNL3 single nucleotide polymorphisms (SNPs) (rs12979860 and rs8099917) in 221 individuals, with chronic HBV infection, and 200 healthy individuals, who were voluntary blood donors, with negative test for HBV. Alleles and genotypes analyses were performed by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods. Results The frequencies of the rs12979860 and rs8099917 genotypes were not significantly different between the HBV-infected and the control groups (CC:CT:TT of 30.3%:48.0%:21.7% vs. 33.0%:49.0%:18.0%, P > 0.05, and GG:GT:TT of 5.8%:39.4%:54.8% vs. 5.0%:41.0%:54.0%, P > 0.05, respectively). Also, the frequencies of the alleles were not significantly different between both groups (C:T of 54.3%:45.7% vs. 57.5%:42.5%, P > 0.05, and G:T of 25.6%:74.4% vs. 25.5%:74.5%, P > 0.05, respectively) and the chronic HBV infection. There were no significant differences between patients, with at least one rs12979860C and or rs8099917T alleles compared to the healthy controls (rs12979860: CT + CC:TT, OR = 1.26, 95%CI = 0.78 - 2.04, P = 0.341 and rs8099917: GT + TT:GG, OR = 1.03, 95%CI = 0.70 - 1.51, P = 0.877, respectively). Conclusions Our study showed no correlation between rs12979860 and rs8099917 SNPs and chronic HBV infection. Further studies, with larger sample sizes and different ethnicities, are necessary to validate our

CVB: the Constrained Vapor Bubble Capillary Experiment on the International Space Station MARANGONI FLOW REGION

NASA Technical Reports Server (NTRS)

Wayner, Peter C., Jr.; Kundan, Akshay; Plawsky, Joel

2014-01-01

The Constrained Vapor Bubble (CVB) is a wickless, grooved heat pipe and we report on a full- scale fluids experiment flown on the International Space Station (ISS). The CVB system consists of a relatively simple setup a quartz cuvette with sharp corners partially filled with either pentane or an ideal mixture of pentane and isohexane as the working fluids. Along with temperature and pressure measurements, the two-dimensional thickness profile of the menisci formed at the corners of the quartz cuvette was determined using the Light Microscopy Module (LMM). Even with the large, millimeter dimensions of the CVB, interfacial forces dominate in these exceedingly small Bond Number systems. The experiments were carried out at various power inputs. Although conceptually simple, the transport processes were found to be very complex with many different regions. At the heated end of the CVB, due to a high temperature gradient, we observed Marangoni flow at some power inputs. This region from the heated end to the central drop region is defined as a Marangoni dominated region. We present a simple analysis based on interfacial phenomena using only measurements from the ISS experiments that lead to a predictive equation for the thickness of the film near the heated end of the CVB. The average pressure gradient for flow in the film is assumed due to the measured capillary pressure at the two ends of the liquid film and that the pressure stress gradient due to cohesion self adjusts to a constant value over a distance L. The boundary conditions are the no slip condition at the wall interface and an interfacial shear stress at the liquid- vapor interface due to the Marangoni stress, which is due to the high temperature gradient. Although the heated end is extremely complex, since it includes three- dimensional variations in radiation, conduction, evaporation, condensation, fluid flow and interfacial forces, we find that using the above simplifying assumptions, a simple successful

Viral reprogramming of the Daxx histone H3.3 chaperone during early Epstein-Barr virus infection.

PubMed

Tsai, Kevin; Chan, Lilian; Gibeault, Rebecca; Conn, Kristen; Dheekollu, Jayaraju; Domsic, John; Marmorstein, Ronen; Schang, Luis M; Lieberman, Paul M

2014-12-01

Host chromatin assembly can function as a barrier to viral infection. Epstein-Barr virus (EBV) establishes latent infection as chromatin-assembled episomes in which all but a few viral genes are transcriptionally silent. The factors that control chromatin assembly and guide transcription regulation during the establishment of latency are not well understood. Here, we demonstrate that the EBV tegument protein BNRF1 binds the histone H3.3 chaperone Daxx to modulate histone mobility and chromatin assembly on the EBV genome during the early stages of primary infection. We demonstrate that BNRF1 substitutes for the repressive cochaperone ATRX to form a ternary complex of BNRF1-Daxx-H3.3-H4, using coimmunoprecipitation and size-exclusion chromatography with highly purified components. FRAP (fluorescence recovery after photobleaching) assays were used to demonstrate that BNRF1 promotes global mobilization of cellular histone H3.3. Mutation of putative nucleotide binding motifs on BNRF1 attenuates the displacement of ATRX from Daxx. We also show by immunofluorescence combined with fluorescence in situ hybridization that BNRF1 is important for the dissociation of ATRX and Daxx from nuclear bodies during de novo infection of primary B lymphocytes. Virion-delivered BNRF1 suppresses Daxx-ATRX-mediated H3.3 loading on viral chromatin as measured by chromatin immunoprecipitation assays and enhances viral gene expression during early infection. We propose that EBV tegument protein BNRF1 replaces ATRX to reprogram Daxx-mediated H3.3 loading, in turn generating chromatin suitable for latent gene expression. Epstein-Barr Virus (EBV) is a human herpesvirus that efficiently establishes latent infection in primary B lymphocytes. Cellular chromatin assembly plays an important role in regulating the establishment of EBV latency. We show that the EBV tegument protein BNRF1 functions to regulate chromatin assembly on the viral genome during early infection. BNRF1 alters the host cellular

Antiviral activities of extracts and selected pure constituents of Ocimum basilicum.

PubMed

Chiang, Lien-Chai; Ng, Lean-Teik; Cheng, Pei-Win; Chiang, Win; Lin, Chun-Ching

2005-10-01

1. Ocimum basilicum (OB), also known as sweet basil, is a well known medicinal herb in traditional Chinese medicine preparations. In the present study, extracts and purified components of OB were used to identify possible antiviral activities against DNA viruses (herpes viruses (HSV), adenoviruses (ADV) and hepatitis B virus) and RNA viruses (coxsackievirus B1 (CVB1) and enterovirus 71 (EV71)). 2. The results show that crude aqueous and ethanolic extracts of OB and selected purified components, namely apigenin, linalool and ursolic acid, exhibit a broad spectrum of antiviral activity. Of these compounds, ursolic acid showed the strongest activity against HSV-1 (EC50 = 6.6 mg/L; selectivity index (SI) = 15.2), ADV-8 (EC50 = 4.2 mg/L; SI = 23.8), CVB1 (EC50 = 0.4 mg/L; SI = 251.3) and EV71 (EC50 = 0.5 mg/L; SI = 201), whereas apigenin showed the highest activity against HSV-2 (EC50 = 9.7 mg/L; SI = 6.2), ADV-3 (EC50 = 11.1 mg/L; SI = 5.4), hepatitis B surface antigen (EC50 = 7.1 mg/L; SI = 2.3) and hepatitis B e antigen (EC50 = 12.8 mg/L; SI = 1.3) and linalool showed strongest activity against AVD-II (EC50 = 16.9 mg/L; SI = 10.5). 3. No activity was noted for carvone, cineole, beta-caryophyllene, farnesol, fenchone, geraniol, beta-myrcene and alpha-thujone. 4. The action of ursolic acid against CVB1 and EV71 was found to occur during the infection process and the replication phase. 5. With SI values greater than 200, the potential use of ursolic acid for treating infection with CVB1 and EV71 merits further investigation.

BPIFB6 Regulates Secretory Pathway Trafficking and Enterovirus Replication

PubMed Central

Morosky, Stefanie; Lennemann, Nicholas J.

2016-01-01

ABSTRACT Bactericidal/permeability-increasing protein (BPI) fold-containing family B, member 3 (BPIFB3) is an endoplasmic reticulum (ER)-localized host factor that negatively regulates coxsackievirus B (CVB) replication through its control of the autophagic pathway. Here, we show that another member of the BPIFB family, BPIFB6, functions as a positive regulator of CVB, and other enterovirus, replication by controlling secretory pathway trafficking and Golgi complex morphology. We show that similar to BPIFB3, BPIFB6 localizes exclusively to the ER, where it associates with other members of the BPIFB family. However, in contrast to our findings that RNA interference (RNAi)-mediated silencing of BPIFB3 greatly enhances CVB replication, we show that silencing of BPIFB6 expression dramatically suppresses enterovirus replication in a pan-viral manner. Mechanistically, we show that loss of BPIFB6 expression induces pronounced alterations in retrograde and anterograde trafficking, which correlate with dramatic fragmentation of the Golgi complex. Taken together, these data implicate BPIFB6 as a key regulator of secretory pathway trafficking and viral replication and suggest that members of the BPIFB family participate in diverse host cell functions to regulate virus infections. IMPORTANCE Enterovirus infections are associated with a number of severe pathologies, such as aseptic meningitis, dilated cardiomyopathy, type I diabetes, paralysis, and even death. These viruses, which include coxsackievirus B (CVB), poliovirus (PV), and enterovirus 71 (EV71), co-opt the host cell secretory pathway, which controls the transport of proteins from the endoplasmic reticulum to the Golgi complex, to facilitate their replication. Here we report on the identification of a novel regulator of the secretory pathway, bactericidal/permeability-increasing protein (BPI) fold-containing family B, member 6 (BPIFB6), whose expression is required for enterovirus replication. We show that loss of

BPIFB6 Regulates Secretory Pathway Trafficking and Enterovirus Replication.

PubMed

Morosky, Stefanie; Lennemann, Nicholas J; Coyne, Carolyn B

2016-05-15

Bactericidal/permeability-increasing protein (BPI) fold-containing family B, member 3 (BPIFB3) is an endoplasmic reticulum (ER)-localized host factor that negatively regulates coxsackievirus B (CVB) replication through its control of the autophagic pathway. Here, we show that another member of the BPIFB family, BPIFB6, functions as a positive regulator of CVB, and other enterovirus, replication by controlling secretory pathway trafficking and Golgi complex morphology. We show that similar to BPIFB3, BPIFB6 localizes exclusively to the ER, where it associates with other members of the BPIFB family. However, in contrast to our findings that RNA interference (RNAi)-mediated silencing of BPIFB3 greatly enhances CVB replication, we show that silencing of BPIFB6 expression dramatically suppresses enterovirus replication in a pan-viral manner. Mechanistically, we show that loss of BPIFB6 expression induces pronounced alterations in retrograde and anterograde trafficking, which correlate with dramatic fragmentation of the Golgi complex. Taken together, these data implicate BPIFB6 as a key regulator of secretory pathway trafficking and viral replication and suggest that members of the BPIFB family participate in diverse host cell functions to regulate virus infections. Enterovirus infections are associated with a number of severe pathologies, such as aseptic meningitis, dilated cardiomyopathy, type I diabetes, paralysis, and even death. These viruses, which include coxsackievirus B (CVB), poliovirus (PV), and enterovirus 71 (EV71), co-opt the host cell secretory pathway, which controls the transport of proteins from the endoplasmic reticulum to the Golgi complex, to facilitate their replication. Here we report on the identification of a novel regulator of the secretory pathway, bactericidal/permeability-increasing protein (BPI) fold-containing family B, member 6 (BPIFB6), whose expression is required for enterovirus replication. We show that loss of BPIFB6 expression

Isolation of equine herpesvirus 3 (EHV-3) from equine coital exanthema of two stallions and sero-epidemiology of EHV-3 infection in Japan

PubMed Central

KIRISAWA, Rikio; TOISHI, Yuko; AKAMATSU, Ai; SOEJIMA, Kosuke; MIYASHITA, Taisuke; TSUNODA, Nobuo

2017-01-01

In the spring of 2015, two stallions reared in Farms A and B in Hokkaido in Japan showed symptoms of equine coital exanthema. Equine herpesvirus 3 (EHV-3) was isolated from penis swab samples of both stallions, and the isolates from each stallion in Farms A and B were designated as SS-1 and YS-1 strains, respectively. BamHI restriction profiles of SS-1 and Japanese reference strain Iwate-1 were indistinguishable, but the BamHI-A fragment of YS-1 was larger than those of SS-1 and Iwate-1 by 1.9 kbp because of the lack of two BamHI sites. Nucleotide sequence analyses of glycoprotein G (gG), gB, gC and VP13/14 coding regions revealed that SS-1 and YS-1 had 99.77% to 100% identities to each other. These results suggested that the origins of SS-1 and YS-1 were different. For a sero-epidemiological survey, serum neutralizing tests using SS-1 against 319 sera of horses from eight farms in Hokkaido were conducted. Six of the eight farms were EHV-3 antibody-positive, and positive rates ranged from 2.6% to 17.6%. To determine the infection time of four EHV-3 antibody-positive horses, a retrospective study was conducted. Infection time of the four horses was in the breeding season, and re-infection or reactivation of latently infected EHV-3 might have occurred in one horse. However, these four horses had never shown any clinical symptoms. The results suggested that several EHV-3 strains are distributed in Japan and that infection is maintained widely in horses without clinical symptoms. PMID:28132964

Potential roles of placental human beta-defensin-3 and apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G in prevention of intrauterine transmission of hepatitis B virus.

PubMed

Bai, Xiaoxia; Tian, Ting; Wang, Peng; Yang, Xiaofu; Wang, Zhengping; Dong, Minyue

2015-03-01

Approximately 5% of newborns were infected by hepatitis B virus (HBV) via intrauterine transmission and this is the main reason for high prevalence of HBV in endemic regions. However, the mechanisms by which intrauterine transmission is avoided in most cases remain elusive and placental natural anti-microbial factors may play a role in the prevention of HBV intrauterine transmission. The expression levels of human β-defensin-3 (HBD-3), apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G (A3G) and mannose binding lectin (MBL) were determined in the placenta of 30 HBV-seronegative pregnant women (controls), 7 HBV-seropositive pregnant women with infants infected via intrauterine transmission (infected group) and 30 HBV-seropositive pregnant women with non-infected infants (non-infected group). The expression of HBD-3, A3G, and MBL of placental trophoblast cell line Swan71 was determined after exposed to HBV. There were significant differences in placental HBD-3 and A3G levels among three groups, but the expression of MBL did not significantly differ. The expressions of HBD-3 and A3G were higher in non-infected group than controls and infected group, but not significantly different between infected group and controls. The exposure to HBV increased significantly the expression of HBD-3, A3G, and MBL by Swan 71. It may be concluded HBV up-regulates HBD-3 and A3G expression in vivo and in vitro in placental trophoblast and lack of this up-regulation is possibly associated with intrauterine transmission of HBV. © 2014 Wiley Periodicals, Inc.

CVB: The Constrained Vapor Bubble 40 mm Capillary Experiment on the ISS

NASA Technical Reports Server (NTRS)

Wayner, Peter C., Jr.; Kundan, Akshay; Plawsky, Joel

2013-01-01

Discuss the Constrained Vapor Bubble (CVB) 40mm Fin experiment on the ISS and how it aims to achieve a better understanding of the physics of evaporation and condensation and how they affect cooling processes in microgravity using a remotely controlled microscope and a small cooling device

Strategies of NF-κB signaling modulation by ectromelia virus in BALB/3T3 murine fibroblasts.

PubMed

Struzik, Justyna; Szulc-Dąbrowska, Lidia; Winnicka, Anna; Niemiałtowski, Marek

2015-10-01

Nuclear factor κB (NF-κB) is a pleiotropic transcription factor that regulates the expression of immune response genes. NF-κB signaling can be disrupted by pathogens that prevent host immune response. In this work, we examined the influence of ectromelia (mousepox) virus (ECTV) on NF-κB signaling in murine BALB/3T3 fibroblasts. Activation of NF-κB via tumor necrosis factor (TNF) receptor 1 (TNFR1) in these cells induces proinflammatory cytokine secretion. We show that ECTV does not recruit NF-κB to viral factories or induce NF-κB nuclear translocation in BALB/3T3 cells. Additionally, ECTV counteracts TNF-α-induced p65 NF-κB nuclear translocation during the course of infection. Inhibition of TNF-α-induced p65 nuclear translocation was also observed in neighboring cells that underwent fusion with ECTV-infected cells. ECTV inhibits the key step of NF-κB activation, i.e. Ser32 phosphorylation and degradation of inhibitor κBα (IκBα) induced by TNF-α. We also observed that ECTV prevents TNF-α-induced Ser536 of p65 phosphorylation in BALB/3T3 cells. Studying TNFR1 signaling provides information about regulation of inflammatory response and cell survival. Unraveling poxviral immunomodulatory strategies may be helpful in drug target identification as well as in vaccine development. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Investigation of a Patient with Pre-vaccine-derived Poliovirus in Shandong Province, China].

PubMed

Lin, Xiaojuan; Liu, Yao; Wang, Suting; Zhang Xiao; Song, Lizhi; Tao, Zexin; Ji, Feng; Xiong, Ping; Xu, Aiqiang

2015-09-01

To analyze the genetic characteristics of a polio-I highly variant vaccine recombinant virus in Shandong Province (China) in 2011 and to identify isolates from healthy contacts, two stool specimens from one patient with acute flaccid paralysis (AFP) and 40 stool specimens from his contacts were collected for virus isolation. The complete genome of poliovirus and VP1 coding region of the non-polio enterovirus were sequenced. Homologous comparison and phylogenetic analyses based on VP1 sequences were undertaken among coxsackievirus (CV) B1, CV-B3 isolates, and those in GenBank. One poliovirus (P1/11186), CV-A4 and CV-A8 were isolated from the AFP patient; one CV-A2, Echovirus 3 (E-3), E-12 and E-14, ten CV-B1, and five CV-B3 strains were isolated from his contacts. These results led us to believe that there may be a human enterovirus epidemic in this area, and that surveillance must be enhanced. P1/11186 was a type-1 vaccine-related poliovirus; it combined with type-2 and type-3 polioviruses in 2A and 3A regions, respectively. There were 25 nucleotide mutations with 9 amino-acid alterations in the entire genome. There were 8 nucleotide mutations with 5 amino-acid alterations in the VP1 region compared with the corresponding Sabin strains. Homology analyses suggested that the ten CV-B1 isolates had 97.0%-100% nucleotide and 98.9%-100% amino-acid identities with each other, as well as 92.6%-100% nucleotide and 99.2%-100% amino-acid identities among the five CV-B3 isolates. Phylogenetic analyses on the complete sequences of VP1 among CV-B1 and CV-B3 isolates showed that Shandong strains, together with strains from other provinces in China, had a close relationship and belonged to the same group.

Susceptibility to viral infection is enhanced by stable expression of 3A or 3AB proteins from foot-and-mouth disease virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosas, Maria F.; Vieira, Yuri A.; Postigo, Raul

2008-10-10

The foot-and-mouth disease virus (FMDV) 3A protein is involved in virulence and host range. A distinguishing feature of FMDV 3B among picornaviruses is that three non-identical copies are encoded in the viral RNA and required for optimal replication in cell culture. Here, we have studied the involvement of the 3AB region on viral infection using constitutive and transient expression systems. BHK-21 stably transformed clones expressed low levels of FMDV 3A or 3A(B) proteins in the cell cytoplasm. Transformed cells stably expressing these proteins did not exhibit inner cellular rearrangements detectable by electron microscope analysis. Upon FMDV infection, clones expressing eithermore » 3A alone or 3A(B) proteins showed a significant increase in the percentage of infected cells, the number of plaque forming units and the virus yield. The 3A-enhancing effect was specific for FMDV as no increase in viral multiplication was observed in transformed clones infected with another picornavirus, encephalomyocarditis virus, or the negative-strand RNA virus vesicular stomatitis virus. A potential role of 3A protein in viral RNA translation was discarded by the lack of effect on FMDV IRES-dependent translation. Increased viral susceptibility was not caused by a released factor; neither the supernatant of transformed clones nor the addition of purified 3A protein to the infection medium was responsible for this effect. Unlike stable expression, high levels of 3A or 3A(B) protein transient expression led to unspecific inhibition of viral infection. Therefore, the effect observed on viral yield, which inversely correlated with the intracellular levels of 3A protein, suggests a transacting role operating on the FMDV multiplication cycle.« less

Antiviral properties of prodelphinidin B-2 3'-O-gallate from green tea leaf.

PubMed

Cheng, Hua-Yew; Lin, Chun-Ching; Lin, Ta-Chen

2002-07-01

Prodelphinidin B-2 3-O-gallate, a proanthocyanidin gallate isolated from green tea leaf, was investigated for its anti-herpes simplex virus type 2 properties in vitro. Prodelphinidin B-2 3'-O-gallate exhibited antiviral activity with IC50 of 5.0 +/-1.0 microM and 1.6 +/-0.3 pM for XTT and plaque reduction (PRA) assays, respectively. Cytotoxicity assay had shown that prodelphinidin B-2 3'-O-gallate possessed cytotoxic effect toward Vero cell at concentration higher than its IC50. The 50% cytotoxic concentration for cell growth (CC50) was 33.3 +/- 3.7 microM. Thus, the selectivity index (SI) (ratio of IC50 to CC50) for XTT assay and PRA was 6.7 and 20.8, respectively. Prodelphinidin B-2 3'-O-gallate significantly reduced viral infectivity at concentrations 10 microM or more. Result of time-of-addition studies suggested that prodelphinidin B-2 3'-O-gallate affected the late stage of HSV-2 infection. In addition, it was also shown to inhibit the virus from attaching and penetrating into the cell. Thus, prodelphinidin B-2 3'-O-gallate was concluded to possess antiviral activity with mechanism of inhibiting viral attachment and penetration, and disturbing the late stage of viral infection.

A short history and introductory background on the coxsackieviruses of group B.

PubMed

Crowell, R L; Landau, B J

1997-01-01

The past 50 years have revealed an array of significant developments in our documentation and understanding of viruses and their associated diseases. The CVB, as enteroviruses, were discovered in the search for poliomyelitis-related viruses by the inoculation of newborn mice. Future strategies for the discovery of additional viruses will undoubtedly come through the application of differentiating cell culture systems with increased susceptibility to infection by specific viruses. Developments in regulation of the cell cycle also will contribute to the better definition of events controlling persistent infections caused by the CVB. Methods utilizing molecular biological probes in situ will prove to be major aids in identifying the molecular events in CVB pathogenesis. Virology of the CVB continues to be an exciting area for research and application of preventive measures to lesson human suffering. The chapters in this book which follow will amplify most of the themes briefly presented here.

Lack of galectin-3 up-regulates IgA expression by peritoneal B1 lymphocytes during B cell differentiation.

PubMed

Oliveira, Felipe L; Bernardes, Emerson S; Brand, Camila; dos Santos, Sofia N; Cabanel, Mariana P; Arcanjo, Kátia D; Brito, José M; Borojevic, Radovan; Chammas, Roger; El-Cheikh, Márcia C

2016-02-01

Galectin-3 is a β-galactoside-binding protein with an inhibitory role in B cell differentiation into plasma cells in distinct lymphoid tissues. We use a model of chronic schistosomiasis, a well-characterized experimental disease hallmarked by polyclonal B cell activation, in order to investigate the role of galectin-3 in controlling IgA production through peritoneal B1 cells. Chronically infected, galectin-3-deficient mice (Lgals3(-/-)) display peritoneal fluid hypercellularity, increased numbers of atypical peritoneal IgM(+)/IgA(+) B1a and B1b lymphocytes and histological disturbances in plasma cell niches when compared with Lgals3(+/+) mice. Similar to our infection model, peritoneal B1 cells from uninfected Lgals3(-/-) mice show enhanced switching to IgA after in vitro treatment with interleukin-5 plus transforming growth factor-β (IL-5 + TGF-β1). A higher number of IgA(+) B1a lymphocytes was found in the peritoneal cavity of Lgals3(-/-)-uninfected mice at 1 week after i.p. injection of IL-5 + TGF-β1; this correlates with the increased levels of secreted IgA detected in the peritoneal fluid of these mice after cytokine treatment. Interestingly, a higher number of degranulated mast cells is present in the peritoneal cavity of uninfected and Schistosoma mansoni-infected Lgals3(-/-) mice, indicating that, at least in part, mast cells account for the enhanced differentiation of B1 into IgA-producing B cells found in the absence of galectin-3. Thus, a novel role is revealed for galectin-3 in controlling the expression of surface IgA by peritoneal B1 lymphocytes; this might have important implications for manipulating the mucosal immune response.

18 CFR 3b.3 - Notice requirements.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

18 CFR 3b.3 - Notice requirements.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

18 CFR 3b.3 - Notice requirements.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

18 CFR 3b.3 - Notice requirements.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

Foot-and-mouth disease virus infection suppresses autophagy and NF-кB antiviral responses via degradation of ATG5-ATG12 by 3Cpro

PubMed Central

Fan, Xuxu; Han, Shichong; Yan, Dan; Gao, Yuan; Wei, Yanquan; Liu, Xiangtao; Liao, Ying; Guo, Huichen; Sun, Shiqi

2017-01-01

Autophagy-related protein ATG5-ATG12 is an essential complex for the autophagophore elongation in autophagy, which has been reported to be involved in foot-and-mouth disease virus (FMDV) replication. Previous reports show that ATG5-ATG12 positively or negatively regulates type I interferon (IFN-α/β) pathway during virus infection. In this study, we found that FMDV infection rapidly induced LC3 lipidation and GFP-LC3 subcellular redistribution at the early infection stage in PK-15 cells. Along with infection time course to 2–5 h.p.i., the levels of LC3II and ATG5-ATG12 were gradually reduced. Further study showed that ATG5-ATG12 was degraded by viral protein 3Cpro, demonstrating that FMDV suppresses autophagy along with viral protein production. Depletion of ATG5-ATG12 by siRNA knock down significantly increased the FMDV yields, whereas overexpression of ATG5-ATG12 had the opposite effects, suggesting that degradation of ATG5-ATG12 benefits virus growth. Further experiment showed that overexpression of ATG5-ATG12 positively regulated NF-кB pathway during FMDV infection, marked with promotion of IKKα/β phosphorylation and IκBα degradation, inhibition of p65 degradation, and facilitation of p65 nuclear translocation. Meanwhile, ATG5-ATG12 also promoted the phosphorylation of TBK1 and activation of IRF3 via preventing TRAF3 degradation. The positive regulation of NF-кB and IRF3 pathway by ATG5-ATG12 resulted in enhanced expression of IFN-β, chemokines/cytokines, and IFN stimulated genes, including anti-viral protein PKR. Altogether, above findings suggest that ATG5-ATG12 positively regulate anti-viral NF-κB and IRF3 signaling during FMDV infection, thereby limiting FMDV proliferation. FMDV has evolved mechanisms to counteract the antiviral function of ATG5-ATG12, via degradation of them by viral protein 3Cpro. PMID:28102839

Foot-and-mouth disease virus infection suppresses autophagy and NF-кB antiviral responses via degradation of ATG5-ATG12 by 3Cpro.

PubMed

Fan, Xuxu; Han, Shichong; Yan, Dan; Gao, Yuan; Wei, Yanquan; Liu, Xiangtao; Liao, Ying; Guo, Huichen; Sun, Shiqi

2017-01-19

Autophagy-related protein ATG5-ATG12 is an essential complex for the autophagophore elongation in autophagy, which has been reported to be involved in foot-and-mouth disease virus (FMDV) replication. Previous reports show that ATG5-ATG12 positively or negatively regulates type I interferon (IFN-α/β) pathway during virus infection. In this study, we found that FMDV infection rapidly induced LC3 lipidation and GFP-LC3 subcellular redistribution at the early infection stage in PK-15 cells. Along with infection time course to 2-5 h.p.i., the levels of LC3II and ATG5-ATG12 were gradually reduced. Further study showed that ATG5-ATG12 was degraded by viral protein 3C pro , demonstrating that FMDV suppresses autophagy along with viral protein production. Depletion of ATG5-ATG12 by siRNA knock down significantly increased the FMDV yields, whereas overexpression of ATG5-ATG12 had the opposite effects, suggesting that degradation of ATG5-ATG12 benefits virus growth. Further experiment showed that overexpression of ATG5-ATG12 positively regulated NF-кB pathway during FMDV infection, marked with promotion of IKKα/β phosphorylation and IκBα degradation, inhibition of p65 degradation, and facilitation of p65 nuclear translocation. Meanwhile, ATG5-ATG12 also promoted the phosphorylation of TBK1 and activation of IRF3 via preventing TRAF3 degradation. The positive regulation of NF-кB and IRF3 pathway by ATG5-ATG12 resulted in enhanced expression of IFN-β, chemokines/cytokines, and IFN stimulated genes, including anti-viral protein PKR. Altogether, above findings suggest that ATG5-ATG12 positively regulate anti-viral NF-κB and IRF3 signaling during FMDV infection, thereby limiting FMDV proliferation. FMDV has evolved mechanisms to counteract the antiviral function of ATG5-ATG12, via degradation of them by viral protein 3C pro .

CRISPR-Cas type I-A Cascade complex couples viral infection surveillance to host transcriptional regulation in the dependence of Csa3b

PubMed Central

He, Fei; Vestergaard, Gisle; Peng, Wenfang; She, Qunxin

2017-01-01

Abstract CRISPR-Cas (clustered regularly interspaced short palindromic repeats and the associated genes) constitute adaptive immune systems in bacteria and archaea and they provide sequence specific immunity against foreign nucleic acids. CRISPR-Cas systems are activated by viral infection. However, little is known about how CRISPR-Cas systems are activated in response to viral infection or how their expression is controlled in the absence of viral infection. Here, we demonstrate that both the transcriptional regulator Csa3b, and the type I-A interference complex Cascade, are required to transcriptionally repress the interference gene cassette in the archaeon Sulfolobus. Csa3b binds to two palindromic repeat sites in the promoter region of the cassette and facilitates binding of the Cascade to the promoter region. Upon viral infection, loading of Cascade complexes onto crRNA-matching protospacers leads to relief of the transcriptional repression. Our data demonstrate a mechanism coupling CRISPR-Cas surveillance of protospacers to transcriptional regulation of the interference gene cassette thereby allowing a fast response to viral infection. PMID:27980065

EBNA3C Directs Recruitment of RBPJ (CBF1) to Chromatin during the Process of Gene Repression in EBV Infected B Cells.

PubMed

Kalchschmidt, Jens S; Gillman, Adam C T; Paschos, Kostas; Bazot, Quentin; Kempkes, Bettina; Allday, Martin J

2016-01-01

It is well established that Epstein-Barr virus nuclear antigen 3C (EBNA3C) can act as a potent repressor of gene expression, but little is known about the sequence of events occurring during the repression process. To explore further the role of EBNA3C in gene repression-particularly in relation to histone modifications and cell factors involved-the three host genes previously reported as most robustly repressed by EBNA3C were investigated. COBLL1, a gene of unknown function, is regulated by EBNA3C alone and the two co-regulated disintegrin/metalloproteases, ADAM28 and ADAMDEC1 have been described previously as targets of both EBNA3A and EBNA3C. For the first time, EBNA3C was here shown to be the main regulator of all three genes early after infection of primary B cells. Using various EBV-recombinants, repression over orders of magnitude was seen only when EBNA3C was expressed. Unexpectedly, full repression was not achieved until 30 days after infection. This was accurately reproduced in established LCLs carrying EBV-recombinants conditional for EBNA3C function, demonstrating the utility of the conditional system to replicate events early after infection. Using this system, detailed chromatin immunoprecipitation analysis revealed that the initial repression was associated with loss of activation-associated histone modifications (H3K9ac, H3K27ac and H3K4me3) and was independent of recruitment of polycomb proteins and deposition of the repressive H3K27me3 modification, which were only observed later in repression. Most remarkable, and in contrast to current models of RBPJ in repression, was the observation that this DNA-binding factor accumulated at the EBNA3C-binding sites only when EBNA3C was functional. Transient reporter assays indicated that repression of these genes was dependent on the interaction between EBNA3C and RBPJ. This was confirmed with a novel EBV-recombinant encoding a mutant of EBNA3C unable to bind RBPJ, by showing this virus was incapable of

Variation in both IL28B and KIR2DS3 genes influence pegylated interferon and ribavirin hepatitis C treatment outcome in HIV-1 co-infection.

PubMed

Keane, Ciara; O'Shea, Daire; Reiberger, Thomas; Peck-Radosavljevic, Markus; Farrell, Gillian; Bergin, Colm; Gardiner, Clair M

2013-01-01

Pegylated-IFN and ribavirin remains the current treatment for chronic HCV infection in patients co-infected with HIV-1, but this regimen has low efficacy rates, particularly for HCV genotype 1/4 infection, has severe side effects and is extremely costly. Therefore, accurate prediction of treatment response is urgently required. We have recently shown that the NK cell gene, KIR2DS3 and a SNP associated with the IL28B gene synergise to increase the risk of chronic infection in primary HCV mono-infected patients. Identification of SNPs associated with the IL28B gene has also proven very powerful for predicting patient response to treatment. Patients co-infected with HIV-1 are of particular concern given they respond less well to HCV treatment, have more side effects and suffer a more rapid liver disease progression. In this study, we examined both IL28B and KIR2DS3 for their ability to predict treatment response in a cohort of HIV-1/HCV co-infected patients attending two treatment centres in Europe. We found that variation in both host genetic risk factors, IL28B and KIR2DS3, was strongly associated with sustained virological response (SVR) to treatment in our co-infected cohort (n = 149). The majority of patients who achieved a rapid virological response (RVR) achieved a SVR. However, it is currently impossible to predict treatment outcome in patients who fail to achieve an RVR. In our cohort, the presence of host genetic risk factors, IL28B-T and KIR2DS3 alleles, resulted in increased odds of treatment failure in these RVR negative patients (n = 88). Our data suggests that testing for host genetic factors will improve predicting treatment responsiveness in the clinical management of co-infected patients, and provides further evidence of the importance of the innate immune system in the immune response to HCV.

[Epidemiology of maternal-fetal group B streptococcal infections].

PubMed

Ben Hamida Nouaili, E; Abidi, K; Chaouachi, S; Marrakchi, Z

2011-03-01

The aim of this study was to determine the incidence, risk factors, and outcome of maternal-fetal infection due to group B streptococcus. We identified all cases of maternal-fetal group B streptococcus infection between January 2003 and December 2007, from neonatal unit reports at the Charles Nicolle Hospital. Ninety cases were identified out of 17,922 live births, incidence 5 ‰ of which 2.3 ‰ of bacteremia. Twenty percent of all newborns were premature and 22.2% had a low birth weight. Peripartum maternal fever was recorded in 52.2% of cases and membrane rupture more than 12 hours before delivery occurred in 74.4%. Among the newborns, 45.6% were symptomatic at birth. Forty percent of group B streptococci were resistant to erythromycin and 3.3% with intermediate resistance to ampicillin. The global neonatal mortality after group B streptococcus infection was 3.3%. Maternal-fetal infection due to group B streptococcus is still frequent and continues to be a major cause of morbidity and mortality. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

CRISPR-Cas type I-A Cascade complex couples viral infection surveillance to host transcriptional regulation in the dependence of Csa3b.

PubMed

He, Fei; Vestergaard, Gisle; Peng, Wenfang; She, Qunxin; Peng, Xu

2017-02-28

CRISPR-Cas (clustered regularly interspaced short palindromic repeats and the associated genes) constitute adaptive immune systems in bacteria and archaea and they provide sequence specific immunity against foreign nucleic acids. CRISPR-Cas systems are activated by viral infection. However, little is known about how CRISPR-Cas systems are activated in response to viral infection or how their expression is controlled in the absence of viral infection. Here, we demonstrate that both the transcriptional regulator Csa3b, and the type I-A interference complex Cascade, are required to transcriptionally repress the interference gene cassette in the archaeon Sulfolobus. Csa3b binds to two palindromic repeat sites in the promoter region of the cassette and facilitates binding of the Cascade to the promoter region. Upon viral infection, loading of Cascade complexes onto crRNA-matching protospacers leads to relief of the transcriptional repression. Our data demonstrate a mechanism coupling CRISPR-Cas surveillance of protospacers to transcriptional regulation of the interference gene cassette thereby allowing a fast response to viral infection. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Retrospective Surveillance of Wastewater To Examine Seasonal Dynamics of Enterovirus Infections

PubMed Central

Fout, G. Shay; Keely, Scott P.

2017-01-01

ABSTRACT Enteroviruses are RNA viruses that are responsible for both mild gastroenteritis and mild respiratory illnesses as well as debilitating diseases such as meningitis and myocarditis. The disease burden of enteroviruses in the United States is difficult to assess because most infections are not recorded. Since infected individuals shed enterovirus in feces and urine, surveillance of municipal wastewater can reveal the diversity of enteroviruses circulating in human populations. Therefore, monthly municipal wastewater samples were collected for 1 year and enteroviruses were quantified by reverse transcriptase quantitative PCR and identified by next-generation, high-throughput sequencing. Enterovirus concentrations ranged from 3.8 to 5.9 log10 equivalent copies/liter in monthly samples. From the mean monthly concentration, it can be estimated that 2.8% of the contributing population was shedding enterovirus daily. Sequence analysis showed that Enterovirus A and Enterovirus B alternate in predominance, with Enterovirus B comprising over 80% of the reads during the summer and fall months and Enterovirus A accounting for >45% of the reads in spring. Enterovirus C was observed throughout the year, while Enterovirus D was present intermittently. Principal-component analysis further supported the date corresponding to enterovirus seasonal trends as CVA6 (Enterovirus A) was predominant in the spring months; CVB3, CVB5, and E9 (Enterovirus B) were predominant in the summer and fall months; and CVA1, CVA19, and CVA22 (Enterovirus C) and EV97 (Enterovirus B) were predominant in winter. Rhinoviruses were also observed. Wastewater monitoring of human enterovirus provided improved insight into the seasonal patterns of enteroviruses circulating in communities and can contribute to understanding of enterovirus disease burden. IMPORTANCE Enterovirus infections are often not tracked or reported to health officials. This makes it hard to know how many people in a community are

Apobec 3G efficiently reduces infectivity of the human exogenous gammaretrovirus XMRV.

