Validation of Respirator Filter Efficacy
2003-03-20
microorganism Bacillus atrophaeus formerly Bacillus globigii or BG). The BG spore of approximately 1 µm diameter and inert particles over a range...conducted using the spore form of the microorganism Bacillus atrophaeus (formerly Bacillus globigii or BG). The BG spore is elliptically shaped with...will be conducted using the spore form of the microorganism Bacillus atrophaeus (formerly Bacillus globigii or BG). The BG spore is elliptically
Interinstrument Variability and Validation Study for the XMX/2L-MIL Biological Air Sampler
2012-07-13
fixed final nozzle orientation. Three XMXs were operated in a 12-m3 aerosol test chamber (ATC) in which a Bacillus globigii (Bg) aerosol was...impactor, aerosol, biological aerosol, collection media, biological agent, Remel M5®, PBS solution, Bacillus globigii, male-specific 2 bacteriophage, MS2...Edmonton AB, Canada. The performance of the XMX was evaluated using two biological agents, spore-forming bacteria Bacillus globigii (Bg) and viral
Szabo, Jeffrey G.; Rice, Eugene W.; Bishop, Paul L.
2007-01-01
Persistence of Bacillus atrophaeus subsp. globigii spores on corroded iron coupons in drinking water was studied using a biofilm annular reactor. Spores were inoculated at 106 CFU/ml in the dechlorinated reactor bulk water. The dechlorination allowed for observation of the effects of hydraulic shear and biofilm sloughing on persistence. Approximately 50% of the spores initially adhered to the corroded iron surface were not detected after 1 month. Addition of a stable 10 mg/liter free chlorine residual after 1 month led to a 2-log10 reduction of adhered B. atrophaeus subsp. globigii, but levels on the coupons quickly stabilized thereafter. Increasing the free chlorine concentration to 25 or 70 mg/liter had no additional effect on inactivation. B. atrophaeus subsp. globigii spores injected in the presence of a typical distribution system chlorine residual (∼0.75 mg/liter) resulted in a steady reduction of adhered B. atrophaeus subsp. globigii over 1 month, but levels on the coupons eventually stabilized. Adding elevated chlorine levels (10, 25, and 70 mg/liter) after 1 month had no effect on the rate of inactivation. Decontamination with elevated free chlorine levels immediately after spore injection resulted in a 3-log10 reduction within 2 weeks, but the rate of inactivation leveled off afterward. This indicates that free chlorine did not reach portions of the corroded iron surface where B. atrophaeus subsp. globigii spores had adhered. B. atrophaeus subsp. globigii spores are capable of persisting for an extended time in the presence of high levels of free chlorine. PMID:17308186
2012-09-01
Emergence of the Military Hypersporulating Strains of Bacillus Atrophaeous var. Globigii by Doncho V. Zhelev, Christopher Dupuis , Suelynn Ren, Anna...Globigii Doncho V. Zhelev, Christopher Dupuis , Suelynn Ren, Anna Le, and Mia Hunt Sensors and Electron Devices Directorate, ARL Henry Gibbons...Zhelev, Christopher Dupuis , Suelynn Ren, Anna Le, Mia Hunt, and Henry Gibbons 5d. PROJECT NUMBER EC-SE-2011-05 5e. TASK NUMBER 5f. WORK UNIT
Risk Assessment of Anthrax Threat Letters
2001-09-01
extent of the hazard. In the experiments, envelopes containing Bacillus globigii spores (a simulant for anthrax) were opened in a mock mail room/office...des spores de Bacillus globigii (une bactérie imitant l’agent de l’anthrax) ont été ouvertes dans un endroit simulant une salle de courrier ou un...provide guidance to first responders and other government departments. In this study (non-pathogenic) Bacillus globigii (BG) spore contaminated
Nano-Mechanical Properties of Heat Inactivated Bacillus anthracis and Bacillus thuringiensis Spores
2008-03-01
Scanner Laser Mirror Cantilever Sample Probe Tip 16 cereus strain 569, and Bacillus globigii var. niger . Zolock determined that there wer...been used to measure the surface elasticities of a variety of microbial organisms including Pseudomonas putida, Bacillus subtilis, Aspergillus ...66:307-311 (2005). Zhao, Liming, David Schaefer, and Mark R. Marten. “Assessment of Elasticity and Topography of Aspergillus nidulans Spores via
Aerosol and Surface Deposition Characteristics of Two Surrogates for Bacillus anthracis Spores
Stapleton, Helen L.
2016-01-01
ABSTRACT Spores of an acrystalliferous derivative of Bacillus thuringiensis subsp. kurstaki, termed Btcry−, are morphologically, aerodynamically, and structurally indistinguishable from Bacillus anthracis spores. Btcry− spores were dispersed in a large, open-ended barn together with spores of Bacillus atrophaeus subsp. globigii, a historically used surrogate for Bacillus anthracis. Spore suspensions (2 × 1012 CFU each of B. atrophaeus subsp. globigii and Btcry−) were aerosolized in each of five spray events using a backpack misting device incorporating an air blower; a wind of 4.9 to 7.6 m s−1 was also flowing through the barn in the same direction. Filter air samplers were situated throughout the barn to assess the aerosol density of the spores during each release. Trays filled with a surfactant in aqueous buffer were placed on the floor near the filter samplers to assess spore deposition. Spores were also recovered from arrays of solid surfaces (concrete, aluminum, and plywood) that had been laid on the floor and set up as a wall at the end of the barn. B. atrophaeus subsp. globigii spores were found to remain airborne for significantly longer periods, and to be deposited on horizontal surfaces at lower densities, than Btcry− spores, particularly near the spray source. There was a 6-fold-higher deposition of Btcry− spores than of B. atrophaeus subsp. globigii spores on vertical surfaces relative to the surrounding airborne density. This work is relevant for selecting the best B. anthracis surrogate for the prediction of human exposure, hazard assessment, and hazard management following a malicious release of B. anthracis. IMPORTANCE There is concern that pathogenic bacteria could be maliciously disseminated in the air to cause human infection and disruption of normal life. The threat from spore-forming organisms, such as the causative agent of anthrax, is particularly serious. In order to assess the extent of this risk, it is important to have a
2008-12-31
TSA 11-g/mL IJ.L IJ.m LWI 2008-01 Acronyms Bacillus globigii also known as Bacillus arophaeus Concentration factor Colony Forming Units per...contracted with MRI to prepare a stock ofBg. This was done using the following steps: 1. An isolation streak was prepared on trypticase soy agar ( TSA ...broth overnight while shaking. 3. Ten milliliters of the overnight culture was inoculated into 1000 mL of a sporulation medium . This sporulation
Saito, Shingo; Maeda, Takeshi; Nakazumi, Hiroyuki; Colyer, Christa L
2013-01-01
In this paper, the characterization and application of the "PectI" (polymer-enhanced capillary transient isotachophoresis) technique for the separation and detection of same genus, gram-positive bacteria, Bacillus globigii (Bg) and Bacillus subtilis, is demonstrated by employing a boronic acid-functionalized squarylium dye (SQ-BA) as an on-capillary labeling agent, including the quantitative performance and applicability to crude samples. The effect of borate in the separation buffer was also investigated, which revealed that borate strongly affects the separation behavior of bacteria.
Decontamination of Bacillus spores adhered to iron and ...
Journal Article This study examines the effectiveness of decontaminating Bacillus globigii spores attached to corroded iron and cement-mortar coupons with free chlorine at two pH levels, monochloramine, chlorine dioxide, ozone, peracetic acid (PAA) and acidified nitrite, followed by flushing.
Pan, Yong-Le; Hill, Steven C; Santarpia, Joshua L; Brinkley, Kelly; Sickler, Todd; Coleman, Mark; Williamson, Chatt; Gurton, Kris; Felton, Melvin; Pinnick, Ronald G; Baker, Neal; Eshbaugh, Jonathan; Hahn, Jerry; Smith, Emily; Alvarez, Ben; Prugh, Amber; Gardner, Warren
2014-04-07
A system for measuring spectrally-resolved fluorescence cross sections of single bioaerosol particles has been developed and employed in a biological safety level 3 (BSL-3) facility at Edgewood Chemical and Biological Center (ECBC). It is used to aerosolize the slurry or solution of live agents and surrogates into dried micron-size particles, and to measure the fluorescence spectra and sizes of the particles one at a time. Spectrally-resolved fluorescence cross sections were measured for (1) bacterial spores: Bacillus anthracis Ames (BaA), B. atrophaeus var. globigii (BG) (formerly known as Bacillus globigii), B. thuringiensis israelensis (Bti), B. thuringiensis kurstaki (Btk), B. anthracis Sterne (BaS); (2) vegetative bacteria: Escherichia coli (E. coli), Pantoea agglomerans (Eh) (formerly known as Erwinia herbicola), Yersinia rohdei (Yr), Yersinia pestis CO92 (Yp); and (3) virus preparations: Venezuelan equine encephalitis TC83 (VEE) and the bacteriophage MS2. The excitation wavelengths were 266 nm, 273 nm, 280 nm, 365 nm and 405 nm.
Full Scale Drinking Water System Decontamination at the Water Security Test Bed.
Szabo, Jeffrey; Hall, John; Reese, Steve; Goodrich, Jim; Panguluri, Sri; Meiners, Greg; Ernst, Hiba
2018-03-20
The EPA's Water Security Test Bed (WSTB) facility is a full-scale representation of a drinking water distribution system. In collaboration with the Idaho National Laboratory (INL), EPA designed the WSTB facility to support full-scale evaluations of water infrastructure decontamination, real-time sensors, mobile water treatment systems, and decontamination of premise plumbing and appliances. The EPA research focused on decontamination of 1) Bacillus globigii (BG) spores, a non-pathogenic surrogate for Bacillus anthracis and 2) Bakken crude oil. Flushing and chlorination effectively removed most BG spores from the bulk water but BG spores still remained on the pipe wall coupons. Soluble oil components of Bakken crude oil were removed by flushing although oil components persisted in the dishwasher and refrigerator water dispenser. Using this full-scale distribution system allows EPA to 1) test contaminants without any human health or ecological risk and 2) inform water systems on effective methodologies responding to possible contamination incidents.
INACTIVATION OF BACILLUS GLOBIGII BY CHLORINATION: A HIERARCHICAL BAYESIAN MODEL
Recent events where spores of Bacillus anthracis have been used as a bioterrorist weapon have prompted interest in determining the resistance of this organism to commonly used disinfectants, such as chlorine, chlorine dioxide and ozone. This work was undertaken to study ...
2011-03-25
379 1317617 BG1320 (06415) NS pksR – Polyketide synthase BSU17720 (71.0) G:C C:S 1698/2574 1326096 BG1327 (06450) NS ebrB – multidrug resistance...frameshift mutation in the mmgD gene on the C-terminus of the 2-methylcitrate synthase homolog of B. atrophaeus strain Detrick-1. Arrow indicates the...lineage of BGwith a long history of use as a simulant for BW operations, focusing on classical bacteriological markers, metabolic profiling and whole
NASA Astrophysics Data System (ADS)
Lien, F. S.; Ji, H.; Yee, E.
Early experimental work, conducted at Defence R&D Canada — Suffield, measured and characterized the personal and environmental contamination associated with the simulated opening of anthrax-tainted letters under a number of different scenarios. A better understanding of the physical and biological processes is considerably significant for detecting, assessing, and formulating potential mitigation strategies for managing these risks. These preliminary experimental investigations have been extended to simulate the contamination from the opening of anthrax-tainted letters in an Open-Office environment using Computational Fluid Dynamics (CFD). Bacillus globigii (BG) was used as a biological simulant for anthrax, with 0.1 gram of the simulant released from opened letters in the experiments conducted. The accuracy of the model for prediction of the spatial distribution of BG spores in the office is first assessed quantitatively by comparison with measured SF6 concentrations (the baseline experiment), and then qualitatively by comparison with measured BG concentrations obtained under a number of scenarios, some involving people moving within various offices.
2005-01-01
Fumapharm AG has developed a second-generation fumarate (fumaric acid) derivative, BG 12 [BG 00012, FAG-201, BG 12/Oral Fumarate], for the oral treatment of psoriasis. Biogen Idec is currently evaluating the product in clinical trials as an oral treatment for multiple sclerosis (phase II) and psoriasis (phase III) trials.BG 12 has an immunomodulatory mechanism of action. It seems that this product has been developed to reduce the adverse effects associated with a first-generation product containing fumaric acid esters (mixed dimethylfumarate and monoethylfumarate salts), Fumaderm. Fumaderm was approved in Germany in August 1994 and is currently the leading oral systemic therapy for moderate-to-severe psoriasis in Germany. One of the problems associated with Fumaderm capsules has been its gastrointestinal adverse effects (including diarrhoea and nausea). In September 2003, Biogen (now Biogen Idec) licensed exclusive worldwide rights (excluding Germany) from Fumapharm to develop and market BG 12. Biogen plans to collaborate with Fumapharm to accelerate phase III development for psoriasis and the registration programme worldwide. Financial terms of the agreement were not disclosed. Development plans for BG 12 include other autoimmune and inflammatory disorders, such as multiple sclerosis. In November 2003, Biogen and IDEC Pharmaceuticals merged to form Biogen Idec. Fumapharm completed phase II trials of this second-generation fumarate derivative for psoriasis prior to licensing of the product to Biogen, also with positive results.
Principal component analysis of bacteria using surface-enhanced Raman spectroscopy
NASA Astrophysics Data System (ADS)
Guicheteau, Jason; Christesen, Steven D.
2006-05-01
Surface-enhanced Raman scattering (SERS) provides rapid fingerprinting of biomaterial in a non-destructive manner. The problem of tissue fluorescence, which can overwhelm a normal Raman signal from biological samples, is largely overcome by treatment of biomaterials with colloidal silver. This work presents a study into the applicability of qualitative SER spectroscopy with principal component analysis (PCA) for the discrimination of four biological threat simulants; Bacillus globigii, Pantoea agglomerans, Brucella noetomae, and Yersinia rohdei. We also demonstrate differentiation of gram-negative and gram-positive species and as well as spores and vegetative cells of Bacillus globigii.
Fernández-García, Aurora; Delgado, Elena; Cuevas, María Teresa; Vega, Yolanda; Montero, Vanessa; Sánchez, Mónica; Carrera, Cristina; López-Álvarez, María José; Miralles, Celia; Pérez-Castro, Sonia; Cilla, Gustavo; Hinojosa, Carmen; Pérez-Álvarez, Lucía; Thomson, Michael M.
2016-01-01
HIV-1 exhibits a characteristically high genetic diversity, with the M group, responsible for the pandemic, being classified into nine subtypes, 72 circulating recombinant forms (CRFs) and numerous unique recombinant forms (URFs). Here we characterize the near full-length genome sequence of an HIV-1 BG intersubtype recombinant virus (X3208) collected in Galicia (Northwest Spain) which exhibits a mosaic structure coincident with that of a previously characterized BG recombinant virus (9601_01), collected in Germany and epidemiologically linked to Portugal, and different from currently defined CRFs. Similar recombination patterns were found in partial genome sequences from three other BG recombinant viruses, one newly derived, from a virus collected in Spain, and two retrieved from databases, collected in France and Portugal, respectively. Breakpoint coincidence and clustering in phylogenetic trees of these epidemiologically-unlinked viruses allow to define a new HIV-1 CRF (CRF73_BG). CRF73_BG shares one breakpoint in the envelope with CRF14_BG, which circulates in Portugal and Spain, and groups with it in a subtype B envelope fragment, but the greatest part of its genome does not appear to derive from CRF14_BG, although both CRFs share as parental strain the subtype G variant circulating in the Iberian Peninsula. Phylogenetic clustering of partial pol and env segments from viruses collected in Portugal and Spain with X3208 and 9691_01 indicates that CRF73_BG is circulating in both countries, with proportions of around 2–3% Portuguese database HIV-1 isolates clustering with CRF73_BG. The fact that an HIV-1 recombinant virus characterized ten years ago as a URF has been shown to represent a CRF suggests that the number of HIV-1 CRFs may be much greater than currently known. PMID:26900693
McKinney, Nancy
2002-01-01
PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piepel, G. F.; Deatherage Kaiser, B. L.; Amidan, B. G.
The performance of a macrofoam-swab sampling method was evaluated using Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus Nakamura (BG) spores applied at nine low target amounts (2-500 spores) to positive-control plates and test coupons (2 in × 2 in) of four surface materials (glass, stainless steel, vinyl tile, and plastic). Test results from cultured samples were used to evaluate the effects of surrogate, surface concentration, and surface material on recovery efficiency (RE), false negative rate (FNR), and limit of detection. For RE, surrogate and surface material had statistically significant effects, but concentration did not. Mean REs were the lowest formore » vinyl tile (50.8% with BAS and 40.2% with BG) and the highest for glass (92.8% with BAS and 71.4% with BG). FNR values ranged from 0 to 0.833 for BAS and 0 to 0.806 for BG; values increased as concentration decreased in the range tested (0.078 to 19.375 CFU/cm2). Surface material also had a statistically significant effect. A FNR-concentration curve was fit for each combination of surrogate and surface material. For both surrogates, the FNR curves tended to be the lowest for glass and highest for vinyl title. The FNR curves for BG tended to be higher than for BAS at lower concentrations, especially for glass. Results using a modified Rapid Viability-Polymerase Chain Reaction (mRV-PCR) analysis method were also obtained. The mRV-PCR results and comparisons to the culture results will be discussed in a subsequent article.« less
The standoff aerosol active signature testbed (SAAST) at MIT Lincoln Laboratory
NASA Astrophysics Data System (ADS)
Richardson, Jonathan M.; Aldridge, John C.
2005-11-01
Standoff LIDAR detection of BW agents depends on accurate knowledge of the infrared and ultraviolet optical elastic scatter (ES) and ultraviolet fluorescence (UVF) signatures of bio-agents and interferents. MIT Lincoln Laboratory has developed the Standoff Aerosol Active Signature Testbed (SAAST) for measuring ES cross sections from BW simulants and interferents at all angles including 180º (direct backscatter). Measurements of interest include the dependence of the ES and UVF signatures on several spore production parameters including growth medium, sporulation protocol, washing protocol, fluidizing additives, and degree of aggregation. Using SAAST, we have made measurements of the ES signature of Bacillus globigii (atropheaus, Bg) spores grown under different growth methods. We have also investigated one common interferent (Arizona Test Dust). Future samples will include pollen and diesel exhaust. This paper presents the details of the SAAST apparatus along with the results of recent measurements.
Chemical and Biological Sensor Standards Study
2005-01-01
that is utilized in lieu of Bacillus anthracis in testing biological agent sensors; both are gram positive, spore forming bacteria that have similar...for a given agent dosage is as follows: C = D r 3 f B Tη4π 3 ρ See the table for the variable designation. Using Bacillus anthracis as an example...e.g., genetic similarity, aerosol dynamics, size, shape, etc.) of the agent of interest. For example, Bacillus globigii is a widely used bacterium
Joint Service Chemical and Biological Defense Program FY 08-09 Overview
2007-10-01
of human plasma-derived butyrylcholinesterase Electronmicrograph of bacillus spores adhering to cell membrane processes Jo i n t Se rv i c e ch e m i...human performance within CB-protective systems. Carbon monolith for electro-swing adsorption Bacillus globigii spores collecting on an...integrated with the ship’s heating, ventilation, and air-conditioning ( HVAC ) systems and provides a filter air supply air for overpressurization of
Enhanced biosensor performance using an avidin-biotin bridge for antibody immobilization
NASA Astrophysics Data System (ADS)
Narang, Upvan; Anderson, George P.; King, Keeley D.; Liss, Heidi S.; Ligler, Frances S.
1997-05-01
Maintaining antibody function after immobilization is critical to the performance of a biosensor. The conventional methods to immobilize antibodies onto surfaces are via covalent attachment using a crosslinker or by adsorption. Often, these methods of immobilization result in partial denaturation of the antibody and conformational changes leading to a reduced activity of the antibody. In this paper, we report on the immobilization of antibodies onto the surface of an optical fiber through an avidin-biotin bridge for the detection of ricin, ovalbumin, and Bacillus globigii (Bg). The assays are performed in a sandwich format. First, a capture antibody is immobilized, followed by the addition of the analyte. Finally, a fluorophore- labeled antibody is added for the specific detection of the analyte. The evanescent wave-induced fluorescence is coupled back through the same fiber to be detected using a photodiode. In all cases, we observe an improved performance of the biosensor, i.e., lower limit of detection and wide linear dynamic range, for the assays in which the antibody is immobilized via avidin-biotin bridges compared to covalent attachment method.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hutchison, Janine R.; Piepel, Gregory F.; Amidan, Brett G.
Surface sampling for Bacillus anthracis spores has traditionally relied on detection via bacterial cultivation methods. Although effective, this approach does not provide the level of organism specificity that can be gained through molecular techniques. False negative rates (FNR) and limits of detection (LOD) were determined for two B. anthracis surrogates with modified rapid viability-polymerase chain reaction (mRV-PCR) following macrofoam-swab sampling. This study was conducted in parallel with a previously reported study that analyzed spores using a plate-culture method. B. anthracis Sterne (BAS) or B. atrophaeus Nakamura (BG) spores were deposited onto four surface materials (glass, stainless steel, vinyl tile, andmore » plastic) at nine target concentrations (2 to 500 spores/coupon; 0.078 to 19.375 colony-forming units [CFU] per cm2). Mean FNR values for mRV-PCR analysis ranged from 0 to 0.917 for BAS and 0 to 0.875 for BG and increased as spore concentration decreased (over the concentrations investigated) for each surface material. FNRs based on mRV-PCR data were not statistically different for BAS and BG, but were significantly lower for glass than for vinyl tile. FNRs also tended to be lower for the mRV-PCR method compared to the culture method. The mRV-PCR LOD95 was lowest for glass (0.429 CFU/cm2 with BAS and 0.341 CFU/cm2 with BG) and highest for vinyl tile (0.919 CFU/cm2 with BAS and 0.917 CFU/cm2 with BG). These mRV-PCR LOD95 values were lower than the culture values (BAS: 0.678 to 1.023 CFU/cm2 and BG: 0.820 to 1.489 CFU/cm2). The FNR and LOD95 values reported in this work provide guidance for environmental sampling of Bacillus spores at low concentrations.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hutchison, Janine R.; Piepel, Gregory F.; Amidan, Brett G.
Surface sampling for Bacillus anthracis spores has traditionally relied on detection via bacterial cultivation methods. Although effective, this approach does not provide the level of organism specificity that can be gained through molecular techniques. False negative rates (FNR) and limits of detection (LOD) were determined for two B. anthracis surrogates with modified rapid viability-polymerase chain reaction (mRV-PCR) following macrofoam-swab sampling. This study was conducted in parallel with a previously reported study that analyzed spores using a plate-culture method. B. anthracis Sterne (BAS) or B. atrophaeus Nakamura (BG) spores were deposited onto four surface materials (glass, stainless steel, vinyl tile, andmore » plastic) at nine target concentrations (2 to 500 spores/coupon; 0.078 to 19.375 colony-forming units [CFU] per cm²). Mean FNR values for mRV-PCR analysis ranged from 0 to 0.917 for BAS and 0 to 0.875 for BG and increased as spore concentration decreased (over the concentrations investigated) for each surface material. FNRs based on mRV-PCR data were not statistically different for BAS and BG, but were significantly lower for glass than for vinyl tile. FNRs also tended to be lower for the mRV-PCR method compared to the culture method. The mRV-PCR LOD₉₅ was lowest for glass (0.429 CFU/cm² with BAS and 0.341 CFU/cm² with BG) and highest for vinyl tile (0.919 CFU/cm² with BAS and 0.917 CFU/cm² with BG). These mRV-PCR LOD₉₅ values were lower than the culture values (BAS: 0.678 to 1.023 CFU/cm² and BG: 0.820 to 1.489 CFU/cm²). The FNR and LOD₉₅ values reported in this work provide guidance for environmental sampling of Bacillus spores at low concentrations.« less
BG60S dissolution interferes with osteoblast calcium signals.
Valério, P; Pereira, M M; Goes, A M; Leite, M F
2007-02-01
We investigated the influence of extracellular calcium concentration, caused by the dissolution of a bioactive glass with 60% of silicon (BG60S), on intracellular calcium (Ca(i) (2 +)) signals and expression of inositol 1, 4, 5-triphosphate receptors (InsP(3)R) in primary culture of osteoblasts. We found that BG60S caused an increase in Ca(i) (2 +) signals in this cell type. Additionally, osteoblasts pre-incubated in the presence of BG60S showed an increase in Ca(i) (2 +) when cells were stimulated with vasopressin. On the other hand, a decrease in Ca(i) (2 +) signals were observed in osteoblasts pre-treated with BG60S and stimulated with KCl. We furher found that in osteoblasts, the type I InsP(3)R is preferentially distributed in the nucleus while the type II InsP(3)R in the cytoplasm. Preincubation of osteoblasts with BG60S altered the receptor expression level, increasing the type I InsP(3)R in the nucleus and decreasing type II InsP(3)R in the cytosol. Together, our results showed that in osteoblasts, BG60S increased Ca(i) (2 +)signals and altered Ca(i) (2 +) machinery.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piepel, Gregory F.; Hutchison, Janine R.
2014-04-16
This report describes the experimental design for a laboratory study to quantify the recovery efficiencies and false negative rates of a validated, macrofoam swab sampling method for low concentrations of Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus (BG) spores on four surface materials (stainless steel, glass, vinyl tile, plastic light cover panel). Two analytical methods (plating/counting and polymerase chain reaction) will be used. Only one previous study has investigated false negative as a function of affecting test factors. The surrogates BAS and BG have not been tested together in the same study previously. Hence, this study will provide for completingmore » gaps in the available information on the performance of macrofoam swab sampling at low concentrations.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piepel, Gregory F.; Hutchison, Janine R.
This report describes the experimental design for a laboratory study to quantify the recovery efficiencies and false negative rates of a validated, macrofoam-swab sampling method for low concentrations of Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus (BG) spores on four surface materials (stainless steel, glass, vinyl tile, plastic light cover panel). Two analytical methods (culture and polymerase chain reaction) will be used. Only one previous study has investigated how the false negative rate depends on test factors. The surrogates BAS and BG have not been tested together in the same study previously. Hence, this study will provide for completing gapsmore » in the available information on the performance of macrofoam-swab sampling at low concentrations.« less
Cho, Hwa Jin; Jang, Won Je; Moon, Soo Young; Lee, Jong Min; Kim, Jang-Ho; Han, Hyon-Sob; Kim, Kang-Woong; Lee, Bong-Joo; Kong, In-Soo
2018-03-01
(1,3)(1,4)-β-d-glucan has been determined to have various beneficial effects due to its unique structure. β-glucooligosaccharides (β-GOS), which are hydrolysates of barley (1,3)(1,4)-β-d-glucan, provide a useful prebiotic material for selective growth of probiotic bacteria. In this study, recombinant β-1,3-1,4-glucanase (Bg1314) from Bacillus sp. SJ-10 (KCCM 90078) was immobilized on porous silica using glutaraldehyde as a crosslinking reagent to achieve efficient production of β-GOS. We investigated the effects of factors such as the amounts of enzyme and glutaraldehyde, reaction temperature, and pH on catalytic activity. Enzyme activity decreased sharply at high concentrations of glutaraldehyde, likely due to the reaction of glutaraldehyde with lysine residues at the catalytic site of Bg1314, because lysine-substituted Bg1314 retained its activity under the same conditions. Immobilized Bg1314 protein (ImBg1314) was stable over a wide range of pH and could be stored long term at 4 °C. The optimal conditions of ImBg1314 were similar to those of Bg1314. However, the optimal temperature of ImBg1314 differed from that of Bg1314. The products were β-GOS composed of 3-O-β-cellobiosyl-d-glucose and 3-O-β-cellotriosyl-d-glucose. After ImBg1314 was reused for 10 cycles, it retained 42% of its initial catalytic activity. This study showed that the Imbg1314 applied economical production of β-GOS. Copyright © 2017 Elsevier Inc. All rights reserved.
Richter, William R; Wood, Joseph P; Wendling, Morgan Q S; Rogers, James V
2018-01-15
The inactivation of Bacillus anthracis spores on subway and used subway railcar materials was evaluated using fogged peracetic acid/hydrogen peroxide (PAA) and hydrogen peroxide (H 2 O 2 ). A total of 21 separate decontamination tests were conducted using bacterial spores of both B. anthracis Ames (B.a.) and Bacillus atrophaeus (B.g.) inoculated onto several types of materials. Tests were conducted using commercial off-the-shelf fogging equipment filled with either PAA or H 2 O 2 to fumigate a ∼15 cubic meter chamber under uncontrolled ambient relative humidity and controlled temperature (10 or 20 °C) from 8 to 168 h. For the present study, no conditions were found that resulted in complete inactivation of either B.a. Ames or B.g. on all test materials. Approximately 41% and 38% of the decontamination efficacies for B.a. and B.g., respectively, exhibited ≥6 log 10 reduction (LR); efficacy depended greatly on the material. When testing at 10 °C, the mean LR was consistently lower for both B.a. and B.g. as compared to 20 °C. Based on the statistical comparison of the LR results, B.g. exhibited equivalent or greater resistance than B.a. for approximately 92% of the time across all 21 tests. The efficacy data suggest that B.g. may be a suitable surrogate for B.a. Ames when assessing the decontamination efficacy of fogged PAA or H 2 O 2 . Moreover, the results of this testing indicate that in the event of B.a. spore release into a subway system, the fogging of PAA or H 2 O 2 represents a decontamination option for consideration. Copyright © 2017 Elsevier Ltd. All rights reserved.
Saito, Shingo; Massie, Tara L; Maeda, Takeshi; Nakazumi, Hiroyuki; Colyer, Christa L
2012-03-06
A new asymmetric, squarylium cyanine dye functionalized by boronic acid ("SQ-BA") was designed and synthesized for on-capillary labeling of gram-positive bacteria to provide for high sensitivity detection by way of a modified form of capillary electrophoresis with laser induced fluorescence detection (CE-LIF). The CE-based separation employed a polymer-enhanced buffer with capillary transient isotachophoresis in a new hybrid method dubbed "PectI." It was found that the addition of various monosaccharides to SQ-BA in a batch aqueous solution greatly enhanced the emission of the boronic acid functionalized dye by a factor of up to 18.3 at a long wavelength (λ(ex) = 630 nm, λ(em) = 660 nm) with a high affinity constant (K = ~10(2.80) M(-1)) superior to other sugar probes. Semiempirical quantum mechanics calculations suggest that the mechanism for this high enhancement may involve the dissociation of initially nonemissive dye associates (stabilized by an intramolecular hydrogen bond) upon complex formation with sugars. The fluorescence emission of SQ-BA was also significantly enhanced in the presence of a gram-positive bacterial spore, Bacillus globigii (Bg), which serves as a simulant of B. anthracis (or anthrax) and which possesses a peptidoglycan (sugar)-rich spore coat to provide ample sites for interaction with the dye. Several peaks were observed for a pure Bg sample even with polyethyleneoxide (PEO) present in the CE separation buffer, despite the polymer's previously demonstrated ability to focus microoorganisms to a single peak during migration. Likewise, several peaks were observed for a Bg sample when capillary transient isotachophoresis (ctITP) alone was employed. However, the new combination of these techniques as "PectI" dramatically and reproducibly focused the bacteria to a single peak with no staining procedure. Using PectI, the trace detection of Bg spores (corresponding to approximately three cells per injection) along with separation efficiency
Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.
2000-05-05
Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCRmore » amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.« less
Arimoto, Hanayo; Harwood, James F; Nunn, Peter J; Richardson, Alec G; Gordon, Scott; Obenauer, Peter J
2015-12-01
Recently, the BG-Sentinel® trap (BGS) trap has been reconfigured for increased durability during harsh field conditions. We evaluated the attractiveness of this redesigned trap, BG-Sentinel 2® (BGS2), and its novel granular lure cartridge system relative to the original trap and lure. Granular lures containing different combinations of lactic acid, ammonia, hexanoic acid, and octenol were also evaluated. Lure cartridges with all components except octenol trapped significantly more Aedes albopictus than lures containing octenol. This new granular lure combination and original BG-Lure® system were paired with BGS and BGS2 traps to compare relative attractiveness of the lures and the traps. All evaluations were conducted under field conditions in a suburban neighborhood in northeastern Florida from July to October 2014. Overall, the average numbers of Ae. albopictus collected by BGS or BGS2 were similar regardless of the lure type (i.e., mesh bag versus granules) (P = 0.56). The functionality and durability of both trap models are discussed.
Placebo-controlled phase 3 study of oral BG-12 or glatiramer in multiple sclerosis.
Fox, Robert J; Miller, David H; Phillips, J Theodore; Hutchinson, Michael; Havrdova, Eva; Kita, Mariko; Yang, Minhua; Raghupathi, Kartik; Novas, Mark; Sweetser, Marianne T; Viglietta, Vissia; Dawson, Katherine T
2012-09-20
BG-12 (dimethyl fumarate) is in development as an oral treatment for relapsing-remitting multiple sclerosis, which is commonly treated with parenteral agents (interferon or glatiramer acetate). In this phase 3, randomized study, we investigated the efficacy and safety of oral BG-12, at a dose of 240 mg two or three times daily, as compared with placebo in patients with relapsing-remitting multiple sclerosis. An active agent, glatiramer acetate, was also included as a reference comparator. The primary end point was the annualized relapse rate over a period of 2 years. The study was not designed to test the superiority or noninferiority of BG-12 versus glatiramer acetate. At 2 years, the annualized relapse rate was significantly lower with twice-daily BG-12 (0.22), thrice-daily BG-12 (0.20), and glatiramer acetate (0.29) than with placebo (0.40) (relative reductions: twice-daily BG-12, 44%, P<0.001; thrice-daily BG-12, 51%, P<0.001; glatiramer acetate, 29%, P=0.01). Reductions in disability progression with twice-daily BG-12, thrice-daily BG-12, and glatiramer acetate versus placebo (21%, 24%, and 7%, respectively) were not significant. As compared with placebo, twice-daily BG-12, thrice-daily BG-12, and glatiramer acetate significantly reduced the numbers of new or enlarging T(2)-weighted hyperintense lesions (all P<0.001) and new T(1)-weighted hypointense lesions (P<0.001, P<0.001, and P=0.002, respectively). In post hoc comparisons of BG-12 versus glatiramer acetate, differences were not significant except for the annualized relapse rate (thrice-daily BG-12), new or enlarging T(2)-weighted hyperintense lesions (both BG-12 doses), and new T(1)-weighted hypointense lesions (thrice-daily BG-12) (nominal P<0.05 for each comparison). Adverse events occurring at a higher incidence with an active treatment than with placebo included flushing and gastrointestinal events (with BG-12) and injection-related events (with glatiramer acetate). There were no malignant neoplasms
Performance of the BG1Luc ER TA method in a qHTS format.
Ceger, Patricia; Allen, David; Huang, Ruili; Xia, Menghang; Casey, Warren
2015-01-01
In 2012, the BG1Luc4E2 estrogen receptor (ER) transactivation (TA) method (BG1Luc ER TA) was accepted by U.S. regulatory agencies and the Organisation for Economic Co-operation and Development to detect substances with ER agonist activity. The method is now part of the Tier 1 testing battery in the Environmental Protection Agency's Endocrine Disruptor Screening Program. The BG1Luc ER TA method uses the BG1 ovarian cell line that endogenously expresses full-length ER (α and β) and is stably transfected with a plasmid containing four estrogen responsive elements upstream of a luciferase reporter gene. To allow increased throughput and testing efficiency, the BG1Luc ER TA ("BG1 manual") method was adapted for quantitative high-throughput screening (BG1 qHTS) in the U.S. Tox21 testing program. The BG1 qHTS test method was used to test approximately 10,000 chemicals three times each, and concentration-response data (n=15) were analyzed to evaluate test method performance. The balanced accuracy of the BG1 qHTS test method (97% [32/33]) was determined by comparing results to ER TA performance standards for the BG1 manual method. Concordance between the BG1 manual and qHTS methods was 92% (57/62) when calculated for a larger set of non-reference chemicals tested in both methods. These data demonstrate that the performance of the BG1 qHTS is similar to the currently accepted BG1 manual method, thereby establishing the utility of the BG1 qHTS method for identifying ER active environmental chemicals.
Stability Characterization of Quinazoline Derivative BG1188 by Optical Methods
NASA Astrophysics Data System (ADS)
Militaru, Andra; Smarandache, Adriana; Mahamoud, Abdallah; Damian, Victor; Ganea, Paul; Alibert, Sandrine; Pagès, Jean-Marie; Pascu, Mihail-Lucian
2011-08-01
3-[2-(dimethylamino)ethyl]-6-nitroquinazolin-4(3H)-one, labeled BG1188, is a new synthesized compound, out of a series of quinazoline derivatives developed to fight the multidrug resistance of antibiotics acquired by bacteria. A characterization of the BG1188 powder was made using FTIR spectra in order to evidence the functional groups in the medicine's molecule. The ultraviolet-visible (UV-Vis) absorption spectra were used to study the stability of the BG1188 solutions in two solvents and at different temperatures. BG1188 concentration in ultrapure water was varied between 2×10-3 M (stock solution) and 10-6 M. The concentration recommended by higher activity on bacteria was 10-3 M. For the same reason, this was the utilized concentration of BG1188 in dimethyl sulfoxide (DMSO). Time stability was characterized by comparing the time evolution of the UV-Vis absorption spectra of the BG1188 solutions in ultrapure de-ionized water or in DMSO. The spectra were recorded daily for about 4 months after the preparation for the BG1188 solutions in ultrapure water. Generally, samples are stable within the experimental errors at concentrations higher than 10-5 M, but the stability time interval may vary from 119 days at 10-4 M to 34 days at 10-5 M. Time evolution of the absorption spectra at 10-3 M in ultrapure water shows reproducibility within the measuring errors (±1.045%) for time intervals up to 1032 hours (more than 40 days) after preparation. On the other hand, BG1188 solutions in DMSO may be considered unstable because the absorption spectra modify in terms of peak shapes and intensities, indicating that the samples exhibit modifications immediately after preparation. Regardless the solvent used, some aggregation phenomena took place and wire-like aggregates were observed in all the solutions with the naked eye. These aggregates were analyzed, tentatively, using optical microscopy and FTIR.
2010-03-19
multiplex array. The array had capture Abs against ricin, Bacillus globigii spores, M13 phage , a1 acid glycoprotein, and fluorescein. Initially, antigen (Ag...comply with a collection of information if it does not display a currently valid OMB control number. 1. REPORT DATE JAN 2010 2. REPORT TYPE 3
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piepel, Gregory F.; Hutchison, Janine R.; Kaiser, Brooke L. D.
The performance of a macrofoam-swab sampling method was evaluated using Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus Nakamura (BG) spores applied at nine low target amounts (2-500 spores) to positive-control plates and test coupons (2 in × 2 in) of four surface materials (glass, stainless steel, vinyl tile, and plastic). Test results from cultured samples were used to evaluate the effects of surrogate, surface concentration, and surface material on recovery efficiency (RE), false negative rate (FNR), and limit of detection. For RE, surrogate and surface material had statistically significant effects, but concentration did not. Mean REs were the lowest formore » vinyl tile (50.8% with BAS, 40.2% with BG) and the highest for glass (92.8% with BAS, 71.4% with BG). FNR values ranged from 0 to 0.833 for BAS and 0 to 0.806 for BG, with values increasing as concentration decreased in the range tested (0.078 to 19.375 CFU/cm2, where CFU denotes ‘colony forming units’). Surface material also had a statistically significant effect. A FNR-concentration curve was fit for each combination of surrogate and surface material. For both surrogates, the FNR curves tended to be the lowest for glass and highest for vinyl title. The FNR curves for BG tended to be higher than for BAS at lower concentrations, especially for glass. Results using a modified Rapid Viability-Polymerase Chain Reaction (mRV-PCR) analysis method were also obtained. The mRV-PCR results and comparisons to the culture results are discussed in a separate report.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piepel, Gregory F.; Hutchison, Janine R.; Deatherage Kaiser, Brooke L
The performance of a macrofoam-swab sampling method was evaluated using Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus Nakamura (BG) spores applied at nine low target amounts (2-500 spores) to positive-control plates and test coupons (2 in. × 2 in.) of four surface materials (glass, stainless steel, vinyl tile, and plastic). Test results from cultured samples were used to evaluate the effects of surrogate, surface concentration, and surface material on recovery efficiency (RE), false negative rate (FNR), and limit of detection. For RE, surrogate and surface material had statistically significant effects, but concentration did not. Mean REs were the lowest formore » vinyl tile (50.8% with BAS, 40.2% with BG) and the highest for glass (92.8% with BAS, 71.4% with BG). FNR values ranged from 0 to 0.833 for BAS and 0 to 0.806 for BG, with values increasing as concentration decreased in the range tested (0.078 to 19.375 CFU/cm 2, where CFU denotes ‘colony forming units’). Surface material also had a statistically significant effect. A FNR-concentration curve was fit for each combination of surrogate and surface material. For both surrogates, the FNR curves tended to be the lowest for glass and highest for vinyl title. The FNR curves for BG tended to be higher than for BAS at lower concentrations, especially for glass. Results using a modified Rapid Viability-Polymerase Chain Reaction (mRV-PCR) analysis method were also obtained. The mRV-PCR results and comparisons to the culture results will be discussed in a subsequent report.« less
Isabel, Sandra; Boissinot, Maurice; Charlebois, Isabelle; Fauvel, Chantal M; Shi, Lu-E; Lévesque, Julie-Christine; Paquin, Amélie T; Bastien, Martine; Stewart, Gale; Leblanc, Eric; Sato, Sachiko; Bergeron, Michel G
2012-03-01
Authorities frequently need to analyze suspicious powders and other samples for biothreat agents in order to assess environmental safety. Numerous nucleic acid detection technologies have been developed to detect and identify biowarfare agents in a timely fashion. The extraction of microbial nucleic acids from a wide variety of powdery and environmental samples to obtain a quality level adequate for these technologies still remains a technical challenge. We aimed to develop a rapid and versatile method of separating bacteria from these samples and then extracting their microbial DNA. Bacillus atrophaeus subsp. globigii was used as a simulant of Bacillus anthracis. We studied the effects of a broad variety of powdery and environmental samples on PCR detection and the steps required to alleviate their interference. With a benchmark DNA extraction procedure, 17 of the 23 samples investigated interfered with bacterial lysis and/or PCR-based detection. Therefore, we developed the dual-filter method for applied recovery of microbial particles from environmental and powdery samples (DARE). The DARE procedure allows the separation of bacteria from contaminating matrices that interfere with PCR detection. This procedure required only 2 min, while the DNA extraction process lasted 7 min, for a total of <10 min. This sample preparation procedure allowed the recovery of cleaned bacterial spores and relieved detection interference caused by a wide variety of samples. Our procedure was easily completed in a laboratory facility and is amenable to field application and automation.
Isabel, Sandra; Boissinot, Maurice; Charlebois, Isabelle; Fauvel, Chantal M.; Shi, Lu-E; Lévesque, Julie-Christine; Paquin, Amélie T.; Bastien, Martine; Stewart, Gale; Leblanc, Éric; Sato, Sachiko
2012-01-01
Authorities frequently need to analyze suspicious powders and other samples for biothreat agents in order to assess environmental safety. Numerous nucleic acid detection technologies have been developed to detect and identify biowarfare agents in a timely fashion. The extraction of microbial nucleic acids from a wide variety of powdery and environmental samples to obtain a quality level adequate for these technologies still remains a technical challenge. We aimed to develop a rapid and versatile method of separating bacteria from these samples and then extracting their microbial DNA. Bacillus atrophaeus subsp. globigii was used as a simulant of Bacillus anthracis. We studied the effects of a broad variety of powdery and environmental samples on PCR detection and the steps required to alleviate their interference. With a benchmark DNA extraction procedure, 17 of the 23 samples investigated interfered with bacterial lysis and/or PCR-based detection. Therefore, we developed the dual-filter method for applied recovery of microbial particles from environmental and powdery samples (DARE). The DARE procedure allows the separation of bacteria from contaminating matrices that interfere with PCR detection. This procedure required only 2 min, while the DNA extraction process lasted 7 min, for a total of <10 min. This sample preparation procedure allowed the recovery of cleaned bacterial spores and relieved detection interference caused by a wide variety of samples. Our procedure was easily completed in a laboratory facility and is amenable to field application and automation. PMID:22210204
Decontamination of Drinking Water Infrastructure ...
Technical Brief This study examines the effectiveness of decontaminating corroded iron and cement-mortar coupons that have been contaminated with spores of Bacillus atrophaeus subsp. globigii (B. globigii), which is often used as a surrogate for pathogenic B. anthracis (anthrax) in disinfection studies. Bacillus spores are persistent on common drinking water material surfaces like corroded iron, requiring physical or chemical methods to decontaminate the infrastructure. In the United States, free chlorine and monochloramine are the primary chemical disinfectants used by the drinking water industry to inactivate microorganisms. Flushing is also a common, easily implemented practice in drinking water distribution systems, although large volumes of contaminated water needing treatment could be generated. Identifying readily available alternative disinfectant formulations for infrastructure decontamination could give water utilities options for responding to specific types of contamination events. In addition to presenting data on flushing alone, which demonstrated the persistence of spores on water infrastructure in the absence of high levels of disinfectants, data on acidified nitrite, chlorine dioxide, free chlorine, monochloramine, ozone, peracetic acid, and followed by flushing are provided.
2D fluorescence spectra measurement of six kinds of bioagents simulants by short range Lidar
NASA Astrophysics Data System (ADS)
Sanpedro, Man
2018-02-01
Pantoea agglomerans (Pan), Staphylococcus aureus (Sta), Bacillus globigii (BG) and Escherichia coli (EH), these four kinds of bioagents simulants of were cultured and then their growth curves were measured, the generation time was 0.99h, 0.835h, 1.07h and 1.909h, respectively. A small short range fluorescence lidar working at wavelengths of 266nm and 355nm was designed and used to measure the two-dimensional fluorescence spectra of bioagents simulants in the amino acid segment and NADH segment, respectively. In a controllable fluorescence measurement chamber, the two-dimensional fluorescence spectra of vegetative liquid bacterial aerosols as well as BSA and OVA, two protein toxinic simulants were measured with a resolution of 4nm. The two-dimensional fluorescence spectral shape of Pan, Sta, EH and BG, BSA and OVA were consistent with the standard fluorescent component tryptophan in the amino acid band with FWHM of 60nm, but the central wavelength of the fluorescence spectra of these simulants blue/purple shifted obviously as affected by the external biochemical environment, concentration and ratio of different bacterial internal fluorophores, so the energy level between the excited state and the ground state of the fluorescence molecule increased. Differently, weak NADH fluorescence spectra with 100nm FWHM inside the four vegetative bacteria aerosols were detected, but Rayleigh scattering, Raman scattering contribution of water, nitrogen in the fluorescence spectra could not be effectively extracted. The second - order derivative fluorescence spectra of four simulants showed that the high - order processing and recognition of the fluorescence spectra was feasible.
Technical Evaluation of Sample-Processing, Collection, and Preservation Methods
2014-07-01
For the Gram-positive organism, B. atrophaeus var. globigii (Unified Culture Collection [ UCC ] designation: BACI051) was selected as a surrogate for...the well-known biothreat agent Bacillus anthracis. For the Gram-negative organism, Y. pestis CO92 (pgm–) ( UCC designation: YERS059) was selected...Diagnostics device) TAMRA tetramethylrhodamine TE buffer tris-ethylenediaminetetraacetic acid buffer UCC Unified Culture Collection USG U.S. Government
The role of FaBG3 in fruit ripening and B. cinerea fungal infection of strawberry.
Li, Qian; Ji, Kai; Sun, Yufei; Luo, Hao; Wang, Hongqing; Leng, Ping
2013-10-01
In plants, β-glucosidases (BG) have been implicated in developmental and pathogen defense, and are thought to take part in abscisic acid (ABA) synthesis via hydrolysis of ABA glucose ester to release active ABA; however, there is no genetic evidence for the role of BG genes in ripening and biotic/abiotic stress in fruits. To clarify the role of BG genes in fruit, eight Fa/FvBG genes encoding β-glucosidase were isolated using information from the GenBank strawberry nucleotide database. Of the Fa/FvBG genes examined, expression of FaBG3 was the highest, showing peaks at the mature stage, coincident with the changes observed in ABA content. To verify the role of this gene, we suppressed the expression of FaBG3 via inoculation with Agrobacterium tumefaciens containing tobacco rattle virus carrying a FaBG3 fragment (RNAi). The expression of FaBG3 in FaBG3-RNAi-treated fruit was markedly reduced, and the ABA content was lower than that of the control. FaBG3-RNAi-treated fruit did not exhibit full ripening, and were firmer, had lower sugar content, and were pale compared with the control due to down-regulation of ripening-related genes. FaBG3-RNAi-treated fruit with reduced ABA levels were much more resistant to Botrytis cinerea fungus but were more sensitive to dehydration stress than control fruit. These results indicate that FaBG3 may play key roles in fruit ripening, dehydration stress and B. cinerea fungal infection in strawberries via modulation of ABA homeostasis and transcriptional regulation of ripening-related genes. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Foam Separation of Pseudomonas fluorescens and Bacillus subtilis var. niger
Grieves, R. B.; Wang, S. L.
1967-01-01
An experimental investigation established the effect of the presence of inorganic salts on the foam separation of Pseudomonas fluorescens and of Bacillus subtilis var. niger (B. globigii) from aqueous suspension by use of a cationic surfactant. For P. fluorescens, 5.0 μeq/ml of NaCl, KCl, Na2SO4, K2SO4, CaCl2, CaSO4, MgCl2, or MgSO4 produced increases in the cell concentration in the residual suspension (not carried into the foam) from 2.9 × 105 up to 1.6 × 106 to 2.8 × 107 cells per milliliter (initial suspensions contain from 3.3 × 107 to 4.8 × 107 cells per milliliter). The exceptional influence of magnesium was overcome by bringing the cells into contact first with the surfactant and then the salt. For B. subtilis, the presence of 5.0 μeq/ml of any of the eight salts increased the residual cell concentration by one order of magnitude from 1.2 × 104 to about 4.0 × 105 cells per milliliter. This occurred regardless of the sequence of contact as long as the surfactant contact period was sufficient. The presence of salts increased collapsed foam volumes with P. fluorescens and decreased collapsed foam volumes with B. subtilis. PMID:4961933
Foam separation of Pseudomonas fluorescens and Bacillus subtilis var. niger.
Grieves, R B; Wang, S L
1967-01-01
An experimental investigation established the effect of the presence of inorganic salts on the foam separation of Pseudomonas fluorescens and of Bacillus subtilis var. niger (B. globigii) from aqueous suspension by use of a cationic surfactant. For P. fluorescens, 5.0 mueq/ml of NaCl, KCl, Na(2)SO(4), K(2)SO(4), CaCl(2), CaSO(4), MgCl(2), or MgSO(4) produced increases in the cell concentration in the residual suspension (not carried into the foam) from 2.9 x 10(5) up to 1.6 x 10(6) to 2.8 x 10(7) cells per milliliter (initial suspensions contain from 3.3 x 10(7) to 4.8 x 10(7) cells per milliliter). The exceptional influence of magnesium was overcome by bringing the cells into contact first with the surfactant and then the salt. For B. subtilis, the presence of 5.0 mueq/ml of any of the eight salts increased the residual cell concentration by one order of magnitude from 1.2 x 10(4) to about 4.0 x 10(5) cells per milliliter. This occurred regardless of the sequence of contact as long as the surfactant contact period was sufficient. The presence of salts increased collapsed foam volumes with P. fluorescens and decreased collapsed foam volumes with B. subtilis.
Early diagnostic value of plasma PCT and BG assay for CRBSI after OLT.
Chen, J; Wang, Y; Shen, Z; Zhu, Z; Song, Y; Han, R
2011-06-01
The aim was to evaluate the role of procalcitonin (PCT) and (1-3)-β-D-glucan (BG) tests for early detection or exclusion of central venous catheter-related bloodstream infections (CRBSI) in patients after orthotopic liver transplantation (OLT). Fifty-five patients with clinically suspected CRBSI were assessed after OLT in this prospective study. On the day of clinical suspicion of CRBSI, blood samples were obtained from central venous catheters and a peripheral vein for blood cultures and from a peripheral vein for PCT and BG tests. Plasma PCT and BG values were measured by using an immunoluminometric assay and Fungitell BG assay, respectively. No prisoners or organs from prisoners were used in this study. Twenty-five patients (45%) were diagnosed with CRBIS. Among them, 13 (52%) displayed gram-positive bacteriemia, 11 (44%) gram-negative bacteriemia, and 1 (4%) fungemia. The PCT values were higher in CRBSI than in non-CRBSI patients (P = .003). CRBSI patients did not show significant increases in plasma BG values compared with non-CRBSI subjects (P = .051). PCT and BG area under receiver operating characteristic curves were 0.840 and 0.486, respectively. Sensitivity, specificity, and positive and negative predictive values of a PCT of ≥ 3.1 ng/mL for the diagnosis of CRBSI were 0.72, 0.87, 0.82, and 0.79, respectively. The figures for a BG of ≥ 83 pg/mL were 0.32, 0.90, 0.73, and 0.61, respectively. Among the 24 patients with bacteria infections, PCT was higher in patients with gram-negative than those with gram-positive bacterial infections (P = .022). We concluded that the PCT assay may be a useful rapid diagnostic adjunct for the diagnosis of suspected CRBSI in OLT patients. Copyright © 2011 Elsevier Inc. All rights reserved.
Ciampolini, Mario; Sifone, Massimiliano
2011-01-01
Background: Meals begin and end subjectively. We trained healthy subjects to recognize initial hunger as a preprandial target for meal consumption, and to create a “recognizing hunger” or initial hunger meal pattern. Objective: Training subjects to “recognize hunger” lowers blood glucose (BG) and improves energy balance, and lowers metabolic risks and bodyweight. A minority may have low BG and low metabolic risks at recruitment, but the others may recover this favorable condition by training. Methods: In a 7-day food diary, subjects reported their preprandial BG measurements; BG and energy availability by blood were assessed at the lowest BG during the day, and diary-mean BG thus characterized the individual meal pattern (daily energy intake). We analyzed the same diaries of a recent paper on a global, randomized comparison of subjects trained in “recognizing hunger” with control subjects. This time, we checked whether subjects who had maintained low BG (LBG subgroup) at recruitment were able to decrease mean BG and metabolic risk factors during “hunger recognition” like those who presented high BG (HBG subgroup). Results: At recruitment, the BG means of 120 investigated subjects were within mean confidence limits of ± 3.84 mg/dL, and we could stratify subjects in ten small strata of which each significantly differed by mean BG. Mean BG was stable in each control subject over five months; the mean absolute change being 6.0 ± 4.6 mg/dL. Only three out of 34 trained subjects who had lower mean BG than 81.8 mg/dL significantly decreased mean BG, whereas 41 out of 55 subjects whose mean BG was greater than 81.8 mg/dL significantly decreased mean BG after training (P < 0.0001). At recruitment, the LBG subgroup showed significantly lower insulin, lower BG area under curve (AUC) in the oral glucose tolerance test (GTT), and lower HbA1c than the HBG group. After training, only HBG subjects, compared with HBG controls, significantly decreased preprandial
Genome Sequence of the Obligate Gammaproteobacterial Methanotroph Methylomicrobium album strain BG8
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kits, K. Dimitri; Kalyuzhnaya, Marina G.; Klotz, Martin G
2013-01-01
The complete genome sequence of Methylomicrobium album BG8, a methane-oxidizing gammaproteobacterium isolated from freshwater, is reported. Aside from conserved inventory for growth on single-carbon compounds, M. album BG8 encodes a range of inventory for additional carbon and nitrogen transformations, but no genes for growth on multi-carbon substrates or for N-fixation.
BG7: A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data
Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Pareja, Eduardo; Tobes, Raquel
2012-01-01
BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version – which is developed in Java, takes advantage of Amazon Web Services (AWS) cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future. PMID:23185310
Gene calling and bacterial genome annotation with BG7.
Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo
2015-01-01
New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).
2007-08-01
osin. which produced easily recognized red colonies wben grown on artificial media. For these reasons. S . marcescens (along with Bacillus globigii^ was...8217 Since that time. S . marcescens has been identified as an important cause of nosocomial infections of the past 30 years, predominantly in...found to be 99% identical to S . marcescens . These results demonstrate the ability to identify the contents of a biological munition that had been buried
2003-09-01
concentration, and Bacillus subtilis var. niger spores were detectable at 10,000 CFU/ml. When combined with bead beating, these spores were consistently...Bioloeical Aaent Simulants. Cell suspensions of Bacillus subtilis var. niger spores (BG spores ) and Erwinia herbicola vegetative cells were prepared for...use as biological simulants. BG spores were prepared by inoculating 1 g spores of Bacillus subtilis var. niger (Merck & Co., Inc., Whitehouse Station
SN 1991bg - A type Ia supernova with a difference
NASA Technical Reports Server (NTRS)
Leibundgut, Bruno; Kirshner, Robert P.; Phillips, Mark M.; Wells, Lisa A.; Suntzeff, N. B.; Hamuy, Mario; Schommer, R. A.; Walker, A. R.; Gonzalez, L.; Ugarte, P.
1993-01-01
While SN 1991bg is an unusual type Ia SN in such a feature as the brief duration of the photospheric phase, which ended only two weeks after maximum, it shares with other Ia SNs strong Si II and Ca II lines near maximum light. In addition, the light and color curve slopes are almost identical with the templates at late times. The spectral evolution of SN 1991bg is also unique but not unrecognizable; nevertheless, the peculiarities associated with this event complicate the fundamental question as to whether the Ia SNs make good standard candles.
Surface charge engineering of a Bacillus gibsonii subtilisin protease.
Jakob, Felix; Martinez, Ronny; Mandawe, John; Hellmuth, Hendrik; Siegert, Petra; Maurer, Karl-Heinz; Schwaneberg, Ulrich
2013-08-01
In proteins, a posttranslational deamidation process converts asparagine (Asn) and glutamine (Gln) residues into negatively charged aspartic (Asp) and glutamic acid (Glu), respectively. This process changes the protein net charge affecting enzyme activity, pH optimum, and stability. Understanding the principles which affect these enzyme properties would be valuable for protein engineering in general. In this work, three criteria for selecting amino acid substitutions of the deamidation type in the Bacillus gibsonii alkaline protease (BgAP) are proposed and systematically studied in their influence on pH-dependent activity and thermal resistance. Out of 113 possible surface amino acids, 18 (11 Asn and 7 Gln) residues of BgAP were selected and evaluated based on three proposed criteria: (1) The Asn or Gln residues should not be conserved, (2) should be surface exposed, and (3) neighbored by glycine. "Deamidation" in five (N97, N253, Q37, Q200, and Q256) out of eight (N97, N154, N250, N253, Q37, Q107, Q200, and Q256) amino acids meeting all criteria resulted in increased proteolytic activity. In addition, pH activity profiles of the variants N253D and Q256E and the combined variant N253DQ256E were dramatically shifted towards higher activity at lower pH (range of 8.5-10). Variant N253DQ256E showed twice the specific activity of wild-type BgAP and its thermal resistance increased by 2.4 °C at pH 8.5. These property changes suggest that mimicking surface deamidation by substituting Gln by Glu and/or Asn by Asp might be a simple and fast protein reengineering approach for modulating enzyme properties such as activity, pH optimum, and thermal resistance.