PubMed

Stieler, Kristin; Fischer, Nicole

2010-07-23

The human exogenous gammaretrovirus XMRV is thought to be implicated in prostate cancer and chronic fatigue syndrome. Besides pressing epidemiologic questions, the elucidation of the tissue and cell tropism of the virus, as well as its sensitivity to retroviral restriction factors is of fundamental importance. The Apobec3 (A3) proteins, a family of cytidine deaminases, are one important group of host proteins that control primary infection and efficient viral spread. Here we demonstrate that XMRV is resistant to human Apobec 3B, 3C and 3F, while being highly susceptible to the human A3G protein, a factor which is known to confer antiviral activity against most retroviruses. We show that XMRV as well as MoMLV virions package Apobec proteins independent of their specific restriction activity. hA3G was found to be a potent inhibitor of XMRV as well as of MoMLV infectivity. In contrast to MoMLV, XMRV infection can also be partially reduced by low concentrations of mA3. Interestingly, established prostate cancer cell lines, which are highly susceptible to XMRV infection, do not or only weakly express hA3G. Our findings confirm and extend recently published data that show restriction of XMRV infection by hA3G. The results will be of value to explore which cells are infected with XMRV and efficiently support viral spread in vivo. Furthermore, the observation that XMRV infection can be reduced by mA3 is of interest with regard to the current natural reservoir of XMRV infection.

Thalidomide enhances both primary and secondary host resistances to Listeria monocytogenes infection by a neutrophil-related mechanism in female B6C3F1 mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Tai L.; Chi, Rui P.; Karrow, Niel A.

2005-12-15

Previously, we have reported that thalidomide can modulate the immune responses in female B6C3F1 mice. Furthermore, thalidomide immunomodulation increased primary host resistance to intravenously infected Listeria monocytogenes. The present study was intended to evaluate the mechanisms underlying the enhanced host resistance to L. monocytogenes by focusing on the neutrophils. Female B6C3F1 mice were treated intraperitoneally with thalidomide (100 mg/kg) for 15 days. Exposure to thalidomide increased the numbers of neutrophils in the spleens and livers of L. monocytogenes-infected mice when compared to the L. monocytogenes-infected control mice. Additionally, the percentage of neutrophils was also significantly increased after Thd treatment inmore » L. monocytogenes-infected mice. Further studies using antibodies to deplete corresponding cells indicated that thalidomide-mediated increase in primary host resistance (both the moribundity and colony counts in the liver and spleen) to L. monocytogenes infection was due to its effect on neutrophils but not CD8{sup +} T cells or NK cells. Finally, Thd exposure also increased host resistance to secondary host resistance to L. monocytogenes infection, and depletion of neutrophils abolished the protective effect. In conclusion, thalidomide enhanced host resistance to both primary and secondary L. monocytogenes infections by a neutrophil-related mechanism in female B6C3F1 mice.« less

PI3K-delta mediates double-stranded RNA-induced upregulation of B7-H1 in BEAS-2B airway epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kan-o, Keiko; Matsumoto, Koichiro, E-mail: koichi@kokyu.med.kyushu-u.ac.jp; Asai-Tajiri, Yukari

Highlights: •Double-stranded RNA upregulates B7-H1 on BEAS-2B airway epithelial cells. •The upregulation of B7-H1 is attenuated by inhibition of PI3Kδ isoform. •PI3Kδ-mediated upregulation of B7-H1 is independent of NF-κB activation. •Inhibition of PI3Kδ may prevent persistent viral infection induced by B7-H1. -- Abstract: Airway viral infection disturbs the health-related quality of life. B7-H1 (also known as PD-L1) is a coinhibitory molecule associated with the escape of viruses from the mucosal immunity, leading to persistent infection. Most respiratory viruses generate double-stranded (ds) RNA during replication. The stimulation of cultured airway epithelial cells with an analog of viral dsRNA, polyinosinic-polycytidylic acid (polymore » IC) upregulates the expression of B7-H1 via activation of the nuclear factor κB(NF-κB). The mechanism of upregulation was investigated in association with phosphatidylinositol 3-kinases (PI3Ks). Poly IC-induced upregulation of B7-H1 was profoundly suppressed by a pan-PI3K inhibitor and partially by an inhibitor or a small interfering (si)RNA for PI3Kδ in BEAS-2B cells. Similar results were observed in the respiratory syncytial virus-infected cells. The expression of p110δ was detected by Western blot and suppressed by pretreatment with PI3Kδ siRNA. The activation of PI3Kδ is typically induced by oxidative stress. The generation of reactive oxygen species was increased by poly IC. Poly IC-induced upregulation of B7-H1 was attenuated by N-acetyl-L-cysteine, an antioxidant, or by oxypurinol, an inhibitor of xanthine oxidase. Poly IC-induced activation of NF-κB was suppressed by a pan-PI3K inhibitor but not by a PI3Kδ inhibitor. These results suggest that PI3Kδ mediates dsRNA-induced upregulation of B7-H1 without affecting the activation of NF-κB.« less

Depletion of the Receptor-Interacting Protein Kinase 3 (RIP3) Decreases Photoreceptor Cell Death During the Early Stages of Ocular Murine Cytomegalovirus Infection.

PubMed

Xu, Jinxian; Mo, Juan; Liu, Xinglou; Marshall, Brendan; Atherton, Sally S; Dong, Zheng; Smith, Sylvia; Zhang, Ming

2018-05-01

The purpose of this study was to determine if the receptor-interacting protein kinase 3 (RIP3) plays a significant role in innate immune responses and death of bystander retinal neurons during murine cytomegalovirus (MCMV) retinal infection, by comparing the innate immune response and cell death in RIP3-depleted mice (Rip3-/-) and Rip3+/+ control mice. Rip3-/- and Rip3+/+ mice were immunosuppressed (IS) and inoculated with MCMV via the supraciliary route. Virus-injected and mock-injected control eyes were removed at days 4, 7, and 10 post infection (p.i.) and markers of innate immunity and cell death were analyzed. Compared to Rip3+/+ mice, significantly more MCMV was recovered and more MCMV-infected RPE cells were observed in injected eyes of Rip3-/- mice at days 4 and 7 p.i. In contrast, fewer TUNEL-stained photoreceptors were observed in Rip3-/- eyes than in Rip3+/+ eyes at these times. Electron microscopy showed that significantly more apoptotic photoreceptor cells were present in Rip3+/+ mice than in Rip3-/- mice. Immunohistochemistry showed that the majority of TUNEL-stained photoreceptors died via mitochondrial flavoprotein apoptosis-inducing factor (AIF)-mediated, caspase 3-independent apoptosis. The majority of RIP3-expressing cells in infected eyes were RPE cells, microglia/macrophages, and glia, whereas retinal neurons contained much lower amounts of RIP3. Western blots showed significantly higher levels of activated nuclear factor-κB and caspase 1 were present in Rip3+/+ eyes compared to Rip3-/- eyes. Our results suggest that RIP3 enhances innate immune responses against ocular MCMV infection via activation of the inflammasome and nuclear factor-κB, which also leads to inflammation and death of bystander cells by multiple pathways including apoptosis and necroptosis.

Depletion of the Receptor-Interacting Protein Kinase 3 (RIP3) Decreases Photoreceptor Cell Death During the Early Stages of Ocular Murine Cytomegalovirus Infection

PubMed Central

Xu, Jinxian; Mo, Juan; Liu, Xinglou; Marshall, Brendan; Atherton, Sally S.; Dong, Zheng; Smith, Sylvia

2018-01-01

Purpose The purpose of this study was to determine if the receptor-interacting protein kinase 3 (RIP3) plays a significant role in innate immune responses and death of bystander retinal neurons during murine cytomegalovirus (MCMV) retinal infection, by comparing the innate immune response and cell death in RIP3-depleted mice (Rip3−/−) and Rip3+/+ control mice. Methods Rip3−/− and Rip3+/+ mice were immunosuppressed (IS) and inoculated with MCMV via the supraciliary route. Virus-injected and mock-injected control eyes were removed at days 4, 7, and 10 post infection (p.i.) and markers of innate immunity and cell death were analyzed. Results Compared to Rip3+/+ mice, significantly more MCMV was recovered and more MCMV-infected RPE cells were observed in injected eyes of Rip3−/− mice at days 4 and 7 p.i. In contrast, fewer TUNEL-stained photoreceptors were observed in Rip3−/− eyes than in Rip3+/+ eyes at these times. Electron microscopy showed that significantly more apoptotic photoreceptor cells were present in Rip3+/+ mice than in Rip3−/− mice. Immunohistochemistry showed that the majority of TUNEL-stained photoreceptors died via mitochondrial flavoprotein apoptosis-inducing factor (AIF)-mediated, caspase 3–independent apoptosis. The majority of RIP3-expressing cells in infected eyes were RPE cells, microglia/macrophages, and glia, whereas retinal neurons contained much lower amounts of RIP3. Western blots showed significantly higher levels of activated nuclear factor–κB and caspase 1 were present in Rip3+/+ eyes compared to Rip3−/− eyes. Conclusions Our results suggest that RIP3 enhances innate immune responses against ocular MCMV infection via activation of the inflammasome and nuclear factor–κB, which also leads to inflammation and death of bystander cells by multiple pathways including apoptosis and necroptosis.

Host and Bacterial Proteins That Repress Recruitment of LC3 to Shigella Early during Infection

PubMed Central

Baxt, Leigh A.; Goldberg, Marcia B.

2014-01-01

Shigella spp. are intracytosolic gram-negative pathogens that cause disease by invasion and spread through the colonic mucosa, utilizing host cytoskeletal components to form propulsive actin tails. We have previously identified the host factor Toca-1 as being recruited to intracellular S. flexneri and being required for efficient bacterial actin tail formation. We show that at early times during infection (40 min.), the type three-secreted effector protein IcsB recruits Toca-1 to intracellular bacteria and that recruitment of Toca-1 is associated with repression of recruitment of LC3, as well as with repression of recruitment of the autophagy marker NDP52, around these intracellular bacteria. LC3 is best characterized as a marker of autophagosomes, but also marks phagosomal membranes in the process LC3-associated phagocytosis. IcsB has previously been demonstrated to be required for S. flexneri evasion of autophagy at late times during infection (4–6 hr) by inhibiting binding of the autophagy protein Atg5 to the Shigella surface protein IcsA (VirG). Our results suggest that IcsB and Toca-1 modulation of LC3 recruitment restricts LC3-associated phagocytosis and/or LC3 recruitment to vacuolar membrane remnants. Together with published results, our findings suggest that IcsB inhibits innate immune responses in two distinct ways, first, by inhibiting LC3-associated phagocytosis and/or LC3 recruitment to vacuolar membrane remnants early during infection, and second, by inhibiting autophagy late during infection. PMID:24722587

75 FR 28188 - Airworthiness Directives; General Electric Company CF34-1A, -3A, -3A1, -3A2, -3B, and -3B1...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-20

... Frost, Aerospace Engineer, Engine Certification Office, FAA, Engine & Propeller Directorate, 12 New..., Massachusetts, on May 10, 2010. Peter A. White, Assistant Manager, Engine and Propeller Directorate, Aircraft... Airworthiness Directives; General Electric Company CF34-1A, -3A, -3A1, -3A2, -3B, and -3B1 Turbofan Engines...

Development of a blocking ELISA based on a monoclonal antibody against a predominant epitope in non-structural protein 3B2 of foot-and-mouth disease virus for differentiating infected from vaccinated animals.

PubMed

Fu, Yuanfang; Lu, Zengjun; Li, Pinghua; Cao, Yimei; Sun, Pu; Tian, Meina; Wang, Na; Bao, Huifang; Bai, Xingwen; Li, Dong; Chen, Yingli; Liu, Zaixin

2014-01-01

A monoclonal antibody (McAb) against non-structural protein (NSP) 3B of foot-mouth-disease virus (FMDV) (3B4B1) was generated and shown to recognize a conserved epitope spanning amino acids 24-32 of 3B (GPYAGPMER) by peptide screening ELISA. This epitope was further shown to be a unique and predominant B cell epitope in 3B2, as sera from animals infected with different serotypes of FMDV blocked the ability of McAb 3B4B1 to bind to NSP 2C3AB. Also, a polyclonal antibody against NSP 2C was produced in a rabbit vaccinated with 2C epitope regions expressed in E. coli. Using McAb 3B4B1 and the 2C polyclonal antibody, a solid-phase blocking ELISA (SPB-ELISA) was developed for the detection of antibodies against NSP 2C3AB to distinguish FMDV-infected from vaccinated animals (DIVA test). The parameters for this SPB-ELISA were established by screening panels of sera of different origins. Serum samples with a percent inhibition (PI) greater than or equal to 46% were considered to be from infected animals, and a PI lower than 46% was considered to indicate a non-infected animal. This test showed a similar performance as the commercially available PrioCHECK NS ELISA. This is the first description of the conserved and predominant GPYAGPMER epitope of 3B and also the first report of a DIVA test for FMDV NSP 3B based on a McAb against this epitope.

Equine herpesvirus-1 infection disrupts interferon regulatory factor-3 (IRF-3) signaling pathways in equine endothelial cells.

PubMed

Sarkar, Sanjay; Balasuriya, Udeni B R; Horohov, David W; Chambers, Thomas M

2016-05-01

Equine herpesvirus-1 (EHV-1) is a major respiratory viral pathogen of horses, causing upper respiratory tract disease, abortion, neonatal death, and neurological disease that may lead to paralysis and death. EHV-1 replicates initially in the respiratory epithelium and then spreads systemically to endothelial cells lining the small blood vessels in the uterus and spinal cord leading to abortion and EHM in horses. Like other herpesviruses, EHV-1 employs a variety of mechanisms for immune evasion including suppression of type-I interferon (IFN) production in equine endothelial cells (EECs). Previously we have shown that the neuropathogenic T953 strain of EHV-1 inhibits type-I IFN production in EECs and this is mediated by a viral late gene product. But the mechanism of inhibition was not known. Here we show that T953 strain infection of EECs induced degradation of endogenous IRF-3 protein. This in turn interfered with the activation of IRF-3 signaling pathways. EHV-1 infection caused the activation of the NF-κB signaling pathways, suggesting that inhibition of type-I IFN production is probably due to interference in IRF-3 and not NF-κB signal transduction. Copyright © 2016 Elsevier B.V. All rights reserved.

Elevated O3 and TYLCV Infection Reduce the Suitability of Tomato as a Host for the Whitefly Bemisia tabaci

PubMed Central

Cui, Hongying; Sun, Yucheng; Chen, Fajun; Zhang, Youjun; Ge, Feng

2016-01-01

The effects of elevated atmospheric ozone (O3) levels on herbivorous insects have been well studied, but little is known about the combined effects of elevated O3 and virus infection on herbivorous insect performance. Using open-top chambers in the field, we determined the effects of elevated O3 and Tomato yellow leaf curl virus (TYLCV) infection on wild-type (Wt) tomato and 35S tomato (jasmonic acid (JA) defense-enhanced genotype) in association with whitefly, Bemisia tabaci Gennadius biotype B. Elevated O3 and TYLCV infection, alone and in combination, significantly reduced the contents of soluble sugars and free amino acids, increased the contents of total phenolics and condensed tannins, and increased salicylic acid (SA) content and the expression of SA-related genes in leaves. The JA signaling pathway was upregulated by elevated O3, but downregulated by TYLCV infection and O3 + TYLCV infection. Regardless of plant genotype, elevated O3, TYLCV infection, or O3 + TYLCV infection significantly decreased B. tabaci fecundity and abundance. These results suggest that elevated O3 and TYLCV infection, alone and in combination, reduce the nutrients available for B. tabaci, increase SA content and SA-related gene expression, and increase secondary metabolites, resulting in decreases in fecundity and abundance of B. tabaci in both tomato genotypes. PMID:27916792

Identification of B Cells as a Major Site for Cyprinid Herpesvirus 3 Latency

PubMed Central

Reed, Aimee N.; Izume, Satoko; Dolan, Brian P.; LaPatra, Scott; Kent, Michael; Dong, Jing

2014-01-01

ABSTRACT Cyprinid herpesvirus 3 (CyHV-3), commonly known as koi herpesvirus (KHV), is a member of the Alloherpesviridae, and is a recently discovered emerging herpesvirus that is highly pathogenic for koi and common carp. Our previous study demonstrated that CyHV-3 becomes latent in peripheral white blood cells (WBC). In this study, CyHV-3 latency was further investigated in IgM+ WBC. The presence of the CyHV-3 genome in IgM+ WBC was about 20-fold greater than in IgM− WBC. To determine whether CyHV-3 expressed genes during latency, transcription from all eight open reading frames (ORFs) in the terminal repeat was investigated in IgM+ WBC from koi with latent CyHV-3 infection. Only a spliced ORF6 transcript was found to be abundantly expressed in IgM+ WBC from CyHV-3 latently infected koi. The spliced ORF6 transcript was also detected in vitro during productive infection as early as 1 day postinfection. The ORF6 transcript from in vitro infection begins at −127 bp upstream of the ATG codon and ends +188 bp downstream of the stop codon, +20 bp downstream of the polyadenylation signal. The hypothetical protein of ORF6 contains a consensus sequence with homology to a conserved domain of EBNA-3B and ICP4 from Epstein-Barr virus and herpes simplex virus 1, respectively, both members of the Herpesviridae. This is the first report of latent CyHV-3 in B cells and identification of gene transcription during latency for a member of the Alloherpesviridae. IMPORTANCE This is the first demonstration that a member of the Alloherpesviridae, cyprinid herpesvirus 3 (CyHV-3), establishes a latent infection in the B cells of its host, Cyprinus carpio. In addition, this is the first report of identification of gene transcription during latency for a member of Herpesvirales outside Herpesviridae. This is also the first report that the hypothetical protein of latent transcript of CyHV-3 contains a consensus sequence with homology to a conserved domain of EBNA-3B from Epstein

Identification of B cells as a major site for cyprinid herpesvirus 3 latency.

PubMed

Reed, Aimee N; Izume, Satoko; Dolan, Brian P; LaPatra, Scott; Kent, Michael; Dong, Jing; Jin, Ling

2014-08-01

Cyprinid herpesvirus 3 (CyHV-3), commonly known as koi herpesvirus (KHV), is a member of the Alloherpesviridae, and is a recently discovered emerging herpesvirus that is highly pathogenic for koi and common carp. Our previous study demonstrated that CyHV-3 becomes latent in peripheral white blood cells (WBC). In this study, CyHV-3 latency was further investigated in IgM(+) WBC. The presence of the CyHV-3 genome in IgM(+) WBC was about 20-fold greater than in IgM(-) WBC. To determine whether CyHV-3 expressed genes during latency, transcription from all eight open reading frames (ORFs) in the terminal repeat was investigated in IgM(+) WBC from koi with latent CyHV-3 infection. Only a spliced ORF6 transcript was found to be abundantly expressed in IgM(+) WBC from CyHV-3 latently infected koi. The spliced ORF6 transcript was also detected in vitro during productive infection as early as 1 day postinfection. The ORF6 transcript from in vitro infection begins at -127 bp upstream of the ATG codon and ends +188 bp downstream of the stop codon, +20 bp downstream of the polyadenylation signal. The hypothetical protein of ORF6 contains a consensus sequence with homology to a conserved domain of EBNA-3B and ICP4 from Epstein-Barr virus and herpes simplex virus 1, respectively, both members of the Herpesviridae. This is the first report of latent CyHV-3 in B cells and identification of gene transcription during latency for a member of the Alloherpesviridae. This is the first demonstration that a member of the Alloherpesviridae, cyprinid herpesvirus 3 (CyHV-3), establishes a latent infection in the B cells of its host, Cyprinus carpio. In addition, this is the first report of identification of gene transcription during latency for a member of Herpesvirales outside Herpesviridae. This is also the first report that the hypothetical protein of latent transcript of CyHV-3 contains a consensus sequence with homology to a conserved domain of EBNA-3B from Epstein-Barr virus and ICP4

Human parechovirus-3 infection in children, South Korea.

PubMed

Han, Tae-Hee; Chung, Ju-Young; You, Su Jeong; Youn, Jeong-Lim; Shim, Gyu-Hong

2013-09-01

Human parechoviruses (HPeVs) have recently been recognized as important viral pathogens causing sepsis-like illness and meningitis in children, but the data on these infections in Korea is limited. Klassevirus is emerging as a novel etiologic agent of acute gastroenteritis, but its role in meningitis remains unclear. To understand the epidemiology of HPeVs and klassevirus in sepsis-like illness and meningitis through the detection and typing of the virus in cerebrospinal fluid (CSF) samples. One hundred and eighty-three CSF samples collected from 183 patients ranging in the age group 1 day to 15 years were tested by using a RT-PCR assay for HPeV, EV and klassevirus. Amplification products of the VP3/VP1 and 3D region of the HPeV, and VP1 region of the EV were sequenced to identify the type. A total of 12 HPeV positive samples (6.5%) were detected from 183 CSF samples and all the samples were typed as HPeV-3. EVs were detected in 39 patients (21.3%) in which echovirus 25 and CVA6 were frequently detected, but mixed infection of HPeV-3 and EV was not observed. Klassevirus was not detected in the study population. Most of the HPeV-3 positive patients were under 3 months of age. HPeV-3 infection was detected mostly in the summer season. The VP3/VP1 gene of the 12 Korean strains clustered most closely to the Japan strain (AB759192) and the 3D gene of the Korean strains also clustered to the Japan strain, which showed no evidence of recombination. To our knowledge, this is the first report on the detection of HPeV-3 from CSF samples in Korea, which suggests the necessity of routine screening for this virus in young infants with sepsis-like illness and meningitis. Copyright © 2013 Elsevier B.V. All rights reserved.

Perceptions of relative attractiveness of nature-based tourism assets: A comparison between CVB directors and visitors

Treesearch

Jinyang Deng; David Dyre; Jing Wang

2012-01-01

This study uses the Analytic Hierarchy Process (AHP) to examine the similarities and differences between directors of Convention and Visitors Bureaus (CVB) and the general travelling public in their perceptions of the attractiveness of nature-based tourism resources in the state of West Virginia.

EV-A71 vaccine licensure: a first step for multivalent enterovirus vaccine to control HFMD and other severe diseases

PubMed Central

Mao, Qunying; Wang, Yiping; Bian, Lianlian; Xu, Miao; Liang, Zhenglun

2016-01-01

Enteroviruses (EVs) are the most common viral agents in humans. Although most infections are mild or asymptomatic, there is a wide spectrum of clinical manifestations that may be caused by EV infections with varying degrees of severity. Among these viruses, EV-A71 and coxsackievirus (CV) CV-A16 from group A EVs attract the most attention because they are responsible for hand, foot and mouth disease (HFMD). Other EV-A viruses such as CV-A6 and CV-A10 were also reported to cause HFMD outbreaks in several countries or regions. Group B EVs such as CV-B3, CV-B5 and echovirus 30 were reported to be the main pathogens responsible for myocarditis and encephalitis epidemics and were also detected in HFMD patients. Vaccines are the best tools to control infectious diseases. In December 2015, China's Food and Drug Administration approved two inactivated EV-A71 vaccines for preventing severe HFMD.The CV-A16 vaccine and the EV-A71-CV-A16 bivalent vaccine showed substantial efficacy against HFMD in pre-clinical animal models. Previously, research on EV-B group vaccines was mainly focused on CV-B3 vaccine development. Because the HFMD pathogen spectrum has changed, and the threat from EV-B virus-associated severe diseases has gradually increased, it is necessary to develop multivalent HFMD vaccines. This study summarizes the clinical symptoms of diseases caused by EVs, such as HFMD, myocarditis and encephalitis, and the related EV vaccine development progress. In conclusion, developing multivalent EV vaccines should be strongly recommended to prevent HFMD, myocarditis, encephalitis and other severe diseases. PMID:27436364

EV-A71 vaccine licensure: a first step for multivalent enterovirus vaccine to control HFMD and other severe diseases.

PubMed

Mao, Qunying; Wang, Yiping; Bian, Lianlian; Xu, Miao; Liang, Zhenglun

2016-07-20

Enteroviruses (EVs) are the most common viral agents in humans. Although most infections are mild or asymptomatic, there is a wide spectrum of clinical manifestations that may be caused by EV infections with varying degrees of severity. Among these viruses, EV-A71 and coxsackievirus (CV) CV-A16 from group A EVs attract the most attention because they are responsible for hand, foot and mouth disease (HFMD). Other EV-A viruses such as CV-A6 and CV-A10 were also reported to cause HFMD outbreaks in several countries or regions. Group B EVs such as CV-B3, CV-B5 and echovirus 30 were reported to be the main pathogens responsible for myocarditis and encephalitis epidemics and were also detected in HFMD patients. Vaccines are the best tools to control infectious diseases. In December 2015, China's Food and Drug Administration approved two inactivated EV-A71 vaccines for preventing severe HFMD.The CV-A16 vaccine and the EV-A71-CV-A16 bivalent vaccine showed substantial efficacy against HFMD in pre-clinical animal models. Previously, research on EV-B group vaccines was mainly focused on CV-B3 vaccine development. Because the HFMD pathogen spectrum has changed, and the threat from EV-B virus-associated severe diseases has gradually increased, it is necessary to develop multivalent HFMD vaccines. This study summarizes the clinical symptoms of diseases caused by EVs, such as HFMD, myocarditis and encephalitis, and the related EV vaccine development progress. In conclusion, developing multivalent EV vaccines should be strongly recommended to prevent HFMD, myocarditis, encephalitis and other severe diseases.

Disoxaril mutants of Coxsackievirus B1: phenotypic characteristics and analysis of the target VP1 gene.

PubMed

Nikolova, Ivanka; Galabov, Angel S; Petkova, Rumena; Chakarov, Stoyan; Atanasov, Boris

2011-01-01

Disoxaril inhibits enterovirus replication by binding to the hydrophobic pocket within the VP1 coat protein, thus stabilizing the virion and blocking its uncoating. Disoxaril-resistant (RES) mutants of the Coxsackievirus B1 (CVB1/RES) were derived from the wild disoxaril-sensitive (SOF) strain (CVB1/SOF) using a selection approach. A disoxaril-dependent (DEP) mutant (CVB1/DEP) was obtained following nine consecutive passages of the disoxaril-resistant mutant in the presence of disoxaril. Phenotypic characteristics of the disoxaril mutants were investigated. A timing-of-addition study of the CVB1/DEP replication demonstrated that in the absence of disoxaril the virus particle assembly stopped. VP1 RNA sequences of disoxaril mutants were compared with the existing Gen Bank CVB1 reference structure. The amino acid sequence of a large VP1 196-258 peptide (disoxaril-binding region) of CVB1/RES was significantly different from that of the CVB1/SOF. Crucially important changes in CVB1/RES were two point mutations, M213H and F237L, both in the ligand-binding pocket. The sequence analysis of the CVB1/DEP showed some reversion to CVB1/SOF. The amino acid sequences of the three VP1 proteins are presented.

Antibody response to the Haemophilus influenzae type b-tetanus toxoid conjugate vaccine in healthy and infection-prone individuals with IgG3 subclass deficiency.

PubMed

Hahn-Zoric, M; Ulanova, M; Friman, V; Björkander, J; Oxelius, V A; Lucas, A; Hanson, L A

2004-09-01

Searching for a possible explanation for the phenotypic heterogeneity in IgG3 deficiency, we studied the antibody response to a polysaccharide and a protein antigen in IgG3-deficient (IgG3d) adults after vaccination with Haemophilus influenzae type b capsular polysaccharide (Hib CP) conjugated to tetanus toxoid. Distribution of isotypes, idiotypes, clonotypes, and Gm allotypes were compared. All the vaccinated individuals, irrespective of the level of IgG3 and proneness to infections, developed protective levels of anti-Hib CP. Significantly lower prevaccination levels of IgG2 (p < 0.05) and IgG4 anti-Hib CP (p < 0.04 and p < 0.03) were noted among the infection-prone compared to the healthy IgG3d individuals and/or controls. Seventy percent of the IgG3d patients and none of the controls had the low responding Gm(ga-n/ga-n) genotype, while the majority of the controls had the alternative Gm(bfn/bfn) genotype. The conjugate ACT-HIB vaccine efficiently overcomes the IgG3 subclass deficiency state and the genetic predisposition for lower responsiveness, providing protection against Hib and tetanus infections. The proneness to infection in some IgG3d individuals may relate to their low prevaccination antibody levels.

[Reactivation of parvovirus B19 infection in an HIV-infected woman].

PubMed

Sterpu, R; Ichou, H; Mahé, I; Mortier, E

2014-06-01

Infection by human parvovirus B19 (erythrovirus B19) is common and usually asymptomatic during childhood conferring lasting protection against a new infection. Parvovirus B19 infection may cause erythema infectiosum (5th disease) and aplastic crisis. Secondary symptomatic parvovirus B19 infection in the same patient is rare and its physiopathology is not always clear. A 48-year-old HIV-infected female patient presented within 5 years two acute episodes of parvovirus B19 infection although her CD4 cells count was above 500/mm(3). Absence of specific antibodies production after the first episode and persisting parvovirus viremia suggested viral reactivation rather than re-infection. During the second episode, specific antibodies were produced. Similarly to most DNA viruses, parvovirus B19 reactivation is possible in HIV-infected patients while effectively treated by antiretroviral therapy. Copyright © 2013 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.

Large-Scale Survey of Human Enteroviruses in Wastewater Treatment Plants of a Metropolitan Area of Southern Italy.

PubMed

Pennino, Francesca; Nardone, Antonio; Montuori, Paolo; Aurino, Sara; Torre, Ida; Battistone, Andrea; Delogu, Roberto; Buttinelli, Gabriele; Fiore, Stefano; Amato, Concetta; Triassi, Maria

2018-06-01

Human enteroviruses (HEVs) occur in high concentrations in wastewater and can contaminate receiving environmental waters, constituting a major cause of acute waterborne disease worldwide. In this study, we investigated the relative abundance, occurrence, and seasonal distribution of polio and other enteroviruses at three wastewater treatment plants (WWTPs) in Naples, Southern Italy, from January 2010 to December 2014. Influent and effluent samples from the three WWTPs were collected monthly. One hundred and sixty-one of the 731 wastewater samples collected (22.0%) before and after water treatment were CPE positive on RD cells; while no samples were positive on L20B cells from any WWTPs. Among the 140 non-polio enterovirus isolated from inlet sewage, 69.3% were Coxsackieviruses type B and 30.7% were Echoviruses. Among these, CVB3 and CVB5 were most prevalent, followed by CVB4 and Echo6. The twenty-one samples tested after treatment contained 6 CVB4, 5 CVB3, 3 Echo11, and 2 Echo6; while other serotypes were isolated less frequently. Data on viral detection in treated effluents of WWTPs confirmed the potential environmental contamination by HEVs and could be useful to establish standards for policies on wastewater management.

Nonstructural 3 Protein of Hepatitis C Virus Modulates the Tribbles Homolog 3/Akt Signaling Pathway for Persistent Viral Infection

PubMed Central

Tran, Si C.; Pham, Tu M.; Nguyen, Lam N.; Park, Eun-Mee; Lim, Yun-Sook

2016-01-01

ABSTRACT Hepatitis C virus (HCV) infection often causes chronic hepatitis, liver cirrhosis, and ultimately hepatocellular carcinoma. However, the mechanisms underlying HCV-induced liver pathogenesis are still not fully understood. By transcriptome sequencing (RNA-Seq) analysis, we recently identified host genes that were significantly differentially expressed in cell culture-grown HCV (HCVcc)-infected cells. Of these, tribbles homolog 3 (TRIB3) was selected for further characterization. TRIB3 was initially identified as a binding partner of protein kinase B (also known as Akt). TRIB3 blocks the phosphorylation of Akt and induces apoptosis under endoplasmic reticulum (ER) stress conditions. HCV has been shown to enhance Akt phosphorylation for its own propagation. In the present study, we demonstrated that both mRNA and protein levels of TRIB3 were increased in the context of HCV replication. We further showed that promoter activity of TRIB3 was increased by HCV-induced ER stress. Silencing of TRIB3 resulted in increased RNA and protein levels of HCV, whereas overexpression of TRIB3 decreased HCV replication. By employing an HCV pseudoparticle entry assay, we further showed that TRIB3 was a negative host factor involved in HCV entry. Both in vitro binding and immunoprecipitation assays demonstrated that HCV NS3 specifically interacted with TRIB3. Consequently, the association of TRIB3 and Akt was disrupted by HCV NS3, and thus, TRIB3-Akt signaling was impaired in HCV-infected cells. Moreover, HCV modulated TRIB3 to promote extracellular signal-regulated kinase (ERK) phosphorylation, activator protein 1 (AP-1) activity, and cell migration. Collectively, these data indicate that HCV exploits the TRIB3-Akt signaling pathway to promote persistent viral infection and may contribute to HCV-mediated pathogenesis. IMPORTANCE TRIB3 is a pseudokinase protein that acts as an adaptor in signaling pathways for important cellular processes. So far, the functional involvement of

Matrix Metalloproteinase 3 Promotes Cellular Anti-Dengue Virus Response via Interaction with Transcription Factor NFκB in Cell Nucleus

PubMed Central

Zuo, Xiangyang; Pan, Wen; Feng, Tingting; Shi, Xiaohong; Dai, Jianfeng

2014-01-01

Dengue virus (DENV), the causative agent of human Dengue hemorrhagic fever, is a mosquito-borne virus of immense global health importance. Characterization of cellular factors promoting or inhibiting DENV infection is important for understanding the mechanism of DENV infection. In this report, MMP3 (stromelysin-1), a secretory endopeptidase that degrades extracellular matrices, has been shown promoting cellular antiviral response against DENV infection. Quantitative RT-PCR and Western Blot showed that the expression of MMP3 was upregulated in DENV-infected RAW264.7 cells. The intracellular viral loads were significantly higher in MMP3 silenced cells compared with controls. The expression level of selective anti-viral cytokines were decreased in MMP3 siRNA treated cells, and the transcription factor activity of NFκB was significantly impaired upon MMP3 silencing during DENV infection. Further, we found that MMP3 moved to cell nucleus upon DENV infection and colocalized with NFκB P65 in nucleus. Co-immunoprecipitation analysis suggested that MMP3 directly interacted with NFκB in nucleus during DENV infection and the C-terminal hemopexin-like domain of MMP3 was required for the interaction. This study suggested a novel role of MMP3 in nucleus during viral infection and provided new evidence for MMPs in immunomodulation. PMID:24416274

Matrix metalloproteinase 3 promotes cellular anti-dengue virus response via interaction with transcription factor NFκB in cell nucleus.

PubMed

Zuo, Xiangyang; Pan, Wen; Feng, Tingting; Shi, Xiaohong; Dai, Jianfeng

2014-01-01

Dengue virus (DENV), the causative agent of human Dengue hemorrhagic fever, is a mosquito-borne virus of immense global health importance. Characterization of cellular factors promoting or inhibiting DENV infection is important for understanding the mechanism of DENV infection. In this report, MMP3 (stromelysin-1), a secretory endopeptidase that degrades extracellular matrices, has been shown promoting cellular antiviral response against DENV infection. Quantitative RT-PCR and Western Blot showed that the expression of MMP3 was upregulated in DENV-infected RAW264.7 cells. The intracellular viral loads were significantly higher in MMP3 silenced cells compared with controls. The expression level of selective anti-viral cytokines were decreased in MMP3 siRNA treated cells, and the transcription factor activity of NFκB was significantly impaired upon MMP3 silencing during DENV infection. Further, we found that MMP3 moved to cell nucleus upon DENV infection and colocalized with NFκB P65 in nucleus. Co-immunoprecipitation analysis suggested that MMP3 directly interacted with NFκB in nucleus during DENV infection and the C-terminal hemopexin-like domain of MMP3 was required for the interaction. This study suggested a novel role of MMP3 in nucleus during viral infection and provided new evidence for MMPs in immunomodulation.

Epstein-Barr Virus (EBV) Latent Protein EBNA3A Directly Targets and Silences the STK39 Gene in B Cells Infected by EBV.

PubMed

Bazot, Quentin; Paschos, Kostas; Allday, Martin J

2018-04-01

Epstein-Barr virus (EBV) establishes latent infection in human B cells and is associated with a wide range of cancers. The EBV nuclear antigen 3 (EBNA3) family proteins are critical for B cell transformation and function as transcriptional regulators. It is well established that EBNA3A and EBNA3C cooperate in the regulation of cellular genes. Here, we demonstrate that the gene STK39 is repressed only by EBNA3A. This is the first example of a gene regulated only by EBNA3A in EBV-transformed lymphoblastoid cell lines (LCLs) without the help of EBNA3C. This was demonstrated using a variety of LCLs carrying either knockout, revertant, or conditional EBNA3 recombinants. Investigating the kinetics of EBNA3A-mediated changes in STK39 expression showed that STK39 becomes derepressed quickly after EBNA3A inactivation. This derepression is reversible as EBNA3A reactivation represses STK39 in the same cells expressing a conditional EBNA3A. STK39 is silenced shortly after primary B cell infection by EBV, and no STK39 -encoded protein (SPAK) is detected 3 weeks postinfection. Chromatin immunoprecipitation (ChIP) analysis indicates that EBNA3A directly binds to a regulatory region downstream of the STK39 transcription start site. For the first time, we demonstrated that the polycomb repressive complex 2 with the deposition of the repressive mark H3K27me3 is not only important for the maintenance of an EBNA3A target gene ( STK39 ) but is also essential for the initial establishment of its silencing. Finally, we showed that DNA methyltransferases are involved in the EBNA3A-mediated repression of STK39 IMPORTANCE EBV is well known for its ability to transform B lymphocytes to continuously proliferating lymphoblastoid cell lines. This is achieved in part by the reprogramming of cellular gene transcription by EBV transcription factors, including the EBNA3 proteins that play a crucial role in this process. In the present study, we found that EBNA3A epigenetically silences STK39 This

Human kidney anion exchanger 1 interacts with kinesin family member 3B (KIF3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duangtum, Natapol; Department of Anatomy, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700; Junking, Mutita

Highlights: {yields} Impaired trafficking of kAE1 causes distal renal tubular acidosis (dRTA). {yields} The interaction between kAE1 and kinesin family member 3B (KIF3B) is reported. {yields} The co-localization between kAE and KIF3B was detected in human kidney tissues. {yields} A marked reduction of kAE1 on the cell membrane was observed when KIF3B was knockdown. {yields} KFI3B plays an important role in trafficking of kAE1 to the plasma membrane. -- Abstract: Impaired trafficking of human kidney anion exchanger 1 (kAE1) to the basolateral membrane of {alpha}-intercalated cells of the kidney collecting duct leads to the defect of the Cl{sup -}/HCO{sub 3}{supmore » -} exchange and the failure of proton (H{sup +}) secretion at the apical membrane of these cells, causing distal renal tubular acidosis (dRTA). In the sorting process, kAE1 interacts with AP-1 mu1A, a subunit of AP-1A adaptor complex. However, it is not known whether kAE1 interacts with motor proteins in its trafficking process to the plasma membrane or not. We report here that kAE1 interacts with kinesin family member 3B (KIF3B) in kidney cells and a dileucine motif at the carboxyl terminus of kAE1 contributes to this interaction. We have also demonstrated that kAE1 co-localizes with KIF3B in human kidney tissues and the suppression of endogenous KIF3B in HEK293T cells by small interfering RNA (siRNA) decreases membrane localization of kAE1 but increases its intracellular accumulation. All results suggest that KIF3B is involved in the trafficking of kAE1 to the plasma membrane of human kidney {alpha}-intercalated cells.« less

Non-polio enteroviruses serotypes circulating in Nigeria.