Ma, Yanxuan; Zheng, Yudong; Huang, Xiaoshan; Xi, Tingfei; Lin, Xiaodan; Han, Dongfei; Song, Wenhui
2010-04-01
Due to the non-bioactivity and poor conjunction performance of present cartilage prostheses, the main work here is to develop the bioactive glass-polyvinyl alcohol hydrogel articular cartilage/bone (BG-PVA/bone) composite implants. The essential criterion for a biomaterial to bond with living bone is well-matched mechanical properties as well as biocompatibility and bioactivity. In vitro studies on the formation of a surface layer of carbonate hydroxyl apatite (HCA) and the corresponding variation of the properties of biomaterials are imperative for their clinical application. In this paper, the mineralization behavior and variation of the interface properties of BG-PVA/bone composites were studied in vitro by using simulated body fluid (SBF). The mineralization and HCA layer formed on the interface between the BG-PVA hydrogel and bone in SBF could provide the composites with bioactivity and firmer combination. The compression property, shear strength and interface morphology of BG-PVA/bone composite implants varying with the immersion time in SBF were characterized. Also, the influence laws of the immersion time, content of BG in the composites and aperture of bones to the mineralization behavior and interface properties were investigated. The good mineralization behavior and enhanced conjunction performance of BG-PVA/bone composites demonstrated that this kind of composite implant might be more appropriate cartilage replacements.
Bullard, Kristen M.; Gullberg, Rebekah C.; Soltani, Elnaz; Steel, J. Jordan; Geiss, Brian J.; Keenan, Susan M.
2015-01-01
Arthropod-borne flavivirus infection continues to cause significant morbidity and mortality worldwide. Identification of drug targets and novel antiflaviviral compounds to treat these diseases has become a global health imperative. A previous screen of 235,456 commercially available small molecules identified the 2-thioxothiazolidin-4-one family of compounds as inhibitors of the flaviviral NS5 capping enzyme, a promising target for antiviral drug development. Rational drug design methodologies enabled identification of lead compound BG-323 from this series. We have shown previously that BG-323 potently inhibits NS5 capping enzyme activity, displays antiviral effects in dengue virus replicon assays and inhibits growth of West Nile and yellow fever viruses with low cytotoxicity in vitro. In this study we further characterized BG-323’s antiviral activity in vitro and in vivo. We found that BG-323 was able to reduce replication of WNV (NY99) and Powassan viruses in culture, and we were unable to force resistance into WNV (Kunjin) in long-term culture experiments. We then evaluated the antiviral activity of BG-323 in a murine model. Mice were challenged with WNV NY99 and administered BG-323 or mock by IP inoculation immediately post challenge and twice daily thereafter. Mice were bled and viremia was quantified on day three. No significant differences in viremia were observed between BG-323-treated and control groups and clinical scores indicated both BG-323-treated and control mice developed signs of illness on approximately the same day post challenge. To determine whether differences in in vitro and in vivo efficacy were due to unfavorable pharmacokinetic properties of BG-323, we conducted a pharmacokinetic evaluation of this small molecule. Insights from pharmacokinetic studies indicate that BG-323 is cell permeable, has a low efflux ratio and does not significantly inhibit two common cytochrome P450 (CYP P450) isoforms thus suggesting this molecule may be less
Bullard, Kristen M; Gullberg, Rebekah C; Soltani, Elnaz; Steel, J Jordan; Geiss, Brian J; Keenan, Susan M
2015-01-01
Arthropod-borne flavivirus infection continues to cause significant morbidity and mortality worldwide. Identification of drug targets and novel antiflaviviral compounds to treat these diseases has become a global health imperative. A previous screen of 235,456 commercially available small molecules identified the 2-thioxothiazolidin-4-one family of compounds as inhibitors of the flaviviral NS5 capping enzyme, a promising target for antiviral drug development. Rational drug design methodologies enabled identification of lead compound BG-323 from this series. We have shown previously that BG-323 potently inhibits NS5 capping enzyme activity, displays antiviral effects in dengue virus replicon assays and inhibits growth of West Nile and yellow fever viruses with low cytotoxicity in vitro. In this study we further characterized BG-323's antiviral activity in vitro and in vivo. We found that BG-323 was able to reduce replication of WNV (NY99) and Powassan viruses in culture, and we were unable to force resistance into WNV (Kunjin) in long-term culture experiments. We then evaluated the antiviral activity of BG-323 in a murine model. Mice were challenged with WNV NY99 and administered BG-323 or mock by IP inoculation immediately post challenge and twice daily thereafter. Mice were bled and viremia was quantified on day three. No significant differences in viremia were observed between BG-323-treated and control groups and clinical scores indicated both BG-323-treated and control mice developed signs of illness on approximately the same day post challenge. To determine whether differences in in vitro and in vivo efficacy were due to unfavorable pharmacokinetic properties of BG-323, we conducted a pharmacokinetic evaluation of this small molecule. Insights from pharmacokinetic studies indicate that BG-323 is cell permeable, has a low efflux ratio and does not significantly inhibit two common cytochrome P450 (CYP P450) isoforms thus suggesting this molecule may be less
10. Credit BG. Interior of control and observation room at ...
10. Credit BG. Interior of control and observation room at Control and Recording Center Building 4221/E-22. - Jet Propulsion Laboratory Edwards Facility, Control & Recording Center, Edwards Air Force Base, Boron, Kern County, CA
Antimicrobial and Immunomodulatory Activities of PR-39 Derived Peptides
Veldhuizen, Edwin J. A.; Schneider, Viktoria A. F.; Agustiandari, Herfita; van Dijk, Albert; Tjeerdsma-van Bokhoven, Johanna L. M.; Bikker, Floris J.; Haagsman, Henk P.
2014-01-01
The porcine cathelicidin PR-39 is a host defence peptide that plays a pivotal role in the innate immune defence of the pig against infections. Besides direct antimicrobial activity, it is involved in immunomodulation, wound healing and several other biological processes. In this study, the antimicrobial- and immunomodulatory activity of PR-39, and N- and C-terminal derivatives of PR-39 were tested. PR-39 exhibited an unexpected broad antimicrobial spectrum including several Gram positive strains such as Bacillus globigii and Enterococcus faecalis. Of organisms tested, only Staphylococcus aureus was insensitive to PR-39. Truncation of PR-39 down to 15 (N-terminal) amino acids did not lead to major loss of activity, while peptides corresponding to the C-terminal part of PR-39 were hampered in their antimicrobial activity. However, shorter peptides were all much more sensitive to inhibition by salt. Active peptides induced ATP leakage and loss of membrane potential in Bacillus globigii and Escherichia coli, indicating a lytic mechanism of action for these peptides. Finally, only the mature peptide was able to induce IL-8 production in porcine macrophages, but some shorter peptides also had an effect on TNF-α production showing differential regulation of cytokine induction by PR-39 derived peptides. None of the active peptides showed high cytotoxicity highlighting the potential of these peptides for use as an alternative to antibiotics. PMID:24755622
Credit BG. Northwest and southwest facades of Administration Building for ...
Credit BG. Northwest and southwest facades of Administration Building for Building 4505 area. Construction began on this building in 1967 - Edwards Air Force Base, North Base, Administration Building, Northeast of A Street, Boron, Kern County, CA
δ Scuti-type pulsation in the hot component of the Algol-type binary system BG Peg
NASA Astrophysics Data System (ADS)
Şenyüz, T.; Soydugan, E.
2014-02-01
In this study, 23 Algol-type binary systems, which were selected as candidate binaries with pulsating components, were observed at the Çanakkale Onsekiz Mart University Observatory. One of these systems was BG Peg. Its hotter component shows δ Scuti-type light variations. Physical parameters of BG Peg were derived from modelling the V light curve using the Wilson-Devinney code. The frequency analysis shows that the pulsational component of the BG Peg system pulsates in two modes with periods of 0.039 and 0.047 d. Mode identification indicates that both modes are most likely non-radial l = 2 modes.
Credit BG. Interior of Deluge Water Booster Station displaying highcapacity ...
Credit BG. Interior of Deluge Water Booster Station displaying high-capacity electrically driven water pumps for fire fighting service - Edwards Air Force Base, North Base, Deluge Water Booster Station, Northeast of A Street, Boron, Kern County, CA
Dia, Vermont P; Krishnan, Hari B
2016-09-15
Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity of BG-4 may be responsible for its capability to cause cytotoxicity to HCT-116 and HT-29 human colon cancer cells with ED50 values of 134.4 and 217.0 μg/mL after 48 h of treatment, respectively. The mechanism involved in the cytotoxic effect may be associated with induction of apoptosis as evidenced by increased percentage of HCT-116 and HT-29 colon cancer cells undergoing apoptosis from 5.4% (untreated) to 24.8% (BG-4 treated, 125 μg/mL for 16 h) and 8.5% (untreated) to 31.9% (BG-4 treated, 125 μg/mL for 16 h), respectively. The molecular mechanistic explanation in the apoptosis inducing property of BG-4 is due to reduced expression of Bcl-2 and increased expression of Bax leading to increased expression of caspase-3 and affecting the expression of cell cycle proteins p21 and CDK2. This is the first report on the anti-cancer potential of a novel bioactive peptide isolated from Momordica charantia in vitro supporting the potential therapeutic property of BG-4 against colon cancer that must be addressed using in vivo models of colon carcinogenesis.
Dia, Vermont P.; Krishnan, Hari B.
2016-01-01
Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity of BG-4 may be responsible for its capability to cause cytotoxicity to HCT-116 and HT-29 human colon cancer cells with ED50 values of 134.4 and 217.0 μg/mL after 48 h of treatment, respectively. The mechanism involved in the cytotoxic effect may be associated with induction of apoptosis as evidenced by increased percentage of HCT-116 and HT-29 colon cancer cells undergoing apoptosis from 5.4% (untreated) to 24.8% (BG-4 treated, 125 μg/mL for 16 h) and 8.5% (untreated) to 31.9% (BG-4 treated, 125 μg/mL for 16 h), respectively. The molecular mechanistic explanation in the apoptosis inducing property of BG-4 is due to reduced expression of Bcl-2 and increased expression of Bax leading to increased expression of caspase-3 and affecting the expression of cell cycle proteins p21 and CDK2. This is the first report on the anti-cancer potential of a novel bioactive peptide isolated from Momordica charantia in vitro supporting the potential therapeutic property of BG-4 against colon cancer that must be addressed using in vivo models of colon carcinogenesis. PMID:27628414
11. Credit BG. Interior of control and observation room at ...
11. Credit BG. Interior of control and observation room at Control and Recording Center, showing detail of switchboard and closed circuit television monitors. - Jet Propulsion Laboratory Edwards Facility, Control & Recording Center, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. Southeast and northeast facades of concrete block structure ...
Credit BG. Southeast and northeast facades of concrete block structure built in the late 1960s. It is now used to store miscellaneous equipment - Edwards Air Force Base, North Base, Liquid Oxygen Storage Facility, Second Street, Boron, Kern County, CA
BioSim (trademark) BG Non-Biological Aerosol Simulant
2004-11-17
39.5 1.36 1,1- difluoroethane HFA 152a – Not used for pharmaceutical inhalers , is used for personal products Boiling point (-13o F) 63 (psig... 1 BIOSIMTM BG NON-BIOLOGICAL AEROSOL SIMULANT David S. Alburty, Kelly L. Brown, Jennifer L. Dannehl and Andrew E. Page Midwest...BioSafey Level 1 regulations. All of these materials of biological origin pose challenging logistics problems including safety issues, cost
7. Credit BG. View looking west into small solid rocket ...
7. Credit BG. View looking west into small solid rocket motor testing bay of Test Stand 'E' (Building 4259/E-60). Motors are mounted on steel table and fired horizontally toward the east. - Jet Propulsion Laboratory Edwards Facility, Test Stand E, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. Interior view of the building displays temporary wooden ...
Credit BG. Interior view of the building displays temporary wooden building construction, pump, and water piping arrangements. The well is currently used as an observation post for changes in ground water levels - Edwards Air Force Base, North Base, Well No. 2, East of Second Street, Boron, Kern County, CA
USDA-ARS?s Scientific Manuscript database
Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity ...
Characterization of calcium deposition induced by Synechocystis sp. PCC6803 in BG11 culture medium
NASA Astrophysics Data System (ADS)
Yan, Huaxiao; Han, Zuozhen; Zhao, Hui; Zhou, Shixue; Chi, Naijie; Han, Mei; Kou, Xiaoyan; Zhang, Yan; Xu, Linlin; Tian, Chenchen; Qin, Song
2014-05-01
Calcium carbonate (CaCO3) crystals in their preferred orientation were obtained in BG11 culture media inoculated with Synechocystis sp. PCC6803 (inoculated BG11). In this study, the features of calcium carbonate deposition were investigated. Inoculated BG11 in different calcium ion concentrations was used for the experimental group, while the BG11 culture medium was used for the control group. The surface morphologies of the calcium carbonate deposits in the experimental and control groups were determined by scanning and transmission electron microscopy. The deposits were analyzed by electronic probe micro-analysis, Fourier transform infrared spectrum, X-ray diffraction, thermal gravimetric analysis and differential scanning calorimetry. The results show that the surfaces of the crystals in the experimental group were hexahedral in a scaly pattern. The particle sizes were micrometer-sized and larger than those in the control group. The deposits of the control group contained calcium (Ca), carbon (C), oxygen (O), phosphorus (P), iron (Fe), copper (Cu), zinc (Zn), and other elements. The deposits in the experimental group contained Ca, C, and O only. The deposits of both groups contained calcite. The thermal decomposition temperature of the deposits in the control group was lower than those in the experimental group. It showed that the CaCO3 deposits of the experimental group had higher thermal stability than those of the control group. This may be due to the secondary metabolites produced by the algae cells, which affect the carbonate crystal structure and result in a close-packed structure. The algae cells that remained after thermal weight loss were heavier in higher calcium concentrations in BG11 culture media. There may be more calcium-containing crystals inside and outside of these cells. These results shall be beneficial for understanding the formation mechanism of carbonate minerals.
Credit BG. View looks southwest (236°) at the warehouse's southeast ...
Credit BG. View looks southwest (236°) at the warehouse's southeast and northeast facades. This building retains its original World War II era materials and appearance - Edwards Air Force Base, North Base, Warehouse, Second & C Streets, Boron, Kern County, CA
3. Credit BG. Interior view looks northeast (46°) at fire ...
3. Credit BG. Interior view looks northeast (46°) at fire pumps, valves, and emergency generator (powered by an internal combustion engine). - Edwards Air Force Base, North Base, Deluge Water Pumping Station, Near Second & D Streets, Boron, Kern County, CA
Credit BG. View looks north northwest (325°) towards Administration Building ...
Credit BG. View looks north northwest (325°) towards Administration Building across aircraft apron east of Building 4505. Building 4507 (Storage Building) appears at extreme right of view - Edwards Air Force Base, North Base, Administration Building, Northeast of A Street, Boron, Kern County, CA
Credit BG. Northeast and northwest facades of Building 4496 (Security ...
Credit BG. Northeast and northwest facades of Building 4496 (Security Facility) as seen when looking south (178°) from entrance to secured area. The Control Tower (Building 4500) appears in background. The Security Facility is part of the secured Building 4505 complex - Edwards Air Force Base, North Base, Security Facility, Northeast of A Street, Boron, Kern County, CA
USDA-ARS?s Scientific Manuscript database
The rhizosphere isolated bacteria belonging to the Bacillus amyloliquefaciens subsp. plantarum and Bacillus methylotrophicus clades are an important group of strains that are used as plant growth promoters and antagonists of plant pathogens. These properties have made these strains the focus of comm...
Credit BG. View looking northeast (42°) at storage building used ...
Credit BG. View looking northeast (42°) at storage building used to store equipment near southeast edge of aircraft apron in the vicinity of Building 4305 (Unicon Portable Hangar) - Edwards Air Force Base, North Base, Equipment Storage Building, East of Second Street, Boron, Kern County, CA
Photographic copy of photograph, B.G. James, photographer, 9 September 1935 ...
Photographic copy of photograph, B.G. James, photographer, 9 September 1935 (original print located at National Archives and Records Center, Denver, Colorado). "DEBRIS IN SPILLWAY BASIN PILED BY HAND BY CCC WORKERS" - Kachess Dam, Kachess River, 1.5 miles north of Interstate 90, Easton, Kittitas County, WA
BG1 has a major role in MHC-linked resistance to malignant lymphoma in the chicken.
Goto, Ronald M; Wang, Yujun; Taylor, Robert L; Wakenell, Patricia S; Hosomichi, Kazuyoshi; Shiina, Takashi; Blackmore, Craig S; Briles, W Elwood; Miller, Marcia M
2009-09-29
Pathogen selection is postulated to drive MHC allelic diversity at loci for antigen presentation. However, readily apparent MHC infectious disease associations are rare in most species. The strong link between MHC-B haplotype and the occurrence of virally induced tumors in the chicken provides a means for defining the relationship between pathogen selection and MHC polymorphism. Here, we verified a significant difference in resistance to gallid herpesvirus-2 (GaHV-2)-induced lymphomas (Marek's disease) conferred by two closely-related recombinant MHC-B haplotypes. We mapped the crossover breakpoints that distinguish these haplotypes to the highly polymorphic BG1 locus. BG1 encodes an Ig-superfamily type I transmembrane receptor-like protein that contains an immunoreceptor tyrosine-based inhibition motif (ITIM), which undergoes phosphorylation and is recognized by Src homology 2 domain-containing protein tyrosine phosphatase (SHP-2). The recombinant haplotypes are identical, except for differences within the BG1 3'-untranslated region (3'-UTR). The 3'-UTR of the BG1 allele associated with increased lymphoma contains a 225-bp insert of retroviral origin and showed greater inhibition of luciferase reporter gene translation compared to the other allele. These findings suggest that BG1 could affect the outcome of GaHV-2 infection through modulation of the lymphoid cell responsiveness to infection, a condition that is critical for GaHV-2 replication and in which the MHC-B haplotype has been previously implicated. This work provides a mechanism by which MHC-B region genetics contributes to the incidence of GaHV-2-induced malignant lymphoma in the chicken and invites consideration of the possibility that similar mechanisms might affect the incidence of lymphomas associated with other oncogenic viral infections.
Okkerse, Pieter; Hay, Justin L; Versage, Eve; Tang, Yongqiang; Galluppi, Gerald; Ravina, Bernard; Verma, Ajay; Williams, Leslie; Aycardi, Ernesto; Groeneveld, Geert Jan
2016-07-01
BG00010 is a protein in the glial cell line-derived neurotrophic factor (GDNF) family. It is a selective ligand for the GDNF family receptor alpha-3 (GFRα3) co-receptor that normalizes cellular changes resulting from damage or disease, and potentially alleviates neuropathic pain. The main objectives of this study were to evaluate the pharmacokinetic and safety profiles and to determine the effects on pain of ascending doses of intravenous injections of BG00010 in patients with sciatica. This was a randomized, blinded, placebo-controlled multiple-dose study in subjects with sciatica. In Part I (16 patients), four IV dose levels were examined (50, 150, 400, 800 μg kg(-1) ) and in Part II (12 patients), three dose levels were examined (400, 600 and 1200 μg kg(-1) ). Safety and efficacy assessments were used as endpoints. The BG00010 concentration-time data indicated relatively low inter-patient variability and there was a dose-dependent (not dose-proportional) increase in serum exposure from 150 to 1200 μg kg(-1) . The effective half-life was between 40 and 60 h. The most frequently occurring adverse events (AEs) reported by patients receiving BG00010 were headache (67-83%), feeling hot (50-100%), and pruritus (42-67%). Most AEs were mild; no serious AEs or AEs leading to discontinuation occurred. Higher dose regimens of BG00010 resulted in greater pain reduction than placebo or lower dose regimens, although a clear dose-response relationship was not seen. The pharmacokinetic profile of BG00010 was characterized by low intra-patient variability. These data from a small sample suggest that BG00010 may have a benefit for patients with sciatica. © 2016 The British Pharmacological Society.
WRF Test on IBM BG/L:Toward High Performance Application to Regional Climate Research
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chin, H S
The effects of climate change will mostly be felt on local to regional scales (Solomon et al., 2007). To develop better forecast skill in regional climate change, an integrated multi-scale modeling capability (i.e., a pair of global and regional climate models) becomes crucially important in understanding and preparing for the impacts of climate change on the temporal and spatial scales that are critical to California's and nation's future environmental quality and economical prosperity. Accurate knowledge of detailed local impact on the water management system from climate change requires a resolution of 1km or so. To this end, a high performancemore » computing platform at the petascale appears to be an essential tool in providing such local scale information to formulate high quality adaptation strategies for local and regional climate change. As a key component of this modeling system at LLNL, the Weather Research and Forecast (WRF) model is implemented and tested on the IBM BG/L machine. The objective of this study is to examine the scaling feature of WRF on BG/L for the optimal performance, and to assess the numerical accuracy of WRF solution on BG/L.« less
5. Credit BG. View looking northeast at southwest facade of ...
5. Credit BG. View looking northeast at southwest facade of Building 4505 as seen from top of Building 4500 (Control Tower). A warehouse wing adjoins southeast side of hangar at right. In far right background is Building 4511, Jet Fuel Depot for grade JP-5 fuel. - Edwards Air Force Base, North Base, Hangar, End of North Base Road, Boron, Kern County, CA
Credit BG. View looking west down into Test Stand "D" ...
Credit BG. View looking west down into Test Stand "D" vertical vacuum cell with top removed. Access to cell is normally through large round port seen in view. Piping and cradling toward bottom of cell was last used in tests of Viking space probe engines - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. Northwest facade of Building 4504 (Deluge Water Booster ...
Credit BG. Northwest facade of Building 4504 (Deluge Water Booster Station) is in view at left, with 500,000 gallon water tank (Building 4503) at right. Fenced electrical substation in view between the above structures is Building 4510. Building 4505 is in background - Edwards Air Force Base, North Base, Deluge Water Booster Station, Northeast of A Street, Boron, Kern County, CA
Credit BG. View looking north northeast at Guard House and ...
Credit BG. View looking north northeast at Guard House and entrance to Building 4505 complex. This Guard House was built in 1993 as a portable unit; it replaced an older structure. The Building 4505 complex is surrounded by a security fence. Building 4496 appears to immediate right of view - Edwards Air Force Base, North Base, Guard House, Northeast of A Street, Boron, Kern County, CA
12. Credit BG. Typical view down one of the underground ...
12. Credit BG. Typical view down one of the underground tunnels connecting the Control and Recording Center with all the JPL Edwards Facility test stands. In addition to personnel traffic, the tunnel system carried electrical power cables, instrumentation and control circuits, and high pressure helium and nitrogen lines. - Jet Propulsion Laboratory Edwards Facility, Control & Recording Center, Edwards Air Force Base, Boron, Kern County, CA
NASA Astrophysics Data System (ADS)
Ansari, Meenhaz; Ashraf, S. S. Z.
2017-10-01
We investigate the energy dependent electron-phonon relaxation rate, energy loss rate, and phonon drag thermopower in single layer graphene (SLG) and bilayer graphene (BLG) under the Bloch-Gruneisen (BG) regime through coupling to acoustic phonons interacting via the Deformation potential in the Boltzmann transport equation approach. We find that the consideration of the chiral nature of electrons alters the temperature dependencies in two-dimensional structures of SLG and BLG from that shown by other conventional 2DEG system. Our investigations indicate that the BG analytical results are valid for temperatures far below the BG limit (˜TBG/4) which is in conformity with a recent experimental investigation for SLG [C. B. McKitterick et al., Phys. Rev. B 93, 075410 (2016)]. For temperatures above this renewed limit (˜TBG/4), there is observed a suppression in energy loss rate and thermo power in SLG, but enhancement is observed in relaxation rate and thermopower in BLG, while a suppression in the energy loss rate is observed in BLG. This strong nonmonotonic temperature dependence in SLG has also been experimentally observed within the BG limit [Q. Ma et al., Phys. Rev. Lett. 112, 247401 (2014)].
Sajid, Imran; Shaaban, Khaled A; Hasnain, Shahida
2013-01-01
A newly isolated strain Streptomyces sp. BG5 was investigated for the production of bioactive compounds. The strain exhibited broad-spectrum activity against an array of nine test organisms including gram-positive bacteria, gram-negative bacteria, and fungal and microalgal pathogens, along with a moderate cytotoxic response (28.9% mortality) in a microwell cytotoxicity assay against the brine shrimp Artimia salina. The morphological, physiological, and biochemical characterization of the Streptomyces sp. BG5 strongly suggested it to be a member of the genus Streptomyces. The nucleotide sequence of 16S rRNA gene (1433 pb) of the Streptomyces sp. BG5 (Gene bank accession number EU301836) exhibited high similarity (98%) with Streptomyces matensis. The large-scale fermentation of Streptomyces sp. BG5 and subsequent extraction, isolation, and purification of the crude extract afforded three pure compounds. The structures of these compounds were identified as ochromycinone (1a), emycin D (2), and 1-acetyl-β-carbolin (3), based on nuclear magnetic resonance (NMR) spectroscopy, mass spectrometry, and by comparison with reference data from the literature.
NASA Astrophysics Data System (ADS)
Salleh, Noor Shafryna; Murad, Abdul Munir Abdul
2016-11-01
In this work, the ability of commercial Trichoderma reesei cellulases preparation, Celluclast® or in combination with Accellerase®BG β-glucosidase to hydrolyse pretreated oil palm empty fruit bunch (OPEFB) was evaluated. Celluclast® alone hydrolyzed OPEFB to produce 2.41±0.44 mg glucose per gram OPEFB. However, the production of glucose was significantly improved with supplementation of Accellerase®BG (8.12±0.93 mg/g). This result suggested that the endoglucanases and exoglucanases in Celluclast® and β-glucosidase in Accellerase®BG able to work synergistically to increase the production of glucose from OPEFB. In addition, the production of xylose was also improved by 30% when the enzyme mixture was used. The result suggested that the mixture of Celluclast® with Accellerase®BG work synergistically to improve the production of sugars by removing the inhibition by cellobiose for complete cellulose hydrolysis. The production of glucose and xylose from OPEFB wastes showed the potential of this biomass as the source of renewable energy and fine chemicals production in Malaysia.
Credit BG. View looks south southwest (202°) across remains of ...
Credit BG. View looks south southwest (202°) across remains of concrete pad foundation for the mess hall. North Base Road (3rd Street) passes nearby. Building 4318 is in the distance at the extreme left of view - Edwards Air Force Base, North Base, Base Mess Hall T-27, Third Street, Boron, Kern County, CA
Reed, Walter; Carroll, James
1900-01-01
1. Bacillus X (Sternberg) belongs to the colon group. 2. Bacillus icteroides (Sanarelli) is a member of the hog-cholera group. 3. The various channels of infection, the duration of the disease and the gross and microscopical lesions in mice, guinea-pigs and rabbits are the same for Bacillus icteroides and the hog-cholera bacillus. 4. The clinical symptoms and the lesions observed in dogs inoculated intravenously with Bacillus icteroides, are reproduced in these animals by infection with the hog-cholera bacillus. 5. Bacillus icteroides when fed to the domestic pig causes fatal infection, accompanied by diphtheritic, necrotic and ulcerative lesions in the digestive tract, such as are seen in hogs when infected with the hog-cholera bacillus. 6. This disease may be acquired by exposing swine in pens already infected with Bacillus icteroides, or by feeding them with the viscera of infected pigs. 7. Guinea-pigs may be immunized with sterilized cultures ofBacillus icteroides from a fatal dose of the hog-cholera bacillus and vice versa. 8. Rabbits may be rendered immune by gradually increasing doses of a living culture of Bacillus icteroides of weak virulence from a fatal dose of a virulent culture of the hog-cholera bacillus 9. The sera of animals immunized with Bacillus icteroides and with the hog-cholera bacillus, respectively, show a marked reciprocal agglutinative reaction. 10. While the blood of yellow fever practically does not exercise an agglutinative reaction upon Bacillus icteroides, the blood of hog-cholera agglutinates this bacillus in a much more marked degree, thus pointing, we think, to the closer etiological relationship of this bacillus to hog-cholera than to yellow fever. PMID:19866945
Li, Yiji; Su, Xinghua; Zhou, Guofa; Zhang, Hong; Puthiyakunnon, Santhosh; Shuai, Shufen; Cai, Songwu; Gu, Jinbao; Zhou, Xiaohong; Yan, Guiyun; Chen, Xiao-Guang
2016-08-12
The surveillance of vector mosquitoes is important for the control of mosquito-borne diseases. To identify a suitable surveillance tool for the adult dengue vector Aedes albopictus, the efficacy of the BG-Sentinel trap, CDC light trap and Mosquito-oviposition trap (MOT) on the capture of vector mosquitoes were comparatively evaluated in this study. The capture efficiencies of the BG-Sentinel trap, CDC light trap and Mosquito-oviposition trap for common vector mosquitoes were tested in a laboratory setting, through the release-recapture method, and at two field sites of Guangzhou, China from June 2013 to May 2014. The captured mosquitoes were counted, species identified and compared among the three traps on the basis of species. In the release-recapture experiments in a laboratory setting, the BG-Sentinel trap caught significantly more Aedes albopictus and Culex quinquefasciatus than the CDC light trap and Mosquito-ovitrap, except for Anopheles sinensis. The BG-Sentinel trap had a higher efficacy in capturing female rather than male Ae. albopictus and Cx. quinquefasciatus, but the capture in CDC light traps displayed no significant differences. In the field trial, BG-Sentinel traps collected more Aedes albopictus than CDC light traps and MOTs collected in both urban and suburban areas. The BG-Sentinel trap was more sensitive for monitoring the population density of Aedes albopictus than the CDC light trap and MOT during the peak months of the year 2013. However, on an average, CDC light traps captured significantly more Cx. quinquefasciatus than BG-Sentinel traps. The population dynamics of Cx. quinquefasciatus displayed a significant seasonal variation, with the lowest numbers in the middle of the year. This study indicates that the BG-Sentinel trap is more effective than the commonly used CDC light trap and MOT in sampling adult Aedes albopictus and Culex quinquefasciatus. We recommend its use in the surveillance of dengue vector mosquitoes in China.
Mantarova, Stefka G; Velcheva, Irena V; Georgieva, Spaska O; Stambolieva, Katerina I
2013-01-01
The last twenty years have witnessed a surge of interest in the autonomic symptoms in Parkinson's disease (PD) and the possibilities to diagnose and treat them. The specialized questionnaire assessing the autonomic symptoms in Parkinson's disease (SCOPA-AUT) has been validated and available in English, Dutch and Spanish. In this study we aim at evaluating the validity, reliability and applicability of the Bulgarian version of SCOPA-AUT (SCOPA-AUT-BG). The study included 55 patients with idiopathic PD (mean age 64.4 +/- 8.9 yrs), and 40 healthy controls (mean age 58.5 +/- 9.4 yrs). Clinical severity and disease stage were assessed by United Parkinson's disease rating scale (UPRDS) and Hoen and Yahr (H&Y). Thirty-two of the PD patients completed SCOPA-AUT-BG again after a 7-day interval. Questionnaire reliability was analyzed by determining the internal consistency, homogeneity, discriminatory and construct validity and test-retest reliability. Analyses showed good internal consistency of the summary evaluation of SCOPA-AUT-BG (coefficient alpha of Cronbach = 0.79), which indicates the high reliability of the questionnaire. The lowest Cronbach's alpha coefficient (0.53) was found for the subscale "cardiovascular functions". A dominant role belongs to the subscales for gastrointestinal and urinary functions (Cronbach's Alpha > 0.7), where a significantly high correlation of PD with the UPDRS scale was observed. We found high test-retest reliability based on the responses associated with dysfunction of the gastrointestinal, urinary, thermoregulatory and pupillary autonomic systems. The correlation of the results of SCOPA-AUT-BG with UPDRS is higher than that with H&Y, and the construct validity is high except for the cardiovascular and pupillomotor functions subscales. The results of this study show that SCOPA-AUT-BG is a valid and reliable specialized questionnaire to evaluate autonomic function in patients with Parkinson's disease. Using it allows for more detailed
Kappos, Ludwig; Gold, Ralf; Arnold, Douglas L; Bar-Or, Amit; Giovannoni, Gavin; Selmaj, Krzysztof; Sarda, Sujata P; Agarwal, Sonalee; Zhang, Annie; Sheikh, Sarah I; Seidman, Emily; Dawson, Katherine T
2014-02-01
Oral BG-12 (dimethyl fumarate), approved for the treatment of the relapsing forms of MS, has demonstrated clinical efficacy with an acceptable safety profile in the Phase III "Determination of the Efficacy and Safety of Oral Fumarate in Relapsing-Remitting Multiple Sclerosis (RRMS)" (DEFINE) and "Comparator and an Oral Fumarate in RRMS" (CONFIRM) studies. To evaluate the health-related quality of life (HRQoL) impairment that is associated with RRMS and to assess the effects of BG-12 on HRQoL in the DEFINE study. Patients with RRMS were randomized to BG-12 240 mg twice (BID) or three times (TID) daily, or placebo, for 2 years. HRQoL was assessed by the Short Form-36 (SF-36), global assessment of well-being visual analog scale and the EuroQol-5D. In the 1237 patients from DEFINE, HRQoL impairment was greatest in patients who had higher disability scores and in those who had experienced relapse. Change in SF-36 physical component summary scores during 2 years' treatment significantly favored BG-12 over placebo (both doses: p < 0.001). We saw similar benefits in other measures of functioning and general well-being as early as Week 24. These benefits were maintained during the study. Our results add to evidence for a negative impact of RRMS on HRQoL and they demonstrate the benefits of BG-12 on HRQoL measures, which coupled with significant clinical efficacy, further support its use as a new treatment for RRMS.
Credit BG. View looks southwest (236°) across concrete foundations towards ...
Credit BG. View looks southwest (236°) across concrete foundations towards Building 4402 (Hangar No. 2). Building 4412 (Liquid Oxygen Repair Facility) and Building 4444 (Communications Building) appear in center background. Trees in view are locusts (Robinia pseudoacacia L.) - Edwards Air Force Base, North Base, Old Firehouse T-41, South end of A Street, Boron, Kern County, CA
Credit BG. View looks west (286°) at the east facade. ...
Credit BG. View looks west (286°) at the east facade. This structure stands between two blast barricades, which protect surrounding structures from damage in case an explosion were to occur while propellants were being mixed in the 150 gallon Baker-Perkins mixer - Jet Propulsion Laboratory Edwards Facility, Mixer, Edwards Air Force Base, Boron, Kern County, CA
2. Credit BG. View looks west southwest (245°) at Building ...
2. Credit BG. View looks west southwest (245°) at Building 4317, Deluge Water Pumping Station. The machinery in this structure draws water from an inground reservoir, Building 4316, whose round roof is visible at left rear of this view. - Edwards Air Force Base, North Base, Deluge Water Pumping Station, Near Second & D Streets, Boron, Kern County, CA
6. Credit BG. Detail view looking north at Building 4306 ...
6. Credit BG. Detail view looking north at Building 4306 (Boiler House) located at southwest corner of Building 4305 (Unicon Portable Hangar). Building retains its original World War II wooden construction and finish. Number sign for Building 4302 belongs to nearby sump pump structure (See HAER photo number CA-170-RR-1) - Edwards Air Force Base, North Base, Unicon Portable Hangar, First & C Streets, Boron, Kern County, CA
2. Credit BG. View down dust ditch at northeast side ...
2. Credit BG. View down dust ditch at northeast side of A Street, looking north northwest in "the loop". Note culverts used to give vehicular and pedestrian access to buildings northeast of A Street, some foundations of which may be seen at right of view. Structures in background belong to Jet Propulsion Laboratory Edwards Facility. - Edwards Air Force Base, North Base, Dust Ditch System, Traversing North Base, Boron, Kern County, CA
Credit BG. West elevation of Test Stand "D" tower, with ...
Credit BG. West elevation of Test Stand "D" tower, with workshop on left, and tunnel entrance at right. Tower is accessed by exterior steel stairway; the vertical vacuum cell (Dv Cell) is obscured behind large square sunscreen. Below the sunscreen can be seen the end of the horizontal vacuum duct leading from the vacuum cell - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
Enhanced Raman scattering of biological molecules
NASA Astrophysics Data System (ADS)
Montoya, Joseph R.
The results presented in this thesis, originate from the aspiration to develop an identification algorithm for Salmonella enterica Serovar Enteritidis (S. enterica), Escherichia coli (E. coli), Bacillus globigii ( B. globigii), and Bacillus megaterium ( B. megaterium) using "enhanced" Raman scattering. We realized our goal, with a method utilizing an immunoassay process in a spectroscopic technique, and the direct use of the enhanced spectral response due to bacterial surface elements. The enhanced Raman signal originates from Surface Enhanced Raman Scattering (SERS) and/or Morphological Dependent Resonances (MDR's). We utilized a modified Lee-Meisel colloidal production method to produce a SERS active substrate, which was applied to a SERS application for the amino acid Glycine. The comparison indicates that the SERS/FRACTAL/MDR process can produce an increase of 107 times more signal than the bulk Raman signal from Glycine. In the extension of the Glycine results, we studied the use of SERS related to S. enterica, where we have shown that the aromatic amino acid contribution from Phenylalanine, Tyrosine, and Tryptophan produces a SERS response that can be used to identify the associated SERS vibrational modes of a S. enterica one or two antibody complexes. The "fingerprint" associated with the spectral signature in conjunction with an enhanced Raman signal allows conclusions to be made: (1) about the orientation of the secondary structure on the metal; (2) whether bound/unbound antibody can be neglected; (3) whether we can lower the detection limit. We have lowered the detection limit of S. enterica to 106 bacteria/ml. We also show a profound difference between S. enterica and E. coli SERS spectra even when there exists non-specific binding on E. coli indicating a protein conformation change induced by the addition of the antigen S. enterica. We confirm TEM imagery data, indicating that the source of the aromatic amino acid SERS response is originating from
Detection of biological warfare agents using ultra violet-laser induced fluorescence LIDAR
NASA Astrophysics Data System (ADS)
Joshi, Deepti; Kumar, Deepak; Maini, Anil K.; Sharma, Ramesh C.
This review has been written to highlight the threat of biological warfare agents, their types and detection. Bacterial biological agent Bacillus anthracis (bacteria causing the disease anthrax) which is most likely to be employed in biological warfare is being discussed in detail. Standoff detection of biological warfare agents in aerosol form using Ultra violet-Laser Induced Fluorescence (UV-LIF) spectroscopy method has been studied. Range-resolved detection and identification of biological aerosols by both nano-second and non-linear femto-second LIDAR is also discussed. Calculated received fluorescence signal for a cloud of typical biological agent Bacillus globigii (Simulants of B. anthracis) at a location of ˜5.0 km at different concentrations in presence of solar background radiation has been described. Overview of current research efforts in internationally available working UV-LIF LIDAR systems are also mentioned briefly.
Credit BG. View looks south southeast (162°) across foundation of ...
Credit BG. View looks south southeast (162°) across foundation of Building 4332 Warehouse "B" (formerly T-81). Top of foundation for Building 4332 Warehouse "A" is visible at extreme left of view. In remote distance are buildings at Main Base, Edwards Air Force Base - Edwards Air Force Base, North Base, Warehouse B, Second Street at E Street, Boron, Kern County, CA
Programming for 1.6 Millon cores: Early experiences with IBM's BG/Q SMP architecture
NASA Astrophysics Data System (ADS)
Glosli, James
2013-03-01
With the stall in clock cycle improvements a decade ago, the drive for computational performance has continues along a path of increasing core counts on a processor. The multi-core evolution has been expressed in both a symmetric multi processor (SMP) architecture and cpu/GPU architecture. Debates rage in the high performance computing (HPC) community which architecture best serves HPC. In this talk I will not attempt to resolve that debate but perhaps fuel it. I will discuss the experience of exploiting Sequoia, a 98304 node IBM Blue Gene/Q SMP at Lawrence Livermore National Laboratory. The advantages and challenges of leveraging the computational power BG/Q will be detailed through the discussion of two applications. The first application is a Molecular Dynamics code called ddcMD. This is a code developed over the last decade at LLNL and ported to BG/Q. The second application is a cardiac modeling code called Cardioid. This is a code that was recently designed and developed at LLNL to exploit the fine scale parallelism of BG/Q's SMP architecture. Through the lenses of these efforts I'll illustrate the need to rethink how we express and implement our computational approaches. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Updated BG Prasad socioeconomic classification, 2014: a commentary.
Mangal, Abha; Kumar, Varun; Panesar, Sanjeet; Talwar, Richa; Raut, Deepak; Singh, Saudan
2015-01-01
Modified BG Prasad socioeconomic scale is widely used to determine the socioeconomic status of study subjects in health studies in India. It is an income-based scale and, therefore, has to be constantly updated to take inflation and depreciation of rupee into account. The Consumer Price Index (CPI) for industrial workers (IW) is used to calculate updated income categories for January 2014. Details of the calculations involved will enable young researchers to calculate specific income categories for their research work. State-specific CPI values are also available on the Department of Labour website and should be used to determine more accurate income categories for the study area.
Ferrenberg Swendsen Analysis of LLNL and NYBlue BG/L p4rhms Data
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soltz, R
2007-12-05
These results are from the continuing Lattice Quantum Chromodynamics runs on BG/L. These results are from the Ferrenberg-Swendsen analysis [?] of the combined data from LLNL and NYBlue BG/L runs for 32{sup 3} x 8 runs with the p4rhmc v2.0 QMP-MPI.X (semi-optimized p4 code using qmp over mpi). The jobs include beta values ranging from 3.525 to 3.535 with an alternate analysis extending to 3.540. The NYBlue data sets are from 9k trajectories from Oct 2007, and the LLNL data are from two independent streams of {approx}5k each, taking from the July 2007 runs. The following outputs are produced bymore » the fs-2+1-chiub.c program. All outputs have had checksums produced by addCks.pl and checked by the checkCks.pl perl script after scanning.« less
Credit BG. View shows the north and west facades of ...
Credit BG. View shows the north and west facades of the building as seen when looking east southeast (124°). Igniters for solid rocket motors were built and tested here. This building was rated for a maximum of 20 pounds (9.1 Kg) of class 1.1 materials and four personnel. Note the lightning rods on roof corners and the exterior electrical system - Jet Propulsion Laboratory Edwards Facility, Igniter Laboratory, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. View looking southwest at Test Stand "D" complex. ...
Credit BG. View looking southwest at Test Stand "D" complex. In the background at left is the Steam Generator Plant 4280/E-81 built in 1972 to house four gas-fired Clayton flash boilers. The boilers were later supplemented by the electrically heated steam accumulator (sphere) to supply steam to the various ejectors at Test Stand "D" vacuum test cells - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. View looks south southeast toward tank farm, Rogers ...
Credit BG. View looks south southeast toward tank farm, Rogers Dry Lake is in the background. Each cylindrical tank is labeled for jet fuel grade JP5. Two 2,000 gallon capacity rectangular tanks in midground are fabricated of concrete for storing hydrocarbons; they were constructed in 1993. Structure at extreme right of view is Building 4515, Jet Fuel Testing Laboratory - Edwards Air Force Base, North Base, Aircraft Fuel Tank Farm, Northeast of A Street, Boron, Kern County, CA
Li, Xiuxia; Li, Ran; Zhu, Bin; Gao, Xiwu; Liang, Pei
2018-06-01
The diamondback moth Plutella xylostella (L.) is the most widely distributed pest of cruciferous crops and has developed resistance to most commonly used insecticides, including chlorantraniliprole. Resistance to chlorantraniliprole is likely caused by mutations of the target, the ryanodine receptor, and/or mediated by an increase in detoxification enzyme activities. Although target-site resistance is documented in detail, resistance mediated by increased metabolism has rarely been reported. The activity of cytochrome P450 was significantly higher in two resistant P. xylostella populations than in a susceptible one. Among ten detected cytochrome P450 genes, CYP6BG1 was significantly overexpressed (over 80-fold) in a field-resistant population compared with expression in a susceptible one. Knockdown of CYP6BG1 by RNA interference dramatically reduced the 7-ethoxycoumarin-O-deethylase (7-ECOD) activity of P450 by 45.5% and increased the toxicity of chlorantraniliprole toward P. xylostella by 26.8% at 48 h postinjection of double-stranded RNA. By contrast, overexpression of CYP6BG1 in a transgenic Drosophila melanogaster line significantly decreased the toxicity of the insecticide to the transgenic flies. Overexpression of CYP6BG1 may contribute to chlorantraniliprole resistance in P. xylostella. Our findings will provide new insights into the mechanisms of resistance to diamide insecticides in other insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Heyrman, Jeroen; Logan, Niall A; Rodríguez-Díaz, Marina; Scheldeman, Patsy; Lebbe, Liesbeth; Swings, Jean; Heyndrickx, Marc; De Vos, Paul
2005-01-01
A group of 24 strains was isolated from deteriorated mural paintings situated in Spain (necropolis of Carmona) and Germany (church of Greene-Kreiensen). (GTG)5-PCR genomic fingerprinting was performed on these strains to assess their genomic variability and the strains were delineated into four groups. Representatives were studied by 16S rRNA gene sequencing and were found to be closely related to Bacillus simplex and the species 'Bacillus macroides' (strain NCIMB 8796) and 'Bacillus maroccanus' (names not validly published) according to a fasta search. The close similarity between B. simplex, 'B. macroides' NCIMB 8796, 'B. maroccanus' and the mural painting isolates was confirmed by additional (GTG)5-PCR, ARDRA, FAME and SDS-PAGE analyses. Furthermore, these techniques revealed that strains of 'Bacillus carotarum', another name that has not been validly published, also showed high similarity to this group of organisms. On the other hand, it was shown that the strains labelled 'B. macroides' in different collections do not all belong to the same species. Strain NCIMB 8796 can be allocated to B. simplex, while strain DSM 54 (=ATCC 12905) shares the highest 16S rRNA gene sequence similarity with Bacillus sphaericus and Bacillus fusiformis (both around 98.6 %). On the basis of further DNA-DNA hybridization data and the study of phenotypic characteristics, one group of five mural painting strains was attributed to a novel species in the genus Bacillus, for which the name Bacillus muralis sp. nov. is proposed. Finally, the remaining mural painting strains, one (LMG 18508=NCIMB 8796) of two strains belonging to 'B. macroides' and strains belonging to 'B. maroccanus' and 'B. carotarum' are allocated to the species B. simplex and an emended description of B. simplex is given.
Credit BG. The north and west sides of this structure ...
Credit BG. The north and west sides of this structure appear as seen when looking east (88°). Building E-67, the tunnel entrance, gives personnel access to the tunnel system. The Assembly Building served as a shop for test crews; it contained a small lathe and other tools for making specialized parts. No explosives were allowed in this structure. Air conditioning ducts are on the roof - Jet Propulsion Laboratory Edwards Facility, Assembly Building, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. View looks southeast at west and south facades ...
Credit BG. View looks southeast at west and south facades of Building 4311. This is one of the World War II structures built in the second phase of North Base construction; it accompanied the Unicon Portable Hangar, situated behind the well house in this view. Function of metal rod with ball on end near ground in lower right corner of view not determined - Edwards Air Force Base, North Base, Well No. 2, East of Second Street, Boron, Kern County, CA
Photographic copy of photograph, B.G. James, photographer, 15 October 1935 ...
Photographic copy of photograph, B.G. James, photographer, 15 October 1935 (original print located at National Archives and Records Center, Denver, Colorado). "PERSONNEL IN CONNECTION WITH WORK. LEFT TO RIGHT - PAUL TAYLOR (BUREAU), CAPTAIN ORDWAY (ARMY), LIEUT. MCCALL (ARMY), LIEUT. LAWSON (ARMY), CAMP SUPT H.E. HOLMAN, MECHANIC WM. PROCTOR WHO SUPERVISED CCC WORKERS" - Kachess Dam, Kachess River, 1.5 miles north of Interstate 90, Easton, Kittitas County, WA
Detection of biological warfare agents using ultra violet-laser induced fluorescence LIDAR.
Joshi, Deepti; Kumar, Deepak; Maini, Anil K; Sharma, Ramesh C
2013-08-01
This review has been written to highlight the threat of biological warfare agents, their types and detection. Bacterial biological agent Bacillus anthracis (bacteria causing the disease anthrax) which is most likely to be employed in biological warfare is being discussed in detail. Standoff detection of biological warfare agents in aerosol form using Ultra violet-Laser Induced Fluorescence (UV-LIF) spectroscopy method has been studied. Range-resolved detection and identification of biological aerosols by both nano-second and non-linear femto-second LIDAR is also discussed. Calculated received fluorescence signal for a cloud of typical biological agent Bacillus globigii (Simulants of B. anthracis) at a location of ~5.0 km at different concentrations in presence of solar background radiation has been described. Overview of current research efforts in internationally available working UV-LIF LIDAR systems are also mentioned briefly. Copyright © 2013 Elsevier B.V. All rights reserved.
Credit BG. Interior view of Building 4316, showing internal construction ...
Credit BG. Interior view of Building 4316, showing internal construction of water reservoir, roof, and monitor. View looks southeast (142°). The pipe which hangs from the roof structure and turns downward under the monitor supplies water to the reservoir; the plate suspended on chains beneath the pipe end deflects water stream so it does not erode the bottom of the reservoir. The intake pipe for the pumps is not visible in this view - Edwards Air Force Base, North Base, Deluge Water Storage Building, Near Second & D Streets, Boron, Kern County, CA
Credit BG. View looks south (174°) at Deluge Water Supply ...
Credit BG. View looks south (174°) at Deluge Water Supply complex, including Water Pumping Booster Station (Building 4317) in foreground, with Deluge Water Storage (Building 4316) in background at right. Pole on roof of Building 4316 is a gauge board used to indicate water level in the reservoir. Structure in left background is Building 4311 (Well No. 2) - Edwards Air Force Base, North Base, Deluge Water Storage Building, Near Second & D Streets, Boron, Kern County, CA
Rolan, Paul E; O'Neill, Gilmore; Versage, Eve; Rana, Jitesh; Tang, Yongqiang; Galluppi, Gerald; Aycardi, Ernesto
2015-01-01
To evaluate the safety, tolerability, and pharmacokinetics of single doses of BG00010 (neublastin, artemin, enovin) in subjects with unilateral sciatica. This was a single-center, blinded, placebo-controlled, randomized Phase 1 sequential-cohort, dose-escalation study (ClinicalTrials.gov identifier NCT00961766; funded by Biogen Idec). Adults with unilateral sciatica were enrolled at The Royal Adelaide Hospital, Australia. Four subjects were assigned to each of eleven cohorts (intravenous BG00010 0.3, 1, 3, 10, 25, 50, 100, 200, 400, or 800 μg/kg, or subcutaneous BG00010 50 μg/kg) and were randomized 3:1 to receive a single dose of BG00010 or placebo. The primary safety and tolerability assessments were: adverse events; clinical laboratory parameters and vital signs; pain as measured by a Likert rating scale; intra-epidermal nerve fiber density; and longitudinal assessment of quantitative sensory test parameters. Blood, serum, and plasma samples were collected for pharmacokinetic and pharmacodynamic assessments. Subjects were blinded to treatment assignment throughout the study. The investigator was blinded to treatment assignment until the Data Safety Review Committee review of unblinded data, which occurred after day 28. Beyond the planned enrollment of 44 subjects, four additional subjects were enrolled into to the intravenous BG00010 200 μg/kg cohort after one original subject experienced mild generalized pruritus. Therefore, a total of 48 subjects were enrolled between August 2009 and December 2011; all were included in the safety analyses. BG00010 was generally well tolerated: in primary analyses, the most common treatment-emergent adverse events were changes in temperature perception, pruritus, rash, or headache; no trends were observed in clinical laboratory parameters, vital signs, intra-epidermal nerve fiber density, or quantitative sensory testing. BG00010 was not associated with any clear, dose-dependent trends in Likert pain scores. BG00010 was
Georgiev, Ivelin S; Joyce, M Gordon; Yang, Yongping; Sastry, Mallika; Zhang, Baoshan; Baxa, Ulrich; Chen, Rita E; Druz, Aliaksandr; Lees, Christopher R; Narpala, Sandeep; Schön, Arne; Van Galen, Joseph; Chuang, Gwo-Yu; Gorman, Jason; Harned, Adam; Pancera, Marie; Stewart-Jones, Guillaume B E; Cheng, Cheng; Freire, Ernesto; McDermott, Adrian B; Mascola, John R; Kwong, Peter D
2015-05-01
Similar to other type I fusion machines, the HIV-1 envelope glycoprotein (Env) requires proteolytic activation; specifically, cleavage of a gp160 precursor into gp120 and gp41 subunits creates an N-terminal gp41 fusion peptide and permits folding from an immature uncleaved state to a mature closed state. While the atomic-level consequences of cleavage for HIV-1 Env are still being determined, the uncleaved state is antigenically distinct from the mature closed state, and cleavage has been reported to be essential for mimicry of the mature viral spike by soluble versions of Env. Here we report the redesign of a current state-of-the-art soluble Env mimic, BG505.SOSIP, to make it cleavage independent. Specifically, we replaced the furin cleavage site between gp120 and gp41 with Gly-Ser linkers of various lengths. The resultant linked gp120-gp41 constructs, termed single-chain gp140 (sc-gp140), exhibited different levels of structural and antigenic mimicry of the parent cleaved BG505.SOSIP. When constructs were subjected to negative selection to remove subspecies recognized by poorly neutralizing antibodies, trimers of high antigenic mimicry of BG505.SOSIP could be obtained; negative-stain electron microscopy indicated these to resemble the mature closed state. Higher proportions of BG505.SOSIP-trimer mimicry were observed in sc-gp140s with linkers of 6 or more residues, with a linker length of 15 residues exhibiting especially promising traits. Overall, flexible linkages between gp120 and gp41 in BG505.SOSIP can thus substitute for cleavage, and sc-gp140s that closely mimicked the vaccine-preferred mature closed state of Env could be obtained. The trimeric HIV-1 envelope glycoprotein (Env) is the sole target of virus-directed neutralizing antibody responses and a primary focus of vaccine design. Soluble mimics of Env have proven challenging to obtain and have been thought to require proteolytic cleavage into two-component subunits, gp120 and gp41, to achieve
Differentiation of Bacillus Anthracis and Other Bacillus Species by Use of Lectins
1983-07-18
TITL9 fAnd Subtfitle) S.TypeO REPORT gi PZRCC rvt 4 DIFFERENTIATION OF BACIL-LUSg’ ANTHRAtgACIS D OTHER BACILLUS , SPECIES BY-USE OYLECTINS" Inter[im...Ricinus communis. Some strains of Bacillus cer-eus var. m-ycoides (B. Mycoides) were strongly reactive with the lectin from Helbi pomtia and weakly reacti...ve with the Glycine max lectin. The differential iCnteractions between Bacillus species and lectins af forded a means of distinguishing B. anthracis
Whole-genome sequencing of Borrelia garinii BgVir, isolated from Taiga ticks (Ixodes persulcatus).
Brenner, Evgeniy V; Kurilshikov, Alexander M; Stronin, Oleg V; Fomenko, Nataliya V
2012-10-01
Most Lyme borreliosis cases in Russia result from Borrelia garinii NT29 group infection. Borrelias of this group circulate exclusively in Ixodes persulcatus ticks, which are seldom found beyond Russia and the far east. Here we report the whole-genome sequence of Borrelia garinii BgVir isolated from an I. persulcatus female.
Roiz, David; Duperier, Sandy; Roussel, Marion; Boussès, Philippe; Fontenille, Didier; Simard, Frédéric; Paupy, Christophe
2016-03-01
Targeted trapping of mosquito disease vectors plays an important role in the surveillance and control of mosquito-borne diseases. The Asian tiger mosquito, Aedes albopictus (Skuse), is an invasive species, which is spreading throughout the world, and is a potential vector of 24 arboviruses, particularly efficient in the transmission of chikungunya, dengue, and zika viruses. Using a 4 × 4 Latin square design, we assessed the efficacy of the new BG-Sentinel 2 mosquito trap using the attractants BG-lure and (R)-1-octen-3-ol cartridge, alone or in combination, and with and without carbon dioxide, for the field collection of Ae. albopictus mosquitoes.We found a synergistic effect of attractant and carbon dioxide that significantly increased twofold to fivefold the capture rate of Ae. albopictus. In combination with carbon dioxide, BG-lure cartridge is more effective than (R)-1-octen-3-ol in attracting females, while a combination of both attractants and carbon dioxide is the most effective for capturing males. In the absence of carbon dioxide, BG-lure cartridge alone did not increase the capture of males or females when compared with an unbaited trap. However, the synergistic effect of carbon dioxide and BG-lure makes this the most efficient combination in attracting Ae. albopictus.
Gillis, Annika; Mahillon, Jacques
2014-01-01
Many bacteriophages (phages) have been widely studied due to their major role in virulence evolution of bacterial pathogens. However, less attention has been paid to phages preying on bacteria from the Bacillus cereus group and their contribution to the bacterial genetic pool has been disregarded. Therefore, this review brings together the main information for the B. cereus group phages, from their discovery to their modern biotechnological applications. A special focus is given to phages infecting Bacillus anthracis, B. cereus and Bacillus thuringiensis. These phages belong to the Myoviridae, Siphoviridae, Podoviridae and Tectiviridae families. For the sake of clarity, several phage categories have been made according to significant characteristics such as lifestyles and lysogenic states. The main categories comprise the transducing phages, phages with a chromosomal or plasmidial prophage state, γ-like phages and jumbo-phages. The current genomic characterization of some of these phages is also addressed throughout this work and some promising applications are discussed here. PMID:25010767
Ko, Kwan Soo; Oh, Won Sup; Lee, Mi Young; Lee, Jang Ho; Lee, Hyuck; Peck, Kyong Ran; Lee, Nam Yong; Song, Jae-Hoon
2006-11-01
Two Gram-positive bacilli, designated as strains SMC 4352-1T and SMC 4352-2T, were isolated sequentially from the blood of a newborn child with sepsis. They could not be identified by using conventional clinical microbiological methods. 16S rRNA gene sequencing and phylogenetic analysis revealed that both strains belonged to the genus Bacillus but clearly diverged from known Bacillus species. Strain SMC 4352-1T and strain SMC 4352-2T were found to be closely related to Bacillus firmus NCIMB 9366T (98.2% sequence similarity) and Bacillus cibi JG-30T (97.1% sequence similarity), respectively. They also displayed low DNA-DNA reassociation values (less than 40%) with respect to the most closely related Bacillus species. On the basis of their polyphasic characteristics, strain SMC 4352-1T and strain SMC 4352-2T represent two novel species of the genus Bacillus, for which the names Bacillus infantis sp. nov. (type strain SMC 4352-1T=KCCM 90025T=JCM 13438T) and Bacillus idriensis sp. nov. (type strain SMC 4352-2T=KCCM 90024T=JCM 13437T) are proposed.