PubMed

Oyero, O G; Adu, F D

2010-12-01

Enteroviruses is one of the most common group of human pathogens, causing a wide range of acute symptoms involving the cardiac and skeletal muscles, central nervous system, pancreas,skin and mucous membranes. In spite of the success recorded in polio eradication globally, infections with other enteroviruses remain frequent and sometimes very serious, requiring hospitalization. In this study we determined the various circulating serotypes of non-polio enteroviruses (NPEVs) with a view to providing information on the activity of these viruses among the Nigerian children, who usually are the most affected. Stool samples were obtained from hospitalized children at two major secondary community hospitals in Ibadan and acute flaccid paralysis (AFP) cases from 26 states ofNigeria. A presumptive identification of NPEVs was based on growth in RD cells. Isolates were identified by neutralization assay using sera obtained from the Institute for Public Health and the Environment, the Netherlands. The problems associated with this assay prompted the use of genotypic method developed at the Centers for Disease Control, Atlanta, USA for the final identification of isolates. Neutralization assay identified the 138 isolates into echoviruses (43.5%), coxsackie B viruses (29.7%) and untypeable isolates (26.8%). Finally genotyping identified echoviruses (E3, E6, E7, E11, E12, E13, E14, E19, E20, E21, E24, E29, E30, E33), coxsackieviruses (CVA3, CVA4, CVA6, CVA17, CVB3, CVB5, CVB6) and enteroviruses (EV69, EV71). The causal association of isolates with different diseases was also established. Majority of the isolates belonged to the human enterovirus gropup B (HEV-B) specie, followed by 4 and 1 in the HEV-A and HEV-C species respectively. This study forms the basis of molecular epidemiology of NPEVs being established for the first time in Nigeria. The implication of the presence of neurotropic serotypes (E3, E6, E7, E11, E14, E20, E24, E29, E30, EV71, CVB3 and CVB5) is that AFP may

Glycogen synthase kinase-3β (GSK3β) inhibition suppresses the inflammatory response to Francisella infection and protects against tularemia in mice

PubMed Central

Zhang, Ping; Katz, Jenny; Michalek, Suzanne M.

2011-01-01

Francisella tularensis, the causative agent of tularemia, is currently considered a category A bioterrorism agent due to its high virulence. Infection with F. tularensis results in an inflammatory response that plays an important role in the pathogenesis of the disease; however, the cellular mechanisms regulating this response are poorly understood. Glycogen synthase kinase-3β (GSK3β) is a serine/threonine protein kinase that has recently emerged as a key regulatory switch in the modulation of the inflammatory response. In this study, we investigated the effect of GSK3β inhibition in regulating F. tularensis LVS-induced inflammatory responses. F. tularensis LVS infection of murine peritoneal macrophages induced a TLR2 dependent phosphorylation of GSK3β. Inhibition of GSK3β resulted in a significant decrease in the production of pro-inflammatory cytokine IL-6, IL-12p40 and TNF-α, as well as a significant increase in the production of the anti-inflammatory cytokine IL-10. GSK3β regulated the F. tularensis LVS-induced cytokine response by differentially affecting the activation of transcription factors NF-κB and CREB. Inhibition of GSK3β by lithium in vivo suppressed the inflammatory response in mice infected with F. tularensis LVS and conferred a survival advantage. In addition, we show that the production of IFN-γ contributed to the development of tularemia and to the fatal outcome of the infected animals, depending on the timing and the relative level of the IFN-γ produced. IFN-γ potentiated F. tularensis LVS-induced cytokine production by increasing GSK3β activity and the nuclear translocation of NF-κB. Taken together, these results demonstrate a regulatory function of GSK3β in modulating inflammatory responses that can be detrimental to the host during an F. tularensis LVS infection, and suggest that inhibition of GSK3β may represent a novel therapeutic approach in the treatment of tularemia. PMID:18929413

The Vaporization of B2O3(l) to B2O3(g) and B2O2(g)

NASA Technical Reports Server (NTRS)

Jacobson, Nathan S.; Myers, Dwight L.

2011-01-01

The vaporization of B2O3 in a reducing environment leads to formation of both B2O3(g) and B2O2(g). While formation of B2O3(g) is well understood, many questions about the formation of B2O2(g) remain. Previous studies using B(s) + B2O3(l) have led to inconsistent thermodynamic data. In this study, it was found that after heating, B(s) and B2O3(l) appear to separate and variations in contact area likely led to the inconsistent vapor pressures of B2O2(g). To circumvent this problem, an activity of boron is fixed with a two-phase mixture of FeB and Fe2B. Both second and third law enthalpies of formation were measured for B2O2(g) and B2O3(g). From these the enthalpies of formation at 298.15 K are calculated to be -479.9 +/- 41.5 kJ/mol for B2O2(g) and -833.4 +/- 13.1 kJ/mol for B2O3(g). Ab initio calculations to determine the enthalpies of formation of B2O2(g) and B2O3(g) were conducted using the W1BD composite method and show good agreement with the experimental values.

Distribution of ABO/Rh blood groups and their association with hepatitis B virus infection in 3.8 million Chinese adults: A population-based cross-sectional study.

PubMed

Liu, J; Zhang, S; Liu, M; Wang, Q; Shen, H; Zhang, Y

2018-04-01

ABO and Rh blood groups play a vital role in blood transfusion safety and clinical practice and are thought to be linked with disease susceptibility. The results from previous studies that focused on the association between blood groups and HBV infection remain controversial. China has the world's largest burden of HBV infection. We assessed the distribution of ABO/Rh blood groups in Chinese adults and examined the association between these groups and HBV infection. We did a nationwide cross-sectional study using data from a physical check-up programme from 31 provinces examined between 2010 and 2012. ELISA was used to test for HBsAg in serologic samples. Multivariable logistic regression was used to estimate aOR of the association between ABO and Rh blood groups and HBV infection. Among 3 827 125 participants, the proportion of participants with blood group A was highest (30.54%), followed by O (30.37%), B (29.42%) and AB (9.66%). A total of 38 907 (1.02%) were Rh-D negative. The prevalence of HBsAg in blood groups O, A, B and AB were 6.34%, 5.55%, 5.18% and 5.06%, respectively. HBsAg prevalence was 5.65% in Rh-D-positive and 3.96% in Rh-D-negative participants. After controlling for other potential risk factors, multivariate models showed that participants with blood group O (adjusted OR = 1.22, 95% CI: 1.20-1.25) were at higher risk of HBV infection compared with group AB. Rh-D-positive participants (adjusted OR = 1.44, 95% CI: 1.37-1.52) were at higher risk of HBV infection than Rh-D-negative participants. The associations between ABO/Rh blood groups and HBV infection were similar in subgroup analysis. The proportions of O, A, B and AB blood groups were approximately 3:3:3:1, and nearly 1 in 100 people was Rh-D negative among Chinese adults. Blood group O and Rh-D positivity were both associated with increased HBV infection. The risk of HBV infection and blood safety should be taken into consideration in clinical practice, especially when transfusing

The anti-obesity drug orlistat reveals anti-viral activity.

PubMed

Ammer, Elisabeth; Nietzsche, Sandor; Rien, Christian; Kühnl, Alexander; Mader, Theresa; Heller, Regine; Sauerbrei, Andreas; Henke, Andreas

2015-12-01

The administration of drugs to inhibit metabolic pathways not only reduces the risk of obesity-induced diseases in humans but may also hamper the replication of different viral pathogens. In order to investigate the value of the US Food and Drug Administration-approved anti-obesity drug orlistat in view of its anti-viral activity against different human-pathogenic viruses, several anti-viral studies, electron microscopy analyses as well as fatty acid uptake experiments were performed. The results indicate that administrations of non-cytotoxic concentrations of orlistat reduced the replication of coxsackievirus B3 (CVB3) in different cell types significantly. Moreover, orlistat revealed cell protective effects and modified the formation of multi-layered structures in CVB3-infected cells, which are necessary for viral replication. Lowering fatty acid uptake from the extracellular environment by phloretin administrations had only marginal impact on CVB3 replication. Finally, orlistat reduced also the replication of varicella-zoster virus moderately but had no significant influence on the replication of influenza A viruses. The data support further experiments into the value of orlistat as an inhibitor of the fatty acid synthase to develop new anti-viral compounds, which are based on the modulation of cellular metabolic pathways.

LAG3 Expression in Active Mycobacterium tuberculosis Infections

PubMed Central

Phillips, Bonnie L.; Mehra, Smriti; Ahsan, Muhammad H.; Selman, Moises; Khader, Shabaana A.; Kaushal, Deepak

2016-01-01

Mycobacterium tuberculosis (MTB) is a highly successful pathogen because of its ability to persist in human lungs for long periods of time. MTB modulates several aspects of the host immune response. Lymphocyte-activation gene 3 (LAG3) is a protein with a high affinity for the CD4 receptor and is expressed mainly by regulatory T cells with immunomodulatory functions. To understand the function of LAG3 during MTB infection, a nonhuman primate model of tuberculosis, which recapitulates key aspects of natural human infection in rhesus macaques (Macaca mulatta), was used. We show that the expression of LAG3 is highly induced in the lungs and particularly in the granulomatous lesions of macaques experimentally infected with MTB. Furthermore, we show that LAG3 expression is not induced in the lungs and lung granulomas of animals exhibiting latent tuberculosis infection. However, simian immunodeficiency virus–induced reactivation of latent tuberculosis infection results in an increased expression of LAG3 in the lungs. This response is not observed in nonhuman primates infected with non-MTB bacterial pathogens, nor with simian immunodeficiency virus alone. Our data show that LAG3 was expressed primarily on CD4+ T cells, presumably by regulatory T cells but also by natural killer cells. The expression of LAG3 coincides with high bacterial burdens and changes in the host type 1 helper T-cell response. PMID:25549835

LAG3 expression in active Mycobacterium tuberculosis infections.

PubMed

Phillips, Bonnie L; Mehra, Smriti; Ahsan, Muhammad H; Selman, Moises; Khader, Shabaana A; Kaushal, Deepak

2015-03-01

Mycobacterium tuberculosis (MTB) is a highly successful pathogen because of its ability to persist in human lungs for long periods of time. MTB modulates several aspects of the host immune response. Lymphocyte-activation gene 3 (LAG3) is a protein with a high affinity for the CD4 receptor and is expressed mainly by regulatory T cells with immunomodulatory functions. To understand the function of LAG3 during MTB infection, a nonhuman primate model of tuberculosis, which recapitulates key aspects of natural human infection in rhesus macaques (Macaca mulatta), was used. We show that the expression of LAG3 is highly induced in the lungs and particularly in the granulomatous lesions of macaques experimentally infected with MTB. Furthermore, we show that LAG3 expression is not induced in the lungs and lung granulomas of animals exhibiting latent tuberculosis infection. However, simian immunodeficiency virus-induced reactivation of latent tuberculosis infection results in an increased expression of LAG3 in the lungs. This response is not observed in nonhuman primates infected with non-MTB bacterial pathogens, nor with simian immunodeficiency virus alone. Our data show that LAG3 was expressed primarily on CD4(+) T cells, presumably by regulatory T cells but also by natural killer cells. The expression of LAG3 coincides with high bacterial burdens and changes in the host type 1 helper T-cell response. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Analysis of APOBEC3A/3B germline deletion polymorphism in breast, cervical and oral cancers from South India and its impact on miRNA regulation.

PubMed

Revathidevi, Sundaramoorthy; Manikandan, Mayakannan; Rao, Arunagiri Kuha Deva Magendhra; Vinothkumar, Vilvanathan; Arunkumar, Ganesan; Rajkumar, Kottayasamy Seenivasagam; Ramani, Rajendran; Rajaraman, Ramamurthy; Ajay, Chandrasekar; Munirajan, Arasambattu Kannan

2016-09-01

Breast cancer and cervical cancer are the leading causes of death in women worldwide as well as in India, whilst oral cancer is the top most common cancer among Asian especially in Indian men in terms of both incidence and mortality rate. Genetic factors determining the predisposition to cancer are being explored to identify the signature genetic variations associated with these cancers. Recently, a germline deletion polymorphism in APOBEC3 gene cluster which completely deletes APOBEC3B coding region has been studied for its association with cancer risk. We screened the germline deletion polymorphism in 409 cancer patients (224 breast cancer, 88 cervical cancer and 97 oral cancer samples), 478 controls and 239 cervical cancer tissue DNAs of South Indian origin. The results suggest that the APOBEC3A/3B deletion polymorphism is not significantly associated with cancer risk in our study population (OR 0.739, 95 % CI, p value 0.91457). Considering the viral restriction property of APOBEC3s, we also screened cervical cancer tissue DNAs for the human papilloma virus infection. We observed a gradual increase in the frequency of HPV16 infection from AA/BB cases (66.86 %) to AA/-- cases (71.43) which signifies the impact of this deletion polymorphism in HPV infection. In addition, we performed in silico analysis to understand the effect of this polymorphism on miRNA regulation of the APOBEC3A/3B fusion transcript. Only 8 APOBEC3B targeting miRNAs were observed to regulate the fusion transcript of which miR-34b-3p and miR-138-5p were found to be frequently downregulated in cancers suggesting miRNA-mediated deregulation of APOBEC3A expression in cancer patients harbouring this particular deletion polymorphism.

Antiviral effect of emodin from Rheum palmatum against coxsakievirus B5 and human respiratory syncytial virus in vitro.

PubMed

Liu, Zhao; Ma, Nian; Zhong, Yan; Yang, Zhan-qiu

2015-12-01

Viral infections are the major causes of morbidity and mortality in elderly people and young children throughout the world. The most common pathogens include coxsackie virus (CV) and respiratory syncytial virus (RSV). However, no antiviral agents with low toxicity and drug resistance are currently available in clinic therapy. The present study aimed to examine the antiviral activities of emodin (an ingredient of Rheum palmatum) against CVB5 and RSV infections, in an attempt to discover new antiviral agents for virus infection. The monomer emodin was extracted and isolated from Rheum palmatum. The antiviral activities of emodin on HEp-2 cells were evaluated, including virus replication inhibition, virucidal and anti-absorption effects, by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tet-razolium bromide (MTT) assay and plaque reduction assay (PRA). The kinetics of virus inhibition by emodin in a period of 14 h was further determined by plaque assay and quantitative real time PCR (qPCR). Cytokine (IFN-γ, TNF-α) mRNA expressions after emodin treatment (7.5, 15, 30 μmol/L) were also assessed by qPCR post-infection. The results showed that emodin had potent inhibitory activities against CVB5 and RSV, with the 50% effective concentration (EC50) ranging from 13.06 to 14.27 μmol/L and selectivity index (SI) being 5.38-6.41 μmol/L. However, emodin couldn't directly inactivate the viruses or block their absorption to cells. It acted as a biological synthesis inhibitor against CVB4 and RSV in a concentration- and time-dependent manner, especially during the first 0-4 h post-infection. Moreover, emodin could decrease the mRNA expression of IFN-α but enhance TNF-γ expression significantly compared to the viral controls in vitro. Our results provide a molecular basis for development of emodin as a novel and safe antiviral agent for human enterovirus and respiratory virus infection in the clinical therapy.

Neuropsychology and neuropharmacology of P3a and P3b.

PubMed

Polich, John; Criado, José R

2006-05-01

Perspectives on the P300 event-related brain potential (ERP) are reviewed by outlining the distinction between the P3a and P3b subcomponents. The critical factor for eliciting P3a is how target/standard discrimination difficulty rather than novelty modulates task processing. The neural loci of P3a and P3b generation are sketched and a theoretical model is developed. P3a originates from stimulus-driven disruption of frontal attention engagement during task processing. P3b originates when temporal-parietal mechanisms process the stimulus information for memory storage. The neuropharmacological implications of this view are then outlined by evaluating how acute and chronic use of ethanol, marijuana, and nicotine affect P3a and P3b. The findings suggest that the circuit underlying ERP generation is influenced in a different ways for acute intake and varies between chronic use levels across drugs. Theoretical implications are assessed.

Urinary infection caused by Micrococcus subgroup 3

PubMed Central

Kerr, Helen

1973-01-01

The laboratory findings and clinical presentations in urinary infections in 23 nurses, 10 caused by Micrococcus subgroup 3 and 13 by Escherichia coli, were studied, and the symptoms and possible predisposing factors compared. There were no important differences between the two groups. The infections caused by Micrococcus subgroup 3 were symptomatically severe, as were those caused by Escherichia coli. PMID:4593863

Characterization of monoclonal antibodies against hepatitis C virus nonstructural protein 3: different antigenic determinants from human B cells.

PubMed

Ou-Yang, P; Chiang, B L; Hwang, L H; Chen, Y G; Yang, P M; Chi, W K; Chen, P J; Chen, D S

1999-04-01

The nonstructural (NS3) region protein of hepatitis C virus (HCV) possesses major B-cell epitopes that induce antibodies after infection. To elucidate further the characteristics of these B cells and their role in the immune regulation of HCV infection, T9 (portion of NS3 region, amino acids [a.a.] 1188-1493)-specific monoclonal antibodies were derived and mapped for B-cell antigenic determinants with recombinant proteins. A total of 10 T9-specific hybridomas were generated and tested for B-cell antigenic determinants. To analyze the B-cell antigenic determinants, eight recombinant proteins including NS3-e (a.a. 1175-1334), NS3-a' (a.a. 1175-1250), NS3-a (a.a. 1251-1334), NS3-b (a.a. 1323-1412), NS3-c (a.a. 1407-1499), NS3-a/b (a.a. 1251-1412), NS3-bc (a.a. 1323-1499), and NS3-abc (a.a. 1251-1499) encoded by NS3-region internal clones were expressed and tested for immunoblotting. The data suggested IgG hybridomas recognized NS3-a, NS3-a', or NS3-b protein by immunoblotting. By contrast, the NS3-e protein bears the major antigenic determinant recognized by human sera. Half of the hybridomas were found to react with protein NS3-a', which is not a major B-cell antigenic determinant in humans. These data suggested that conformational epitopes in vivo may be important for B-cell recognition.

APOBEC3B edits HBV DNA and inhibits HBV replication during reverse transcription.

PubMed

Chen, Yanmeng; Hu, Jie; Cai, Xuefei; Huang, Yao; Zhou, Xing; Tu, Zeng; Hu, Jieli; Tavis, John E; Tang, Ni; Huang, Ailong; Hu, Yuan

2018-01-01

Hepatitis B virus is a partially double-stranded DNA virus that replicates by reverse transcription, which occurs within viral core particles in the cytoplasm. The cytidine deaminase APOBEC3B is a cellular restriction factor for HBV. Recently, it was reported that APOBEC3B can edit HBV cccDNA in the nucleus, causing its degradation. However, whether and how it can edit HBV core-associated DNAs during reverse transcription is unclear. Our studies to address this question revealed the following: First, silencing endogenous APOBEC3B in an HBV infection system lead to upregulation of HBV replication. Second, APOBEC3B can inhibit replication of HBV isolates from genotypes (gt) A, B, C, and D as determined by employing transfection of plasmids expressing isolates from four different HBV genotypes. For HBV inhibition, APOBEC3B-mediated inhibition of replication primarily depends on the C-terminal active site of APOBEC3B. In addition, employing the HBV RNaseH-deficient D702A mutant and a polymerase-deficient YMHA mutant, we demonstrated that APOBEC3B can edit both the HBV minus- and plus-strand DNAs, but not the pregenomic RNA in core particles. Furthermore, we found by co-immunoprecipitation assays that APOBEC3B can interact with HBV core protein in an RNA-dependent manner. Our results provide evidence that APOBEC3B can interact with HBV core protein and edit HBV DNAs during reverse transcription. These data suggest that APOBEC3B exerts multifaceted antiviral effects against HBV. Copyright © 2017 Elsevier B.V. All rights reserved.

Infection of Female BWF1 Lupus Mice with Malaria Parasite Attenuates B Cell Autoreactivity by Modulating the CXCL12/CXCR4 Axis and Its Downstream Signals PI3K/AKT, NFκB and ERK

PubMed Central

Badr, Gamal; Sayed, Ayat; Abdel-Maksoud, Mostafa A.; Mohamed, Amany O.; El-Amir, Azza; Abdel-Ghaffar, Fathy A.; Al-Quraishy, Saleh; Mahmoud, Mohamed H.

2015-01-01

Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by abnormal autoreactivity in B cells. Lymphocytes and their soluble mediators contribute to the disease pathogenesis. We recently demonstrated that infecting lupus mice with malaria confers protection against lupus nephritis by attenuating oxidative stress in both liver and kidney tissues. In the current study, we further investigated B cell autoreactivity in female BWF1 lupus mice after infection with either live or gamma-irradiated malaria, using ELISA, flow cytometry and Western blot analysis. The lupus mice exhibited a significant elevation in plasma levels of IL-4, IL-6, IL-7, IL-12, IL-17, IFN-α, IFN-γ, TGF-β, BAFF and APRIL and a marked elevation of IgG2a, IgG3 and ant-dsDNA autoantibodies compared with normal healthy mice. Infecting lupus mice with live but not gamma-irradiated malaria parasite partially and significantly restored the levels of the soluble mediators that contribute to the progression of lupus. Furthermore, the B cells of lupus mice exhibited an increased proliferative capacity; aberrant overexpression of the chemokine receptor CXCR4; and a marked elevation in responsiveness to their cognate ligand (CXCL12) via aberrant activation of the PI3K/AKT, NFκB and ERK signaling pathways. Interestingly, infecting lupus mice with live but not gamma-irradiated malaria parasite restored a normal proliferative capacity, surface expression of CXCR4 and B cell response to CXCL-12. Taken together, our data present interesting findings that clarify, for the first time, the molecular mechanisms of how infection of lupus mice with malaria parasite controls B cell autoreactivity and thus confers protection against lupus severity. PMID:25909640

Infection of Female BWF1 Lupus Mice with Malaria Parasite Attenuates B Cell Autoreactivity by Modulating the CXCL12/CXCR4 Axis and Its Downstream Signals PI3K/AKT, NFκB and ERK.

PubMed

Badr, Gamal; Sayed, Ayat; Abdel-Maksoud, Mostafa A; Mohamed, Amany O; El-Amir, Azza; Abdel-Ghaffar, Fathy A; Al-Quraishy, Saleh; Mahmoud, Mohamed H

2015-01-01

Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by abnormal autoreactivity in B cells. Lymphocytes and their soluble mediators contribute to the disease pathogenesis. We recently demonstrated that infecting lupus mice with malaria confers protection against lupus nephritis by attenuating oxidative stress in both liver and kidney tissues. In the current study, we further investigated B cell autoreactivity in female BWF1 lupus mice after infection with either live or gamma-irradiated malaria, using ELISA, flow cytometry and Western blot analysis. The lupus mice exhibited a significant elevation in plasma levels of IL-4, IL-6, IL-7, IL-12, IL-17, IFN-α, IFN-γ, TGF-β, BAFF and APRIL and a marked elevation of IgG2a, IgG3 and ant-dsDNA autoantibodies compared with normal healthy mice. Infecting lupus mice with live but not gamma-irradiated malaria parasite partially and significantly restored the levels of the soluble mediators that contribute to the progression of lupus. Furthermore, the B cells of lupus mice exhibited an increased proliferative capacity; aberrant overexpression of the chemokine receptor CXCR4; and a marked elevation in responsiveness to their cognate ligand (CXCL12) via aberrant activation of the PI3K/AKT, NFκB and ERK signaling pathways. Interestingly, infecting lupus mice with live but not gamma-irradiated malaria parasite restored a normal proliferative capacity, surface expression of CXCR4 and B cell response to CXCL-12. Taken together, our data present interesting findings that clarify, for the first time, the molecular mechanisms of how infection of lupus mice with malaria parasite controls B cell autoreactivity and thus confers protection against lupus severity.

Genotyping of occult hepatitis B virus infection in Egyptian hemodialysis patients without hepatitis C virus infection.

PubMed

Esmail, Mona A; Mahdi, Wafaa K M; Khairy, Rasha M; Abdalla, Nilly H

2016-01-01

Occult hepatitis B viral infection is the presence of hepatitis B viral nucleic acids in the serum and/or liver in the absence of hepatitis B surface antigen. The study aimed to determine the prevalence of occult hepatitis B virus infection among hepatitis C virus-negative hemodialysis patients and to identify their genotypes. of 144 patients on maintenance hemodialysis, 50 hepatitis B surface antigen and hepatitis C virus nucleic acid-negative patients were selected according to strict inclusion criteria to avoid the effect of confounding variables. The following investigations were done: serum AST and ALT; HBsAg; HBcAb; HCV-Ab; HCV-RNA; and HBV-DNA. Positive hepatitis B viral nucleic acid was confirmed in 12/144 (8.3%) hemodialysis patients and 12/50 (24%) in our study group (occult infection). Mean hemodialysis periods for negative patients and occult hepatitis B virus patients were 27.3±18.8 and 38.4±8.14 months, respectively, and this difference was significant (p-value=0.02). Mean alanine transaminase levels were 20.27±5.5IU/L and 25.3±9.6 in negative patients and occult infection patients, respectively. This difference was non-significant. Aspartate transaminase levels were 21.4±10.2IU/L and 27.3±4.6IU/L, respectively, in negative patients and infected patients; this difference was significant (p-value=0.03). Half (6/12) of the positive samples belonged to genotype 'B', 33.3% (4/12) to 'C', and 16.6% (2/12) to genotype 'D'. OBI is likely among hemodialysis patients even without HCV coinfection (24%). Genotype D cannot be the only genotype distributed in Upper Egypt, as the current study reported relatively new results that 50% of the patients with occult B carry genotype B, 33.3% carry genotype C and only 16.6% carry genotype D. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Hepatitis B infection among HIV infected individuals in Gabon: Occult hepatitis B enhances HBV DNA prevalence

PubMed Central

Amougou-Atsama, Marie; Zoa-Assoumou, Samira; M’boyis Kamdem, Hervé; Nzengui-Nzengui, Guy Francis; Ndojyi-Mbiguino, Angélique; Njouom, Richard; François-Souquière, Sandrine

2018-01-01

In Gabon, a central African country, human immunodeficiency virus (HIV) and hepatitis B virus (HBV) are endemic. In a recent study, conducted in a semi-urban area (Franceville, Gabon), HBV infection was found to be more prevalent among HIV infected individuals. This study aims to investigate the prevalence and genetic diversity of hepatitis B virus infection among HIV infected individuals, predominantly under antiretroviral therapy, living in fully urbanized area: Libreville, capital of Gabon. Serological and molecular tests were performed to detect HBV infection among patients living with HIV/AIDS (PLHA). We used Monolisa HBsAg ULTRA, Anti-HBc Plus and Anti-HBs Plus EIA kits for serological analyses. HBV DNA viral load (HBV DNA VL) was determined by real time PCR and molecular characterization of HBV strains was performed by sequencing and phylogenetic analysis of partial HBV surface and core genes. At all, 70.2% of patients were under antiretroviral therapy. The prevalence of HBsAg was 8.8% (43/487). Detectable HBV DNA was found in 69.7% (30/43) of HBsAg positive patients and in 17.5% (24/137) HBsAg negative patients. HBV DNA VL was significantly higher among patient with CD4 cell counts less than 200 cells/mm3 than those with CD4 cell counts greater than 500 cells/mm3 (p = 0.008). We confirmed the presence of HBV sub-genotypes QS-A3 (40%), and A4 (20%) and HBV-E genotype (40%). The percentage of resistance to Lamivudine was high (40%) and varied according to the M204V/I motif. Occult hepatitis B infection (OBI) was found in patients with isolated HBcAb and among patients who had completed their HBsAg seroconversion. We detected HBV DNA for one patient without any HBV serological marker. This study provides a new landmark for the comprehension of HBV infection in PLHA in urban areas. OBI enhances HBV DNA prevalence and should be investigated in all HBsAg negative individuals. PMID:29315352

Hepatitis B infection among HIV infected individuals in Gabon: Occult hepatitis B enhances HBV DNA prevalence.

PubMed

Bivigou-Mboumba, Berthold; Amougou-Atsama, Marie; Zoa-Assoumou, Samira; M'boyis Kamdem, Hervé; Nzengui-Nzengui, Guy Francis; Ndojyi-Mbiguino, Angélique; Njouom, Richard; François-Souquière, Sandrine

2018-01-01

In Gabon, a central African country, human immunodeficiency virus (HIV) and hepatitis B virus (HBV) are endemic. In a recent study, conducted in a semi-urban area (Franceville, Gabon), HBV infection was found to be more prevalent among HIV infected individuals. This study aims to investigate the prevalence and genetic diversity of hepatitis B virus infection among HIV infected individuals, predominantly under antiretroviral therapy, living in fully urbanized area: Libreville, capital of Gabon. Serological and molecular tests were performed to detect HBV infection among patients living with HIV/AIDS (PLHA). We used Monolisa HBsAg ULTRA, Anti-HBc Plus and Anti-HBs Plus EIA kits for serological analyses. HBV DNA viral load (HBV DNA VL) was determined by real time PCR and molecular characterization of HBV strains was performed by sequencing and phylogenetic analysis of partial HBV surface and core genes. At all, 70.2% of patients were under antiretroviral therapy. The prevalence of HBsAg was 8.8% (43/487). Detectable HBV DNA was found in 69.7% (30/43) of HBsAg positive patients and in 17.5% (24/137) HBsAg negative patients. HBV DNA VL was significantly higher among patient with CD4 cell counts less than 200 cells/mm3 than those with CD4 cell counts greater than 500 cells/mm3 (p = 0.008). We confirmed the presence of HBV sub-genotypes QS-A3 (40%), and A4 (20%) and HBV-E genotype (40%). The percentage of resistance to Lamivudine was high (40%) and varied according to the M204V/I motif. Occult hepatitis B infection (OBI) was found in patients with isolated HBcAb and among patients who had completed their HBsAg seroconversion. We detected HBV DNA for one patient without any HBV serological marker. This study provides a new landmark for the comprehension of HBV infection in PLHA in urban areas. OBI enhances HBV DNA prevalence and should be investigated in all HBsAg negative individuals.

Epidemiology of hepatitis B infection in Liberian infants.

PubMed

Prince, A M; White, T; Pollock, N; Riddle, J; Brotman, B; Richardson, L

1981-05-01

To provide background for a hepatitis B vaccine efficacy trial, sera were collected from 0- to 4-year-old Liberian infants and their mothers, on two occasions an average of 14.75 months apart, and tested for serological markers of hepatitis B virus infection. The prevalence of the hepatitis B surface antigen (HBsAg) was 2.9% in the 0- to 6-month age group and 23% in infants 3 to 4 years of age. HBsAg persisted for the 14.75-month average follow-up period in 80.8% of the infants tested. The annual incidence of development of HBsAg was 18.9% for infants less than 1 year of age and 13.6% in infants 3 to 4 years of age. Infants born to HBsAg carrier mothers had significantly higher age-specific prevalence and incidence of hepatitis B virus infection. However, it was estimated that only a minor proportion of hepatitis B infections in Liberia are derived by vertical transmission from carrier mothers.

Hepatitis B virus infection in Indonesia.

PubMed

Yano, Yoshihiko; Utsumi, Takako; Lusida, Maria Inge; Hayashi, Yoshitake

2015-10-14

Approximately 240 million people are chronically infected with hepatitis B virus (HBV), 75% of whom reside in Asia. Approximately 600000 of infected patients die each year due to HBV-related diseases or hepatocellular carcinoma (HCC). The endemicity of hepatitis surface antigen in Indonesia is intermediate to high with a geographical difference. The risk of HBV infection is high in hemodialysis (HD) patients, men having sex with men, and health care workers. Occult HBV infection has been detected in various groups such as blood donors, HD patients, and HIV-infected individuals and children. The most common HBV subgenotype in Indonesia is B3 followed by C1. Various novel subgenotypes of HBV have been identified throughout Indonesia, with the novel HBV subgenotypes C6-C16 and D6 being successfully isolated. Although a number of HBV subgenotypes have been discovered in Indonesia, genotype-related pathogenicity has not yet been elucidated in detail. Therefore, genotype-related differences in the prognosis of liver disease and their effects on treatments need to be determined. A previous study conducted in Indonesia revealed that hepatic steatosis was associated with disease progression. Pre-S2 mutations and mutations at C1638T and T1753V in HBV/B3 have been associated with advanced liver diseases including HCC. However, drug resistance to lamivudine, which is prominent in Indonesia, remains obscure. Although the number of studies on HBV in Indonesia has been increasing, adequate databases on HBV infection are limited. We herein provided an overview of the epidemiology and clinical characteristics of HBV infection in Indonesia.

Hepatitis B virus infection in Indonesia

PubMed Central

Yano, Yoshihiko; Utsumi, Takako; Lusida, Maria Inge; Hayashi, Yoshitake

2015-01-01

Approximately 240 million people are chronically infected with hepatitis B virus (HBV), 75% of whom reside in Asia. Approximately 600000 of infected patients die each year due to HBV-related diseases or hepatocellular carcinoma (HCC). The endemicity of hepatitis surface antigen in Indonesia is intermediate to high with a geographical difference. The risk of HBV infection is high in hemodialysis (HD) patients, men having sex with men, and health care workers. Occult HBV infection has been detected in various groups such as blood donors, HD patients, and HIV-infected individuals and children. The most common HBV subgenotype in Indonesia is B3 followed by C1. Various novel subgenotypes of HBV have been identified throughout Indonesia, with the novel HBV subgenotypes C6-C16 and D6 being successfully isolated. Although a number of HBV subgenotypes have been discovered in Indonesia, genotype-related pathogenicity has not yet been elucidated in detail. Therefore, genotype-related differences in the prognosis of liver disease and their effects on treatments need to be determined. A previous study conducted in Indonesia revealed that hepatic steatosis was associated with disease progression. Pre-S2 mutations and mutations at C1638T and T1753V in HBV/B3 have been associated with advanced liver diseases including HCC. However, drug resistance to lamivudine, which is prominent in Indonesia, remains obscure. Although the number of studies on HBV in Indonesia has been increasing, adequate databases on HBV infection are limited. We herein provided an overview of the epidemiology and clinical characteristics of HBV infection in Indonesia. PMID:26478663

The role of FaBG3 in fruit ripening and B. cinerea fungal infection of strawberry.

PubMed

Li, Qian; Ji, Kai; Sun, Yufei; Luo, Hao; Wang, Hongqing; Leng, Ping

2013-10-01

In plants, β-glucosidases (BG) have been implicated in developmental and pathogen defense, and are thought to take part in abscisic acid (ABA) synthesis via hydrolysis of ABA glucose ester to release active ABA; however, there is no genetic evidence for the role of BG genes in ripening and biotic/abiotic stress in fruits. To clarify the role of BG genes in fruit, eight Fa/FvBG genes encoding β-glucosidase were isolated using information from the GenBank strawberry nucleotide database. Of the Fa/FvBG genes examined, expression of FaBG3 was the highest, showing peaks at the mature stage, coincident with the changes observed in ABA content. To verify the role of this gene, we suppressed the expression of FaBG3 via inoculation with Agrobacterium tumefaciens containing tobacco rattle virus carrying a FaBG3 fragment (RNAi). The expression of FaBG3 in FaBG3-RNAi-treated fruit was markedly reduced, and the ABA content was lower than that of the control. FaBG3-RNAi-treated fruit did not exhibit full ripening, and were firmer, had lower sugar content, and were pale compared with the control due to down-regulation of ripening-related genes. FaBG3-RNAi-treated fruit with reduced ABA levels were much more resistant to Botrytis cinerea fungus but were more sensitive to dehydration stress than control fruit. These results indicate that FaBG3 may play key roles in fruit ripening, dehydration stress and B. cinerea fungal infection in strawberries via modulation of ABA homeostasis and transcriptional regulation of ripening-related genes. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Targeted delivery of anti-coxsackievirus siRNAs using ligand-conjugated packaging RNAs.

PubMed

Zhang, Huifang M; Su, Yue; Guo, Songchuan; Yuan, Ji; Lim, Travis; Liu, Jing; Guo, Peixuan; Yang, Decheng

2009-09-01

Coxsackievirus B3 (CVB3) is a common pathogen of myocarditis. We previously synthesized a siRNA targeting the CVB3 protease 2A (siRNA/2A) gene and achieved reduction of CVB3 replication by 92% in vitro. However, like other drugs under development, CVB3 siRNA faces a major challenge of targeted delivery. In this study, we investigated a novel approach to deliver CVB3 siRNAs to a specific cell population (e.g. HeLa cells containing folate receptor) using receptor ligand (folate)-linked packaging RNA (pRNA) from bacterial phage phi29. pRNA monomers can spontaneously form dimers and multimers under optimal conditions by base-pairing between their stem loops. By covalently linking a fluorescence-tag to folate, we delivered the conjugate specifically to HeLa cells without the need of transfection. We further demonstrated that pRNA covalently conjugated to siRNA/2A achieved an equivalent antiviral effect to that of the siRNA/2A alone. Finally, the drug targeted delivery was further evaluated by using pRNA monomers or dimers, which carried both the siRNA/2A and folate ligand and demonstrated that both of them strongly inhibited CVB3 replication. These data indicate that pRNA as a siRNA carrier can specifically deliver the drug to target cells via its ligand and specific receptor interaction and inhibit virus replication effectively.

A Revised Mechanism for the Activation of Complement C3 to C3b

PubMed Central

Rodriguez, Elizabeth; Nan, Ruodan; Li, Keying; Gor, Jayesh; Perkins, Stephen J.

2015-01-01

The solution structure of complement C3b is crucial for the understanding of complement activation and regulation. C3b is generated by the removal of C3a from C3. Hydrolysis of the C3 thioester produces C3u, an analog of C3b. C3b cleavage results in C3c and C3d (thioester-containing domain; TED). To resolve functional questions in relation to C3b and C3u, analytical ultracentrifugation and x-ray and neutron scattering studies were used with C3, C3b, C3u, C3c, and C3d, using the wild-type allotype with Arg102. In 50 mm NaCl buffer, atomistic scattering modeling showed that both C3b and C3u adopted a compact structure, similar to the C3b crystal structure in which its TED and macroglobulin 1 (MG1) domains were connected through the Arg102–Glu1032 salt bridge. In physiological 137 mm NaCl, scattering modeling showed that C3b and C3u were both extended in structure, with the TED and MG1 domains now separated by up to 6 nm. The importance of the Arg102–Glu1032 salt bridge was determined using surface plasmon resonance to monitor the binding of wild-type C3d(E1032) and mutant C3d(A1032) to immobilized C3c. The mutant did not bind, whereas the wild-type form did. The high conformational variability of TED in C3b in physiological buffer showed that C3b is more reactive than previously thought. Because the Arg102-Glu1032 salt bridge is essential for the C3b-Factor H complex during the regulatory control of C3b, the known clinical associations of the major C3S (Arg102) and disease-linked C3F (Gly102) allotypes of C3b were experimentally explained for the first time. PMID:25488663

Enterocin B3A-B3B produced by LAB collected from infant faeces: potential utilization in the food industry for Listeria monocytogenes biofilm management.

PubMed

Al-Seraih, Alaa; Belguesmia, Yanath; Baah, John; Szunerits, Sabine; Boukherroub, Rabah; Drider, Djamel

2017-02-01

Enterococcus faecalis B3A-B3B produces the bacteriocin B3A-B3B with activity against Listeria monocytogenes, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA) and Clostridium perfringens, but apparently not against fungi or Gram-negative bacteria, except for Salmonella Newport. B3A-B3B enterocin has two different nucleotides but similar amino acid composition to the class IIb MR10A-MR10B enterocin. B3A-B3B consists of two peptides of predicted molecular mass of 5176.31 Da (B3A) and 5182.21 Da (B3B). Importantly, B3A-B3B impeded biofilm formation of the foodborne pathogen L. monocytogenes 162 grown on stainless steel. The antimicrobial treatment of stainless steel with nisin (1 or 16 mg ml -1 ) decreased the cell numbers by about 2 log CFU ml -1 , thereby impeding the biofilm formation by L. monocytogenes 162 or its nisin-resistant derivative strain L. monocytogenes 162R. Furthermore, the combination of nisin and B3A-B3B enterocin reduced the MIC required to inhibit this pathogen grown in planktonic or biofilm cultures.

Structure of C3b reveals conformational changes that underlie complement activity.

PubMed

Janssen, Bert J C; Christodoulidou, Agni; McCarthy, Andrew; Lambris, John D; Gros, Piet

2006-11-09

Resistance to infection and clearance of cell debris in mammals depend on the activation of the complement system, which is an important component of innate and adaptive immunity. Central to the complement system is the activated form of C3, called C3b, which attaches covalently to target surfaces to amplify complement response, label cells for phagocytosis and stimulate the adaptive immune response. C3b consists of 1,560 amino-acid residues and has 12 domains. It binds various proteins and receptors to effect its functions. However, it is not known how C3 changes its conformation into C3b and thereby exposes its many binding sites. Here we present the crystal structure at 4-A resolution of the activated complement protein C3b and describe the conformational rearrangements of the 12 domains that take place upon proteolytic activation. In the activated form the thioester is fully exposed for covalent attachment to target surfaces and is more than 85 A away from the buried site in native C3 (ref. 5). Marked domain rearrangements in the alpha-chain present an altered molecular surface, exposing hidden and cryptic sites that are consistent with known putative binding sites of factor B and several complement regulators. The structural data indicate that the large conformational changes in the proteolytic activation and regulation of C3 take place mainly in the first conversion step, from C3 to C3b. These insights are important for the development of strategies to treat immune disorders that involve complement-mediated inflammation.

Nitrative DNA damage and Oct3/4 expression in urinary bladder cancer with Schistosomahaematobium infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, Ning; Thanan, Raynoo; Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie

Highlights: {yields} Oct3/4-positive cells increase in Schistosoma haematobium (SH)-associated bladder cancer. {yields} iNOS-dependent DNA lesion, 8-nitroguanine, was formed in Oct3/4-positive cells. {yields} 8-Nitroguanine formed in stem-like cells plays a role in SH-induced carcinogenesis. {yields} Mutant stem cells may participate in inflammation-related carcinogenesis. -- Abstract: To investigate whether mutant stem cells participate in inflammation-related carcinogenesis, we performed immunohistochemical analysis to examine nitrative and oxidative DNA lesions (8-nitroguanine and 8-oxodG) and a stem cell marker Oct3/4 in bladder tissues obtained from cystitis and bladder cancer patients infected with Schistosomahaematobium (S. haematobium). We also detected the expression of nuclear factor-{kappa}B (NF-{kappa}B) and induciblemore » nitric oxide synthase (iNOS), which lead to 8-nitroguanine formation. The staining intensity of 8-nitroguanine and 8-oxodG was significantly higher in bladder cancer and cystitis tissues than in normal tissues. iNOS expression was colocalized with NF-{kappa}B in 8-nitroguanine-positive tumor cells from bladder cancer patients. Oct3/4 expression was significantly increased in cells from S. haematobium-associated bladder cancer tissues in comparison to normal bladder and cancer tissues without infection. Oct3/4 was also expressed in epithelial cells of cystitis patients. Moreover, 8-nitroguanine was formed in Oct3/4-positive stem cells in S. haematobium-associated cystitis and cancer tissues. In conclusion, inflammation by S.haematobium infection may increase the number of mutant stem cells, in which iNOS-dependent DNA damage occurs via NF-{kappa}B activation, leading to tumor development.« less

45 CFR 5b.3 - Policy.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 45 Public Welfare 1 2012-10-01 2012-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent possible...

EBNA3C regulates p53 through induction of Aurora kinase B

PubMed Central

Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

2015-01-01

In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

Control of the immune response by DHEA and its metabolites.

PubMed

Loria, R M; Padgett, D A

1998-06-01

The 17 keto steroid, Dehydroepiandrosterone (5-androsten-3 beta-17-one, DHEA) has been shown to protect mice from a variety of lethal infections. This includes, but is not limited to, infection with viruses (herpesvirus type 2, coxsackievirus B4-CVB4),bacteria (Enterococcus faecalis, Pseudomonas aeruginosa), and a parasite (Cryptosporidium parvum). We have reported that androstenediol (5-androsten-3 beta-17 beta-diol, beta AED), which is derived from DHEA, is at least 100x more effective in up-regulating systemic resistance against CVB4-infection than its precursor. Furthermore, androstenetriol (5-androstene-3 beta-7 beta-17 beta-triol beta AET) which is formed by 7 beta hydroxylation of beta AED, was more effective against CVB4-infection than its precursor beta AED. Neither steroid however has shown any significant direct antiviral effects. The in-vitro influences of DHEA, beta AED, and beta AET on a mitogen-induced mixed splenocyte proliferation assay were determined. The results showed that DHEA suppressed the proliferation of concanavalin A (Con A) or lipopolysaccharide (LPS) activated cultures in a dose dependent manner. beta AED had little influence on the activation response. However, beta AET potentiated the response to both mitogens significantly above control. The regulation of interleukin-2 and interleukin-3 secretion from Con A-activated lymphocytes was analogous to these observations. These functions were suppressed by DHEA, unaffected by beta AED, and potently increased by beta AET. Moreover, the classic immuno-suppressive effects of hydro-cortisone on Con A-induced lymphocyte proliferation, as well as IL-2 and IL-3 production were unaffected by co-cultured with DHEA and only minimally counteracted by beta AED. In contrast, beta AET significantly counteracted the effect of hydrocortisone when co-cultured together. These results show that while in-vivo, DHEA, beta AED, and beta AET each function in a similar manner. In-vitro, their effects are

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

8-Prenylkaempferol Suppresses Influenza A Virus-Induced RANTES Production in A549 Cells via Blocking PI3K-Mediated Transcriptional Activation of NF-κB and IRF3

PubMed Central

Chiou, Wen-Fei; Chen, Chen-Chih; Wei, Bai-Luh

2011-01-01

8-Prenylkaempferol (8-PK) is a prenylflavonoid isolated from Sophora flavescens, a Chinese herb with antiviral and anti-inflammatory properties. In this study, we investigated its effect on regulated activation, normal T cell expressed and secreted (RANTES) secretion by influenza A virus (H1N1)-infected A549 alveolar epithelial cells. Cell inoculation with H1N1 evoked a significant induction in RANTES accumulation accompanied with time-related increase in nuclear translocation of nuclear factor-κB (NF-κB) and interferon regulatory factor 3 (IRF-3), but showed no effect on c-Jun phosphorylation. 8-PK could significantly inhibit not only RANTES production but also NF-κB and IRF-3 nuclear translocation. We had proved that both NF-κB and IRF-3 participated in H1N1-induced RANTES production since NF-κB inhibitor pyrrolidinedithio carbamate (PDTC) and IRF-3 siRNA attenuated significantly RANTES accumulation. H1N1 inoculation also increased PI3K activity as well as Akt phosphorylation and such responsiveness were attenuated by 8-PK. In the presence of wortmannin, nuclear translocation of NF-κB and IRF3 as well as RANTES production by H1N1 infection were all reversed, demonstrating that PI3K-Akt pathway is essential for NF-κB- and IRF-3-mediated RANTES production in A549 cells. Furthermore, 8-PK but not wortmannin, prevented effectively H1N1-evoked IκB degradation. In conclusion, 8-PK might be an anti-inflammatory agent for suppressing influenza A virus-induced RANTES production acts by blocking PI3K-mediated transcriptional activation of NF-κB and IRF-3 and in part by interfering with IκB degradation which subsequently decreases NF-κB translocation. PMID:19592477

8 CFR 343b.3 - Interrogation.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Interrogation. 343b.3 Section 343b.3 Aliens... NATURALIZATION FOR RECOGNITION BY A FOREIGN STATE § 343b.3 Interrogation. When Form N-565 presents a prima facie... issuance of the certificate. Interrogation of the applicant shall be conducted before the application is...

8 CFR 343b.3 - Interrogation.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Interrogation. 343b.3 Section 343b.3 Aliens... NATURALIZATION FOR RECOGNITION BY A FOREIGN STATE § 343b.3 Interrogation. When Form N-565 presents a prima facie... issuance of the certificate. Interrogation of the applicant shall be conducted before the application is...

34 CFR 5b.3 - Policy.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 34 Education 1 2012-07-01 2012-07-01 false Policy. 5b.3 Section 5b.3 Education Office of the Secretary, Department of Education PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent possible while nonetheless permitting the...

45 CFR 5b.3 - Policy.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is... public is entitled to have under the Freedom of Information Act, 5 U.S.C. 552, and part 5 of this title. ...

BvrR/BvrS-Controlled Outer Membrane Proteins Omp3a and Omp3b Are Not Essential for Brucella abortus Virulence▿

PubMed Central

Manterola, Lorea; Guzmán-Verri, Caterina; Chaves-Olarte, Esteban; Barquero-Calvo, Elías; de Miguel, María-Jesús; Moriyón, Ignacio; Grilló, María-Jesús; López-Goñi, Ignacio; Moreno, Edgardo

2007-01-01

The Brucella abortus two-component regulatory system BvrR/BvrS controls the expression of outer membrane proteins (Omp) Omp3a (Omp25) and Omp3b (Omp22). Disruption of bvrS or bvrR generates avirulent mutants with altered cell permeability, higher sensitivity to microbicidal peptides, and complement. Consequently, the role of Omp3a and Omp3b in virulence was examined. Similar to bvrS or bvrR mutants, omp3a and omp3b mutants displayed increased attachment to cells, indicating surface alterations. However, they showed unaltered permeability; normal expression of Omp10, Omp16, Omp19, Omp2b, and Omp1; native hapten polysaccharide; and lipopolysaccharide and were resistant to complement and polymyxin B at ranges similar to those of the wild-type (WT) counterpart. Likewise, omp3a and omp3b mutants were able to replicate in murine macrophages and in HeLa cells, were resistant to the killing action of human neutrophils, and persisted in mice, like the WT strain. Murine macrophages infected with the omp3a mutant generated slightly higher levels of tumor necrosis factor alpha than the WT, whereas the bvrS mutant induced lower levels of this cytokine. Since the absence of Omp3a or Omp3b does not result in attenuation, it can be concluded that BvrR/BvrS influences additional Brucella properties involved in virulence. Our results are discussed in the light of previous works suggesting that disruption of omp3a generates attenuated Brucella strains, and we speculate on the role of group 3 Omps. PMID:17664262

Mycoplasmal Infections Prevent Apoptosis and Induce Malignant Transformation of Interleukin-3-Dependent 32D Hematopoietic Cells

PubMed Central

Feng, Shaw-Huey; Tsai, Shien; Rodriguez, Jose; Lo, Shyh-Ching

1999-01-01

32D cells, a murine myeloid cell line, rapidly undergo apoptosis upon withdrawal of interleukin-3 (IL-3) supplement in culture. We found that 32D cells, if infected by several species of human mycoplasmas that rapidly activated NF-κB, would live and continue to grow in IL-3-depleted culture. Mycoplasma-infected cells showed no evidence of autocrine production of IL-3. Pyrrolidine dithiocarbamate (PDTC) blocked activation of NF-κB and led to prominent cell death. Heat-killed mycoplasmas or mycoplasmal membrane preparations alone could support continued growth of 32D cells in culture without IL-3 supplement for a substantial period of time. However, upon removal of heat-inactivated mycoplasmas, 32D cells quickly became apoptotic. In comparison, live Mycoplasma fermentans or M. penetrans infection for 4 to 5 weeks induced malignant transformation of 32D cells. Transformed 32D cells grew autonomously and no longer required support of growth-stimulating factors including IL-3 and mycoplasmas. The transformed 32D cells quickly formed tumors when injected into nude mice. Karyotyping showed that development of chromosomal changes and trisomy 19 was often associated with malignant transformation and tumorigenicity of 32D cells. Mycoplasmal infections apparently affected the fidelity of genomic transmission in cell division as well as checkpoints coordinating the progression of cell cycle events. PMID:10567525

Genome-wide Association Study Implicates PARD3B-based AIDS Restriction

PubMed Central

Nelson, George W.; Lautenberger, James A.; Chinn, Leslie; McIntosh, Carl; Johnson, Randall C.; Sezgin, Efe; Kessing, Bailey; Malasky, Michael; Hendrickson, Sher L.; Pontius, Joan; Tang, Minzhong; An, Ping; Winkler, Cheryl A.; Limou, Sophie; Le Clerc, Sigrid; Delaneau, Olivier; Zagury, Jean-François; Schuitemaker, Hanneke; van Manen, Daniëlle; Bream, Jay H.; Gomperts, Edward D.; Buchbinder, Susan; Goedert, James J.; Kirk, Gregory D.; O'Brien, Stephen J.

2011-01-01

Background. Host genetic variation influences human immunodeficiency virus (HIV) infection and progression to AIDS. Here we used clinically well-characterized subjects from 5 pretreatment HIV/AIDS cohorts for a genome-wide association study to identify gene associations with rate of AIDS progression. Methods.  European American HIV seroconverters (n = 755) were interrogated for single-nucleotide polymorphisms (SNPs) (n = 700,022) associated with progression to AIDS 1987 (Cox proportional hazards regression analysis, co-dominant model). Results.  Association with slower progression was observed for SNPs in the gene PARD3B. One of these, rs11884476, reached genome-wide significance (relative hazard = 0.3; P =3. 370 × 10−9) after statistical correction for 700,022 SNPs and contributes 4.52% of the overall variance in AIDS progression in this study. Nine of the top-ranked SNPs define a PARD3B haplotype that also displays significant association with progression to AIDS (hazard ratio, 0.3; P = 3.220 × 10−8). One of these SNPs, rs10185378, is a predicted exonic splicing enhancer; significant alteration in the expression profile of PARD3B splicing transcripts was observed in B cell lines with alternate rs10185378 genotypes. This SNP was typed in European cohorts of rapid progressors and was found to be protective for AIDS 1993 definition (odds ratio, 0.43, P = .025). Conclusions. These observations suggest a potential unsuspected pathway of host genetic influence on the dynamics of AIDS progression. PMID:21502085

[Multiple myeloma and HIV infection: report of 3 cases].

PubMed

Elira Dokekias, A; Moutschen, M; Purhuence, M F; Malanda, F; Moyikoua, A

2004-02-01

HIV infection rages at the endemic state in Sub Saharan African and especially in Congo Brazzaville. We report the observation of three female patients infected with HIV and developing multiple myeloma. The three patients were treated at the University hospital of Brazzaville between 2000 and 2002. In two cases multiple myeloma was discovered after the diagnosis of HIV infection. In the other case, the diagnosis of HIV infection was posterior to the occurrence of multiple myeloma. HIV infection was symptomatic in two cases who received consequently antiviral treatment. Multiple myeloma was diagnosed at an advanced stage in the three cases. The paraprotein was an IgG in two cases and an IgA in the other one. The CD4 counts before treatment were around 200/mm3 in two cases and within normal limits in the third case. Viral load was not measured. VMCP and VAMCP regimens were administered without major complications and under anti-infectious prophylaxis. The follow-up is still insufficient to assess the medium-term evolution and to determine the prognosis of multiple myeloma. The description of these three cases confirms the involvement of HIV in B cell lymphoma genesis.

Structure-based discovery of clinically approved drugs as Zika virus NS2B-NS3 protease inhibitors that potently inhibit Zika virus infection in vitro and in vivo.

PubMed

Yuan, Shuofeng; Chan, Jasper Fuk-Woo; den-Haan, Helena; Chik, Kenn Ka-Heng; Zhang, Anna Jinxia; Chan, Chris Chung-Sing; Poon, Vincent Kwok-Man; Yip, Cyril Chik-Yan; Mak, Winger Wing-Nga; Zhu, Zheng; Zou, Zijiao; Tee, Kah-Meng; Cai, Jian-Piao; Chan, Kwok-Hung; de la Peña, Jorge; Pérez-Sánchez, Horacio; Cerón-Carrasco, José Pedro; Yuen, Kwok-Yung

2017-09-01

Zika virus (ZIKV) infection may be associated with severe complications in fetuses and adults, but treatment options are limited. We performed an in silico structure-based screening of a large chemical library to identify potential ZIKV NS2B-NS3 protease inhibitors. Clinically approved drugs belonging to different drug classes were selected among the 100 primary hit compounds with the highest predicted binding affinities to ZIKV NS2B-NS3-protease for validation studies. ZIKV NS2B-NS3 protease inhibitory activity was validated in most of the selected drugs and in vitro anti-ZIKV activity was identified in two of them (novobiocin and lopinavir-ritonavir). Molecular docking and molecular dynamics simulations predicted that novobiocin bound to ZIKV NS2B-NS3-protease with high stability. Dexamethasone-immunosuppressed mice with disseminated ZIKV infection and novobiocin treatment had significantly (P < 0.05) higher survival rate (100% vs 0%), lower mean blood and tissue viral loads, and less severe histopathological changes than untreated controls. This structure-based drug discovery platform should facilitate the identification of additional enzyme inhibitors of ZIKV. Copyright © 2017 Elsevier B.V. All rights reserved.

Using new non-invasive quick method to detect Borrelia Burgdorferi (B.B.) infection from specific parts of the heart in "seemingly normal" ECGs, and from the ECGs of Atrial Fibrillation (AF), a majority of AF ECGs are found to have: 1) Significant B.B. infection, 2) Markedly increased ANP, 3) Increased Cardiac Troponin I & 4) Markedly reduced Taurine. These 4 factors were mainly localized at infected areas of the SA node area, R-&L-Atria & pulmonary veins at the L-atrium.

PubMed

Omura, Yoshiaki; Lu, Dominic; Jones, Marilyn K; Nihrane, Abdallah; Duvvi, Harsha; Yapor, Dario; Shimotsuura, Yasuhiro; Ohki, Motomu

2015-01-01

Lyme disease is found in a majority of people we tested. Once Borrelia Burgdorferi (B.B.) spirochete enters human body, it not only causes pain by infecting joints, but it also often enters the brain and the heart. Infection of brain can be quickly detected from the pupil and infection of the heart by ECGs non-invasively. By evaluating recorded ECGs of atrial fibrillation (AF), using U.S. patented non-invasive highly sensitive electromagnetic field (EMF) resonance phenomenon between 2 identical molecules or between a molecule and its antibody, we examined 25 different AF patients' ECGs and found the majority of them suffer from various degrees of B.B. spirochete infection in SA node areas, also in the right & left atria, and pulmonary vein near and around its junction at left atrium & lesser degrees of infection at the AV node & His Bundle. When B.B. infection reaches over 224-600ng or higher at these areas, AF often appears in the majority of all AF analyzed. In order to develop AF, the 4 abnormal factors must be present simultaneously: 1) B.B. infection must be increased to 224-600ng or higher, 2) Atrial Natriuretic Peptide (ANP) must be markedly reduced from normal value of less than 4ng to over 100-400ng, 3) A significant increase of Cardiac Troponin I from normal value of less than 3ng to over 12ng and 4) Taurine must also be markedly reduced from normal value of 4-6ng to 0.25ng. These 4 changes were mainly found only at infected sites of the SA node area, both atria and between the end of the T wave & the beginning of the SA node area, which corresponds to U waves at recorded ECG. Origin of the U wave is mainly due to abnormal electrical potential of pulmonary vein at L-atrium. If all 4 factors do not occur at the infection site, no AF will develop. In seemingly normal ECGs, if using this method, one can detect invisible B.B. infection in early stages. Long before AF appears, AF can be prevented by improved treatment with Amoxicillin 500ng 3 times

Genetic defects in PI3Kδ affect B-cell differentiation and maturation leading to hypogammaglobulineamia and recurrent infections.

PubMed

Wentink, Marjolein; Dalm, Virgil; Lankester, Arjan C; van Schouwenburg, Pauline A; Schölvinck, Liesbeth; Kalina, Tomas; Zachova, Radana; Sediva, Anna; Lambeck, Annechien; Pico-Knijnenburg, Ingrid; van Dongen, Jacques J M; Pac, Malgorzata; Bernatowska, Ewa; van Hagen, Martin; Driessen, Gertjan; van der Burg, Mirjam

2017-03-01

Mutations in PIK3CD and PIK3R1 cause activated PI3K-δ syndrome (APDS) by dysregulation of the PI3K-AKT pathway. We studied precursor and peripheral B-cell differentiation and apoptosis via flowcytometry. Furthermore, we performed AKT-phosphorylation assays and somatic hypermutations (SHM) and class switch recombination (CSR) analysis. We identified 13 patients of whom 3 had new mutations in PIK3CD or PIK3R1. Patients had low total B-cell numbers with increased frequencies of transitional B cells and plasmablasts, while the precursor B-cell compartment in bone marrow was relatively normal. Basal AKT phosphorylation was increased in lymphocytes from APDS patients and natural effector B cells where most affected. PI3K mutations resulted in altered SHM and CSR and increased apoptosis. The B-cell compartment in APDS patients is affected by the mutations in PI3K. There is reduced differentiation beyond the transitional stage, increased AKT phosphorylation and increased apoptosis. This B-cell phenotype contributes to the clinical phenotype. Copyright © 2017. Published by Elsevier Inc.

Epidemiology of hepatitis B infection in Liberian infants.

PubMed Central

Prince, A M; White, T; Pollock, N; Riddle, J; Brotman, B; Richardson, L

1981-01-01

To provide background for a hepatitis B vaccine efficacy trial, sera were collected from 0- to 4-year-old Liberian infants and their mothers, on two occasions an average of 14.75 months apart, and tested for serological markers of hepatitis B virus infection. The prevalence of the hepatitis B surface antigen (HBsAg) was 2.9% in the 0- to 6-month age group and 23% in infants 3 to 4 years of age. HBsAg persisted for the 14.75-month average follow-up period in 80.8% of the infants tested. The annual incidence of development of HBsAg was 18.9% for infants less than 1 year of age and 13.6% in infants 3 to 4 years of age. Infants born to HBsAg carrier mothers had significantly higher age-specific prevalence and incidence of hepatitis B virus infection. However, it was estimated that only a minor proportion of hepatitis B infections in Liberia are derived by vertical transmission from carrier mothers. PMID:7251143

The activating receptor NKG2D of natural killer cells promotes resistance against enterovirus-mediated inflammatory cardiomyopathy.

PubMed

Klingel, Karin; Fabritius, Cornelia; Sauter, Martina; Göldner, Katrin; Stauch, Diana; Kandolf, Reinhard; Ettischer, Nicole; Gahlen, Sabine; Schönberger, Tanja; Ebner, Susanne; Makrigiannis, Andrew P; Bélanger, Simon; Diefenbach, Andreas; Polić, Bojan; Pratschke, Johann; Kotsch, Katja

2014-10-01

In enterovirus-induced cardiomyopathy, information regarding the detailed impact of natural killer (NK) cells on the outcome of the disease is limited. We therefore hypothesized that NK cells and certain NK cell receptors determine the different outcome of coxsackievirus B3 (CVB3) myocarditis. Here, we demonstrate in murine models that resistance to chronic CVB3 myocarditis in immunocompetent C57BL/6 mice is characterized by significantly more mature CD11b(high) NK cells, the presence of NKG2D on NK cells, and enhanced NKG2D-dependent cytotoxicity compared to CVB3-susceptible A.BY/SnJ mice. The highly protective role of NKG2D in myocarditis was further proven by in vivo neutralization of NKG2D as well as in NKG2D-deficient mice but was shown to be independent of CD8(+) T-cell-dependent immunity. Moreover, the adoptive transfer of immunocompetent C57BL/6 NK cells pre- (day -1) as well as post-infectionem (day +2) displayed the potential to prevent permissive A.BY/SnJ mice from a progressive outcome of CVB3 myocarditis reflected by significantly improved cardiopathology and heart function. Altogether, our results provide firm evidence for a protective role of NKG2D-activated NK cells in CVB3 myocarditis leading to an effective virus clearance, thus offering novel therapeutic options in the treatment of virus-induced myocarditis. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Structures and chemical bonding of B{sub 3}O{sub 3}{sup −/0} and B{sub 3}O{sub 3}H{sup −/0}: A combined photoelectron spectroscopy and first-principles theory study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Li-Juan; Xu, Hong-Guang; Feng, Gang

We present a combined photoelectron spectroscopy and first-principles theory study on the structural and electronic properties and chemical bonding of B{sub 3}O{sub 3}{sup −/0} and B{sub 3}O{sub 3}H{sup −/0} clusters. The concerted experimental and theoretical data show that the global-minimum structures of B{sub 3}O{sub 3} and B{sub 3}O{sub 3}H neutrals are very different from those of their anionic counterparts. The B{sub 3}O{sub 3}{sup −} anion is characterized to possess a V-shaped OB–B–BO chain with overall C{sub 2v} symmetry (1A), in which the central B atom interacts with two equivalent boronyl (B≡O) terminals via B–B single bonds as well as withmore » one O atom via a B=O double bond. The B{sub 3}O{sub 3}H{sup −} anion has a C{sub s} (2A) structure, containing an asymmetric OB–B–OBO zig-zag chain and a terminal H atom interacting with the central B atom. In contrast, the C{sub 2v} (1a) global minimum of B{sub 3}O{sub 3} neutral contains a rhombic B{sub 2}O{sub 2} ring with one B atom bonded to a BO terminal and that of neutral B{sub 3}O{sub 3}H (2a) is also of C{sub 2v} symmetry, which is readily constructed from C{sub 2v} (1a) by attaching a H atom to the opposite side of the BO group. The H atom in B{sub 3}O{sub 3}H{sup −/0} (2A and 2a) prefers to interact terminally with a B atom, rather than with O. Chemical bonding analyses reveal a three-center four-electron (3c-4e) π hyperbond in the B{sub 3}O{sub 3}H{sup −} (2A) cluster and a four-center four-electron (4c-4e) π bond (that is, the so-called o-bond) in B{sub 3}O{sub 3} (1a) and B{sub 3}O{sub 3}H (2a) neutral clusters.« less

Sero-prevalence and factors associated with Hepatitis B and C co-infection in pregnant Nigerian women living with HIV Infection

PubMed Central

Ezechi, Oliver Chukwujekwu; Kalejaiye, Olufunto Olufela; Gab-Okafor, Chidinma Vivian; Oladele, David Ayola; Oke, Bamidele Oludare; Musa, Zaidat Adesola; Ekama, Sabdat Ozichu; Ohwodo, Harry; Agahowa, Endurance; Gbajabiamilla, Titilola; Ezeobi, Paschal Mbanefo; Okwuraiwe, Azuka; Audu R, Rosemary Ajuma; Okoye, Rosemary Nwakaego; David, Agatha Nkiru; Odunukwe, Nkiruka Nonyelum; Onwujekwe, Dan Ifeanyi; Ujah, Innocent Achanya

2014-01-01

Introduction Perinatal and horizontal transmission of Hepatitis B occur in areas of high endemicity as most infections are acquired in the first 5 years of life. Unless Hepatitis B and C infected pregnant women identified, and appropriate treatment provided, children born to these women are at high risk of chronic Hepatitis B (and C) virus infection. The objecive of this study was to determined the prevalence and the factors associated with Hepatitis B and C Virus infection in pregnant HIV positive Nigerians. Methods A cross sectional study among HIV Positive pregnant women seen at a large PMTCT clinic in Lagos Nigeria. The women were screened for Hepatitis B and C Virus infection at enrollment. HIV viral load, CD4 count, liver transaminases and hemoglobin levels were also determined. Data were managed with SPSS for windows version. Ethical approval was obtained from the Institutions Ethical Review Board. Results Of the 2391 studied subjects, 101(4.2%) and 37(1.5%) respectively were seropositive for Hepatitis B and C Virus infection. Twowomen (0. 08%) had triple infections. blood transfusion, (cOR: 2.3; 95% CI:1.1 - 4.6), history of induced abortion (cOR:2. 2;95% CI:1.3 - 3.6), and elevated baseline ALT (cOR:2. 2; 95%CI:2. 2;4.2) were significantly associated with HBV. History of induced abortion was the only factor found to be associated with HIV/ HCV (cOR: 1.9;95%CI:1. 3-3.9). Conclusion Hepatitis B Virus infection (4.2%) is relatively common in our environment and associated with induced abortion, blood transfusion and elevated baseline transaminase. Hepatitis C Virus infection (1.5%) is less common and associated with only history of induced abortion. PMID:25396023

B7-H3 Augments Inflammatory Responses and Exacerbates Brain Damage via Amplifying NF-κB p65 and MAPK p38 Activation during Experimental Pneumococcal Meningitis.

PubMed

Chen, Xuqin; Li, Yan; Blankson, Siobhan; Liu, Min; Huang, Danping; Redmond, H Paul; Huang, Jing; Wang, Jiang Huai; Wang, Jian

2017-01-01

The costimulatory protein B7-H3 has been shown to play a contributory role in the development and progression of experimental pneumococcal meningitis by augmentation of the innate immunity-associated inflammatory response via a TLR2-dependent manner. This study aimed to clarify the component(s) of TLR2-mediated signal transduction pathways responsible for B7-H3-augmented inflammatory response and subsequent brain damage during experimental pneumococcal meningitis. Administration of B7-H3 did not augment expression of TLR2 and other TLR2 upstream components, but led to an enhanced formation of MyD88-IRAK immunocomplex in the brain of S. pneumoniae-infected mice. Furthermore, B7-H3 substantially augmented S. pneumoniae-induced activation of TLR2 downstream NF-κB p65 and MAPK p38 pathways in the brain of S. pneumoniae-infected mice. Notably, blockage of NF-κB p65 and/or MAPK p38 with their specific inhibitors strongly attenuated B7-H3-amplified inflammatory response with significantly reduced proinflammatory cytokine and chemokine production, and markedly ameliorated B7-H3-exacerbated disruption of blood-brain barrier and severity of disease status in S. pneumoniae-infected mice. These results indicate that targeting NF-κB p65 and/or MAPK p38 may represent a promising therapeutic option for amelioration of overwhelming inflammatory response-associated brain injury frequently observed during pneumococcal meningitis.

B7-H3 Augments Inflammatory Responses and Exacerbates Brain Damage via Amplifying NF-κB p65 and MAPK p38 Activation during Experimental Pneumococcal Meningitis

PubMed Central

Chen, Xuqin; Li, Yan; Blankson, Siobhan; Liu, Min; Huang, Danping; Redmond, H. Paul; Huang, Jing; Wang, Jiang Huai; Wang, Jian

2017-01-01

The costimulatory protein B7-H3 has been shown to play a contributory role in the development and progression of experimental pneumococcal meningitis by augmentation of the innate immunity-associated inflammatory response via a TLR2-dependent manner. This study aimed to clarify the component(s) of TLR2-mediated signal transduction pathways responsible for B7-H3-augmented inflammatory response and subsequent brain damage during experimental pneumococcal meningitis. Administration of B7-H3 did not augment expression of TLR2 and other TLR2 upstream components, but led to an enhanced formation of MyD88-IRAK immunocomplex in the brain of S. pneumoniae-infected mice. Furthermore, B7-H3 substantially augmented S. pneumoniae-induced activation of TLR2 downstream NF-κB p65 and MAPK p38 pathways in the brain of S. pneumoniae-infected mice. Notably, blockage of NF-κB p65 and/or MAPK p38 with their specific inhibitors strongly attenuated B7-H3-amplified inflammatory response with significantly reduced proinflammatory cytokine and chemokine production, and markedly ameliorated B7-H3-exacerbated disruption of blood-brain barrier and severity of disease status in S. pneumoniae-infected mice. These results indicate that targeting NF-κB p65 and/or MAPK p38 may represent a promising therapeutic option for amelioration of overwhelming inflammatory response-associated brain injury frequently observed during pneumococcal meningitis. PMID:28141831

Presence of multiple lesion types with vastly different microenvironments in C3HeB/FeJ mice following aerosol infection with Mycobacterium tuberculosis

PubMed Central

Irwin, Scott M.; Driver, Emily; Lyon, Edward; Schrupp, Christopher; Ryan, Gavin; Gonzalez-Juarrero, Mercedes; Basaraba, Randall J.; Nuermberger, Eric L.; Lenaerts, Anne J.

2015-01-01

ABSTRACT Cost-effective animal models that accurately reflect the pathological progression of pulmonary tuberculosis are needed to screen and evaluate novel tuberculosis drugs and drug regimens. Pulmonary disease in humans is characterized by a number of heterogeneous lesion types that reflect differences in cellular composition and organization, extent of encapsulation, and degree of caseous necrosis. C3HeB/FeJ mice have been increasingly used to model tuberculosis infection because they produce hypoxic, well-defined granulomas exhibiting caseous necrosis following aerosol infection with Mycobacterium tuberculosis. A comprehensive histopathological analysis revealed that C3HeB/FeJ mice develop three morphologically distinct lesion types in the lung that differ with respect to cellular composition, degree of immunopathology and control of bacterial replication. Mice displaying predominantly the fulminant necrotizing alveolitis lesion type had significantly higher pulmonary bacterial loads and displayed rapid and severe immunopathology characterized by increased mortality, highlighting the pathological role of an uncontrolled granulocytic response in the lung. Using a highly sensitive novel fluorescent acid-fast stain, we were able to visualize the spatial distribution and location of bacteria within each lesion type. Animal models that better reflect the heterogeneity of lesion types found in humans will permit more realistic modeling of drug penetration into solid caseous necrotic lesions and drug efficacy testing against metabolically distinct bacterial subpopulations. A more thorough understanding of the pathological progression of disease in C3HeB/FeJ mice could facilitate modulation of the immune response to produce the desired pathology, increasing the utility of this animal model. PMID:26035867

Prevalence of naturally occurring NS5A resistance-associated substitutions in patients infected with hepatitis C virus subtype 1a, 1b, and 3a, co-infected or not with HIV in Brazil.

PubMed

Malta, Fernanda; Gaspareto, Karine Vieira; Lisboa-Neto, Gaspar; Carrilho, Flair José; Mendes-Correa, Maria Cássia; Pinho, João Renato Rebello

2017-11-13

Non-structural 5A protein (NS5A) resistance-associated substitutions (RASs) have been identified in patients infected with hepatitis C virus (HCV), even prior to exposure to direct-acting antiviral agents (DAAs). Selection for these variants occurs rapidly during treatment and, in some cases, leads to antiviral treatment failure. DAAs are currently the standard of care for hepatitis C treatment in many parts of the world. Nevertheless, in Brazil, the prevalence of pre-existing NS5A RASs is largely unknown. In this study, we evaluated the frequency of naturally occurring NS5A RASs in Brazilian patients infected with HCV as either a monoinfection or coinfection with human immunodeficiency virus (HIV). Direct Sanger sequencing of the NS5A region was performed in 257 DAA-naïve patients chronically infected with HCV (156 monoinfected with HCV and 101 coinfected with HIV/HCV). The frequencies of specific RASs in monoinfected patients were 14.6% for HCV GT-1a (M28 V and Q30H/R), 6.0% for GT-1b (L31F/V and Y93H), and 22.6% for GT-3a (A30K and Y93H). For HIV/HCV-coinfected patients, the frequencies of RAS were 3.9% for GT-1a (M28 T and Q30H/R), and 11.1% for GT-1b (Y93H); no RASs were found in GT-3a sequences. Substitutions that may confer resistance to NS5A inhibitors exist at baseline in Brazilian DAA-naïve patients infected with HCV GT-1a, -1b, and -3a. Standardization of RAS definitions is needed to improve resistance analyses and to facilitate comparisons of substitutions reported across studies worldwide. Therapeutic strategies should be optimized to efficiently prevent DAA treatment failure due to selection for RASs, especially in difficult-to-cure patients.

The Interferon-Stimulated Gene Ifitm3 Restricts West Nile Virus Infection and Pathogenesis.