NASA Technical Reports Server (NTRS)
Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.
1992-01-01
Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.
Brennan, Jennifer C.; Bassal, Arzoo; He, Guochun; Denison, Michael S.
2016-01-01
Estrogenic endocrine disrupting chemicals are found in environmental and biological samples, commercial and consumer products, food, and numerous other sources. Given their ubiquitous nature and potential for adverse effects, there is a critical need for rapidly detecting these chemicals. We developed an estrogen-responsive recombinant human ovarian (BG1Luc4E2) cell line recently accepted by the USEPA and OECD as a bioanalytical method to detect estrogen receptor (ER) agonists/antagonists. Unfortunately, these cells appear to contain only one of the two known ER isoforms, ERα but not ERβ, and the differential ligand selectivity of these ERs indicates that the currently accepted screening method only detects a subset of total estrogenic chemicals. To improve the estrogen screening bioassay, BG1Luc4E2 cells were stably transfected with an ERβ expression plasmid and positive clones identified using ERβ-selective ligands (genistein and Br-ERβ-041). A highly responsive clone (BG1LucERβc9) was identified that exhibited greater sensitivity and responsiveness to ERβ-selective ligands than BG1Luc4E2 cells and qRT-PCR confirmed the presence of ERβ expression in these cells. Screening of pesticides and industrial chemicals identified chemicals that preferentially stimulated ERβ-dependent reporter gene expression. Together, these results not only demonstrate the utility of this dual ER recombinant cell line for detecting a broader range of estrogenic chemicals than the current BG1Luc4E2 cell line, but screening with both cell lines allows identification of ERα and ERβ-selective chemicals. PMID:26139245
Stable-isotope fingerprints of biological agents as forensic tools.
Horita, Juske; Vass, Arpad A
2003-01-01
Naturally occurring stable isotopes of light elements in chemical and biological agents may possess unique "stable-isotope fingerprints" depending on their sources and manufacturing processes. To test this hypothesis, two strains of bacteria (Bacillus globigii and Erwinia agglomerans) were grown under controlled laboratory conditions. We observed that cultured bacteria cells faithfully inherited the isotopic composition (hydrogen, carbon, and nitrogen) of media waters and substrates in predictable manners in terms of bacterial metabolism and that even bacterial cells of the same strain, which grew in media water and substrates of different isotopic compositions, have readily distinguishable isotopic signatures. These "stable-isotopic fingerprints" of chemical and biological agents can be used as forensic tools in the event of biochemical terrorist attacks.
2. Credit BG. The northwest and southwest sides of the ...
2. Credit BG. The northwest and southwest sides of the building appear as seen when looking northeast (38°). (Photo taken from location near Building 4275/E-76, Standby Generator.) Note the extent of the barricades. On the corner of the roof at the extreme right of this view appears a small funnel; according to JPL personnel, this device collected rainwater and conducted it through a pipe which appears at the corner of the building below. The water was used to flush any wastes from the nearby drainage trenches in the exterior concrete pads. - Jet Propulsion Laboratory Edwards Facility, Weigh & Control Building, Edwards Air Force Base, Boron, Kern County, CA
4. Credit BG. View looking northeast at west facade of ...
4. Credit BG. View looking northeast at west facade of Test Stand 'E' 4259/E-60, solid rocket motor test facility. Wooden barricades to north and south of 4259/E-60 protect personnel and other facilities from flying debris in case of inadvertent explosions. Test Stand 'E' is accessed from the tunnel system by the inclined tube shown at the center of the image adjacent to a ladder. Racks running to the north (having the appearance of a low fence) carry electrical cables to Test Stand 'G' (Building 4271/E-72). - Jet Propulsion Laboratory Edwards Facility, Test Stand E, Edwards Air Force Base, Boron, Kern County, CA
5. Credit BG. View looking northwest at eastern facade of ...
5. Credit BG. View looking northwest at eastern facade of Test Stand 'E' (Building 4259/E-60), solid rocket motor test facility. Central bay (high concrete walls) was used for testing large solid motors in a vertical position. A second smaller bay to the north fired smaller motors horizontally. Just south of the large bay is an equipment room with access to the tunnel system; entrance is by small single door on east side. The large double doors lead to a third bay used for X-raying solid rocket motors before testing. - Jet Propulsion Laboratory Edwards Facility, Test Stand E, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. The southeast and northeast facades appear as seen ...
Credit BG. The southeast and northeast facades appear as seen when looking due west (270°). Doors to the mixer room are open; the smaller closed doors lead to a building equipment room containing heating and refrigeration units for temperature control of the mixer and its contents. The mixer room doors and sidewalls are filled with foam and constructed to blow out in case of an explosion in the mixer. Note the lightning rods and two exterior emergency showers. The two tanks at the eastern corner of the building are unidentified - Jet Propulsion Laboratory Edwards Facility, Mixer & Casting Building, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. View shows north and west sides of structure ...
Credit BG. View shows north and west sides of structure as seen when looking east southeast (124°). The thick walls of this building are solid concrete, and the rooms are isolated from each other. The magazine is rated for a maximum of 100 pounds (45.4 Kg) of class 1.1 materials, and two personnel. Handles, attached to walls next to door handles, are static electric discharge points for personnel to touch before entering magazine doors. Note the lightning rods on roof corners and the exterior electrical system for interior lighting - Jet Propulsion Laboratory Edwards Facility, Igniter Magazine, Edwards Air Force Base, Boron, Kern County, CA
Ong, Magdalena; Ongkudon, Clarence M; Wong, Clemente Michael Vui Ling
2016-10-02
Pedobacter cryoconitis BG5 are psychrophiles isolated from the cold environment and capable of proliferating and growing well at low temperature regime. Their cellular products have found a broad spectrum of applications, including in food, medicine, and bioremediation. Therefore, it is imperative to develop a high-cell density cultivation strategy coupled with optimized growth medium for P. cryoconitis BG5. To date, there has been no published report on the design and optimization of growth medium for P. cryoconitis, hence the objective of this research project. A preliminary screening of four commercially available media, namely tryptic soy broth, R2A, Luria Bertani broth, and nutrient broth, was conducted to formulate the basal medium. Based on the preliminary screening, tryptone, glucose, NaCl, and K2HPO4 along with three additional nutrients (yeast extract, MgSO4, and NH4Cl) were identified to form the basal medium which was further analyzed by Plackett-Burman experimental design. Central composite experimental design using response surface methodology was adopted to optimize tryptone, yeast extract, and NH4Cl concentrations in the formulated growth medium. Statistical data analysis showed a high regression factor of 0.84 with a predicted optimum optical (600 nm) cell density of 7.5 using 23.7 g/L of tryptone, 8.8 g/L of yeast extract, and 0.7 g/L of NH4Cl. The optimized medium for P. cryoconitis BG5 was tested, and the observed optical density was 7.8. The cost-effectiveness of the optimized medium was determined as 6.25 unit prices per gram of cell produced in a 250-ml Erlenmeyer flask.
Brennan, Jennifer C; Bassal, Arzoo; He, Guochun; Denison, Michael S
2016-01-01
Estrogenic endocrine-disrupting chemicals are found in environmental and biological samples, commercial and consumer products, food, and numerous other sources. Given their ubiquitous nature and potential for adverse effects, a critical need exists for rapidly detecting these chemicals. The authors developed an estrogen-responsive recombinant human ovarian (BG1Luc4E2) cell line recently accepted by the US Environmental Protection Agency (USEPA) and Organisation for Economic Co-operation and Development (OECD) as a bioanalytical method to detect estrogen receptor (ER) agonists/antagonists. Unfortunately, these cells appear to contain only 1 of the 2 known ER isoforms, ERα but not ERβ, and the differential ligand selectivity of these ERs indicates that the currently accepted screening method only detects a subset of total estrogenic chemicals. To improve the estrogen screening bioassay, BG1Luc4E2 cells were stably transfected with an ERβ expression plasmid and positive clones identified using ERβ-selective ligands (genistein and Br-ERβ-041). A highly responsive clone (BG1LucERβc9) was identified that exhibited greater sensitivity and responsiveness to ERβ-selective ligands than BG1Luc4E2 cells, and quantitative reverse-transcription polymerase chain reaction confirmed the presence of ERβ expression in these cells. Screening of pesticides and industrial chemicals identified chemicals that preferentially stimulated ERβ-dependent reporter gene expression. Together, these results not only demonstrate the utility of this dual-ER recombinant cell line for detecting a broader range of estrogenic chemicals than the current BG1Luc4E2 cell line, but screening with both cell lines allows identification of ERα- and ERβ-selective chemicals. © 2015 SETAC.
Coutouné, Natalia; Mulato, Aline Tieppo Nogueira
2017-01-01
ABSTRACT Here, we present the draft genome sequence of Saccharomyces cerevisiae BG-1, a Brazilian industrial strain widely used for bioethanol production from sugarcane. The 11.7-Mb genome sequence consists of 216 scaffolds and harbors 5,607 predicted protein-coding genes. PMID:28360170
Khatri, Indu; Sharma, Shailza; Ramya, T N C; Subramanian, Srikrishna
2016-01-01
Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions.
Credit BG. Looking northwest at the Dd stand complex. To ...
Credit BG. Looking northwest at the Dd stand complex. To the left is the Test Stand "D" tower with steam-driven ejectors and interstage condenser visible along with steam lines. The steam accumulator appears in the left foreground (sphere); steam lines emerging from the top conduct steam to the Dv, Dd, and Dy stand ejectors. The T-shaped vertical pipes atop the accumulator are burst-disk type safety valves. The ejector ends of the Dd and Dy trains are visible to the right. Tracks permitted each train to expand and contract with temperature or equipment changes - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. View west of Test Stand "D" complex, with ...
Credit BG. View west of Test Stand "D" complex, with ends of Dd (left) and Dy (right) station ejectors in view. Steam piping from accumulator (sphere) to ejectors is apparent; long horizontal loops in the pipes permit expansion and contraction without special joints. The small platform straddling the Dd ejector (near the accumulator) was originally constructed for a "Hyprox" steam generator which supplied steam to the Dd ejector before the accumulator and Dy stand were built. Note ejectors on top of interstage condenser in Test Stand "D" tower. Metal shed in far right background is for storage - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
NASA Technical Reports Server (NTRS)
La Duc, Myron Thomas (Inventor); Venkateswaran, Kasthuri (Inventor)
2007-01-01
The present invention relates to discovery and isolation of a biologically pure culture of a Bacillus odysseyi isolate with high adherence and sterilization resistant properties. B. odysseyi is a round spore forming Bacillus species that produces an exosporium. This novel species has been characterized on the basis of phenotypic traits, 16S rDNA sequence analysis and DNA-DNA hybridization. According to the results of these analyses, this strain belongs to the genus Bacillus and the type strain is 34hs-1.sup.T (=ATCC PTA-4993.sup.T=NRRL B-30641.sup.T=NBRC 100172.sup.T). The GenBank accession number for the 16S rDNA sequence of strain 34hs-1.sup.T is AF526913.
Testing large volume water treatment and crude oil ...
Report EPA’s Homeland Security Research Program (HSRP) partnered with the Idaho National Laboratory (INL) to build the Water Security Test Bed (WSTB) at the INL test site outside of Idaho Falls, Idaho. The WSTB was built using an 8-inch (20 cm) diameter cement-mortar lined drinking water pipe that was previously taken out of service. The pipe was exhumed from the INL grounds and oriented in the shape of a small drinking water distribution system. Effluent from the pipe is captured in a lagoon. The WSTB can support drinking water distribution system research on a variety of drinking water treatment topics including biofilms, water quality, sensors, and homeland security related contaminants. Because the WSTB is constructed of real drinking water distribution system pipes, research can be conducted under conditions similar to those in a real drinking water system. In 2014, WSTB pipe was experimentally contaminated with Bacillus globigii spores, a non-pathogenic surrogate for the pathogenic B. anthracis, and then decontaminated using chlorine dioxide. In 2015, the WSTB was used to perform the following experiments: • Four mobile disinfection technologies were tested for their ability to disinfect large volumes of biologically contaminated “dirty” water from the WSTB. B. globigii spores acted as the biological contaminant. The four technologies evaluated included: (1) Hayward Saline C™ 6.0 Chlorination System, (2) Advanced Oxidation Process (A
Li, Huan; Wang, Daofeng; Wei, Wenxiao; Ouyang, Lamei; Lou, Ning
2017-01-01
Anastomotic leak was a potentially severe life-threatening complication of esophagectomy, which drew attention in consequence of progressive dyspnea until acute respiratory distress syndrome (ARDS) due to the early asymptomatic presentation. Respiratory failure, caused by ARDS as the severe presentation of anastomotic leak, is the most common organ failure. CRP (C-reactive protein), procalcitonin (PCT), and Blood G (BG) test are the sensitivity markers for inflammatory, sepsis, and fungemia, respectively. Early recognition and intervention treatment of anastomotic leak may alleviate complication and improve outcome. We retrospectively analyzed 71 patients, accepting mechanical ventilation support because of ARDS as the complication after radical resection of esophagus cancer. Clinical data were collected from the patients' electronic medical records, including their clinically hematological examination, drainage fluid cultures, and sputum culture. Accord to appearance of anastomotic leak or not, all patients were divided into 2 groups, leak group and no-leak group. Inflammatory markers, such as CRP, PCT, and the coefficient of BG and PCT, were significantly different between the 2 groups. Respiratory index, white blood cell, hemoglobin (HBG), platelet (PLT), and other clinical factors were not significantly different between the 2 groups. Receiver operating characteristic curves were constructed to calculate the sensitivity, specificity, positive predictive value, negative predictive value, and area under the curve for various cutoff levels of several factors. Blood G tests presented the better predicting value for anastomotic leak. Blood G tests and PCT should be tested after esophagectomy. The coefficient of PCT and BG (>260) is of great significance, and clinical value to predict anastomotic leak for patients with postesophagectomy ARDS, early PCT and BG test, and especially, dynamic variation may alleviate complication and improve outcome.
Ramya, T. N. C.; Subramanian, Srikrishna
2016-01-01
Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions. PMID:27258038
Rahimzadeh, Mahsa; Poodat, Manijeh; Javadpour, Sedigheh; Qeshmi, Fatemeh Izadpanah; Shamsipour, Fereshteh
2016-01-01
Background: L-asparaginase has been used as a chemotherapeutic agent in treatment of lymphoblastic leukemia. In the present investigation, Bacillus sp. PG03 and Bacillus sp. PG04 were studied. Methods: L- asparaginases were produced using different culture media and were purified using ion exchange chromatography. Results: Maximum productivity was obtained when asparagine was used as the nitrogen source at pH 7 and 48 h after cultivation. New intracellular L-asparaginases showed an apparent molecular weight of 25 kDa and 30 kDa by SDS-PAGE respectively. These enzymes were active in a wide pH range (3-9) with maximum activity at pH 6 for Bacillus PG03 and pH 7 for Bacillus PG04 L-asparaginase. Bacillus PG03 enzyme was optimally active at 37 ˚C and Bacillus PG04 maximum activity was observed at 40˚C. Kinetic parameters km and Vmax of both enzymes were studied using L-asparagine as the substrate. Thermal inactivation studies of Bacillus PG03 and Bacillus PG04 L-asparaginase exhibited t1/2 of 69.3 min and 34.6 min in 37 ˚C respectively. Also T50 and ∆G of inactivation were measured for both enzymes. Conclusion: The results revealed that both enzymes had appropriate characteristics and thus could be a potential candidate for medical applications. PMID:27999622
Transcriptional Analysis of the bgIP Gene from Streptococcus mutans
2006-04-21
Lactobacillus plantarum . FEMS Microbiol Lett 2000, 186(2):269-273. 5. Le Coq D, Lindner C, Kruger S, Steinmetz M, Stulke J: New beta- glucoside (bgl) genes in...longisporum [3], Lactobacillus plantarium [4], Bacillus subtilis [5,6], and Streptococcus mutans [7]. All of these organisms rely on the phosphoe
5. Credit BG. This interior view shows the weigh room, ...
5. Credit BG. This interior view shows the weigh room, looking west (240°): Electric lighting and scale read-outs (boxes with circular windows on the wall) are fitted with explosion-proof enclosures; these enclosures prevent malfunctioning electrical parts from sparking and starting fires or explosions. One marble table and scale have been removed at the extreme left of the view. Two remaining scales handle small and large quantities of propellants and additives. Marble tables do not absorb chemicals or conduct electricity; their mass also prevents vibration from upsetting the scales. The floor has an electrically conductive coating to dissipate static electric charges, thus preventing sparks which might ignite propellants. - Jet Propulsion Laboratory Edwards Facility, Weigh & Control Building, Edwards Air Force Base, Boron, Kern County, CA
Credit BG. Test Stand "D" tower as seen looking northeast ...
Credit BG. Test Stand "D" tower as seen looking northeast (See caption for CA-163-F-18). To the right of the view is the stainless steel dome top for Dv Cell (see CA-163-F-22 for view into cell), behind which rests a spherical accumulator--an electrically heated steam generator for powering the vacuum system at "C" and Test Stand "D." Part of the ejector system can be seen on the right corner of the tower, other connections include electrical ducts (thin, flat metal members) and fire protection systems. Note the stand in the foreground with lights used to indicate safety status of the stand during tests - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
2. Credit BG. Looking west at east facade of Steam ...
2. Credit BG. Looking west at east facade of Steam Generator Plant, Building 4280/E-81; steam generators have been removed as part of dismantling program for Test Stand 'D.' Metal cylindrical objects to left of door were roof vents. The steam-driven ejector system for Dv Cell is clearly visible on the east side of Test Stand 'D' tower. The X-stage ejector is vertically installed at the bottom left of the tower, Y-stage is horizontally positioned close to the tower top, and the Z- and Z-1 stages are attached to the top of the interstage condenser. Light-colored piping is thermally insulated steam line. - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Steam Generator Plant, Edwards Air Force Base, Boron, Kern County, CA
Lemieux, P; Wood, J; Drake, J; Minamyer, S; Silvestri, E; Yund, C; Nichols, T; Ierardi, M; Amidan, B
2016-01-01
The Bio-response Operational Testing and Evaluation (BOTE) Project was a cross-government effort designed to operationally test and evaluate a response to a biological incident (release of Bacillus anthracis [Ba] spores, the causative agent for anthrax) from initial public health and law enforcement response through environmental remediation. The BOTE Project was designed to address site remediation after the release of a Ba simulant, Bacillus atrophaeus spp. globigii (Bg), within a facility, drawing upon recent advances in the biological sampling and decontamination areas. A key component of response to a biological contamination incident is the proper management of wastes and residues, which is woven throughout all response activities. Waste is generated throughout the response and includes items like sampling media packaging materials, discarded personal protective equipment, items removed from the facility either prior to or following decontamination, aqueous waste streams, and materials generated through the application of decontamination technologies. The amount of residual contaminating agent will impact the available disposal pathways and waste management costs. Waste management is an integral part of the decontamination process and should be included through "Pre-Incident" response planning. Overall, the pH-adjusted bleach decontamination process generated the most waste from the decontamination efforts, and fumigation with chlorine dioxide generated the least waste. A majority of the solid waste generated during pH-adjusted bleach decontamination was the nonporous surfaces that were removed, bagged, decontaminated ex situ, and treated as waste. The waste during the two fumigation rounds of the BOTE Project was associated mainly with sampling activities. Waste management activities may represent a significant contribution to the overall cost of the response/recovery operation. This paper addresses the waste management activities for the BOTE field test
Dielectrophoretic manipulation of particles for use in microfluidic devices
DOE Office of Scientific and Technical Information (OSTI.GOV)
Belgrader, P; Bettencourt, K; Hamilton, J
1999-06-23
Amplification and hybridization of DNA are commonly used techniques to verify the presence of a specific DNA sequence in a test sample. Automatic sample handling to concentrate and purify sample prior to amplification is desirable both from the cost standpoint and from the standpoint of reducing the possibility of sample contamination. This paper explores the use of the dielectrophoretic force to manipulate DNA, Bacillus globigii spores, and Erwinia herbicola bacteria to provide concentration and purification as part of the sample handling functions in biological monitoring equipment. It was found that for what would be considered a typical microfabricated structure withmore » electrode gaps at 30 {micro}m operating at 5V, that concentration of the particles is very effective.« less
Bacillus pumilus SAFR-032 isolate
NASA Technical Reports Server (NTRS)
Venkateswaran, Kasthuri J. (Inventor)
2007-01-01
The present invention relates to discovery and isolation of a biologically pure culture of a Bacillus pumilus SAFR-032 isolate with UV sterilization resistant properties. This novel strain has been characterized on the basis of phenotypic traits, 16S rDNA sequence analysis and DNA-DNA hybridization. According to the results of these analyses, this strain belongs to the genus Bacillus. The GenBank accession number for the 16S rDNA sequence of the Bacillus pumilus SAFR-032 isolate is AY167879.
Nine-analyte detection using an array-based biosensor
NASA Technical Reports Server (NTRS)
Taitt, Chris Rowe; Anderson, George P.; Lingerfelt, Brian M.; Feldstein, s. Mark. J.; Ligler, Frances S.
2002-01-01
A fluorescence-based multianalyte immunosensor has been developed for simultaneous analysis of multiple samples. While the standard 6 x 6 format of the array sensor has been used to analyze six samples for six different analytes, this same format has the potential to allow a single sample to be tested for 36 different agents. The method described herein demonstrates proof of principle that the number of analytes detectable using a single array can be increased simply by using complementary mixtures of capture and tracer antibodies. Mixtures were optimized to allow detection of closely related analytes without significant cross-reactivity. Following this facile modification of patterning and assay procedures, the following nine targets could be detected in a single 3 x 3 array: Staphylococcal enterotoxin B, ricin, cholera toxin, Bacillus anthracis Sterne, Bacillus globigii, Francisella tularensis LVS, Yersiniapestis F1 antigen, MS2 coliphage, and Salmonella typhimurium. This work maximizes the efficiency and utility of the described array technology, increasing only reagent usage and cost; production and fabrication costs are not affected.
Delvecchio, Vito G; Connolly, Joseph P; Alefantis, Timothy G; Walz, Alexander; Quan, Marian A; Patra, Guy; Ashton, John M; Whittington, Jessica T; Chafin, Ryan D; Liang, Xudong; Grewal, Paul; Khan, Akbar S; Mujer, Cesar V
2006-09-01
Differentially expressed and immunogenic spore proteins of the Bacillus cereus group of bacteria, which includes Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis, were identified. Comparative proteomic profiling of their spore proteins distinguished the three species from each other as well as the virulent from the avirulent strains. A total of 458 proteins encoded by 232 open reading frames were identified by matrix-assisted laser desorption ionization-time-of-flight mass spectrometry analysis for all the species. A number of highly expressed proteins, including elongation factor Tu (EF-Tu), elongation factor G, 60-kDa chaperonin, enolase, pyruvate dehydrogenase complex, and others exist as charge variants on two-dimensional gels. These charge variants have similar masses but different isoelectric points. The majority of identified proteins have cellular roles associated with energy production, carbohydrate transport and metabolism, amino acid transport and metabolism, posttranslational modifications, and translation. Novel vaccine candidate proteins were identified using B. anthracis polyclonal antisera from humans postinfected with cutaneous anthrax. Fifteen immunoreactive proteins were identified in B. anthracis spores, whereas 7, 14, and 7 immunoreactive proteins were identified for B. cereus and in the virulent and avirulent strains of B. thuringiensis spores, respectively. Some of the immunodominant antigens include charge variants of EF-Tu, glyceraldehyde-3-phosphate dehydrogenase, dihydrolipoamide acetyltransferase, Delta-1-pyrroline-5-carboxylate dehydrogenase, and a dihydrolipoamide dehydrogenase. Alanine racemase and neutral protease were uniquely immunogenic to B. anthracis. Comparative analysis of the spore immunome will be of significance for further nucleic acid- and immuno-based detection systems as well as next-generation vaccine development.
DelVecchio, Vito G.; Connolly, Joseph P.; Alefantis, Timothy G.; Walz, Alexander; Quan, Marian A.; Patra, Guy; Ashton, John M.; Whittington, Jessica T.; Chafin, Ryan D.; Liang, Xudong; Grewal, Paul; Khan, Akbar S.; Mujer, Cesar V.
2006-01-01
Differentially expressed and immunogenic spore proteins of the Bacillus cereus group of bacteria, which includes Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis, were identified. Comparative proteomic profiling of their spore proteins distinguished the three species from each other as well as the virulent from the avirulent strains. A total of 458 proteins encoded by 232 open reading frames were identified by matrix-assisted laser desorption ionization-time-of-flight mass spectrometry analysis for all the species. A number of highly expressed proteins, including elongation factor Tu (EF-Tu), elongation factor G, 60-kDa chaperonin, enolase, pyruvate dehydrogenase complex, and others exist as charge variants on two-dimensional gels. These charge variants have similar masses but different isoelectric points. The majority of identified proteins have cellular roles associated with energy production, carbohydrate transport and metabolism, amino acid transport and metabolism, posttranslational modifications, and translation. Novel vaccine candidate proteins were identified using B. anthracis polyclonal antisera from humans postinfected with cutaneous anthrax. Fifteen immunoreactive proteins were identified in B. anthracis spores, whereas 7, 14, and 7 immunoreactive proteins were identified for B. cereus and in the virulent and avirulent strains of B. thuringiensis spores, respectively. Some of the immunodominant antigens include charge variants of EF-Tu, glyceraldehyde-3-phosphate dehydrogenase, dihydrolipoamide acetyltransferase, Δ-1-pyrroline-5-carboxylate dehydrogenase, and a dihydrolipoamide dehydrogenase. Alanine racemase and neutral protease were uniquely immunogenic to B. anthracis. Comparative analysis of the spore immunome will be of significance for further nucleic acid- and immuno-based detection systems as well as next-generation vaccine development. PMID:16957262
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumazawa, S.; Mitsui, A.
Heterocystous filamentous cyanobacterium Anabaena cylindrica B629 and nonheterocystous filamentous cyanobacterium Oscillatoria sp. strain Miami BG7 were cultured in media with N/sub 2/ as the sole nitrogen source; and activities of oxygen-dependent hydrogen uptake, photohydrogen production photooxygen evolution, and respiration were compared amperometrically under the same or similar experimental conditions for both strains. Distinct differences in these activities were observed in both strains. The rates of hydrogen photoproduction and hydrogen accumulation were significantly higher in Oscillatoria sp. strain BG7 than in A. cylindrica B629 at every light intensity tested. The major reason for the difference was attributable to the fact thatmore » the heterocystous cyanobacterium had a high rate of oxygen-dependent hydrogen consumption activity and the nonheterocystous cyanobacterium did not. The activity of oxygen photoevolution and respiration also contributed to the difference. Oscillatoria sp. strain BG7 had lower O/sub 2/ evolution and higher respiration than did A. cylindrica B629. Thus, the effect of O/sub 2/ on hydrogen photoproduction was minimized in Oscillatoria sp. strain BG7. 32 references, 5 figures.« less
Adhikari, Atin; Yermakov, Michael; Indugula, Reshmi; Reponen, Tiina; Driks, Adam; Grinshpun, Sergey A
2016-05-01
Destruction of bioweapon facilities due to explosion or fire could aerosolize highly pathogenic microorganisms. The post-event air quality assessment is conducted through air sampling. A bioaerosol sample (often collected on a filter for further culture-based analysis) also contains combustion products, which may influence the microbial culturability and, thus, impact the outcome. We have examined the interaction between spores deposited on collection filters using two simulants of Bacillus anthracis [B. thuringiensis (Bt) and B. atrophaeus (referred to as BG)] and incoming combustion products of Al as well as Mg and B·Ti (common ingredient of metalized explosives). Spores extracted from Teflon, polycarbonate, mixed cellulose ester (MCE), and gelatin filters (most common filter media for bioaerosol sampling), which were exposed to combustion products during a short-term sampling, were analyzed by cultivation. Surprisingly, we observed that aluminum combustion products enhanced the culturability of Bt (but not BG) spores on Teflon filters increasing the culturable count by more than an order of magnitude. Testing polycarbonate and MCE filter materials also revealed a moderate increase of culturability although gelatin did not. No effect was observed with either of the two species interacting on either filter media with products originated by combustion of Mg and B·Ti. Sample contamination, spore agglomeration, effect of a filter material on the spore survival, changes in the spore wall ultrastructure and germination, as well as other factors were explored to interpret the findings. The study raises a question about the reliability of certain filter materials for collecting airborne bio-threat agents in combustion environments. Copyright © 2016 Elsevier Inc. All rights reserved.
Fajardo-Cavazos, Patricia; Nicholson, Wayne
2006-01-01
As part of an ongoing effort to catalog spore-forming bacterial populations in environments conducive to interplanetary transfer by natural impacts or by human spaceflight activities, spores of Bacillus spp. were isolated and characterized from the interior of near-subsurface granite rock collected from the Santa Catalina Mountains, AZ. Granite was found to contain ∼500 cultivable Bacillus spores and ∼104 total cultivable bacteria per gram. Many of the Bacillus isolates produced a previously unreported diffusible blue fluorescent compound. Two strains of eight tested exhibited increased spore UV resistance relative to a standard Bacillus subtilis UV biodosimetry strain. Fifty-six isolates were identified by repetitive extragenic palindromic PCR (rep-PCR) and 16S rRNA gene analysis as most closely related to B. megaterium (15 isolates), B. simplex (23 isolates), B. drentensis (6 isolates), B. niacini (7 isolates), and, likely, a new species related to B. barbaricus (5 isolates). Granite isolates were very closely related to a limited number of Bacillus spp. previously found to inhabit (i) globally distributed endolithic sites such as biodeteriorated murals, stone tombs, underground caverns, and rock concretions and (ii) extreme environments such as Antarctic soils, deep sea floor sediments, and spacecraft assembly facilities. Thus, it appears that the occurrence of Bacillus spp. in endolithic or extreme environments is not accidental but that these environments create unique niches excluding most Bacillus spp. but to which a limited number of Bacillus spp. are specifically adapted. PMID:16597992
4. Credit BG. View looking northwest at Control and Recording ...
4. Credit BG. View looking northwest at Control and Recording Center 4221/E-22, as seen from Test Stand 'C' tower. The Test Stand 'C' workshop 4213/E-14 appears at lower left of the image. To the south of 4221/E-22 lies Blower House No. 2, Building 4226/E-27, used for ventilating the tunnel system which connected 4221/E-22 to all test stands. At the southeast corner of 4221/E-22 is the Booster Pumping Station, Building 4227/E-28. To the northwest of 4221/E-22 is a Water Storage Tank, Building 4289/E-90 which supplies the water and firefighting systems at the JPL Edwards facility. - Jet Propulsion Laboratory Edwards Facility, Control & Recording Center, Edwards Air Force Base, Boron, Kern County, CA
Environmental Persistence of Bacillus anthracis and Bacillus subtilis Spores
Wood, Joseph P.; Meyer, Kathryn M.; Kelly, Thomas J.; Choi, Young W.; Rogers, James V.; Riggs, Karen B.; Willenberg, Zachary J.
2015-01-01
There is a lack of data for how the viability of biological agents may degrade over time in different environments. In this study, experiments were conducted to determine the persistence of Bacillus anthracis and Bacillus subtilis spores on outdoor materials with and without exposure to simulated sunlight, using ultraviolet (UV)-A/B radiation. Spores were inoculated onto glass, wood, concrete, and topsoil and recovered after periods of 2, 14, 28, and 56 days. Recovery and inactivation kinetics for the two species were assessed for each surface material and UV exposure condition. Results suggest that with exposure to UV, decay of spore viability for both Bacillus species occurs in two phases, with an initial rapid decay, followed by a slower inactivation period. The exception was with topsoil, in which there was minimal loss of spore viability in soil over 56 days, with or without UV exposure. The greatest loss in viable spore recovery occurred on glass with UV exposure, with nearly a four log10 reduction after just two days. In most cases, B. subtilis had a slower rate of decay than B. anthracis, although less B. subtilis was recovered initially. PMID:26372011
Le Goff, Gilbert; Damiens, David; Payet, Laurent; Ruttee, Abdoul-Hamid; Jean, Frédéric; Lebon, Cyrille; Dehecq, Jean-Sébastien; Gouagna, Louis-Clément
2016-09-22
Trapping male mosquitoes in the field is essential for the development of area-wide vector control programs with a sterile insect technique (SIT) component. To determine the optimal temporal and spatial release strategy, an estimation of the wild population density and its temporal dynamics is essential. Among the traps available for such data collection, the BG-Sentinel trap developed by the Biogents company uses a combination of visual cues, convection currents and olfactory signals. Although in numerous cases, this trap has shown high efficiency in sampling Aedes albopictus, in some cases low capture rates of Ae. albopictus males were recorded for the BG-sentinel mosquito trap baited with synthetic attractants. The effects of modifying the BG-sentinel trap (by adding one mouse, two or three live mice to the trap) on the efficiency of trapping Ae. albopictus males and females was tested. The experiment was carried out in three distinct areas on La Réunion that have been selected for pilot field testing of the release of sterile male Ae. albopictus mosquitoes. The effect of four types of attractant (including the generic BG-Lure, one mouse or two to three mice) in baited BGS traps was tested with a Latin square design in order to control for the variability of different sampling positions and dates. At the three studied sites, the number of Ae. albopictus adults caught and the proportion of males per trap consistently increased with the number of mice present in the trap. The results from this study suggest that some new attractants derived from, or similar to, mouse odors could be developed and tested in combination with other existing attractive components, such as CO 2 and heat, in order to provide a reliable estimation method for Ae. albopictus adult male abundance in the wild.
Peak, K. Kealy; Duncan, Kathleen E.; Luna, Vicki A.; King, Debra S.; McCarthy, Peter J.; Cannons, Andrew C.
2011-01-01
Bacillus strains with >99.7% 16S rRNA gene sequence similarity were characterized with DNA:DNA hybridization, cellular fatty acid (CFA) analysis, and testing of 100 phenotypic traits. When paired with the most closely related type strain, percent DNA:DNA similarities (% S) for six Bacillus strains were all far below the recommended 70% threshold value for species circumscription with Bacillus nealsonii. An apparent genomic group of four Bacillus strain pairings with 94%–70% S was contradicted by the failure of the strains to cluster in CFA- and phenotype-based dendrograms as well as by their differentiation with 9–13 species level discriminators such as nitrate reduction, temperature range, and acid production from carbohydrates. The novel Bacillus strains were monophyletic and very closely related based on 16S rRNA gene sequence. Coherent genomic groups were not however supported by similarly organized phenotypic clusters. Therefore, the strains were not effectively circumscribed within the taxonomic species definition. PMID:22046187
Niculescu, Iulia; Paraschiv, Simona; Paraskevis, Dimitrios; Abagiu, Adrian; Batan, Ionelia; Banica, Leontina
2015-01-01
Abstract Since 2011, Romania has faced an HIV outbreak among injecting drug users (IDUs). Our aim was to identify and describe clinical and epidemiological patterns of this outbreak. A cross-sectional study enrolled 138 IDUs diagnosed with HIV infection between 2011 and 2013 with 58 sexually infected individuals included as the control group. The IDUs had a long history of heroin abuse (10 years) and a recent history of new psychostimulant injection (3–4 years). Classical epidemiological data and molecular techniques were used to describe the transmission dynamics. A high prevalence of hepatitis C virus (HCV) coinfection was noted (98.6%) compared to the control group (10.3%) (p<0.001). IDUs had initially been infected with HCV. HIV infection was more recent, linked to starting injecting stimulants. HIV subtype analysis showed a predominance of the local F1 strain in both IDUs and sexually infected patients; in IDUs it also identified 28 CRF14_BG recombinants and six unique recombinant forms (URFs) between F1 and CRF14_BG. A few patients from both risk groups were infected with subtype B. Among IDUs, CRF14_BG was associated with a lower CD4 cell count and more advanced stages of disease, which correlated with CXCR4 tropism. Phylogenetic analysis revealed the spread of HIV through three major IDU clusters of recent date. Among IDUs with CRF14_BG, some reported travel abroad (Spain, Greece). By identifying clusters of IDUs with related viruses, molecular epidemiologic methods provide valuable information on patterns of HIV transmission that can be useful in planning appropriate harm reduction interventions. PMID:25369079
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Site Investigation Report for Fort McClellan, Alabama
1993-08-31
used 55 Assumed RD or VX used BG Bacillus Gobi SM Serratia Marcescens Reference: Solid Waste Study No. 99-056-73/76, Fort McClellan, AL, Jul 73-Aug...Bacillus Gobi SM Serratia Marcescens STB Supertropical Bleach Reference: Solid Waste Study No. 99-056-73/76, Fort McClellan, AL, Jul 73-Aug 75...REPORT ORGANIZATION ................................ 1-1 1.4 FACILITY BACKGROUND ............................... 1-3 1.4.1 Post Description and History
Measurement of Metabolic Activity in Dormant Spores of Bacillus Species
2015-01-14
SECURITY CLASSIFICATION OF: Spores of Bacillus megaterium and Bacillus subtilis were harvested shortly after release from sporangia, incubated under...Measurement of Metabolic Activity in Dormant Spores of Bacillus Species Report Title Spores of Bacillus megaterium and Bacillus subtilis were...ribosomal RNA when newly harvested Bacillus subtilis spores are incubated at physiological temperatures, as well as some evidence for transcription in
Effect of garlic solution to Bacillus sp. removal
NASA Astrophysics Data System (ADS)
Zainol, N.; Rahim, S. R.
2018-04-01
Biofilm is a microbial derived sessile community characterized by cells that are irreversibly attached to a substratum or interface to each other, embedded in a matrix of extracellular polymeric substances that they have produced. Bacillus sp. was used as biofilm model in this study. The purpose of this study is to determine the effect of Garlic solution in term of ratio of water and Garlic solution (W/G) and ratio of Garlic solution to Bacillus sp. (GS/B) on Bacillus sp removal. Garlic solution was used to remove Bacillus sp. In this study, Garlic solution was prepared by crushing the garlic and mixed it with water. the Garlic solution was added into Bacillus sp. mixture and mixed well. The mixture then was spread on nutrient agar. The Bacillus sp. weight on agar plate was measured by using dry weight measurement method. In this study, initially Garlic solution volume and Garlic solution concentration were studied using one factor at time (OFAT). Later two-level-factorial analysis was done to determine the most contributing factor in Bacillus sp. removal. Design Expert software (Version 7) was used to construct experimental table where all the factors were randomized. Bacilus sp removal was ranging between 42.13% to 99.6%. The analysis of the results showed that at W/G of 1:1, Bacillus sp. removal increased when more Garlic solution was added to Bacillus sp. Effect of Garlic solution to Bacillus sp. will be understood which in turn may be beneficial for the industrial purpose.
USDA-ARS?s Scientific Manuscript database
Background: Bitter melon (Momordica charantia) is a commonly used food crop for management of a variety of diseases most notably for control of diabetes, a disease associated with aberrant inflammation. Purpose: To evaluate the anti-inflammatory property of BG-4, a novel bioactive peptide isolated f...
Bacillus odysseyi sp. nov., a round-spore-forming bacillus isolated from the Mars Odyssey spacecraft
NASA Technical Reports Server (NTRS)
La Duc, Myron T.; Satomi, Masataka; Venkateswaran, Kasthuri
2004-01-01
A round-spore-forming Bacillus species that produces an exosporium was isolated from the surface of the Mars Odyssey spacecraft. This novel species has been characterized on the basis of phenotypic traits, 16S rDNA sequence analysis and DNA-DNA hybridization. According to the results of these analyses, this strain belongs to the genus Bacillus and is a Gram-positive, aerobic, rod-shaped, endospore-forming eubacterium. Ultrathin sections of the spores showed the presence of an exosporium, spore coat, cortex and core. 16S rDNA sequence similarities between this strain, Bacillus fusiformis and Bacillus silvestris were approximately 96% and DNA-DNA reassociation values with these two bacilli were 23 and 17%, respectively. Spores of the novel species were resistant to desiccation, H2O2 and UV and gamma radiation. Of all strains tested, the spores of this strain were the most consistently resistant and survived all of the challenges posed, i.e. exposure to conditions of desiccation (100% survival), H2O2 (26% survival), UV radiation (10% survival at 660 J m(-2)) and gamma radiation (0.4% survival). The name proposed for this novel bacterium is Bacillus odysseyi sp. nov.; the type strain is 34hs-1T (=ATCC PTA-4993T=NRRL B-30641T=NBRC 100172T).
1. Credit BG. The southwest and southeast sides of Weigh ...
1. Credit BG. The southwest and southeast sides of Weigh & Control appear as the camera looks due north (0°). Barricades on the northwest and northeast sides protect this structure from effects of any explosions at the Mixer Building (4233/E34), Oxidizer Grinder Building (4235/E-36) or other nearby propellant processing structures. The proliferation of doors is because many of the rooms have no interior interconnection--a safeguard to contain and prevent the internal spread of fires or explosions. Signs are posted on the doors describing maximum allowable propellant weights and number of personnel in rooms. A safety shower is featured on the southern exterior corner of the building. Apparatus on the roof consists of air conditioning ducts and fume vents. - Jet Propulsion Laboratory Edwards Facility, Weigh & Control Building, Edwards Air Force Base, Boron, Kern County, CA
Genetic map of the Bacillus stearothermophilus NUB36 chromosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vallier, H.; Welker, N.E.
1990-02-01
A circular genetic map of Bacillus stearothermophilus NUB36 was constructed by transduction with bacteriophage TP-42C and protoplast fusion. Sixty-four genes were tentatively assigned a cognate Bacillus subtilis gene based on growth response to intermediates or end products of metabolism, cross-feeding, accumulation of intermediates, or their relative order in a linkage group. Although the relative position of many genes on the Bacillus subtilis genetic map appears to be similar, some differences were detected. The tentative order of the genes in the Bacillus stearothermophilus aro region is aspB-aroBAFEC-tyra-hisH-(trp), whereas it is aspB-aroE-tyrA-hisH-(trp)-aroHBF in Bacillus subtilis. The aroA, aroC, and aroG genes inmore » Bacillus subtilis are located in another region. The tentative order of genes in the trp operon of Bacillus stearothermophilus is trpFCDABE, whereas it is trpABFCDE in Bacillus subtilis.« less
Disinfection of Vegetative Cells of Bacillus anthracis
2016-03-01
1. INTRODUCTION Disinfection of Bacillus anthracis spores in drinking water is well documented in peer-reviewed literature (Adcock et al., 2004... Disinfection kinetics of vegetative cells of Bacillus anthracis in water with free available chlorine ([FAC] 2 mg/L) and monochloramine ([MC] 2 mg/L) were...anthracis. Bacillus anthracis cells Drinking water Chlorine demand-free (CDF
Research evaluated the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface material using formaldehyde gas. Spores were dried on seven types of indoor surfaces and exposed to 1100 ppm formaldehyde gas for 10 hr. Fo...
NASA Astrophysics Data System (ADS)
Ragupathy, S.; Raghu, K.; Prabu, P.
2015-03-01
Synthesis of titanium dioxide (TiO2) nanoparticles and TiO2 loaded cashew nut shell activated carbon (TiO2/CNSAC) had been undertaken using sol-gel method and their application in BG and MB dyes removal under sunlight radiation has been investigated. The synthesized photocatalysts were characterized by X-ray diffraction analysis (XRD), Fourier infra-red spectroscopy (FT-IR), UV-Vis-diffuse reflectance spectroscopy (DRS) and scanning electron microscopy (SEM) with energy dispersive X-ray analysis (EDX). The various experimental parameters like amount of catalyst, contact time for efficient dyes degradation of BG and MB were concerned in this study. Activity measurements performed under solar irradiation has shown good results for the photodegradation of BG and MB in aqueous solution. It was concluded that the higher photocatalytic activity in TiO2/CNSAC was due to parameters like band-gap, number of hydroxyl groups, surface area and porosity of the catalyst. The kinetic data were also described by the pseudo-first-order and pseudo-second-order kinetic models.
Ragupathy, S; Raghu, K; Prabu, P
2015-03-05
Synthesis of titanium dioxide (TiO2) nanoparticles and TiO2 loaded cashew nut shell activated carbon (TiO2/CNSAC) had been undertaken using sol-gel method and their application in BG and MB dyes removal under sunlight radiation has been investigated. The synthesized photocatalysts were characterized by X-ray diffraction analysis (XRD), Fourier infra-red spectroscopy (FT-IR), UV-Vis-diffuse reflectance spectroscopy (DRS) and scanning electron microscopy (SEM) with energy dispersive X-ray analysis (EDX). The various experimental parameters like amount of catalyst, contact time for efficient dyes degradation of BG and MB were concerned in this study. Activity measurements performed under solar irradiation has shown good results for the photodegradation of BG and MB in aqueous solution. It was concluded that the higher photocatalytic activity in TiO2/CNSAC was due to parameters like band-gap, number of hydroxyl groups, surface area and porosity of the catalyst. The kinetic data were also described by the pseudo-first-order and pseudo-second-order kinetic models. Copyright © 2014 Elsevier B.V. All rights reserved.
Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F.; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G.
2015-01-01
Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession. PMID:26610554
Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G
2015-11-25
Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Bacillus oryzisoli sp. nov., isolated from rice rhizosphere.
Zhang, Xiao-Xia; Gao, Ju-Sheng; Zhang, Lei; Zhang, Cai-Wen; Ma, Xiao-Tong; Zhang, Jun
2016-09-01
The taxonomy of strain 1DS3-10T, a Gram-staining-positive, endospore-forming bacterium isolated from rice rhizosphere, was investigated using a polyphasic approach. Phylogenetic analysis based on 16S rRNA gene sequences demonstrated that the novel strain was grouped with established members of the genus Bacillus and appeared to be closely related to the type strains Bacillus benzoevorans DSM 5391T (97.9 %), Bacillus circulans DSM 11T (97.7 %), Bacillus novalis JCM 21709T (97.3 %), Bacillus soli JCM 21710T (97.3 %), Bacillus oceanisediminis CGMCC 1.10115T (97.3 %) and BacillusnealsoniiFO-92T (97.1 %). The fatty acid profile of strain 1DS3-10T, which showed a predominance of iso-C15 : 0 and anteiso-C15 : 0, supported the allocation of the strain to the genus Bacillus. The predominant menaquinone was MK-7 (100 %). The major polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol and unknown aminolipids. Cell-wall peptidoglycan contained meso-diaminopimelic acid. DNA-DNA hybridization values between strain 1DS3-10T and the type strains of closely related species were 25-33 %, which supported that 1DS3-10T represented a novel species in the genus Bacillus. The results of some physiological and biochemical tests also allowed the phenotypic differentiation of strain 1DS3-10T from the most closely related recognized species. On the basis of the phylogenetic and phenotypic evidence, strain 1DS3-10T represents a novel species of the genus Bacillus, for which the name Bacillus oryzisoli sp. nov. is proposed. The type strain of the novel species is 1DS3-10T (=ACCC 19781T=DSM 29761T).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wolfe, Lothar PhD
2000-03-01
The DOE-Utility Nuclear Power Engineering Education Matching Grant Program has been established to support the education of students in Nuclear Engineering Programs to maintain a knowledgeable workforce in the United States in order to keep nuclear power as a viable component in a mix of energy sources for the country. The involvement of the utility industry ensures that this grant program satisfies the needs and requirements of local nuclear energy producers and at the same time establishes a strong linkage between education and day-to-day nuclear power generation. As of 1997, seventeen pairs of university-utility partners existed. UMCP was never amore » member of that group of universities, but applied for the first time with a proposal to Baltimore Gas and Electric Company in January 1999 [1]. This proposal was generously granted by BG&E [2,3] in the form of a gift in the amount of $25,000 from BG&E's Corporate Contribution Program. Upon the arrival of a newly appointed Director of Administration in the Department of Materials and Nuclear Engineering, the BG&E check was deposited into the University's Maryland Foundation Fund. The receipt of the letter and the check enabled UMCP to apply for DOE's matching funds in the same amount by a proposal.« less
Non-HACEK gram-negative bacillus endocarditis.
Morpeth, Susan; Murdoch, David; Cabell, Christopher H; Karchmer, Adolf W; Pappas, Paul; Levine, Donald; Nacinovich, Francisco; Tattevin, Pierre; Fernández-Hidalgo, Núria; Dickerman, Stuart; Bouza, Emilio; del Río, Ana; Lejko-Zupanc, Tatjana; de Oliveira Ramos, Auristela; Iarussi, Diana; Klein, John; Chirouze, Catherine; Bedimo, Roger; Corey, G Ralph; Fowler, Vance G
2007-12-18
Infective endocarditis caused by non-HACEK (species other than Haemophilus species, Actinobacillus actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, or Kingella species) gram-negative bacilli is rare, is poorly characterized, and is commonly considered to be primarily a disease of injection drug users. To describe the clinical characteristics and outcomes of patients with non-HACEK gram-negative bacillus endocarditis in a large, international, contemporary cohort of patients. Observations from the International Collaboration on Infective Endocarditis Prospective Cohort Study (ICE-PCS) database. 61 hospitals in 28 countries. Hospitalized patients with definite endocarditis. Characteristics of non-HACEK gram-negative bacillus endocarditis cases were described and compared with those due to other pathogens. Among the 2761 case-patients with definite endocarditis enrolled in ICE-PCS, 49 (1.8%) had endocarditis (20 native valve, 29 prosthetic valve or device) due to non-HACEK, gram-negative bacilli. Escherichia coli (14 patients [29%]) and Pseudomonas aeruginosa (11 patients [22%]) were the most common pathogens. Most patients (57%) with non-HACEK gram-negative bacillus endocarditis had health care-associated infection, whereas injection drug use was rare (4%). Implanted endovascular devices were frequently associated with non-HACEK gram-negative bacillus endocarditis compared with other causes of endocarditis (29% vs. 11%; P < 0.001). The in-hospital mortality rate of patients with endocarditis due to non-HACEK gram-negative bacilli was high (24%) despite high rates of cardiac surgery (51%). Because of the small number of patients with non-HACEK gram-negative bacillus endocarditis in each treatment group and the lack of long-term follow-up, strong treatment recommendations are difficult to make. In this large, prospective, multinational cohort, more than one half of all cases of non-HACEK gram-negative bacillus endocarditis were associated with
... It is used similarly to lactobacillus and other probiotics as "beneficial" bacteria. People take Bacillus coagulans for ... intestine. Early evidence shows that using a specific probiotic product (Lactol, Bioplus Life Sciences Pvt. Ltd., India) ...
Spicher, G; Peters, J; Borchers, U
1999-02-01
For the spores of Bacillus subtilis and Bacillus stearothermophilus as well as for spore earth (acc. DIN 58,946 Part 4 of August 1982), the dependence of resistance on the superheating of the steam used to kill germs was determined. A material (glass fibre fleece) was used as the germ carrier which does not superheat on contact with steam. The temperature of the saturated steam was 100 degrees C (B. subtilis) and 120 degrees C (B. stearothermophilus and spore earth). The yardstick for the resistance of the spores or bioindicators was the exposure period of the saturated or superheated steam at which 50% of the treated test objects no longer showed any viable test germs. The spores of Bacillus subtilis were far more sensitive to superheating of steam and reacted far more than the spores of Bacillus stearothermophilus and the germs in the spore earth. When superheating by 4 Kelvin the spores of Bacillus subtilis were approximately 2.5 times more resistant than they were to saturated steam. The resistance of Bacillus stearothermophilus and spore earth was only slightly higher up to superheating by 10 Kelvin. The spores of Bacillus subtilis had the highest resistance during superheating by 29 Kelvin; they were 119 times more resistant than they were to saturated steam. The resistance maximum of the spores of Bacillus stearothermophilus was at an superheating by around 22 Kelvin. However, the spores were only 4.1 times more resistant than they were to saturated steam. When using steam to kill germs, we must expect superheated steam. This raises the question whether the spores of Bacillus stearothermophilus, with their weaker reaction to the superheating of steam, are suitable as test germs for sterilisation with steam in all cases.
Kim, Cho-Won; Go, Ryeo-Eun
2015-01-01
Synthetic pyrethroids (SPs) are the most common pesticides which are recently used for indoor pest control. The widespread use of SPs has resulted in the increased exposure to wild animals and humans. Recently, some SPs are suspected as endocrine disrupting chemicals (EDCs) and have been assessed for their potential estrogenicity by adopting various analyzing assays. In this study, we examined the estrogenic effects of lambda-cyhalothrin (LC) and cypermethrin (CP), the most commonly used pesticides in Korea, using BG-1 ovarian cancer cells expressing estrogen receptors (ERs). To evaluate the estrogenic activities of two SPs, LC and CP, we employed MTT assay and reverse-transcription polymerase chain reaction (RT-PCR) in LC or CP treated BG-1 ovarian cancer cells. In MTT assay, LC (10−6 M) and CP (10−5 M) significantly induced the growth of BG-1 cancer cells. LC or CP-induced cell growth was antagonized by addition of ICI 182,720 (10−8 M), an ER antagonist, suggesting that this effect appears to be mediated by an ER-dependent manner. Moreover, RT-PCR results showed that transcriptional level of cyclin D1, a cell cycle-regulating gene, was significantly up-regulated by LC and CP, while these effects were reversed by co-treatment of ICI 182,780. However, p21, a cyclin D-ckd-4 inhibitor gene, was not altered by LC or CP. Moreover, ERα expression was not significantly changed by LC and CP, while downregulated by E2. Finally, in xenografted mouse model transplanted with human BG-1 ovarian cancer cells, E2 significantly increased the tumor volume compare to a negative control, but LC did not. Taken together, these results suggest that LC and CP may possess estrogenic potentials by stimulating the growth of BG-1 ovarian cancer cells via partially ER signaling pathway associated with cell cycle as did E2, but this estrogenic effect was not found in in vivo mouse model. PMID:26877835
Real-Time PCR Assay for a Unique Chromosomal Sequence of Bacillus anthracis
2004-12-01
13061 Neisseria lactamica .............................................................. 23970 Bacillus coagulans ...NEG Bacillus coagulane 7050 NEG NEG Bacillus cereus 13472 NEG NEG Bacillus licheniforms 12759 NEG NEG Bacillus cereus 13824 NEG NEG Bacillus ...Assay for a Unique Chromosomal Sequence of Bacillus anthracis Elizabeth Bode,1 William Hurtle,2† and David Norwood1* United States Army Medical
Bacillus beijingensis sp. nov. and Bacillus ginsengi sp. nov., isolated from ginseng root.
Qiu, Fubin; Zhang, Xiaoxia; Liu, Lin; Sun, Lei; Schumann, Peter; Song, Wei
2009-04-01
Four alkaligenous, moderately halotolerant strains, designated ge09, ge10(T), ge14(T) and ge15, were isolated from the internal tissue of ginseng root and their taxonomic positions were investigated by using a polyphasic approach. Cells of the four strains were Gram-positive-staining, non-motile, short rods. Phylogenetic analysis based on 16S rRNA gene sequences showed that strains ge09 and ge10(T) formed one cluster and strains ge14(T) and ge15 formed another separate cluster within the genus Bacillus. 16S rRNA gene sequence similarities with type strains of other Bacillus species were less than 97 %. Levels of DNA-DNA relatedness among the four strains showed that strains ge09 and ge10(T) and strains ge14(T) and ge15 belonged to two separate species; the mean level of DNA-DNA relatedness between ge10(T) and ge14(T) was only 28.7 %. Their phenotypic and physiological properties supported the view that the two strains represent two different novel species of the genus Bacillus. The DNA G+C contents of strains ge10(T) and ge14(T) were 49.9 and 49.6 mol%, respectively. Strains ge10(T) and ge14(T) showed the peptidoglycan type A4alpha l-Lys-d-Glu. The lipids present in strains ge10(T) and ge14(T) were diphosphatidylglycerol, phosphatidylglycerol, a minor amount of phosphatidylcholine and two unknown phospholipids. Their predominant respiratory quinone was MK-7. The fatty acid profiles of the four novel strains contained large quantities of branched and saturated fatty acids. The predominant cellular fatty acids were iso-C(15 : 0) (42.5 %), anteiso-C(15 : 0) (22.2 %), anteiso-C(17 : 0) (7.3 %) and C(16 : 1)omega7c alcohol (5.7 %) in ge10(T) and iso-C(15 : 0) (50.7 %) and anteiso-C(15 : 0) (20.1 %) in ge14(T). On the basis of their phenotypic properties and phylogenetic distinctiveness, two novel species of the genus Bacillus are proposed, Bacillus beijingensis sp. nov. (type strain ge10(T) =DSM 19037(T) =CGMCC 1.6762(T)) and Bacillus ginsengi sp. nov. (type strain ge14
Capsule Depolymerase Overexpression Reduces Bacillus anthracis Virulence
2010-01-01
protein that autocatalytically forms a heterodimer consisting of 35 kDa and 15 kDa subunits. CapD shares 32 % identity with the Bacillus subtilis GGT and 35...Immun 49, 291–297. Kimura, K., Tran, L. S., Uchida, I. & Itoh, Y. (2004). Characterization of Bacillus subtilis gamma-glutamyltransferase and its...Capsule depolymerase overexpression reduces Bacillus anthracis virulence Angelo Scorpio,3 Donald J. Chabot, William A. Day,4 Timothy A. Hoover and
Credit BG. View looking northeast at southwestern side of Test ...