PubMed

Gorman, Matthew J; Poddar, Subhajit; Farzan, Michael; Diamond, Michael S

2016-09-15

The interferon-induced transmembrane protein (IFITM) family of proteins inhibit infection of several different enveloped viruses in cell culture by virtue of their ability to restrict entry and fusion from late endosomes. As few studies have evaluated the importance of Ifitm3 in vivo in restricting viral pathogenesis, we investigated its significance as an antiviral gene against West Nile virus (WNV), an encephalitic flavivirus, in cells and mice. Ifitm3(-/-) mice were more vulnerable to lethal WNV infection, and this was associated with greater virus accumulation in peripheral organs and central nervous system tissues. As no difference in viral burden in the brain or spinal cord was observed after direct intracranial inoculation, Ifitm3 likely functions as an antiviral protein in nonneuronal cells. Consistent with this, Ifitm3(-/-) fibroblasts but not dendritic cells resulted in higher yields of WNV in multistep growth analyses. Moreover, transcomplementation experiments showed that Ifitm3 inhibited WNV infection independently of Ifitm1, Ifitm2, Ifitm5, and Ifitm6. Beyond a direct effect on viral infection in cells, analysis of the immune response in WNV-infected Ifitm3(-/-) mice showed decreases in the total number of B cells, CD4(+) T cells, and antigen-specific CD8(+) T cells. Finally, bone marrow chimera experiments demonstrated that Ifitm3 functioned in both radioresistant and radiosensitive cells, as higher levels of WNV were observed in the brain only when Ifitm3 was absent from both compartments. Our analyses suggest that Ifitm3 restricts WNV pathogenesis likely through multiple mechanisms, including the direct control of infection in subsets of cells. As part of the mammalian host response to viral infections, hundreds of interferon-stimulated genes (ISGs) are induced. The inhibitory activity of individual ISGs varies depending on the specific cell type and viral pathogen. Among ISGs, the genes encoding interferon-induced transmembrane protein (IFITM

Cryptic Production of trans-3-Hydroxyproline in Echinocandin B Biosynthesis.

PubMed

Mattay, Johanna; Houwaart, Stefanie; Hüttel, Wolfgang

2018-04-01

are important drugs for the treatment of systemic fungal infections. We have recently shown that in the biosynthesis of pneumocandins A 0 and B 0 , three hydroxyproline building blocks are provided by one proline hydroxylase. Here we demonstrate that the proline hydroxylase from echinocandin B biosynthesis in Aspergillus pachycristatus produces the same hydroxyprolines, with an increased proportion of trans -3-hydroxyproline. However, echinocandin B biosynthesis does not require trans -3-hydroxyproline; its formation remains cryptic. While one can only speculate on the evolutionary background of this unexpected finding, proline hydroxylation in G. lozoyensis and A. pachycristatus provides an unusual insight into peptide antibiotic biosynthesis-namely, the complex interplay between the selectivity of a hydroxylase and the substrate specificity of a nonribosomal peptide synthetase. Copyright © 2018 American Society for Microbiology.

Enterovirus-D68 (EV-D68) in pediatric patients with respiratory infection: The circulation of a new B3 clade in Italy.

PubMed

Piralla, Antonio; Principi, Nicola; Ruggiero, Luca; Girello, Alessia; Giardina, Federica; De Sando, Elisabetta; Caimmi, Silvia; Bianchini, Sonia; Marseglia, Gian Luigi; Lunghi, Giovanna; Baldanti, Fausto; Esposito, Susanna

In recent years, several outbreaks due to Enterovirus D-68 (EV-D68) have been reported, and it was confirmed that the virus can cause upper and lower respiratory tract diseases and be associated with the development of neurological problems. The main aim of this research was to study the genetic characteristics of EV-D68 strains that were circulating in Italy identified during an outbreak of an EV-D68 infection that occurred in Italy during the period March-October 2016. A retrospective study of the circulation of different types and subtypes of EV-D68 was performed. Nasopharyngeal swabs were collected from March 2016 through October 2016 in children admitted to the Emergency Room with respiratory diseases. Among 390 children, 22 (59.1% males; mean age 47 months) were found to be infected by EV-D68 and most of them were immunocompetent (72.7%). Pneumonia was diagnosed in 12 (54.5%) children. Phylogenetic analysis of the VP1 region showed that all the strains identified in this study belonged to clade B3. Within B3 subclade, the Italian EV-D68 strains were most closely related to strains detected in Southern China in 2015 as well as to strains detected in US and the Netherlands in 2016. These results showed that EV-D68 infections are a common cause of lower respiratory illness in pediatric age. The circulation of one EV-D68 lineage has been proven in Italy and in the European region during 2016. However, further studies are required to investigate whether some strains or lineages may possess a higher affinity for the lower airway or central nervous system. Copyright © 2018 Elsevier B.V. All rights reserved.

Bcl-xL mediates RIPK3-dependent necrosis in M. tuberculosis-infected macrophages

PubMed Central

Zhao, Xiaomin; Khan, Nargis; Gan, Huixian; Tzelepis, Fanny; Nishimura, Tomoyasu; Park, Seung-Yeol; Divangahi, Maziar; Remold, Heinz G.

2017-01-01

Virulent Mycobacterium tuberculosis (Mtb) triggers necrosis in host Mφ, which is essential for successful pathogenesis. Here we demonstrate that necrosis of Mtb-infected Mφ is dependent on the action of the cytosolic kinase Receptor Interacting Protein 3 (RIPK3) and the mitochondrial Bcl-2 family member protein B-cell lymphoma - extra large (Bcl-xL). RIPK3-deficient Mφ are able to better control bacterial growth in vitro and in vivo. Cytosolic RIPK3 translocates to the mitochondria where it promotes necrosis and blocks caspase 8-activation and apoptosis via Bcl-xL. Furthermore, necrosis is associated with stabilization of hexokinase II on the mitochondria as well as cyclophilin D-dependent mitochondrial permeability transition (MPT). These events up-regulate the level of reactive oxygen species (ROS) to induce necrosis. Thus, in Mtb-infected Mφ mitochondria are an essential platform for induction of necrosis by activating RIPK3 function and preventing caspase 8 - activation. PMID:28401933

Bcl-xL mediates RIPK3-dependent necrosis in M. tuberculosis-infected macrophages.

PubMed

Zhao, X; Khan, N; Gan, H; Tzelepis, F; Nishimura, T; Park, S-Y; Divangahi, M; Remold, H G

2017-11-01

Virulent Mycobacterium tuberculosis (Mtb) triggers necrosis in host Mϕ, which is essential for successful pathogenesis in tuberculosis. Here we demonstrate that necrosis of Mtb-infected Mϕ is dependent on the action of the cytosolic Receptor Interacting Protein Kinase 3 (RIPK3) and the mitochondrial Bcl-2 family member protein B-cell lymphoma-extra large (Bcl-x L ). RIPK3-deficient Mϕ are able to better control bacterial growth in vitro and in vivo. Mechanistically, cytosolic RIPK3 translocates to the mitochondria where it promotes necrosis and blocks caspase 8-activation and apoptosis via Bcl-x L . Furthermore, necrosis is associated with stabilization of hexokinase II on the mitochondria as well as cyclophilin D-dependent mitochondrial permeability transition. Collectively, these events upregulate the level of reactive oxygen species to induce necrosis. Thus, in Mtb-infected Mϕ, mitochondria are an essential platform for induction of necrosis by activating RIPK3 function and preventing caspase 8-activation.

SOCS3, a Major Regulator of Infection and Inflammation

PubMed Central

Carow, Berit; Rottenberg, Martin E.

2014-01-01

In this review, we describe the role of suppressor of cytokine signaling-3 (SOCS3) in modulating the outcome of infections and autoimmune diseases as well as the underlying mechanisms. SOCS3 regulates cytokine or hormone signaling usually preventing, but in some cases aggravating, a variety of diseases. A main role of SOCS3 results from its binding to both the JAK kinase and the cytokine receptor, which results in the inhibition of STAT3 activation. Available data also indicate that SOCS3 can regulate signaling via other STATs than STAT3 and also controls cellular pathways unrelated to STAT activation. SOCS3 might either act directly by hampering JAK activation or by mediating the ubiquitination and subsequent proteasome degradation of the cytokine/growth factor/hormone receptor. Inflammation and infection stimulate SOCS3 expression in different myeloid and lymphoid cell populations as well as in diverse non-hematopoietic cells. The accumulated data suggest a relevant program coordinated by SOCS3 in different cell populations, devoted to the control of immune homeostasis in physiological and pathological conditions such as infection and autoimmunity. PMID:24600449

The Role of Semaphorin 3B (SEMA3B) in the Pathogenesis of Breast Cancer

DTIC Science & Technology

2006-04-01

apoptotic and anti-proliferative effect on cancer lines it is in part by the inhibition of Akt pathway. In conclusion, we hypothesize that VEGF165...autocrine activity and by inhibiting the Akt pathway. 15. SUBJECT TERMS tumor suppressor gene, breast cancer and apoptosis 16. SECURITY...TGFβ TGFR2 Smad4 M D A M B A 54 9 H 12 99 H el a H 46 0 M C F7 ZR -7 5 H 15 7 2 31 GAPDH TGFR1 B. C 2H 24H 48H 72H SEMA3B SEMA3B

216-B-3 expansion ponds closure plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1994-10-01

This document describes the activities for clean closure under the Resource Conservation and Recovery Act of 1976 (RCRA) of the 216-B-3 Expansion Ponds. The 216-B-3 Expansion Ponds are operated by the US Department of Energy, Richland Operations Office (DOE-RL) and co-operated by Westinghouse Hanford Company (Westinghouse Hanford). The 216-B-3 Expansion Ponds consists of a series of three earthen, unlined, interconnected ponds that receive waste water from various 200 East Area operating facilities. The 3A, 3B, and 3C ponds are referred to as Expansion Ponds because they expanded the capability of the B Pond System. Waste water (primarily cooling water, steammore » condensate, and sanitary water) from various 200 East Area facilities is discharged to the Bypass pipe (Project X-009). Water discharged to the Bypass pipe flows directly into the 216-B-3C Pond. The ponds were operated in a cascade mode, where the Main Pond overflowed into the 3A Pond and the 3A Pond overflowed into the 3C Pond. The 3B Pond has not received waste water since May 1985; however, when in operation, the 3B Pond received overflow from the 3A Pond. In the past, waste water discharges to the Expansion Ponds had the potential to have contained mixed waste (radioactive waste and dangerous waste). The radioactive portion of mixed waste has been interpreted by the US Department of Energy (DOE) to be regulated under the Atomic Energy Act of 1954; the dangerous waste portion of mixed waste is regulated under RCRA.« less

Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box.

PubMed

Ezcurra, I; Wycliffe, P; Nehlin, L; Ellerström, M; Rask, L

2000-10-01

The transcriptional activator ABI3 is a key regulator of gene expression during embryo maturation in crucifers. In monocots, the related VP1 protein regulates the Em promoter synergistically with abscisic acid (ABA). We identified cis-elements in the Brassica napus napin napA promoter mediating regulation by ABI3 and ABA, by analyzing substitution mutation constructs of napA in transgenic tobacco plantlets ectopically expressing ABI3. In transient analysis using particle bombardment of tobacco leaf sections, a tetramer of the distB ABRE (abscisic acid-responsive element) mediated transactivation by ABI3 and ABI3-dependent response to ABA, whereas a tetramer of the composite RY/G complex, containing RY repeats and a G-box, mediated only ABA-independent transactivation by ABI3. Deletion of the conserved B2 and B3 domains of ABI3 abolished transactivation of napA by ABI3. The two domains of ABI3 interact with different cis-elements: B2 is necessary for ABA-independent and ABA-dependent activations through the distB ABRE, whereas B3 interacts with the RY/G complex. Thus B2 mediates the interaction of ABI3 with the protein complex at the ABRE. The regulation of napA by ABI3 differs from Em regulation by VP1, in that the B3 domain of ABI3 is essential for the ABA-dependent regulation of napA.

Impact of myocardial inflammation on cytosolic and mitochondrial creatine kinase activity and expression.

PubMed

Ebermann, Linda; Piper, Cornelia; Kühl, Uwe; Klingel, Karin; Schlattner, Uwe; Siafarikas, Nikias; Zeichhardt, Heinz; Schultheiss, Heinz-Peter; Dörner, Andrea

2009-05-01

The disturbance of myocardial energy metabolism has been discussed as contributing to the progression of heart failure. Little however is known about the cardiac mitochondrial/cytosolic energy transfer in murine and human inflammatory heart disease. We examined the myocardial creatine kinase (CK) system, which connects mitochondrial ATP-producing and cytosolic ATP-consuming processes and is thus of central importance to the cellular energy homeostasis. The time course of expression and enzymatic activity of mitochondrial (mtCK) and cytosolic CK (cytCK) was investigated in Coxsackievirus B3 (CVB3)-infected SWR mice, which are susceptible to the development of chronic myocarditis. In addition, cytCK activity and isoform expression were analyzed in biopsies from patients with chronic inflammatory heart disease (n = 22). Cardiac CVB3 titer in CVB3-infected mice reached its maximum at 4 days post-infection (pi) and became undetectable at 28 days pi; cardiac inflammation cumulated 14 days pi but persisted through the 28-day survey. MtCK enzymatic activity was reduced by 40% without a concurrent decrease in mtCK protein during early and acute MC. Impaired mtCK activity was correlated with virus replication and increased level of interleukine 1beta (IL-1beta), tumor necrosis factor alpha (TNFalpha), and elevated catalase expression, a marker for intracellular oxidative stress. A reduction in cytCK activity of 48% was observed at day 14 pi and persisted to day 28 pi. This restriction was caused by a decrease in cytCK subunit expression but also by direct inhibition of specific cytCK activity. CytCK activity and expression were also reduced in myocardial biopsies from enterovirus genome-negative patients with inflammatory heart disease. The decrease in cytCK activity correlated with the number of infiltrating macrophages. Thus, viral infection and myocardial inflammation significantly influence the myocardial CK system via restriction of specific CK activity and down

Polymorphisms at the 3' untranslated region of SLC11A1 gene are associated with protection to Brucella infection in goats.

PubMed

Iacoboni, Paola A; Hasenauer, Flavia C; Caffaro, M Eugenia; Gaido, Analia; Rossetto, Cristina; Neumann, Roberto D; Salatin, Antonio; Bertoni, Emiliano; Poli, Mario A; Rossetti, Carlos A

2014-08-15

Goats are susceptible to brucellosis and the detection of Brucella-infected animals is carried out by serological tests. In other ruminant species, polymorphisms in microsatellites (Ms) of 3' untranslated region (3'UTR) of the solute carrier family 11 member A1 (SLC11A1) gene were associated with resistance to Brucella abortus infection. Goats present two polymorphic Ms at the 3'UTR end of SLC11A1 gene, called regions A and B. Here, we evaluated if polymorphisms in regions A and/or B are associated with Brucella infection in goats. Serum (for the detection of Brucella-specific antibodies) and hair samples (for DNA isolation and structure analysis of the SLC11A1 gene) were randomly collected from 229 adult native goats from the northwest of Argentina. Serological status was evaluated by buffer plate antigen test (BPAT) complemented by the fluorescent polarization assay (FPA), and the genotype of the 3'UTR of the SLC11A1 gene was determined by capillary electrophoresis and confirmed by sequence analysis. Polymorphisms in regions A and B of the 3'UTR SLC11A1 gene were found statistically significant associated with protection to Brucella infection. Specifically, the association study indicates statistical significance of the allele A15 and B7/B7 genotype with absence of Brucella-specific antibodies (p=0.0003 and 0.0088, respectively). These data open a promising opportunity for limiting goat brucellosis through selective breeding of animals based on genetic markers associated with natural resistance to B. melitensis infection. Copyright © 2014 Elsevier B.V. All rights reserved.

Metallic Borides, La 2 Re 3 B 7 and La 3 Re 2 B 5 , Featuring Extensive Boron–Boron Bonding

DOE PAGES

Bugaris, Daniel E.; Malliakas, Christos D.; Chung, Duck Young; ...

2016-01-26

We synthesized La 2Re 3B 7 and La 3Re 2B 5 in single-crystalline form from a molten La/Ni eutectic at 1000°C, in the first example of the flux crystal growth of ternary rare-earth rhenium borides. Both compounds crystallize in their own orthorhombic structure types, with La 2Re 3B 7 (space group Pcca) having lattice parameters a = 7.657(2) Å, b = 6.755(1) Å, and c = 11.617(2) Å, and La 3Re 2B 5 (space group Pmma) having lattice parameters a = 10.809(2) Å, b = 5.287(1) Å, and c = 5.747(1) Å. Furthermore, the compounds possess three-dimensional framework structures thatmore » are built up from rhenium boride polyhedra and boron-boron bonding. La 3Re 2B 5 features fairly common B 2 dumbbells, whereas La 2Re 3B 7 has unique one-dimensional subunits composed of alternating triangular B3 and trans-B4 zigzag chain fragments. Also observed in La 3Re 2B 5 is an unusual coordination of B by an octahedron of La atoms. Electronic band structure calculations predict that La 2Re 3B 7 is a semimetal, which is observed in the electrical resistivity data as measured on single crystals, with behavior obeying the Bloch-Grüneisen model and a room-temperature resistivity ρ300K of ~ 375 μΩ cm. The electronic band structure calculations also suggest that La 3Re 2B 5 is a regular metal.« less

Metallic Borides, La 2 Re 3 B 7 and La 3 Re 2 B 5 , Featuring Extensive Boron–Boron Bonding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bugaris, Daniel E.; Malliakas, Christos D.; Chung, Duck Young

We synthesized La 2Re 3B 7 and La 3Re 2B 5 in single-crystalline form from a molten La/Ni eutectic at 1000°C, in the first example of the flux crystal growth of ternary rare-earth rhenium borides. Both compounds crystallize in their own orthorhombic structure types, with La 2Re 3B 7 (space group Pcca) having lattice parameters a = 7.657(2) Å, b = 6.755(1) Å, and c = 11.617(2) Å, and La 3Re 2B 5 (space group Pmma) having lattice parameters a = 10.809(2) Å, b = 5.287(1) Å, and c = 5.747(1) Å. Furthermore, the compounds possess three-dimensional framework structures thatmore » are built up from rhenium boride polyhedra and boron-boron bonding. La 3Re 2B 5 features fairly common B 2 dumbbells, whereas La 2Re 3B 7 has unique one-dimensional subunits composed of alternating triangular B3 and trans-B4 zigzag chain fragments. Also observed in La 3Re 2B 5 is an unusual coordination of B by an octahedron of La atoms. Electronic band structure calculations predict that La 2Re 3B 7 is a semimetal, which is observed in the electrical resistivity data as measured on single crystals, with behavior obeying the Bloch-Grüneisen model and a room-temperature resistivity ρ300K of ~ 375 μΩ cm. The electronic band structure calculations also suggest that La 3Re 2B 5 is a regular metal.« less

RL10A-3-3B high mixture ratio qualification program

NASA Technical Reports Server (NTRS)

Vogel, T.; Varella, D.; Smith, C.

1987-01-01

The results of the high mixture ratio qualification testing of the RL10 engine for the Shuttle/Centaur program are presented. The objective of the engine qualification test was to demonstrate the suitability of the RL10A-3-3B engine for space vehicle flight by subjecting it to the testing specified in RL10A-3-3B Model Specification Number 2295 dated February 1986. The applicable section of the specification is presented. Due to payload volume advantages which can be achieved by increasing the operating mixture ratio of the RL10, a decision was made to qualify the engine to run at a higher mixture ratio. A program was created to qualify the RL10 engine for operation at 15,000 pounds thrust and a nominal 6.0 to 1 mixture ratio. This model of the engine was designated the RL10A-3-3B. The qualification program included three test series as follows: (1) hardware durability and limits test in which the engine completed 23 firings and 4605.7 seconds with 1588.7 seconds at less than 6.6 mixture ratio; (2) preliminary qualification test in which the engine completed 26 firings and 5750 seconds; and (3) qualification test in which the engine completed 26 hot firings and 5693.4 seconds with 905.9 seconds at 6.7 mixture ratio. Several changes in engine hardware were required for operation of the RL10A-3-3B engine in the Space Shuttle which include a duel pressure switch ignition, an oxidizer flow control, and helium plumbing changes.

Capable Infection of Hepatitis B Virus in Diffuse Large B-cell Lymphoma

PubMed Central

Wang, Yanchun; Wang, Huijie; Pan, Shaokun; Hu, Tao; Shen, Jiabin; Zheng, Hui; Xie, Suhong; Xie, Youhua; Lu, Renquan; Guo, Lin

2018-01-01

Background: Diffuse large B-cell lymphoma (DLBCL) is the most common pathological type of non-Hodgkin lymphoma (NHL). It is strongly correlated to the host immunity and infection status. Aim: This study tested the hypothesis that hepatitis B virus (HBV) infection is also associated with DLBCL. Methods: Clinical analysis of the correlation between DLBCL and HBV infection, detection of HBV in situ of DLBCL tissue, and biological experiments that determined whether HBV infects B lymphocytes were conducted. Results: Our long-term clinical data showed that the positive rate of serum HBV was significantly increased in DLBCL patients (23.6%) compared to that in the general Chinese population (7.2%, P<0.001), especially in advanced stage lymphoma patients (P=0.003). In addition, HBV could infect B lymphocytes in vitro and the HBV antigen and nucleic acid could be detected intracellularly. Hepatitis B x protein (HBx) was also strongly expressed in tissues from DLBCL patients that were serum HBV surface antigen (HBsAg) positive. These patients responded less well to therapy with an odds ratio (OR) of 3.04. Conclusions: HBV can infect B lymphocytes. It might be related to the development of DLBCL and may also impact the efficacy of treatment. PMID:29760795

Core promoter mutations 3 years after anti-hepatitis B e seroconversion in patients with chronic hepatitis B or hepatitis B and C infection and cancer remission.

PubMed

Zampino, Rosa; Marrone, Aldo; Karayiannis, Peter; Cirillo, Grazia; del Giudice, Emanuele Miraglia; Rania, Giovanni; Utili, Riccardo; Ruggiero, Giuseppe

2002-09-01

In this study, we aimed to evaluate the persistence of hepatitis B virus (HBV) DNA and the role of HBV core promoter and precore region mutations in 28 young cancer survivor patients with HBV or HBV and hepatitis C virus (HCV) infections, and persistently normal ALT levels, after spontaneous or interferon (IFN)-induced anti-hepatitis B e (HBe) seroconversion. Sera from 15 patients with HBV and 13 with dual HBV-HCV infection were analyzed for the presence of HBV-DNA and HCV-RNA by polymerase chain reaction 3 yr after anti-HBe seroconversion. A total of 21 patients had seroconverted spontaneously and seven did so after IFN treatment. The core promoter and the precore regions were amplified sequenced directly. Among patients with HBV infection, HBV-DNA was detected in five of nine (55%) with spontaneous anti-HBe and in all six treated patients (p = 0.092). In the coinfected patients, four had cleared both HBV-DNA and HCV-RNA, five were HBV-DNA negative/HCV-RNA positive and four had the reverse viral pattern. Among the 15 patients with persistence of HBV-DNA, a 7-base pair nucleotide deletion in the core promoter (1757-1763) was present in seven of 10 patients with spontaneous and in one of five patients with IFN-induced seroconversion (p = 0.033). The G1896A precore stop codon mutation was never observed. HBV-DNA levels were significantly lower in patients with the core promoter deletion (p = 0.011). The 7-base pair deletion generated a truncated X protein at amino-acid position 132. A core promoter deletion after anti-HBe seroconversion was associated with low HBV-DNA levels, probably because of downregulation of pregenomic RNA production and truncation of the X protein. HBV-DNA persistence was a frequent event, even in the absence of active liver disease.

Hepatitis B Infection and Association with Other Sexually Transmitted Infections Among Men Who Have Sex with Men in Peru

PubMed Central

Lama, Javier R.; Agurto, Hellen S.; Guanira, Juan V.; Ganoza, Carmela; Casapia, Martin; Ojeda, Nora; Ortiz, Abner; Zamalloa, Victoria; Suarez-Ognio, Luis; Cabezas, Cesar; Sanchez, Jose L.; Sanchez, Jorge

2010-01-01

To assess the epidemiology of hepatitis B virus (HBV) infection among men who have sex with men (MSM) in Peru, we evaluated the prevalence and associated risk factors for HBV serologic markers among participants of a HIV sentinel surveillance conducted in 2002–2003. The standardized prevalences for total antibodies to hepatitis B core antigen (anti-HBc) and hepatitis B surface antigen (HBsAg) were 20.2% and 2.8%, respectively. Individuals with human immunodeficiency virus (HIV-1) infection had significantly higher anti-HBc (44.3% versus 19.3%) and HBsAg (9.5% versus 2.3%) prevalences than uninfected men. Increasing age (adjusted odds ratio [AOR] = 1.06), versatile sexual role (AOR = 1.59), sex in exchange for money/gifts (AOR = 1.58), syphilis (AOR = 1.74), HIV-1 infection (AOR = 1.64), and herpes simplex virus type 2 (HSV-2, AOR = 2.77) infection were independently associated with anti-HBc positivity, whereas only HIV-1 infection (AOR = 3.51) and generalized lymph node enlargement (AOR = 3.72) were associated with HBsAg positivity. Pre-existing HBV infection is very common among Peruvian MSM and was correlated with sexual risk factors. MSM in Peru constitute a target population for further HBV preventive and treatment interventions. PMID:20595501

Hepatitis B infection and association with other sexually transmitted infections among men who have sex with men in Peru.

PubMed

Lama, Javier R; Agurto, Hellen S; Guanira, Juan V; Ganoza, Carmela; Casapia, Martin; Ojeda, Nora; Ortiz, Abner; Zamalloa, Victoria; Suarez-Ognio, Luis; Cabezas, Cesar; Sanchez, Jose L; Sanchez, Jorge

2010-07-01

To assess the epidemiology of hepatitis B virus (HBV) infection among men who have sex with men (MSM) in Peru, we evaluated the prevalence and associated risk factors for HBV serologic markers among participants of a HIV sentinel surveillance conducted in 2002-2003. The standardized prevalences for total antibodies to hepatitis B core antigen (anti-HBc) and hepatitis B surface antigen (HBsAg) were 20.2% and 2.8%, respectively. Individuals with human immunodeficiency virus (HIV-1) infection had significantly higher anti-HBc (44.3% versus 19.3%) and HBsAg (9.5% versus 2.3%) prevalences than uninfected men. Increasing age (adjusted odds ratio [AOR] = 1.06), versatile sexual role (AOR = 1.59), sex in exchange for money/gifts (AOR = 1.58), syphilis (AOR = 1.74), HIV-1 infection (AOR = 1.64), and herpes simplex virus type 2 (HSV-2, AOR = 2.77) infection were independently associated with anti-HBc positivity, whereas only HIV-1 infection (AOR = 3.51) and generalized lymph node enlargement (AOR = 3.72) were associated with HBsAg positivity. Pre-existing HBV infection is very common among Peruvian MSM and was correlated with sexual risk factors. MSM in Peru constitute a target population for further HBV preventive and treatment interventions.

PREVALENCE OF MALNUTRITION IN CHILDREN WITH CHRONIC HEPATITIS B INFECTION.

PubMed

Şahin, Yasin

2016-01-01

There have been limited studies investigating the impact of chronic hepatitis B virus infection on the growth of children. Our objective was to investigate the prevalence of malnutrition in children with chronic hepatitis B infection. The nutritional status of patients was retrospectively evaluated in the outpatient Clinic of Pediatric Gastroenterology between February and November 2014. During the study, biochemical laboratory parameters, duration of disease, liver biopsy scores, and medication were evaluated. Additionally body mass index and body mass index centiles were calculated. Of the 96 patients in this study, 68 were male and 28 were female, and the mean age was 144.7±43.9 months and 146.1±47.3 months, respectively. According to body mass index centiles five (5.2%) patients were underweight, seven (7.3%) patients were overweight, and seven (7.3%) patients were obese. Moderate rates of malnutrition (including obesity) were found in chronic hepatitis B infection. Additional nutritional status information of healthy and sick children should be assessed in the infection's early period, and timely interventions should be initiated.

Regulated production and anti-HIV type 1 activities of cytidine deaminases APOBEC3B, 3F, and 3G.

PubMed

Rose, Kristine M; Marin, Mariana; Kozak, Susan L; Kabat, David

2005-07-01

APOBEC3G and 3F (A3G and A3F) cytidine deaminases incorporate into retroviral cores where they lethally hypermutate nascent DNA reverse transcripts. As substantiated here, the viral infectivity factor (Vif) encoded by human immunodeficiency virus type-1 (HIV-1) binds A3G and A3F and induces their degradation, thereby precluding their incorporation into viral progeny. Previous evidence suggested that A3G is expressed in H9 and other nonpermissive cells that contain this antiviral defense but not in several permissive cells, and that overexpression of A3G or A3F makes permissive cells nonpermissive. Using a broader panel of cell lines, we confirmed a correlation between A3G and cellular abilities to inactivate HIV-1(Deltavif). However, there was a quantitative discrepancy because several cells with weak antiviral activities had similar amounts of wild-type A3G mRNA and protein compared to H9 cells. Antiviral activity of H9 cells was also attenuated in some conditions. These quantitative discrepancies could not be explained by the presence of A3F or other A3G paralogs in some of the cell lines. Thus, A3A, A3B, and A3C had weak but significant anti-HIV-1 activities and did not dominantly interfere with A3G or A3F antiviral functions. Control of A3G synthesis by the protein kinase C/mitogen-activated protein kinase kinase/extracellular signal-regulated kinase pathway was also similar in permissive and nonpermissive cells. A3G in highly permissive cells is degraded by Vif, suggesting that it is not in a sequestered site, and is specifically incorporated in low amounts into HIV-1(Deltavif). Although A3G and/or A3F inactivate HIV-1(Deltavif) and are neutralized by Vif, the antiviral properties of cell lines are also influenced by other cellular and viral factors.

PI3Kδ-selective and PI3Kα/δ-combinatorial inhibitors in clinical development for B-cell non-Hodgkin lymphoma.

PubMed

Lampson, Benjamin L; Brown, Jennifer R

2017-11-01

The efficacy of the prototypical phosphatidylinositol-3-kinase (PI3K) inhibitor idelalisib for the treatment of chronic lymphocytic leukemia (CLL) and indolent non-Hodgkin lymphoma (iNHL) has led to development of multiple compounds targeting this pathway. Areas Covered: We review the hypothesized therapeutic mechanisms of PI3K inhibitors, including abrogation of B cell receptor signaling, blockade of microenvironmental pro-survival signals, and enhancement of anti-tumor immunity. We examine toxicities of idelalisib, including bacterial infections (possibly secondary to drug-induced neutropenia), opportunistic infections (possibly attributable to on-target inhibition of T cell function), and organ toxicities such as transaminitis and enterocolitis (possibly autoimmune, secondary to on-target inhibition of p110δ in regulatory T cells). We evaluate PI3K inhibitors that have entered trials for the treatment of lymphoma, focusing on agents with selectivity for PI3Kα and PI3Kδ. Expert Opinion: PI3K inhibitors, particularly those that target p110δ, have robust efficacy in the treatment of CLL and iNHL. However, idelalisib has infectious and autoimmune toxicities that limit its use. Outside of trials, idelalisib should be restricted to CLL patients with progression on ibrutinib or iNHL patients with progression on two prior therapies. Whether newer PI3K inhibitors will demonstrate differentiated toxicity profiles in comparable patient populations while retaining efficacy remains to be seen.

The temperate Burkholderia phage AP3 of the Peduovirinae shows efficient antimicrobial activity against B. cenocepacia of the IIIA lineage.

PubMed

Roszniowski, Bartosz; Latka, Agnieszka; Maciejewska, Barbara; Vandenheuvel, Dieter; Olszak, Tomasz; Briers, Yves; Holt, Giles S; Valvano, Miguel A; Lavigne, Rob; Smith, Darren L; Drulis-Kawa, Zuzanna

2017-02-01

Burkholderia phage AP3 (vB_BceM_AP3) is a temperate virus of the Myoviridae and the Peduovirinae subfamily (P2likevirus genus). This phage specifically infects multidrug-resistant clinical Burkholderia cenocepacia lineage IIIA strains commonly isolated from cystic fibrosis patients. AP3 exhibits high pairwise nucleotide identity (61.7 %) to Burkholderia phage KS5, specific to the same B. cenocepacia host, and has 46.7-49.5 % identity to phages infecting other species of Burkholderia. The lysis cassette of these related phages has a similar organization (putative antiholin, putative holin, endolysin, and spanins) and shows 29-98 % homology between specific lysis genes, in contrast to Enterobacteria phage P2, the hallmark phage of this genus. The AP3 and KS5 lysis genes have conserved locations and high amino acid sequence similarity. The AP3 bacteriophage particles remain infective up to 5 h at pH 4-10 and are stable at 60 °C for 30 min, but are sensitive to chloroform, with no remaining infective particles after 24 h of treatment. AP3 lysogeny can occur by stable genomic integration and by pseudo-lysogeny. The lysogenic bacterial mutants did not exhibit any significant changes in virulence compared to wild-type host strain when tested in the Galleria mellonella moth wax model. Moreover, AP3 treatment of larvae infected with B. cenocepacia revealed a significant increase (P < 0.0001) in larvae survival in comparison to AP3-untreated infected larvae. AP3 showed robust lytic activity, as evidenced by its broad host range, the absence of increased virulence in lysogenic isolates, the lack of bacterial gene disruption conditioned by bacterial tRNA downstream integration site, and the absence of detected toxin sequences. These data suggest that the AP3 phage is a promising potent agent against bacteria belonging to the most common B. cenocepacia IIIA lineage strains.

Qatar Exoplanet Survey : Qatar-3b, Qatar-4b, and Qatar-5b

NASA Astrophysics Data System (ADS)

Alsubai, Khalid; Mislis, Dimitris; Tsvetanov, Zlatan I.; Latham, David W.; Bieryla, Allyson; Buchhave, Lars A.; Esquerdo, Gilbert A.; Bramich, D. M.; Pyrzas, Stylianos; Vilchez, Nicolas P. E.; Mancini, Luigi; Southworth, John; Evans, Daniel F.; Henning, Thomas; Ciceri, Simona

2017-04-01

We report the discovery of Qatar-3b, Qatar-4b, and Qatar-5b, three new transiting planets identified by the Qatar Exoplanet Survey. The three planets belong to the hot Jupiter family, with orbital periods of {P}{{Q}3{{b}}} = 2.50792 days, {P}{{Q}4{{b}}} = 1.80539 days, and {P}{{Q}5{{b}}} = 2.87923 days. Follow-up spectroscopic observations reveal the masses of the planets to be {M}{{Q}3{{b}}} = 4.31 ± 0.47 {M}{{J}}, {M}{{Q}4{{b}}} = 6.10 ± 0.54 {M}{{J}}, and {M}{{Q}5{{b}}} = 4.32 ± 0.18 {M}{{J}}, while model fits to the transit light curves yield radii of {R}{{Q}3{{b}}} = 1.096 ± 0.14 {R}{{J}}, {R}{{Q}4{{b}}} = 1.135 ± 0.11 {R}{{J}}, and {R}{{Q}5{{b}}} = 1.107 ± 0.064 {R}{{J}}. The host stars are low-mass main sequence stars with masses and radii M Q3 = 1.145 ± 0.064 M ⊙, M Q4 = 0.896 ± 0.048 M ⊙, M Q5 = 1.128 ± 0.056 M ⊙ and R Q3 = 1.272 ± 0.14 R ⊙, R Q4 = 0.849 ± 0.063 R ⊙, and R Q5 = 1.076 ± 0.051 R ⊙ for Qatar-3, 4, and 5 respectively. The V magnitudes of the three host stars are V Q3 = 12.88, V Q4 = 13.60, and V Q5 = 12.82. All three new planets can be classified as heavy hot Jupiters (M > 4 M J).

Chronically infected wild boar can transmit genotype 3 hepatitis E virus to domestic pigs.

PubMed

Schlosser, Josephine; Vina-Rodriguez, Ariel; Fast, Christine; Groschup, Martin H; Eiden, Martin

2015-10-22

Hepatitis E virus (HEV) causes acute hepatitis E in humans in developing countries, but sporadic and autochthonous cases do also occur in industrialized nations. In Europe, food-borne zoonotic transmission of genotype 3 (gt3) has been associated with the consumption of raw and undercooked products from domestic pig and wild boar. As shown recently, naturally acquired HEV gt3 replicates efficiently in experimentally infected wild boar and is transmissible from a wild boar to domestic pigs. Generally, following an acute infection swine suffer from a transient febrile illness and viremia in connection with fecal virus shedding. However, little is known about sub-acute or chronic HEV infections in swine, and how and where HEV survives the immune response. In this paper, we describe the incidental finding of a chronic HEVgt3 infection in two naturally infected European wild boar which were raised and housed at FLI over years. The wild boar displayed fecal HEV RNA excretion and viremia over nearly the whole observation period of more than five months. The animal had mounted a substantial antibody response, yet without initial clearance of the virus by the immune system. Further analysis indicated a subclinical course of HEV with no evidence of chronic hepatitis. Additionally, we could demonstrate that this chronic wild boar infection was still transmissible to domestic pigs, which were housed together with this animal. Sentinel pigs developed fecal virus shedding accompanied by seroconversion. Wild boar should therefore be considered as an important reservoir for transmission of HEV gt3 in Europe. Copyright © 2015 Elsevier B.V. All rights reserved.

Evaluation of FlaB1, FlaB2, FlaB3, and Tp0463 of Treponema pallidum for serodiagnosis of syphilis.