Credit BG. View looking northeast at southwestern side of Test Stand "D" complex. Test Stand "D" workshop (Building 4222/E-23) is at left; shed to its immediate right is an entrance to underground tunnel system which interconnects all test stands. To the right of Test Stand "D" tower are four Clayton water-tube flash boilers once used in the Steam Generator Plant 4280/E-81 to power the vacuum ejector system at "D" and "C" stands. A corner of 4280/E-81 appears behind the boilers. Boilers were removed as part of stand dismantling program. The Dv (vertical vacuum) Test Cell is located in the Test Stand "D" tower, behind the sunscreen on the west side. The top of the tower contains a hoist for lifting or lowering rocket engines into the Dv Cell. Other equipment mounted in the tower is part of the steam-driven vacuum ejector system - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
1. Credit BG. View looking southeast down onto roof and ...
1. Credit BG. View looking southeast down onto roof and the north and west facades of Steam Generator Plant, Building 4280/E-81. Vents on roof were from gas-fired steam generators. Pipes emerging from north facade are for steam. Elevated narrow tray is for electrical cables. To lower left of image (immediate north of 4280/E-81) is concrete-lined pond originally built to neutralize rocket engine exhaust compounds; it was only used as a cooling pond. To the lower right of this image are concrete pads which held two 7,500 gallon feedwater tanks for the boilers in 4280/E-81; these tanks were transferred to another federal space science organization and removed from the JPL compound in 1994. Beyond 4280/E-81 to the upper left is a reclamation pond. ... - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Steam Generator Plant, Edwards Air Force Base, Boron, Kern County, CA
Gomes-Pepe, Elisângela Soares; Machado Sierra, Elwi Guillermo; Pereira, Mariana Rangel; Castellane, Tereza Cristina Luque
2016-01-01
New ß-glucosidases with product (glucose) or ethanol tolerances are greatly desired to make industrial processes more marketable and efficient. Therefore, this report describes the in silico/vitro characterization of Bg10, a metagenomically derived homodimeric ß-glucosidase that exhibited a Vmax of 10.81 ± 0.43 μM min-1, Kcat of 175.1± 6.91 min-1, and Km of 0.49 ± 0.12 mM at a neutral pH and 37°C when pNP-ß-D-glucopyranoside was used as the substrate, and the enzyme retained greater than 80% activity within the respective pH and temperature ranges of 6.5 to 8.0 and 35 to 40°C. The enzyme was stimulated by its product, glucose; consequently, the Bg10 activity against 50 and 100 mM of glucose were increased by 36.8% and 22%, respectively, while half of the activity was retained at 350 mM. Moreover, the Bg10 was able to hydrolyse 55% (milk sample) and 100% (purified sugar) of the lactose at low (6°C) and optimum (37°C) temperatures, respectively, suggesting the possibility of further optimization of the reaction for lactose-free dairy production. In addition, the enzyme was able to fully hydrolyse 40 mM of cellobiose at one hour and was tolerant to ethanol up to concentrations of 500 mM (86% of activity), while a 1 M concentration still resulted in 41% residual activity, which could be interesting for biofuel production. PMID:28002476
Dobson, Rosie; Whittaker, Robyn; Jiang, Yannan; Shepherd, Matthew; Maddison, Ralph; Carter, Karen; Cutfield, Richard; McNamara, Catherine; Khanolkar, Manish; Murphy, Rinki
2016-04-02
Addressing the increasing prevalence, and associated disease burden, of diabetes is a priority of health services internationally. Interventions to support patients to effectively self-manage their condition have the potential to reduce the risk of costly and debilitating complications. The utilisation of mobile phones to deliver self-management support allows for patient-centred care at the frequency and intensity that patients desire from outside the clinic environment. Self-Management Support for Blood Glucose (SMS4BG) is a novel text message-based intervention for supporting people with diabetes to improve self-management behaviours and achieve better glycaemic control and is tailored to individual patient preferences, demographics, clinical characteristics, and culture. This study aims to assess whether SMS4BG can improve glycaemic control in adults with poorly controlled diabetes. This paper outlines the rationale and methods of the trial. A two-arm, parallel, randomised controlled trial will be conducted across New Zealand health districts. One thousand participants will be randomised at a 1:1 ratio to receive SMS4BG, a theoretically based and individually tailored automated text message-based diabetes self-management support programme (intervention) in addition to usual care, or usual care alone (control). The primary outcome is change in glycaemic control (HbA1c) at 9 months. Secondary outcomes include glycaemic control at 3 and 6 months, self-efficacy, self-care behaviours, diabetes distress, health-related quality of life, perceived social support, and illness perceptions. Cost information and healthcare utilisation will also be collected as well as intervention satisfaction and interaction. This study will provide information on the effectiveness of a text message-based self-management support tool for people with diabetes. If found to be effective it has the potential to provide individualised support to people with diabetes across New Zealand (and
Molecular epidemiology of HIV type 1 in Mexico: emergence of BG and BF intersubtype recombinants.
Vázquez-Valls, Eduardo; Escoto-Delgadillo, Martha; López-Márquez, Francisco Carlos; Castillero-Manzano, Marcelo; Echegaray-Guerrero, Ernesto; Bitzer-Quintero, Oscar Kurt; Kobayashi-Gutiérrez, Antonio; Torres-Mendoza, Blanca Miriam
2010-07-01
The molecular epidemiology of subtypes and intersubtype recombinants (IRs) of human immunodeficiency virus type 1 (HIV-1) in Mexico has not been characterized fully. Understanding its regional distribution, prevalence, adaptability, viral fitness, pathogenicity, and immunogenicity is decisive for any design of an effective HIV vaccine. The aim of this study was to describe the presence of IRs types BG and BF in a Mexican population. Protease and reverse transcriptase regions of the pol gene were sequenced using an automated sequencing system. A phylogenic tree was constructed and genetic distances were calculated using MEGA 3.1. Recombination analysis was done by bootscan using SimPlot software. Two hundred and twenty-three HIV-1-positive individuals were enrolled in the study. At baseline, the mean plasma viral load was 285,500 HIV-1 RNA copies/ml and the mean CD4 cell count was 213 cells/ml. Subtype B was found in 220 (98.6%) samples, whereas IRs were found in three patients (1.4%): two (0.9%) with BG and one (0.45%) with BF. IRs were observed in 2/124 (1.6%) samples from treated patients and in 1/99 (1.0%) from naive patients. The presence of these HIV forms at low frequency points to the need for research on the diversity, geographic distribution, and evolution of other subtypes including circulating recombinant forms and IRs to understand the molecular epidemiology and tendencies of the HIV infection in Mexico.
Johnson, Kenneth A.; Ve, Thomas; Larsen, Øivind; Pedersen, Rolf B.; Lillehaug, Johan R.; Jensen, Harald B.; Helland, Ronny; Karlsen, Odd A.
2014-01-01
CorA is a copper repressible protein previously identified in the methanotrophic bacterium Methylomicrobium album BG8. In this work, we demonstrate that CorA is located on the cell surface and binds one copper ion per protein molecule, which, based on X-ray Absorption Near Edge Structure analysis, is in the reduced state (Cu(I)). The structure of endogenously expressed CorA was solved using X-ray crystallography. The 1.6 Å three-dimensional structure confirmed the binding of copper and revealed that the copper atom was coordinated in a mononuclear binding site defined by two histidines, one water molecule, and the tryptophan metabolite, kynurenine. This arrangement of the copper-binding site is similar to that of its homologous protein MopE* from Metylococcus capsulatus Bath, confirming the importance of kynurenine for copper binding in these proteins. Our findings show that CorA has an overall fold similar to MopE, including the unique copper(I)-binding site and most of the secondary structure elements. We suggest that CorA plays a role in the M. album BG8 copper acquisition. PMID:24498370
Haldar, Lopamudra; Gandhi, D. N.
2016-01-01
Aim: To investigate the effect of oral administration of two Bacillus strains on fecal coliforms, Lactobacillus and Bacillus spp. in rat animal model. Materials and Methods: An in vivo experiment was conducted for 49-day period on 36 adult male albino Wister rats divided equally into to four groups. After 7-day adaptation period, one group (T1) was fed on sterile skim milk along with basal diet for the next 28 days. Second (T2) and (T3) groups received spore biomass of Bacillus coagulans B37 and Bacillus pumilus B9, respectively, suspended in sterilized skim milk at 8-9 log colony-forming units/ml plus basal diet for 28 days, while control group (T4) was supplied with clean water along with basal diet. There was a 14-day post-treatment period. A total of 288 fecal samples (8 fecal collections per rat) were collected at every 7-day interval starting from 0 to 49 days and subjected to the enumeration of the counts of coliforms and lactobacilli and Bacillus spores using respective agar media. In vitro acid and bile tolerance tests on both the strains were performed. Results: The rats those (T2 and T3) received either B. coagulans B37 or B. pumilus B9 spore along with non-fermented skim milk showed decrease (p<0.01) in fecal coliform counts and increase (p<0.05) in both fecal lactobacilli and Bacillus spore counts as compared to the control group (T4) and the group fed only skim milk (T1). In vitro study indicated that both the strains were found to survive at pH 2.0 and 3.0 even up to 3 h and tolerate bile up to 2.0% concentration even after 12 h of exposure. Conclusions: This study revealed that oral administration of either B. coagulans B37 or B. pumilus B9 strains might be useful in reducing coliform counts accompanied by concurrent increase in lactobacilli counts in the intestinal flora in rats. PMID:27536040
Haldar, Lopamudra; Gandhi, D N
2016-07-01
To investigate the effect of oral administration of two Bacillus strains on fecal coliforms, Lactobacillus and Bacillus spp. in rat animal model. An in vivo experiment was conducted for 49-day period on 36 adult male albino Wister rats divided equally into to four groups. After 7-day adaptation period, one group (T1) was fed on sterile skim milk along with basal diet for the next 28 days. Second (T2) and (T3) groups received spore biomass of Bacillus coagulans B37 and Bacillus pumilus B9, respectively, suspended in sterilized skim milk at 8-9 log colony-forming units/ml plus basal diet for 28 days, while control group (T4) was supplied with clean water along with basal diet. There was a 14-day post-treatment period. A total of 288 fecal samples (8 fecal collections per rat) were collected at every 7-day interval starting from 0 to 49 days and subjected to the enumeration of the counts of coliforms and lactobacilli and Bacillus spores using respective agar media. In vitro acid and bile tolerance tests on both the strains were performed. The rats those (T2 and T3) received either B. coagulans B37 or B. pumilus B9 spore along with non-fermented skim milk showed decrease (p<0.01) in fecal coliform counts and increase (p<0.05) in both fecal lactobacilli and Bacillus spore counts as compared to the control group (T4) and the group fed only skim milk (T1). In vitro study indicated that both the strains were found to survive at pH 2.0 and 3.0 even up to 3 h and tolerate bile up to 2.0% concentration even after 12 h of exposure. This study revealed that oral administration of either B. coagulans B37 or B. pumilus B9 strains might be useful in reducing coliform counts accompanied by concurrent increase in lactobacilli counts in the intestinal flora in rats.
Zhu, Peijuan; Ding, Wei; Tong, Wei; Ghosal, Anima; Alton, Kevin; Chowdhury, Swapan
2009-06-01
A retention-time-shift-tolerant background subtraction and noise reduction algorithm (BgS-NoRA) is implemented using the statistical programming language R to remove non-drug-related ion signals from accurate mass liquid chromatography/mass spectrometry (LC/MS) data. The background-subtraction part of the algorithm is similar to a previously published procedure (Zhang H and Yang Y. J. Mass Spectrom. 2008, 43: 1181-1190). The noise reduction algorithm (NoRA) is an add-on feature to help further clean up the residual matrix ion noises after background subtraction. It functions by removing ion signals that are not consistent across many adjacent scans. The effectiveness of BgS-NoRA was examined in biological matrices by spiking blank plasma extract, bile and urine with diclofenac and ibuprofen that have been pre-metabolized by microsomal incubation. Efficient removal of background ions permitted the detection of drug-related ions in in vivo samples (plasma, bile, urine and feces) obtained from rats orally dosed with (14)C-loratadine with minimal interference. Results from these experiments demonstrate that BgS-NoRA is more effective in removing analyte-unrelated ions than background subtraction alone. NoRA is shown to be particularly effective in the early retention region for urine samples and middle retention region for bile samples, where the matrix ion signals still dominate the total ion chromatograms (TICs) after background subtraction. In most cases, the TICs after BgS-NoRA are in excellent qualitative correlation to the radiochromatograms. BgS-NoRA will be a very useful tool in metabolite detection and identification work, especially in first-in-human (FIH) studies and multiple dose toxicology studies where non-radio-labeled drugs are administered. Data from these types of studies are critical to meet the latest FDA guidance on Metabolite in Safety Testing (MIST). Copyright (c) 2009 John Wiley & Sons, Ltd.
[Screening and antibacterial function of Bacillus amyloliquefaciens X030].
He, Hao; Zhu, Yingling; Chi, Liqing; Zhao, Zizhao; Wang, Ting; Zuo, Mingxing; Zhang, Tong; Zhou, Fengjuan; Xia, Liqiu; Ding, Xuezhi
2015-09-04
We isolated 339 bacillus strains from 72 soil samples all over the country, then purified their antimicrobial compounds and studied the antibacterial activity, to enrich bacillus resources and explore their second metabolites. A bacillus strain with strong antibacterial activity was selected by dilution plate and water bath heating from a soil sample from a peanut plantation in Henan Province; this strain was identified according to morphological observation, physiological and biochemical characteristics, and consequences of 16S rRNA homologous analysis. Antibacterial compound from the identified strain, Bacillus amyloliquefaciens X030, was separated and purified by acetone precipitation, Sephadex chromatography, C18 reverse phase column chromatography. Its molecular weight was analyzed by LC-MS/MS. The antibacterial activity was characterized by disc diffusion and plate two-way cultivation. Bacillus amyloliquefaciens was isolated that not only has antibacterial activity against Staphylococcus aureus, Candida albican and Saccharomycetes; but also against Pyriculariaoryzae, Chili pointed cell anthrax, Gloeosporium eriobotryae speg and Phytophthora parasitica. The compound was confirmed as polypeptide. Bacillus amyloliquefaciens X030 can produce a polypeptide that inhibits pathogenic bacteria and plant pathogenic fungi.
Tobe, Seiichi; Shimogaki, Hisao; Ohdera, Motoyasu; Asai, Yoshio; Oba, Kenkichi; Iwama, Masanori; Irie, Masachika
2006-01-01
An attempt was made to express protease BYA produced by an alkalophilic Bacillus sp. Y in Bacillus subtilis by gene engineering methods. The gene encoding protease BYA was cloned from Bacillus sp. Y, and expression vector pTA71 was constructed from the amylase promoter of Bacillus licheniformis, DNA fragments encoding the open reading frame of protease BYA, and pUB110. Protease BYA was secreted at an activity level of 5100 APU/ml in the common industrial culture medium of Bacillus subtilis transformed with pTA71. We then attempted to increase the specific activity of protease BYA by site-directed mutagenesis. Amino acid residue Ala29 next to catalytic Asp30 was replaced by one of three uncharged amino acid residues (Val29, Leu29, Ile29), and each mutant enzyme was expressed and isolated from the culture medium. Val29 mutant enzyme was secreted at an activity level of greater than 7000 APU/ml in culture medium, and its specific activity was 1.5-fold higher than that of the wild-type enzyme. Other mutant enzymes had specific activity similar to that of the original one and were less stabile than the wild-type enzyme. It can be thought that the substitution at amino acid residue 29 affects the level of activity and stability of protease BYA.
Potential of Bacillus spp produces siderophores insuppressing thewilt disease of banana plants
NASA Astrophysics Data System (ADS)
Kesaulya, H.; Hasinu, J. V.; Tuhumury, G. NC
2018-01-01
In nature, different types of siderophore such as hydroxymate, catecholets and carboxylate, are produced by different bacteria. Bacillus spp were isolated from potato rhizospheric soil can produce siderophore of both catecholets and salicylate type with different concentrations. Various strains of Bacillus spp were tested for pathogen inhibition capability in a dual culture manner. The test results showed the ability of inhibition of pathogen isolated from banana wilt disease. From the result tested were found Bacillus niabensis Strain PT-32-1, Bacillus subtilis Strain SWI16b, Bacillus subtilis Strain HPC21, Bacillus mojavensis Strain JCEN3, and Bacillus subtilis Strain HPC24 showed different capabilities in suppressing pathogen.
Aims: To evaluate the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface materials using hydrogen peroxide gas. Methods and Results: B. anthracis, B. subtilis, and G. Stearothermophilus spores were dried on seven...
Laser-induced speckle scatter patterns in Bacillus colonies
Kim, Huisung; Singh, Atul K.; Bhunia, Arun K.; Bae, Euiwon
2014-01-01
Label-free bacterial colony phenotyping technology called BARDOT (Bacterial Rapid Detection using Optical scattering Technology) provided successful classification of several different bacteria at the genus, species, and serovar level. Recent experiments with colonies of Bacillus species provided strikingly different characteristics of elastic light scatter (ELS) patterns, which were comprised of random speckles compared to other bacteria, which are dominated by concentric rings and spokes. Since this laser-based optical sensor interrogates the whole volume of the colony, 3-D information of micro- and macro-structures are all encoded in the far-field scatter patterns. Here, we present a theoretical model explaining the underlying mechanism of the speckle formation by the colonies from Bacillus species. Except for Bacillus polymyxa, all Bacillus spp. produced random bright spots on the imaging plane, which presumably dependent on the cellular and molecular organization and content within the colony. Our scatter model-based analysis revealed that colony spread resulting in variable surface roughness can modify the wavefront of the scatter field. As the center diameter of the Bacillus spp. colony grew from 500 to 900 μm, average speckles area decreased two-fold and the number of small speckles increased seven-fold. In conclusion, as Bacillus colony grows, the average speckle size in the scatter pattern decreases and the number of smaller speckle increases due to the swarming growth characteristics of bacteria within the colony. PMID:25352840
Yuan, Hong; Frank, Jonathan E; Merrill, Joseph R; Hillesheim, Daniel A; Khachaturian, Mark H; Anzellotti, Atilio I
2016-01-01
The hypoxia PET tracer, 1-[18F]fluoro-3-(2-nitro-1Himidazol- 1-yl)-propan-2-ol ([18F]FMISO) is the first radiotracer developed for hypoxia PET imaging and has shown promising for cancer diagnosis and prognosis. However, access to [18F]FMISO radiotracer is limited due to the needed cyclotron and radiochemistry expertise. The study aimed to develop the automated production method on the [18F]FMISO radiotracer with the novel fully automated platform of the BG75 system and validate its usage on animal tumor models. [18F]FMISO was produced with the dose synthesis cartridge automatically on the BG75 system. Validation of [18F]FMISO hypoxia imaging functionality was conducted on two tumor mouse models (FaDu/U87 tumor). The distribution of [18F]FMISO within tumor was further validated by the standard hypoxia marker EF5. The average radiochemical purity was (99±1) % and the average pH was 5.5±0.2 with other quality attributes passing standard criteria (n=12). Overall biodistribution for [18F]FMISO in both tumor models was consistent with reported studies where bladder and large intestines presented highest activity at 90 min post injection. High spatial correlation was found between [18F]FMISO autoradiography and EF5 hypoxia staining, indicating high hypoxia specificity of [18MF]FMISO. This study shows that qualified [18F]FMISO can be efficiently produced on the BG75 system in an automated "dose-on-demand" mode using single dose disposable cards. The possibilities of having a low-cost, automated system manufacturing ([18F]Fluoride production + synthesis + QC) different radiotracers will greatly enhance the potential for PET technology to reach new geographical areas and underserved patient populations. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Bacillus As Potential Probiotics: Status, Concerns, and Future Perspectives
Elshaghabee, Fouad M. F.; Rokana, Namita; Gulhane, Rohini D.; Sharma, Chetan; Panwar, Harsh
2017-01-01
Spore-forming bacilli are being explored for the production and preservation of food for many centuries. The inherent ability of production of large number of secretory proteins, enzymes, antimicrobial compounds, vitamins, and carotenoids specifies the importance of bacilli in food chain. Additionally, Bacillus spp. are gaining interest in human health related functional food research coupled with their enhanced tolerance and survivability under hostile environment of gastrointestinal tract. Besides, bacilli are more stable during processing and storage of food and pharmaceutical preparations, making them more suitable candidate for health promoting formulations. Further, Bacillus strains also possess biotherapeutic potential which is connected with their ability to interact with the internal milieu of the host by producing variety of antimicrobial peptides and small extracellular effector molecules. Nonetheless, with proposed scientific evidences, commercial probiotic supplements, and functional foods comprising of Bacillus spp. had not gained much credential in general population, since the debate over probiotic vs pathogen tag of Bacillus in the research and production terrains is confusing consumers. Hence, it’s important to clearly understand the phenotypic and genotypic characteristics of selective beneficial Bacillus spp. and their substantiation with those having GRAS status, to reach a consensus over the same. This review highlights the probiotic candidature of spore forming Bacillus spp. and presents an overview of the proposed health benefits, including application in food and pharmaceutical industry. Moreover, the growing need to evaluate the safety of individual Bacillus strains as well as species on a case by case basis and necessity of more profound analysis for the selection and identification of Bacillus probiotic candidates are also taken into consideration. PMID:28848511
Ouoba, Labia Irene I; Thorsen, Line; Varnam, Alan H
2008-06-10
The ability of various species of Bacillus from fermented seeds of Parkia biglobosa known as African locust bean (Soumbala) and fermented seeds of Hibiscus sabdariffa (Bikalga) was investigated. The study included screening of the isolates by haemolysis on blood agar, detection of toxins in broth and during the fermentation of African locust bean using the Bacillus cereus Enterotoxin Reverse Passive Latex Agglutination test kit (BCET-RPLA) and the Bacillus Diarrhoeal Enterotoxin Visual Immunoassay (BDEVIA). Detection of genes encoding cytotoxin K (CytK), haemolysin BL (Hbl A, Hbl C, Hbl D), non-hemolytic enterotoxin (NheA, NheB, NheC) and EM1 specific of emetic toxin producers was also investigated using PCR with single pair and multiplex primers. Of 41 isolates, 29 Bacillus belonging to the species of B. cereus, Bacillus subtilis, Bacillus licheniformis and Bacillus pumilus showed haemolysis on blood agar. Using RPLA, enterotoxin production was detected for three isolates of B. cereus in broth and all B. cereus (9) in fermented seeds. Using BDEVIA, enterotoxin production was detected in broth as well as in fermented seeds for all B. cereus isolates. None of the isolates belonging to the other Bacillus species was able to produce enterotoxins either by RPLA or BDEVIA. Nhe genes were detected in all B. cereus while Hbl and CytK genes were detected respectively in five and six B. cereus strains. A weak presence of Hbl (A, D) and CytK genes was detected in two isolates of B. subtilis and one of B. licheniformis but results were inconsistent, especially for Hbl genes. The emetic specific gene fragment EM1 was not detected in any of the isolates studied.
Gama, Renata Antonaci; da Silva, Ivoneide Maria; Geier, Martin; Eiras, Álvaro Eduardo
2013-01-01
Although the human-landing catch (HLC) method is the most effective for collecting anthropophilic anophelines, it has been increasingly abandoned, primarily for ethical considerations. The objective of the present study was to develop a new trap for the collection of Anopheles darlingi . The initial trials were conducted using the BG-Sentinel trap as a standard for further trap development based on colour, airflow direction and illumination. The performance of the trap was then compared with those of the CDC, Fay-Prince, counterflow geometry trap (CFG) and HLC. All trials were conducted outdoors between 06:00 pm-08:00 pm. Female specimens of An. darlingi were dissected to determine their parity. A total of 8,334 anophelines were captured, of which 4,945 were identified as An. darlingi . The best trap configuration was an all-white version, with an upward airflow and no required light source. This configuration was subsequently named BG-Malaria (BGM). The BGM captured significantly more anophelines than any of the other traps tested and was similar to HLC with respect to the number and parity of anophelines. The BGM trap can be used as an alternative to HLC for collecting anophelines. PMID:24037199
Biodegradation of naphthalene and phenanthren by Bacillus subtilis 3KP
NASA Astrophysics Data System (ADS)
Ni'matuzahroh, Trikurniadewi, N.; Pramadita, A. R. A.; Pratiwi, I. A.; Salamun, Fatimah, Sumarsih, Sri
2017-06-01
The purposes of this research were to know growth response, degradation ability, and uptake mechanism of naphthalene and phenanthrene by Bacillus subtilis 3KP. Bacillus subtilis 3KP was grown on Mineral Synthetic (MS) medium with addition of 1% yeast extract and naphthalene and phenanthrene respectively 200 ppm in different cultures. Bacillus subtilis 3KP growth response was monitored by Total Plate Count (TPC) method, the degradation ability was monitored by UV-Vis spectrophotometer, and the uptake mechanism of hydrocarbon was monitored by emulsification activity, decrease of surface tension, and activity of Bacterial Adherence to Hydrocarbon (BATH). Bacillus subtilis 3KP was able to grow and show biphasic growth pattern on both of substrates. Naphthalene and phenanthrene were used as a carbon source for Bacillus subtilis 3KP growth that indicated by the reduction of substrate concomitant with the growth. At room temperature conditions (± 30°C) and 90 rpm of agitation for 7 days, Bacillus subtilis 3KP could degrade naphthalene in the amount of 70.5% and phenanthrene in the amount of 24.8%. Based on the analysis of UV-Vis spectrophotometer, three metabolites, 1-hydroxy-2-naphthoic acid, salicylic acid, and pyrocatechol were found in both cultures. The metabolite identification became basis of propose degradation pathway of naphthalene and phenanthrene by Bacillus subtilis 3KP. The results of hydrocarbon uptake mechanism test show that Bacillus subtilis 3KP used all of the mechanism to degrade naphthalene and phenanthrene.
Lee, Nam Keun; Yeo, In-Cheol; Park, Joung Whan; Kang, Byung-Sun; Hahm, Young Tae
2010-09-01
In this study, an effective substance was isolated from Bacillus subtilis SC-8, which was obtained from traditionally fermented soybean paste, cheonggukjang. The substance was purified by HPLC, and its properties were analyzed. It had an adequate antagonistic effect on Bacilluscereus, and its spectrum of activity was narrow. When tested on several gram-negative and gram-positive foodborne pathogenic bacteria such as Salmonella enterica, Salmonella enteritidis, Staphylococcus aureus, and Listeria monocytogenes, no antagonistic effect was observed. Applying the derivative from B. subtilis SC-8 within the same genus did not inhibit the growth of major soybean-fermenting bacteria such as Bacillus subtilis, Bacillus licheniformis, and Bacillus amyloquefaciens. The range of pH stability of the purified antagonistic substance was wide (from 4.0 to >10.0), and the substance was thermally stable up to 60 degrees C. In the various enzyme treatments, the antagonistic activity of the purified substance was reduced with proteinase K, protease, and lipase; its activity was partially destroyed with esterase. Spores of B. cereus did not grow at all in the presence of 5mug/mL of the purified antagonistic substance. The isolated antagonistic substance was thought to be an antibiotic-like lipopeptidal compound and was tentatively named BSAP-254 because it absorbed to UV radiation at 254nm. Copyright 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
In Vitro Assessment of Marine Bacillus for Use as Livestock Probiotics
Prieto, Maria Luz; O’Sullivan, Laurie; Tan, Shiau Pin; McLoughlin, Peter; Hughes, Helen; Gutierrez, Montserrat; Lane, Jonathan A.; Hickey, Rita M.; Lawlor, Peadar G.; Gardiner, Gillian E.
2014-01-01
Six antimicrobial-producing seaweed-derived Bacillus strains were evaluated in vitro as animal probiotics, in comparison to two Bacillus from an EU-authorized animal probiotic product. Antimicrobial activity was demonstrated on solid media against porcine Salmonella and E. coli. The marine isolates were most active against the latter, had better activity than the commercial probiotics and Bacillus pumilus WIT 588 also reduced E. coli counts in broth. All of the marine Bacillus tolerated physiological concentrations of bile, with some as tolerant as one of the probiotics. Spore counts for all isolates remained almost constant during incubation in simulated gastric and ileum juices. All of the marine Bacillus grew anaerobically and the spores of all except one isolate germinated under anaerobic conditions. All were sensitive to a panel of antibiotics and none harbored Bacillus enterotoxin genes but all, except B. pumilus WIT 588, showed some degree of β-hemolysis. However, trypan blue dye exclusion and xCELLigence assays demonstrated a lack of toxicity in comparison to two pathogens; in fact, the commercial probiotics appeared more cytotoxic than the majority of the marine Bacillus. Overall, some of the marine-derived Bacillus, in particular B. pumilus WIT 588, demonstrate potential for use as livestock probiotics. PMID:24796302
Khowal, Sapna; Siddiqui, Md Zulquarnain; Ali, Shadab; Khan, Mohd Taha; Khan, Mather Ali; Naqvi, Samar Husain; Wajid, Saima
2017-02-01
The study involves isolation of arsenic resistant bacteria from soil samples. The characterization of bacteria isolates was based on 16S rRNA gene sequences. The phylogenetic consanguinity among isolates was studied employing rpoB and gltX gene sequence. RAPD-PCR technique was used to analyze genetic similarity between arsenic resistant isolates. In accordance with the results Bacillus subtilis and Bacillus pumilus strains may exhibit extensive horizontal gene transfer. Arsenic resistant potency in Bacillus sonorensis and high arsenite tolerance in Bacillus pumilus strains was identified. The RAPD-PCR primer OPO-02 amplified a 0.5kb DNA band specific to B. pumilus 3ZZZ strain and 0.75kb DNA band specific to B. subtilis 3PP. These unique DNA bands may have potential use as SCAR (Sequenced Characterized Amplified Region) molecular markers for identification of arsenic resistant B. pumilus and B. subtilis strains. Copyright © 2016 Elsevier Inc. All rights reserved.
Credit BG. View looking northeast down from the tower onto ...
Credit BG. View looking northeast down from the tower onto the two horizontal test stations at Test Stand "D." Station Dy is at the far left (Dy vacuum cell out of view), with in-line exhaust gas cooling sections and steam-driven "air ejector" (or evacuator) discharging engine exhausts to the east. The Dd cell is visible at the lower left, and the Dd exhaust train has the same functions as at Dy. The spherical tank is an electrically heated "accumulator" which supplies steam to the ejectors at Dv, Dd, and Dy stations. Other large piping delivered cooling water to the horizontal train cooling sections. The horizontal duct at the "Y" branch in the Dd train connects the Dd ejector to the Dv and Cv vacuum duct system (a blank can be bolted into this duct to isolate the Dd system). The shed roof for the Dpond test station appears at bottom center of this image. The open steel frame to the lower left of the image supports a hoist and crane for installing or removing test engines from the Dd test cell - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
3. Credit BG. The interior of the control room appears ...
3. Credit BG. The interior of the control room appears in this view, looking north (0°). The control console in the room center permitted remote control of various propellant grinders and mixers in surrounding buildings. Television monitors (absent from their mounts in this view) permitted direct viewing of operating machinery. From foreground to background: Panel (1) contains OGAR warning light switches for Curing Buildings E-39, E-40, E-41 and E-86; (O=off, G=green safe, A=amber caution, R=red danger) Panel (2) E-85 Oxidizer Dryer Building console: OGAR switch Panel (3) E-84 Oxidizer Grinder Building console: controls for vibrator, feed, and hammer; Panel (4) E-36 Oxidizer Grinder Building console: controls for vibrator, feed, hammer, attritor, and SWECO ("SWECO" undefined) Panels (5) & (6) blank Panel (7) E-38 Mixer & Casting Building console: vacuum pump, blender, heating and cooling controls Panel (8) E-37 Mixer & Casting Building console: motor controls for 1 pint, 1 gallon, 5 gallon and 30 gallon mixers; vacuum pump, deluge (fire suppression), pot up/down, vibrator, feed, and SWECO. - Jet Propulsion Laboratory Edwards Facility, Weigh & Control Building, Edwards Air Force Base, Boron, Kern County, CA
Identification of Bacillus Strains for Biological Control of Catfish Pathogens
Ran, Chao; Carrias, Abel; Williams, Malachi A.; Capps, Nancy; Dan, Bui C. T.; Newton, Joseph C.; Kloepper, Joseph W.; Ooi, Ei L.; Browdy, Craig L.; Terhune, Jeffery S.; Liles, Mark R.
2012-01-01
Bacillus strains isolated from soil or channel catfish intestine were screened for their antagonism against Edwardsiella ictaluri and Aeromonas hydrophila, the causative agents of enteric septicemia of catfish (ESC) and motile aeromonad septicaemia (MAS), respectively. Twenty one strains were selected and their antagonistic activity against other aquatic pathogens was also tested. Each of the top 21 strains expressed antagonistic activity against multiple aquatic bacterial pathogens including Edwardsiella tarda, Streptococcus iniae, Yersinia ruckeri, Flavobacterium columnare, and/or the oomycete Saprolegnia ferax. Survival of the 21 Bacillus strains in the intestine of catfish was determined as Bacillus CFU/g of intestinal tissue of catfish after feeding Bacillus spore-supplemented feed for seven days followed by normal feed for three days. Five Bacillus strains that showed good antimicrobial activity and intestinal survival were incorporated into feed in spore form at a dose of 8×107 CFU/g and fed to channel catfish for 14 days before they were challenged by E. ictaluri in replicate. Two Bacillus subtilis strains conferred significant benefit in reducing catfish mortality (P<0.05). A similar challenge experiment conducted in Vietnam with four of the five Bacillus strains also showed protective effects against E. ictaluri in striped catfish. Safety of the four strains exhibiting the strongest biological control in vivo was also investigated in terms of whether the strains contain plasmids or express resistance to clinically important antibiotics. The Bacillus strains identified from this study have good potential to mediate disease control as probiotic feed additives for catfish aquaculture. PMID:23029244
2015-03-01
albopictus, BG-Sentinel, oviposition cup surveillance, Florida, dengue INTRODUCTION Dengue fever remains a serious mosquitoborne disease in many...state of Florida (FL) in 1986 at a waste tire site in Jacksonville (O’Meara et al. 1992). While the role of Ae. aegypti in the transmission of dengue ...virus is well known, the importance of Ae. albopictus in the transmission of arboviruses in the USA, including dengue , is not clear. Specifically, Cache
Outdoor chamber measurements of biological aerosols with a passive FTIR spectrometer
NASA Astrophysics Data System (ADS)
D'Amico, Francis M.; Emge, Darren K.; Roelant, Geoffrey J.
2004-02-01
Outdoor measurements of dry bacillus subtilis (BG) spores were conducted with a passive Fourier transform infrared (FTIR) spectrometer using two types of chambers. One was a large open-ended cell, and the other was a canyon of similar dimensions. The canyon exposes the aerosol plume to downwelling sky radiance, while the open-ended cell does not. The goal of the experiments was to develop a suitable test methodology for evaluation of passive standoff detectors for open-air aerosol measurements. Dry BG aerosol particles were dispersed with a blower through an opening in the side of the chamber to create a pseudo-stationary plume, wind conditions permitting. Numerous trials were performed with the FTIR spectrometer positioned to view mountain, sky and mixed mountain-sky backgrounds. This paper will discuss the results of the FTIR measurements for BG and Kaolin dust releases.
Gangrenous mastitis caused by Bacillus species in six goats.
Mavangira, Vengai; Angelos, John A; Samitz, Eileen M; Rowe, Joan D; Byrne, Barbara A
2013-03-15
6 lactating dairy goats were examined because of acute mastitis. Goats were considered to have endotoxemia on the basis of physical examination and clinicopathologic findings. The affected udder halves had gangrenous discolored distal portions with sharp demarcations from grossly normal tissue proximally. Udder secretions from the affected sides were serosanguineous in all cases. A Bacillus sp was isolated in pure cultures in all cases. In 1 case, the Bacillus sp was identified as Bacillus cereus. Goats were treated for mastitis and endotoxemia with polyionic IV fluid therapy, systemic and intramammary antimicrobial administration, anti-inflammatory drug administration, and other supportive treatment. All goats survived to discharge. All except 1 goat had follow-up information available. The affected udder halves sloughed in 1 to 2 months following discharge. In subsequent lactations after the mastitis episodes, milk production in 2 of 5 goats was above the mean, as determined on the basis of Dairy Herd Improvement records, and 3 of 5 goats were voluntarily withdrawn from lactation. All 5 goats had successful kiddings after the Bacillus mastitis episode. Bacillus sp should be considered as a causative agent in goats with gangrenous mastitis, especially when the Bacillus sp is isolated in a pure culture. Antimicrobial sensitivity testing is recommended for selection of an appropriate antimicrobial for treatment. Prognosis for survival appears to be good, although milk production may be decreased.
Rosenberg, Gili; Steinberg, Nitai; Oppenheimer-Shaanan, Yaara; Olender, Tsvia; Doron, Shany; Ben-Ari, Julius; Sirota-Madi, Alexandra; Bloom-Ackermann, Zohar; Kolodkin-Gal, Ilana
2016-01-01
Bacillus subtilis biofilms have a fundamental role in shaping the soil ecosystem. During this process, they unavoidably interact with neighbour bacterial species. We studied the interspecies interactions between biofilms of the soil-residing bacteria B. subtilis and related Bacillus species. We found that proximity between the biofilms triggered recruitment of motile B. subtilis cells, which engulfed the competing Bacillus simplex colony. Upon interaction, B. subtilis secreted surfactin and cannibalism toxins, at concentrations that were inert to B. subtilis itself, which eliminated the B. simplex colony, as well as colonies of Bacillus toyonensis. Surfactin toxicity was correlated with the presence of short carbon-tail length isomers, and synergistic with the cannibalism toxins. Importantly, during biofilm development and interspecies interactions a subpopulation in B. subtilis biofilm lost its native plasmid, leading to increased virulence against the competing Bacillus species. Overall, these findings indicate that genetic programs and traits that have little effect on biofilm development when each species is grown in isolation have a dramatic impact when different bacterial species interact. PMID:28721238
Credit BG. This view looks northwest (290°) in the mixer ...
Credit BG. This view looks northwest (290°) in the mixer room at the 30-gallon Baker-Perkins model 121/2 PVM mixer and its associated equipment. The hopper in the left background feeds ingredients to the mixing pot when the hopper is mounted on the mixer frame; the hoist overhead is used to mount the hopper. The mixing pot is in its lowered position beneath the mixer blades. The pot is normally raised and secured to the upper half of the mixer, and a vacuum is applied during mixing operations to prevent the entrainment of air bubbles in the mix. A second mixing pot appears in the right background, and a pot vacuum lid appears in the extreme right foreground. The equipment on the palette in the left foreground is not related to the mixer. Note the explosion-proof fluorescent lighting fixtures suspended from the ceiling. The floor has an electrically conductive coating to dissipate static electrical charges - Jet Propulsion Laboratory Edwards Facility, Mixer & Casting Building, Edwards Air Force Base, Boron, Kern County, CA
Effect of Bacillus subtilis on Granite Weathering: A Laboratory Experiment
NASA Astrophysics Data System (ADS)
Song, W.; Ogawa, N.; Oguchi, C. T.; Hatta, T.; Matsukura, Y.
2006-12-01
We performed a comparative experiment to investigate how the ubiquitous soil bacterium Bacillus subtilis weathers granite and which granite-forming minerals weather more rapidly via biological processes. Batch type experiments (granite specimen in a 500 ml solution including NaCl, glucose, yeast extract and bacteria Bacillus subtilis at 27°E C) were carried out for 30 days. Granite surfaces were observed by SEM before and after the experiment. Bacillus subtilis had a strong influence on granite weathering by forming pits. There were 2.4 times as many pits and micropores were 2.3 times wider in granite exposed to Bacillus subtilis when compared with bacteria-free samples. Bacillus subtilis appear to preferentially select an optimum place to adhere to the mineral and dissolve essential elements from the mineral to live. Plagioclase was more vulnerable to bacterial weathering than biotite among the granite composing minerals.
Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan
2009-08-01
In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.
BOOK REVIEW – BACILLUS THURINGIENSIS: A CORNERSTONE OF MODERN AGRICULTURE BACILLUS THURINGIENSIS
Are you interested in the technical issues surrounding the use of Bacillus thuringiensis pesticidal traits as sprays and as plant incorporated protectants (transgenic crops)? Should the dimensions of human health, ecology, entomology, risk assessment, resistance management, and d...
Credit BG. Looking southeast at Test Stand "D" (Building 4223/E24). ...
Credit BG. Looking southeast at Test Stand "D" (Building 4223/E-24). Left foreground contains six high-pressure nitrogen tanks which supplied nitrogen for operation of propellant valves. Several tanks for other substances have been removed from the base of the tower as part of decontamination and dismantling program. The vertical vacuum test cell can be seen in the tower behind the western sunscreen. At the top of the tower in the northeast corner is the interstage condenser used in the series of vacuum ejectors; at the top of the condenser is one of two Z-stage ejectors used to evacuate the condenser. The hoist beam for lifting/lowering rocket engines can be clearly seen projecting to the west over the pavement. In the distance on the right are Clayton water-tube steam generators from Building 4280/E-81, and the towers for Test Stand "C" and its scrubber-condenser - Jet Propulsion Laboratory Edwards Facility, Test Stand D, Edwards Air Force Base, Boron, Kern County, CA
Hypervelocity Impact (HVI). Volume 8; Tile Small Targets A-1, Ag-1, B-1, and Bg-1
NASA Technical Reports Server (NTRS)
Gorman, Michael R.; Ziola, Steven M.
2007-01-01
During 2003 and 2004, the Johnson Space Center's White Sands Testing Facility in Las Cruces, New Mexico conducted hypervelocity impact tests on the space shuttle wing leading edge. Hypervelocity impact tests were conducted to determine if Micro-Meteoroid/Orbital Debris impacts could be reliably detected and located using simple passive ultrasonic methods. The objective of Targets A-1, Ag-1, B-1, and Bg-1 was to study hypervelocity impacts on the reinforced Shuttle Heat Shield Tiles of the Wing. Impact damage was detected using lightweight, low power instrumentation capable of being used in flight.
Bacillus purgationiresistans sp. nov., isolated from a drinking-water treatment plant.
Vaz-Moreira, Ivone; Figueira, Vânia; Lopes, Ana R; Lobo-da-Cunha, Alexandre; Spröer, Cathrin; Schumann, Peter; Nunes, Olga C; Manaia, Célia M
2012-01-01
A Gram-positive, aerobic, non-motile, endospore-forming rod, designated DS22(T), was isolated from a drinking-water treatment plant. Cells were catalase- and oxidase-positive. Growth occurred at 15-37 °C, at pH 7-10 and with <8% (w/v) NaCl (optimum growth: 30 °C, pH 7-8 and 1-3% NaCl). The major respiratory quinone was menaquinone 7, the G+C content of the genomic DNA was 36.5 mol% and the cell wall contained meso-diaminopimelic acid. On the basis of 16S rRNA gene sequence analysis, strain DS22(T) was a member of the genus Bacillus. Its closest phylogenetic neighbours were Bacillus horneckiae NRRL B-59162(T) (98.5% 16S rRNA gene sequence similarity), Bacillus oceanisediminis H2(T) (97.9%), Bacillus infantis SMC 4352-1(T) (97.4%), Bacillus firmus IAM 12464(T) (96.8%) and Bacillus muralis LMG 20238(T) (96.8%). DNA-DNA hybridization, and biochemical and physiological characterization allowed the differentiation of strain DS22(T) from its closest phylogenetic neighbours. The data supports the proposal of a novel species, Bacillus purgationiresistans sp. nov.; the type strain is DS22(T) (=DSM 23494(T)=NRRL B-59432(T)=LMG 25783(T)).
Detection of indoor biological hazards using the man-portable laser induced breakdown spectrometer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Munson, Chase A.; Gottfried, Jennifer L.; Snyder, Emily Gibb
2008-11-01
The performance of a man-portable laser induced breakdown spectrometer was evaluated for the detection of biological powders on indoor office surfaces and wipe materials. Identification of pure unknown powders was performed by comparing against a library of spectra containing biological agent surrogates and confusant materials, such as dusts, diesel soot, natural and artificial sweeteners, and drink powders, using linear correlation analysis. Simple models constructed using a second technique, partial least squares discriminant analysis, successfully identified Bacillus subtilis (BG) spores on wipe materials and office surfaces. Furthermore, these models were able to identify BG on materials not used in the trainingmore » of the model.« less
Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong
2015-01-01
A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.
Inhibitory effects of spice essential oils on the growth of Bacillus species.
Ozcan, Mehmet Musa; Sağdiç, Osman; Ozkan, Gülcan
2006-01-01
A series of essential oils of 11 Turkish plant spices [black thyme, cumin, fennel (sweet), laurel, marjoram, mint, oregano, pickling herb, sage, savory, and thyme], used in foods mainly for their flavor, aromas, and preservation, in herbal tea, in alternative medicines, and in natural therapies, were screened for antibacterial effects at 1:50, 1:100, 1:250, and 1:500 dilutions by the paper disc diffusion method against six Bacillus species (Bacillus amyloliquefaciens ATCC 3842, Bacillus brevis FMC 3, Bacillus cereus FMC 19, Bacillus megaterium DSM 32, Bacillus subtilis IMG 22, and B. subtilis var. niger ATCC 10). All of the tested essential oils (except for cumin) showed antibacterial activity against one or more of the Bacillus species used in this study. Generally, the essential oils at 1:50 and 1:100 levels were more effective. Only one essential oil (laurel) was not found effective against the tested bacteria. The bacterium most sensitive to all of the spice essential oils was B. amyloliquefaciens ATCC 3842. Based on the results of this study, it is likely that essential oils of some spices may be used as antimicrobial agents to prevent the spoilage of food products.
von Cosmos, Nicolas H; Watson, Bruce A; Fellman, J K; Mattinson, D S; Edwards, Charles G
2017-10-01
This report provides the first confirmed evidence of Bacillus-like bacteria present in a wine from Washington State. These bacteria were isolated from a 2013 Pinot noir wine whose aroma was sensorially described as being 'dirty' or 'pond scum.' Based on physiological traits and genetic sequencing, three bacterial isolates were identified as Bacillus megaterium (strain NHO-1), Bacillus pumilus (strain NHO-2), and Paenibacillus polymyxa (strain NHO-3). These bacteria grew in synthetic media of low pH (pH 3.5) while some survived ethanol concentrations up to 15% v/v. However, none tolerated molecular SO 2 concentrations ≥0.4 mg/l. Growth of strains NHO-1 and NHO-3 in a Merlot grape juice resulted in increases of titratable and volatile acidities while decreases in titratable acidity were noted for NHO-2. Copyright © 2017. Published by Elsevier Ltd.
Watanabe, K; Hayano, K
1993-07-01
Proteolytic bacteria in paddy field soils under rice cultivation were characterized and enumerated using azocoll agar plates. Bacillus spp. were the proteolytic bacteria that were most frequently present, comprising 59% of the isolates. They were always the numerically dominant proteolytic bacteria isolated from three kinds of fertilizer treatments (yearly application of rice-straw compost and chemical fertilizer, yearly application of chemical fertilizer, and no fertilizer application) and at three different stages of rice development (vegetative growth stage, maximal tillering stage, and harvest stage). Of the 411 proteolytic bacteria isolated, 124 isolates had stronger proteolytic activity than others on the basis of gelatin liquefaction tests and most of them were Bacillus spp. (100% in 1989 and 92.4% in 1991). Bacillus subtilis and Bacillus cereus were the main bacteria of this group and Bacillus mycoides, Bacillus licheniformis, and Bacillus megaterium were also present. We conclude that these Bacillus spp. are the primary source of soil protease in these paddy fields.
Brown, J. Howard; Orcutt, Marion L.
1920-01-01
Bacillus pyogenes is probably quite common in this country, as it is known to be in Europe. A careful study of twelve strains from cattle and one from a hog has disclosed the following characteristics which have not been reported or have been in dispute. Bacillus pyogenes is Gram-positive and pleomorphic, producing forms ranging from short chains of streptococcoid elements to branching filaments. It is hemolytic, producing the beta type of hemolysis in blood agar. It is not hemoglobinophilic, though its growth is greatly favored by some higher protein material such as egg albumin, serum, or blood. It ferments xylose in addition to the substances previously reported. The coagulation of milk by Bacillus pyogenes is primarily an enzyme coagulation and the subsequent digestion of the curd takes place in an acid medium. The intravenous injection of rabbits was invariably fatal. The lesions most commonly developed were those of the bones. Paralysis was frequently produced, and in each case was caused by lesions in the vertebrae exerting pressure against the ventral columns of the spinal cord. Muscle abscesses were also frequently produced. The authors regard the organism as belonging to the Corynebacteria rather than to the influenza group. PMID:19868442
Large-Area Chemical and Biological Decontamination Using a High Energy Arc Lamp (HEAL) System.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duty, Chad E; Smith, Rob R; Vass, Arpad Alexander
2008-01-01
Methods for quickly decontaminating large areas exposed to chemical and biological (CB) warfare agents can present significant logistical, manpower, and waste management challenges. Oak Ridge National Laboratory (ORNL) is pursuing an alternate method to decompose CB agents without the use of toxic chemicals or other potentially harmful substances. This process uses a high energy arc lamp (HEAL) system to photochemically decompose CB agents over large areas (12 m2). Preliminary tests indicate that more than 5 decades (99.999%) of an Anthrax spore simulant (Bacillus globigii) were killed in less than 7 seconds of exposure to the HEAL system. When combined withmore » a catalyst material (TiO2) the HEAL system was also effective against a chemical agent simulant, diisopropyl methyl phosphonate (DIMP). These results demonstrate the feasibility of a rapid, large-area chemical and biological decontamination method that does not require toxic or corrosive reagents or generate hazardous wastes.« less
Laser induced disruption of bacterial spores on a microchip.
Hofmann, Oliver; Murray, Kirk; Wilkinson, Alan-Shaun; Cox, Timothy; Manz, Andreas
2005-04-01
We report on the development of a laser based spore disruption method. Bacillus globigii spores were mixed with a laser light absorbing matrix and co-crystallized into 200-microm-wide and 20-microm-deep nanovials formed in a polydimethylsiloxane (PDMS) target plate. Surface tension effects were exploited to effect up to 125-fold spore enrichment. When the target zones were illuminated at atmospheric pressure with pulsed UV-laser light at fluences below 20 mJ cm(-2) a change in spore morphology was observed within seconds. Post illumination PCR analysis suggests the release of endogenous DNA indicative of spore disruption. For laser fluences above 20 mJ cm(-2), desorption of spores and fragments was also observed even without a matrix being employed. Desorbed material was collected in a PDMS flowcell attached to the target plate during laser illumination. This opens up a route towards the direct extraction of released DNA in an integrated spore disruption-PCR amplification microchip device.
2008-03-01
slips was first coated with a detergent wash. Commercially available Ivory soap shavings were diluted with sterile Millipore® water in a...environments. This removed controllable variability between the Bacillus species and increased the confidence in continued use of such surrogacy
Bacillus swezeyi sp. nov. and Bacillus haynesii sp. nov., isolated from desert soil
USDA-ARS?s Scientific Manuscript database
Two isolates of Gram-positive, facultatively anaerobic, motile, rod-shaped, endospore-forming bacteria were identified during a survey of the diversity of Bacillus strains deposited in the Agriculture Research Service Culture Collection. These strains were originally isolated from soil in Evolution ...
Biofilms affecting progression of mild steel corrosion by Gram positive Bacillus sp.
Lin, Johnson; Madida, Bafana B
2015-10-01
The biodeterioration of metals have detrimental effects on the environment with economic implications. The deterioration of metals is of great concern to industry. In this study, mild steel coupons which were immersed in a medium containing Gram-positive Bacillus spp. and different nutrient sources were compared with the control in sterile deionized water. The weight loss of the coupons in the presence of Bacillus spp. alone was lower than the control and was further reduced when additional carbon sources, especially fructose, were added. The level of metal corrosion was significantly increased in the presence of nitrate with or without bacteria. There was a significant strong correlation between the weight loss and biofilm level (r = 0.64; p < 0.05). The addition of nitrate and Bacillus spp. produced more biofilms on the coupons and resulted in greater weight loss compared to that with Bacillus spp. only under the same conditions. However, Bacillus spp. enriched with carbon sources formed less biofilms and results in lower weight loss compared to that with Bacillus spp. only. The production of biofilm by Bacillus spp. influences the level of metal corrosion under different environmental conditions, thereby, supporting the development of a preventive strategy against corrosion. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Heavy Metal Detoxification by Different Bacillus Species Isolated from Solar Salterns
Syed, Shameer; Chinthala, Paramageetham
2015-01-01
The biosorption mechanism is an alternative for chemical precipitation and ultrafiltration which have been employed to treat heavy metal contamination with a limited success. In the present study, three species of Bacillus which were isolated from solar salterns were screened for their detoxification potential of the heavy metals, lead, chromium, and copper, by biosorption. Biosorption potential of each isolate was determined by Atomic Absorption Spectroscopy (AAS), Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES), and Energy Dispersive Spectroscopy (EDS) as the amount of metal present in the medium after the treatment with the isolates. Bacterial isolates, Bacillus licheniformis NSPA5, Bacillus cereus NSPA8, and Bacillus subtilis NSPA13, showed significant level of lead biosorption with maximum of 87–90% by Bacillus cereus NSPA8. The biosorption of copper and chromium was relatively low in comparison with lead. With the obtained results, we have concluded that the bacterial isolates are potential agents to treat metal contamination in more efficient and ecofriendly manner. PMID:26525498
Effects of Mn2+ Levels on the Resistance Properties of Bacillus cereus Spores
2013-01-01
In contrast, Bacillus subtilis spores with over a 200-fold range of protoplast Mn levels exhibited no significant differences in resistance to... Bacillus subtilis . J. Bacteriol. 189:8458-8466. Coleman WH, Zhang P, Li YQ, Setlow P (2010). Mechanism of killing of spores of Bacillus cereus and...Gaidamakova EK, Matrosova VY, Daly MJ, Setlow P (2011). Effects of levels of Mn and Fe on Bacillus subtilis spore resistance, and effects of Mn 2
Jeyaram, Kumaraswamy; Romi, Wahengbam; Singh, Thangjam Anand; Adewumi, Gbenga Adedeji; Basanti, Khundrakpam; Oguntoyinbo, Folarin Anthony
2011-11-01
PCR amplification of 16S rRNA gene by universal primers followed by restriction fragment length polymorphism analysis using RsaI, CfoI and HinfI endonucleases, distinctly differentiated closely related Bacillus amyloliquefaciens, Bacillus licheniformis and Bacillus pumilus from Bacillus subtilis sensu stricto. This simple, economical, rapid and reliable protocol could be an alternative to misleading phenotype-based grouping of these closely related species. Copyright © 2011 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Bacillus subtilis consists of a large collection of strains from which several cryptic species have been delineated, and most of these along with strains within the species are important biocontrol agents. Bacillus mojavensis, a species recently distinguished from this broad Bacillus subtilis grou...
Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.
Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo
2011-05-01
A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T) = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.
Bacillus cereus Biofilms—Same, Only Different
Majed, Racha; Faille, Christine; Kallassy, Mireille; Gohar, Michel
2016-01-01
Bacillus cereus displays a high diversity of lifestyles and ecological niches and include beneficial as well as pathogenic strains. These strains are widespread in the environment, are found on inert as well as on living surfaces and contaminate persistently the production lines of the food industry. Biofilms are suspected to play a key role in this ubiquitous distribution and in this persistency. Indeed, B. cereus produces a variety of biofilms which differ in their architecture and mechanism of formation, possibly reflecting an adaptation to various environments. Depending on the strain, B. cereus has the ability to grow as immersed or floating biofilms, and to secrete within the biofilm a vast array of metabolites, surfactants, bacteriocins, enzymes, and toxins, all compounds susceptible to act on the biofilm itself and/or on its environment. Within the biofilm, B. cereus exists in different physiological states and is able to generate highly resistant and adhesive spores, which themselves will increase the resistance of the bacterium to antimicrobials or to cleaning procedures. Current researches show that, despite similarities with the regulation processes and effector molecules involved in the initiation and maturation of the extensively studied Bacillus subtilis biofilm, important differences exists between the two species. The present review summarizes the up to date knowledge on biofilms produced by B. cereus and by two closely related pathogens, Bacillus thuringiensis and Bacillus anthracis. Economic issues caused by B. cereus biofilms and management strategies implemented to control these biofilms are included in this review, which also discuss the ecological and functional roles of biofilms in the lifecycle of these bacterial species and explore future developments in this important research area. PMID:27458448
Isolation and expression of a Bacillus cereus gene encoding benzil reductase.
Maruyama, R; Nishizawa, M; Itoi, Y; Ito, S; Inoue, M
2001-12-20
Benzil was reduced stereospecifically to (S)-benzoin by Bacillus cereus strain Tim-r01. To isolate the gene responsible for asymmetric reduction, we constructed a library consisting of Escherichia coli clones that harbored plasmids expressing Bacillus cereus genes. The library was screened using the halo formation assay, and one clone showed benzil reduction to (S)-benzoin. Thus, this clone seemed to carry a plasmid encoding a Bacillus cereus benzil reductase. The deduced amino acid sequence had marked homologies to the Bacillus subtilis yueD protein (41% identity), the yeast open reading frame YIR036C protein (31%), and the mammalian sepiapterin reductases (28% to 30%), suggesting that benzil reductase is a novel short-chain de-hydrogenases/ reductase. Copyright 2001 John Wiley & Sons, Inc.
Role of Th17 Cell in Tubercle Bacillus Infection
NASA Astrophysics Data System (ADS)
Zhang, Dandan
2018-01-01
Tuberculosis is mainly a kind of lung disease. Normal immune cell expression can inhibit proliferation of tubercle bacillus in the lungs, but this may also lead to chronic inflammation and pathological lesion. Th17 cell is a newly discovered CD4 + effector T cell subsets, whose differentiation and roles are influenced by various cytokines in the surrounding environment. Th17 cell plays an important role in resisting tubercle bacillus infection, but also it may cause pathological damage through the inflammatory response. Therefore, to balance two kinds of roles of Th17 cells in tubercle bacillus infection can effectively protect the body. This paper intends to do a summary on differentiation, regulation, and biological functions of Th17 cell.
Radhakrishnan, Ramalingam; Hashem, Abeer; Abd_Allah, Elsayed F.
2017-01-01
Crop productivity is affected by environmental and genetic factors. Microbes that are beneficial to plants are used to enhance the crop yield and are alternatives to chemical fertilizers and pesticides. Pseudomonas and Bacillus species are the predominant plant growth-promoting bacteria. The spore-forming ability of Bacillus is distinguished from that of Pseudomonas. Members of this genus also survive for a long time under unfavorable environmental conditions. Bacillus spp. secrete several metabolites that trigger plant growth and prevent pathogen infection. Limited studies have been conducted to understand the physiological changes that occur in crops in response to Bacillus spp. to provide protection against adverse environmental conditions. This review describes the current understanding of Bacillus-induced physiological changes in plants as an adaptation to abiotic and biotic stresses. During water scarcity, salinity and heavy metal accumulate in soil, Bacillus spp. produce exopolysaccharides and siderophores, which prevent the movement of toxic ions and adjust the ionic balance and water transport in plant tissues while controlling the pathogenic microbial population. In addition, the synthesis of indole-3-acetic acid, gibberellic acid and1-aminocyclopropane-1-carboxylate (ACC) deaminase by Bacillus regulates the intracellular phytohormone metabolism and increases plant stress tolerance. Cell-wall-degrading substances, such as chitosanase, protease, cellulase, glucanase, lipopeptides and hydrogen cyanide from Bacillus spp. damage the pathogenic bacteria, fungi, nematodes, viruses and pests to control their populations in plants and agricultural lands. The normal plant metabolism is affected by unfavorable environmental stimuli, which suppress crop growth and yield. Abiotic and biotic stress factors that have detrimental effects on crops are mitigated by Bacillus-induced physiological changes, including the regulation of water transport, nutrient up-take and
Radhakrishnan, Ramalingam; Hashem, Abeer; Abd Allah, Elsayed F
2017-01-01
Crop productivity is affected by environmental and genetic factors. Microbes that are beneficial to plants are used to enhance the crop yield and are alternatives to chemical fertilizers and pesticides. Pseudomonas and Bacillus species are the predominant plant growth-promoting bacteria. The spore-forming ability of Bacillus is distinguished from that of Pseudomonas . Members of this genus also survive for a long time under unfavorable environmental conditions. Bacillus spp. secrete several metabolites that trigger plant growth and prevent pathogen infection. Limited studies have been conducted to understand the physiological changes that occur in crops in response to Bacillus spp. to provide protection against adverse environmental conditions. This review describes the current understanding of Bacillus -induced physiological changes in plants as an adaptation to abiotic and biotic stresses. During water scarcity, salinity and heavy metal accumulate in soil, Bacillus spp. produce exopolysaccharides and siderophores, which prevent the movement of toxic ions and adjust the ionic balance and water transport in plant tissues while controlling the pathogenic microbial population. In addition, the synthesis of indole-3-acetic acid, gibberellic acid and1-aminocyclopropane-1-carboxylate (ACC) deaminase by Bacillus regulates the intracellular phytohormone metabolism and increases plant stress tolerance. Cell-wall-degrading substances, such as chitosanase, protease, cellulase, glucanase, lipopeptides and hydrogen cyanide from Bacillus spp. damage the pathogenic bacteria, fungi, nematodes, viruses and pests to control their populations in plants and agricultural lands. The normal plant metabolism is affected by unfavorable environmental stimuli, which suppress crop growth and yield. Abiotic and biotic stress factors that have detrimental effects on crops are mitigated by Bacillus -induced physiological changes, including the regulation of water transport, nutrient up-take and
Identification and Pathogenic Potential of Clinical Bacillus and Paenibacillus Isolates
Celandroni, Francesco; Salvetti, Sara; Gueye, Sokhna Aissatou; Mazzantini, Diletta; Lupetti, Antonella; Senesi, Sonia; Ghelardi, Emilia
2016-01-01
The soil-related Bacillus and Paenibacillus species have increasingly been implicated in various human diseases. Nevertheless, their identification still poses problems in the clinical microbiology laboratory and, with the exception of Bacillus anthracis and Bacillus cereus, little is known on their pathogenicity for humans. In this study, we evaluated the use of matrix-assisted laser desorption—ionization time of flight mass spectrometry (MALDI-TOF MS) in the identification of clinical isolates of these genera and conducted genotypic and phenotypic analyses to highlight specific virulence properties. Seventy-five clinical isolates were subjected to biochemical and MALDI-TOF MS identification. 16S rDNA sequencing and supplemental tests were used to solve any discrepancies or failures in the identification results. MALDI-TOF MS significantly outperformed classical biochemical testing for correct species identification and no misidentification was obtained. One third of the collected strains belonged to the B. cereus species, but also Bacillus pumilus and Bacillus subtilis were isolated at high rate. Antimicrobial susceptibility testing showed that all the B. cereus, B. licheniformis, B. simplex, B. mycoides, Paenibacillus glucanolyticus and Paenibacillus lautus isolates are resistant to penicillin. The evaluation of toxin/enzyme secretion, toxin-encoding genes, motility, and biofilm formation revealed that B. cereus displays the highest virulence potential. However, although generally considered nonpathogenic, most of the other species were shown to swim, swarm, produce biofilms, and secrete proteases that can have a role in bacterial virulence. In conclusion, MALDI-TOF MS appears useful for fast and accurate identification of Bacillus and Paenibacillus strains whose virulence properties make them of increasing clinical relevance. PMID:27031639
Reparation and Immunomodulating Properties of Bacillus sp. Metabolites from Permafrost.
Kalenova, L F; Melnikov, V P; Besedin, I M; Bazhin, A S; Gabdulin, M A; Kolyvanova, S S
2017-09-01
An ointment containing metabolites of Bacillus sp. microorganisms isolated from permafrost samples was applied onto the skin wound of BALB/c mice. Metabolites isolated during culturing of Bacillus sp. at 37°C produced a potent therapeutic effect and promoted wound epithelialization by 30% in comparison with the control (ointment base) and by 20% in comparison with Solcoseryl. Treatment with Bacillus sp. metabolites stimulated predominantly humoral immunity, reduced the time of wound contraction and the volume of scar tissue, and promoted complete hair recovery. These metabolites can be considered as modulators of the wound process with predominance of regeneration mechanisms.
Bacillus siamensis sp. nov., isolated from salted crab (poo-khem) in Thailand.
Sumpavapol, Punnanee; Tongyonk, Linna; Tanasupawat, Somboon; Chokesajjawatee, Nipa; Luxananil, Plearnpis; Visessanguan, Wonnop
2010-10-01
A Gram-positive, endospore-forming, rod-shaped bacterium, strain PD-A10(T), was isolated from salted crab (poo-khem) in Thailand and subjected to a taxonomic study. Phenotypic and chemotaxonomic characteristics, including phylogenetic analyses, showed that the novel strain was a member of the genus Bacillus. The novel strain grew in medium with 0-14 % (w/v) NaCl, at 4-55°C and at pH4.5-9. The predominant quinone was a menaquinone with seven isoprene units (MK-7). The major fatty acids were anteiso-C₁₅:₀ and anteiso-C₁₇:₀. Polar lipid analysis revealed the presence of diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, lysylphosphatidylglycerol, glycolipid and unknown lipids. The DNA G+C content was 41.4 mol%. The 16S rRNA gene sequence similarities between strain PD-A10(T) and Bacillus amyloliquefaciens NBRC 15535(T), Bacillus subtilis DSM 10(T), Bacillus vallismortis DSM 11031(T) and Bacillus mojavensis IFO 15718(T) were 99.5, 99.4, 99.4 and 99.2 %, respectively. Strain PD-A10(T) showed a low degree similarity of rep-PCR fingerprints and low DNA-DNA relatedness with the above-mentioned species. On the basis of the data gathered in this study, strain PD-A10(T) should be classified as representing a novel species of the genus Bacillus, for which the name Bacillus siamensis sp. nov. is proposed. The type strain is PD-A10(T) (=BCC 22614(T)=KCTC 13613(T)).
Butyric acid released during milk lipolysis triggers biofilm formation of Bacillus species.
Pasvolsky, Ronit; Zakin, Varda; Ostrova, Ievgeniia; Shemesh, Moshe
2014-07-02
Bacillus species form biofilms within milking pipelines and on surfaces of equipment in the dairy industry which represent a continuous hygiene problem and can lead to serious economic losses due to food spoilage and equipment impairment. Although much is known about the mechanism by which the model organism Bacillus subtilis forms biofilms in laboratory mediums in vitro, little is known of how these biofilms are formed in natural environments such as milk. Besides, little is known of the signaling pathways leading to biofilm formation in other Bacillus species, such as Bacillus cereus and Bacillus licheniformis, both of which are known to contaminate milk. In this study, we report that milk triggers the formation of biofilm-related structures, termed bundles. We show this to be a conserved phenomenon among all Bacillus members tested. Moreover, we demonstrate that the tasA gene, which encodes a major portion of the matrix which holds the biofilm together, is vital for this process. Furthermore, we show that the free fatty acid (FFA) - butyric acid (BA), which is released during lipolysis of milk fat and demonstrates antimicrobial activity, is the potent trigger for biofilm bundle formation. We finally show that BA-triggered biofilm bundle formation is mediated by the histidine kinase, KinD. Taken together, these observations indicate that BA, which is a major FFA within milk triggers biofilm formation in a conserved mechanism among members of the Bacillus genus. Copyright © 2014 Elsevier B.V. All rights reserved.
New inhibitors of colony spreading in Bacillus subtilis and Bacillus anthracis.
Hao, Xin; Nguyen, Tam; Kearns, Daniel B; Arpin, Carolynn C; Fall, Ray; Sammakia, Tarek
2011-09-15
We have recently characterized sliding motility in Bacillus subtilis strains that lack functional flagella, and here describe the discovery of inhibitors of colony spreading in these strains as well as the aflagellate pathogen, Bacillus anthracis. Aflagellate B. subtilis strains were used to screen for new types of antibacterials that might inhibit colony spreading on semi-solid media. From a diverse set of organic structures, p-nitrophenylglycerol (NPG), an agent used primarily in clinical laboratories to control Proteus swarming, was found to inhibit colony spreading. The four stereoisomers of NPG were synthesized and tested, and only the 1R,2S-(1R-anti) and 1R,2R-(1R-syn) NPG isomers had significant activity in a quantitative colony-spreading assay. Twenty-six NPG analogs and related structures were synthesized and tested to identify more active inhibitors. p-Methylsulfonylphenylglycerol (p-SPG), but not its ortho or meta analogs, was found to be the most effective of these compounds, and synthesis and testing of all four p-SPG stereoisomers showed that the 1R-anti-isomer was the most active with an average IC(50) of 16 μM (3-5 μg mL(-1)). For B. anthracis, the colony-spreading IC(50) values for 1R-anti-SPG and 1R-anti-NPG are 12 μM (2-4 μg mL(-1)) and >150 μM, respectively. For both Bacillus species tested, 1R-anti-SPG inhibits colony spreading of surface cultures on agar plates, but is not bacteriostatic or bacteriocidal in liquid cultures. Work is in progress to find the cellular target(s) of the NPG/SPG class of compounds, since this could lead to an understanding of the mechanism(s) of colony spreading as well as design and development of more potent inhibitors for the control of B. anthracis surface cultures. Copyright © 2011 Elsevier Ltd. All rights reserved.
Posada, Luisa F; Alvarez, Javier C; Hu, Chia-Hui; de-Bashan, Luz E; Bashan, Yoav
2016-09-01
Strains of Bacillus subtilis are plant growth-promoting bacteria (PGPB) of many crops and are used as inoculants. PGPB colonization is an important trait for success of a PGPB on plants. A specific probe, based on the 16 s rRNA of Bacillus subtilis, was designed and evaluated to distinguishing, by fluorescence in situ hybridization (FISH), between this species and the closely related Bacillus amyloliquefaciens. The selected target for the probe was between nucleotides 465 and 483 of the gene, where three different nucleotides can be identified. The designed probe successfully hybridized with several strains of Bacillus subtilis, but failed to hybridize not only with B. amyloliquefaciens, but also with other strains such as Bacillus altitudinis, Bacillus cereus, Bacillus gibsonii, Bacillus megaterium, Bacillus pumilus; and with the external phylogenetic strains Azospirillum brasilense Cd, Micrococcus sp. and Paenibacillus sp. The results showed the specificity of this molecular probe for B. subtilis.
Differentiation of strains from the Bacillus cereus group by RFLP-PFGE genomic fingerprinting.
Otlewska, Anna; Oltuszak-Walczak, Elzbieta; Walczak, Piotr
2013-11-01
Bacillus mycoides, Bacillus pseudomycoides, Bacillus weihenstephanensis, Bacillus anthracis, Bacillus thuringiensis, and Bacillus cereus belong to the B. cereus group. The last three species are characterized by different phenotype features and pathogenicity spectrum, but it has been shown that these species are genetically closely related. The macrorestriction analysis of the genomic DNA with the NotI enzyme was used to generate polymorphism of restriction profiles for 39 food-borne isolates (B. cereus, B. mycoides) and seven reference strains (B. mycoides, B. thuringiensis, B. weihenstephanensis, and B. cereus). The PFGE method was applied to differentiate the examined strains of the B. cereus group. On the basis of the unweighted pair group method with the arithmetic mean method and Dice coefficient, the strains were divided into five clusters (types A-E), and the most numerous group was group A (25 strains). A total of 21 distinct pulsotypes were observed. The RFLP-PFGE analysis was successfully used for the differentiation and characterization of B. cereus and B. mycoides strains isolated from different food products. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Binding Affinity of Glycoconjugates to BACILLUS Spores and Toxins
NASA Astrophysics Data System (ADS)
Rasol, Aveen; Eassa, Souzan; Tarasenko, Olga
2010-04-01
Early recognition of Bacillus cereus group species is important since they can cause food-borne illnesses and deadly diseases in humans. Glycoconjugates (GCs) are carbohydrates covalently linked to non-sugar moieties including lipids, proteins or other entities. GCs are involved in recognition and signaling processes intrinsic to biochemical functions in cells. They also stimulate cell-cell adhesion and subsequent recognition and activation of receptors. We have demonstrated that GCs are involved in Bacillus cereus spore recognition. In the present study, we have investigated whether GCs possess the ability to bind and recognize B. cereus spores and Bacillus anthracis recombinant single toxins (sTX) and complex toxins (cTX). The affinity of GCs to spores + sTX and spores + cTX toxins was studied in the binding essay. Our results demonstrated that GC9 and GC10 were able to selectively bind to B. cereus spores and B. anthracis toxins. Different binding affinities for GCs were found toward Bacillus cereus spores + sTX and spores + cTX. Dilution of GCs does not impede the recognition and binding. Developed method provides a tool for simultaneous recognition and targeting of spores, bacteria toxins, and/or other entities.
Bacillus ciccensis sp. nov., isolated from maize (Zea mays L.) seeds.
Liu, Yang; Li, Nannan; Eom, Mi Kyung; Schumann, Peter; Zhang, Xin; Cao, Yanhua; Ge, Yuanyuan; Xiao, Ming; Zhao, Jiuran; Cheng, Chi; Kim, Song-Gun
2017-11-01
Two Gram-stain-positive bacterial strains, designated as 5L6 T and 6L6, isolated from seeds of hybrid maize (Zea mays L., Jingke 968) were investigated using a polyphasic taxonomic approach. The cells were aerobic, motile, endospore-forming and rod-shaped. Phylogenetic analysis based on 16S rRNA gene sequences showed that the isolates were recognized as a species of the genus Bacillus, to which the five closest neighbours are Bacillus solani FJAT-18043 T (99.8 % similarity), Bacillus horneckiae DSM 23495 T (97.7 %), Bacillus eiseniae A1-2 T (97.4 %), Bacillus kochii WCC 4582 T (97.1 %) and Bacillus purgationiresistens DS22 T (97.0 %). The DNA G+C content of strain 5L6 T was 37.4 mol%. Its polar lipid profile consisted of diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The predominant respiratory quinone was MK-7 and the major fatty acids were iso-C15 : 0, anteiso-C15 : 0, iso-C16 : 0, iso-C14 : 0, anteiso-C17 : 0 and C16 : 1 ω7c alcohol. The cell-wall peptidoglycan contained ornithine, serine, aspartic acid, glutamic acid and alanine while diaminopimelic acid could not be detected. Strains 5L6 T and 6L6 were clearly distinguished from the type strains of related validly named species using phylogenetic analysis, DNA-DNA hybridization, fatty acid analysis, peptidoglycan analysis and comparison of a range of physiological and biochemical characteristics. The genotypic and phenotypic data show that strains 5L6 T and 6L6 represent a novel species of the genus Bacillus, for which the name Bacillusciccensis sp. nov. is proposed. The type strain is 5L6 T (=KCTC 33663 T =CICC 23855 T =DSM 104513 T ).
Decontamination Efficacy and Skin Toxicity of Two Decontaminants against Bacillus anthracis
Stratilo, Chad W.; Crichton, Melissa K. F.; Sawyer, Thomas W.
2015-01-01
Decontamination of bacterial endospores such as Bacillus anthracis has traditionally required the use of harsh or caustic chemicals. The aim of this study was to evaluate the efficacy of a chlorine dioxide decontaminant in killing Bacillus anthracis spores in solution and on a human skin simulant (porcine cadaver skin), compared to that of commonly used sodium hypochlorite or soapy water decontamination procedures. In addition, the relative toxicities of these decontaminants were compared in human skin keratinocyte primary cultures. The chlorine dioxide decontaminant was similarly effective to sodium hypochlorite in reducing spore numbers of Bacillus anthracis Ames in liquid suspension after a 10 minute exposure. After five minutes, the chlorine dioxide product was significantly more efficacious. Decontamination of isolated swine skin contaminated with Bacillus anthracis Sterne with the chlorine dioxide product resulted in no viable spores sampled. The toxicity of the chlorine dioxide decontaminant was up to two orders of magnitude less than that of sodium hypochlorite in human skin keratinocyte cultures. In summary, the chlorine dioxide based decontaminant efficiently killed Bacillus anthracis spores in liquid suspension, as well as on isolated swine skin, and was less toxic than sodium hypochlorite in cultures of human skin keratinocytes. PMID:26394165
Faille, C; Bénézech, T; Blel, W; Ronse, A; Ronse, G; Clarisse, M; Slomianny, C
2013-04-01
This study was designed to evaluate the respective roles of mechanical and chemical effects on the removal of Bacillus spores during cleaning-in-place. This analysis was performed on 12 strains belonging to the Bacillus cereus group (B. cereus, Bacillus anthracis, Bacillus thuringiensis) or to less related Bacillus species (Bacillus pumilus, Bacillus licheniformis, Bacillus sporothermodurans, Bacillus subtilis). Adherent spores were subjected to rinsing-in-place (mechanical action) and cleaning-in-place (mechanical and chemical actions) procedures, the latter involving NaOH 0.5% at 60°C. Results revealed that mechanical action alone only removed between 53 and 89% of the attached spores at a shear stress of 500 Pa. This resistance to shear was not related to spore surface properties. Conversely, in the presence of NaOH at a shear stress of 4 Pa, spores were readily detached, with between 80 and 99% of the adherent spores detached during CIP and the chemical action greatly depended on the strain. This finding suggests that chemical action plays the major role during CIP, whose efficacy is significantly governed by the spore surface chemistry. Copyright © 2012 Elsevier Ltd. All rights reserved.
CHLORINE INACTIVATION OF BACILLUS ENDOSPORES
The possibility of a bioterrorism event resulting in the release of Bacillus anthracis endospores into a drinking water distribution system necessitates research into means by which these endospores can be inactivated. This study was designed to determine the chlorine resistance...
Wood, J P; Lemieux, P; Betancourt, D; Kariher, P; Gatchalian, N G
2010-07-01
To obtain needed data on the dry thermal resistance of Bacillus anthracis spores and other Bacillus species for waste incinerator applications. Tests were conducted in a pilot-scale incinerator utilizing biological indicators comprised of spores of Geobacillus stearothermophilus, Bacillus atrophaeus and B. anthracis (Sterne) and embedded in building material bundles. Tests were also conducted in a dry heat oven to determine the destruction kinetics for the same species. In the pilot-scale incinerator tests, B. atrophaeus and G. stearothermophilus demonstrated similar thermal sensitivity, but B. anthracis (Sterne) was less thermally resistant than G. stearothermophilus. For the dry heat oven tests conducted at 175°C, the D-values were 0·4, 0·2 and 0·3 min for B. atrophaeus, B. anthracis (Sterne) and G. stearothermophilus, respectively. Bacillus anthracis (Sterne) possesses similar or less dry heat resistance compared to B. atrophaeus and G. stearothermophilus. Previous studies have demonstrated conditions under which bacterial spores may survive in an incinerator environment. The data from this study may assist in the selection of surrogates or indicator micro-organisms to ensure B. anthracis spores embedded in building materials are completely inactivated in an incinerator. © 2009 The Society for Applied Microbiology, Journal of Applied Microbiology. No claim to US Government works.
Wu, Jia; Xu, Guoqiang; Jin, Yangyang; Sun, Cong; Zhou, Li; Lin, Guodong; Xu, Rong; Wei, Ling; Fei, Hui; Wang, Dan; Chen, Jianqing; Lv, Zhengbing; Liu, Kuancheng
2018-05-22
The abuse of antibiotics and following rapidly increasing of antibiotic-resistant pathogens is the serious threat to our society. Natural products from microorganism are regarded as the important substitution antimicrobial agents of antibiotics. We isolated a new strain, Bacillus sp. GFP-2, from the Chiloscyllium plagiosum (Whitespotted bamboo shark) intestine, which showed great inhibitory effects on the growth of both Gram-positive and Gram-negative bacteria. Additionally, the growth of salmon was effectively promoted when fed with inactivated strain GFP-2 as the inhibition agent of pathogenic bacteria. The genes encoding antimicrobial peptides like LCI, YFGAP and hGAPDH and gene clusters for secondary metabolites and bacteriocins, such as difficidin, bacillibactin, bacilysin, surfactin, butirosin, macrolactin, bacillaene, fengycin, lanthipeptides and LCI, were predicted in the genome of Bacillus sp. GFP-2, which might be expressed and contribute to the antimicrobial activities of this strain. The gene encoding β-1,3-1,4-glucanase was successfully cloned from the genome and this protein was detected in the culture supernatant of Bacillus sp. GFP-2 by the antibody produced in rabbit immunized with the recombinant β-1,3-1,4-glucanase, indicating that this strain could express β-1,3-1,4-glucanase, which might partially contribute to its antimicrobial activities. This study can enhance a better understanding of the mechanism of antimicrobial activities in genus Bacillus and provide a useful material for the biotechnology study in antimicrobial agent development.
Reclassification of Bacillus marismortui as Salibacillus marismortui comb. nov.
Arahal, D R; Márquez, M C; Volcani, B E; Schleifer, K H; Ventosa, A
2000-07-01
Recently, the features of a group of strains isolated from Dead Sea enrichments obtained in 1936 by one of us (B. E. Volcani) were described. They were gram-positive, moderately halophilic, spore-forming rods, and were placed in a new species, Bacillus marismortui. At the same time, the new genus Salibacillus was proposed for the halophilic species Bacillus salexigens. B. marismortui and Salibacillus salexigens have similar phenotypic characteristics and the same peptidoglycan type. Phylogenetic analysis based on 16S rRNA sequence comparisons showed that they are sufficiently closely related (96.6% similarity) as to warrant placement in the same genus. However, DNA-DNA hybridization experiments showed that they constitute two separate species (41% DNA similarity). Therefore the reclassification of Bacillus marismortui as Salibacillus marismortui comb. nov. is proposed.
Ge, Cibin; Liu, Bo; Che, Jianmei; Chen, Meichun; Liu, Guohong; Wei, Jiangchun
2015-05-04
The present work reported the isolation, identification and diversity of Bacillus species colonizing on the surface and endophyte in lichens collected from Wuyi Mountain. Nine lichen samples of Evernia, Stereocaulon, Menegazzia and other 6 genera belonging to 7 families were collected from Wuyi mountain nature reserve. The bacillus-like species colonizing on the surface and endophyte in these lichens were isolated and identified by 16S rRNA gene sequence analysis. There was no bacillus-like species isolated from Evernia, Ramalina and Lecarona. A total of 34 bacillus-like bacteria were isolated from another 6 lichen samples. These bacteria were identified as 24 species and were classified into Bacillus, Paenibacillus, Brevibacillus, Lysinibacillus and Viridiibacillus. Paenibacillus and Bacillus are the dominant genera, and accounting for 41. 2% and 35. 3% of all isolated bacteria respectively. Brevibacillus, Lysinibacillus and Viridiibacillu were first reported being isolated from lichens. There were different species and quantity of bacillus colonizing on the surface and endophyte in different lichens. The quantity of bacillus colonizing on the surface of Physcia was more than 3.85 x 10(6) cfu/g and was the largest in the isolated bacteria, while the species of bacillus colonizing on the surface and endophyte in Stereocaulon was the most abundant. Most of the isolated bacteria were colonizing on (in) one lichen genera, but Paenibacillus taichungensis, Paenibacillus odorifer, Brevibacillus agri, Lysinibacillus xylanilyticus was respectively colonizing on (in) 2-3 lichen genera and Bacillus mycoides was colonizing on (in) Menegazzia, Cladonia Physcia, and Stereocaulon. There are species and quantity diversity of bacillus colonizing on (in) lichens.
Ahmed, Mumdooh A M; Bamm, Vladimir V; Harauz, George; Ladizhansky, Vladimir
2007-08-28
The genes of the oligodendrocyte lineage (Golli) encode a family of developmentally regulated isoforms of myelin basic protein. The "classic" MBP isoforms arise from transcription start site 3, whereas Golli-specific isoforms arise from transcription start site 1, and comprise both Golli-specific and classic MBP sequences. The Golli isoform BG21 has been suggested to play roles in myelination and T cell activation pathways. It is an intrinsically disordered protein, thereby presenting a large effective surface area for interaction with other proteins such as Golli-interacting protein. We have used multidimensional heteronuclear NMR spectroscopy to achieve sequence-specific resonance assignments of the recombinant murine BG21 in physiologically relevant buffer, to analyze its secondary structure using chemical shift indexing (CSI), and to investigate its backbone dynamics using 15N spin relaxation measurements. We have assigned 184 out of 199 residues unambiguously. The CSI analysis revealed little ordered secondary structure under these conditions, with only some small fragments having a slight tendency toward alpha-helicity, which may represent putative recognition motifs. The 15N relaxation and NOE measurements confirmed the general behavior of the protein as an extended polypeptide chain, with the N-terminal Golli-specific portion (residues S5-T69) being exceptionally flexible, even in comparison to other intrinsically disordered proteins that have been studied this way. The high degree of flexibility of this N-terminal region may be to provide additional plasticity, or conformational adaptability, in protein-protein interactions. Another highly mobile segment, A126-S127-G128-G129, may function as a hinge.
Bacillus spore-based oral carriers loading curcumin for the therapy of colon cancer.
Yin, Liang; Meng, Zhan; Zhang, Yuxiao; Hu, Kaikai; Chen, Wuya; Han, Kaibin; Wu, Bao-Yan; You, Rong; Li, Chu-Hua; Jin, Ying; Guan, Yan-Qing
2018-02-10
Oral drug delivery has attracted substantial attention due to its advantages over other administration routes. Bacillus spores, as oral probiotic agents, are applied widely. In this paper, a novel Bacillus spore-based oral colon targeted carrier loading curcumin was developed for colon cancer treatment. Curcumin was linked covalently with the outer coat of Bacillus spore and folate, respectively (SPORE-CUR-FA). Bacillus spores are capable of delivering drugs to the colon area through gastric barrier, taking the advantage of its tolerance to the harsh conditions and disintegration of the outer coat of spores after germination in the colon. The drug release in vitro and in vivo of SPORE-CUR-FA was investigated. Results showed that SPORE-CUR-FA had the characteristics of colon-targeted drug release. Pharmacokinetic studies confirmed that Bacillus spore-based carriers could efficiently improve the oral bioavailability of curcumin. In vitro and in vivo anti-tumor studies showed that SPORE-CUR-FA had substantial ability for inhibiting colon cancer cells. These findings suggest that this Bacillus spore-based oral drug delivery system has a great potential for the treatment of colon cancer. Copyright © 2017 Elsevier B.V. All rights reserved.
Study of the Bacillus flora of Nigerian spices.
Antai, S P
1988-05-01
Bacteriological examination of 230 samples of five different unprocessed spices (aligator pepper, red pepper, black pepper, thyme and curry powder) collected randomly from Port Harcourt main markets revealed that the spices were highly contaminated, with bacterial counts ranging from 1.8 x 10(4) to 1.1 x 10(8) per gram. Bacillus cereus was isolated in high numbers in the majority of the 230 samples examined. It was also observed that other Bacillus spp. including B. subtilis, B. polymyxa and B. coagulans occurred in significant numbers.
Bacillus horneckiae sp. nov., isolated from a spacecraft-assembly clean room.
Vaishampayan, Parag; Probst, Alexander; Krishnamurthi, Srinivasan; Ghosh, Sudeshna; Osman, Shariff; McDowall, Alasdair; Ruckmani, Arunachalam; Mayilraj, Shanmugam; Venkateswaran, Kasthuri
2010-05-01
Five Gram-stain-positive, motile, aerobic strains were isolated from a clean room of the Kennedy Space Center where the Phoenix spacecraft was assembled. All strains are rod-shaped, spore-forming bacteria, whose spores were resistant to UV radiation up to 1000 J m(-2). The spores were subterminally positioned and produced an external layer. A polyphasic taxonomic study including traditional biochemical tests, fatty acid analysis, cell-wall typing, lipid analyses, 16S rRNA gene sequencing and DNA-DNA hybridization studies was performed to characterize these novel strains. 16S rRNA gene sequencing and lipid analyses convincingly grouped these novel strains within the genus Bacillus as a cluster separate from already described species. The similarity of 16S rRNA gene sequences among the novel strains was >99 %, but the similarity was only about 97 % with their nearest neighbours Bacillus pocheonensis, Bacillus firmus and Bacillus bataviensis. DNA-DNA hybridization dissociation values were <24 % to the closest related type strains. The novel strains had a G+C content 35.6+/-0.5 mol% and could liquefy gelatin but did not utilize or produce acids from any of the carbon substrates tested. The major fatty acids were iso-C(15 : 0) and anteiso-C(15 : 0) and the cell-wall diamino acid was meso-diaminopimelic acid. Based on phylogenetic and phenotypic results, it is concluded that these strains represent a novel species of the genus Bacillus, for which the name Bacillus horneckiae sp. nov. is proposed. The type strain is 1P01SC(T) (=NRRL B-59162(T) =MTCC 9535(T)).
Effect of Hyperbaric Carbon Dioxide on Spores and Vegetative Cells of Bacillus stearothermophilus
1994-05-01
BACILLUS STEAROTHERMOPHILUS DTIC ELECTE JUN131994 D By Chester T. Roskey* Anthony Sikes *Framingham State College Framingham, MA 01701 94-18004...Spores and Vegetative Cells of Bacillus Stearothermophilus 6. AUTHOR(S) Dr. Chester T. Roskey* & Dr. Anthony Sikes 5 FUNDING NUMBERS PR: TB040...SUBJECT TERMS BACILLUS STEAROTHERMOPHILUS THERM0PHILIC BACTERIA THERM0PHILIC SPOILAGE 15. NUMBER OF PAGES 39 16 PRICE CODE 17. SECURITY
Antimicrobial peptides of the genus Bacillus: a new era for antibiotics.
Sumi, Chandra Datta; Yang, Byung Wook; Yeo, In-Cheol; Hahm, Young Tae
2015-02-01
The rapid onset of resistance reduces the efficacy of most conventional antimicrobial drugs and is a general cause of concern for human well-being. Thus, there is great demand for a continuous supply of novel antibiotics to combat this problem. Bacteria-derived antimicrobial peptides (AMPs) have long been used as food preservatives; moreover, prior to the development of conventional antibiotics, these AMPs served as an efficient source of antibiotics. Recently, peptides produced by members of the genus Bacillus were shown to have a broad spectrum of antimicrobial activity against pathogenic microbes. Bacillus-derived AMPs can be synthesized both ribosomally and nonribosomally and can be classified according to peptide biosynthesis, structure, and molecular weight. The precise mechanism of action of these AMPs is not yet clear; however, one proposed mechanism is that these AMPs kill bacteria by forming channels in and (or) disrupting the bacterial cell wall. Bacillus-derived AMPs have potential in the pharmaceutical industry, as well as the food and agricultural sectors. Here, we focus on Bacillus-derived AMPs as a novel alternative approach to antibacterial drug development. We also provide an overview of the biosynthesis, mechanisms of action, applications, and effectiveness of different AMPs produced by members of the Bacillus genus, including several recently identified novel AMPs.
Evaluation of in situ valine production by Bacillus subtilis in young pigs.
Nørgaard, J V; Canibe, N; Soumeh, E A; Jensen, B B; Nielsen, B; Derkx, P; Cantor, M D; Blaabjerg, K; Poulsen, H D
2016-11-01
Mutants of Bacillus subtilis can be developed to overproduce Val in vitro. It was hypothesized that addition of Bacillus subtilis mutants to pig diets can be a strategy to supply the animal with Val. The objective was to investigate the effect of Bacillus subtilis mutants on growth performance and blood amino acid (AA) concentrations when fed to piglets. Experiment 1 included 18 pigs (15.0±1.1 kg) fed one of three diets containing either 0.63 or 0.69 standardized ileal digestible (SID) Val : Lys, or 0.63 SID Val : Lys supplemented with a Bacillus subtilis mutant (mutant 1). Blood samples were obtained 0.5 h before feeding and at 1, 2, 3, 4, 5 and 6 h after feeding and analyzed for AAs. In Experiment 2, 80 piglets (9.1±1.1 kg) were fed one of four diets containing 0.63 or 0.67 SID Val : Lys, or 0.63 SID Val : Lys supplemented with another Bacillus subtilis mutant (mutant 2) or its parent wild type. Average daily feed intake, daily weight gain and feed conversion ratio were measured on days 7, 14 and 21. On day 17, blood samples were taken and analyzed for AAs. On days 24 to 26, six pigs from each dietary treatment were fitted with a permanent jugular vein catheter, and blood samples were taken for AA analysis 0.5 h before feeding and at 1, 2, 3, 4, 5 and 6 h after feeding. In experiment 1, Bacillus subtilis mutant 1 tended (P<0.10) to increase the plasma levels of Val at 2 and 3 h post-feeding, but this was not confirmed in Experiment 2. In Experiment 2, Bacillus subtilis mutant 2 and the wild type did not result in a growth performance different from the negative and positive controls. In conclusion, results obtained with the mutant strains of Bacillus subtilis were not better than results obtained with the wild-type strain, and for both strains, the results were not different than the negative control.
Current research efforts with Bacillus thuringiensis
Normand R. Dubois
1991-01-01
The bioassay of 260 strains of Bacillus thuringiensis (Bt) and 70 commercial preparations show that regression coefficient estimates may be as critical as LC5O estimates when evaluating them for future consideration.
Measurements of DNA Damage and Repair in Bacillus anthracis Sterne Spores by UV Radiation
2014-09-18
MEASUREMENTS OF DNA DAMAGE AND REPAIR IN BACILLUS ANTHRACIS STERNE SPORES BY UV RADIATION...AFIT-ENP-T-14-S-01 MEASUREMENTS OF DNA DAMAGE AND REPAIR IN BACILLUS ANTHRACIS STERNE SPORES BY UV RADIATION THESIS Presented to the... DAMAGE AND REPAIR IN BACILLUS ANTHRACIS STERNE SPORES BY UV RADIATION Chelsea C. Marcum, BS Approved
Genome sequence of the thermophile Bacillus coagulans Hammer, the type strain of the species.
Su, Fei; Tao, Fei; Tang, Hongzhi; Xu, Ping
2012-11-01
Here we announce a 3.0-Mb assembly of the Bacillus coagulans Hammer strain, which is the type strain of the species within the genus Bacillus. Genomic analyses based on the sequence may provide insights into the phylogeny of the species and help to elucidate characteristics of the poorly studied strains of Bacillus coagulans.
Spencer, R C
2003-01-01
The events of 11 September 2001 and the subsequent anthrax outbreaks have shown that the West needs to be prepared for an increasing number of terrorist attacks, which may include the use of biological warfare. Bacillus anthracis has long been considered a potential biological warfare agent, and this review will discuss the history of its use as such. It will also cover the biology of this organism and the clinical features of the three disease forms that it can produce: cutaneous, gastrointestinal, and inhalation anthrax. In addition, treatment and vaccination strategies will be reviewed. PMID:12610093
Leski, Tomasz A.; Caswell, Clayton C.; Pawlowski, Marcin; Klinke, David J.; Bujnicki, Janusz M.; Hart, Sean J.; Lukomski, Slawomir
2009-01-01
The Bacillus cereus group includes three closely related species, B. anthracis, B. cereus, and B. thuringiensis, which form a highly homogeneous subdivision of the genus Bacillus. One of these species, B. anthracis, has been identified as one of the most probable bacterial biowarfare agents. Here, we evaluate the sequence and length polymorphisms of the Bacillus collagen-like protein bcl genes as a basis for B. anthracis detection and fingerprinting. Five genes, designated bclA to bclE, are present in B. anthracis strains. Examination of bclABCDE sequences identified polymorphisms in bclB alleles of the B. cereus group organisms. These sequence polymorphisms allowed specific detection of B. anthracis strains by PCR using both genomic DNA and purified Bacillus spores in reactions. By exploiting the length variation of the bcl alleles it was demonstrated that the combined bclABCDE PCR products generate markedly different fingerprints for the B. anthracis Ames and Sterne strains. Moreover, we predict that bclABCDE length polymorphism creates unique signatures for B. anthracis strains, which facilitates identification of strains with specificity and confidence. Thus, we present a new diagnostic concept for B. anthracis detection and fingerprinting, which can be used alone or in combination with previously established typing platforms. PMID:19767469
Baril, Eugénie; Coroller, Louis; Couvert, Olivier; Leguérinel, Ivan; Postollec, Florence; Boulais, Christophe; Carlin, Frédéric; Mafart, Pierre
2012-05-01
Although sporulation environmental factors are known to impact on Bacillus spore heat resistance, they are not integrated into predictive models used to calculate the efficiency of heating processes. This work reports the influence of temperature and pH encountered during sporulation on heat resistance of Bacillus weihenstephanensis KBAB4 and Bacillus licheniformis AD978 spores. A decrease in heat resistance (δ) was observed for spores produced either at low temperature, at high temperature or at acidic pH. Sporulation temperature and pH maximizing the spore heat resistance were identified. Heat sensitivity (z) was not modified whatever the sporulation environmental factors were. A resistance secondary model inspired by the Rosso model was proposed. Sporulation temperatures and pHs minimizing or maximizing the spore heat resistance (T(min(R)), T(opt(R)), T(max(R)), pH(min(R)) and pH(opt(R))) were estimated. The goodness of the model fit was assessed for both studied strains and literature data. The estimation of the sporulation temperature and pH maximizing the spore heat resistance is of great interest to produce spores assessing the spore inactivation in the heating processes applied by the food industry. Copyright © 2011 Elsevier Ltd. All rights reserved.
Genome Sequence of the Thermophile Bacillus coagulans Hammer, the Type Strain of the Species
Su, Fei; Tao, Fei; Tang, Hongzhi
2012-01-01
Here we announce a 3.0-Mb assembly of the Bacillus coagulans Hammer strain, which is the type strain of the species within the genus Bacillus. Genomic analyses based on the sequence may provide insights into the phylogeny of the species and help to elucidate characteristics of the poorly studied strains of Bacillus coagulans. PMID:23105047
Bacillus kyonggiensis sp. nov., isolated from soil of a lettuce field.
Dong, Ke; Lee, Sangseob
2011-10-01
A Gram-positive, rod-shaped, motile, endospore-forming bacterial strain, designated NB22(T), was isolated from soil of a lettuce field in Kyonggi province, South Korea, and was characterized by using a polyphasic taxonomic approach. This novel isolate grew optimally at 30-37°C and pH 8-9. It grew in the presence of 0-4% NaCl (optimum, 1-2%). Comparative 16S rRNA gene sequence analysis showed that strain NB22(T) was closely related to members of the genus Bacillus and fell within a coherent cluster comprising B. siralis 171544(T) (98.1%) and B. korlensis ZLC-26(T) (97.3%). The levels of 16S rRNA gene sequence similarity with respect to other Bacillus species with validly published names were less than 96.4%. Strain NB22(T) had a genomic DNA G+C content of 36.3 mol% and the predominant respiratory quinone was MK-7. The peptidoglycan contained meso-diaminopimelic acid. The major cellular fatty acids were iso-C(15:0), anteiso-C(15:0), C(14:0), and C(16:0). These chemotaxonomic results supported the affiliation of strain NB22(T) to the genus Bacillus, and the low DNA-DNA relatedness values and distinguishing phenotypic characteristics allowed genotypic and phenotypic differentiation of strain NB22(T) from recognized Bacillus species. On the basis of the evidence presented, strain NB22(T) is considered to represent a novel species of the genus Bacillus, for which the name Bacillus kyonggiensis sp. nov. is proposed. The type strain is NB22(T) (=KEMB 5401-267(T) =JCM 17569(T)).
Seasonal Outbreak of Bacillus Bacteremia Associated With Contaminated Linen in Hong Kong.
Cheng, Vincent C C; Chen, Jonathan H K; Leung, Sally S M; So, Simon Y C; Wong, Shuk-Ching; Wong, Sally C Y; Tse, Herman; Yuen, Kwok-Yung
2017-05-15
A high seasonal incidence of Bacillus bacteremia was associated with the use of contaminated hospital linens. An outbreak investigation was conducted to study the incidence and source of Bacillus bacteremia during the baseline, outbreak, and postoutbreak period from 1 January 2012 through 31 July 2016 at a university-affiliated teaching hospital in Hong Kong. Replicate organism detection and counting plates were used for microbial screening of linen samples. The Bacillus species isolated from patient and linen samples were identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and were phylogenetically analyzed. During the study period, a total of 113 207 blood cultures were collected from 43 271 patients, of which 978 (0.86%) specimens from 744 (1.72%) patients were identified as Bacillus species. The incidence of Bacillus bacteremia per 10 000 patient admissions and per 10 000 patient-days was significantly higher during the summer outbreak as compared with baseline and 1 year postoutbreak after cessation of the linen supply from the designated laundry and change of laundry protocol (39.97 vs 18.21 vs 2.27; 13.36 vs 5.61 vs 0.73; P < .001). The mean total aerobic bacterial count per 100 cm2 was significantly higher among the 99 linen samples screened during the outbreak period compared to the 100 screened in the postoutbreak period (916.0 ± 641.6 vs 0.6 ± 1.6; P < .001). Blood culture isolates of Bacillus cereus group in 14 of 87 (16.1%) patients were phylogenetically associated with 9 linen sample isolates. Suboptimal conditions of hospital laundry contributed to the seasonal outbreak of Bacillus bacteremia. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
2016-09-01
The Bacillus-inoculated NSM agar plates were incubated at 35°C for at least 48 h until Gram stains revealed the presence of > 90% Bacillus spores in...longer visible in Gram stained samples. Finally, centrifugation was used to remove soluble debris from the preparation and spore concentrations were...minutes post treatment. Gram Stains . Gram stains were used to track the emergence of vegetative Bacillus cells from spores. In this assay, bacterial
Faille, C; Bénézech, T; Midelet-Bourdin, G; Lequette, Y; Clarisse, M; Ronse, G; Ronse, A; Slomianny, C
2014-06-01
Bacillus strains are often isolated from biofilms in the food industries. Previous works have demonstrated that sporulation could occur in biofilms, suggesting that biofilms would be a significant source of food contamination with spores. In this study, we investigated the properties of mono-species and mixed Bacillus biofilms and the ability of Bacillus strains to sporulate inside biofilms. Bacillus strains were able to form mono-species biofilms on stainless steel coupons, with up to 90% spores after a 48 h-incubation. These spores were highly resistant to cleaning but were easily transferred to agar, mimicking the cross-contamination of food, thereby suggesting that biofilms would be of particular concern due to a potential for Bacillus spore food contamination. This hypothesis was strengthened by the fact that Bacillus strains were able to form mixed biofilms with resident strains and that sporulation still occurred easily in these complex structures. Copyright © 2014 Elsevier Ltd. All rights reserved.
2014-01-01
Response surface methodology using a face-centered cube design was used to describe and predict spore inactivation of Bacillus anthracis ∆Sterne and Bacillus thuringiensis Al Hakam spores after exposure of six spore-contaminated materials to hot, humid air. For each strain/material pair, an attempt was made to fit a first or second order model. All three independent predictor variables (temperature, relative humidity, and time) were significant in the models except that time was not significant for B. thuringiensis Al Hakam on nylon. Modeling was unsuccessful for wiring insulation and wet spores because there was complete spore inactivation in the majority of the experimental space. In cases where a predictive equation could be fit, response surface plots with time set to four days were generated. The survival of highly purified Bacillus spores can be predicted for most materials tested when given the settings for temperature, relative humidity, and time. These predictions were cross-checked with spore inactivation measurements. PMID:24949256
Performance of Microbial Concrete Developed Using Bacillus Subtilus JC3
NASA Astrophysics Data System (ADS)
Rao, M. V. Seshagiri; Reddy, V. Srinivasa; Sasikala, Ch.
2017-12-01
Concrete is vulnerable to deterioration, corrosion, and cracks, and the consequent damage and loss of strength requires immensely expensive remediation and repair. So need for special concrete that they would respond to crack formation with an autonomous self-healing action lead to research and development of microbial concrete. The microbial concrete works on the principle of calcite mineral precipitation by a specific group of alkali-resistant spore-forming bacteria related to the genus Bacillus called Bacillus subtilis JC3, this phenomenon is called biomineralization or Microbiologically Induced Calcite Crystal Precipitation. Bacillus subtilis JC3, a common soil bacterium, has inherent ability to precipitate calcite crystals continuously which enhances the strength and durability performance of concrete enormously. This microbial concrete can be called as a "Self healing Bacterial Concrete" because it can remediate its cracks by itself without any human intervention and would make the concrete more durable and sustainable. This paper discuss the incorporation of microorganism Bacillus subtilis JC3 (developed at JNTU, India) into concrete and presents the results of experimental investigations carried out to study the improved durability and sustainability characteristics of microbial concrete.
In vitro susceptibility of Bacillus spp. to selected antimicrobial agents.
Weber, D J; Saviteer, S M; Rutala, W A; Thomann, C A
1988-01-01
Although often dismissed as contaminants when isolated from blood cultures, Bacillus spp. are increasingly recognized as capable of causing serious systemic infections. As part of a clinical-microbiological study, 89 strains of Bacillus spp. isolated from clinical blood cultures between 1981 and 1985 had their species determined and were tested for antimicrobial agent susceptibility to 18 antibiotics. Species of isolates were determined by the API 50CH and API 20E systems. Bacillus cereus (54 strains) was the most common species isolated, followed by B. megaterium (13 strains), B. polymyxa (5 strains), B. pumilus (4 strains), B. subtilis (4 strains), B. circulans (3 strains), B. amyloliquefaciens (2 strains), B. licheniformis (1 strain), and Bacillus spp. (3 strains). Microdilution MIC susceptibility tests revealed all B. cereus strains to be susceptible to imipenem, vancomycin, chloramphenicol, gentamicin, and ciprofloxacin. Non-B. cereus strains were most susceptible to imipenem, vancomycin, LY146032, and ciprofloxacin. Disk susceptibility testing suggested that B. cereus was rarely susceptible to penicillins, semisynthetic penicillins, or cephalosporins with the exception of mezlocillin. In contrast, many non-B. cereus strains were susceptible to penicillins, semisynthetic penicillins, and cephalosporins, but marked variability was noted among species. PMID:3395100
21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 3 2013-04-01 2013-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the culture...
21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 3 2012-04-01 2012-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the culture...
21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false α-Amylase enzyme preparation from Bacillus... Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the culture filtrate that results from a pure...
21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the culture...
21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the culture...
40 CFR 180.1128 - Bacillus subtilis MBI 600; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis MBI 600; exemption... FOOD Exemptions From Tolerances § 180.1128 Bacillus subtilis MBI 600; exemption from the requirement of... biofungicide Bacillus subtilis MBI 600 in or on all food commodities, including residues resulting from post...
40 CFR 180.1269 - Bacillus mycoides Isolate J: exemption from the requirement of a tolerance.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus mycoides Isolate J: exemption... FOOD Exemptions From Tolerances § 180.1269 Bacillus mycoides Isolate J: exemption from the requirement of a tolerance. Bacillus mycoides isolate J is temporarily exempt from the requirement of a tolerance...
Induced calcium carbonate precipitation using Bacillus species.
Seifan, Mostafa; Samani, Ali Khajeh; Berenjian, Aydin
2016-12-01
Microbially induced calcium carbonate precipitation is an emerging process for the production of self-healing concrete. This study was aimed to investigate the effects and optimum conditions on calcium carbonate biosynthesis. Bacillus licheniformis, Bacillus sphaericus, yeast extract, urea, calcium chloride and aeration were found to be the most significant factors affecting the biomineralization of calcium carbonate. It was noticed that the morphology of microbial calcium carbonate was mainly affected by the genera of bacteria (cell surface properties), the viscosity of the media and the type of electron acceptors (Ca 2+ ). The maximum calcium carbonate concentration of 33.78 g/L was achieved at the optimum conditions This value is the highest concentration reported in the literature.
Class IV polyhydroxyalkanoate (PHA) synthases and PHA-producing Bacillus.
Tsuge, Takeharu; Hyakutake, Manami; Mizuno, Kouhei
2015-08-01
This review highlights the recent investigations of class IV polyhydroxyalkanoate (PHA) synthases, the newest classification of PHA synthases. Class IV synthases are prevalent in organisms of the Bacillus genus and are composed of a catalytic subunit PhaC (approximately 40 kDa), which has a PhaC box sequence ([GS]-X-C-X-[GA]-G) at the active site, and a second subunit PhaR (approximately 20 kDa). The representative PHA-producing Bacillus strains are Bacillus megaterium and Bacillus cereus; the nucleotide sequence of phaC and the genetic organization of the PHA biosynthesis gene locus are somewhat different between these two strains. It is generally considered that class IV synthases favor short-chain-length monomers such as 3-hydroxybutyrate (C4) and 3-hydroxyvalerate (C5) for polymerization, but can polymerize some unusual monomers as minor components. In Escherichia coli expressing PhaRC from B. cereus YB-4, the biosynthesized PHA undergoes synthase-catalyzed alcoholytic cleavage using endogenous and exogenous alcohols. This alcoholysis is thought to be shared among class IV synthases, and this reaction is useful not only for the regulation of PHA molecular weight but also for the modification of the PHA carboxy terminus. The novel properties of class IV synthases will open up the possibility for the design of new PHA materials.
Purification and characterization of two polyhydroxyalcanoates from Bacillus cereus.
Zribi-Maaloul, Emna; Trabelsi, Imen; Elleuch, Lobna; Chouayekh, Hichem; Ben Salah, Riadh
2013-10-01
This work aimed to study the potential of 155 strains of Bacillus sp., isolated from a collection of Tunisian microorganisms, for polyhydroxyalcanoates production. The strains were submitted to a battery of standard tests commonly used for determining bioplastic properties. The findings revealed that two of the isolates, namely Bacillus US 163 and US 177, provided red excitations at a wavelength of approximately 543 nm. The polyhydroxyalcanoates produced by the two strains were purified. Gas chromatography-mass spectroscopy (GC-MS), Fourier transformed infrared spectroscopy (FTIR), and gel permeation chromatography (GPC) were used to characterize the two biopolymers. Bacillus US 163 was noted to produce a poly methyl-3-hydroxy tetradecanoic acid (P-3HTD) with an average molecular weight of 455 kDa, a completely amorphous homopolymer without crystallinity. The US 177 strain produced a homopolymer of methyl-3-hydroxy octadecanoic acid (P3-HOD) with an average molecular weight of 555 kDa. Exhibiting the highest performance, US 163 and US 177 were submitted to 16S rRNA gene sequencing, and the results revealed that they belonged to the Bacillus cereus species. Overall, the findings indicated that the Bacilli from petroleum soil have a number of promising properties that make them promising candidates for bioplastic production. Copyright © 2013 Elsevier B.V. All rights reserved.
Barratt, M D; Langowski, J J
1999-01-01
The DEREK knowledge-based computer system contains a subset of approximately 50 rules describing chemical substructures (toxophores) responsible for skin sensitization. This rulebase, based originally on Unilever historical in-house guinea pig maximization test data, has been subject to extensive validation and is undergoing refinement as the next stage of its development. As part of an ongoing program of validation and testing, the predictive ability of the sensitization rule set has been assessed by processing the structures of the 84 chemical substances in the list of contact allergens issued by the BgVV (German Federal Institute for Health Protection of Consumers). This list of chemicals is important because the biological data for each of the chemicals have been carefully scrutinized and peer reviewed, a key consideration in an area of toxicology in which much unreliable and potentially misleading data have been published. The existing DEREK rulebase for skin sensitization identified toxophores for skin sensitization in the structures of 71 out of the 84 chemicals (85%). The exercise highlighted areas of chemistry where further development of the rulebase was required, either by extension of the scope of existing rules or by generation of new rules where a sound mechanistic rationale for the biological activity could be established. Chemicals likely to be acting as photoallergens were identified, and new rules for photoallergenicity have subsequently been written. At the end of the exercise, the refined rulebase was able to identify toxophores for skin sensitization for 82 of the 84 chemicals in the BgVV list.
NASA Astrophysics Data System (ADS)
Watanabe, Toshio; Yamada, Yohei; Motonaka, Junko; Yabutani, Tomoki; Sakuraba, Haruhiko; Yasuzawa, Mikito
In this study, electrodeposition of thermostable enzyme Bacillus subtilis CotA, which is a laccase and has a bilirubin oxidase (BOD) activity, was investigated. The electrodeposition was operated in a mixture of Bacillus subtilis CotA in the PBS (pH 8.0) and TritonX-100 under applying potential (1100 mV vs. Ag/AgCl for 5 min.). The current response was measured by linear sweep voltammetry technique (LSV). The thermostable enzyme Bacillus subtilis CotA electrodeposited electrode was compared with a mesophile BOD electrodeposited electrode. As a result, the Bacillus subtilis CotA modified electrode showed better sensitivity and long-term stability than the mesophile BOD modified electrode.
Inactivation of Bacillus Anthracis Spores Using Carbon Nanotubes
2014-10-30
S1793984412300129 Marquita Lilly, Liju Yang, Kamal Aferchich. Effect of Single-walled Carbon Nanotubes on Bacillus Anthracis Cell Growth, Sporulation ...addition, SWNTs treatment did not induce sporulation of B. anthracis. [Aferichich, et al. 2012]. 2) SWNTs in combination with oxidizing agents...8. Kamal Aferchich, Marquita Lilly, Liju Yang*. 2012. Effect of Single‐walled Carbon Nanotubes on Bacillus Anthracis Cell Growth, Sporulation , and
Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies
NASA Technical Reports Server (NTRS)
Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.
1991-01-01
Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".
Rogers, J V; Sabourin, C L K; Choi, Y W; Richter, W R; Rudnicki, D C; Riggs, K B; Taylor, M L; Chang, J
2005-01-01
To evaluate the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface materials using hydrogen peroxide gas. Bacillus anthracis, B. subtilis, and G. stearothermophilus spores were dried on seven types of indoor surfaces and exposed to > or =1000 ppm hydrogen peroxide gas for 20 min. Hydrogen peroxide exposure significantly decreased viable B. anthracis, B. subtilis, and G. stearothermophilus spores on all test materials except G. stearothermophilus on industrial carpet. Significant differences were observed when comparing the reduction in viable spores of B. anthracis with both surrogates. The effectiveness of gaseous hydrogen peroxide on the growth of biological indicators and spore strips was evaluated in parallel as a qualitative assessment of decontamination. At 1 and 7 days postexposure, decontaminated biological indicators and spore strips exhibited no growth, while the nondecontaminated samples displayed growth. Significant differences in decontamination efficacy of hydrogen peroxide gas on porous and nonporous surfaces were observed when comparing the mean log reduction in B. anthracis spores with B. subtilis and G. stearothermophilus spores. These results provide comparative information for the decontamination of B. anthracis spores with surrogates on indoor surfaces using hydrogen peroxide gas.
Expression and characterization of aiiA gene from Bacillus subtilis BS-1.
Pan, Jieru; Huang, Tianpei; Yao, Fan; Huang, Zhipeng; Powell, Charles A; Qiu, Sixin; Guan, Xiong
2008-01-01
AHL-lactonase (AiiA), a metallo-beta-lactamase produced by Bacillus thuringiensis, Bacillus cereus and Bacillus anthracis, specifically hydrolyzes N-acyl-homoserine lactones (AHLs) secreted by Gram-negative bacteria and thereby attenuates the symptoms caused by plant pathogens. In this study, an aiiA gene was cloned from Bacillus subtilis BS-1 by PCR with a pair of degenerate primers. The deduced 250 amino acid sequence contained two small conserved regions, 103SHLHFDH109 and 166TPGHTPGH173, which are characteristic of the metallo-beta-lactamase family. Homology comparison revealed that the deduced amino acid sequence had a high degree of similarity with those of the known AiiA proteins in the B. cereus group. Additionally, the aiiA gene was expressed in Escherichia coli BL21 (DE3) pLysS and the expressed AiiA protein could attenuate the soft rot symptoms caused by Erwinia carotovora var. carotovora.
40 CFR 180.1111 - Bacillus subtilis GB03; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis GB03; exemption from... FOOD Exemptions From Tolerances § 180.1111 Bacillus subtilis GB03; exemption from the requirement of a tolerance. The biofungicide Bacillus subtilis GB03 is exempted from the requirement of a tolerance in or on...
Classification of Bacillus beneficial substances related to plants, humans and animals.
Mongkolthanaruk, Wiyada
2012-12-01
Genus Bacillus is a spore-forming bacterium that has unique properties in cell differentiation, allowing the forming of spores in stress conditions and activated in the vegetative cell, with suitable environments occurring during the life cycle acting as a trigger. Their habitat is mainly in soil; thus, many species of Bacillus are associated with plants as well as rhizosphere bacteria and endophytic bacteria. Signal transduction is the principal mechanism of interactions, both within the cell community and with the external environment, which provides the subsequent functions or properties for the cell. The antimicrobial compounds of Bacillus sp. are potentially useful products, which have been used in agriculture for the inhibition of phytopathogens, for the stimulation of plant growth, and in the food industry as probiotics. There are two systems for the synthesis of these substances: nonribosomal synthesis of cyclic lipopeptides (NRPS) and polyketides (PKS). For each group, the structures, properties, and genes of the main products are described. The different compounds described and the way in which they co-exist exhibit the relationship of Bacillus substances to plants, humans, and animals.