PubMed

Jiang, Chuanhao; Xiao, Jinhong; Xie, Yafeng; Xiao, Yongjian; Wang, Chuan; Kuang, Xingxing; Xu, Man; Li, Ranhui; Zeng, Tiebing; Liu, Shuanquan; Yu, Jian; Zhao, Feijun; Wu, Yimou

2016-02-01

Syphilis is a multistage disease caused by the invasive spirochete Treponema pallidum subsp. pallidum, and accurate diagnosis is important for the prevention and treatment of syphilis. Here, to identify appropriate diagnostic antigens for serodiagnosis of syphilis, 6 recombinant proteins were expressed in Escherichia coli and purified, including flagellins (FlaB1 [Tp0868], FlaB2 [Tp0792], and FlaB3 [Tp0870]), Tp0463, Tp0751, and Tp1038. The sensitivities were determined by screening sera from individuals with primary (n=82), secondary (n=115), latent (n=105), and congenital (n=65) syphilis. The specificities were determined by screening sera from uninfected controls (n=30) and potentially cross-reactive infections including Lyme disease (n=30), leptospirosis (n=5), and hepatitis B (n=30). Our data showed that FlaB1, FlaB2, FlaB3, Tp0463, and Tp1038 exhibited higher overall sensitivities and specificities for detecting IgG antibody, with 95.4% and 98.9%, 92.6% and 95.8%, 95.1% and 95.8%, 92.6% and 97.9%, and 95.9% and 98.9%, respectively. In contrast, Tp0751 demonstrated only an overall sensitivity of 39.2%. For comparison, the sensitivity and specificity of Architect Syphilis TP were determined to be 98.1% and 93.7%, respectively. In addition, FlaB1, FlaB2, FlaB3, and Tp0463 demonstrated excellent performance for detecting IgM antibody in primary and congenital syphilis, with sensitivities of 76.8% and 83.1%, 72.0% and 87.7%, 74.4% and 89.2%, and 64.6% and 75.3%, respectively. These results indicate that FlaB1, FlaB2, FlaB3, and Tp0463 could be as novel diagnostic candidates for serodiagnosis of syphilis. Copyright © 2016 Elsevier Inc. All rights reserved.

B3GNT3 Expression Is a Novel Marker Correlated with Pelvic Lymph Node Metastasis and Poor Clinical Outcome in Early-Stage Cervical Cancer

PubMed Central

Niu, Chunhao; Song, Libing; Zhang, Yanna

2015-01-01

Background The β1,3-N-acetylglucosaminyltransferase-3 gene (B3GNT3) encodes a member of the B3GNT family that functions as the backbone structure of dimeric sialyl-Lewis A and is involved in L-selectin ligand biosynthesis, lymphocyte homing and lymphocyte trafficking. B3GNT3 has been implicated as an important element in the development of certain cancers. However, the characteristics of B3GNT3 in the development and progression of cancer remain largely unknown. Thus, our study aimed to investigate the expression pattern and the prognostic value of B3GNT3 in patients with early-stage cervical cancer. Methods The mRNA and protein levels of B3GNT3 expression were examined in eight cervical cancer cell lines and ten paired cervical cancer tumors, using real-time PCR and western blotting, respectively. Immunohistochemistry (IHC) was used to analyze B3GNT3 protein expression in paraffin-embedded tissues from 196 early-stage cervical cancer patients. Statistical analyses were applied to evaluate the association between B3GNT3 expression scores and clinical parameters, as well as patient survival. Results B3GNT3 expression was significantly upregulated in cervical cancer cell lines and lesions compared with normal cells and adjacent noncancerous cervical tissues. In the 196 cases of tested early-stage cervical cancer samples, the B3GNT3 protein level was positively correlated with high risk TYPES of human papillomavirus (HPV) infection (P = 0.026), FIGO stage (P < 0.001), tumor size (P = 0.025), tumor recurrence (P = 0.004), vital status (P < 0.001), concurrent chemotherapy and radiotherapy (P = 0.016), lymphovascular space involvement (P = 0.003) and most importantly, lymph node metastasis (P = 0.003). Patients with high B3GNT3 expression had a shorter overall survival (OS) and disease-free survival (DFS) compared with those with low expression of this protein. Multivariate analysis suggested that B3GNT3 expression is an independent prognostic indicator for cervical

Human APOBEC3B interacts with the heterogenous nuclear ribonucleoprotein A3 in cancer cells.

PubMed

Mishra, Nawneet; Reddy, K Sony; Timilsina, Uddhav; Gaur, Deepak; Gaur, Ritu

2018-04-25

Human APOBEC3B (A3B), like other APOBEC3 members, is a cytosine deaminase which causes hypermutation of single stranded genome. Recent studies have shown that A3B is predominantly elevated in multiple cancer tissues and cell lines such as the bladder, cervix, lung, head and neck, and breast. Upregulation and activation of A3B in developing tumors can cause an unexpected cluster of mutations which promote cancer development and progression. The cellular proteins which facilitate A3B function through direct or indirect interactions remain largely unknown. In this study, we performed LC-MS-based proteomics to identify cellular proteins which coimmunoprecipitated with A3B. Our results indicated a specific interaction of A3B with hnRNP A3 (heterogeneous nuclear ribonucleoprotein). This interaction was verified by co-immunoprecipitation and was found to be RNA-dependent. Furthermore, A3B and hnRNP A3 colocalized as evident from immunofluorescence analysis. © 2018 Wiley Periodicals, Inc.

7 CFR 1b.3 - Categorical exclusions.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 1 2013-01-01 2013-01-01 false Categorical exclusions. 1b.3 Section 1b.3 Agriculture Office of the Secretary of Agriculture NATIONAL ENVIRONMENTAL POLICY ACT § 1b.3 Categorical exclusions... individual or cumulative effect on the human environment and are excluded from the preparation of...

18 CFR 3b.4 - Government contractors.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Government contractors. 3b.4 Section 3b.4 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... PERSONAL INFORMATION General § 3b.4 Government contractors. Systems of records operated by a contractor...

18 CFR 3b.4 - Government contractors.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Government contractors. 3b.4 Section 3b.4 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... PERSONAL INFORMATION General § 3b.4 Government contractors. Systems of records operated by a contractor...

3B11-N, a monoclonal antibody against MERS-CoV, reduces lung pathology in rhesus monkeys following intratracheal inoculation of MERS-CoV Jordan-n3/2012

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Reed F., E-mail: johnsonreed@mail.nih.gov; Bagci, Ulas; Center for Research in Computer Vision

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was identified in 2012 as the causative agent of a severe, lethal respiratory disease occurring across several countries in the Middle East. To date there have been over 1600 laboratory confirmed cases of MERS-CoV in 26 countries with a case fatality rate of 36%. Given the endemic region, it is possible that MERS-CoV could spread during the annual Hajj pilgrimage, necessitating countermeasure development. In this report, we describe the clinical and radiographic changes of rhesus monkeys following infection with 5×10{sup 6} PFU MERS-CoV Jordan-n3/2012. Two groups of NHPs were treated with either a humanmore » anti-MERS monoclonal antibody 3B11-N or E410-N, an anti-HIV antibody. MERS-CoV Jordan-n3/2012 infection resulted in quantifiable changes by computed tomography, but limited other clinical signs of disease. 3B11-N treated subjects developed significantly reduced lung pathology when compared to infected, untreated subjects, indicating that this antibody may be a suitable MERS-CoV treatment. - Highlights: • MERS-CoV Jordan-n3/2012 challenge of rhesus monkeys results in a mild disease. • CT can be used to monitor disease progression to aid models of human disease. • Treatment with the human monoclonal antibody 3B11-N resulted in decreased disease.« less

Fetal thrombocytopenia in pregnancies with fetal human parvovirus-B19 infection.

PubMed

Melamed, Nir; Whittle, Wendy; Kelly, Edmond N; Windrim, Rory; Seaward, P Gareth R; Keunen, Johannes; Keating, Sarah; Ryan, Greg

2015-06-01

Fetal infection with human parvovirus B19 (hParvo-B19) has been associated mainly with fetal anemia, although data regarding other fetal hematologic effects are limited. Our aim was to assess the rate and consequences of severe fetal thrombocytopenia after fetal hParvo-B19 infection. We conducted a retrospective study of pregnancies that were complicated by fetal hParvo-B19 infection that underwent fetal blood sampling (FBS). The characteristics and outcomes of fetuses with severe thrombocytopenia (<50 × 10(9)/L) were compared with those of fetuses with a platelet concentration of ≥50 × 10(9)/L (control fetuses). Fetuses in whom 3 FBSs were performed (n = 4) were analyzed to assess the natural history of platelet levels after fetal hParvo-B19 infection. A total of 37 pregnancies that were affected by fetal hParvo-B19 infection were identified. Of the 29 cases that underwent FBS and had information regarding fetal platelets, 11 cases (38%) were complicated by severe fetal thrombocytopenia. Severely thrombocytopenic fetuses were characterized by a lower hemoglobin concentration (2.6 ± 0.9 g/dL vs 5.5 ± 3.6 g/dL; P = .01), lower reticulocyte count (9.1% ± 2.8% vs 17.3% ± 10.6%; P = .02), and lower gestational age at the time of diagnosis (21.4 ± 3.1 wk vs 23.6 ± 2.2 wk; P = .03). Both the fetal death rate within 48 hours of FBS (27.3% vs 0%; P = .02) and the risk of prematurity (100.0% vs 13.3%; P < .001) were higher in fetuses with severe thrombocytopenia. Fetal thrombocytopenia was more common during the second trimester but, in some cases, persisted into the third trimester. Intrauterine transfusion (IUT) of red blood cells resulted in a further mean decrease of 40.1% ± 31.0% in fetal platelet concentration. Severe fetal thrombocytopenia is relatively common after fetal hParvo-B19 infection, can be further worsened by IUT, and may be associated with an increased risk of procedure-related fetal loss after either FBS or IUT. Copyright © 2015. Published by

Occult hepatitis B virus infection in hematopoietic stem cell donors in a hepatitis B virus endemic area.

PubMed

Hui, Chee-kin; Sun, Jian; Au, Wing-yan; Lie, Albert K W; Yueng, Yui-hung; Zhang, Hai-ying; Lee, Nikki P; Hou, Jin-ling; Liang, Raymond; Lau, George K K

2005-06-01

The acquisition of hepatitis B virus (HBV) infection following organ transplantation from donors with occult HBV infection is an important cause of morbidity and mortality. The aim of this study is to determine the prevalence of occult HBV in allogeneic hematopoietic stem cell (HSC) transplantation donors. We performed a retrospective study on 124 consecutive hepatitis B surface antigen negative HSC donors. Their serum samples were analyzed by PCR for the pre-S/S, pre-core/core and X regions of the virus. Samples reactive by at least two PCR assays were considered HBV-DNA positive. Nineteen of the 124 HSC donors (15.3%) had occult HBV infection. Sixteen of these 19 donors with occult HBV infection (84.2%) tested positive for hepatitis B core antibody while 78 of 105 subjects (74.3%) without occult HBV infection were also positive (P=0.56). Fourteen of the 19 donors (73.7%) with occult HBV infection tested positive for hepatitis B surface antibody while 67 of the 105 subjects without occult HBV infection were also positive (P=0.45). The prevalence of occult HBV infection among HSC donors in Hong Kong is high. Anti-HBc and anti-HBs status had no significant correlation with the presence of occult HBV infection.

Killer cell immunoglobulin-like receptor 3DL1 variation modifies HLA-B*57 protection against HIV-1.

PubMed

Martin, Maureen P; Naranbhai, Vivek; Shea, Patrick R; Qi, Ying; Ramsuran, Veron; Vince, Nicolas; Gao, Xiaojiang; Thomas, Rasmi; Brumme, Zabrina L; Carlson, Jonathan M; Wolinsky, Steven M; Goedert, James J; Walker, Bruce D; Segal, Florencia P; Deeks, Steven G; Haas, David W; Migueles, Stephen A; Connors, Mark; Michael, Nelson; Fellay, Jacques; Gostick, Emma; Llewellyn-Lacey, Sian; Price, David A; Lafont, Bernard A; Pymm, Phillip; Saunders, Philippa M; Widjaja, Jacqueline; Wong, Shu Cheng; Vivian, Julian P; Rossjohn, Jamie; Brooks, Andrew G; Carrington, Mary

2018-05-01

HLA-B*57 control of HIV involves enhanced CD8+ T cell responses against infected cells, but extensive heterogeneity exists in the level of HIV control among B*57+ individuals. Using whole-genome sequencing of untreated B*57+ HIV-1-infected controllers and noncontrollers, we identified a single variant (rs643347A/G) encoding an isoleucine-to-valine substitution at position 47 (I47V) of the inhibitory killer cell immunoglobulin-like receptor KIR3DL1 as the only significant modifier of B*57 protection. The association was replicated in an independent cohort and across multiple outcomes. The modifying effect of I47V was confined to B*57:01 and was not observed for the closely related B*57:03. Positions 2, 47, and 54 tracked one another nearly perfectly, and 2 KIR3DL1 allotypes differing only at these 3 positions showed significant differences in binding B*57:01 tetramers, whereas the protective allotype showed lower binding. Thus, variation in an immune NK cell receptor that binds B*57:01 modifies its protection. These data highlight the exquisite specificity of KIR-HLA interactions in human health and disease.

Genetic Analysis of Human Chymotrypsin-Like Elastases 3A and 3B (CELA3A and CELA3B) to Assess the Role of Complex Formation between Proelastases and Procarboxypeptidases in Chronic Pancreatitis.

PubMed

Párniczky, Andrea; Hegyi, Eszter; Tóth, Anna Zsófia; Szücs, Ákos; Szentesi, Andrea; Vincze, Áron; Izbéki, Ferenc; Németh, Balázs Csaba; Hegyi, Péter; Sahin-Tóth, Miklós

2016-12-20

Human chymotrypsin-like elastases 3A and 3B (CELA3A and CELA3B) are the products of gene duplication and share 92% identity in their primary structure. CELA3B forms stable complexes with procarboxypeptidases A1 and A2 whereas CELA3A binds poorly due to the evolutionary substitution of Ala241 with Gly in exon 7. Since position 241 is polymorphic both in CELA3A (p.G241A) and CELA3B (p.A241G), genetic analysis can directly assess whether individual variability in complex formation might alter risk for chronic pancreatitis. Here we sequenced exon 7 of CELA3A and CELA3B in a cohort of 225 subjects with chronic pancreatitis (120 alcoholic and 105 non-alcoholic) and 300 controls of Hungarian origin. Allele frequencies were 2.5% for CELA3A p.G241A and 1.5% for CELA3B p.A241G in controls, and no significant difference was observed in patients. Additionally, we identified six synonymous variants, two missense variants, a gene conversion event and ten variants in the flanking intronic regions. Variant c.643-7G>T in CELA3B showed an association with alcoholic chronic pancreatitis with a small protective effect (OR = 0.59, 95% CI = 0.39-0.89, p = 0.01). Functional analysis of missense variants revealed no major defects in secretion or activity. We conclude that variants affecting amino-acid position 241 in CELA3A and CELA3B are not associated with chronic pancreatitis, indicating that changes in complex formation between proelastases and procarboxypeptidases do not alter pancreatitis risk.

Nuclear Hyperfine Structure in the Donor – Acceptor Complexes (CH3)3N-BF3 and (CH)33N-B(CH3)3

EPA Science Inventory

The donor-acceptor complexes (CH3)3N-BF3 and (CH3)3N-B(CH3)3 have been reinvestigated at high resolution by rotational spectroscopy in a supersonic jet. Nuclear hyperfine structure resulting from both nitrogen and boron has been resolved and quadrupole coupling constants have bee...

Inhibition of Drp1 attenuates mitochondrial damage and myocardial injury in Coxsackievirus B3 induced myocarditis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Lin; Zhang, Ming; Yan, Rui

Viral myocarditis (VMC) is closely related to apoptosis, oxidative stress, innate immunity, and energy metabolism, which are all linked to mitochondrial dysfunction. A close nexus between mitochondrial dynamics and cardiovascular disease with mitochondrial dysfunction has been deeply researched, but there is still no relevant report in viral myocarditis. In this study, we aimed to explore the role of Dynamin-related protein 1 (Drp1)-linked mitochondrial fission in VMC. Mice were inoculated with the Coxsackievirus B3 (CVB3) and treated with mdivi1 (a Drp1 inhibitor). Protein expression of Drp1 was increased in mitochondria while decreased in cytoplasm and accompanied by excessive mitochondrial fission inmore » VMC mice. In addition, midivi1 treatment attenuate inflammatory cells infiltration in myocardium of the mice, serum Cardiac troponin I (CTnI) and Creatine kinase-MB (CK-MB) level. Mdivi1 also could improved the survival rate of mice and mitochondrial dysfunction reflected as the up-regulated mitochondrial marker enzymatic activities of succinate dehydrogenase (SDH), cytochrome c oxidase (COX) and mitochondrial membrane potential (MMP). At the same time, mdivi1 rescued the body weight loss, myocardial injury and apoptosis of cardiomyocyte. Furthermore, decease in LVEDs and increase in EF and FS were detected by echocardiogram, which indicated the improved myocardial function. Thus, Drp1-linked excessive mitochondrial fission contributed to VMC and midivi1 may be a potential therapeutic approach. - Highlights: • The expression of Drp1 is significantly increased in mitochondria while decreased in cytoplasm in VMC mice. • Drp1-linked excessive mitochondrial fission is involved in VMC. • Midivi1 treatment mitigate the mitochondrial damage, inflammation, apoptosis in VMC mice. • The disturbance of mitochondrial dynamics may be a new therapeutic target for VMC.« less

Human Herpesvirus 6B Induces Hypomethylation on Chromosome 17p13.3, Correlating with Increased Gene Expression and Virus Integration.

PubMed

Engdahl, Elin; Dunn, Nicky; Niehusmann, Pitt; Wideman, Sarah; Wipfler, Peter; Becker, Albert J; Ekström, Tomas J; Almgren, Malin; Fogdell-Hahn, Anna

2017-06-01

Human herpesvirus 6B (HHV-6B) is a neurotropic betaherpesvirus that achieves latency by integrating its genome into host cell chromosomes. Several viruses can induce epigenetic modifications in their host cells, but no study has investigated the epigenetic modifications induced by HHV-6B. This study analyzed methylation with an Illumina 450K array, comparing HHV-6B-infected and uninfected Molt-3 T cells 3 days postinfection. Bisulfite pyrosequencing was used to validate the Illumina results and to investigate methylation over time in vitro Expression of genes was investigated using quantitative PCR (qPCR), and virus integration was investigated with PCR. A total of 406 CpG sites showed a significant HHV-6B-induced change in methylation in vitro Remarkably, 86% (351/406) of these CpGs were located <1 Mb from chromosomal ends and were all hypomethylated in virus-infected cells. This was most evident at chromosome 17p13.3, where HHV-6B had induced CpG hypomethylation after 2 days of infection, possibly through TET2, which was found to be upregulated by the virus. In addition, virus-induced cytosine hydroxymethylation was observed. Genes located in the hypomethylated region at 17p13.3 showed significantly upregulated expression in HHV-6B-infected cells. A temporal experiment revealed HHV-6B integration in Molt-3 cell DNA 3 days after infection. The telomere at 17p has repeatedly been described as an integration site for HHV-6B, and we show for the first time that HHV-6B induces hypomethylation in this region during acute infection, which may play a role in the integration process, possibly by making the DNA more accessible. IMPORTANCE The ability to establish latency in the host is a hallmark of herpesviruses, but the mechanisms differ. Human herpesvirus 6B (HHV-6B) is known to establish latency through integration of its genome into the telomeric regions of host cells, with the ability to reactivate. Our study is the first to show that HHV-6B specifically induces

Polymorphisms of CCL3L1/CCR5 genes and recurrence of hepatitis B in liver transplant recipients.

PubMed

Li, Hong; Xie, Hai-Yang; Zhou, Lin; Wang, Wei-Lin; Liang, Ting-Bo; Zhang, Min; Zheng, Shu-Sen

2011-12-01

The genetic diversity of chemokines and chemokine receptors has been associated with the outcome of hepatitis B virus infection. The aim of this study was to evaluate whether the copy number variation in the CCL3L1 gene and the polymorphisms of CCR5Δ32 and CCR5-2459A→G (rs1799987) are associated with recurrent hepatitis B in liver transplantation for hepatitis B virus infection-related end-stage liver disease. A total of 185 transplant recipients were enrolled in this study. The genomic DNA was extracted from whole blood, the copy number of the CCL3L1 gene was determined by a quantitative real-time PCR based assay, CCR5Δ32 was detected by a sizing PCR method, and a single-nucleotide polymorphism in CCR5-2459 was detected by restriction fragment length polymorphism PCR. No CCR5Δ32 mutation was detected in any of the individuals from China. Neither copy number variation nor polymorphism in CCR5-2459 was associated with post-transplant re-infection with hepatitis B virus. However, patients with fewer copies (<4) of the CCL3L1 gene compared with the population median in combination with the CCR5G allele had a significantly higher risk for recurrent hepatitis B (odds ratio=1.93, 95% CI: 1.00-3.69; P=0.047). Patients possessing the compound decreased functional genotype of both CCL3L1 and CCR5 genes might be more likely to have recurrence of hepatitis B after transplantation.

Identification and Characterization of the Spodoptera Su(var) 3-9 Histone H3K9 trimethyltransferase and Its Effect in AcMNPV Infection

PubMed Central

Li, Binbin; Li, Sisi; Yin, Juan; Zhong, Jiang

2013-01-01

Histone H3-lysine9 (H3K9) trimethyltransferase gene Su(var) 3-9 was cloned and identified in three Spodoptera insects, Spodoptera frugiperda ( S . frugiperda ), S . exigua and S . litura . Sequence analysis showed that Spodoptera Su(var) 3-9 is highly conserved evolutionarily. Su(var) 3-9 protein was found to be localized in the nucleus in Sf9 cells, and interact with histone H3, and the heterochromatin protein 1a (HP1a) and HP1b. A dose-dependent enzymatic activity was found at both 27 °C and 37 °C in vitro, with higher activity at 27 °C. Addition of specific inhibitor chaetocin resulted in decreased histone methylation level and host chromatin relaxation. In contrast, overexpression of Su(var) 3-9 caused increased histone methylation level and cellular genome compaction. In AcMNV-infected Sf9 cells, the transcription of Su(var) 3-9 increased at late time of infection, although the mRNA levels of most cellular genes decreased. Pre-treatment of Sf9 cells with chaetocin speeded up viral DNA replication, and increased the transcription level of a variety of virus genes, whereas in Sf9 cells pre-transformed with Su(var) 3-9 expression vector, viral DNA replication slow down slightly. These findings suggest that Su(var) 3-9 might participate in the viral genes expression an genome replication repression during AcMNPV infection. It provided a new insight for the understanding virus–host interaction mechanism. PMID:23894480

Multi-filter Transit Observations of HAT-P-3b and TrES-3b with Multiple Northern Hemisphere Telescopes

NASA Astrophysics Data System (ADS)

Ricci, D.; Sada, P. V.; Navarro-Meza, S.; López-Valdivia, R.; Michel, R.; Fox Machado, L.; Ramón-Fox, F. G.; Ayala-Loera, C.; Brown Sevilla, S.; Reyes-Ruiz, M.; La Camera, A.; Righi, C.; Cabona, L.; Tosi, S.; Truant, N.; Peterson, S. W.; Prieto-Arranz, J.; Velasco, S.; Pallé, E.; Deeg, H.

2017-06-01

We present a photometric follow-up of transiting exoplanets HAT-P-3b and TrES-3b, observed by using several optical and near-infrared filters, with four small-class telescopes (D = 36-152 cm) in the Northern Hemisphere. Two of the facilities present their first scientific results. New 10 HAT-P-3b light curves and new 26 TrES-3b light curves are reduced and combined by filter to improve the quality of the photometry. Combined light curves fitting is carried out independently by using two different analysis packages, allowing the corroboration of the orbital and physical parameters in the literature. Results find no differences in the relative radius with the observing filter. In particular, we report for HAT-P-3b a first estimation of the planet-to-star radius {R}p/{R}* ={0.1112}-0.0026+0.0025 in the B band which is coherent with values found in the VRIz‧JH filters. Concerning TrES-3b, we derive a value for the orbital period of P = 1.3061862 ± 0.0000001 days which shows no linear variations over nine years of photometric observations.

NS3 protease resistance-associated substitutions in liver tissue and plasma samples from patients infected by hepatitis C virus genotype 1A or 1B.

PubMed

Morsica, Giulia; Andolina, Andrea; Merli, Marco; Messina, Emanuela; Hasson, Hamid; Lazzarin, Adriano; Uberti-Foppa, Caterina; Bagaglio, Sabrina

2017-08-01

The presence of naturally occurring resistance-associated substitutions (RASs) in the HCV-protease domain has been poorly investigated in the liver, the main site of HCV replication. We evaluated the natural resistance of the virus to NS3 protease inhibitors in liver tissue and plasma samples taken from HCV-infected patients. RASs were investigated by means of viral population sequencing in liver tissue samples from 18 HCV-infected patients harbouring genotype 1a or genotype 1b; plasma samples from 12 of these patients were also available for virological investigation. A discordant genotype was found in two of the 12 patients (16.6%) who provided samples from both compartments. Sequence analysis of the NS3 protease domain showed the presence of RASs in four of the 18 liver tissue samples (22.2%), two of which showed cross-resistance to protease inhibitors in clinical use or phase 2-3 trials. The analysis of the 12 paired tissues and plasma samples excluded the presence of RASs in the plasma compartment. The dominance of discordant genotypes in the paired liver and plasma samples of some HCV-infected patients suggests mixed infection possibly leading to the selective advantage of different genotype in the two compartments. The presence of RASs at intra-hepatic level is not uncommon and may lead to the early emergence of cross-resistant strains.

18 CFR 3b.1 - Purpose.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Purpose. 3b.1 Section 3b.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE PERSONAL...

18 CFR 3b.1 - Purpose.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Purpose. 3b.1 Section 3b.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE PERSONAL...

18 CFR 3b.2 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Definitions. 3b.2 Section 3b.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE PERSONAL...

18 CFR 3b.1 - Purpose.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Purpose. 3b.1 Section 3b.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE PERSONAL...

18 CFR 3b.1 - Purpose.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Purpose. 3b.1 Section 3b.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE PERSONAL...

18 CFR 3b.2 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 3b.2 Section 3b.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE PERSONAL...

18 CFR 3b.2 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Definitions. 3b.2 Section 3b.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE PERSONAL...

18 CFR 3b.2 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Definitions. 3b.2 Section 3b.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE PERSONAL...

Pathogenesis of a genotype C strain of bovine parainfluenza virus type 3 infection in albino guinea pigs.

PubMed

Shi, Hong-Fei; Zhu, Yuan-Mao; Dong, Xiu-Mei; Cai, Hong; Ma, Lei; Wang, Shu; Yan, Hao; Wang, Xue-Zhi; Xue, Fei

2014-08-08

Bovine parainfluenza virus type 3 (BPIV3) is one of the most important of the known viral respiratory tract agents of both young and adult cattle and widespread among cattle around the world. Up to present, three genotypes A, B and C of BPIV3 have been described on the basis of genetic and phylogenetic analysis and only limited studies on the pathogenesis of the genotype A of BPIV3 infection in calves and laboratory animals have been performed. The report about experimental infections of the genotypes B and C of BPIV3 in laboratory animals and calves was scant. Therefore, an experimental infection of guinea pigs with the Chinese BPIV3 strain SD0835 of the genotype C was performed. Sixteen guinea pigs were intranasally inoculated with the suspension of SD0835, while eight control guinea pigs were also intranasally inoculated with the same volume of supernatant from uninfected MDBK cells. The virus-inoculated guinea pigs displayed a few observable clinical signs that were related to the respiratory tract disease and two of the sixteen experimentally infected guinea pigs died at 2 and 3 days post inoculation (PI), respectively, and apparent gross pneumonic lesions were observed at necropsy. The gross pneumonic lesions in guinea pigs inoculated with SD0835 consisted of dark red, slightly depressed, irregular areas of consolidation in the lung lobes from the second to 9th day of infection at necropsy, and almost complete consolidation and atelectasis of the lung lobes were seen at 7 days PI. Histopathological changes including alveoli septa thickening and focal cellulose pneumonia were also observed in the lungs of guinea pigs experimentally infected with SD0835. Viral replication was detectable by virus isolation and titration, real-time RT-PCR and immunohistochemistry (IHC) staining in the respiratory tissues of guinea pigs as early as 24h after intranasal inoculation with SD0835. The results of virus isolation and titration showed that guinea pigs were permissive for

21 CFR 73.3123 - 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 1 2013-04-01 2013-04-01 false 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one. 73.3123 Section 73.3123 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Medical...

21 CFR 73.3123 - 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 1 2012-04-01 2012-04-01 false 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one. 73.3123 Section 73.3123 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Medical...

21 CFR 73.3123 - 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 1 2011-04-01 2011-04-01 false 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one. 73.3123 Section 73.3123 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Medical...

21 CFR 73.3123 - 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 1 2014-04-01 2014-04-01 false 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one. 73.3123 Section 73.3123 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Medical...

21 CFR 73.3123 - 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 1 2010-04-01 2010-04-01 false 6-Ethoxy-2-(6-ethoxy-3-oxobenzo[b]thien-2(3H)-ylidene) benzo[b]thiophen-3 (2H)-one. 73.3123 Section 73.3123 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Medical...

Runx2 mediates epigenetic silencing of the bone morphogenetic protein-3B (BMP-3B/GDF10) in lung cancer cells

PubMed Central

2012-01-01

Background The Runt-related transcription factor Runx2 is essential for bone development but is also implicated in progression of several cancers of breast, prostate and bone, where it activates cancer-related genes and promotes invasive properties. The transforming growth factor β (TGF-β) family member bone morphogenetic protein-3B (BMP-3B/GDF10) is regarded as a tumor growth inhibitor and a gene silenced in lung cancers; however the regulatory mechanisms leading to its silencing have not been identified. Results Here we show that Runx2 is highly expressed in lung cancer cells and downregulates BMP-3B. This inverse relationship between Runx2 and BMP-3B expression is further supported by increased expression of BMP-3B in mesenchymal cells from Runx2 deficient mice. The ectopic expression of Runx2, but not DNA binding mutant Runx2, in normal lung fibroblast cells and lung cancer cells resulted in suppression of BMP-3B levels. The chromatin immunoprecipitation studies identified that the mechanism of Runx2-mediated suppression of BMP-3B is due to the recruitment of Runx2 and histone H3K9-specific methyltransferase Suv39h1 to BMP-3B proximal promoter and a concomitant increase in histone methylation (H3K9) status. The knockdown of Runx2 in H1299 cells resulted in decreased histone H3K9 methylation on BMP-3B promoter and increased BMP-3B expression levels. Furthermore, co-immunoprecipitation studies showed a direct interaction of Runx2 and Suv39h1 proteins. Phenotypically, Runx2 overexpression in H1299 cells increased wound healing response to TGFβ treatment. Conclusions Our studies identified BMP-3B as a new Runx2 target gene and revealed a novel function of Runx2 in silencing of BMP-3B in lung cancers. Our results suggest that Runx2 is a potential therapeutic target to block tumor suppressor gene silencing in lung cancer cells. PMID:22537242

Incidence of infection in 39-month-old ewes with TMEM154 diplotypes "1 1," "1 3," and "3 3" after natural exposure to ovine progressive pneumonia virus.

PubMed

Leymaster, K A; Chitko-McKown, C G; Heaton, M P

2015-01-01

Production and well-being of sheep and goats in many countries are harmfully impacted by small ruminant lentiviruses (SRLV) that cause incurable, progressive diseases. Susceptibility to ovine progressive pneumonia virus (OPPV), the North American form of SRLV, is influenced by variants of the ovine transmembrane protein 154 gene (TMEM154). The experimental objective was to estimate additive and dominance effects of TMEM154 haplotypes 1 and 3 on susceptibility of breeding ewes to infection after natural exposure to OPPV from birth to 39 mo of age. Sires and dams were heterozygous for TMEM154 haplotypes 1 and 3, producing ewe lambs with diplotypes "1 1," "1 3," and "3 3." These lambs were raised by mature, infected dams to ensure natural, maternal exposure to OPPV. Ewe lambs (n = 108) were kept for breeding and joined an infected flock of ewes to guarantee natural, nonmaternal exposure to OPPV. Ewes were bred to lamb at 1, 2, and 3 yr of age. Serum samples were collected at breeding, 1 mo before lambing and shortly after weaning each year to monitor infection status to 39 mo of age. During the experiment, 9 of the 108 ewes died while uninfected and data collected on these ewes were not analyzed. Infection status of the remaining 99 ewes at 39 mo of age was analyzed using logistic regression procedures. Effects of ewe type of birth, ewe type of rearing, and breed type of dam were not detected (P > 0.10), and the estimated sire variance component was nil. Ewe diplotype affected infection status (P < 0.0001), as did additive (P < 0.0001) and dominance (P < 0.0022) effects. Predicted probabilities of infection for ewes with diplotypes "1 1," "1 3," and "3 3" were 0.10, 0.88, and 0.89, respectively, and confidence intervals for diplotypes "1 3" and "3 3" were distinct from "1 1." Haplotype 3 was completely dominant to haplotype 1 at 39 mo of age. The probability of infection for ewes with either diplotype "1 3" or "3 3" averaged 8.5 times that of ewes with diplotype "1 1

Integrated rheology model: Explosive Composition B-3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davis, Stephen M.; Zerkle, David K.; Smilowitz, Laura B.

Composition B-3 (Comp B-3) is a high explosive formulation composed of 60/40wt% RDX (1,3,5-trinitroperhydro-1,3,5-triazine) /TNT (2,4,6 trinitrotoluene). Above approximately 78°C this formulation partially melts to form a multiphase system with solid RDX particles in a molten TNT matrix. This multiphase system presents a number of phenomena that influence its apparent viscosity. In an earlier study explosive Composition B-3 (Comp B-3, 60/40wt% RDX/TNT) was examined for evidence of yield stress using a non-isothermal falling ball viscometer and a yield stress model was proposed in this paper. An integrated viscosity model suitable for use in computational fluid dynamics (CFD) simulations is developedmore » to capture the transition from a heterogeneous solid to a Bingham viscoplastic fluid. This viscosity model is used to simulate the motion of imbedded spheres falling through molten Comp B-3. Finally, comparison of the simulations to physical tests show agreement between the positions predicted by the model and the measured locations of the spheres as a function of temperature between 90C and 165C.« less

Integrated rheology model: Explosive Composition B-3

DOE PAGES

Davis, Stephen M.; Zerkle, David K.; Smilowitz, Laura B.; ...

2018-03-20

Composition B-3 (Comp B-3) is a high explosive formulation composed of 60/40wt% RDX (1,3,5-trinitroperhydro-1,3,5-triazine) /TNT (2,4,6 trinitrotoluene). Above approximately 78°C this formulation partially melts to form a multiphase system with solid RDX particles in a molten TNT matrix. This multiphase system presents a number of phenomena that influence its apparent viscosity. In an earlier study explosive Composition B-3 (Comp B-3, 60/40wt% RDX/TNT) was examined for evidence of yield stress using a non-isothermal falling ball viscometer and a yield stress model was proposed in this paper. An integrated viscosity model suitable for use in computational fluid dynamics (CFD) simulations is developedmore » to capture the transition from a heterogeneous solid to a Bingham viscoplastic fluid. This viscosity model is used to simulate the motion of imbedded spheres falling through molten Comp B-3. Finally, comparison of the simulations to physical tests show agreement between the positions predicted by the model and the measured locations of the spheres as a function of temperature between 90C and 165C.« less

The IκB family member Bcl-3 coordinates the pulmonary defense against Klebsiella pneumoniae infection.

PubMed

Pène, Frédéric; Paun, Andrea; Sønder, Søren Ulrik; Rikhi, Nimisha; Wang, Hongshan; Claudio, Estefania; Siebenlist, Ulrich

2011-02-15

Bcl-3 is an atypical member of the IκB family that has the potential to positively or negatively modulate nuclear NF-κB activity in a context-dependent manner. Bcl-3's biologic impact is complex and includes roles in tumorigenesis and diverse immune responses, including innate immunity. Bcl-3 may mediate LPS tolerance, suppressing cytokine production, but it also seems to contribute to defense against select systemic bacterial challenges. However, the potential role of Bcl-3 in organ-specific host defense against bacteria has not been addressed. In this study, we investigated the relevance of Bcl-3 in a lung challenge with the Gram-negative pathogen Klebsiella pneumoniae. In contrast to wild-type mice, Bcl-3-deficient mice exhibited significantly increased susceptibility toward K. pneumoniae pneumonia. The mutant mice showed increased lung damage marked by neutrophilic alveolar consolidation, and they failed to clear bacteria in lungs, which correlated with increased bacteremic dissemination. Loss of Bcl-3 incurred a dramatic cytokine imbalance in the lungs, which was characterized by higher levels of IL-10 and a near total absence of IFN-γ. Moreover, Bcl-3-deficient mice displayed increased lung production of the neutrophil-attracting chemokines CXCL-1 and CXCL-2. Alveolar macrophages and neutrophils are important to antibacterial lung defense. In vitro stimulation of Bcl-3-deficient alveolar macrophages with LPS or heat-killed K. pneumoniae recapitulated the increase in IL-10 production, and Bcl-3-deficient neutrophils were impaired in intracellular bacterial killing. These findings suggest that Bcl-3 is critically involved in lung defense against Gram-negative bacteria, modulating functions of several cells to facilitate efficient clearance of bacteria.

Crystal structure of a 3B3 variant - A broadly neutralizing HIV-1 scFv antibody

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clark, K. Reed; Walsh, Scott T.R.; NCH)

2009-12-10

We present the crystal structure determination of an anti-HIV-1 gp120 single-chain variable fragment antibody variant, 3B3, at 2.5 {angstrom} resolution. This 3B3 variant was derived from the b12 antibody, using phage display and site-directed mutagenesis of the variable heavy chain (V{sub H}) complementary-determining regions (CDRs). 3B3 exhibits enhanced binding affinity and neutralization activity against several cross-clade primary isolates of HIV-1 by interaction with the recessed CD4-binding site on the gp120 envelope protein. Comparison with the structures of the unbound and bound forms of b12, the 3B3 structure closely resembles these structures with minimal differences with two notable exceptions. First, theremore » is a reorientation of the CDR-H3 of the V{sub H} domain where the primary sequences evolved from b12 to 3B3. The structural changes in CDR-H3 of 3B3, in light of the b12-gp120 complex structure, allow for positioning an additional Trp side chain in the binding interface with gp120. Finally, the second region of structural change involves two peptide bond flips in CDR-L3 of the variable light (VL) domain triggered by a point mutation in CDR-H3 of Q100eY resulting in changes in the intramolecular hydrogen bonding patterning between the VL and VH domains. Thus, the enhanced binding affinities and neutralization capabilities of 3B3 relative to b12 probably result from higher hydrophobic driving potential by burying more aromatic residues at the 3B3-gp120 interface and by indirect stabilization of intramolecular contacts of the core framework residues between the VL and VH domains possibly through more favorable entropic effect through the expulsion of water.« less

Thieno[3,2-b]- and thieno[2,3-b]pyrrole bioisosteric analogues of the hallucinogen and serotonin agonist N,N-dimethyltryptamine.