Diversity of Secondary Metabolites from Marine Bacillus Species: Chemistry and Biological Activity
Mondol, Muhammad Abdul Mojid; Shin, Hee Jae; Islam, Mohammad Tofazzal
2013-01-01
Marine Bacillus species produce versatile secondary metabolites including lipopeptides, polypeptides, macrolactones, fatty acids, polyketides, and isocoumarins. These structurally diverse compounds exhibit a wide range of biological activities, such as antimicrobial, anticancer, and antialgal activities. Some marine Bacillus strains can detoxify heavy metals through reduction processes and have the ability to produce carotenoids. The present article reviews the chemistry and biological activities of secondary metabolites from marine isolates. Side by side, the potential for application of these novel natural products from marine Bacillus strains as drugs, pesticides, carotenoids, and tools for the bioremediation of heavy metal toxicity are also discussed. PMID:23941823
Li, Jinxing; Singh, Virendra V; Sattayasamitsathit, Sirilak; Orozco, Jahir; Kaufmann, Kevin; Dong, Renfeng; Gao, Wei; Jurado-Sanchez, Beatriz; Fedorak, Yuri; Wang, Joseph
2014-11-25
Threats of chemical and biological warfare agents (CBWA) represent a serious global concern and require rapid and efficient neutralization methods. We present a highly effective micromotor strategy for photocatalytic degradation of CBWA based on light-activated TiO2/Au/Mg microspheres that propel autonomously in natural water and obviate the need for external fuel, decontaminating reagent, or mechanical agitation. The activated TiO2/Au/Mg micromotors generate highly reactive oxygen species responsible for the efficient destruction of the cell membranes of the anthrax simulant Bacillus globigii spore, as well as rapid and complete in situ mineralization of the highly persistent organophosphate nerve agents into nonharmful products. The water-driven propulsion of the TiO2/Au/Mg micromotors facilitates efficient fluid transport and dispersion of the photogenerated reactive oxidative species and their interaction with the CBWA. Coupling of the photocatalytic surface of the micromotors and their autonomous water-driven propulsion thus leads to a reagent-free operation which holds a considerable promise for diverse "green" defense and environmental applications.
The Hemolytic Enterotoxin HBL Is Broadly Distributed among Species of the Bacillus cereus Group
Prüß, Birgit M.; Dietrich, Richard; Nibler, Birgit; Märtlbauer, Erwin; Scherer, Siegfried
1999-01-01
The prevalence of the hemolytic enterotoxin complex HBL was determined in all species of the Bacillus cereus group with the exception of Bacillus anthracis. hblA, encoding the binding subunit B, was detected by PCR and Southern analysis and was confirmed by partial sequencing of 18 strains. The sequences formed two clusters, one including B. cereus and Bacillus thuringiensis strains and the other one consisting of Bacillus mycoides, Bacillus pseudomycoides, and Bacillus weihenstephanensis strains. From eight B. thuringiensis strains, the enterotoxin gene hblA could be amplified. Seven of them also expressed the complete HBL complex as determined with specific antibodies against the L1, L2, and B components. Eleven of 16 B. mycoides strains, all 3 B. pseudomyoides strains, 9 of 15 B. weihenstephanensis strains, and 10 of 23 B. cereus strains carried hblA. While HBL was not expressed in the B. pseudomycoides strains, the molecular assays were in accordance with the immunological assays for the majority of the remaining strains. In summary, the hemolytic enterotoxin HBL seems to be broadly distributed among strains of the B. cereus group and relates neither to a certain species nor to a specific environment. The consequences of this finding for food safety considerations need to be evaluated. PMID:10584001
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-20
... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 180 [EPA-HQ-OPP-2010-0944; FRL-9334-3] Bacillus... requirement of a tolerance for residues of Bacillus amyloliquefaciens strain D747 (formerly known as Bacillus subtilis variant amyloliquefaciens strain D747). This document is being issued to correct the typographical...
Controlling gastrointestinal nematodes in cattle by Bacillus species.
Pinto, Natália Berne; de Castro, Leonardo Mortagua; de Almeida Capella, Gabriela; Motta, Tairan Ourique; de Souza Stori de Lara, Ana Paula; de Moura, Micaele Quintana; Berne, Maria Elisabeth Aires; Leite, Fábio Pereira Leivas
2017-10-15
In this study, we tested the in vitro and in vivo larvicidal activity of Bacillus species against gastrointestinal nematodes in cattle, and their viability in the presence of anthelmintics. For in vitro tests, cattle feces naturally infected with trichostrongylides were incubated with spore suspensions of Bacillus circulans (Bcir), B. thuringiensis var. osvaldocruzi (Bto), B. thuringiensis var. israelensis (Bti) or B. thuringiensis var. kurstaki (Btk). Subsequently, residual larvae were counted and identified. All of the Bacillus species showed 60% or more larvicidal effects. Bcir and Bti were selected to be incubated with anthelmintics (moxidectin, nitroxynil and levamisole), and after 24, 72, and 144h, their viability was evaluated. Bti showed highest drug resistance, maintaining a concentration of 1×10 7 CFU/mL. Based on this result, Bti was selected for in vivo tests on calves naturally infected with gastrointestinal nematodes. The calves were dived into four groups: Group 1, Bti suspension of ∼1×10 9 CFU orally administered; Group 2, Bti suspension of ∼1×10 9 CFU orally administered with levamisole (subcutaneously, 150mg); Group 3, only levamisole (subcutaneously, 150mg), and Group 4 untreated. Then 24 and 48h after treatment, larvae numbers were counted. We observed a reduction of 84%, 100%, and 100% after 48h of treatment, respectively, for Groups 1, 2 and 3 treatments in comparison with the untreated. The tested Bacillus species showed larvicidal activity against bovine trichostrongylides, and its association with anthelmintics. It may serve as a promising integrated alternative for control of gastrointestinal nematodes in cattle. Copyright © 2017 Elsevier B.V. All rights reserved.
Engineering of thermotolerant Bacillus coagulans for production of D(-)-lactic acid
Wang, Qingzhao; Shanmugam, Keelnatham T; Ingram, Lonnie O
2014-12-02
Genetically modified microorganisms having the ability to produce D(-)-lactic acid at temperatures between 30.degree. C. and 55.degree. C. are provided. In various embodiments, the microorganisms may have the chromosomal lactate dehydrogenase (ldh) gene and/or the chromosomal acetolactate synthase (alsS) gene inactivated. Exemplary microorganisms for use in the disclosed methods are Bacillus spp., such as Bacillus coagulans.
Characterization of Bacillus phage-K2 isolated from chungkookjang, a fermented soybean foodstuff.
Kim, Eun Ju; Hong, Jeong Won; Yun, Na-Rae; Lee, Young Nam
2011-01-01
An investigation of a virulent Bacillus phage-K2 (named Bp-K2) isolated from chungkookjang (a fermented soybean foodstuff) was made. Bp-K2 differed in infectivity against a number of Bacillus subtilis strains including starter strains of chungkookjang and natto, being more infectious to Bacillus strains isolated from the chungkookjang, but much less active against a natto strain. Bp-K2 is a small DNA phage whose genome size is about 21 kb. Bp-K2 is a tailed bacteriophage with an isometric icosahedral head (50 nm long on the lateral side, 80 nm wide), a long contractile sheath (85-90 nm × 28 nm), a thin tail fiber (80-85 nm long, 10 nm wide), and a basal plate (29 nm long, 47 nm wide) with a number of spikes, but no collar. The details of the structures of Bp-K2 differ from natto phage ϕBN100 as well as other known Bacillus phages such as SPO1-like or ϕ 29-like viruses. These data suggest that Bp-K2 would be a new member of the Myoviridae family of Bacillus bacteriophages.
Germination of Spores of Astrobiologically Relevant Bacillus Species in High-Salinity Environments.
Nagler, Katja; Julius, Christina; Moeller, Ralf
2016-07-01
In times of increasing space exploration and search for extraterrestrial life, new questions and challenges for planetary protection, aiming to avoid forward contamination of different planets or moons with terrestrial life, are emerging. Spore-forming bacteria such as Bacillus species have a high contamination potential due to their spores' extreme resistance, enabling them to withstand space conditions. Spores require liquid water for their conversion into a growing cell (i.e., spore germination and subsequent growth). If present, water on extraterrestrial planets or moons is likely to be closely associated with salts (e.g., in salty oceans or brines), thus constituting high-salinity environments. Spores of Bacillus subtilis can germinate despite very high salt concentrations, although salt stress does exert negative effects on this process. In this study, germination and metabolic reactivation ("outgrowth") of spores of five astrobiologically relevant Bacillus species (B. megaterium, B. pumilus SAFR-032, B. nealsonii, B. mojavensis, and B. vallismortis) in high salinity (≤3.6 M NaCl) were investigated. Spores of different species exhibited different germination and outgrowth capabilities in high salinity, which strongly depended on germination conditions, especially the exact composition of the medium. In this context, a new "universal" germination trigger for Bacillus spores, named KAGE (KCl, L-alanine, D-glucose, ectoine), was identified, which will be very useful for future comparative germination and outgrowth studies on different Bacillus species. Overall, this study yielded interesting new insights on salt stress effects on spore germination and points out the difficulty of predicting the potential of spores to contaminate salty environments on extraterrestrial celestial bodies. Bacillus species-Spores-Germination-High salinity-Salt stress-NaCl-Inhibition. Astrobiology 16, 500-512.
Wang, Kui; Shu, Changlong; Soberón, Mario; Bravo, Alejandra; Zhang, Jie
2018-04-30
The goal of this work was to perform a systematic characterization of Bacillus thuringiensis (Bt) strains from the Bacillus Genetic Stock Center (BGSC) collection using Multi-Locus Sequence Typing (MLST). Different genetic markers of 158 Bacillus thuringiensis (Bt) strains from 73 different serovars stored in the BGSC, that represented 92% of the different Bt serovars of the BGSC were analyzed, the 8% that were not analyzed were not available. In addition, we analyzed 72 Bt strains from 18 serovars available at the pubMLST bcereus database, and Bt strains G03, HBF18 and Bt185, with no H serovars provided by our laboratory. We performed a systematic MLST analysis using seven housekeeping genes (glpF, gmK, ilvD, pta, pur, pycA and tpi) and analyzed correlation of the results of this analysis with strain serovars. The 233 Bt strains analyzed were assigned to 119 STs from which 19 STs were new. Genetic relationships were established by phylogenetic analysis and showed that STs could be grouped in two major Clusters containing 21 sub-groups. We found that a significant number of STs (101 in total) correlated with specific serovars, such as ST13 that corresponded to nine Bt isolates from B. thuringiensis serovar kenyae. However, other serovars showed high genetic variability and correlated with multiple STs; for example, B. thuringiensis serovar morrisoni correlated with 11 different STs. In addition, we found that 16 different STs correlated with multiple serovars (2-4 different serovars); for example, ST12 correlated with B. thuringiensis serovar alesti, dakota, palmanyolensis and sotto/dendrolimus. These data indicated that only partial correspondence between MLST and serotyping can be established. Copyright © 2018 Elsevier Inc. All rights reserved.
Gu, Fenglin; Chen, Yonggan; Fang, Yiming; Wu, Guiping; Tan, Lehe
2015-10-09
Colonizing Bacillus in vanilla (Vanilla planifolia Andrews) beans is involved in glucovanillin hydrolysis and vanillin formation during conventional curing. The flavor profiles of vanilla beans under Bacillus-assisted curing were analyzed through gas chromatography-mass spectrometry, electronic nose, and quantitative sensory analysis. The flavor profiles were analytically compared among the vanilla beans under Bacillus-assisted curing, conventional curing, and non-microorganism-assisted curing. Vanilla beans added with Bacillus vanillea XY18 and Bacillus subtilis XY20 contained higher vanillin (3.58%±0.05% and 3.48%±0.10%, respectively) than vanilla beans that underwent non-microorganism-assisted curing and conventional curing (3.09%±0.14% and 3.21%±0.15%, respectively). Forty-two volatiles were identified from endogenous vanilla metabolism. Five other compounds were identified from exogenous Bacillus metabolism. Electronic nose data confirmed that vanilla flavors produced through the different curing processes were easily distinguished. Quantitative sensory analysis confirmed that Bacillus-assisted curing increased vanillin production without generating any unpleasant sensory attribute. Partial least squares regression further provided a correlation model of different measurements. Overall, we comparatively analyzed the flavor profiles of vanilla beans under Bacillus-assisted curing, indirectly demonstrated the mechanism of vanilla flavor formation by microbes.
Liu, Min; Cui, Ying; Chen, Yuqing; Lin, Xiangzhi; Huang, Huiqin; Bao, Shixiang
2017-03-01
Members of the genus Bacillus and related spore-forming genera are ubiquitous. However, Bacillus-like species isolated from marine sediments have attracted less interest than their terrestrial relatives. Here, we investigated the diversity of Bacillus-like bacterial communities in the sediments of the Bamenwan mangrove wetland in Hainan, China, using culture-dependent and culture-independent methods, and present the first report on this subject. We also discovered some potential novel species from the sediment samples. Four families, Bacillaceae (58%), Paenibacillaceae (22%), Alicyclobacillaceae (15%), and Planococcaceae (5%), and 9 genera, Bacillus (42%), Paenibacillus (16%), Halobacillus (13%), Alicyclobacillus (11%), Rummeliibacillus (5%), Cohnella (5%), Tumebacillus (4%), Pontibacillus (3%), and Aneurinibacillus (2%), were identified by pyrosequencing. In contrast, only 4 genera, Bacillus (57%), Paenibacillus (23%), Halobacillus (14%), and Virgibacillus (6%), were detected by the culture-dependent method. In the 16S rDNA sequencing analysis, the isolates HB12036 and HB12037 were closest to Bacillus okuhidensis Kh10-101 T and Paenibacillus xylanilyticus XIL14 T with similarities of 94.8% and 95.9%, respectively, indicating that these were novel species. Bacillus sp. HB12035 and HB12040 exhibited antimicrobial activity against Staphylococcus aureus ATCC 25923, and Bacillus sp. HB12033 exhibited antimicrobial activity against Ustilago scitaminea Syd.
NASA Astrophysics Data System (ADS)
Qi, Hong; Na, Ri; Xin, Jiletu; Jie Xie, Ya; Guo, Jiu Feng
2013-03-01
Bacillus Natto is an important strain for gamma-poly glutamic acid (γ-PGA) production. The mutagenesis of Bacillus Natto 20646 under corona electric field and the screening of high γ-PGA producing mutant were investigated. A new mutant bacillus natto Ndlz01 was isolated from Bacillus Natto 20646 after mutation in corona electric field at 9kV for 2min. The Ndlz01 exhibited genetic stability of high γ-PGA producing ability even after five generation cultures. When the bacterium was mutated in streamer discharge state at 9kV for 2min, its death rate was more than 90%. Compared with the yield of γ-PGA based on the original Bacillus Natto 20646, the γ-PGA yield of mutant bacillus natto Ndlz01 increased from 2.6 to 5.94 g/L, with an increase rate of 129.78%.
Ikawa, K; Araki, H; Tsujino, Y; Hayashi, Y; Igarashi, K; Hatada, Y; Hagihara, H; Ozawa, T; Ozaki, K; Kobayashi, T; Ito, S
1998-09-01
We have constructed a new excretion vector, pHSP64, to develop a hyperexcretion system for Bacillus subtilis [Sumitomo et al., Biosci. Biotech. Biochem., 59, 2172-2175 (1995)]. The structural gene for a novel liquefying semi-alkaline alpha-amylase from the alkaliphilic Bacillus sp. KSM-1378 was amplified by PCR. It was cloned into a SalI-SmaI site of pHSP64 and the recombinant plasmid obtained was introduced into B. subtilis. The transformed B. subtilis hyperproduced the alpha-amylase activity extracellularly, corresponding to approximately 1.0 g (5 x 10(6) units) per liter of an optimized liquid culture. The recombinant enzyme was purified to homogeneity by a simple purification procedure with very high yield. No significant differences in physiochemical and catalytic properties were observed between the recombinant enzyme and the native enzyme produced by Bacillus sp. KSM-1378. The enzymatic properties of the recombinant enzyme were further examined with respect to the responses to various metal ions. The recombinant enzyme could easily be crystallized at room temperature within one day in a buffered solution of 10% (w/v) ammonium sulfate (pH 6.5).
40 CFR 180.1209 - Bacillus subtilis strain QST 713; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis strain QST 713... RESIDUES IN FOOD Exemptions From Tolerances § 180.1209 Bacillus subtilis strain QST 713; exemption from the... the microbial pesticide Bacillus subtilis strain QST 713 when used in or on all food commodities. [65...
Sánchez, Marta; Prim, Núria; Rández-Gil, Francisca; Pastor, F I Javier; Diaz, Pilar
2002-05-05
Lipases are versatile biocatalists showing multiple applications in a wide range of biotechnological processes. The gene lipA coding for Lipase A from Bacillus subtilis was isolated by PCR amplification, cloned and expressed in Escherichia coli, Saccharomyces cerevisiae and Bacillus subtilis strains, using pBR322, YEplac112 and pUB110-derived vectors, respectively. Lipase activity analysis of the recombinant strains showed that the gene can be properly expressed in all hosts assayed, this being the first time a lipase from bacterial origin can be expressed in baker's S. cerevisiae strains. An important increase of lipase production was obtained in heterologous hosts with respect to that of parental strains, indicating that the described systems can represent a useful tool to enhance productivity of the enzyme for biotechnological applications, including the use of the lipase in bread making, or as a technological additive. Copyright 2002 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Nur Afifah, Diana; Rustanti, Ninik; Anjani, Gemala; Syah, Dahrul; Yanti; Suhartono, Maggy T.
2017-02-01
This paper presents the proteomics study which includes separation, identification and characterization of proteins. The experiment on Indonesian fermented food such as extracellular fibrinolytic protease from Bacillus licheniformis RO3 and Bacillus pumilus 2.g isolated from red oncom and tempeh gembus was conducted. The experimental works comprise the following steps: (1) a combination of one- and two-dimensional electrophoresis analysis, (2) mass spectrometry analysis using MALDI-TOF-MS and (3) investigation using protein database. The result suggested that there were new two protein fractions of B. licheniformis RO3 and three protein fractions of B. pumilus 2.g. These result has not been previously reported.
Tomaso, Herbert; Bartling, Carsten; Al Dahouk, Sascha; Hagen, Ralf M; Scholz, Holger C; Beyer, Wolfgang; Neubauer, Heinrich
2006-01-01
Anthrax Blood Agar (ABA) and Cereus Ident Agar (CEI) were evaluated as selective growth media for the isolation of Bacillus anthracis using 92 B. anthracis and 132 other Bacillus strains from 30 species. The positive predictive values for the identification of B. anthracis on ABA, CEI, and the combination of both were 72%, 71%, and 90%, respectively. Thus, less than 10% of all species were misidentified using both nutrient media. Species which might be misidentified as B. anthracis were B. cereus, B. mycoides, and B. thuringiensis. Particularly, 30% of B. weihenstephanensis strains were misidentified as B. anthracis.
Yan, Fang; Yu, Yiyang; Wang, Luyao; Luo, Yuming; Guo, Jian-Hua; Chai, Yunrong
2016-01-01
Bacteria adopt alternative cell fates during development. In Bacillus subtilis, the transition from planktonic growth to biofilm formation and sporulation is controlled by a complex regulatory circuit, in which the most important event is activation of Spo0A, a transcription factor and a master regulator for genes involved in both biofilm formation and sporulation. In B. cereus, the regulatory pathway controlling biofilm formation and cell differentiation is much less clear. In this study, we show that a novel gene, comER, plays a significant role in biofilm formation as well as sporulation in both B. subtilis and B. cereus. Mutations in the comER gene result in defects in biofilm formation and a delay in spore formation in the two Bacillus species. Our evidence supports the idea that comER may be part of the regulatory circuit that controls Spo0A activation. comER likely acts upstream of sda, a gene encoding a small checkpoint protein for both sporulation and biofilm formation, by blocking the phosphor-relay and thereby Spo0A activation. In summary, our studies outlined a conserved, positive role for comER, a gene whose function was previously uncharacterized, in the regulation of biofilm formation and sporulation in the two Bacillus species.
Yan, Fang; Yu, Yiyang; Wang, Luyao; Luo, Yuming; Guo, Jian-hua; Chai, Yunrong
2016-01-01
Bacteria adopt alternative cell fates during development. In Bacillus subtilis, the transition from planktonic growth to biofilm formation and sporulation is controlled by a complex regulatory circuit, in which the most important event is activation of Spo0A, a transcription factor and a master regulator for genes involved in both biofilm formation and sporulation. In B. cereus, the regulatory pathway controlling biofilm formation and cell differentiation is much less clear. In this study, we show that a novel gene, comER, plays a significant role in biofilm formation as well as sporulation in both B. subtilis and B. cereus. Mutations in the comER gene result in defects in biofilm formation and a delay in spore formation in the two Bacillus species. Our evidence supports the idea that comER may be part of the regulatory circuit that controls Spo0A activation. comER likely acts upstream of sda, a gene encoding a small checkpoint protein for both sporulation and biofilm formation, by blocking the phosphor-relay and thereby Spo0A activation. In summary, our studies outlined a conserved, positive role for comER, a gene whose function was previously uncharacterized, in the regulation of biofilm formation and sporulation in the two Bacillus species. PMID:27446060
2011-11-28
New Reprint Screening of Peptide Libraries against Protective Antigen of Bacillus anthracis in a Disposable Microfluidic Cartridge W911NF-09-D-0001...against Protective Antigen of Bacillus anthracis in a Disposable Microfluidic Cartridge Report Title ABSTRACT See attached. Screening of Peptide...Libraries against Protective Antigen of Bacillus anthracis in a Disposable Microfluidic Cartridge Joshua M. Kogot1, Yanting Zhang2, Stephen J. Moore3
USDA-ARS?s Scientific Manuscript database
‘Bacillus vanillea’ XY18T (=CGMCC 8629 T =NCCB 100507 T) was isolated from cured vanilla beans and involved in the formation of vanilla aroma compounds. A draft genome of this type strain was assembled and yielded a length of 3.72 Mbp and a GC content of 46.3%. Comparative genomic analysis with its ...
Ehling-Schulz, Monika; Messelhäusser, Ute
2013-01-01
The highly heterogeneous genus Bacillus comprises the largest species group of endospore forming bacteria. Because of their ubiquitous nature, Bacillus spores can enter food production at several stages resulting in significant economic losses and posing a potential risk to consumers due the capacity of certain Bacillus strains for toxin production. In the past, food microbiological diagnostics was focused on the determination of species using conventional culture-based methods, which are still widely used. However, due to the extreme intra-species diversity found in the genus Bacillus, DNA-based identification and typing methods are gaining increasing importance in routine diagnostics. Several studies showed that certain characteristics are rather strain-dependent than species-specific. Therefore, the challenge for current and future Bacillus diagnostics is not only the efficient and accurate identification on species level but also the development of rapid methods to identify strains with specific characteristics (such as stress resistance or spoilage potential), trace contamination sources, and last but not least discriminate potential hazardous strains from non-toxic strains.
Bacillus thermotolerans sp. nov., a thermophilic bacterium capable of reducing humus.
Yang, Guiqin; Zhou, Xuemei; Zhou, Shungui; Yang, Dehui; Wang, Yueqiang; Wang, Dingmei
2013-10-01
A novel thermotolerant bacterium, designated SgZ-8(T), was isolated from a compost sample. Cells were non-motile, endospore-forming, Gram-staining positive, oxidase-negative and catalase-positive. The isolate was able to grow at 20-65 °C (optimum 50 °C) and pH 6.0-9.0 (optimum 6.5-7.0), and tolerate up to 9.0 % NaCl (w/v) under aerobic conditions. Anaerobic growth occurred with anthraquinone-2,6-disulphonate (AQDS), fumarate and NO3(-) as electron acceptors. Phylogenetic analysis based on the16S rRNA and gyrB genes grouped strain SgZ-8(T) into the genus Bacillus, with the highest similarity to Bacillus badius JCM 12228(T) (96.2 % for 16S rRNA gene sequence and 83.5 % for gyrB gene sequence) among all recognized species in the genus Bacillus. The G+C content of the genomic DNA was 49.3 mol%. The major isoprenoid quinone was menaquinone 7 (MK-7) and the polar lipids consisted of diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and an unidentified phospholipid. The major cellular fatty acid was iso-C16 : 0. On the basis of its phenotypic and phylogenetic properties, chemotaxonomic analysis and the results of physiological and biochemical tests, strain SgZ-8(T) ( = CCTCC AB 2012108(T) = KACC 16706(T)) was designated the type strain of a novel species of the genus Bacillus, for which the name Bacillus thermotolerans sp. nov. is proposed.
Chauhan, Ankit Kumar; Maheshwari, Dinesh Kumar; Kim, Kangmin; Bajpai, Vivek K
2016-10-01
Bacillus strains were isolated from termitarium soil and screened for their antifungal activity through the production of diffusible and volatile metabolites. Further, the bacterial strains that showed antifungal activity were evaluated for their biocontrol potential on the basis of their plant-growth-promoting attributes. Termitarium-inhabiting Bacillus strains TSH42 and TSH77 significantly reduced the growth of pathogenic fungus Fusarium solani, controlled the symptoms of rhizome rot in turmeric (Curcuma longa L.), and demonstrated various plant-growth-promoting traits in different in vitro assays. On the basis of morphological, physiological, biochemical, and 16S rDNA characteristics, isolates TSH42 and TSH77 were identified as Bacillus endophyticus (KT379993) and Bacillus cereus (KT379994), respectively. Through liquid chromatography - mass spectrometry analysis, acidified cell-free culture filtrate (CFCF) of B. cereus TSH77 was shown to contain surfactin and fengycin, while CFCF of B. endophyticus TSH42 contained iturin in addition to surfactin and fengycin. Treatment of the turmeric (C. longa L.) plants with TSH42 and TSH77 significantly reduced the percentage incidence of rhizome rot disease caused by F. solani. The same treatment also increased the fresh rhizome biomass and plant growth in greenhouse conditions.
Lead (Pb) bioaccumulation; genera Bacillus isolate S1 and SS19 as a case study
NASA Astrophysics Data System (ADS)
Arifiyanto, Achmad; Apriyanti, Fitria Dwi; Purwaningsih, Puput; Kalqutny, Septian Hary; Agustina, Dyah; Surtiningsih, Tini; Shovitri, Maya; Zulaika, Enny
2017-06-01
Lead (Pb) includes a group of large heavy metal in nature was toxic either on animal or human and did not provide an advantage function biologically. Bacillus isolates S1 and SS19 known resistant to lead up to 50 mg / L PbCl2. In this research will be examined whether genera Bacillus isolates S1 and SS19 could accumulate metal lead (Pb), their capability in accumulating and profile protein differences when the bacteria genera Bacillus isolates S1 and SS19 get exposed metal lead (Pb). Inoculum at age ± 9 hours are used, with a Nutrient Broth (NB) containing 50, 75 and 100 mg / L PbCl2. Inductively Coupled Plasma Atomic Emission Spectrometry (ICP) used to assessed Pb2+ concentrations. Bioaccumulation levels of Pb2+ by Bacillus isolate S1 and SS19 related to the distinction of beginning concentration to the final concentration. Bacillus isolate S1 achieved 53% and 51% bioaccumulation efficiency rate in lead presence concentration (75 and 100 mg/L) and 51% (50 mg/L). Another way Bacillus isolate SS19 was able to accumulate 57% (50 mg/L PbCl2) and kept stable on 36% bioaccumulation efficiency rate (75 and 100 mg/L PbCl2). Regarding SDS-PAGE electrophoresis protein profile result, protein in ± 127 kDa, molecule mass detected in the presence of Lead for Bacillus isolate S1.
Safety assessment of the use of Bacillus-based cleaning products.
Berg, Ninna W; Evans, Matthew R; Sedivy, John; Testman, Robert; Acedo, Kimon; Paone, Domenic; Long, David; Osimitz, Thomas G
2018-06-01
Non-pathogenic Bacillus species used in cleaning products produce the appropriate enzymes to degrade stains and soils. However, there is little scientific data regarding the human exposure by inhalation of Bacillus spores during or after use of microbial-based cleaning products. Herein, air samples were collected at various locations in a ventilated, carpeted, residential room to determine the air concentration of viable bacteria and spores during and after the application of microbial-based carpet cleaning products containing Bacillus spores. The influence of human activities and vacuuming was investigated. Bioaerosol levels associated with use and post-application activities of whole room carpet treatments were elevated during post-application activity, but quickly returned to the indoor background range. Use of trigger spray spot applications generated aerosolized spores in the immediate vicinity, however, their use pattern and the generation of mostly non-respirable particles suggest minimal risks for pulmonary exposure from their use. The aerosol counts associated with use of these microbial-based cleaners were below the recommendation for safe exposure levels to non-pathogenic and non-toxigenic microorganisms except during application of the spot cleaner. The data presented suggest that carpet cleaning products, containing non-pathogenic Bacillus spores present a low potential for inhalation exposure and consequently minimal risk of adverse effects. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kent, R M; Guinane, C M; O'Connor, P M; Fitzgerald, G F; Hill, C; Stanton, C; Ross, R P
2012-08-01
The aim of this study was to identify Bacillus isolates capable of degrading sodium caseinate and subsequently to generate bioactive peptides with antimicrobial activity. Sodium caseinate (2.5% w/v) was inoculated separately with 16 Bacillus isolates and allowed to ferment overnight. Protein breakdown in the fermentates was analysed using gel permeation-HPLC (GP-HPLC) and screened for peptides (<3-kDa) with MALDI-TOF mass spectrometry. Caseicin A (IKHQGLPQE) and caseicin B (VLNENLLR), two previously characterized antimicrobial peptides, were identified in the fermentates of both Bacillus cereus and Bacillus thuringiensis isolates. The caseicin peptides were subsequently purified by RP-HPLC and antimicrobial assays indicated that the peptides maintained the previously identified inhibitory activity against the infant formula pathogen Cronobacter sakazakii. We report a new method using Bacillus sp. to generate two previously characterized antimicrobial peptides from casein. This study highlights the potential to exploit Bacillus sp. or the enzymes they produce for the generation of bioactive antimicrobial peptides from bovine casein. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.
Kaewtapee, Chanwit; Burbach, Katharina; Tomforde, Georgina; Hartinger, Thomas; Camarinha-Silva, Amélia; Heinritz, Sonja; Seifert, Jana; Wiltafsky, Markus; Mosenthin, Rainer; Rosenfelder-Kuon, Pia
2017-01-01
Bacillus spp. seem to be an alternative to antimicrobial growth promoters for improving animals' health and performance. However, there is little information on the effect of Bacillus spp. in combination with different dietary crude protein (CP) levels on the ileal digestibility and microbiota composition. Therefore, the objective of this study was to determine the effect of Bacillus spp. supplementation to low- (LP) and high-protein diets (HP) on ileal CP and amino acid (AA) digestibility and intestinal microbiota composition. Eight ileally cannulated pigs with an initial body weight of 28.5 kg were randomly allocated to a row-column design with 8 pigs and 3 periods of 16 d each. The assay diets were based on wheat-barley-soybean meal with two protein levels: LP (14% CP, as-fed) and HP diet (18% CP, as-fed). The LP and HP diets were supplemented with or without Bacillus spp. at a level of 0.04% (as-fed). The apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of CP and AA was determined. Bacterial community composition from ileal digesta was analyzed by Illumina amplicon sequencing and quantitative real-time PCR. Data were analyzed as a 2 × 2 factorial design using the GLIMMIX procedures of SAS. The supplementation with Bacillus spp. did not affect both AID and SID of CP and AA in growing pigs. Moreover, there was no difference in AID of CP and AA between HP and LP diets, but SID of cystine, glutamic acid, glycine, and proline was lower ( P < 0.05) in pigs fed the HP diets. The HP diets increased abundance of Bifidobacterium spp. and Lactobacillus spp., ( P < 0.05) and by amplicon sequencing the latter was identified as predominant genus in microbiota from HP with Bacillus spp., whereas dietary supplementation of Bacillus spp. increased ( P < 0.05) abundance of Roseburia spp.. The HP diet increased abundance of Lactobacillus spp. and Bifidobacterium spp.. The supplementation of Bacillus spp. resulted in a higher
Bacillus cereus causing fulminant sepsis and hemolysis in two patients with acute leukemia.
Arnaout, M K; Tamburro, R F; Bodner, S M; Sandlund, J T; Rivera, G K; Pui, C H; Ribeiro, R C
1999-01-01
Hemolysis is so rarely associated with Bacillus cereus sepsis that only two very well documented cases have been reported. This article reports two unusual cases of Bacillus cereus sepsis with massive intravascular hemolysis in patients who had acute lymphoblastic leukemia (ALL). A 20-year-old woman who was 9 weeks pregnant experienced a relapse of ALL. A therapeutic abortion was performed. During week 4 of reinduction the patient had abdominal pain, nausea, and vomiting, with severe neutropenia but no fever. Her condition deteriorated rapidly with cardiovascular collapse, acute massive intravascular hemolysis, and death within hours of the onset of symptoms. Blood cultures were positive for Bacillus cereus. Postmortem histologic examination and cultures revealed Bacillus cereus and Candida albicans in multiple organs. The second patient, a 10-year-old girl, presented with relapsed T-cell ALL. In the second week of reinduction, she had abdominal pain followed by hypotension. Again, no fever was noted. Laboratory studies showed intravascular hemolysis 12 hours after admission. Aggressive support was promptly initiated. Despite disseminated intravascular coagulation; cardiovascular, hepatic, and renal failure; and multiple intracerebral hypodense lesions believed to be infarcts, the patient recovered fully and resumed reinduction therapy. Bacillus cereus infection can have a fulminant clinical course that may be complicated by massive intravascular hemolysis. This pathogen should be suspected in immunosuppressed patients who experience gastrointestinal symptoms and should not be precluded by the absence of fever, especially if steroids such as dexamethasone are being given. Exchange transfusion may be lifesaving in Bacillus cereus septicemia associated with massive hemolysis.
1987-07-01
nontransformable Bacillus species such as B. anthracis. Our results suggest that plasmid pLS20 of Bacillus subtilis ( natto ), which promotes transfer of the...mobilizing pBC16, pLS20 mediates transfer of the B. subtills ( natto ) plasmid pLS19 and the Staphylococcus aureus plasmid pUB110. To facilitate direct...and (v) transformation of B. cereus and B. anthracis with plasmid DNA. The 55-kb plasmid, pLS20, of Bacillus subtilis ( natto ) 3335 promotes tr msfer
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis var... EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Exemptions From Tolerances § 180.1243 Bacillus subtilis... the requirement of a tolerance for residues of the Bacillus subtilis var. amyloliquefaciens strain...
Manganese(II)-oxidizing Bacillus spores in Guaymas Basin hydrothermal sediments and plumes.
Dick, Gregory J; Lee, Yifan E; Tebo, Bradley M
2006-05-01
Microbial oxidation and precipitation of manganese at deep-sea hydrothermal vents are important oceanic biogeochemical processes, yet nothing is known about the types of microorganisms or mechanisms involved. Here we report isolation of a number of diverse spore-forming Mn(II)-oxidizing Bacillus species from Guaymas Basin, a deep-sea hydrothermal vent environment in the Gulf of California, where rapid microbially mediated Mn(II) oxidation was previously observed. mnxG multicopper oxidase genes involved in Mn(II) oxidation were amplified from all Mn(II)-oxidizing Bacillus spores isolated, suggesting that a copper-mediated mechanism of Mn(II) oxidation could be important at deep-sea hydrothermal vents. Phylogenetic analysis of 16S rRNA and mnxG genes revealed that while many of the deep-sea Mn(II)-oxidizing Bacillus species are very closely related to previously recognized isolates from coastal sediments, other organisms represent novel strains and clusters. The growth and Mn(II) oxidation properties of these Bacillus species suggest that in hydrothermal sediments they are likely present as spores that are active in oxidizing Mn(II) as it emerges from the seafloor.
14C Analysis of Protein Extracts from Bacillus Spores
Cappucio, Jenny A.; Sarachine Falso, Miranda J.; Kashgarian, Michaele; Buchholz, Bruce A.
2014-01-01
Investigators of bioagent incidents or interdicted materials need validated, independent analytical methods that will allow them to distinguish between recently made bioagent samples versus material drawn from the archives of a historical program. Heterotrophic bacteria convert the carbon in their food sources, growth substrate or culture media, into the biomolecules they need. The F14C (fraction modern radiocarbon) of a variety of media, Bacillus spores, and separated proteins from Bacillus spores was measured by accelerator mass spectrometry (AMS). AMS precisely measures F14C values of biological materials and has been used to date the synthesis of biomaterials over the bomb pulse era (1955 to present). The F14C of Bacillus spores reflects the radiocarbon content of the media in which they were grown. In a survey of commercial media we found that the F14C value indicated that carbon sources for the media were alive within about a year of the date of manufacture and generally of terrestrial origin. Hence, bacteria and their products can be dated using their 14C signature. Bacillus spore samples were generated onsite with defined media and carbon free purification and also obtained from archived material. Using mechanical lysis and a variety of washes with carbon free acids and bases, contaminant carbon was removed from soluble proteins to enable accurate 14C bomb-pulse dating. Since media is contemporary, 14C bomb-pulse dating of isolated soluble proteins can be used to distinguish between historical archives of bioagents and those produced from recent media. PMID:24814329
14C Analysis of protein extracts from Bacillus spores.
Cappuccio, Jenny A; Falso, Miranda J Sarachine; Kashgarian, Michaele; Buchholz, Bruce A
2014-07-01
Investigators of bioagent incidents or interdicted materials need validated, independent analytical methods that will allow them to distinguish between recently made bioagent samples versus material drawn from the archives of a historical program. Heterotrophic bacteria convert the carbon in their food sources, growth substrate or culture media, into the biomolecules they need. The F(14)C (fraction modern radiocarbon) of a variety of media, Bacillus spores, and separated proteins from Bacillus spores was measured by accelerator mass spectrometry (AMS). AMS precisely measures F(14)C values of biological materials and has been used to date the synthesis of biomaterials over the bomb pulse era (1955 to present). The F(14)C of Bacillus spores reflects the radiocarbon content of the media in which they were grown. In a survey of commercial media we found that the F(14)C value indicated that carbon sources for the media were alive within about a year of the date of manufacture and generally of terrestrial origin. Hence, bacteria and their products can be dated using their (14)C signature. Bacillus spore samples were generated onsite with defined media and carbon free purification and also obtained from archived material. Using mechanical lysis and a variety of washes with carbon free acids and bases, contaminant carbon was removed from soluble proteins to enable accurate (14)C bomb-pulse dating. Since media is contemporary, (14)C bomb-pulse dating of isolated soluble proteins can be used to distinguish between historical archives of bioagents and those produced from recent media. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Resistance of Bacillus Endospores to Extreme Terrestrial and Extraterrestrial Environments
Nicholson, Wayne L.; Munakata, Nobuo; Horneck, Gerda; Melosh, Henry J.; Setlow, Peter
2000-01-01
Endospores of Bacillus spp., especially Bacillus subtilis, have served as experimental models for exploring the molecular mechanisms underlying the incredible longevity of spores and their resistance to environmental insults. In this review we summarize the molecular laboratory model of spore resistance mechanisms and attempt to use the model as a basis for exploration of the resistance of spores to environmental extremes both on Earth and during postulated interplanetary transfer through space as a result of natural impact processes. PMID:10974126
Genetic analysis of Bacillus stearothermophilus by protoplast fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Z.; Wojcik, S.F.; Welker, N.E.
1986-03-01
Efficient and reliable protoplasting, regeneration, and fusion techniques were established for the prototrophic strain Bacillus stearothermophilus NUB36. Auxotrophic mutants were isolated, and protoplast fusion was used to construct isogenic mutant strains and for chromosomal mapping. Markers were mapped using two-, three-, and four-factor crosses. The order of the markers was hom-1-thr-1-his-1-(gly-1 or gly-2)-pur-1-pur-2. These markers may be analogous to hom, thrA, hisA, glyC, and purA markers on the Bacillus subtilis chromosome. No analogous pur-1 marker has been reported in B. subtilis. The relative order of three of the markers (hom-1-thr-1-gly-1) was independently confirmed by transduction.
Buhr, T L; Wells, C M; Young, A A; Minter, Z A; Johnson, C A; Payne, A N; McPherson, D C
2013-08-01
To develop test methods and evaluate survival of Bacillus anthracis Ames, B. anthracis ∆Sterne and B. thuringiensis Al Hakam spores after exposure to PES-Solid (a solid source of peracetic acid), including PES-Solid formulations with bacteriostatic surfactants. Spores (≥ 7 logs) were dried on seven different test materials and treated with three different PES-Solid formulations (or preneutralized controls) at room temperature for 15 min. There was either no spore survival or less than 1 log (<10 spores) of spore survival in 56 of 63 test combinations (strain, formulation and substrate). Less than 2.7 logs (<180 spores) survived in the remaining seven test combinations. The highest spore survival rates were seen on water-dispersible chemical agent resistant coating (CARC-W) and Naval ship topcoat (NTC). Electron microscopy and Coulter analysis showed that all spore structures were intact after spore inactivation with PES-Solid. Three PES-Solid formulations inactivated Bacillus spores that were dried on seven different materials. A test method was developed to show that PES-Solid formulations effectively inactivate Bacillus spores on different materials. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Bacillus galliciensis sp. nov., isolated from faeces of wild seahorses (Hippocampus guttulatus).
Balcázar, José Luis; Pintado, José; Planas, Miquel
2010-04-01
A Gram-positive-staining, motile, rod-shaped, endospore-forming bacterium (BFLP-1( T)) was isolated from faeces of wild long-snouted seahorses ( Hippocampus guttulatus) captured in north-west Spain (Toralla, Galicia). Strain BFLP-1(T) grew at 10-30 degrees C and pH 5.5-9 (optimally at 20 degrees C and pH 7.2) and with 0-7 % (w/v) NaCl (optimally with 2 % NaCl). The G+C content of the DNA was 48.1 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain BFLP-1(T) was a member of the genus Bacillus and was most closely related to Bacillus herbersteinensis D-1,5a(T) (96.6 %), B. shackletonii LMG 18435(T) (96.0 %) and B. isabeliae CVS-8(T) (95.9 %). Chemotaxonomic data (peptidoglycan type, meso-diaminopimelic acid; major menaquinone, MK-7; predominant fatty acids, anteiso-C(15 : 0 ), anteiso-C(17 : 0) and C(16 : 1 )omega11c; major polar lipids, diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and an unknown aminoglycophospholipid) supported the affiliation of strain BFLP-1(T) to the genus Bacillus . Comparative analysis of 16S rRNA gene sequences and chemotaxonomic and phenotypic features indicated that strain BFLP-1(T) represents a novel species within the genus Bacillus, for which the name Bacillus galliciensis sp. nov. is proposed. The type strain is BFLP-1( T) (=DSM 21539(T) =LMG 24668(T)).
Gas discharge plasmas are effective in inactivating Bacillus and Clostridium spores.
Tseng, Shawn; Abramzon, Nina; Jackson, James O; Lin, Wei-Jen
2012-03-01
Bacterial spores are the most resistant form of life and have been a major threat to public health and food safety. Nonthermal atmospheric gas discharge plasma is a novel sterilization method that leaves no chemical residue. In our study, a helium radio-frequency cold plasma jet was used to examine its sporicidal effect on selected strains of Bacillus and Clostridium. The species tested included Bacillus subtilis, Bacillus stearothermophilus, Clostridium sporogenes, Clostridium perfringens, Clostridium difficile, and Clostridium botulinum type A and type E. The plasmas were effective in inactivating selected Bacillus and Clostridia spores with D values (decimal reduction time) ranging from 2 to 8 min. Among all spores tested, C. botulinum type A and C. sporogenes were significantly more resistant to plasma inactivation than other species. Observations by phase contrast microscopy showed that B. subtilis spores were severely damaged by plasmas and the majority of the treated spores were unable to initiate the germination process. There was no detectable fragmentation of the DNA when the spores were treated for up to 20 min. The release of dipicolinic acid was observed almost immediately after the plasma treatment, indicating the spore envelope damage could occur quickly resulting in dipicolinic acid release and the reduction of spore resistance.
Rogers, J V; Choi, Y W; Richter, W R; Rudnicki, D C; Joseph, D W; Sabourin, C L K; Taylor, M L; Chang, J C S
2007-10-01
To evaluate the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface materials using formaldehyde gas. B. anthracis, B. subtilis, and G. stearothermophilus spores were dried on seven types of indoor surfaces and exposed to approx. 1100 ppm formaldehyde gas for 10 h. Formaldehyde exposure significantly decreased viable B. anthracis, B. subtilis, and G. stearothermophilus spores on all test materials. Significant differences were observed when comparing the reduction in viable spores of B. anthracis with B. subtilis (galvanized metal and painted wallboard paper) and G. stearothermophilus (industrial carpet and painted wallboard paper). Formaldehyde gas inactivated>or=50% of the biological indicators and spore strips (approx. 1x10(6) CFU) when analyzed after 1 and 7 days. Formaldehyde gas significantly reduced the number of viable spores on both porous and nonporous materials in which the two surrogates exhibited similar log reductions to that of B. anthracis on most test materials. These results provide new comparative information for the decontamination of B. anthracis spores with surrogates on indoor surfaces using formaldehyde gas.
Dobson, Rosie; Whittaker, Robyn; Jiang, Yannan; Maddison, Ralph; Shepherd, Matthew; McNamara, Catherine; Cutfield, Richard; Khanolkar, Manish; Murphy, Rinki
2018-05-17
To determine the effectiveness of a theoretically based and individually tailored, text message based, diabetes self management support intervention (SMS4BG) in adults with poorly controlled diabetes. Nine month, two arm, parallel randomised controlled trial. Primary and secondary healthcare services in New Zealand. 366 participants aged 16 years and over with poorly controlled type 1 or type 2 diabetes (HbA1c ≥65 mmol/mol or 8%) randomised between June 2015 and November 2016 (n=183 intervention, n=183 control). The intervention group received a tailored package of text messages for up to nine months in addition to usual care. Text messages provided information, support, motivation, and reminders related to diabetes self management and lifestyle behaviours. The control group received usual care. Messages were delivered by a specifically designed automated content management system. Primary outcome measure was change in glycaemic control (HbA1c) from baseline to nine months. Secondary outcomes included change in HbA1c at three and six months, and self efficacy, diabetes self care behaviours, diabetes distress, perceptions and beliefs about diabetes, health related quality of life, perceived support for diabetes management, and intervention engagement and satisfaction at nine months. Regression models adjusted for baseline outcome, health district category, diabetes type, and ethnicity. The reduction in HbA1c at nine months was significantly greater in the intervention group (mean -8.85 mmol/mol (standard deviation 14.84)) than in the control group (-3.96 mmol/mol (17.02); adjusted mean difference -4.23 (95% confidence interval -7.30 to -1.15), P=0.007). Of 21 secondary outcomes, only four showed statistically significant improvements in favour of the intervention group at nine months. Significant improvements were seen for foot care behaviour (adjusted mean difference 0.85 (95% confidence interval 0.40 to 1.29), P<0.001), overall diabetes support (0.26 (0.03 to 0
Whittaker, Robyn; Jiang, Yannan; Maddison, Ralph; Shepherd, Matthew; McNamara, Catherine; Cutfield, Richard; Khanolkar, Manish; Murphy, Rinki
2018-01-01
Abstract Objective To determine the effectiveness of a theoretically based and individually tailored, text message based, diabetes self management support intervention (SMS4BG) in adults with poorly controlled diabetes. Design Nine month, two arm, parallel randomised controlled trial. Setting Primary and secondary healthcare services in New Zealand. Participants 366 participants aged 16 years and over with poorly controlled type 1 or type 2 diabetes (HbA1c ≥65 mmol/mol or 8%) randomised between June 2015 and November 2016 (n=183 intervention, n=183 control). Interventions The intervention group received a tailored package of text messages for up to nine months in addition to usual care. Text messages provided information, support, motivation, and reminders related to diabetes self management and lifestyle behaviours. The control group received usual care. Messages were delivered by a specifically designed automated content management system. Main outcome measures Primary outcome measure was change in glycaemic control (HbA1c) from baseline to nine months. Secondary outcomes included change in HbA1c at three and six months, and self efficacy, diabetes self care behaviours, diabetes distress, perceptions and beliefs about diabetes, health related quality of life, perceived support for diabetes management, and intervention engagement and satisfaction at nine months. Regression models adjusted for baseline outcome, health district category, diabetes type, and ethnicity. Results The reduction in HbA1c at nine months was significantly greater in the intervention group (mean −8.85 mmol/mol (standard deviation 14.84)) than in the control group (−3.96 mmol/mol (17.02); adjusted mean difference −4.23 (95% confidence interval −7.30 to −1.15), P=0.007). Of 21 secondary outcomes, only four showed statistically significant improvements in favour of the intervention group at nine months. Significant improvements were seen for foot care behaviour (adjusted mean
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Bacillus thuringiensis Cry1F protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.504 Bacillus thuringiensis Cry1F protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in the food...
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...
Bernhards, Casey B.; Chen, Yan; Toutkoushian, Hannah
2014-01-01
Bacterial endospores can remain dormant for decades yet can respond to nutrients, germinate, and resume growth within minutes. An essential step in the germination process is degradation of the spore cortex peptidoglycan wall, and the SleB protein in Bacillus species plays a key role in this process. Stable incorporation of SleB into the spore requires the YpeB protein, and some evidence suggests that the two proteins interact within the dormant spore. Early during germination, YpeB is proteolytically processed to a stable fragment. In this work, the primary sites of YpeB cleavage were identified in Bacillus anthracis, and it was shown that the stable products are comprised of the C-terminal domain of YpeB. Modification of the predominant YpeB cleavage sites reduced proteolysis, but cleavage at other sites still resulted in loss of full-length YpeB. A B. anthracis strain lacking the HtrC protease did not generate the same stable YpeB products. In B. anthracis and Bacillus subtilis htrC mutants, YpeB was partially stabilized during germination but was still degraded at a reduced rate by other, unidentified proteases. Purified HtrC cleaved YpeB to a fragment similar to that observed in vivo, and this cleavage was stimulated by Mn2+ or Ca2+ ions. A lack of HtrC did not stabilize YpeB or SleB during spore formation in the absence of the partner protein, indicating other proteases are involved in their degradation during sporulation. PMID:25384476
Miller, Rachel A.; Beno, Sarah M.; Kent, David J.; Carroll, Laura M.; Martin, Nicole H.; Boor, Kathryn J.
2016-01-01
A facultatively anaerobic, spore-forming Bacillus strain, FSL W8-0169T, collected from raw milk stored in a silo at a dairy powder processing plant in the north-eastern USA was initially identified as a Bacillus cereus group species based on a partial sequence of the rpoB gene and 16S rRNA gene sequence. Analysis of core genome single nucleotide polymorphisms clustered this strain separately from known B. cereus group species. Pairwise average nucleotide identity blast values obtained for FSL W8-0169T compared to the type strains of existing B. cereus group species were <95 % and predicted DNA–DNA hybridization values were <70 %, suggesting that this strain represents a novel B. cereus group species. We characterized 10 additional strains with the same or closely related rpoB allelic type, by whole genome sequencing and phenotypic analyses. Phenotypic characterization identified a higher content of iso-C16 : 0 fatty acid and the combined inability to ferment sucrose or to hydrolyse arginine as the key characteristics differentiating FSL W8-0169T from other B. cereus group species. FSL W8-0169T is psychrotolerant, produces haemolysin BL and non-haemolytic enterotoxin, and is cytotoxic in a HeLa cell model. The name Bacillus wiedmannii sp. nov. is proposed for the novel species represented by the type strain FSL W8-0169T (=DSM 102050T=LMG 29269T). PMID:27520992
Pathogenicity of Bacillus thuringiensis variety kurstaki to Ixodes scapularis (Acari: Ixodidae)
Zhioua, Elyes; Heyer, Klaus; Browning, M.; Ginsberg, Howard S.; LeBrun, Roger A.
1999-01-01
Pathogenicity of the entomopathogenic bacterium Bacillus thuringiensis var. kurstaki de Barjac & Lemille was tested against the black-legged tick, Ixodes scapularis Say. Engorged larvae dipped in a solution of 108 spores per ml showed 96% mortality, 3 wk post-infection. The LC50 value for engorged larvae (concentration required to kill 50% of ticks) was 107 spores/ml. Bacillus thuringiensis shows considerable potential as a microbial control agent for the management of Ixodes scapularis.
Sudha, S N; Jayakumar, R; Sekar, V
1999-03-01
The abilities of Bacillus polymyxa and Bacillus thuringiensis to survive on the rice phyllospere were compared; it was found that B. polymyxa colonizes the crop better. This study also showed that B. polymyxa inoculation to rice plants increased the shoot and the root growth of the crop. Efforts were made to introduce the cry1Ac gene of B. thuringiensis subsp. kurstaki into B. polymyxa so that the application of such transgenic B. polymyxa strains would prove to be dually beneficial to rice crops both as a biopesticide and as a biofertilizer. Immunoblot analysis of the recombinant organism containing the cry1Ac gene, strain BP113, indicated efficient expression of this gene in the heterologous host. Bioassays with the first instar larvae of the yellow stem borer of rice (Scirpophaga incertulas) revealed that the protein preparations from BP113 were toxic.
Kalenova, L F; Kolyvanova, S S; Bazhin, A S; Besedin, I M; Mel'nikov, V P
2017-06-01
We studied the effects of secondary metabolites of Bacillus sp. isolated from late Neogene permafrost on secretion of proinflammatory (TNF-α, IL-1β, IL-8, IL-2, and IFNγ) and antiinflammatory (IL-4 and IL-10) cytokines by human peripheral blood mononuclear cells. It was found that metabolites of Bacillus sp. produced more potent effect on cytokine secretion than mitogen phytohemagglutinin and metabolites of Bacillus cereus, medicinal strain IP5832. Activity of metabolites depended on the temperature of bacteria incubation. "Cold" metabolites of Bacillus sp. (isolated at -5°C) primarily induced Th1-mediated secretion of IFNγ, while "warm" metabolites (obtained at 37°C) induced Th2-mediated secretion of IL-4. The results suggest that Bacillus sp. metabolites are promising material for the development of immunomodulating drugs.
Genetic Characterization of Bacillus anthracis 17 JB strain.
Seyed-Mohamadi, Sakineh; Moradi Bidhendi, Soheila; Tadayon, Keyvan; Ghaderi, Rainak
2015-06-01
Bacillus anthracis is one of the most homogenous bacteria ever described. Some level of diversity. Bacillus anthracis 17JB is a laboratory strain It is broadly used as a challenge strain in guinea pigs for potency test of anthrax vaccine. This work describes genetic characterization of B. anthracis 17 JB strain using the SNPs and MLVA genotyping. In SNPs typing, the originally French 17JB strain represented the A.Br. 008/009 subgroup. In Levy's genotyping method, 843, 451 and 864 bp long fragments were identified at AA03, AJ03 and AA07 loci, respectively. In the vaccine manufacturer perspective these findings are much valuable on their own account, but similar research is required to extend molecular knowledge of B. anthracis epidemiology in Persia.
Ehling-Schulz, Monika; Messelhäusser, Ute
2013-01-01
The highly heterogeneous genus Bacillus comprises the largest species group of endospore forming bacteria. Because of their ubiquitous nature, Bacillus spores can enter food production at several stages resulting in significant economic losses and posing a potential risk to consumers due the capacity of certain Bacillus strains for toxin production. In the past, food microbiological diagnostics was focused on the determination of species using conventional culture-based methods, which are still widely used. However, due to the extreme intra-species diversity found in the genus Bacillus, DNA-based identification and typing methods are gaining increasing importance in routine diagnostics. Several studies showed that certain characteristics are rather strain-dependent than species-specific. Therefore, the challenge for current and future Bacillus diagnostics is not only the efficient and accurate identification on species level but also the development of rapid methods to identify strains with specific characteristics (such as stress resistance or spoilage potential), trace contamination sources, and last but not least discriminate potential hazardous strains from non-toxic strains. PMID:23440299
Multigeneration Cross-Contamination of Mail with Bacillus anthracis Spores
Edmonds, Jason; Lindquist, H. D. Alan; Sabol, Jonathan; Martinez, Kenneth; Shadomy, Sean; Cymet, Tyler; Emanuel, Peter
2016-01-01
The release of biological agents, including those which could be used in biowarfare or bioterrorism in large urban areas, has been a concern for governments for nearly three decades. Previous incidents from Sverdlosk and the postal anthrax attack of 2001 have raised questions on the mechanism of spread of Bacillus anthracis spores as an aerosol or contaminant. Prior studies have demonstrated that Bacillus atrophaeus is easily transferred through simulated mail handing, but no reports have demonstrated this ability with Bacillus anthracis spores, which have morphological differences that may affect adhesion properties between spore and formite. In this study, equipment developed to simulate interactions across three generations of envelopes subjected to tumbling and mixing was used to evaluate the potential for cross-contamination of B. anthracis spores in simulated mail handling. In these experiments, we found that the potential for cross-contamination through letter tumbling from one generation to the next varied between generations while the presence of a fluidizer had no statistical impact on the transfer of material. Likewise, the presence or absence of a fluidizer had no statistically significant impact on cross-contamination levels or reaerosolization from letter opening. PMID:27123934
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fukai, Kazuyoshi; Oh, Jangsuk; Karim, M.A.
Chediak-Higashi syndrome (CHS) is an autosomal recessive disorder characterized by hypopigmentation or oculocutaneous albinism and severe immunologic deficiency with neutropenia and lack of natural killer (NK) cell function. Most patients die in childhood from pyogenic infections or an unusual lymphoma-like condition. A hallmark of the disorder is giant inclusion bodies seen in all granule-containing cells, including granulocytes, lymphocytes, melanocytes, mast cells, and neurons. Similar ultrastructural abnormalities occur in the beige mouse, which thus has been suggested to be homologous to human CHS. High-resolution genetic mapping has indicated that the bg gene region of mouse chromosome 13 is likely homologous tomore » the distal portion of human chromosome 1q. Accordingly, we carried out homozygosity mapping using markers derived from distal human chromosome 1q in four inbred families or probands with CHS. Our results indicate that the human CHS gene maps to an 18.8-cM interval in chromosome segment 1q42-q44 and that human CHS therefore is very likely homologous to mouse bg. 43 refs., 2 figs.« less
Bacillus niabensis sp. nov., isolated from cotton-waste composts for mushroom cultivation.
Kwon, Soon-Wo; Lee, Seon-Young; Kim, Byung-Yong; Weon, Hang-Yeon; Kim, Jung-Bong; Go, Seung-Joo; Lee, Gil-Bok
2007-08-01
A group of five bacilli, designated strains 4T12, 4T19(T), 5M45, 5M53 and 5T52, isolated from cotton-waste composts for mushroom cultivation, were examined. These strains were Gram-positive, aerobic, motile, spore-forming rods. 16S rRNA gene sequence analyses revealed that the isolates belonged to the genus Bacillus, showing the highest levels of similarity (approx. 96.6-96.9 %) with respect to Bacillus herbersteinensis DSM 16534(T). The values for DNA-DNA hybridization (approx. 85-96 %) among these five strains revealed that they belong to the same species. The major menaquinone present was MK-7 and the predominant cellular fatty acids were anteiso-C(15 : 0) (approx. 24.5-33.9 %) and C(16 : 0) (approx. 15.1-34.1 %). The DNA G+C contents were 37.7-40.9 mol%. On the basis of physiological, biochemical, chemotaxonomic and comparative genomic analyses, the five isolates represent a novel species of the genus Bacillus, for which the name Bacillus niabensis sp. nov. is proposed. The type strain is 4T19(T) (=KACC 11279(T) =DSM 17723(T)).
Yin, Liang; Xue, Yanfen; Ma, Yanhe
2015-01-01
The alkaliphilic halotolerant bacterium Bacillus sp. N16-5 is often exposed to salt stress in its natural habitats. In this study, we used one-colour microarrays to investigate adaptive responses of Bacillus sp. N16-5 transcriptome to long-term growth at different salinity levels (0%, 2%, 8%, and 15% NaCl) and to a sudden salt increase from 0% to 8% NaCl. The common strategies used by bacteria to survive and grow at high salt conditions, such as K+ uptake, Na+ efflux, and the accumulation of organic compatible solutes (glycine betaine and ectoine), were observed in Bacillus sp. N16-5. The genes of SigB regulon involved in general stress responses and chaperone-encoding genes were also induced by high salt concentration. Moreover, the genes regulating swarming ability and the composition of the cytoplasmic membrane and cell wall were also differentially expressed. The genes involved in iron uptake were down-regulated, whereas the iron homeostasis regulator Fur was up-regulated, suggesting that Fur may play a role in the salt adaption of Bacillus sp. N16-5. In summary, we present a comprehensive gene expression profiling of alkaliphilic Bacillus sp. N16-5 cells exposed to high salt stress, which would help elucidate the mechanisms underlying alkaliphilic Bacillus spp. survival in and adaptation to salt stress. PMID:26030352
Germination of Spores of Astrobiologically Relevant Bacillus Species in High-Salinity Environments
NASA Astrophysics Data System (ADS)
Nagler, Katja; Julius, Christina; Moeller, Ralf
2016-07-01
In times of increasing space exploration and search for extraterrestrial life, new questions and challenges for planetary protection, aiming to avoid forward contamination of different planets or moons with terrestrial life, are emerging. Spore-forming bacteria such as Bacillus species have a high contamination potential due to their spores' extreme resistance, enabling them to withstand space conditions. Spores require liquid water for their conversion into a growing cell (i.e., spore germination and subsequent growth). If present, water on extraterrestrial planets or moons is likely to be closely associated with salts (e.g., in salty oceans or brines), thus constituting high-salinity environments. Spores of Bacillus subtilis can germinate despite very high salt concentrations, although salt stress does exert negative effects on this process. In this study, germination and metabolic reactivation ("outgrowth") of spores of five astrobiologically relevant Bacillus species (B. megaterium, B. pumilus SAFR-032, B. nealsonii, B. mojavensis, and B. vallismortis) in high salinity (≤3.6 M NaCl) were investigated. Spores of different species exhibited different germination and outgrowth capabilities in high salinity, which strongly depended on germination conditions, especially the exact composition of the medium. In this context, a new "universal" germination trigger for Bacillus spores, named KAGE (KCl, L-alanine, D-glucose, ectoine), was identified, which will be very useful for future comparative germination and outgrowth studies on different Bacillus species. Overall, this study yielded interesting new insights on salt stress effects on spore germination and points out the difficulty of predicting the potential of spores to contaminate salty environments on extraterrestrial celestial bodies.
Antagonism of Bacillus spp. isolated from marine biofilms against terrestrial phytopathogenic fungi.
Ortega-Morales, B O; Ortega-Morales, F N; Lara-Reyna, J; De la Rosa-García, S C; Martínez-Hernández, A; Montero-M, Jorge
2009-01-01
We aimed at determining the antagonistic behavior of bacteria derived from marine biofilms against terrestrial phytopathogenic fungi. Some bacteria closely related to Bacillus mojavensis (three isolates) and Bacillus firmus (one isolate) displayed antagonistic activity against Colletotrichum gloeosporioides ATCC 42374, selected as first screen organism. The four isolates were further quantitatively tested against C. gloeosporioides, Colletotrichum fragariae, and Fusarium oxysporum on two culture media, potato dextrose agar (PDA) and a marine medium-based agar [yeast extract agar (YEA)] at different times of growth of the antagonists (early, co-inoculation with the pathogen and late). Overall antagonistic assays showed differential susceptibility among the pathogens as a function of the type of culture media and time of colonization (P < 0.05). In general, higher suppressive activities were recorded for assays performed on YEA than on PDA; and also when the antagonists were allowed to grow 24 h earlier than the pathogen. F. oxysporum was the most resistant fungus while the most sensitive was C. gloeosporioides ATCC 42374. Significant differences in antagonistic activity (P < 0.05) were found between the different isolates. In general, Bacillus sp. MC3B-22 displayed a greater antagonistic effect than the commercial biocontrol strain Bacillus subtilis G03 (Kodiak). Further incubation studies and scanning electronic microscopy revealed that Bacillus sp. MC3B-22 was able to colonize, multiply, and inhibit C. gloeosporioides ATCC 42374 when tested in a mango leaf assay, showing its potential for fungal biocontrol. Additional studies are required to definitively identify the active isolates and to determine their mode of antifungal action, safety, and biocompatibility.
Distribution of phenotypes among Bacillus thuringiensis strains
USDA-ARS?s Scientific Manuscript database
An extensive collection of Bacillus thuringiensis isolates from around the world were phenotypically profiled using standard biochemical tests. Six phenotypic traits occurred in 20-86% of the isolates and were useful in distinguishing isolates: production of urease (U; 20.5% of isolates), hydrolysis...
The Blueprint of a Minimal Cell: MiniBacillus
Reuß, Daniel R.; Commichau, Fabian M.; Gundlach, Jan; Zhu, Bingyao
2016-01-01
SUMMARY Bacillus subtilis is one of the best-studied organisms. Due to the broad knowledge and annotation and the well-developed genetic system, this bacterium is an excellent starting point for genome minimization with the aim of constructing a minimal cell. We have analyzed the genome of B. subtilis and selected all genes that are required to allow life in complex medium at 37°C. This selection is based on the known information on essential genes and functions as well as on gene and protein expression data and gene conservation. The list presented here includes 523 and 119 genes coding for proteins and RNAs, respectively. These proteins and RNAs are required for the basic functions of life in information processing (replication and chromosome maintenance, transcription, translation, protein folding, and secretion), metabolism, cell division, and the integrity of the minimal cell. The completeness of the selected metabolic pathways, reactions, and enzymes was verified by the development of a model of metabolism of the minimal cell. A comparison of the MiniBacillus genome to the recently reported designed minimal genome of Mycoplasma mycoides JCVI-syn3.0 indicates excellent agreement in the information-processing pathways, whereas each species has a metabolism that reflects specific evolution and adaptation. The blueprint of MiniBacillus presented here serves as the starting point for a successive reduction of the B. subtilis genome. PMID:27681641
[Pilot-scale purification of lipopeptide from marine-derived Bacillus marinus].
Gu, Kangbo; Guan, Cheng; Xu, Jiahui; Li, Shulan; Luo, Yuanchan; Shen, Guomin; Zhang, Daojing; Li, Yuanguang
2016-11-25
This research was aimed at establishing the pilot-scale purification technology of lipopeptide from marine-derived Bacillus marinus. We studied lipopeptide surfactivity interferences on scale-up unit technologies including acid precipitation, methanol extraction, solvent precipitation, salting out, extraction, silica gel column chromatography and HZ806 macroporous absorption resin column chromatography. Then, the unit technologies were combined in a certain order, to remove the impurities gradually, and to gain purified lipopeptide finally, with high recovery rate throughout the whole process. The novel pilot-scale purification technology could effectively isolate and purify lipopeptide with 87.51% to 100% purity in hectograms from 1 ton of Bacillus marinus B-9987 fermentation broth with more than 81.73% recovery rate. The first practical hectogram production of highly purified lipopeptide derived from Bacillus marinus was achieved. With this new purification method, using complex media became possible in fermentation process to reduce the fermentation cost and scale-up the purification for lipopeptide production. For practicability and economy, foaming problem resulting from massive water evaporation was avoided in this technology.
A Bacillus subtilis malate dehydrogenase gene.
Jin, S; De Jesús-Berríos, M; Sonenshein, A L
1996-01-01
A Bacillus subtilis gene for malate dehydrogenase (citH) was found downstream of genes for citrate synthase and isocitrate dehydrogenase. Disruption of citH caused partial auxotrophy for aspartate and a requirement for aspartate during sporulation. In the absence of aspartate, citH mutant cells were blocked at a late stage of spore formation. PMID:8550482
Federal Register 2010, 2011, 2012, 2013, 2014
2012-12-12
... subtilis Strain QST 713 Variant Soil; Amendment to an Exemption From the Requirement of a Tolerance for Bacillus subtilis Strain QST 713 To Include Residues of Bacillus subtilis Strain QST 713 Variant Soil... in or on all food commodities by including residues of Bacillus subtilis strain QST 713 variant soil...
Biosynthesis of silver nanoparticles by a Bacillus sp. of marine origin
NASA Astrophysics Data System (ADS)
Janardhanan, A.; Roshmi, T.; Varghese, Rintu T.; Soniya, E. V.; Mathew, Jyothis; Radhakrishnan, E. K.
2013-04-01
This study was aimed to explore the nanoparticle synthesizing properties of a silver resistant Bacillus sp. isolated from a marine water sample. The 16SrDNA sequence analysis of the isolate proved it as a Bacillus strain. Very interestingly, the isolate was found to have the ability to form intracellular silver nanoparticles at room temperature within 24 hours. This was confirmed by the UV-Vis absorption analysis which showed a peak at 430 nm corresponding to the plasmon absorbance of silver nanoparticles. Further characterization of the nanoparticles was carried out by transmission electron microscopy (TEM) and scanning electron microscopy (SEM) analysis. The presence of silver nanoparticles with the size less than 100 nm was confirmed. These particles were found to be extremely stable as confirmed by the TEM analysis after three months of purification. So, the current study is the demonstration of an efficient synthesis of stable silver nanoparticles by a marine Bacillus strain.
Surfactin production by strains of Bacillus mojavensis
USDA-ARS?s Scientific Manuscript database
Bacillus mojavensis, RRC101 is an endophytic bacterium patented for control of fungal diseases in maize and other plants. DNA fingerprint analysis of the rep-PCR fragments of 35 B. mojavensis and 4 B. subtilis strains using the Diversilab genotyping system revealed genotypic distinctive strains alon...
Probiotic Bacillus spp. in Soy-Curd: Nutritional, Rheological, Sensory, and Antioxidant Properties.
Shobharani, P; Prakash, Maya; Halami, Prakash M
2015-10-01
The focus of this study was to coculture probiotic Bacillus spp. with dairy starter cultures namely, Streptococcus thermophilus and Lactobacillus bulgaricus for enhanced nutritional properties of soy-curd. Subsequently, rheological, sensory, and antioxidant properties of soy-curd along with mineral as well as fatty acid composition were analyzed. Data revealed an increase in the cell viability of probiotic Bacillus spp. on coculturing rather than as mono-culture. Proximate analysis showed higher nutritional value along with increased trace elements. UFA/SFA ratio, rheology, and sensory properties of probiotic soy-curd were in the acceptable range. Probiotic soy-curd showed higher antioxidant activity as measured by the ability to scavenge free radicals. No significant difference in the overall quality within the probiotic products was observed. However, B. flexus MCC2427 cocultured product displayed slightly better attributes than other samples. In general, the results suggest that soy-curd can be a suitable carrier for probiotic Bacillus spp. and the enhanced nutritional and antioxidant properties could be of additional advantage to combat malnutrition problem. In order to supply consumers with intriguing probiotic products for improving health benefits, several criteria including technological and functional properties should be considered as a quality control measures. Further, a meaningful level of probiotics has to be viable to exhibit beneficial effect. Hence, present work has been carried out to improve the quality of soy-curd by supplementation of probiotic Bacillus spp. These Bacillus spp. are well characterized native probiotic cultures with potential functional attributes including antimicrobial, antioxidant, anticholesterol activity (Shobharani and Halami 2014). Hence, the application of these cultures will encourage for development of food product with wider health benefits. © 2015 Institute of Food Technologists®
Inactivation of Bacillus spores inoculated in milk by Ultra High Pressure Homogenization.
Amador Espejo, Genaro Gustavo; Hernández-Herrero, M M; Juan, B; Trujillo, A J
2014-12-01
Ultra High-Pressure Homogenization treatments at 300 MPa with inlet temperatures (Ti) of 55, 65, 75 and 85 °C were applied to commercial Ultra High Temperature treated whole milk inoculated with Bacillus cereus, Bacillus licheniformis, Bacillus sporothermodurans, Bacillus coagulans, Geobacillus stearothermophilus and Bacillus subtilis spores in order to evaluate the inactivation level achieved. Ultra High-Pressure Homogenization conditions at 300 MPa with Ti = 75 and 85 °C were capable of a spore inactivation of ∼5 log CFU/mL. Furthermore, under these processing conditions, commercial sterility (evaluated as the complete inactivation of the inoculated spores) was obtained in milk, with the exception of G. stearothermophilus and B. subtilis treated at 300 MPa with Ti = 75 °C. The results showed that G. stearothermophilus and B. subtilis have higher resistance to the Ultra High-Pressure Homogenization treatments applied than the other microorganisms inoculated and that a treatment performed at 300 MPa with Ti = 85 °C was necessary to completely inactivate these microorganisms at the spore level inoculated (∼1 × 10(6) CFU/mL). Besides, a change in the resistance of B. licheniformis, B. sporothermodurans, G. stearothermophilus and B. subtilis spores was observed as the inactivation obtained increased remarkably in treatments performed with Ti between 65 and 75 °C. This study provides important evidence of the suitability of UHPH technology for the inactivation of spores in high numbers, leading to the possibility of obtaining commercially sterile milk. Copyright © 2014 Elsevier Ltd. All rights reserved.
Composite Sampling of a Bacillus anthracis Surrogate with ...
Journal Article A series of experiments were conducted to explore the utility of composite-based collection of surface samples for the detection of a Bacillus anthracis surrogate using cellulose sponge samplers on a stainless steel surface.
Survival strategies of Bacillus spores in food.
Stecchini, Mara Lucia; Del Torre, Manuela; Polese, Pierluigi
2013-11-01
Control of bacterial spores is one of the major problem in the food preservation. Spores of Bacillus genus are commonly present in different environments, including soil and the gut of insects and animals and, as a result, they can be spread to all kind of foods. Due to their high resistance properties, their complete inactivation in food is often impossible without changing the product characteristics. Surviving spores can germinate and grow out to vegetative cells, with the consequent great risk of food spoilage and food poisoning after consumption. Spores have evolved various mechanisms, including phenotypic variability, to protect themselves from a wide range of damage resulting from food preservation treatments. Even if the phenotypic heterogeneity contributes to increase the chances of survival of Bacillus spore to conventional preservation treatments, in some specific instances, an homogeneous response could be the result of a strategy adopted by the spores to increase resistance to those treatments.
Emtseva, T V
1975-01-01
The effect of different sources of carbon, nitrogen, amino acids and vitamins on the synthesis of alkaline proteases by the stock and mutant strains of Bacillus mesentericus and by the natural strain of Bacillus subtilis-12 has been investigated. The maximum synthesis of alkaline protease has been obtained in the media containing starch or its hydrolysates--dextrine and maltose as the carbon source. Ammonium phosphate and casein as the nitrogen source prove to be optimal for Bac. mesentericus and Bac. subtilis, respectively. Complex B vitamins added to the nutrient medium accelerate the enzyme synthesis 2.5-4-fold.
Systematic Evaluation of Aggressive Air Sampling for Bacillus ...
Report The primary objectives of this project were to evaluate the Aggressive Air Sampling (AAS) method compared to currently used surface sampling methods and to determine if AAS is a viable option for sampling Bacillus anthracis spores.
Evaluation of Surface Sampling for Bacillus Spores Using ...
Report The primary objectives of this project were to evaluate the Aggressive Air Sampling (AAS) method compared to currently used surface sampling methods and to determine if AAS is a viable option for sampling Bacillus anthracis spores.
Pepe, Olimpia; Blaiotta, Giuseppe; Moschetti, Giancarlo; Greco, Teresa; Villani, Francesco
2003-04-01
Two types of white wheat bread (high- and low-type loaves) were investigated for rope spoilage. Thirty of the 56 breads tested developed rope spoilage within 5 days; the high-type loaves were affected by rope spoilage more than the low-type loaves. Sixty-one Bacillus strains were isolated from ropy breads and were characterized on the basis of their phenotypic and genotypic traits. All of the isolates were identified as Bacillus subtilis by biochemical tests, but molecular assays (randomly amplified polymorphic DNA PCR assay, denaturing gradient gel electrophoresis analysis, and sequencing of the V3 region of 16S ribosomal DNA) revealed greater Bacillus species variety in ropy breads. In fact, besides strains of B. subtilis, Bacillus licheniformis, Bacillus cereus, and isolates of Bacillus clausii and Bacillus firmus were also identified. All of the ropy Bacillus isolates exhibited amylase activity, whereas only 32.4% of these isolates were able to produce ropiness in bread slices after treatment at 96 degrees C for 10 min. Strains of lactic acid bacteria previously isolated from sourdough were first selected for antirope activity on bread slices and then used as starters for bread-making experiments. Prevention of growth of approximately 10(4) rope-producing B. subtilis G1 spores per cm(2) on bread slices for more than 15 days was observed when heat-treated cultures of Lactobacillus plantarum E5 and Leuconostoc mesenteroides A27 were added. Growth of B. subtilis G1 occurred after 7 days in breads started with Saccharomyces cerevisiae T22, L. plantarum E5, and L. mesenteroides A27.
Omardien, Soraya; Ter Beek, Alexander; Vischer, Norbert; Montijn, Roy; Schuren, Frank; Brul, Stanley
2018-06-14
An empirical approach was taken to screen a novel synthetic compound library designed to be active against Gram-positive bacteria. We obtained five compounds that were active against spores from the model organism Bacillus subtilis and the food-borne pathogen Bacillus cereus during our population based experiments. Using single cell live imaging we were able to observe effects of the compounds on spore germination and outgrowth. Difference in sensitivity to the compounds could be observed between B. subtilis and B. cereus using live imaging, with minor difference in the minimal inhibitory and bactericidal concentrations of the compounds against the spores. The compounds all delayed the bursting time of germinated spores and affected the generation time of vegetative cells at sub-inhibitory concentrations. At inhibitory concentrations spore outgrowth was prevented. One compound showed an unexpected potential for preventing spore germination at inhibitory concentrations, which merits further investigation. Our study shows the valuable role single cell live imaging can play in the final selection process of antimicrobial compounds.
An Alkalophilic Bacillus sp. Produces 2-Phenylethylamine
Hamasaki, Nobuko; Shirai, Shinji; Niitsu, Masaru; Kakinuma, Katsumi; Oshima, Tairo
1993-01-01
A large amount of 2-phenylethylamine was produced in cells of alkalophilic Bacillus sp. strain YN-2000. This amine is secreted in the medium during the cell growth. The amounts of 2-phenylethylamine in both cells and medium change upon changing the pH of the medium. PMID:16349025
Analysis of the Effects of a gerP Mutation on the Germination of Spores of Bacillus subtilis
2012-11-01
REPORT Analysis of the effects of a gerP mutation on the germination of spores of Bacillus subtilis 14. ABSTRACT 16. SECURITY CLASSIFICATION OF... Bacillus subtilis spores with a gerP mutation triggered spore germination via nutrient germinant receptors (GRs) slowly, although this defect was...gerP, Bacillus subtilis , dipicolinic acid Xuan Y. Butzin, Anthony J. Troiano, William H. Coleman, Keren K. Griffiths, Christopher J. Doona, Florence E
Verma, Pankaj; Pandey, Prashant Kumar; Gupta, Arvind Kumar; Seong, Chi Nam; Park, Seong Chan; Choe, Han Na; Baik, Keun Sik; Patole, Milind Shivaji; Shouche, Yogesh Shreepad
2012-10-01
We have carried out a polyphasic taxonomic characterization of Bacillus beijingensis DSM 19037(T) and Bacillus ginsengi DSM 19038(T), which are closely related phylogenetically to Bhargavaea cecembensis LMG 24411(T). All three strains are Gram-stain-positive, non-motile, moderately halotolerant and non-spore-forming. 16S rRNA gene sequence analyses showed that the strains constituted a coherent cluster, with sequence similarities between 99.7 and 98.7 %. The percentage similarity on the basis of amino acid sequences deduced from partial gyrB gene nucleotide sequences of these three type strains was 96.1-92.7 %. Phylogenetic trees based on the 16S rRNA gene and GyrB amino acid sequences, obtained by using three different algorithms, were consistent and showed that these three species constituted a deeply rooted cluster separated from the clades represented by the genera Bacillus, Planococcus, Planomicrobium, Sporosarcina, Lysinibacillus, Viridibacillus, Kurthia and Geobacillus, supporting their placement in the genus Bhargavaea. All three type strains have menaquinone MK-8 as the major respiratory quinone and showed similar fatty acid profiles. The main polar lipids present in the three type strains were diphosphatidylglycerol and phosphatidylglycerol, and the three strains showed peptidoglycan type A4α with L-lysine as the diagnostic diamino acid. The DNA G+C contents of Bacillus beijingensis DSM 19037(T), Bacillus ginsengi DSM 19038(T) and Bhargavaea cecembensis LMG 24411(T) were 53.1, 50.2 and 53.7 mol%, respectively. The level of DNA-DNA hybridization among the three strains was 57-39 %, indicating that they are members of different species of the genus Bhargavaea. The phenotypic data are consistent with the placement of these three species in a single genus and support their differentiation at the species level. On the basis of these data, we have emended the description of the genus Bhargavaea and propose the reclassification of Bacillus beijingensis
[Maxillary sinus infection by Bacillus licheniformis: a case report from Djibouti].
Garcia Hejl, C; Sanmartin, N; Samson, T; Soler, C; Koeck, J-L
2015-01-01
Aerobic, spore-forming gram-positive Bacillus spp infections are rare and reported mainly in immunocompromised hosts. We report a case of acute unilateral maxillary sinusitis, caused by Bacillus licheniformis, in a 35-year-old French soldier stationed in Djibouti. It was easily identifiable due to its typical culture and resistance profile. This case is interesting for two reasons: first, it is, to our knowledge, the first case of sinusitis attributed to this microbe, and second, it has rarely been described in immunocompetent patients without altered skin or mucous membranes.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1107 Delta endotoxin of Bacillus thuringiensis variety kurstaki encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin of...
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1107 Delta endotoxin of Bacillus thuringiensis variety kurstaki encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin of...
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1107 Delta endotoxin of Bacillus thuringiensis variety kurstaki encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin of...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1107 Delta endotoxin of Bacillus thuringiensis variety kurstaki encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin of...
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1107 Delta endotoxin of Bacillus thuringiensis variety kurstaki encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin of...
Development of an aerosol surface inoculation method for bacillus spores.
Lee, Sang Don; Ryan, Shawn P; Snyder, Emily Gibb
2011-03-01
A method was developed to deposit Bacillus subtilis spores via aerosolization onto various surface materials for biological agent decontamination and detection studies. This new method uses an apparatus coupled with a metered dose inhaler to reproducibly deposit spores onto various surfaces. A metered dose inhaler was loaded with Bacillus subtilis spores, a surrogate for Bacillus anthracis. Five different material surfaces (aluminum, galvanized steel, wood, carpet, and painted wallboard paper) were tested using this spore deposition method. This aerosolization method deposited spores at a concentration of more than 10(7) CFU per coupon (18-mm diameter) with less than a 50% coefficient of variation, showing that the aerosolization method developed in this study can deposit reproducible numbers of spores onto various surface coupons. Scanning electron microscopy was used to probe the spore deposition patterns on test coupons. The deposition patterns observed following aerosol impaction were compared to those of liquid inoculation. A physical difference in the spore deposition patterns was observed to result from the two different methods. The spore deposition method developed in this study will help prepare spore coupons via aerosolization fast and reproducibly for bench top decontamination and detection studies.
Protocol for Detection of Bacillus anthracis in Environmental Samples
This pProtocol Method describes proceduresintended for the analyses of swabs, wipes, Sponge-Sticks, vacuum socks and filters, air filters, drinking water, and decontamination waste water for Bacillus anthracis spores.
Bio sorption of strontium from aqueous solution by New Strain Bacillus sp. GTG-83
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tajer Mohammad Ghazvini, P.; Ghorbanzadeh Mashkani, S.; Ghafourian, H.
Attempt was made to isolate bacterial strains capable of removing Sr biologically. In this study we collected ten different water samples from naturally radioactive spring Neydasht in Iran and bacterial strains samples isolated. Initial screening of a total of 50 bacterial isolates resulted in selection of one strain. The strain showed maximum adsorption capacity with 55 mg Sr/g dry wt. It was tentatively identified as Bacillus sp. according to morphological and biochemical properties and called strain GTG-83. Studies indicated that Bacillus sp. GTG-83 was able to grow aerobically in the presence of 50 mM SrCl{sub 2} but showed severe growthmore » inhibition at levels above that concentration. The bio-sorption capacity of Bacillus sp. GTG-83 strongly depends on solution pH, and the maximum Sr sorption capacity of Bacillus sp. GTG-83 were obtained at pH 10 independent of the absence or the presence of increasing concentrations of salt (MgCl{sub 2}). Sr-salt bio-sorption studies were also performed at this pH values. Equilibrium uptakes of Sr increased with increasing Sr concentrations up to 250 mg/l for Bacillus sp. GTG-83. Maximum bio-sorption of Sr was obtained at temperatures in the range of 30-35 deg. C. Bacillus sp. GTG-83 bio-sorbed 97 mg Sr/g dry wt at 100 mg/l initial Sr concentration without salt medium (MgCl{sub 2}). When salt concentration (MgCl{sub 2}) increased to 15% (w/v), these values dropped to 23.6 mg Sr/g dry wt at the same conditions. Uptake of Sr within 5 min of incubation was relatively rapid and the absorption continued slowly thereafter. (authors)« less
Eom, Jeong Seon; Lee, Sun Young; Choi, Hye Sun
2014-11-01
Bacillus subtilis HJ18-4 isolated from buckwheat sokseongjang, a traditional Korean fermented soybean food, exhibits broad-spectrum antimicrobial activity against foodborne pathogens, including Bacillus cereus. In this study, we investigated the antibacterial efficacy and regulation of toxin gene expression in B. cereus by B. subtilis HJ18-4. Expression of B. cereus toxin-related genes (groEL, nheA, nheC, and entFM) was downregulated by B. subtilis HJ18-4, which also exhibited strong antibacterial activity against B. cereus. We also found that water extracts of soy product fermented with B. subtilis HJ18-4 significantly inhibited the growth of B. cereus and toxin expression. These results indicate that B. subtilis HJ18-4 could be used as an antimicrobial agent to control B. cereus in the fermented soybean food industry. Our findings also provide an opportunity to develop an efficient biological control agent against B. cereus. © 2014 The Authors. Journal of Food Science published by Wiley Periodicals, Inc. on behalf of Institute of Food Technologists®
Whole-Genome Sequences of 94 Environmental Isolates of Bacillus cereus Sensu Lato
Feldgarden, Michael; Kolter, Roberto; Mahillon, Jacques
2013-01-01
Bacillus cereus sensu lato is a species complex that includes the anthrax pathogen Bacillus anthracis and other bacterial species of medical, industrial, and ecological importance. Their phenotypes of interest are typically linked to large plasmids that are closely related to the anthrax plasmids pXO1 and pXO2. Here, we present the draft genome sequences of 94 isolates of B. cereus sensu lato, which were chosen for their plasmid content and environmental origins. PMID:24092776
Yasin, Ina-salwany Md; Razak, Nabilah Fatin; Natrah, F M I; Harmin, Sharr Azni
2016-07-01
A total of 58 Gram-positive bacteria strains were isolated from the marine environment and screened for potential probiotics for disease prevention and improving the productivity of tiger grouper Epinephelus fuscoguttatus larvae and juveniles. The bacteria were identified as Bacillus licheniformis, B. subtilis, B. circulans, B. sphaericus, B. cereus, Brevibacillus brevis, Corynebacterium propinquum, Leifsonia aquatica and Paenibacillus macerans. Only 24 strains showed antagonistic activities against four pathogenic strains; Vibrio alginolyticus, V. harveyi, V. parahaemolyticus and Aeromonas hydrophila, where two of the Bacillus strains, B12 and B45 demonstrated intermediate to highest level of inhibitory activity against these pathogenic strains, respectively. Further assessment by co-culture assay showed that Bacillus strain B12 exhibited a total inhibition of V. alginolyticus, while B45 strain displayed no inhibitory activity. Mixed culture of Bacillus B12 and B45 strains to outcompete V. alginolyticus was observed at a cell density of 10(7) CFU ml(-1). Molecular identification and phylogenetic tree analysis have categorized Bacillus strain B12 to the reference strains GQ340480 and JX290193 of? B. amyloliquafaciens, and Bacillus strain B45 with a reference strain JF496522 of B. subtilis. Safety tests of probionts by intraperitoneal administration of B12 and B45 strains at cell densities of 103, 105 and 10(7) CFU ml(-1) revealed no abnormalities and cent percent survival for healthy Epinephelus fuscoguttatus juveniles within 15 days of experimental period. Overall, the study revealed that Bacillus B12 strain possesses tremendous probiotic potential that could be used as a feed supplement in tiger grouper diets. ?
Inhibitory effects of Bacillus subtilis on plant pathogens of conservatory in high latitudes
NASA Astrophysics Data System (ADS)
Xue, Chun-Mei; Wang, Xue; Yang, Jia-Li; Zhang, Yue-Hua
2018-03-01
Researching the effect of three kinds of Bacillus and their mixed strains inhibitory on common fungal diseases of conservatory vegetables. The results showed that B. megaterium culture medium had a significant inhibition effect on Cucumber Fusarium wilt, and the inhibition rate was up to 84.36%; B. mucilaginosus and B. megaterium sterile superna-tant had an obvious inhibitory effect on brown disease of eggplant, and the inhibition rate as high as 85.49%; B. subtilis sterile supernatant had a good inhibitory effect on the spore germination of C. Fusarium wilt, and the inhibition rate was 76.83%. The results revealed that Bacillus had a significant inhibitory effect on five common fungal pathogens. Three kinds of Bacillus can be used for the prevention and control of common fungal diseases in conservatory vegetables.
USDA-ARS?s Scientific Manuscript database
We are developing a collection of Bacillus strains, isolated from different environments, for use in controlling Sclerotinia sclerotiorum on oilseed rape in China and elsewhere. Strain BY-2, isolated from internal tissues of an oilseed rape root, was demonstrated to be Bacillus subtilis based on bi...
Microbiological studies on the radiation environment of the ionosphere and stratosphere.
Petras, E; Bisa, K
1968-01-01
Rocket, balloon and laboratory experiments have been performed in order to study the survival chances of microorganisms, which exist under the environmental conditions of ionosphere and stratosphere. The main results are: 1. Not only near the earth, but also in the stratosphere and even in the ionosphere, microorganisms are endangered primarily by UV- and EUV-light irradiation. 2. The observed effect of more penetrating kinds of radiation was relatively unimportant. High-vacuum and temperature effects have not been observed at all. Even membrane filters and thin protein layers protected the exposed spores of Bacillus subtilis var. niger (= Bac. globigii) in a clear-cut manner. 3. UV-light with a wavelength between 200 and 300 nm reduces the number of cells able to divide much quicker, than EUV-light of the same energy level does, but damages caused by EUV-light can not be reversed by photoreactivation. 4. Microbes which have been damaged by solar radiation, can be photoreactivated to a degree. Photoreactivation is high after exposure near the Earth and significant after exposure within the stratosphere. 5. After exposure to ionospheric irradiations no changes in the antigenic behavior of E. coli cells could be detected.
Short-range lidar for bioagent detection and classification
NASA Astrophysics Data System (ADS)
Hô, Nicolas; Émond, Frédéric; Babin, François; Healy, Dave; Simard, Jean-Robert; Buteau, Sylvie; McFee, John E.
2010-04-01
We have developed a small, relatively lightweight and efficient short range (<100 m) LIDAR instrument for remotely detecting harmful bioagents. The system is based on a pulsed, eye-safe, 355 nm laser exciting aerosols which then fluoresce with a typical spectrum. The system makes use of a novel technology for continuously monitoring for the presence of unusual concentrations of bioaerosols at a precise remote location within the monitored area, with response within seconds. Fluorescence is spectrally resolved over 32 channels capable of photon counting. Results show a sensitivity level of 40 ACPLA of Bacillus Globigii, an anthrax simulant, at a distance of 100 m (assumed worst case where 1 ppl = 1 ACPLA) considering particle sizes between 0.5 and 10 μm, with a geometric mean at 1 um. The apparatus has been tested in the field during three test and evaluation campaigns with multiple bioagents and public security products. Preliminary results show that the system is able to distinguish between harmful bioagents and naturally occurring ones. A classification algorithm was successfully tested with a single type of bioagent; experiments for daytime measurements are discussed.
Bacillus Endospores - an ideal exobiological Tool
NASA Astrophysics Data System (ADS)
Moeller, R.; Horneck, G.
Exobiology investigations have one overall goal -- finding the answer to the question if Earth is the only possible place in our universe where life was created. For tackling this question a good approach is to use a simple and ubiquitous system like bacteria as used in BIOPAN and EXPOSE. Many of these microorganisms have the ability to form metabolic inactive continuous forms such as Bacillus endospores. These spores are highly resistant against a variety of environmental stresses, such as toxic chemical agents, desiccation, high and low pressure, high doses of ionising and UV radiation and temperature extremes such as heat or permafrost. They are ubiquitous, inhabit soils and rocks and are easily disseminated by wind and water. Therefore they are suitable test systems for studying several questions of astrobiology, such as the theory of Panspermia, planetary protection issues in connection with missions to Mars or Europa, or chances for life on past or present Mars. The strategies Bacillus sp. endospores have developed to survive harsh conditions include a desiccated spore core, an altered conformation of their DNA (A-form), high concentration of small acid-soluble proteins (SASPs) stabilising the DNA, dipicolinic acid (DPA) for stabilisation and protective spore coating layers. We have investigated the role of endogenous and exogenous pigments in the UV-resistance of Bacillus endospores by using spores of different degree and kind of pigmentation, i.e. white, grey or red spores (DSMZ culture collection). The spectral ranges of UV radiation represented those of the early or present UV radiation climate of Earth or Mars. It was found, that endogenous carotenoids, identified by spectrophotometrical analysis from a spore extract as well as in-situ by Raman spectroscopy, efficiently protect against UV-A radiation, whereas melanin was also protective against UV-C radiation. From these studied follows, that highly pigmented spores might survive even in an intense UV
Inactivation of Bacillus anthracis Spores in Soil Matrices with ...
Report This report documents the results of a laboratory study designed to better understand the effectiveness of chlorine dioxide (ClO2) gas to decontaminate soil materials contaminated with Bacillus anthracis spores.
NASA Astrophysics Data System (ADS)
Ghiuță, I.; Cristea, D.; Croitoru, C.; Kost, J.; Wenkert, R.; Vyrides, I.; Anayiotos, A.; Munteanu, D.
2018-04-01
In this work, the biosynthesis of silver nanoparticles, using AgNO3 as a precursor, by two Bacillus species, namely Bacillus amyloliquefaciens and Bacillus subtillis, is reported. After the synthesis stages, the absorbance of the brown nanoparticle colloidal solutions was assessed by UV-vis spectrophotometry, which showed the peak absorbance values at 418 nm and 414 nm, corresponding to surface plasmon resonance of silver nanoparticles. The EDX, SEM and DLS analyses confirmed the formation of spherical silver nanoparticles with an average diameter smaller than 140 nm. XRD confirmed the presence of face-centered cubic silver crystals, with the highest intensity peak at 2θ = 38.12°, which corresponds to the (111) diffraction planes. The antibacterial activity after 24 h of incubation was observed against gram negative bacteria: Escherichia coli, Pseudomonas aeruginosa, Salmonella, as well as gram positive: Staphylococcus aureus, Streptococcus pyogenes. Furthermore, the antifungal activity was assessed against Candida albicans. The inhibition zone was clearly observed on the plates containing silver nanoparticles, either standalone or in combination with antibiotics, thus showing their potentiating antibacterial effect.
Bioremoval of trivalent chromium using Bacillus biofilms through continuous flow reactor.
Sundar, K; Sadiq, I Mohammed; Mukherjee, Amitava; Chandrasekaran, N
2011-11-30
Present study deals with the applicability of bacterial biofilms for the bioremoval of trivalent chromium from tannery effluents. A continuous flow reactor was designed for the development of biofilms on different substrates like glass beads, pebbles and coarse sand. The parameters for the continuous flow reactor were 20 ml/min flow rate at 30°C, pH4. Biofilm biomass on the substrates was in the following sequence: coarse sand>pebbles>glass beads (4.8 × 10(7), 4.5 × 10(7) and 3.5 × 10(5)CFU/cm(2)), which was confirmed by CLSM. Biofilms developed using consortium of Bacillus subtilis and Bacillus cereus on coarse sand had more surface area and was able to remove 98% of Cr(III), SEM-EDX proved 92.60% Cr(III) adsorption on biofilms supported by coarse sand. Utilization of Bacillus biofilms for effective bioremoval of Cr(III) from chrome tanning effluent could be a better option for tannery industry, especially during post chrome tanning operation. Copyright © 2011 Elsevier B.V. All rights reserved.
Shu, Lin-Jie; Yang, Yu-Liang
2017-11-14
Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) is a reliable and rapid technique applied widely in the identification and classification of microbes. MALDI-TOF MS has been used to identify many endospore-forming Bacillus species; however, endospores affect the identification accuracy when using MALDI-TOF MS because they change the protein composition of samples. Since culture conditions directly influence endospore formation and Bacillus growth, in this study we clarified how culture conditions influence the classification of Bacillus species by using MALDI-TOF MS. We analyzed members of the Bacillus subtilis group and Bacillus cereus group using different incubation periods, temperatures and media. Incubation period was found to affect mass spectra due to endospores which were observed mixing with vegetative cells after 24 hours. Culture temperature also resulted in different mass spectra profiles depending on the temperature best suited growth and sporulation. Conversely, the four common media for Bacillus incubation, Luria-Bertani agar, nutrient agar, plate count agar and brain-heart infusion agar did not result in any significant differences in mass spectra profiles. Profiles in the range m/z 1000-3000 were found to provide additional data to the standard ribosomal peptide/protein region m/z 3000-15000 profiles to enable easier differentiation of some highly similar species and the identification of new strains under fresh culture conditions. In summary, control of culture conditions is vital for Bacillus identification and classification by MALDI-TOF MS.
Nimrat, Subuntith; Suksawat, Sunisa; Boonthai, Traimat; Vuthiphandchai, Verapong
2012-10-12
Epidemics of epizootics and occurrence of multiresistant antibiotics of pathogenic bacteria in aquaculture have put forward a development of effective probiotics for the sustainable culture. This study examined the effectiveness of forms of mixed Bacillus probiotics (probiotic A and probiotic B) and mode of probiotic administration on growth, bacterial numbers and water quality during rearing of white shrimp (Litopenaeus vannamei) in two separated experiments: (1) larval stages and (2) postlarval (PL) stages. Forms of Bacillus probiotics and modes of probiotic administration did not affect growth and survival of larval to PL shrimp. The compositions of Bacillus species in probiotic A and probiotic B did not affect growth and survival of larvae. However, postlarvae treated with probiotic B exhibited higher (P<0.05) growth than probiotic A and controls, indicating Bacillus probiotic composition affects the growth of PL shrimp. Total heterotrophic bacteria and Bacillus numbers in larval and PL shrimp or culture water of the treated groups were higher (P<0.05) than in controls. Levels of pH, ammonia and nitrite of the treated shrimp were significantly decreased, compared to the controls. Microencapsulated Bacillus probiotic was effective for rearing of PL L. vannamei. This investigation showed that administration of mixed Bacillus probiotics significantly improved growth and survival of PL shrimp, increased beneficial bacteria in shrimp and culture water and enhanced water quality for the levels of pH, ammonia and nitrite of culture water. Copyright © 2012 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Plomp, M; Leighton, T; Wheeler, K
2005-02-18
We have utilized atomic force microscopy (AFM) to visualize the native surface topology and ultrastructure of Bacillus thuringiensis and Bacillus cereus spores in water and in air. AFM was able to resolve the nanostructure of the exosporium and three distinctive classes of appendages. Removal of the exosporium exposed either a hexagonal honeycomb layer (B. thuringiensis) or a rodlet outer spore coat layer (B. cereus). Removal of the rodlet structure from B. cereus spores revealed an underlying honeycomb layer similar to that observed with B. thuringiensis spores. The periodicity of the rodlet structure on the outer spore coat of B. cereusmore » was {approx}8 nm, and the length of the rodlets was limited to the cross-patched domain structure of this layer to {approx}200 nm. The lattice constant of the honeycomb structures was {approx}9 nm for both B. cereus and B. thuringiensis spores. Both honeycomb structures were composed of multiple, disoriented domains with distinct boundaries. Our results demonstrate that variations in storage and preparation procedures result in architectural changes in individual spore surfaces, which establish AFM as a useful tool for evaluation of preparation and processing ''fingerprints'' of bacterial spores. These results establish that high-resolution AFM has the capacity to reveal species-specific assembly and nanometer scale structure of spore surfaces. These species-specific spore surface structural variations are correlated with sequence divergences in a spore core structural protein SspE.« less
Sun, Peng; Li, Jinan; Bu, Dengpan; Nan, Xuemei; Du, Hong
2016-05-01
This study was to investigate the effects of live or autoclaved Bacillus subtilis natto, their fermented products and media on rumen fermentation and rumen functional bacteria in vitro. Rumen fluid from three multiparous lactating Holstein cows was combined and transferred into serum bottles after diluted. Fifteen serum bottles were divided into five treatments, which were designed as following: CTR (the fermentation of 0.5 g TMR and ruminal fluids from dairy cows), LBS (CTR plus a minimum of 10(11) cfu live Bacillus subtilis natto), ABS (CTR plus a minimum of 10(11) cfu autoclaved Bacillus subtilis natto), BSC (CTR plus 1 ml Bacillus subtilis natto fermentation products without bacteria), and BSM (CTR plus 1 ml liquid fermentation medium). When separated from the culture, live Bacillus subtilis natto individually increased the concentrations of ammonia-N (P < 0.01), MCP production (P < 0.01), and tended to elevate total VFA (P = 0.07), but decreased the ratio of acetate and propionate (P < 0.01). Autoclaved Bacillus subtilis natto has the similar function with the live bacteria except for the ratio of acetate and propionate. Except B. fibrisolvens, live or autoclaved Bacillus subtilis natto did not influence or decreased the 16S rRNA gene quantification of the detected bacteria. BSC and BSM altered the relative expression of certain functional bacteria in the rumen. These results indicated that it was Bacillus subtilis natto thalli that played the important role in promoting rumen fermentation when applied as a probiotic in dairy ration.
USDA-ARS?s Scientific Manuscript database
Sprayer comparisons and larval morality assays were conducted following SR450 backpack mist blower and Superhawk XP thermal fogger applications of Vectobac® WDG Bacillus thuringiensis israelensis (Bti) de Barjac against Culex quinquefasciatus Say. Bacillus thuringiensis israelensis was applied at m...
Itagaki, Shiori; Haga, Minami; Oikawa, Yuji; Sakoda, Ayaka; Ohke, Yoshie; Sawada, Hiroshi; Eguchi, Tadashi; Tamegai, Hideyuki
2013-01-01
BtrC2 of the butirosin producer Bacillus circulans is a non-catalytic subunit of 2-deoxy-scyllo-inosose (DOI) synthase that is involved in butirosin biosynthesis, and also a homolog of glutamine amidotransferase subunit (PdxT) of pyridoxal 5'-phosphate (PLP) synthase of Bacillus subtilis. BtrC2 has been found to have functions in B. circulans both in primary and secondary metabolism. In this study, we investigated the properties of PdxT of B. subtilis in order to determine whether the property of enzyme stabilization is universal among PdxT homologs. Complementation with PdxT in the btrC2 disruptant of B. circulans restored the growth and short-term production of antibiotics, but long-term production of antibiotics cannot be restored. Additionally, PdxT did not bind physically with or stabilize BtrC. Our results indicate that the function of BtrC2 in secondary metabolism is specific properties, not universal among PdxT homologs.
40 CFR 180.1282 - Bacillus firmus I-1582; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus firmus I-1582; exemption from the requirement of a tolerance. 180.1282 Section 180.1282 Protection of Environment ENVIRONMENTAL..., for residues of Bacillus firmus I-1582 when used as a soil application or seed treatment. [73 FR 25528...
Kinetics of Germination of Bacillus Spores1
Vary, J. C.; Halvorson, H. O.
1965-01-01
Vary, J. C. (University of Wisconsin, Madison), and H. O. Halvorson. Kinetics or germination of Bacillus spores. J. Bacteriol. 89:1340–1347. 1965.—The kinetics of germination of Bacillus cereus strain T spores was accurately described by McCormick. To study the mechanism of germination, it is necessary to correlate the characteristic changes in a population of germinating spores with the behavior of the individual spores in the same population. Two microscopic events are apparent during germination: microlag, the time interval between the addition of l-alanine to heat-activated spores and the beginning of loss in refractility, and microgermination time, the time for the actual change in refractility to occur. The frequency distributions of both events are skewed, and appear to be independent. The effects of l-alanine concentration, heat activation, and temperature of germination on three parameters, microlag, microgermination, and per cent germination, were microscopically studied. The data are discussed in relation to the mechanism of germination, and a correlation between microlag and microgermination times with the constants of McCormick's equation has been suggested. Images PMID:14293008
Biodegradation of furfural by Bacillus subtilis strain DS3.
Zheng, Dan; Bao, Jianguo; Lu, Jueming; Lv, Quanxi
2015-07-01
An aerobic bacterial strain DS3, capable of growing on furfural as sole carbon source, was isolated from actived sludge of wastewater treatment plant in a diosgenin factory after enrichment. Based on morphological physiological tests as well as 16SrDNA sequence and Biolog analyses it was identified as Bacillus subtilis. The study revealed that strain DS3 utilized furfural, as analyzed by high-performance liquid chromatography (HPLC). Under following conditions: pH 8.0, temperature 35 degrees C, 150 rpm and 10% inoculum, strain DS3 showed 31.2% furfural degradation. Furthermore, DS3 strain was found to tolerate furfural concentration as high as 6000 mg(-1). The ability of Bacillus subtilis strain DS3 to degrade furfural has been demonstrated for the first time in the present study.
Chen, Yonggan; Li, Jihua; He, Shuzhen; Xu, Fei; Fang, Yiming
2015-01-01
Vanilla beans were analyzed using biochemical methods, which revealed that glucovanillin disperses from the inner part to the outer part of the vanilla bean during the curing process and is simultaneously hydrolyzed by β-d-glucosidase. Enzymatic hydrolysis was found to occur on the surface of the vanilla beans. Transcripts of the β-d-glucosidase gene (bgl) of colonizing microorganisms were detected. The results directly indicate that colonizing microorganisms are involved in glucovanillin hydrolysis. Phylogenetic analysis based on 16S rRNA gene sequences showed that the colonizing microorganisms mainly belonged to the Bacillus genus. bgl was detected in all the isolates and presented clustering similar to that of the isolate taxonomy. Furthermore, inoculation of green fluorescent protein-tagged isolates showed that the Bacillus isolates can colonize vanilla beans. Glucovanillin was metabolized as the sole source of carbon in a culture of the isolates within 24 h. These isolates presented unique glucovanillin degradation capabilities. Vanillin was the major volatile compound in the culture. Other compounds, such as α-cubebene, β-pinene, and guaiacol, were detected in some isolate cultures. Colonizing Bacillus isolates were found to hydrolyze glucovanillin in culture, indirectly demonstrating the involvement of colonizing Bacillus isolates in glucovanillin hydrolysis during the vanilla curing process. Based on these results, we conclude that colonizing Bacillus isolates produce β-d-glucosidase, which mediates glucovanillin hydrolysis and influences flavor formation. PMID:25979899
Jacobsen, B J; Zidack, N K; Larson, B J
2004-11-01
ABSTRACT Bacillus-based biological control agents (BCAs) have great potential in integrated pest management (IPM) systems; however, relatively little work has been published on integration with other IPM management tools. Unfortunately, most research has focused on BCAs as alternatives to synthetic chemical fungicides or bactericides and not as part of an integrated management system. IPM has had many definitions and this review will use the national coalition for IPM definition: "A sustainable approach to managing pests by combining biological, cultural, physical and chemical tools in a way that minimizes economic, health and environmental risks." This review will examine the integrated use of Bacillus-based BCAs with disease management tools, including resistant cultivars, fungicides or bactericides, or other BCAs. This integration is important because the consistency and degree of disease control by Bacillus-based BCAs is rarely equal to the control afforded by the best fungicides or bactericides. In theory, integration of several tools brings stability to disease management programs. Integration of BCAs with other disease management tools often provides broader crop adaptation and both more efficacious and consistent levels of disease control. This review will also discuss the use of Bacillus-based BCAs in fungicide resistance management. Work with Bacillus thuringiensis and insect pest management is the exception to the relative paucity of reports but will not be the focus of this review.
Switzer, Blum J.; Burns, Bindi A.; Buzzelli, J.; Stolz, J.F.; Oremland, R.S.
1998-01-01
Two gram-positive anaerobic bacteria (strains E1H and MLS10) were isolated from the anoxic muds of Mono Lake, California, an alkaline, hypersaline, arsenic-rich water body. Both grew by dissimilatory reduction of As(V) to As(III) with the concomitant oxidation of lactate to acetate plus CO2. Bacillus arsenicoselenatis (strain E1H) is a spore-forming rod that also grew by dissimilatory reduction of Se(VI) to Se(IV). Bacillus selenitireducens (strain MLS 10) is a short, non-spore-forming rod that grew by dissimilatory reduction of Se(IV) to Se(0). When the two isolates were cocultured, a complete reduction of Se(VI) to Se(0) was achieved. Both isolates are alkaliphiles and had optimal specific growth rates in the pH range of 8.5-10. Strain E1H had a salinity optimum at 60 g 1-1 NaCl, while strain MLS10 had optimal growth at lower salinities (24-60 g 1-1 NaCl). Both strains have limited abilities to grow with electron donors and acceptors other than those given above. Strain MLS10 demonstrated weak growth as a microaerophile and was also capable of fermentative growth on glucose, while strain E1H is a strict anaerobe. Comparative 16S rRNA gene sequence analysis placed the two isolates with other Bacillus spp. in the low G+C gram-positive group of bacteria.
Reis, Leonardo O; Ferreira, Ubirajara; Billis, Athanase; Cagnon, Valéria H A; Fávaro, Wagner J
2012-02-01
We compared and characterized the effects of intravesical bacillus Calmette-Guérin and/or staphylococcal enterotoxin B for nonmuscle invasive bladder cancer. A total of 75 female Fisher 344 rats were anesthetized. Of the rats 15 received 0.3 ml saline (control) and 60 received 1.5 mg/kg MNU (N-methyl-n-nitrosourea) intravesically every other week for 6 weeks. The rats were divided into 5 groups. The MNU and control groups received 0.3 ml saline. The bacillus Calmette-Guérin group received 10(6) cfu bacillus Calmette-Guérin. The staphylococcal enterotoxin B group received 10 μg/ml staphylococcal enterotoxin B. The bacillus Calmette-Guérin plus staphylococcal enterotoxin B group received the 2 treatments simultaneously. Each group was treated intravesically for 6 weeks. At 15 weeks all bladders were collected for histopathological and immunological evaluation, and Western blot. Papillary carcinoma (pTa) and high grade intraepithelial neoplasia (carcinoma in situ) were more common in the MNU group. Papillary hyperplasia was more common in the bacillus Calmette-Guérin and enterotoxin groups. Flat hyperplasia was more common in the bacillus Calmette-Guérin plus enterotoxin group. No significant toxicity was observed. The apoptosis and cellular proliferation indexes decreased in the bacillus Calmette-Guérin, enterotoxin and bacillus Calmette-Guérin plus enterotoxin groups compared to the MNU group. Intensified vascular endothelial growth factor, matrix metalloproteinase-9, Ki-67 and insulin-like growth factor receptor-1 immunoreactivity was verified in the MNU group, moderate in the bacillus Calmette-Guérin and enterotoxin groups, and weak in the bacillus Calmette-Guérin plus enterotoxin and control groups. In contrast, intense endostatin immunoreactivity was verified in the control and bacillus Calmette-Guérin plus enterotoxin groups. Bacillus Calmette-Guérin and staphylococcal enterotoxin B showed similar anti-angiogenic effects. Bacillus Calmette
Siahmoshteh, Fatemeh; Siciliano, Ilenia; Banani, Houda; Hamidi-Esfahani, Zohreh; Razzaghi-Abyaneh, Mehdi; Gullino, Maria Lodovica; Spadaro, Davide
2017-08-02
Pistachio (Pistacia vera) is an important nut for its economic, nutritional and health aspects but it can be contaminated by aflatoxigenic fungi in the field and during storage. Biological control could be considered as an alternative to chemical treatment. In this study, we evaluated the antifungal and anti-mycotoxigenic capability of two Bacillus spp. both in vitro and on pistachio kernels. In in vitro conditions, both strains were able to reduce the mycelial growth and they were able to degrade the four aflatoxins during the first three days after inoculation. AFG 1 and AFG 2 were rapidly degraded within two days of incubation with the bacterial strains. No aflatoxin was found in the bacterial cell walls, permitting exclusion of mycotoxin adsorption and hypothesis of an in vitro biodegradation as a mode of action. The cultivar of pistachio most susceptible to fungal colonization was 'Ahmad-Aghaei', selected among four main Iranian cultivars. A. parasiticus was able to grow and produce aflatoxins on pistachios, but at longer inoculation periods, a natural decrease of aflatoxins was registered. Both strains were able to reduce the fungal incidence and number of spores on pistachio with a stronger effect during the first 5dpi. The effect on aflatoxin content in vivo was less pronounced than in vitro, with a maximum effect at 8dpi. At longer times, there was a contrasting effect due to the lower activity of Bacillus spp. in stationary phase and higher growth of Aspergillus species. This consideration could explain the lack of aflatoxin reduction at 12dpi. Both bacterial strains showed good antifungal activity and aflatoxin reduction in in vitro conditions and on pistachio kernels. Altogether, these results indicate that Bacillus species could be considered as potential biocontrol agents to combat toxigenic fungal growth and subsequent aflatoxin contamination of nuts and agricultural crops in practice. Copyright © 2017. Published by Elsevier B.V.
Wang, Pengxia; Zhu, Yiguang; Zhang, Yuyang; Zhang, Chunyi; Xu, Jianyi; Deng, Yun; Peng, Donghai; Ruan, Lifang; Sun, Ming
2016-06-10
Bacillus thuringiensis and Bacillus cereus are two important species in B. cereus group. The intensive study of these strains at the molecular level and construction of genetically modified bacteria requires the development of efficient genetic tools. To insert genes into or delete genes from bacterial chromosomes, marker-less manipulation methods were employed. We present a novel genetic manipulation method for B. thuringiensis and B. cereus strains that does not leave selection markers. Our approach takes advantage of the relaxase Mob02281 encoded by plasmid pBMB0228 from Bacillus thuringiensis. In addition to its mobilization function, this Mob protein can mediate recombination between oriT sites. The Mob02281 mobilization module was associated with a spectinomycin-resistance gene to form a Mob-Spc cassette, which was flanked by the core 24-bp oriT sequences from pBMB0228. A strain in which the wild-type chromosome was replaced with the modified copy containing the Mob-Spc cassette at the target locus was obtained via homologous recombination. Thus, the spectinomycin-resistance gene can be used to screen for Mob-Spc cassette integration mutants. Recombination between the two oriT sequences mediated by Mob02281, encoded by the Mob-Spc cassette, resulted in the excision of the Mob-Spc cassette, producing the desired chromosomal alteration without introducing unwanted selection markers. We used this system to generate an in-frame deletion of a target gene in B. thuringiensis as well as a gene located in an operon of B. cereus. Moreover, we demonstrated that this system can be used to introduce a single gene or an expression cassette of interest in B. thuringiensis. The Mob/oriT recombination system provides an efficient method for unmarked genetic manipulation and for constructing genetically modified bacteria of B. thuringiensis and B. cereus. Our method extends the available genetic tools for B. thuringiensis and B. cereus strains.
Kharchenko, Maria S; Teslya, Petr N; Babaeva, Maria N; Zakataeva, Natalia P
2018-05-01
Bacillus subtilis pheS was genetically modified to obtain a counter-selection marker with high selection efficiency in Bacillus amyloliquefaciens. The application of the new replication-thermosensitive integrative vector pNZTM1, containing this marker, pheS BsT255S/A309G , with a two-step replacement recombination procedure provides an effective tool for the genetic engineering of industrially important Bacillus species. Copyright © 2018. Published by Elsevier B.V.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1108 Delta endotoxin of Bacillus thuringiensis variety San Diego encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin...
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1108 Delta endotoxin of Bacillus thuringiensis variety San Diego encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin...
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1108 Delta endotoxin of Bacillus thuringiensis variety San Diego encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1108 Delta endotoxin of Bacillus thuringiensis variety San Diego encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin...
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Delta endotoxin of Bacillus... From Tolerances § 180.1108 Delta endotoxin of Bacillus thuringiensis variety San Diego encapsulated into killed Pseudomonas fluorescens; exemption from the requirement of a tolerance. The delta endotoxin...
Swiecicka, Izabela; Mahillon, Jacques
2006-04-01
Although Bacillus cereus sensu lato are important both from an ecological and an economical point of view, little is known about their population structure, ecology, and relationships with other organisms. In the present work, the genotypic similarity of arthropod-borne B. cereus s.l. isolates, and their symbiotic relationship with the host are assessed. Bacilli of this group were recovered from the digestive tracts of sow bugs (Porcellio scaber) collected in three closely located sites. Their genotypic diversity was investigated using pulse-field gel electrophoresis (PFGE) following the whole-genome DNA digestions with NotI and AscI, and PCR amplification of virulence genes. The majority of the sow-bug Bacillus cereus sensu stricto isolates originating from the same but also from different sites displayed identical PFGE patterns, virulence gene content and enterotoxicity, indicating strong genetic and genomic relationships. The sow-bug Bacillus mycoides/Bacillus pseudomycoides strains displayed a higher diversity. The isopod-B. cereus s.l. relationship was also evaluated using antibiotic-resistant derivatives of B. cereus s.s., B. mycoides/B. pseudomycoides and Bacillus thuringiensis reintroduced into sow bugs. Both spores and vegetative cells of B. cereus s.l. were recovered from sow bugs over a 30-day period, strongly suggesting that these bacteria are natural residents of terrestrial isopods.