PubMed

Blair, J B; Marona-Lewicka, D; Kanthasamy, A; Lucaites, V L; Nelson, D L; Nichols, D E

1999-03-25

The synthesis and biological activity of 6-[2-(N, N-dimethylamino)ethyl]-4H-thieno[3,2-b]pyrrole (3a) and 4-[2-(N, N-dimethylamino)ethyl]-6H-thieno[2,3-b]pyrrole (3b), thienopyrroles as potential bioisosteres of N,N-dimethyltryptamine (1a), are reported. Hallucinogen-like activity was evaluated in the two-lever drug discrimination paradigm using LSD- and DOI-trained rats. Neither 3a nor 3b substituted for LSD or DOI up to doses of 50 micromol/kg. By comparison, 1a fully substituted in LSD-trained rats. However, 3a and 3b fully substituted for the 5-HT1A agonist LY293284 ((-)-(4R)-6-acetyl-4-(di-n-propylamino)-1,3,4, 5-tetrahydrobenz[c,d]indole). Both 3a and 3b induced a brief "serotonin syndrome" and salivation, an indication of 5-HT1A receptor activation. At the cloned human 5-HT2A receptor 3b had about twice the affinity of 3a. At the cloned human 5-HT2B and 5-HT2C receptors, however, 3a had about twice the affinity of 3b. Therefore, thiophene lacks equivalence as a replacement for the phenyl ring in the indole nucleus of tryptamines that bind to 5-HT2 receptor subtypes and possess LSD-like behavioral effects. Whereas both of the thienopyrroles had lower affinity than the corresponding 1a at 5-HT2 receptors, 3a and 3b had significantly greater affinity than 1a at the 5-HT1A receptor. Thus, thienopyrrole does appear to serve as a potent bioisostere for the indole nucleus in compounds that bind to the serotonin 5-HT1A receptor. These differences in biological activity suggest that serotonin receptor isoforms are very sensitive to subtle changes in the electronic character of the aromatic systems of indole compounds.

3B11-N, a monoclonal antibody against MERS-CoV, reduces lung pathology in rhesus monkeys following intratracheal inoculation of MERS-CoV Jordan-n3/2012.

PubMed

Johnson, Reed F; Bagci, Ulas; Keith, Lauren; Tang, Xianchun; Mollura, Daniel J; Zeitlin, Larry; Qin, Jing; Huzella, Louis; Bartos, Christopher J; Bohorova, Natasha; Bohorov, Ognian; Goodman, Charles; Kim, Do H; Paulty, Michael H; Velasco, Jesus; Whaley, Kevin J; Johnson, Joshua C; Pettitt, James; Ork, Britini L; Solomon, Jeffrey; Oberlander, Nicholas; Zhu, Quan; Sun, Jiusong; Holbrook, Michael R; Olinger, Gene G; Baric, Ralph S; Hensley, Lisa E; Jahrling, Peter B; Marasco, Wayne A

2016-03-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was identified in 2012 as the causative agent of a severe, lethal respiratory disease occurring across several countries in the Middle East. To date there have been over 1600 laboratory confirmed cases of MERS-CoV in 26 countries with a case fatality rate of 36%. Given the endemic region, it is possible that MERS-CoV could spread during the annual Hajj pilgrimage, necessitating countermeasure development. In this report, we describe the clinical and radiographic changes of rhesus monkeys following infection with 5×10(6) PFU MERS-CoV Jordan-n3/2012. Two groups of NHPs were treated with either a human anti-MERS monoclonal antibody 3B11-N or E410-N, an anti-HIV antibody. MERS-CoV Jordan-n3/2012 infection resulted in quantifiable changes by computed tomography, but limited other clinical signs of disease. 3B11-N treated subjects developed significantly reduced lung pathology when compared to infected, untreated subjects, indicating that this antibody may be a suitable MERS-CoV treatment. Published by Elsevier Inc.

Latency-Associated Nuclear Antigen E3 Ubiquitin Ligase Activity Impacts Gammaherpesvirus-Driven Germinal Center B Cell Proliferation.

PubMed

Cerqueira, Sofia A; Tan, Min; Li, Shijun; Juillard, Franceline; McVey, Colin E; Kaye, Kenneth M; Simas, J Pedro

2016-09-01

Viruses have evolved mechanisms to hijack components of cellular E3 ubiquitin ligases, thus modulating the ubiquitination pathway. However, the biological relevance of such mechanisms for viral pathogenesis in vivo remains largely unknown. Here, we utilized murid herpesvirus 4 (MuHV-4) infection of mice as a model system to address the role of MuHV-4 latency-associated nuclear antigen (mLANA) E3 ligase activity in gammaherpesvirus latent infection. We show that specific mutations in the mLANA SOCS box (V199A, V199A/L202A, or P203A/P206A) disrupted mLANA's ability to recruit Elongin C and Cullin 5, thereby impairing the formation of the Elongin BC/Cullin 5/SOCS (EC5S(mLANA)) complex and mLANA's E3 ligase activity on host NF-κB and Myc. Although these mutations resulted in considerably reduced mLANA binding to viral terminal repeat DNA as assessed by electrophoretic mobility shift assay (EMSA), the mutations did not disrupt mLANA's ability to mediate episome persistence. In vivo, MuHV-4 recombinant viruses bearing these mLANA SOCS box mutations exhibited a deficit in latency amplification in germinal center (GC) B cells. These findings demonstrate that the E3 ligase activity of mLANA contributes to gammaherpesvirus-driven GC B cell proliferation. Hence, pharmacological inhibition of viral E3 ligase activity through targeting SOCS box motifs is a putative strategy to control gammaherpesvirus-driven lymphoproliferation and associated disease. The gammaherpesviruses Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV) cause lifelong persistent infection and play causative roles in several human malignancies. Colonization of B cells is crucial for virus persistence, and access to the B cell compartment is gained by virus-driven proliferation in germinal center (GC) B cells. Infection of B cells is predominantly latent, with the viral genome persisting as a multicopy episome and expressing only a small subset of viral genes. Here, we focused on

E3 ubiquitin ligase Cbl-b in innate and adaptive immunity

PubMed Central

Liu, Qingjun; Zhou, Hong; Langdon, Wallace Y; Zhang, Jian

2014-01-01

Casitas B-lineage lymphoma proto-oncogene-b (Cbl-b), a RING finger E3 ubiquitin-protein ligase, has been demonstrated to play a crucial role in establishing the threshold for T-cell activation and controlling peripheral T-cell tolerance via multiple mechanisms. Accumulating evidence suggests that Cbl-b also regulates innate immune responses and plays an important role in host defense to pathogens. Understanding the signaling pathways regulated by Cbl-b in innate and adaptive immune cells is therefore essential for efficient manipulation of Cbl-b in emerging immunotherapies for human disorders such as autoimmune diseases, allergic inflammation, infections, and cancer. In this article, we review the latest developments in the molecular structural basis of Cbl-b function, the regulation of Cbl-b expression, the signaling mechanisms of Cbl-b in immune cells, as well as the biological function of Cbl-b in physiological and pathological immune responses in animal models and human diseases. PMID:24875217

Epstein-Barr virus EBNA2 directs doxorubicin resistance of B cell lymphoma through CCL3 and CCL4-mediated activation of NF-κB and Btk.

PubMed

Kim, Joo Hyun; Kim, Won Seog; Hong, Jung Yong; Ryu, Kung Ju; Kim, Seok Jin; Park, Chaehwa

2017-01-17

Epstein-Barr virus (EBV)-encoded nuclear antigen, EBNA2, expressed in EBV-infected B lymphocytes is critical for lymphoblastoid cell growth. Microarray profiling and cytokine array screening revealed that EBNA2 is associated with upregulation of the chemokines CCL3 and CCL4 in lymphoma cells. Depletion or inactivation of CCL3 or CCL4 sensitized DLBCL cells to doxorubicin. Our results indicate that EBV influences cell survival via an autocrine mechanism whereby EBNA2 increases CCL3 and CCL4, which in turn activate the Btk and NF-κB pathways, contributing to doxorubicin resistance of B lymphoma cells. Western blot data further confirmed that CCL3 and CCL4 direct activation of Btk and NF-κB. Based on these findings, we propose that a pathway involving EBNA2/Btk/NF-κB/CCL3/CCL4 plays a key role in doxorubicin resistance, and therefore, inhibition of specific components of this pathway may sensitize lymphoma cells to doxorubicin. Evaluation of the relationship between CCL3 expression and EBV infection revealed high CCL3 levels in EBV-positive patients. Our data collectively suggest that doxorubicin treatment for EBNA2-positive DLBCL cells may be effectively complemented with a NF-κB or Btk inhibitor. Moreover, evaluation of the CCL3 and CCL4 levels may be helpful for selecting DLBCL patients likely to benefit from doxorubicin treatment in combination with the velcade or ibrutinib.

Epidemiological and Phylogenetic Characteristics of Influenza B Infection in Severe Acute Respiratory Infection Cases in Beijing, 2014 to 2015.

PubMed

Pan, Yang; Zhang, Yi; Yang, Peng; Qian, Haiqun; Shi, Weixian; Wu, Shuangsheng; Cui, Shujuan; Zhang, Daitao; Wang, Quanyi

2015-12-01

Influenza B viral infection is of great importance, but the epidemiological and phylogenetic characteristics of influenza B infection in severe acute respiratory infection (SARI) cases are still unclear.The clinical information of 2816 SARI cases and 467,737 influenza-like illness (ILI) cases in Beijing area from September 2014 to April 2015 were collected and analyzed. Among them, 91 influenza B viruses isolated from SARI cases were sequenced.The overall yield rate of influenza A/B infection was 14.21% and 27.77% in sampled SARI and ILI cases, respectively. Compared with influenza A infection, the frequency of influenza B infection in SARI cases was higher in younger patients. Phylogenetic analysis suggested that most tested hemagglutination genes belonged to Yamagata lineage Clade 3, which were similar with current circulating viruses but different with 2014 to 2015 influenza season vaccine strain (Clade 2). Importantly, HA-Y3/NA-V4 intralineage reassorting was identified in Beijing area for the first time, which can act as a possible risk factor of SARIs.The influenza activity and virus types/subtypes/lineages among SARI patients were well correlated with that of ILI cases. Furthermore, the potential risk of reassorted influenza B virus infection should not be overlooked.

Up-regulated ephrinB3/EphB3 expression in intractable temporal lobe epilepsy patients and pilocarpine induced experimental epilepsy rat model.

PubMed

Huang, Hao; Li, Ruohan; Yuan, Jinxian; Zhou, Xin; Liu, Xi; Ou, Shu; Xu, Tao; Chen, Yangmei

2016-05-15

EphB family receptor tyrosine kinases, in cooperation with cell surface-bound ephrinB ligands, play a critical role in maintenance of dendritic spine morphogenesis, axons guidance, synaptogenesis, synaptic reorganization and plasticity in the central nervous system (CNS). However, the expression pattern of ephrinB/EphB in intractable temporal lobe epilepsy (TLE) and the underlying molecular mechanisms during epileptogenesis remain poorly understood. Here we investigated the expression pattern and cellular distribution of ephrinB/EphB in intractable TLE patients and lithium chloride-pilocarpine induced TLE rats using real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemistry, double-labeled immunofluorescence and Western blot analysis. Compared to control groups, ephrinB3 and EphB3 mRNA expression were significantly up-regulated in intractable TLE patients and TLE rats, while the mRNA expression trend of ephrinB1/2 and EphB1/2/4/6 in intractable TLE patients and TLE rats were inconsistent. Western blot analysis and semi-quantitative immunohistochemistry confirmed that ephrinB3 and EphB3 protein level were up-regulated in intractable TLE patients and TLE rats. At the same time, double-labeled immunofluorescence indicate that ephrinB3 was expressed mainly in the cytoplasm and protrusions of glia and neurons, while EphB3 was expressed mainly in the cytoplasm of neurons. Taken together, up-regulated expression of ephrinB3/EphB3 in intractable TLE patients and experimental TLE rats suggested that ephrinB3/EphB3 might be involved in the pathogenesis of TLE. Copyright © 2016 Elsevier B.V. All rights reserved.

Understanding Complex Tribofilms by Means of H3BO3-B2O3 Model Glasses.

PubMed

Spadaro, F; Rossi, A; Ramakrishna, Shivaprakash N; Lainé, E; Woodward, P; Spencer, N D

2018-02-13

The discovery of the spontaneous reaction of boric oxides with moisture in the air to form lubricious H 3 BO 3 films has led to great interest in the tribology of boron compounds in general. Despite this, a study of the growth kinetics of H 3 BO 3 on a B 2 O 3 substrate under controlled relative humidity (RH) has not yet been reported in the literature. Here, we describe the tribological properties of H 3 BO 3 -B 2 O 3 glass systems after aging under controlled RH over different lengths of time. A series of tribological tests has been performed applying a normal load of 15 N, at both room temperature and 100 °C in YUBASE 4 oil. In addition, the cause of H 3 BO 3 film failure under high-pressure and high-temperature conditions has been studied to find out whether the temperature, the tribostress, or both influence the removal of the lubricious film from the contact points. The following techniques were exploited: confocal Raman spectroscopy to characterize the structure and chemical nature of the glass systems, environmental scanning electron microscopy to examine the morphology of the H 3 BO 3 films developed, atomic force microscopy to monitor changes in roughness as a consequence of the air exposure, focused-ion-beam scanning electron microscopy to measure the average thickness of the H 3 BO 3 films grown over various times on B 2 O 3 glass substrates and to reveal the morphology of the sample in the vertical section, tribological tests to shed light on the system's lubricating properties, and finally small-area X-ray photoelectron spectroscopy to investigate the composition of the transfer film formed on the steel ball while tribotesting.

Investigation of the role of GBF1 in the replication of positive-sense single-stranded RNA viruses.

PubMed

Ferlin, Juliette; Farhat, Rayan; Belouzard, Sandrine; Cocquerel, Laurence; Bertin, Antoine; Hober, Didier; Dubuisson, Jean; Rouillé, Yves

2018-06-20

GBF1 has emerged as a host factor required for the replication of positive-sense single-stranded RNA viruses of different families, but its mechanism of action is still unknown. GBF1 is a guanine nucleotide exchange factor for Arf family members. Recently, we identified Arf4 and Arf5 (class II Arfs) as host factors required for the replication of hepatitis C virus (HCV), a GBF1-dependent virus. To assess whether a GBF1/class II Arf pathway is conserved among positive-sense single-stranded RNA viruses, we investigated yellow fever virus (YFV), Sindbis virus (SINV), coxsackievirus B4 (CVB4) and human coronavirus 229E (HCoV-229E). We found that GBF1 is involved in the replication of these viruses. However, using siRNA or CRISPR-Cas9 technologies, it was seen that the depletion of Arf1, Arf3, Arf4 or Arf5 had no impact on viral replication. In contrast, the depletion of Arf pairs suggested that class II Arfs could be involved in HCoV-229E, YFV and SINV infection, as for HCV, but not in CVB4 infection. In addition, another Arf pair, Arf1 and Arf4, appears to be essential for YFV and SINV infection, but not for infection by other viruses. Finally, CVB4 infection was not inhibited by any combination of Arf depletion. We conclude that the mechanism of action of GBF1 in viral replication appears not to be conserved, and that a subset of positive-sense single-stranded RNA viruses from different families might require class II Arfs for their replication.

Enhanced scintillation of Ba3In(B3O6)3 based on nitrogen doping

NASA Astrophysics Data System (ADS)

Wang, Z. X.; Pei, H.; Tao, X. M.; Cai, G. M.; Mao, R. H.; Jin, Z. P.

2018-02-01

Scintillating materials, as a class of luminescent materials, are highly demanded for practical use in the high-energy detection. However, the applications are often hampered by their low light yield (LY) or long decay time for many traditional scintillators. In this work, upon nitrogen anion doping, scintillation performance in layered borate Ba3In(B3O6)3 (BIB) has been excellently enhanced with high XEL intensity of ～3 times as large as that of commercial Bi4Ge3O12 (BGO) and ultra-fast fluorescent decay time of ～1.25 ns. To shed light on origins of the intrinsic violet-blue emission, we measured the in-situ vacuum ultraviolet excited (VUV) emission spectra of N-BIB ceramic. Combined with experiments and first principles calculations, the band-gap reduction and donor-acceptor density increasing by nitrogen (N) doping is responsible for the enhancement of scintillation performance for N-doped Ba3In(B3O6)3. Moreover, nitrogen anion doping rather than conventional cation doping is found to be also applicable to other intrinsic luminescent materials for enhancing performance.

Epidemiological and clinical characteristics of hepatitis B virus in HIV-infected patients in Guangdong, China.

PubMed

Huang, S M; Cai, W P; Hu, F Y; Lan, Y; Liao, B L; Chen, Y P; Tang, X P

2016-09-01

This study investigated the epidemiological and clinical characteristics of hepatitis B virus (HBV) in HIV-infected adults at the time of antiretroviral therapy (ART) initiation in Guangdong province, China. A total of 2793 HIV-infected adults were enrolled between January 2004 and September 2011. Demographic data and laboratory parameters were collected, HBV-DNA levels were measured, and HBV genotypes were identified before ART initiation. The prevalence of hepatitis B surface antigen (HBsAg) in HIV-infected patients was 13.2%. A total of 266 HIV/HBV co-infected patients and 1469 HIV mono-infected patients were recruited. The median alanine aminotransferase and aspartate aminotransferase levels of HIV/HBV co-infected patients were higher than HIV mono-infected patients (32 U/L vs. 22 U/L, p < 0.001 and 35 U/L vs. 24 U/L, p < 0.001, respectively), whereas the median CD4 cell count of HIV/HBV co-infected patients was lower than HIV mono-infected patients (59 cells/mm(3) vs. 141 cells/mm(3), p < 0.001). The level of CD4 cell count was lower in hepatitis B e-antigen (HBeAg)-positive co-infected patients than HBeAg-negative patients (36 cells/mm(3) vs. 69 cells/mm(3), p = 0.014). A similar result was found in high level of HBV-DNA and low level of HBV-DNA groups (33 cells/mm(3) vs. 89 cells/mm(3), p < 0.001). HBV genotypes were classified as genotypes B and C. Patients infected with genotypes B and C differed significantly in terms of proportion of those who were HBeAg-positive (40.5% vs. 62.2%, p = 0.014). This study indicates a high prevalence of HBsAg in HIV-infected adults in Guangdong. The level of CD4 cell count in HIV/HBV co-infected patients was much lower than HIV mono-infected patients, especially in patients who were HBeAg-positive and had a high level of HBV-DNA. The predominant HBV genotype in HIV/HBV co-infected patients is genotype B. © The Author(s) 2015.

Point-of-care screening, prevalence, and risk factors for hepatitis B infection among 3,728 mainly undocumented migrants from non-EU countries in northern Italy.

PubMed

El-Hamad, Issa; Pezzoli, Maria Chiara; Chiari, Erika; Scarcella, Carmelo; Vassallo, Francesco; Puoti, Massimo; Ciccaglione, Anna; Ciccozzi, Massimo; Scalzini, Alfredo; Castelli, Francesco

2015-01-01

Screening migrants from areas where hepatitis B virus (HBV) infection is endemic is important to implement preventive measures in Europe. The aim of our study was to assess (1) the feasibility of point-of-care screening in a primary care clinic and (2) hepatitis B surface antigen (HBsAg) prevalence, associated risk factors, and its clinical and epidemiological implications in undocumented migrants in Brescia, northern Italy. A longitudinal prospective study was conducted from January 2006 to April 2010 to assess HBsAg reactivity and associated risk factors among consenting undocumented migrants who accessed the Service of International Medicine of Brescia's Local Health Authority. Genotyping assay was also performed in HBV DNA-positive patients. Screening was accepted by 3,728/4,078 (91.4%) subjects consecutively observed during the study period, 224 (6%) of whom were found to be HBsAg-positive. HBsAg reactivity was independently associated with the prevalence of HBsAg carriers in the geographical area of provenance (p < 0.001). On the contrary, current or past sexual risk behaviors (despite being common in our sample) were not associated with HBV infection. Half of the HBsAg patients (111/224) had either hepatitis B e-antigen (HBeAg)-positive or -negative chronic HBV infection with a possible indication for treatment. HBV genotypes were identified in 45 of 167 HBV-infected patients as follows: genotype D, 27 subjects; genotype A, 8; genotype B, 5; and genotype C, 5. The geographical distribution of genotypes reflected the geographic provenance. Our results suggest that point-of-care screening is feasible in undocumented migrants and should be targeted according to provenance. Case detection of HBV infection among migrants could potentially reduce HBV incidence in migrants' contacts and in the general population by prompting vaccination of susceptible individuals and care of eligible infected patients. © 2014 International Society of Travel Medicine.

Seroprevalence of Hepatitis B Infection in Nigeria: A National Survey

PubMed Central

Olayinka, Adebola T.; Oyemakinde, Akin; Balogun, Muhammad S.; Ajudua, Anthonia; Nguku, Patrick; Aderinola, Moses; Egwuenu-Oladejo, Abiodun; Ajisegiri, Simeon W.; Sha'aibu, Samuel; Musa, Bolanle O. P.; Gidado, Saheed; Nasidi, Abdulsalami

2016-01-01

Hepatitis B virus (HBV) infection accounts for about 1 million deaths worldwide annually. This study was to determine the prevalence, distribution of HBV, and factors associated with infection in an apparently healthy population in Nigeria. A cross-sectional study among the general population was conducted employing a multistage sampling technique. Data on demographic, social, and behavioral indicators were collected using questionnaires and blood samples tested for HBV seromarkers. Descriptive, bivariate, and multivariate analyses were done. Prevalence of hepatitis B infection was 12.2% (confidence interval [CI] = 10.3–14.5). Of the participants, more than half, 527 (54.6%), had evidence of previous exposure to HBV, while 306 (31.7%) showed no serologic evidence of infection or vaccination. Only 76 (7.9%) participants showed serologic evidence of immunity to HBV through vaccination. Factors associated with testing positive for HBV infection were dental procedure outside the health facility (odds ratios [OR] = 3.4, 95% CI = 1.52–7.70), local circumcision (OR = 1.73, 95% CI = 1.17–2.57), and uvulectomy (OR = 1.65, 95% = 1.06–2.57). With logistic regression, only dental procedure outside the health facility (adjusted OR = 3.32, 95% CI = 1.38–7.97) remained significant. This first national survey on seroprevalence of hepatitis B describes the epidemiology and high prevalence of HBV infection in Nigeria and highlights the need for improved vaccination against HBV. PMID:27527630

Seroprevalence of Hepatitis B Infection in Nigeria: A National Survey.

PubMed

Olayinka, Adebola T; Oyemakinde, Akin; Balogun, Muhammad S; Ajudua, Anthonia; Nguku, Patrick; Aderinola, Moses; Egwuenu-Oladejo, Abiodun; Ajisegiri, Simeon W; Sha'aibu, Samuel; Musa, Bolanle O P; Gidado, Saheed; Nasidi, Abdulsalami

2016-10-05

Hepatitis B virus (HBV) infection accounts for about 1 million deaths worldwide annually. This study was to determine the prevalence, distribution of HBV, and factors associated with infection in an apparently healthy population in Nigeria. A cross-sectional study among the general population was conducted employing a multistage sampling technique. Data on demographic, social, and behavioral indicators were collected using questionnaires and blood samples tested for HBV seromarkers. Descriptive, bivariate, and multivariate analyses were done. Prevalence of hepatitis B infection was 12.2% (confidence interval [CI] = 10.3-14.5). Of the participants, more than half, 527 (54.6%), had evidence of previous exposure to HBV, while 306 (31.7%) showed no serologic evidence of infection or vaccination. Only 76 (7.9%) participants showed serologic evidence of immunity to HBV through vaccination. Factors associated with testing positive for HBV infection were dental procedure outside the health facility (odds ratios [OR] = 3.4, 95% CI = 1.52-7.70), local circumcision (OR = 1.73, 95% CI = 1.17-2.57), and uvulectomy (OR = 1.65, 95% CI = 1.06-2.57). With logistic regression, only dental procedure outside the health facility (adjusted OR = 3.32, 95% CI = 1.38-7.97) remained significant. This first national survey on seroprevalence of hepatitis B describes the epidemiology and high prevalence of HBV infection in Nigeria and highlights the need for improved vaccination against HBV. © The American Society of Tropical Medicine and Hygiene.

18 CFR 3b.250 - Specific exemptions.

Code of Federal Regulations, 2010 CFR

2010-04-01

... individual in the public notice of the system of -records; (5) 5 U.S.C. 552a(e)(4)(H); 18 CFR 3b.3(a)(9... public notice of the system of -records; (6) 5 U.S.C. 552a(e)(4)(I); 18 CFR 3b.3(a)(10)—Requiring a... of a confidential source who furnished the information to the Government under an express promise...

Association of HSD17B3 and HSD3B1 polymorphisms with acne vulgaris in Southwestern Han Chinese.

PubMed

Yang, Xiao-Yan; Wu, Wen-Juan; Yang, Cheng; Yang, Ting; He, Jun-Dong; Yang, Zhi; He, Li

2013-01-01

Acne vulgaris is a very common skin disorder. Previous studies have indicated that genetic background factors play key roles in the onset of acne. Our previous investigation implicated several genes in the androgen metabolism pathway with acne vulgaris in the Han Chinese population. Thus, we further investigated genes and genetic variants that play important roles in this pathway for their relationship with the pathology of acne. In this study, a total of 610 subjects, including 403 acne patients and 207 healthy controls, were genotyped for 15 single-nucleotide polymorphisms in HSD3B1 and HSD17B3 genes. This study shows that rs6428829 in HSD3B1 was associated with acne vulgaris in Han patients from Southwest China, even after adjusting for age and sex. The GG genotype was associated with an increased risk of acne vulgaris (p < 0.05) and G allele carriers were associated with an increased risk of acne vulgaris (p < 0.05). In addition, the haplotype AAT in HSD3B1 significantly increased the risk of acne vulgaris in the case-control study (p < 0.05). Furthermore, for another gene in this pathway, HSD17B3, the haplotype H8 was significantly associated with an increased risk of acne vulgaris. Based on these analyses, our study indicates that the cutaneous androgen metabolism-regulated genes HSD3B1 and HSD17B3 increase the susceptibility to acne vulgaris in Han Chinese from Southwest China. © 2013 S. Karger AG, Basel.

Hormonal Regulation and Distinct Functions of Semaphorin-3B and Semaphorin-3F in Ovarian Cancer

PubMed Central

Joseph, Doina; Ho, Shuk-Mei; Syed, Viqar

2009-01-01

Semaphorins comprise a family of molecules that influence neuronal growth and guidance. Class-3 semaphorins, semaphorin-3B (SEMA3B) and semaphorin-3F (SEMA3F) illustrate their effects by forming a complex with neuropilins (NP-1 or NP-2) and plexins. We examined the status and regulation of semaphorins and their receptors in human ovarian cancer cells. A significantly reduced expression of SEMA3B (83 kD), SEMA3F (90 kD), and plexin-A3 was observed in ovarian cancer (OVCA) cell lines when compared to normal human ovarian surface epithelial (HOSE) cells. The expression of NP-1, NP-2 and plexin-A1 was not altered in HOSE and OVCA cells. The decreased expression of SEMA3B, SEMA3F, and plexin-A3 was confirmed in stage 3 ovarian tumors. Treatment of OVCA cells with luteinizing hormone, follicle-stimulating hormone, and estrogen induced a significant upregulation of SEMA3B, whereas SEMA3F was upregulated only by estrogen. Co-treatment of cell lines with a hormone and its specific antagonist blocked the effect of the hormone. Ectopic expression of SEMA3B or SEMA3F reduced soft-agar colony formation, adhesion, and cell invasion of OVCA cell cultures. Forced expression of SEMA3B, but not SEMA3F, inhibited viability of OVCA cells. Overexpression of SEMA3B and SEMA3F reduced focal adhesion kinase (FAK) phosphorylation and matrix metalloproteinase (MMP)-2 and -9 expression in OVCA cells. Forced expression of SEMA3F, but not SEMA3B in OVCA cells, significantly inhibited endothelial cell tube formation. Collectively, our results suggest loss of SEMA3 expression could be a hallmark of cancer progression. Furthermore, gonadotropin- and/or estrogen-mediated maintenance of SEMA3 expression could control ovarian cancer angiogenesis and metastasis. PMID:20124444

Expression of progesterone receptor B is associated with G0/G1 arrest of the cell cycle and growth inhibition in NIH3T3 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horiuchi, Shinji; Kato, Kiyoko; Suga, Shin

2005-05-01

Previously, we found a significant reduction of progesterone receptor B (PR-B) expression levels in the Ras-mediated NIH3T3 cell transformation, and re-expression of exogenous PR-B eliminated the tumorigenic potential. We hypothesized that this reduction is of biological significance in cell transformation. In the present study, we determined the correlation between PR-B expression and cell cycle progression. In synchronized NIH3T3 cells, we found an increase in PR-B protein and p27 CDK inhibitor levels in the G0/G1 phase and a reduction due to redistribution in the S and G2/M phases. The MEK inhibitor or cAMP stimulation arrested NIH3T3 cells in the G0/G1 phasemore » of the cell cycle. The expression of PR-B and p27 CDK inhibitors was up-regulated by treatment with both the MEK inhibitor and cAMP. Treatment of synchronized cells with a PKA inhibitor in the presence of 1% calf serum resulted in a significant reduction in both PR-B and p27 levels. The decrease in the PR-B levels caused by anti-sense oligomers or siRNA corresponded to the reduction in p27 levels. PR-B overexpression by adenovirus infection induced p27 and suppressed cell growth. Finally, we showed that PR-B modulation involved in the regulation of NIH3T3 cell proliferation was independent of nuclear estrogen receptor (ER) activity but dependent on non-genomic ER activity.« less

Maternal hepatitis B infection and gestational diabetes mellitus.

PubMed

Lao, Terence T; Chan, Ben C P; Leung, Wing-Cheong; Ho, Lai-Fong; Tse, Ka-Yu

2007-07-01

This retrospective cohort study was performed to examine the relationship between maternal hepatitis B virus infection, as indicated by the surface antigen status, with the development of gestational diabetes mellitus in a normal-risk Chinese obstetric population. Maternal demographics, risk factors, and pregnancy outcome of 13,683 singleton pregnancies delivering in 1998-2001 were analysed according to maternal hepatitis B surface antigen status, which was routinely screened. Multiple logistic regression analysis was performed to examine the role of hepatitis B infection in the development of gestational diabetes mellitus. The 1138 women (8.3%) with hepatitis B infection had lower mean weight and body mass index, similar prevalence of chronic medical diseases and smokers, but increased prevalence of gestational diabetes mellitus, which remained significant (odds ratio 1.24, 95% confidence interval 1.01-1.51) after adjustment for confounding variables. However, there was no difference in pregnancy outcome. Our results confirmed the independent association between hepatitis B infection with gestational diabetes mellitus. The magnitude of chronic hepatitis B infection in the developing world and certain ethnic groups could have contributed to the high prevalence of gestational and possibly type 2 diabetes in these populations. Further studies on the long-term implications of our finding are warranted.

Parvovirus B19 Infection and Severe Anemia in Renal Transplant Recipients

PubMed Central

Carraturo, Antonio; Catalani, Valentina; Ottaviani, Donatella; Menichelli, Patrizia; Rossini, Maurizio; Terella, Delia; Biondi, Brunello

2012-01-01

Kidney transplant (KT) recipients can develop symptomatic Parvovirus (PV) B19 infections, frequently associated with persistent anemia. The aim of this study was to evaluate the prevalence and clinical significance of PV B19 infection in anemic and non-anemic KT patients. Overall, out of 64 patients monitored for the presence of PV B19 by real-time PCR, 2 (3.12%) had an active PV B19 infection, in absence of other viral coinfections. The 2 cases occurred in nonanemic kidney transplant patients group (2/50, 4%), while none of the anemic transplant patients (0/14) was found to suffer from this infection. Moreover, patients affected by active PV B19 infection showed viral loads not exceeding 1 × 105 genome copies/reaction. In conclusion, in this study, PV B19 infection was not common in renal transplant population and wasn't associated with severe anemia. PMID:22619569

ATP1B3 Protein Modulates the Restriction of HIV-1 Production and Nuclear Factor κ Light Chain Enhancer of Activated B Cells (NF-κB) Activation by BST-2*

PubMed Central

Nishitsuji, Hironori; Sugiyama, Ryuichi; Abe, Makoto; Takaku, Hiroshi

2016-01-01

Here, we identify ATP1B3 and fibrillin-1 as novel BST-2-binding proteins. ATP1B3 depletion in HeLa cells (BST-2-positive cells), but not 293T cells (BST-2-negative cells), induced the restriction of HIV-1 production in a BST-2-dependent manner. In contrast, fibrillin-1 knockdown reduced HIV-1 production in 293T and HeLa cells in a BST-2-independent manner. Moreover, NF-κB activation was enhanced by siATP1B3 treatment in HIV-1- and HIV-1ΔVpu-infected HeLa cells. In addition, ATP1B3 silencing induced high level BST-2 expression on the surface of HeLa cells. These results indicate that ATP1B3 is a co-factor that accelerates BST-2 degradation and reduces BST-2-mediated restriction of HIV-1 production and NF-κB activation. PMID:26694617

Acetylation-mediated Siah2 stabilization enhances PHD3 degradation in Helicobacter pylori-infected gastric epithelial cancer cells.

PubMed

Kokate, Shrikant Babanrao; Dixit, Pragyesh; Das, Lopamudra; Rath, Suvasmita; Roy, Arjama Dhar; Poirah, Indrajit; Chakraborty, Debashish; Rout, Niranjan; Singh, Shivaram Prasad; Bhattacharyya, Asima

2018-04-24

Gastric epithelial cells infected with Helicobacter pylori acquire highly invasive and metastatic characteristics. The seven in absentia homolog (Siah)2, an E3 ubiquitin ligase, is one of the major proteins that induces invasiveness of infected gastric epithelial cells. We find that p300-driven acetylation of Siah2 at lysine 139 residue stabilizes the molecule in infected cells, thereby substantially increasing its efficiency to degrade prolyl hydroxylase (PHD)3 in the gastric epithelium. This enhances the accumulation of an oncogenic transcription factor hypoxia-inducible factor 1α (Hif1α) in H. pylori-infected gastric cancer cells in normoxic condition and promotes invasiveness of infected cells. Increased acetylation of Siah2, Hif1α accumulation, and the absence of PHD3 in the infected human gastric metastatic cancer biopsy samples and in invasive murine gastric cancer tissues further confirm that the acetylated Siah2 (ac-Siah2)-Hif1α axis is crucial in promoting gastric cancer invasiveness. This study establishes the importance of a previously unrecognized function of ac-Siah2 in regulating invasiveness of H. pylori-infected gastric epithelial cells.-Kokate, S. B., Dixit, P., Das, L., Rath, S., Roy, A. D., Poirah, I., Chakraborty, D., Rout, N., Singh, S. P., Bhattacharyya, A. Acetylation-mediated Siah2 stabilization enhances PHD3 degradation in Helicobacter pylori-infected gastric epithelial cancer cells.

B7-H3 participates in the development of experimental pneumococcal meningitis by augmentation of the inflammatory response via a TLR2-dependent mechanism.

PubMed

Chen, Xuqin; Quinn, Edel M; Ni, Hong; Wang, Jian; Blankson, Siobhan; Redmond, H Paul; Wang, Jiang Huai; Feng, Xing

2012-07-01

In addition to a well-documented role in regulating T cell-mediated immune responses, B7-H3, a newly discovered member of the B7 superfamily, has been recently identified as a costimulator in the innate immunity-mediated inflammatory response. In this study, we further report that B7-H3 participates in the development of pneumococcal meningitis in a murine model. Exogenous administration of B7-H3 strongly amplified the inflammatory response, exacerbated blood-brain barrier disruption, and aggravated the clinical disease status in Streptococcus pneumoniae-infected C3H/HeN wild-type mice. Consistent with the in vivo findings, B7-H3 substantially augmented proinflammatory cytokine and chemokine production, upregulated NF-κB p65 and MAPK p38 phosphorylation, and enhanced the nuclear transactivation of NF-κB p65 at both TNF-α and IL-6 promoters in S. pneumoniae-stimulated primary murine microglia cells. These B7-H3-associated in vitro and in vivo effects appeared to be dependent on TLR2 signaling, as B7-H3 almost completely lost its amplifying actions in both TLR2-deficient microglial cells and TLR2-deficient mice. Furthermore, administration of the anti-B7-H3 mAb (MIH35) attenuated the inflammatory response and ameliorated blood-brain barrier disruption in S. pneumoniae-infected wild-type mice. Collectively, our results indicate that B7-H3 plays a contributory role in the development of S. pneumoniae infection-induced bacterial meningitis.

In Vivo Administration of a JAK3 Inhibitor during Acute SIV Infection Leads to Significant Increases in Viral Load during Chronic Infection

PubMed Central

Takahashi, Yoshiaki; Byrareddy, Siddappa N.; Albrecht, Christina; Brameier, Markus; Walter, Lutz; Mayne, Ann E.; Dunbar, Paul; Russo, Robert; Little, Dawn M.; Villinger, Tara; Khowawisetsut, Ladawan; Pattanapanyasat, Kovit; Villinger, Francois; Ansari, Aftab A.

2014-01-01

The studies reported herein are the first to document the effect of the in vivo administration of a JAK3 inhibitor for defining the potential role of NK cells during acute SIV infection of a group of 15 rhesus macaques (RM). An additional group of 16 MHC/KIR typed RM was included as controls. The previously optimized in vivo dose regimen (20 mg/kg daily for 35 days) led to a marked depletion of each of the major NK cell subsets both in the blood and gastro-intestinal tissues (GIT) during acute infection. While such depletion had no detectable effects on plasma viral loads during acute infection, there was a significant sustained increase in plasma viral loads during chronic infection. While the potential mechanisms that lead to such increased plasma viral loads during chronic infection remain unclear, several correlates were documented. Thus, during acute infection, the administration of the JAK3 inhibitor besides depleting all NK cell subsets also decreased some CD8+ T cells and inhibited the mobilization of the plasmacytoid dendritic cells in the blood and their localization to the GIT. Of interest is the finding that the administration of the JAK3 inhibitor during acute infection also resulted in the sustained maintenance during chronic infection of a high number of naïve and central memory CD4+ T cells, increases in B cells in the blood, but decreases in the frequencies and function of NKG2a+ NK cells within the GIT and blood, respectively. These data identify a unique role for JAK3 inhibitor sensitive cells, that includes NK cells during acute infection that in concert lead to high viral loads in SIV infected RM during chronic infection without affecting detectable changes in antiviral humoral/cellular responses. Identifying the precise mechanisms by which JAK3 sensitive cells exert their influence is critical with important implications for vaccine design against lentiviruses. PMID:24603870

Natural co-infection of influenza A/H3N2 and A/H1N1pdm09 viruses resulting in a reassortant A/H3N2 virus.

PubMed

Rith, Sareth; Chin, Savuth; Sar, Borann; Y, Phalla; Horm, Srey Viseth; Ly, Sovann; Buchy, Philippe; Dussart, Philippe; Horwood, Paul F

2015-12-01

Despite annual co-circulation of different subtypes of seasonal influenza, co-infections between different viruses are rarely detected. These co-infections can result in the emergence of reassortant progeny. We document the detection of an influenza co-infection, between influenza A/H3N2 with A/H1N1pdm09 viruses, which occurred in a 3 year old male in Cambodia during April 2014. Both viruses were detected in the patient at relatively high viral loads (as determined by real-time RT-PCR CT values), which is unusual for influenza co-infections. As reassortment can occur between co-infected influenza A strains we isolated plaque purified clonal viral populations from the clinical material of the patient infected with A/H3N2 and A/H1N1pdm09. Complete genome sequences were completed for 7 clonal viruses to determine if any reassorted viruses were generated during the influenza virus co-infection. Although most of the viral sequences were consistent with wild-type A/H3N2 or A/H1N1pdm09, one reassortant A/H3N2 virus was isolated which contained an A/H1N1pdm09 NS1 gene fragment. The reassortant virus was viable and able to infect cells, as judged by successful passage in MDCK cells, achieving a TCID50 of 10(4)/ml at passage number two. There is no evidence that the reassortant virus was transmitted further. The co-infection occurred during a period when co-circulation of A/H3N2 and A/H1N1pdm09 was detected in Cambodia. It is unclear how often influenza co-infections occur, but laboratories should consider influenza co-infections during routine surveillance activities. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

A Naturally Occurring Domestic Cat APOBEC3 Variant Confers Resistance to Feline Immunodeficiency Virus Infection.

PubMed

Yoshikawa, Rokusuke; Izumi, Taisuke; Yamada, Eri; Nakano, Yusuke; Misawa, Naoko; Ren, Fengrong; Carpenter, Michael A; Ikeda, Terumasa; Münk, Carsten; Harris, Reuben S; Miyazawa, Takayuki; Koyanagi, Yoshio; Sato, Kei

2016-01-01

Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3 (APOBEC3; A3) DNA cytosine deaminases can be incorporated into progeny virions and inhibit lentiviral replication. On the other hand, viral infectivity factor (Vif) of lentiviruses antagonizes A3-mediated antiviral activities by degrading A3 proteins. It is known that domestic cat (Felis catus) APOBEC3Z3 (A3Z3), the ortholog of human APOBEC3H, potently suppresses the infectivity of vif-defective feline immunodeficiency virus (FIV). Although a recent report has shown that domestic cat encodes 7 haplotypes (hap I to hap VII) of A3Z3, the relevance of A3Z3 polymorphism in domestic cats with FIV Vif has not yet been addressed. In this study, we demonstrated that these feline A3Z3 variants suppress vif-defective FIV infectivity. We also revealed that codon 65 of feline A3Z3 is a positively selected site and that A3Z3 hap V is subject to positive selection during evolution. It is particularly noteworthy that feline A3Z3 hap V is resistant to FIV Vif-mediated degradation and still inhibits vif-proficient viral infection. Moreover, the side chain size, but not the hydrophobicity, of the amino acid at position 65 determines the resistance to FIV Vif-mediated degradation. Furthermore, phylogenetic analyses have led to the inference that feline A3Z3 hap V emerged approximately 60,000 years ago. Taken together, these findings suggest that feline A3Z3 hap V may have been selected for escape from an ancestral FIV. This is the first evidence for an evolutionary "arms race" between the domestic cat and its cognate lentivirus. Gene diversity and selective pressure are intriguing topics in the field of evolutionary biology. A direct interaction between a cellular protein and a viral protein can precipitate an evolutionary arms race between host and virus. One example is primate APOBEC3G, which potently restricts the replication of primate lentiviruses (e.g., human immunodeficiency virus type 1 [HIV-1] and simian

Influenza A virus-induced degradation of eukaryotic translation initiation factor 4B contributes to viral replication by suppressing IFITM3 protein expression.

PubMed

Wang, Song; Chi, Xiaojuan; Wei, Haitao; Chen, Yuhai; Chen, Zhilong; Huang, Shile; Chen, Ji-Long

2014-08-01

Although alteration in host cellular translation machinery occurs in virus-infected cells, the role of such alteration and the precise pathogenic processes are not well understood. Influenza A virus (IAV) infection shuts off host cell gene expression at transcriptional and translational levels. Here, we found that the protein level of eukaryotic translation initiation factor 4B (eIF4B), an integral component of the translation initiation apparatus, was dramatically reduced in A549 cells as well as in the lung, spleen, and thymus of mice infected with IAV. The decrease in eIF4B level was attributed to lysosomal degradation of eIF4B, which was induced by viral NS1 protein. Silencing eIF4B expression in A549 cells significantly promoted IAV replication, and conversely, overexpression of eIF4B markedly inhibited the viral replication. Importantly, we observed that eIF4B knockdown transgenic mice were more susceptible to IAV infection, exhibiting faster weight loss, shorter survival time, and more-severe organ damage. Furthermore, we demonstrated that eIF4B regulated the expression of interferon-induced transmembrane protein 3 (IFITM3), a critical protein involved in immune defense against a variety of RNA viruses, including influenza virus. Taken together, our findings reveal that eIF4B plays an important role in host defense against IAV infection at least by regulating the expression of IFITM3, which restricts viral entry and thereby blocks early stages of viral production. These data also indicate that influenza virus has evolved a strategy to overcome host innate immunity by downregulating eIF4B protein. Influenza A virus (IAV) infection stimulates the host innate immune system, in part, by inducing interferons (IFNs). Secreted IFNs activate the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway, leading to elevated transcription of a large group of IFN-stimulated genes that have antiviral function. To circumvent the host innate

The 3-dimensional cellular automata for HIV infection

NASA Astrophysics Data System (ADS)

Mo, Youbin; Ren, Bin; Yang, Wencao; Shuai, Jianwei

2014-04-01

The HIV infection dynamics is discussed in detail with a 3-dimensional cellular automata model in this paper. The model can reproduce the three-phase development, i.e., the acute period, the asymptotic period and the AIDS period, observed in the HIV-infected patients in a clinic. We show that the 3D HIV model performs a better robustness on the model parameters than the 2D cellular automata. Furthermore, we reveal that the occurrence of a perpetual source to successively generate infectious waves to spread to the whole system drives the model from the asymptotic state to the AIDS state.

The cortical generators of P3a and P3b: a LORETA study.

PubMed

Volpe, U; Mucci, A; Bucci, P; Merlotti, E; Galderisi, S; Maj, M

2007-07-12

The P3 is probably the most well known component of the brain event-related potentials (ERPs). Using a three-tone oddball paradigm two different components can be identified: the P3b elicited by rare target stimuli and the P3a elicited by the presentation of rare non-target stimuli. Although the two components may partially overlap in time and space, they have a different scalp topography suggesting different neural generators. The present study is aimed at defining the scalp topography of the two P3 components by means of reference-independent methods and identifying their electrical cortical generators by using the low-resolution electromagnetic tomography (LORETA). ERPs were recorded during a three-tone oddball task in 32 healthy, right-handed university students. The scalp topography of the P3 components was assessed by means of the brain electrical microstates technique and their cortical sources were evaluated by LORETA. P3a and P3b showed different scalp topography and cortical sources. The P3a electrical field had a more anterior distribution as compared to the P3b and its generators were localized in cingulate, frontal and right parietal areas. P3b sources included bilateral frontal, parietal, limbic, cingulate and temporo-occipital regions. Differences in scalp topography and cortical sources suggest that the two components reflect different neural processes. Our findings on cortical generators are in line with the hypothesis that P3a reflects the automatic allocation of attention, while P3b is related to the effortful processing of task-relevant events.

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Formononetin inhibits enterovirus 71 replication by regulating COX- 2/PGE₂ expression.

PubMed

Wang, Huiqiang; Zhang, Dajun; Ge, Miao; Li, Zhuorong; Jiang, Jiandong; Li, Yuhuan

2015-03-01

The activation of ERK, p38 and JNK signal cascade in host cells has been demonstrated to up-regulate of enterovirus 71 (EV71)-induced cyclooxygenase-2 (COX-2)/ prostaglandins E2 (PGE₂) expression which is essential for viral replication. So, we want to know whether a compound can inhibit EV71 infection by suppressing COX-2/PGE₂ expression. The antiviral effect of formononetin was determined by cytopathic effect (CPE) assay and the time course assays. The influence of formononetin for EV71 replication was determined by immunofluorescence assay, western blotting assay and qRT-PCR assay. The mechanism of the antiviral activity of formononetin was determined by western blotting assay and ELISA assay. Formononetin could reduce EV71 RNA and protein synthesis in a dose-dependent manner. The time course assays showed that formononetin displayed significant antiviral activity both before (24 or 12 h) and after (0-6 h) EV71 inoculation in SK-N-SH cells. Formononetin was also able to prevent EV71-induced cytopathic effect (CPE) and suppress the activation of ERK, p38 and JNK signal pathways. Furthermore, formononetin could suppress the EV71-induced COX-2/PGE₂ expression. Also, formononetin exhibited similar antiviral activities against other members of Picornaviridae including coxsackievirus B2 (CVB2), coxsackievirus B3 (CVB3) and coxsackievirus B6 (CVB6). Formononetin could inhibit EV71-induced COX-2 expression and PGE₂ production via MAPKs pathway including ERK, p38 and JNK. Formononetin exhibited antiviral activities against some members of Picornaviridae. These findings suggest that formononetin could be a potential lead or supplement for the development of new anti-EV71 agents in the future.

Influence of B2O3 content on sintering behaviour and dielectric properties of La2O3-B2O3-CaO/Al2O3 glass-ceramic composites for LTCC applications

NASA Astrophysics Data System (ADS)

Wang, F. L.; Zhang, Y. W.; Chen, X. Y.; Mao, H. J.; Zhang, W. J.

2018-01-01

La2O3-B2O3-CaO glasses with different B2O3 content were synthesized by melting method to produce glass/ceramic composites in this work. XRD and DSC results revealed that the diminution of B2O3 content was beneficial to increase the crystallization tendency of glass and improve the quality of crystalline phase, while decreasing the effect of glass during sintering process as sintering aids. The choice of glass/ceramic mass ratio was also influenced by the B2O3 content of glass. Dense samples sintered at 875 ºC showed good dielectric properties which meet the requirement of LTCC applications: moderate dielectric constant (7.8-9.4) and low dielectric loss (2.0×10-3).

Canine susceptibility to human influenza viruses (A/pdm 09H1N1, A/H3N2 and B).

PubMed

Song, Daesub; Kim, Hyekwon; Na, Woonsung; Hong, Minki; Park, Seong-Jun; Moon, Hyoungjoon; Kang, Bokyu; Lyoo, Kwang-Soo; Yeom, Minjoo; Jeong, Dae Gwin; An, Dong-Jun; Kim, Jeong-Ki

2015-02-01

We investigated the infectivity and transmissibility of the human seasonal H3N2, pandemic (pdm) H1N1 (2009) and B influenza viruses in dogs. Dogs inoculated with human seasonal H3N2 and pdm H1N1 influenza viruses exhibited nasal shedding and were seroconverted against the viruses; this did not occur in the influenza B virus-inoculated dogs. Transmission of human H3N2 virus between dogs was demonstrated by observing nasal shedding and seroconversion in naïve dogs after contact with inoculated dogs. The seroprevalence study offered evidence of human H3N2 infection occurring in dogs since 2008. Furthermore, serological evidence of pdm H1N1 influenza virus infection alone and in combination with canine H3N2 virus was found in the serum samples collected from field dogs during 2010 and 2011. Our results suggest that dogs may be hosts for human seasonal H3N2 and pdm H1N1 influenza viruses. © 2015 The Authors.

Reduced expression of IL-12 p35 by SJL/J macrophages responding to Theiler's virus infection is associated with constitutive activation of IRF-3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dahlberg, Angela; Auble, Mark R.; Petro, Thomas M.

2006-09-30

Macrophages responding to viral infections may contribute to autoimmune demyelinating diseases (ADD). Macrophages from ADD-susceptible SJL/J mice responding to Theiler's Virus (TMEV) infection, the TLR7 agonist loxoribine, or the TLR4 agonist-LPS expressed less IL-12 p35 but more IL-12/23 p40 and IFN-{beta} than macrophages from ADD-resistant B10.S mice. While expression of IRF-1 and -7 was similar between B10.S and SJL/J TMEV-infected macrophages, SJL/J but not B10.S macrophages exhibited constitutively active IRF-3. In contrast to overexpressed IRF-1, IRF-5, and IRF-7, which stimulated p35 promoter reporter activity, overexpressed IRF-3 repressed p35 promoter activity in response to TMEV infection, loxoribine, IFN-{gamma}/LPS, but not IFN-{gamma}more » alone. IRF-3 lessened but did not eliminate IRF-1-stimulated p35 promoter activity. Repression by IRF-3 required bp -172 to -122 of the p35 promoter. The data suggest that pre-activated IRF-3 is a major factor in the differences in IL-12 production between B10.S and SJL/J macrophages responding to TMEV.« less

Yield Stress Model for Molten Composition B-3

NASA Astrophysics Data System (ADS)

Davis, Stephen; Zerkle, David

2017-06-01

Composition B-3 (Comp B-3) is a melt-castable explosive composed of 60/40 wt% RDX/TNT (hexahydro-1,3,5-trinitro-1,3,5-triazine/2,4,6-trinitrotoluene). During casting operations thermal conditions are controlled which along with the low melting point of TNT and the insensitivity of the mixture to external stimuli leading to safe use. Outside these standard operating conditions a more rigorous model of Comp B-3 rheological properties is necessary to model thermal transport as Comp B-3 evolves from quiescent solid through vaporization/decomposition upon heating. One particular rheological phenomena of interest is Bingham plasticity, where a material behaves as a quiescent solid unless a sufficient load is applied, resulting in fluid flow. In this study falling ball viscometer data is used to model the change in Bingham plastic yield stresses as a function of RDX particle volume fraction; a function of temperature. Results show the yield stress of Comp B-3 (τy) follows the expression τy = B ϕ -ϕc N , where Φ and Φc are the volume fraction of RDX and a critical volume fraction, respectively and B and N are experimentally evaluated constants.

18 CFR 1b.3 - Scope of investigations.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.3 Scope of investigations. The...

18 CFR 1b.3 - Scope of investigations.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.3 Scope of investigations. The...

18 CFR 1b.3 - Scope of investigations.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.3 Scope of investigations. The...

18 CFR 1b.3 - Scope of investigations.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.3 Scope of investigations. The...

Endogenous APOBEC3B restricts LINE-1 retrotransposition in transformed cells and human embryonic stem cells.

PubMed

Wissing, Silke; Montano, Mauricio; Garcia-Perez, Jose Luis; Moran, John V; Greene, Warner C

2011-10-21

Members of the APOBEC3 (A3) family of cytidine deaminase enzymes act as host defense mechanisms limiting both infections by exogenous retroviruses and mobilization of endogenous retrotransposons. Previous studies revealed that the overexpression of some A3 proteins could restrict engineered human Long INterspersed Element-1 (LINE-1 or L1) retrotransposition in HeLa cells. However, whether endogenous A3 proteins play a role in restricting L1 retrotransposition remains largely unexplored. Here, we show that HeLa cells express endogenous A3B and A3C, whereas human embryonic stem cells (hESCs) express A3B, A3C, A3DE, A3F, and A3G. To study the relative contribution of endogenous A3 proteins in restricting L1 retrotransposition, we first generated small hairpin RNAs (shRNAs) to suppress endogenous A3 mRNA expression, and then assessed L1 mobility using a cell-based L1 retrotransposition assay. We demonstrate that in both HeLa and hESCs, shRNA-based knockdown of A3B promotes a ∼2-3.7-fold increase in the retrotransposition efficiency of an engineered human L1. Knockdown of the other A3s produced no significant increase in L1 activity. Thus, A3B appears to restrict engineered L1 retrotransposition in a broad range of cell types, including pluripotent cells.

The 11S Proteasome Subunit PSME3 Is a Positive Feedforward Regulator of NF-κB and Important for Host Defense against Bacterial Pathogens.

PubMed

Sun, Jinxia; Luan, Yi; Xiang, Dong; Tan, Xiao; Chen, Hui; Deng, Qi; Zhang, Jiaojiao; Chen, Minghui; Huang, Hongjun; Wang, Weichao; Niu, Tingting; Li, Wenjie; Peng, Hu; Li, Shuangxi; Li, Lei; Tang, Wenwen; Li, Xiaotao; Wu, Dianqing; Wang, Ping

2016-02-02

The NF-κB pathway plays important roles in immune responses. Although its regulation has been extensively studied, here, we report an unknown feedforward mechanism for the regulation of this pathway by Toll-like receptor (TLR) ligands in macrophages. During bacterial infections, TLR ligands upregulate the expression of the 11S proteasome subunit PSME3 via NF-κB-mediated transcription in macrophages. PSME3, in turn, enhances the transcriptional activity of NF-κB by directly binding to and destabilizing KLF2, a negative regulator of NF-κB transcriptional activity. Consistent with this positive role of PSME3 in NF-κB regulation and importance of the NF-κB pathway in host defense against bacterial infections, the lack of PSME3 in hematopoietic cells renders the hosts more susceptible to bacterial infections, accompanied by increased bacterial burdens in host tissues. Thus, this study identifies a substrate for PSME3 and elucidates a proteolysis-dependent, but ubiquitin-independent, mechanism for NF-κB regulation that is important for host defense and innate immunity. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

45 CFR 73b.3 - Reports of violations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Reports of violations. 73b.3 Section 73b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION DEBARMENT OR SUSPENSION OF FORMER EMPLOYEES § 73b.3 Reports of violations. (a) If an officer or employee of the Department has reason to...

Upregulation of 14-3-3 eta in chronic liver fluke infection is a potential diagnostic marker of cholangiocarcinoma.

PubMed

Haonon, Ornuma; Rucksaken, Rucksak; Pinlaor, Porntip; Pairojkul, Chawalit; Chamgramol, Yaovalux; Intuyod, Kitti; Onsurathum, Sudarat; Khuntikeo, Narong; Pinlaor, Somchai

2016-03-01

To discover protein markers in chronic/advanced opisthorchiasis for the early detection of Opisthorchis viverrini (OV)-associated cholangiocarcinoma (CCA). Liver tissues derived from normal hamsters and those with chronic/advanced opisthorchiasis (n = 5 per group) were subjected to 2DE and LC-MS/MS. Candidate protein expression was confirmed in hamster models and human CCA tissue microarray (TMA) using immunohistochemistry and Western blot. Proteomics analysis detected 14-3-3 eta only in infected hamsters, not in uninfected controls. Immunohistochemistry and Western blot analysis confirmed low expression of 14-3-3 eta in normal hamster livers and demonstrated increased expression through time in infected livers. This protein was also observed in parasite organs, especially during the chronic phase of opisthorchiasis. Moreover, increased expression of 14-3-3 eta, relative to normal hamster livers, was observed during the early stage of CCA induced by OV infection and administration of N-nitrosodimethylamine. Immunohistochemical analysis of human TMA revealed that 14-3-3 eta was highly expressed in CCA (84.23%, 187/222 cases) but was not found in hepatocellular carcinoma or healthy liver tissues. 14-3-3 eta protein has potential as a screening and early diagnostic marker for CCA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

CgIκB3, the third novel inhibitor of NF-kappa B (IκB) protein, is involved in the immune defense of the Pacific oyster, Crassostrea gigas.

PubMed

Xu, Fengjiao; Li, Jun; Zhang, Yuehuan; Li, Xiaomei; Zhang, Yang; Xiang, Zhiming; Yu, Ziniu

2015-10-01

Inhibitor of NF-κB (IκB), the important regulator of NF-κB/Rel signaling pathway, plays the crucial role in immune response of both vertebrates and invertebrates. Here, a novel homologue of IκB was cloned from Crassostrea gigas, and designated as CgIκB3. The complete CgIκB3 cDNA was 1282 bp in length, including a 942 bp open reading frame (ORF), a 51 bp 5' UTR and a 289 bp 3' UTR. The ORF encodes a putative protein of 313 amino acids with a predicted molecular weight of approximately 34.7 kDa. Sequence analysis reveals that CgIκB3 contains a conserved degradation motif but with only five ankyrin repeats. Neither a PEST domain nor a C-terminal casein kinase II phosphorylation site was identified through either alignment or bioinformatic prediction. Phylogenetic analysis suggested that CgIκB3 shares common ancestor with CgIκB1 rather CgIκB2, and theoretically it may originate from one duplication event prior to divergence of CgIκB1 and CgIκB2. Tissue expression analyses demonstrated that CgIκB3 mRNA is the most abundant in gills and heart. The expression following PAMP infection showed that CgIκB3 was significantly up-regulated in a similar pattern when challenged with LPS, HKLM or HKVA, respectively. Moreover, similar to CgIκB1 and CgIκB2, CgIκB3 can also inhibit Rel dependent NF-κB activation in HEK293 cells in a dose-dependent manner. In summary, these findings suggest that CgIκB3 can be as the functional inhibitor of NF-κB/Rel and involved in the host defense of C. gigas. The discovery of the third IκB emphasizes the complexity and importance of the regulation on NF-κB activation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Photocatalytic self-cleaning transparent 2Bi2O3-B2O3 glass ceramics

NASA Astrophysics Data System (ADS)

Sharma, Sumeet Kumar; Singh, V. P.; Chauhan, Vishal S.; Kushwaha, H. S.; Vaish, Rahul

2017-09-01

Photocatalytic response of as-quenched and heat-treated 2Bi2O3-B2O3 glasses was studied. X ray diffraction reveals that the controlled heat treatment of glasses at 380 °C for 1 h, 2 h, and 3 h shows the formation of Bi4B2O9 crystals embedded in 2Bi2O3-B2O3 the host glass matrix. Scanning electron microscopic images reveal the presence of nanocrystallization in as-quenched glass. Significant photocatalytic activities were observed in as-quenched transparent glass. Photocatalytic activities were studied using the degradation of Resazurin as well as pharmaceutical 17 β-Estradiol under UV irradiation. Measurement of contact angle shows enhanced hydrophilicity with the increase in crystallization of the samples. Further, for as quenched 2Bi2O3-B2O3 glass ceramic, under UV irradiation, the water contact angle decreased from 92.7° to 39.5° and the sample surface transformed from hydrophobic to hydrophilic. Effective photocatalytic performance along with photoinduced hydrophilicity promotes 2Bi2O3-B2O3 glass ceramics in self-cleaning applications.

The NLRP3 Inflammasome Suppresses Protective Immunity to Gastrointestinal Helminth Infection.

PubMed

Alhallaf, Rafid; Agha, Zainab; Miller, Catherine M; Robertson, Avril A B; Sotillo, Javier; Croese, John; Cooper, Matthew A; Masters, Seth L; Kupz, Andreas; Smith, Nicholas C; Loukas, Alex; Giacomin, Paul R

2018-04-24

Inflammasomes promote immunity to microbial pathogens by regulating the function of IL-1-family cytokines such as IL-18 and IL-1β. However, the roles for inflammasomes during parasitic helminth infections remain unclear. We demonstrate that mice and humans infected with gastrointestinal nematodes display increased IL-18 secretion, which in Trichuris-infected or worm antigen-treated mice and in macrophages co-cultured with Trichuris antigens or exosome-like vesicles was dependent on the NLRP3 inflammasome. NLRP3-deficient mice displayed reduced pro-inflammatory type 1 cytokine responses and augmented protective type 2 immunity, which was reversed by IL-18 administration. NLRP3-dependent suppression of immunity partially required CD4 + cells but was apparent even in Rag1 -/- mice that lack adaptive immune cells, suggesting that NLRP3 influences both innate and adaptive immunity. These data highlight a role for NLRP3 in limiting protective immunity to helminths, suggesting that targeting the NLRP3 inflammasome may be an approach for limiting the disease burden associated with helminth infections. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Flavan-3-ols Are an Effective Chemical Defense against Rust Infection.

PubMed

Ullah, Chhana; Unsicker, Sybille B; Fellenberg, Christin; Constabel, C Peter; Schmidt, Axel; Gershenzon, Jonathan; Hammerbacher, Almuth

2017-12-01

Phenolic secondary metabolites are often thought to protect plants against attack by microbes, but their role in defense against pathogen infection in woody plants has not been investigated comprehensively. We studied the biosynthesis, occurrence, and antifungal activity of flavan-3-ols in black poplar ( Populus nigra ), which include both monomers, such as catechin, and oligomers, known as proanthocyanidins (PAs). We identified and biochemically characterized three leucoanthocyanidin reductases and two anthocyanidin reductases from P. nigra involved in catalyzing the last steps of flavan-3-ol biosynthesis, leading to the formation of catechin [2,3-trans-(+)-flavan-3-ol] and epicatechin [2,3-cis-(-)-flavan-3-ol], respectively. Poplar trees that were inoculated with the biotrophic rust fungus ( Melampsora larici-populina ) accumulated higher amounts of catechin and PAs than uninfected trees. The de novo-synthesized catechin and PAs in the rust-infected poplar leaves accumulated significantly at the site of fungal infection in the lower epidermis. In planta concentrations of these compounds strongly inhibited rust spore germination and reduced hyphal growth. Poplar genotypes with constitutively higher levels of catechin and PAs as well as hybrid aspen ( Populus tremula × Populus alba ) overexpressing the MYB134 transcription factor were more resistant to rust infection. Silencing PnMYB134 , on the other hand, decreased flavan-3-ol biosynthesis and increased susceptibility to rust infection. Taken together, our data indicate that catechin and PAs are effective antifungal defenses in poplar against foliar rust infection. © 2017 American Society of Plant Biologists. All Rights Reserved.

Conventional kinesin KIF5B mediates adiponectin secretion in 3T3-L1 adipocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cui, Ju, E-mail: juzi.cui@gmail.com; Pang, Jing; Lin, Ya-Jun

2016-08-05

Insulin stimulates adiponectin secretion and glucose transporter type 4 (GLUT4) translocation in adipocyte to regulate metabolism homeostasis. Similar to GLUT4 translocation, intracellular trafficking and release of adiponectin in adipocytes relies on the trans-Golgi network and endosomal system. Recent studies show that the heavy chain of conventional kinesin (KIF5B) mediates GLUT4 translocation in murine 3T3-L1 adipocytes, however, the motor machinery involved in mediating intracellular trafficking and release of adiponectin is unknown. Here, we examined the role of KIF5B in the regulation of adiponectin secretion. The KIF5B level was up-regulated during 3T3-L1 adipogenesis. This increase in cytosolic KIF5B was synchronized with themore » induction of adiponectin. Endogenous KIF5B and adiponectin were partially colocalized at the peri-nuclear and cytosolic regions. In addition, adiponectin-containing vesicles were co-immunoprecipitated with KIF5B. Knockdown of KIF5B resulted in a marked inhibition of adiponectin secretion and overexpression of KIF5B enhanced adiponectin release, whereas leptin secretion was not affected by changes in KIF5B expression. These data suggest that the secretion of adiponectin, but not leptin, is dependent on functional KIF5B. - Highlights: • The KIF5B level was up regulated during 3T3-L1 adipogenesis. • Endogenous KIF5B and adiponectin were partially colicalized. • Adiponectin-containing vesicles were co-immunoprecipitated with KIF5B. • The secretion of adiponectin, but not leptin, is dependent on functional KIF5B.« less

Reduced dose and duration of peginterferon alfa-2b and weight-based ribavirin in patients with genotype 2 and 3 chronic hepatitis C.

PubMed

Manns, Michael; Zeuzem, Stefan; Sood, Ajit; Lurie, Yoav; Cornberg, Markus; Klinker, Hartwig; Buggisch, Peter; Rössle, Martin; Hinrichsen, Holger; Merican, Ismail; Ilan, Yaron; Mauss, Stefan; Abu-Mouch, Saif; Horban, Andryes; Müller, Thomas H; Welsch, Christoph; Chen, Rongdean; Faruqi, Rab; Pedicone, Lisa D; Wedemeyer, Heiner

2011-09-01

There is increasing interest in identifying patients with chronic hepatitis C genotype 2 or 3 infection in whom it is possible to lower the burden of therapy while retaining high levels of efficacy. Treatment-naive patients with chronic hepatitis C genotype 2/3 infection were randomized to receive peginterferon alfa-2b (1.5μg/kg/wk) for 24weeks (group A); peginterferon alfa-2b (1.0μg/kg/wk) for 24weeks (group B); or peginterferon alfa-2b (1.5μg/kg/wk) for 16weeks (group C), each in combination with weight-based ribavirin (800-1200mg/d). The study population comprised two cohorts: the Hep-Net cohort enrolled in Germany and an International cohort enrolled at study sites throughout Europe and Asia. The primary end point was sustained virological response (SVR). The study included 682 patients; 80.2% had genotype 3 infection. In the intent-to-treat population, SVR rates were 66.5%, 64.3%, and 56.6% in groups A, B, and C, and were similar in Asian and white patients. Treatment differences (A vs. B and A vs. C) failed to reach the predefined margin for noninferiority of -10%; and thus groups B and C failed to show noninferiority relative to group A. Among patients with undetectable HCV RNA at week 4, SVR rates were 75.3%, 75.9%, and 72.4%, respectively. Relapse rates were 17.8%, 16.3%, and 29.3%, respectively. Treatment-emergent serious adverse events were highest in group A and lowest in group C, and adverse events leading to discontinuation were similar across treatment arms. For patients with chronic hepatitis C genotype 2/3 infection, 24weeks of peginterferon alfa-2b (1.5μg/kg/wk) plus weight-based ribavirin remains a standard-of-care therapy; however, treatment for 16weeks may be considered for patients with undetectable HCV RNA at week 4 of the treatment. Copyright © 2011. Published by Elsevier B.V.

45 CFR 73b.3 - Reports of violations.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 45 Public Welfare 1 2013-10-01 2013-10-01 false Reports of violations. 73b.3 Section 73b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION DEBARMENT OR SUSPENSION OF FORMER EMPLOYEES § 73b.3 Reports of violations. (a) If an officer or employee of the Department has reason to believe that a former officer or employee...

Heat shock proteins stimulate APOBEC-3-mediated cytidine deamination in the hepatitis B virus.

PubMed

Chen, Zhigang; Eggerman, Thomas L; Bocharov, Alexander V; Baranova, Irina N; Vishnyakova, Tatyana G; Kurlander, Roger; Patterson, Amy P

2017-08-11

Apolipoprotein B mRNA-editing enzyme catalytic subunit 3 (APOBEC-3) enzymes are cytidine deaminases that are broadly and constitutively expressed. They are often up-regulated during carcinogenesis and candidate genes for causing the major single-base substitution in cancer-associated DNA mutations. Moreover, APOBEC-3s are involved in host innate immunity against many viruses. However, how APOBEC-3 mutational activity is regulated in normal and pathological conditions remains largely unknown. Heat shock protein levels are often elevated in both carcinogenesis and viral infection and are associated with DNA mutations. Here, using mutational analyses of hepatitis B virus (HBV), we found that Hsp90 stimulates deamination activity of APOBEC-3G (A3G), A3B, and A3C during co-expression in human liver HepG2 cells. Hsp90 directly stimulated A3G deamination activity when the purified proteins were used in in vitro reactions. Hsp40, -60, and -70 also had variable stimulatory effects in the cellular assay, but not in vitro Sequencing analyses further demonstrated that Hsp90 increased both A3G cytosine mutation efficiency on HBV DNA and total HBV mutation frequency. In addition, Hsp90 shifted A3G's cytosine region selection in HBV DNA and increased A3G's 5' nucleoside preference for deoxycytidine (5'-CC). Furthermore, the Hsp90 inhibitor 17- N -allylamino-17-demethoxygeldanamycin dose dependently inhibited A3G and A3B mutational activity on HBV viral DNA. Hsp90 knockdown by siRNA or by Hsp90 active-site mutation also decreased A3G activity. These results indicate that heat shock proteins, in particular Hsp90, stimulate APOBEC-3-mediated DNA deamination activity, suggesting a potential physiological role in carcinogenesis and viral innate immunity.

Transgenic expression of omega-3 PUFA synthesis genes improves zebrafish survival during Vibrio vulnificus infection.

PubMed

Cheng, Chih-Lun; Huang, Shin-Jie; Wu, Chih-Lu; Gong, Hong-Yi; Ken, Chuian-Fu; Hu, Shao-Yang; Wu, Jen-Leih

2015-11-17

Highly desaturated n-3 polyunsaturated fatty acids (PUFAs), such as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), are synthesized by desaturases and elongase. They exert hepatoprotective effects to prevent alcoholic fatty liver syndrome or cholestatic liver injury. However, it is unclear how n-3 PUFAs improve immune function in liver. Vibrio vulnificus, a gram-negative bacterial pathogen, causes high mortality of aquaculture fishes upon infection. Humans can become infected with V. vulnificus through open wounds or by eating raw seafood, and such infections may result in systemic septicemia. Moreover, patients with liver diseases are vulnerable to infection, and are more likely than healthy persons to present with liver inflammation following infection. This study quantified n-3 PUFAs and their anti-bacterial effects in Fadsd6 and Elvol5a transgenic zebrafish. Two transgenic zebrafish strains with strong liver specific expression of Fadsd6 and Elvol5a (driven by the zebrafish Fabp10 promoter) were established using the Tol2 system. Synthesis of n-3 PUFAs in these strains were increased by 2.5-fold as compared to wild type (Wt) fish. The survival rate in 24 h following challenge with V. vulnificus was 20 % in Wt, but 70 % in the transgenic strains. In addition, the bacteria counts in transgenic fish strains were significantly decreased. The expression levels of pro-inflammatory genes, such as TNF-α, IL-1β, and NF-κB, were suppressed between 9 and 12 h after challenge. This study confirms the anti-bacterial function of n-3 PUFAs in a transgenic zebrafish model. Fadsd6 and Elvol5a transgenic zebrafish are more resistant to V. vulnificus infection, and enhance survival by diminishing the attendant inflammatory response.

An update on 11B,10B fractionation in the fundamental reaction: 10B(OH)3 + 11B(OH)4- = 11B(OH)3 + 10B(OH)4-

NASA Astrophysics Data System (ADS)

Klochko, K.; Tossell, J. A.

2007-12-01

It has recently been demonstrated experimentally by Byrne, et al. (2006) and Klochko, et al. (2006) that the equilibrium constant for the isotopic exchange reaction: 10B(OH)3 + 11B(OH)4- = 11B(OH)3 + 10B(OH)4- (1) has a value around 1.027 for seawater at 25°C, for total B concentrations from 0.01 to 0.05 molal. These experimental studies involved essentially the accurate determination of the small pKa difference between the 11B and 10B isotopomers of boric acid. This new equilibrium constant value is significantly higher than the traditional value of 1.0194 from Kakihana, et al. (1977). This result has been obscured in recent controversies (Honisch, et al., 2007). The new value agrees well with the ab initio quantum cluster calculated values of Liu and Tossell (2005) and with the ab initio MD harmonic values of Rustad and Bylaska (2007). We will present additional calculations supporting and extending the study of Liu and Tossell (2005) and will discuss the general unsuitability of methods such as Sanchez-Valle, et al. (2005) which employ experimental spectral data. We have also established that polyborate formation in solutions as concentrated as 0.50 molal total B has little effect on the equilibrium constant. A mechanism is also presented for the interaction of B(OH)3 and B(OH)4- with HCO3- species occurring on the calcite surface. References: Byrne, et al. Deep-Sea Research I (2006) 53, 684-688. Honisch, et al. Geochim. Cosmochim. Acta (2007) 71, 1636-1641. Kakihana, et al. Bull. Chem. Soc. Jpn. (1977) 50, 158-163. Klochko, et al. Earth Planet. Sci. Lett. (2006) 248, 276-285. Liu and Tossell Geochim. Cosmochim. Acta (2005) 69, 3995-4006. Rustad and Bylaska J. Am. Chem. Soc. (2007) 129, 2222-2223. Sanchez-Valle, et al. Geochim. Cosmochim. Acta (2005) 69, 4301-4313.

Hepatitis C virus core protein activates autophagy through EIF2AK3 and ATF6 UPR pathway-mediated MAP1LC3B and ATG12 expression

PubMed Central

Wang, Ji; Kang, Rongyan; Huang, He; Xi, Xueyan; Wang, Bei; Wang, Jianwei; Zhao, Zhendong

2014-01-01

HCV infection induces autophagy, but how this occurs is unclear. Here, we report the induction of autophagy by the structural HCV core protein and subsequent endoplasmic reticular (ER) stress in Huh7 hepatoma cells. During ER stress, both the EIF2AK3 and ATF6 pathways of the unfolded protein response (UPR) were activated by HCV core protein. Then, these pathways upregulated transcription factors ATF4 and DDIT3. The ERN1-XBP1 pathway was not activated. Through ATF4 in the EIF2AK3 pathway, the autophagy gene ATG12 was upregulated. DDIT3 upregulated the transcription of autophagy gene MAP1LC3B (LC3B) by directly binding to the –253 to –99 base region of the LC3B promoter, contributing to the development of autophagy. Collectively, these data suggest not only a novel role for the HCV core protein in autophagy but also offer new insight into detailed molecular mechanisms with respect to HCV-induced autophagy, specifically how downstream UPR molecules regulate key autophagic gene expression. PMID:24589849

18 CFR 3b.4 - Government contractors.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Government contractors. 3b.4 Section 3b.4 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

18 CFR 3b.4 - Government contractors.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Government contractors. 3b.4 Section 3b.4 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

18 CFR 3b.4 - Government contractors.