Bacillusin A, an antibacterial macrodiolide from Bacillus amyloliquefaciens
USDA-ARS?s Scientific Manuscript database
Bioassay-guided fractionation of the organic extracts of a Bacillus amyloliquefaciens strain (AP183) led to the discovery of a new macrocyclic polyene antibiotic, bacillusin A (1). Its structure was assigned by interpretation of NMR and MS spectroscopic data as a novel macrodiolide composed of dimer...
Roles of the Bacillus anthracis Spore Protein ExsK in Exosporium Maturation and Germination
2009-12-01
exosporium maturation and assembly and suggest a novel role for the exosporium in germination. During starvation, bacteria of the genus Bacillus...Bacillus subtilis, the outermost struc- ture is a protective layer called the coat, which guards the spore against reactive small molecules, degradative ...analysis. Generation of anti-ExsK antibodies. Recombinant ExsK was generated and purified using the pET expression system (Novagen) according to the
Molecular mechanisms involved in Bacillus subtilis biofilm formation
Mielich-Süss, Benjamin; Lopez, Daniel
2014-01-01
Summary Biofilms are the predominant lifestyle of bacteria in natural environments, and they severely impact our societies in many different fashions. Therefore, biofilm formation is a topic of growing interest in microbiology, and different bacterial models are currently studied to better understand the molecular strategies that bacteria undergo to build biofilms. Among those, biofilms of the soil-dwelling bacterium Bacillus subtilis are commonly used for this purpose. Bacillus subtilis biofilms show remarkable architectural features that are a consequence of sophisticated programs of cellular specialization and cell-cell communication within the community. Many laboratories are trying to unravel the biological role of the morphological features of biofilms, as well as exploring the molecular basis underlying cellular differentiation. In this review, we present a general perspective of the current state of knowledge of biofilm formation in B. subtilis. In particular, a special emphasis is placed on summarizing the most recent discoveries in the field and integrating them into the general view of these truly sophisticated microbial communities. PMID:24909922
Bacillus subtilis genome diversity.
Earl, Ashlee M; Losick, Richard; Kolter, Roberto
2007-02-01
Microarray-based comparative genomic hybridization (M-CGH) is a powerful method for rapidly identifying regions of genome diversity among closely related organisms. We used M-CGH to examine the genome diversity of 17 strains belonging to the nonpathogenic species Bacillus subtilis. Our M-CGH results indicate that there is considerable genetic heterogeneity among members of this species; nearly one-third of Bsu168-specific genes exhibited variability, as measured by the microarray hybridization intensities. The variable loci include those encoding proteins involved in antibiotic production, cell wall synthesis, sporulation, and germination. The diversity in these genes may reflect this organism's ability to survive in diverse natural settings.
Bacillus alkalilacus sp. nov., isolated from a sediment sample from a lake in India.
Singh, Harjodh; Kaur, Manpreet; Sharma, Shivani; Kaur, Lakhwinder; Mishra, Sunita; Tanuku, Naga Radha Srinivas; Pinnaka, Anil Kumar
2018-05-01
An aerobic, endospore-forming, haloalkali-tolerant, Gram-stain-positive, motile, rod-shaped bacterium, designated strain AK73 T , was isolated from a sediment sample collected from Sambhar lake, Jaipur, Rajasthan, India. Colonies were circular, 1-2 mm in diameter, glossy, smooth, yellowish and convex with an entire margin after 48 h growth on marine agar at pH 9 and 37 °C. Growth occurred at 15-42 °C, 0-10 % (w/v) NaCl and at a pH range of 7-12. Strain AK73 T was positive for catalase and arginine dihydrolase 2 activities, hydrolysis of Tweens 20, 40 and 80, and negative for esculinase, caseinase, gelatinase, β-galactosidase, lipase (Tween 60) and urease activities. The fatty acids were dominated by branched iso-, anteiso-, saturated fatty acids with a high abundance of iso-C15 : 0, anteiso-C15 : 0, C16 : 0 and anteiso-C17 : 0; MK-7 was the major menaquinone. The cell-wall peptidoglycan contained meso-diaminopimelic acid as the diagnostic diamino acid. The polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, one unidentified aminophospholipid, four unidentified phospholipids and three unidentified lipids. The DNA G+C content of strain AK73 T was 54 mol%. Analysis based on comparative 16S rRNA gene sequence analysis indicated that Bacillus alcalophilus was the nearest phylogenetic neighbour, with a pair-wise sequence similarity of 96.0 %. Phylogenetic analysis showed that strain AK73 T formed a separate lineage but was loosely associated with a peripheral cluster of organisms that contained Bacillus gibsonii, Bacillus murimartini and Bacillus plakortidis with similarity values of 93.6, 93.5 and 93.4 %, respectively. Based on its phenotypic characteristics and on phylogenetic inference, strain AK73 T represents a novel species of the genus Bacillus, for which the name Bacillus alkalilacus sp. nov. is proposed. The type strain is AK73 T (=JCM 32184 T =MTCC 12637 T =KCTC 33880 T ).
Bacillus cereus and related species.
Drobniewski, F A
1993-10-01
Bacillus cereus is a gram-positive aerobic or facultatively anaerobic spore-forming rod. It is a cause of food poisoning, which is frequently associated with the consumption of rice-based dishes. The organism produces an emetic or diarrheal syndrome induced by an emetic toxin and enterotoxin, respectively. Other toxins are produced during growth, including phospholipases, proteases, and hemolysins, one of which, cereolysin, is a thiol-activated hemolysin. These toxins may contribute to the pathogenicity of B. cereus in nongastrointestinal disease. B. cereus isolated from clinical material other than feces or vomitus was commonly dismissed as a contaminant, but increasingly it is being recognized as a species with pathogenic potential. It is now recognized as an infrequent cause of serious nongastrointestinal infection, particularly in drug addicts, the immunosuppressed, neonates, and postsurgical patients, especially when prosthetic implants such as ventricular shunts are inserted. Ocular infections are the commonest types of severe infection, including endophthalmitis, panophthalmitis, and keratitis, usually with the characteristic formation of corneal ring abscesses. Even with prompt surgical and antimicrobial agent treatment, enucleation of the eye and blindness are common sequelae. Septicemia, meningitis, endocarditis, osteomyelitis, and surgical and traumatic wound infections are other manifestations of severe disease. B. cereus produces beta-lactamases, unlike Bacillus anthracis, and so is resistant to beta-lactam antibiotics; it is usually susceptible to treatment with clindamycin, vancomycin, gentamicin, chloramphenicol, and erythromycin. Simultaneous therapy via multiple routes may be required.
Ke, Qian; Zhang, Yunge; Wu, Xilin; Su, Xiaomei; Wang, Yuyang; Lin, Hongjun; Mei, Rongwu; Zhang, Yu; Hashmi, Muhammad Zaffar; Chen, Chongjun; Chen, Jianrong
2018-09-15
In this study, high-efficient phenol-degrading bacterium Bacillus sp. SAS19 which was isolated from activated sludge by resuscitation-promoting factor (Rpf) addition, were immobilized on porous carbonaceous gels (CGs) for phenol degradation. The phenol-degrading capabilities of free and immobilized Bacillus sp. SAS19 were evaluated under various initial phenol concentrations. The obtained results showed that phenol could be removed effectively by both free and immobilized Bacillus sp. SAS19. Furthermore, for degradation of phenol at high concentrations, long-term utilization and recycling were more readily achieved for immobilized bacteria as compared to free bacteria. Immobilized bacteria exhibited significant increase in phenol-degrading capabilities in the third cycle of recycling and reuse, which demonstrated 87.2% and 100% of phenol (1600 mg/L) degradation efficiency at 12 and 24 h, respectively. The present study revealed that immobilized Bacillus sp. SAS19 can be potentially used for enhanced treatment of synthetic phenol-laden wastewater. Copyright © 2018 Elsevier Ltd. All rights reserved.
Sohail, Muhammad; Latif, Zakia
2016-01-01
Background: Keeping in mind the commercial application of polygalacturonase (PG) in juice and beverages industry, bacterial strains were isolated from rotten fruits and vegetables to screen for competent producers of PG. Objectives: In this study, the plate method was used for preliminary screening of polygalacturonase-producing bacteria, while the Dinitrosalicylic Acid (DNS) method was used for quantifications of PG. Materials and Methods: Biochemically-identified polygalacturonase-producing Bacillus and Pseudomonas species were further characterized by molecular markers. The genetic diversity among these selected strains was analyzed by investigating microsatellite distribution in their genome. Out of 110 strains, 17 competent strains of Bacillus and eight strains of Pseudomonas were selected, identified and confirmed biochemically. Selected strains were characterized by 16S rRNA sequencing and data was submitted to the national center for biotechnology information (NCBI) website for accession numbers. Results: Among the Bacillus, Bacillus vallismortis (JQ990307) isolated from mango was the most competent producer of PG; producing up to 4.4 U/µL. Amongst Pseudomonas, Pseudomonas aeruginosa (JQ990314) isolated from oranges was the most competent PG producer equivalent to B. vallismortis (JQ990307). To determine genetic diversity of different strains of Pseudomonas and Bacillus varying in PG production, fingerprinting was done on the basis of Simple Sequence Repeats (SSR) or microsatellites. The data was analyzed and a phylogenetic tree was constructed using the Minitab 3 software for comparison of bacterial isolates producing different concentrations of PG. Fingerprinting showed that presence or absence of certain microsatellites correlated with the ability of PG production. Conclusions: Bacteria from biological waste were competent producers of PG and must be used on an industrial scale to cope with the demand of PG in the food industry. PMID:27099686
BOOK REVIEW: BACILLUS THURINGIENSIS: A CORNERSTONE OF MODERN AGRICULTURE
Are you interested in the technical issues surrounding the use of Bacillus thuringiensis pesticidal traits as sprays and as plant incorporated protectants (transgenic crops)? Should the dimensions of human health, ecology, entomology, risk assessment, resistance management, and d...
POROSITY OF ISOLATED CELL WALLS OF SACCHAROMYCES CEREVISIAE AND BACILLUS MEGATERIUM.
GERHARDT, P; JUDGE, J A
1964-04-01
Gerhardt, Philipp (The University of Michigan, Ann Arbor), and Jean A. Judge. Porosity of isolated cell walls of a yeast and a bacillus. J. Bacteriol. 87:945-951. 1964.-Decagram masses of cell walls were isolated from Saccharomyces cerevisiae and Bacillus megaterium; their porosity was examined by measuring the extent of uptake with polyethylene glycols and dextrans varying in molecular weight from 62 to 2,000,000. The results indicated that both walls are heteroporous. The near equality of extrapolated water-uptake values and determined moisture contents suggested that water in the cell walls is mainly free for distribution of solutes. Polymers with molecular weights of 4,500 and above were excluded by the yeast walls, and those with molecular weights of 57,000 were excluded by the bacillus walls; from these results, maximal openings of 36 and 107 A, respectively, were calculated. Electron micrographs of shadowed, stained, and sectioned walls revealed fine structure not inconsistent with heteroporosity, but the predicted openings were not seen. Altogether, in structure and permeability behavior, the cell walls were like a random meshwork of cross-linked macromolecular strands.
Directed evolution improves the fibrinolytic activity of nattokinase from Bacillus natto.
Yongjun, Cai; Wei, Bao; Shujun, Jiang; Meizhi, Weng; Yan, Jia; Yan, Yin; Zhongliang, Zheng; Goulin, Zou
2011-12-01
Nattokinase (subtilisin NAT, NK) is a relatively effective microbial fibrinolytic enzyme that has been identified and characterized from Bacillus natto. In the current report, DNA family shuffling was used to improve the fibrinolytic activity of nattokinase. Three homologous genes from B. natto AS 1.107, Bacillus amyloliquefaciens CICC 20164 and Bacillus licheniformis CICC 10092 were shuffled to generate a mutant library. A plate-based method was used to screen the mutant libraries for improved activity. After three rounds of DNA shuffling, one desirable mutant with 16 amino acid substitutions was obtained. The mutant enzyme was purified and characterized. The kinetic measurements showed that the catalytic efficiency of the mutant NK was approximately 2.3 times higher than that of the wild-type nattokinase. In addition, the molecular modeling analysis suggested that the mutations affect the enzymatic function by changing the surface conformation of the substrate-binding pocket. The current study shows that the evolution of nattokinase with improved fibrinolytic activity by DNA family shuffling is feasible and provides useful references to facilitate the application of nattokinase in thrombolytic therapy. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Development of an Aerosol Surface Inoculation Method for Bacillus Spores ▿
Lee, Sang Don; Ryan, Shawn P.; Snyder, Emily Gibb
2011-01-01
A method was developed to deposit Bacillus subtilis spores via aerosolization onto various surface materials for biological agent decontamination and detection studies. This new method uses an apparatus coupled with a metered dose inhaler to reproducibly deposit spores onto various surfaces. A metered dose inhaler was loaded with Bacillus subtilis spores, a surrogate for Bacillus anthracis. Five different material surfaces (aluminum, galvanized steel, wood, carpet, and painted wallboard paper) were tested using this spore deposition method. This aerosolization method deposited spores at a concentration of more than 107 CFU per coupon (18-mm diameter) with less than a 50% coefficient of variation, showing that the aerosolization method developed in this study can deposit reproducible numbers of spores onto various surface coupons. Scanning electron microscopy was used to probe the spore deposition patterns on test coupons. The deposition patterns observed following aerosol impaction were compared to those of liquid inoculation. A physical difference in the spore deposition patterns was observed to result from the two different methods. The spore deposition method developed in this study will help prepare spore coupons via aerosolization fast and reproducibly for bench top decontamination and detection studies. PMID:21193670
Characterization of Cyt2Bc Toxin from Bacillus thuringiensis subsp. medellin
Juárez-Pérez, Victor; Guerchicoff, Alejandra; Rubinstein, Clara; Delécluse, Armelle
2002-01-01
We cloned and sequenced a new cytolysin gene from Bacillus thuringiensis subsp. medellin. Three IS240-like insertion sequence elements and the previously cloned cyt1Ab and p21 genes were found in the vicinity of the cytolysin gene. The cytolysin gene encodes a protein 29.7 kDa in size that is 91.5% identical to Cyt2Ba from Bacillus thuringiensis subsp. israelensis and has been designated Cyt2Bc. Inclusions containing Cyt2Bc were purified from the crystal-negative strain SPL407 of B. thuringiensis. Cyt2Bc reacted weakly with antibodies directed against Cyt2Ba and was not recognized by an antiserum directed against the reference cytolysin Cyt1Aa. Cyt2Bc was hemolytic only upon activation with trypsin and had only one-third to one-fifth of the activity of Cyt2Ba, depending on the activation time. Cyt2Bc was also mosquitocidal against Aedes aegypti, Anopheles stephensi, and Culex quinquefasciatus, including strains resistant to the Bacillus sphaericus binary toxin. Its toxicity was half of that of Cyt2Ba on all mosquito species except resistant C. quinquefasciatus. PMID:11872472
NASA Astrophysics Data System (ADS)
Vélez-Lee, Angel Eduardo; Cordova-Lozano, Felipe; Bandala, Erick R.; Sanchez-Salas, Jose Luis
2016-02-01
In this work, the vgb gene from Vitrocilla stercoraria was used to genetically modify a Bacillus cereus strain isolated from pulp and paper wastewater effluent. The gene was cloned in a multicopy plasmid (pUB110) or uni-copy gene using a chromosome integrative vector (pTrpBG1). B. cereus and its recombinant strains were used for phenol and p-nitrophenol biodegradation using aerobic or micro-aerobic conditions and two different temperatures (i.e. 37 and 25 °C). Complete (100%) phenol degradation was obtained for the strain where the multicopy of vgb gene was present, 98% for the strain where uni-copy gene was present and 45% for wild type strain for the same experimental conditions (i.e. 37 °C and aerobic condition). For p-nitrophenol degradation at the same conditions, the strain with the multi-copy vgb gene was capable to achieve 50% of biodegradation, ˜100% biodegradation was obtained using the uni-copy strain and ˜24% for wild type strain. When the micro-aerobic condition was tested, the biodegradation yield showed a significant decreased. The biodegradation trend observed for aerobic was similar for micro-aerobic assessments: the modified strains showed higher degradation rates when compared with wild type strain. For all experimental conditions, the highest p-nitrophenol degradation was observed using the strain with uni-copy of vgb gene. Besides the increase of biodegradative capability of the strain, insertion of the vgb gene was observed able to modify other morphological characteristics such as avoiding the typical flake formation in the B. cereus culture. In both cases, the modification seems to be related with the enhancement of oxygen supply to the cells generated by the vgb gene insertion. The application of the genetically modified microorganism (GMM) to the biodegradation of pollutants in contaminated water possesses high potential as an environmentally friendly technology to facing this emergent problem.
Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung
2015-06-01
Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.
[Characteristics of Bacillus cereus dissociants].
Doroshenko, E V; Loĭko, N G; Il'inskaia, O N; Kolpakov, A I; Gornova, I B; Klimanova, E V; El'-Registan, G I
2001-01-01
The autoregulation of the phenotypic (populational) variability of the Bacillus cereus strain 504 was studied. The isolated colonial morphotypes of this bacterium were found to differ in their growth characteristics and the synthesis of extracellular proteases. The phenotypic variabilities of vegetative proliferating cells and those germinated from endospores and cystlike refractory cells were different. Bacterial variants also differed in the production of the d1 and d2 factors (the autoinducers of dormancy and autolysis, respectively) and sensitivity to them. The possible role of these factors in the dissociation of microorganisms is discussed.
Chen, Yonggan; Gu, Fenglin; Li, Jihua; He, Shuzhen; Xu, Fei; Fang, Yiming
2015-08-01
Vanilla beans were analyzed using biochemical methods, which revealed that glucovanillin disperses from the inner part to the outer part of the vanilla bean during the curing process and is simultaneously hydrolyzed by β-d-glucosidase. Enzymatic hydrolysis was found to occur on the surface of the vanilla beans. Transcripts of the β-d-glucosidase gene (bgl) of colonizing microorganisms were detected. The results directly indicate that colonizing microorganisms are involved in glucovanillin hydrolysis. Phylogenetic analysis based on 16S rRNA gene sequences showed that the colonizing microorganisms mainly belonged to the Bacillus genus. bgl was detected in all the isolates and presented clustering similar to that of the isolate taxonomy. Furthermore, inoculation of green fluorescent protein-tagged isolates showed that the Bacillus isolates can colonize vanilla beans. Glucovanillin was metabolized as the sole source of carbon in a culture of the isolates within 24 h. These isolates presented unique glucovanillin degradation capabilities. Vanillin was the major volatile compound in the culture. Other compounds, such as α-cubebene, β-pinene, and guaiacol, were detected in some isolate cultures. Colonizing Bacillus isolates were found to hydrolyze glucovanillin in culture, indirectly demonstrating the involvement of colonizing Bacillus isolates in glucovanillin hydrolysis during the vanilla curing process. Based on these results, we conclude that colonizing Bacillus isolates produce β-d-glucosidase, which mediates glucovanillin hydrolysis and influences flavor formation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Buhr, T L; Young, A A; Barnette, H K; Minter, Z A; Kennihan, N L; Johnson, C A; Bohmke, M D; DePaola, M; Cora-Laó, M; Page, M A
2015-11-01
To develop test methods and evaluate survival of Bacillus anthracis ∆Sterne or Bacillus thuringiensis Al Hakam on materials contaminated with dirty spore preparations after exposure to hot, humid air using response surface modelling. Spores (>7 log10 ) were mixed with humic acid + spent sporulation medium (organic debris) or kaolin (dirt debris). Spore samples were then dried on five different test materials (wiring insulation, aircraft performance coating, anti-skid, polypropylene, and nylon). Inoculated materials were tested with 19 test combinations of temperature (55, 65, 75°C), relative humidity (70, 80, 90%) and time (1, 2, 3 days). The slowest spore inactivation kinetics was on nylon webbing and/or after addition of organic debris. Hot, humid air effectively decontaminates materials contaminated with dirty Bacillus spore preparations; debris and material interactions create complex decontamination kinetic patterns; and B. thuringiensis Al Hakam is a realistic surrogate for B. anthracis. Response surface models of hot, humid air decontamination were developed which may be used to select decontamination parameters for contamination scenarios including aircraft. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.
Zhou, Ziyao; Zhou, Xiaoxiao; Zhong, Zhijun; Wang, Chengdong; Zhang, Hemin; Li, Desheng; He, Tingmei; Li, Caiwu; Liu, Xuehan; Yuan, Hui; Ji, Hanli; Luo, Yongjiu; Gu, Wuyang; Fu, Hualin; Peng, Guangneng
2014-12-01
Bacillus group is a prevalent community of Giant Panda's intestinal flora, and plays a significant role in the field of biological control of pathogens. To understand the diversity of Bacillus group from the Giant Panda intestine and their functions in maintaining the balance of the intestinal microflora of Giant Panda, this study isolated a significant number of strains of Bacillus spp. from the feces of Giant Panda, compared the inhibitory effects of these strains on three common enteric pathogens, investigated the distributions of six universal antimicrobial genes (ituA, hag, tasA, sfp, spaS and mrsA) found within the Bacillus group by PCR, and analyzed the characterization of antimicrobial gene distributions in these strains using statistical methods. The results suggest that 34 strains of Bacillus spp. were isolated which has not previously been detected at such a scale, these Bacillus strains could be classified into five categories as well as an external strain by 16S rRNA; Most of Bacillus strains are able to inhibit enteric pathogens, and the antimicrobial abilities may be correlated to their categories of 16S rRNA; The detection rates of six common antimicrobial genes are between 20.58 %(7/34) and 79.41 %(27/34), and genes distribute in three clusters in these strains. We found that the antimicrobial abilities of Bacillus strains can be one of the mechanisms by which Giant Panda maintains its intestinal microflora balance, and may be correlated to their phylogeny.
Grubbs, Kirk J; Bleich, Rachel M; Santa Maria, Kevin C; Allen, Scott E; Farag, Sherif; Shank, Elizabeth A; Bowers, Albert A
2017-01-01
Bacteria possess an amazing capacity to synthesize a diverse range of structurally complex, bioactive natural products known as specialized (or secondary) metabolites. Many of these specialized metabolites are used as clinical therapeutics, while others have important ecological roles in microbial communities. The biosynthetic gene clusters (BGCs) that generate these metabolites can be identified in bacterial genome sequences using their highly conserved genetic features. We analyzed an unprecedented 1,566 bacterial genomes from Bacillus species and identified nearly 20,000 BGCs. By comparing these BGCs to one another as well as a curated set of known specialized metabolite BGCs, we discovered that the majority of Bacillus natural products are comprised of a small set of highly conserved, well-distributed, known natural product compounds. Most of these metabolites have important roles influencing the physiology and development of Bacillus species. We identified, in addition to these characterized compounds, many unique, weakly conserved BGCs scattered across the genus that are predicted to encode unknown natural products. Many of these "singleton" BGCs appear to have been acquired via horizontal gene transfer. Based on this large-scale characterization of metabolite production in the Bacilli , we go on to connect the alkylpyrones, natural products that are highly conserved but previously biologically uncharacterized, to a role in Bacillus physiology: inhibiting spore development. IMPORTANCE Bacilli are capable of producing a diverse array of specialized metabolites, many of which have gained attention for their roles as signals that affect bacterial physiology and development. Up to this point, however, the Bacillus genus's metabolic capacity has been underexplored. We undertook a deep genomic analysis of 1,566 Bacillus genomes to understand the full spectrum of metabolites that this bacterial group can make. We discovered that the majority of the specialized
Gustafsson, Tomas N; Osman, Harer; Werngren, Jim; Hoffner, Sven; Engman, Lars; Holmgren, Arne
2016-06-01
Bacillus anthracis is the causative agent of anthrax, a disease associated with a very high mortality rate in its invasive forms. We studied a number of ebselen analogs as inhibitors of B. anthracis thioredoxin reductase and their antibacterial activity on Bacillus subtilis, Staphylococcus aureus, Bacillus cereus and Mycobacterium tuberculosis. The most potent compounds in the series gave IC(50) values down to 70 nM for the pure enzyme and minimal inhibitory concentrations (MICs) down to 0.4 μM (0.12 μg/ml) for B. subtilis, 1.5 μM (0.64 μg/ml) for S. aureus, 2 μM (0.86 μg/ml) for B. cereus and 10 μg/ml for M. tuberculosis. Minimal bactericidal concentrations (MBCs) were found at 1-1.5 times the MIC, indicating a general, class-dependent, bactericidal mode of action. The combined bacteriological and enzymological data were used to construct a preliminary structure-activity-relationship for the benzoisoselenazol class of compounds. When S. aureus and B. subtilis were exposed to ebselen, we were unable to isolate resistant mutants on both solid and in liquid medium suggesting a high resistance barrier. These results suggest that ebselen and analogs thereof could be developed into a novel antibiotic class, useful for the treatment of infections caused by B. anthracis, S. aureus, M. tuberculosis and other clinically important bacteria. Furthermore, the high barrier against resistance development is encouraging for further drug development. We have characterized the thioredoxin system from B. anthracis as a novel drug target and ebselen and analogs thereof as a potential new class of antibiotics targeting several important human pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.
Heme inhibition of ferrisiderophore reductase in Bacillus subtilis.
Lodge, J S; Gaines, C G; Arceneaux, J E; Byers, B R
1982-11-01
Heme was a noncompetitive inhibitor (apparent K(i) and K'(i) = 0.043 mM) of a ferrisiderophore reductase purified from Bacillus subtilis; protoporphyrin IX had no effect. The cellular level of heme may partly regulate the function of this reductase to yield a controlled flow of iron into metabolism.
Moura, M C; Trentin, D S; Napoleão, T H; Primon-Barros, M; Xavier, A S; Carneiro, N P; Paiva, P M G; Macedo, A J; Coelho, L C B B
2017-10-01
To evaluate the antibiofilm potential of water-soluble Moringa oleifera seed lectin (WSMoL) on Serratia marcescens and Bacillus sp. WSMoL inhibited biofilm formation by S. marcescens at concentrations lower than 2·6 μg ml -1 and impaired bacterial growth at higher concentrations, avoiding biofilm formation. For Bacillus sp., the lectin inhibited bacterial growth at all concentrations. The antibiofilm action of WSMoL is associated with damage to bacterial cells. WSMoL did not disrupt preformed S. marcescens biofilms but was able to damage cells inside them. On the other hand, the lectin reduced the number of cells in Bacillus sp. biofilm treated with it. WSMoL was able to control biofilm formation when immobilized on glass surface (116 μg cm -2 ), damaging S. marcescens cells and avoiding adherence of Bacillus sp. cells on glass. The Bacillus sp. isolate is member of Bacillus subtilis species complex and closely related to species of the conspecific 'amyloliquefaciens' group. WSMoL prevented biofilm development by S. marcescens and Bacillus sp. and the antibiofilm effect is also observed when the lectin is immobilized on glass. Taking together, our results provide support to the potential use of WSMoL for controlling biofilm formation by bacteria. © 2017 The Society for Applied Microbiology.
[The medical treatment of Kim Phúc at the BG Unfallklinik Ludwigshafen].
Kiefer, J; Daigeler, A; Lehnhardt, M
2012-08-01
The Vietnam War was a military conflict in Vietnam during the Cold War that followed the First Indochina War. This war was fought between North Vietnam, supported by its communist allies, and the government of South Vietnam, supported by the USA and other anti-communist countries. Kim Phúc is the child depicted in the Pulitzer Prize winning photograph taken on June 8, 1972 by AP photographer Nick Út. The iconic photo shows her at about nine years of age running naked on a road amid the chaos after being severely burned by a napalm attack. After 14 months of hospital stay and 17 surgical procedures Kim Phúc was able to return home. Since then, she was used as a propaganda symbol by the communist government of Vietnam. To continue her studies, Kim was granted permission to move to Cuba where she met her future husband. However, the sequelae of her burn wounds affected her everyday life enormously. In 1984, with the support of the international aid organization "terre des hommes" and the German magazine "STERN", Kim Phúc got the opportunity to meet and get treated by Professor Zellner. Professor Peter Rudolph Zellner was the first chief of the Department of Hand, Plastic and Reconstructive Surgery, Burn Center, BG Trauma Center Ludwigshafen, and one of the founder members of the German Society of Plastic Surgeons. The reconstructive surgeries provide Kim Phúc an almost normal life. Later on, she was involved in international aid organizations; she was named a UNESCO Goodwill Ambassador and she was awarded several honorary Doctorates of Law. Kim Phúc became a Canadian citizen. Today, she lives with her husband and two children in Ontario, Canada. © Georg Thieme Verlag KG Stuttgart · New York.
Algicidal activity of Bacillus sp. Lzh-5 and its algicidal compounds against Microcystis aeruginosa.
Li, Zhenghua; Geng, Mengxin; Yang, Hong
2015-01-01
A freshwater algicidal bacterial strain, Lzh-5, isolated from Lake Taihu, with strong algicidal activity against Microcystis aeruginosa, was identified as Bacillus sp. based on its phenotypic characteristics and 16S ribosomal RNA (rRNA) gene sequence. The algicidal mode of Bacillus sp. Lzh-5 was indirect, attacking M. aeruginosa cells by releasing algicidal compounds. Two algicidal compounds (S-5A and S-5B) produced by Bacillus sp. Lzh-5 were purified with ethyl acetate extraction, column chromatography, and high-performance liquid chromatography and identified as hexahydropyrrolo[1,2-a]pyrazine-1,4-dione and 3-isopropyl-hexahydropyrrolo[1,2-a]pyrazine-1,4-dione based on liquid chromatography-mass spectrometry, gas chromatography-mass spectrometry, and nuclear magnetic resonance analyses. The active algicidal compounds S-5A (hexahydropyrrolo[1,2-a]pyrazine-1,4-dione) and S-5B (3-isopropyl-hexahydropyrrolo[1,2-a]pyrazine-1,4-dione) displayed high levels of algicidal activity against M. aeruginosa 9110, with LD50 values of 5.7 and 19.4 μg/ml, respectively. This is the first report of 3-isopropyl-hexahydropyrrolo[1,2-a]pyrazine-1,4-dione as an algicidal compound. Compounds S-5A and S-5B also induced obvious morphological changes in M. aeruginosa 9110. In cocultures of M. aeruginosa 9110 and Bacillus sp. Lzh-5, the cell density of Bacillus sp. Lzh-5 and the concentrations of S-5A and S-5B correlated positively with the algicidal activity. Our results indicate that strain Lzh-5 and its two algicidal compounds are potentially useful for controlling cyanobacterial blooms in Lake Taihu.
Parellada, Eduardo A; Igarza, Mercedes; Isacc, Paula; Bardón, Alicia; Ferrero, Marcela; Ameta, Keshav Lalit; Neske, Adriana
Squamocin belongs to a group of compounds called annonaceous acetogenins. They are secondary products of Annonaceae metabolism and can be isolated from Annona cherimolia seeds. This paper deals with the stimulation of biofilm formation of Bacillus atrophaeus CN4 by employing low squamocin concentrations to increase naphthalene degradation. Bacillus atrophaeus CN4, isolated from contaminated soil, has the ability to degrade naphthalene as the only source of carbon and energy. In the absence of additional carbon sources, the strain removed 69% of the initial concentration of naphthalene (approx. 0.2mmol/l) in the first 12h of incubation. The addition of squamocin in LB medium stimulated Bacillus atrophaeus CN4 biofilm formation and enhanced naphthalene removal. Squamocin (2.5μg/ml) does not affect planktonic growth and therefore, the observed increases are solely due to the stimulation of biofilm formation. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Genetic diversity of Bacillus sp producers of amylase isolated from the soil.
Xavier, A R E O; Lima, E R; Oliveira, A M E; Cardoso, L; Santos, J; Cangussu, C H C; Leite, L N; Quirino, M C L; Júnior, I G C; Oliveira, D A; Xavier, M A S
2017-09-27
The microorganisms are the best source of extracellular enzymes since they allow an economical technology with low-resource consumption compared to animals and plants. The amylases are among the most important enzymes being the genus Bacillus one of the most investigated due to its ability to produce this enzyme. The objective of this study was to isolate and analyze the genetic diversity among bacteria of the genus Bacillus sp producer of amylase originated from the soil. To this end, soil samples were collected and submitted to the condition of extreme temperature. The serial dilution procedure followed by seeding on solid medium containing starch was used for isolation of strains that produce amylase. The microorganisms isolated were subjected to standard morphological methods for presumptive identification of the genus Bacillus. The PCR assay with the universal genetic marker 16S rDNA was used for confirmation of bacterial strain. All the 10 isolates presumptively identified as bacteria amplified a fragment of 370 bp corresponding to the 16S rDNA gene. The enzymatic activity was expressed as an enzymatic index (EI), after 24 h of incubation. All isolate producers of amylase exhibited EI ≥ 2.0. The determination of the genetic profile and the clonal relationship among the isolates were performed by the method of ERIC-PCR polymorphism. The isolates of Bacillus spp were divided into 2 groups (I and II). Through this method, the discriminatory capacity of this analysis of polymorphisms was verified in differing producer strains from those not producing amylase.
USDA-ARS?s Scientific Manuscript database
Transgenic crops containing pyramid-stacked genes for Bacillus thuringiensis derived toxins for controlling coleopteran and lepidopteran pests are increasingly common. As part of environmental risk assessments, these crops are evaluated for toxicity against non-target organisms, and for their poten...
Rowan, Neil J.; Deans, Karen; Anderson, John G.; Gemmell, Curtis G.; Hunter, Iain S.; Chaithong, Thararat
2001-01-01
Forty-seven strains representing 14 different Bacillus species isolated from clinical and food samples were grown in reconstituted infant milk formulae (IMF) and subsequently assessed for adherence to, invasion of, and cytotoxicity toward HEp-2 and Caco-2 cells. Cell-free supernatant fluids from 38 strains (81%) were shown to be cytotoxic, 43 strains (91%) adhered to the test cell lines, and 23 strains (49%) demonstrated various levels of invasion. Of the 21 Bacillus cereus strains examined, 5 (24%) were invasive. A larger percentage of clinically derived Bacillus species (20%) than of similar species tested from the food environment were invasive. Increased invasion occurred after growth of selected Bacillus species in reconstituted IMF containing glucose. While PCR primer studies revealed that many different Bacillus species contained DNA sequences encoding the hemolysin BL (HBL) enterotoxin complex and B. cereus enterotoxin T, not all of these isolates expressed these diarrheagenic genes after growth in reconstituted IMF. Of the 47 Bacillus isolates examined, 3 isolates of B. cereus and 1 isolate of B. subtilis produced the HBL enterotoxin after 18 h of growth in brain heart infusion broth. However, eight isolates belonging to the species B. cereus, B. licheniformis, B. circulans, and B. megaterium were found to produce this enterotoxin after growth in reconstituted IMF when assessed with the B. cereus enterotoxin (diarrheal type) reversed passive latex agglutination (RPLA) kit. It is concluded that several Bacillus species occurring occasionally in clinical specimens and food samples are of potential medical significance due to the expression of putative virulence factors. PMID:11525980
USDA-ARS?s Scientific Manuscript database
This study was aimed at assessing the potential of allochthonous Bacillus sp. SKK11 and sesame oil cake extract for transformation of Pb in mine soil. The bacteria were isolated from a brackish environment and identified as Bacillus sp. based on partial 16S rDNA sequences. The isolate SKK11 exhibite...
From Genome to Function: Systematic Analysis of the Soil Bacterium Bacillus Subtilis
Crawshaw, Samuel G.; Wipat, Anil
2001-01-01
Bacillus subtilis is a sporulating Gram-positive bacterium that lives primarily in the soil and associated water sources. Whilst this bacterium has been studied extensively in the laboratory, relatively few studies have been undertaken to study its activity in natural environments. The publication of the B. subtilis genome sequence and subsequent systematic functional analysis programme have provided an opportunity to develop tools for analysing the role and expression of Bacillus genes in situ. In this paper we discuss analytical approaches that are being developed to relate genes to function in environments such as the rhizosphere. PMID:18628943
Ouoba, L I I; Parkouda, C; Diawara, B; Scotti, C; Varnam, A H
2008-01-01
To identify Bacillus spp. responsible of the fermentation of Hibiscus sabdariffa for production of Bikalga, an alkaline fermented food used as a condiment in Burkina Faso. Seventy bacteria were isolated from Bikalga produced in different regions of Burkina Faso and identified by phenotyping and genotyping using PCR amplification of the 16S-23S rDNA intergenic transcribed spacer (ITS-PCR), repetitive sequence-based PCR (rep-PCR) and DNA sequencing. The isolates were characterized as motile, rod-shaped, endospore forming, catalase positive, Gram-positive bacteria. ITS-PCR allowed typing mainly at species level. Rep-PCR was more discriminative and allowed a typing at ssp. level. The DNA sequencing combined with the Blast search program and fermentation profiles using API 50CHB system allowed an identification of the bacteria as Bacillus subtilis, B. licheniformis, B. cereus, B. pumilus, B. badius, Brevibacillus bortelensis, B. sphaericus and B. fusiformis. B. subtilis were the predominant bacterium (42) followed by B. licheniformis (16). Various species and ssp. of Bacillus are involved in fermentation of H. sabdariffa for production of Bikalga. Selection of starter cultures of Bacillus for controlled production of Bikalga, selection of probiotic bacteria.
NASA Astrophysics Data System (ADS)
Yopi, Rahmani, Nanik; Jannah, Alifah Mafatikhul; Nugraha, Irfan Pebi; Ramadana, Roni Masri
2017-11-01
Endo-β-1, 4-mannanase is the key enzymes for randomly hydrolyzing the β-1,4-linkages within the mannan backbone releasing manno-oligosaccharides (MOS). A marine bacterium of Bacillus subtilis LBF-005 was reported have ability to produce endo-type mannanase. The aims of this research were to compare commercial biomass Locust Bean Gum (LBG) and raw biomass contaning mannan as carbon source for mannanase production from Bacillus subtilis LBF-005, to analyze the optimum condition of mannanase production, and to find out the potential of the mannanase for MOS production. Bacillus subtilis LBF-005 was cultivated in Artificial Sea Water (ASW) medium contain NaCl and various mannan biomass as carbon source for mannanase production. The cells were grown in submerged fermentation. The maximum enzyme activity was obtained with porang potato as a substrate with concentration 1%, pH medium 8, and incubation temperature 50°C with an enzyme activity of 37.7 U/mL. The mainly MOS product released by crude mannanase produced by Bacillus subtilis LBF-005 were mannobiose (M2), mannotriose (M3), mannotetraose (M4), and mannopentaose (M5).
Heinze, Simon; Kornberger, Petra; Grätz, Christian; Schwarz, Wolfgang H; Zverlov, Vladimir V; Liebl, Wolfgang
2018-06-08
The genus Bacillus includes a great variety of species with potential applications in biotechnology. While species such as B. subtilis or B. licheniformis are well-known and used to provide various products at industrial scale, other Bacillus species are less characterized and are not yet used in commercial processes. One reason for this is the fact that genetic manipulation of new isolates is usually complicated with conventional techniques which have to be adapted to each new strain. Even in well-established strains, the available transformation protocols often suffer from low efficiencies. In this paper, we provide a new broad host range E. coli/Bacillus shuttle vector, named pBACOV (Bacillus conjugation vector), that can be efficiently transferred to various Bacillus species using a single protocol. A variant of pBACOV carrying the sfGFP gene was successfully transferred to eight different species from the genus Bacillus and to one Paenibacillus species using triparental conjugation ("transmating"). This was achieved using a single protocol and worked for nine out of eleven tested acceptor species. The transmating procedure was used to test expression of the heterologous reporter gene sfGFP under control of the P aprE -promoter from B. subtilis in several Bacillus species in parallel. Expression of sfGFP was found in eight out of nine transmates. For several of the tested species, this is the first report of a method for genetic modification and heterologous gene expression. The expression level, analyzed by measuring the relative sfGFP-fluorescence normalized to the cell density of the cultures, was highest in B. mojavensis. The new shuttle vector pBACOV can be transferred to many different Bacillus and Paenibacillus species using a simple and efficient transmating protocol. It is a versatile tool facilitating the application of recombinant DNA technology in new as well as established strains, or selection of an ideal host for heterologous gene expression from
Geraskina, Natalia V; Butov, Ivan A; Yomantas, Yurgis A V; Stoynova, Nataliya V
2015-02-01
Genetically engineered microbes are of high practical importance due to their cost-effective production of valuable metabolites and enzymes, and the search for new selectable markers for genetic manipulation is of particular interest. Here, we revealed that the soil bacterium Bacillus amyloliquefaciens A50 is tolerant to the non-canonical amino acid D-tyrosine (D-Tyr), in contrast to the closely related Bacillus strain B. subtilis 168, which is a widely used "domesticated" laboratory strain. The gene responsible for resistance to D-Tyr was identified. The resistance was associated with the activity of a potential D-tyrosyl-tRNA(Tyr) deacylase. Orthologs of this enzyme are capable of hydrolyzing the ester bond and recycling misacetylated D-aminoacyl-tRNA molecules into free tRNAs and D-amino acids. This gene, yrvI (dtd), is applicable as a convenient, small selectable marker for non-antibiotic resistance selection in experiments aimed at genome editing of D-Tyr-sensitive microorganisms. Copyright © 2014 Elsevier GmbH. All rights reserved.
Endotrophic Calcium, Strontium, and Barium Spores of Bacillus megaterium and Bacillus cereus1
Foerster, Harold F.; Foster, J. W.
1966-01-01
Foerster, Harold F. (The University of Texas, Austin), and J. W. Foster. Endotrophic calcium, strontium, and barium spores of Bacillus megaterium and Bacillus cereus. J. Bacteriol. 91:1333–1345. 1966.—Spores were produced by washed vegetative cells suspended in deionized water supplemented with CaCl2, SrCl2, or BaCl2. Normal, refractile spores were produced in each case; a portion of the barium spores lost refractility and darkened. Thin-section electron micrographs revealed no apparent anatomical differences among the three types of spores. Analyses revealed that the different spore types were enriched specifically in the metal to which they were exposed during sporogenesis. The calcium content of the strontium and the barium spores was very small. From binary equimolar mixtures of the metal salts, endotrophic spores accumulated both metals to nearly the same extent. Viability of the barium spores was considerably less than that of the other two types. Strontium and barium spores were heat-resistant; however, calcium was essential for maximal heat resistance. Significant differences existed in the rates of germination; calcium spores germinated fastest, strontium spores were slower, and barium spores were slowest. Calcium-barium and calcium-strontium spores germinated readily. Endotrophic calcium and strontium spores germinated without the prior heat activation essential for growth spores. Chemical germination of the different metal-type spores with n-dodecylamine took place at the same relative rates as physiological germination. Heat-induced release of dipicolinic acid occurred much faster with barium and strontium spores than with calcium spores. The washed “coat fraction” from disrupted spores contained little of the spore calcium but most of the spore barium. The metal in this fraction was released by dilute acid. The demineralized coats reabsorbed calcium and barium at neutral pH. Images PMID:4956334
Ugwuanyi, J Obeta; Harvey, L M; McNeil, B
2007-01-01
Thermophilic Bacillus spp. isolated from thermophilic aerobic digestion (TAD) of model agricultural slurry were screened for ability to secret linamarase activity and degrade linamarin, a cyanogenic glycoside toxin abundant in cassava. Screening was performed by both linamarin - picrate assay and by p-nitrophenyl beta-D-glucoside (PNPG) degradation, and results of both assays were related. Linamarase positive isolates were identified as Bacillus coagulans, Bacillus licheniformis and Bacillus stearothermophilus. Enzyme production was growth related and peak production was reached in 48 h in B. coagulans and 36 h in B. stearothermophilus. B. coagulans produced over 40 times greater activity than B. stearothermophilus. Enzyme productivity in shake flask was not strictly related to screening assay result. Crude enzyme of B. coagulans was optimally active at 75 degrees C while that of B. stearothermophilus was optimally active at 80 degrees C and both had optimum activity at pH 8.0. The thermophilic and neutrophilic- to marginally alkaline activity of the crude enzymes could be very useful in the detoxification and reprocessing of cyanogens containing cassava wastes by TAD for use in animal nutrition.
Screen for agents that induce autolysis in Bacillus subtilis.
Lacriola, Christopher J; Falk, Shaun P; Weisblum, Bernard
2013-01-01
The growing prevalence of antibiotic-resistant infections underscores the need to discover new antibiotics and to use them with maximum effectiveness. In response to these needs, we describe a screening protocol for the discovery of autolysis-inducing agents that uses two Bacillus subtilis reporter strains, SH-536 and BAU-102. To screen chemical libraries, autolysis-inducing agents were first identified with a BAU-102-based screen and then subdivided with SH-536 into two major groups: those that induce autolysis by their direct action on the cell membrane and those that induce autolysis secondary to inhibition of cell wall synthesis. SH-536 distinguishes between the two groups of autolysis-inducing agents by synthesizing and then releasing β-galactosidase (β-Gal) in late stationary phase at a time that cells have nearly stopped growing and are therefore tolerant of cell wall synthesis inhibitors. Four hits, named compound 2, compound 3, compound 5, and compound 24, obtained previously as inducers of autolysis by screening a 10,080-compound discovery library with BAU-102, were probed with SH-536 and found to release β-Gal, indicating that their mode of action was to permeabilize the B. subtilis cell membrane. The four primary hits inhibited growth in Staphylococcus aureus, Enterococcus faecium, Bacillus subtilis, and Bacillus anthracis, with MICs in the 12.5- to 25-μg/ml (20 to 60 μM) range. The four primary hits were further used to probe B. subtilis, and their action was partially characterized with respect to the dependence of induced autolysis on specific autolysins.
Screen for Agents That Induce Autolysis in Bacillus subtilis
Lacriola, Christopher J.; Falk, Shaun P.
2013-01-01
The growing prevalence of antibiotic-resistant infections underscores the need to discover new antibiotics and to use them with maximum effectiveness. In response to these needs, we describe a screening protocol for the discovery of autolysis-inducing agents that uses two Bacillus subtilis reporter strains, SH-536 and BAU-102. To screen chemical libraries, autolysis-inducing agents were first identified with a BAU-102-based screen and then subdivided with SH-536 into two major groups: those that induce autolysis by their direct action on the cell membrane and those that induce autolysis secondary to inhibition of cell wall synthesis. SH-536 distinguishes between the two groups of autolysis-inducing agents by synthesizing and then releasing β-galactosidase (β-Gal) in late stationary phase at a time that cells have nearly stopped growing and are therefore tolerant of cell wall synthesis inhibitors. Four hits, named compound 2, compound 3, compound 5, and compound 24, obtained previously as inducers of autolysis by screening a 10,080-compound discovery library with BAU-102, were probed with SH-536 and found to release β-Gal, indicating that their mode of action was to permeabilize the B. subtilis cell membrane. The four primary hits inhibited growth in Staphylococcus aureus, Enterococcus faecium, Bacillus subtilis, and Bacillus anthracis, with MICs in the 12.5- to 25-μg/ml (20 to 60 μM) range. The four primary hits were further used to probe B. subtilis, and their action was partially characterized with respect to the dependence of induced autolysis on specific autolysins. PMID:23089762
Novel Routes for Improving Biocontrol Activity of Bacillus Based Bioinoculants
Wu, Liming; Wu, Hui-Jun; Qiao, Junqing; Gao, Xuewen; Borriss, Rainer
2015-01-01
Biocontrol (BC) formulations prepared from plant-growth-promoting bacteria are increasingly applied in sustainable agriculture. Especially inoculants prepared from endospore-forming Bacillus strains have been proven as efficient and environmental-friendly alternative to chemical pesticides due to their long shelf life, which is comparable with that of agrochemicals. However, these formulations of the first generation are sometimes hampered in their action and do not fulfill in each case the expectations of the appliers. In this review we use the well-known plant-associated Bacillus amyloliquefaciens type strain FZB42 as example for the successful application of different techniques offered today by comparative, evolutionary and functional genomics, site-directed mutagenesis and strain construction including marker removal, for paving the way for preparing a novel generation of BC agents. PMID:26696998
Al-Holy, Murad A; Lin, Mengshi; Alhaj, Omar A; Abu-Goush, Mahmoud H
2015-02-01
Alicyclobacillus is a causative agent of spoilage in pasteurized and heat-treated apple juice products. Differentiating between this genus and the closely related Bacillus is crucially important. In this study, Fourier transform infrared spectroscopy (FT-IR) was used to identify and discriminate between 4 Alicyclobacillus strains and 4 Bacillus isolates inoculated individually into apple juice. Loading plots over the range of 1350 and 1700 cm(-1) reflected the most distinctive biochemical features of Bacillus and Alicyclobacillus. Multivariate statistical methods (for example, principal component analysis and soft independent modeling of class analogy) were used to analyze the spectral data. Distinctive separation of spectral samples was observed. This study demonstrates that FT-IR spectroscopy in combination with multivariate analysis could serve as a rapid and effective tool for fruit juice industry to differentiate between Bacillus and Alicyclobacillus and to distinguish between species belonging to these 2 genera. © 2015 Institute of Food Technologists®
Yadav, Neerja; Gupta, Munishwar Nath; Khare, Sunil K
2017-10-01
In the present study, a halophilic Bacillus subtilis subsp. spizizenii (NCBI GenBank accession number KX109607) was isolated from the Sambhar Salt Lake, Rajasthan India. This organism exhibited significance antibacterial and antifungal activity against Proteus vulgaris, Bacillus subtilis, Aspergillus niger, Rhizopus oligosporus and Penicillium chrysogenum respectively. The bioactive constituent responsible for it was extracted by three phase partitioning and purified by column chromatography. The purified compound was further characterized by FTIR-ATR, NMR and Mass spectrometry. The mass spectra show a molecular ion of m/z 301.14. The compound has very high antimicrobial activity showing 35mm zone of inhibition against Bacillus subtilis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Environmental and Biofilm-dependent Changes in a Bacillus cereus Secondary Cell Wall Polysaccharide*
Candela, Thomas; Maes, Emmanuel; Garénaux, Estelle; Rombouts, Yoann; Krzewinski, Frédéric; Gohar, Michel; Guérardel, Yann
2011-01-01
Bacterial species from the Bacillus genus, including Bacillus cereus and Bacillus anthracis, synthesize secondary cell wall polymers (SCWP) covalently associated to the peptidoglycan through a phospho-diester linkage. Although such components were observed in a wide panel of B. cereus and B. anthracis strains, the effect of culture conditions or of bacterial growth state on their synthesis has never been addressed. Herein we show that B. cereus ATCC 14579 can synthesize not only one, as previously reported, but two structurally unrelated secondary cell wall polymers (SCWP) polysaccharides. The first of these SCWP, →4)[GlcNAc(β1–3)]GlcNAc(β1–6)[Glc(β1-3)][ManNAc(α1–4)]GalNAc(α1–4)ManNAc(β1→, although presenting an original sequence, fits to the already described the canonical sequence motif of SCWP. In contrast, the second polysaccharide was made up by a totally original sequence, →6)Gal(α1–2)(2-R-hydroxyglutar-5-ylamido)Fuc2NAc4N(α1-6)GlcNAc(β1→, which no equivalent has ever been identified in the Bacillus genus. In addition, we established that the syntheses of these two polysaccharides were differently regulated. The first one is constantly expressed at the surface of the bacteria, whereas the expression of the second is tightly regulated by culture conditions and growth states, planktonic, or biofilm. PMID:21784857
Biocontrol of Botrytis cinerea and Calonectria gracilis by eucalypts growth promoters Bacillus spp.
Paz, Isabel Cristina Padula; Santin, Rita de Cássia Madail; Guimarães, Alexandre Martins; Rosa, Osmar Paulo Pereira da; Quecine, Maria Carolina; Silva, Michele de Cássia Pereira E; Azevedo, João Lúcio; Matsumura, Aida Terezinha Santos
2018-05-17
The clonal Eucalyptus plants are commonly obtained by vegetative propagation under a protected environment. This system improves the Botrytis cinerea and Calonectria spp infection on the young eucalypts plantings, resulting gray mold and cutting rot respectively. Currently, the unique available control method is based on chemicals. As alternative, novel methods to manage plant diseases, endophytic microorganisms could be an interesting alternative. Thus, we aimed to evaluate endophytic Bacillus isolated from eucalypts as a biocontrol agent against Botrytis cinerea and Calonectria gracilis, important fungal pathogens in the greenhouse, using clonal plantlets of E. urograndis. Eight endophytic strains of Bacillus, previously described as eucalyptus growth promoters, were evaluated in vitro and in vivo against Botrytis cinerea and Calonectria gracilis. The diffusible metabolites assay showed the potential of endophytic Bacillus to decrease the growth of both pathogens. Differences in the susceptibility of the pathogens to bacterial volatile metabolites were observed, B. cinerea showed more susceptible than Calonectria gracilis. In vivo assays, Bacillus amyloliquefaciens EUCB 10 demonstrated better overall reductions in these diseases. Based on the results obtained from the in vitro and in vivo analyses, we suggest that the endophytic B. amyloliquefaciens strain EUCB 10 constitutes a promising biocontrol agent against B. cinerea and Calonectria gracilis. Furthermore, this is the first reporting of B. amyloliquefaciens previously describe as plant growth promoter and also as potential control agent of B. cinerea and Calonectria gracilis to eucalyptus. Copyright © 2018 Elsevier Ltd. All rights reserved.
Bacillus thuringeniensis: potential for management of emerald ash borer
Leah S. Bauer; Donald Dean; Jo Handelsman
2006-01-01
The active ingredients of microbial insecticides are live microorganisms pathogenic to certain insects. One such insect pathogen is Bacillus thuringiensis (Bt), a bacterium found naturally in soil, on leaves, in places were insects are abundant (such as grain silos and insectaries), and in infected insects.
Bacteriocin-like inhibitor substances produced by Mexican strains of Bacillus thuringiensis.
Barboza-Corona, J Eleazar; Vázquez-Acosta, Herminia; Bideshi, Dennis K; Salcedo-Hernández, Rubén
2007-02-01
Bacteriocins are antimicrobial peptides synthesized and secreted by bacteria and could potentially be used as natural food preservatives. Here, we report the production of bacteriocin-like inhibitor substances (Bt-BLIS) by five Mexican strains of Bacillus thuringiensis. Bacillus thuringiensis subsp. morrisoni (LBIT 269), B. thuringiensis subsp. kurstaki (LBIT 287), B. thuringiensis subsp kenyae (LBIT 404), B. thuringiensis subsp. entomocidus (LBIT 420) and B. thuringiensis subsp. tolworthi (LBIT 524) produced proteinaceous Bt-BLIS with high levels of activity against Bacillus cereus and other gram-positive bacteria. Although none was active against the gram-negative bacteria, Escherichia coli, Shigella species and Pseudomonas aeruginosa, the five Bt-BLIS demonstrated antimicrobial activity against Vibrio cholerae, the etiologic agent of cholera. Biochemical and biophysical studies demonstrated that the five Bt-BLIS could be categorized into two groups, those produced by LBIT 269 and 287 (Group A) and LBIT 404, 420, 524 (Group B), based on relative time of peptide synthesis, distinctive bacterial target specificity and stability in a wide range of temperatures and pH. Because of their stability and bactericidal activities against B. cereus and V. cholerae agents of emetic, diarrheal and lethal syndromes in humans, these Bt-BLIS could potentially be used as biodegradable preservatives in the food industry.
Öztopuz, Özlem; Pekin, Gülseren; Park, Ro Dong; Eltem, Rengin
2018-05-03
Bacillus is an antagonistic bacteria that shows high effectiveness against different phytopathogenic fungi and produces various lytic enzymes, such as chitosanase, chitinase, protease, and gluconase. The aim of this study is to determine Bacillus spp. for lytic enzyme production and to evaluate the antifungal effects of the selected strains for biocontrol of mycotoxigenic and phytopathogenic fungi. A total of 92 endospore-forming bacterial isolates from the 24 fig orchard soil samples were screened for chitosanase production, and six best chitosanolytic isolates were selected to determine chitinase, protease, and N-acetyl-β-hexosaminidase activity and molecularly identified. The antagonistic activities of six Bacillus strains against Aspergillus niger EGE-K-213, Aspergillus foetidus EGE-K-211, Aspergillus ochraceus EGE-K-217, and Fusarium solani KCTC 6328 were evaluated. Fungal spore germination inhibition and biomass inhibition activities were also measured against A. niger EGE-K-213. The results demonstrated that Bacillus mojavensis EGE-B-5.2i and Bacillus thuringiensis EGE-B-14.1i were more efficient antifungal agents against A. niger EGE-K-213. B. mojavensis EGE-B-5.2i has shown maximum inhibition of the biomass (30.4%), and B. thuringiensis EGE-B-14.1i has shown maximum inhibition of spore germination (33.1%) at 12 h. This is the first study reporting the potential of antagonist Bacillus strains as biocontrol agents against mycotoxigenic fungi of fig orchads.
Diversity among French Bacillus anthracis isolates.
Fouet, Agnès; Smith, Kimothy L; Keys, Chris; Vaissaire, Josée; Le Doujet, Claudine; Lévy, Martine; Mock, Michèle; Keim, Paul
2002-12-01
While outbreaks of animal anthrax zoonoses still regularly occur in France, little is known about the epidemiology links between them. We have used the eight-locus multilocus variable-number tandem repeat analysis typing technique against a collection of 50 Bacillus anthracis isolates from France. There were eight distinct genotypes belonging to two dissimilar genetic clusters. Regional strain patterns were observed, with the B2 genotypes prevalent in southern France and the A1a genotypes found only in northern France.
Kim, Ji Seong; Lee, Jeong Eun; Nie, Hualin; Lee, Yong Jae; Kim, Sun Tae; Kim, Sun-Hyung
2018-02-01
In this study, the effects of the plant growth-promoting rhizobacterium (PGPR), Bacillus sp. JS on the growth of tobacco (Nicotiana tabacum 'Xanthi') and lettuce (Lactuca sativa 'Crispa'), were evaluated by comparing various growth parameters between plants treated with the bacterium and those exposed to water or nutrient broth as control. In both tobacco and lettuce, fresh weight and length of shoots were increased upon exposure to Bacillus sp. JS. To explain the overall de novo expression of plant proteins by bacterial volatiles, two-dimensional gel electrophoresis was performed on samples from PGPR-treated tobacco plants. Our results showed that chlorophyll a/b binding proteins were significantly up-regulated, and total chlorophyll content was also increased. Our findings indicate the potential benefits of using Bacillus sp. JS as a growth-promoting factor in agricultural practice, and highlight the need for further research to explore these benefits.
Saggu, Sandeep Kaur; Mishra, Prakash Chandra
2017-01-01
Proteases are one of the largest groups of hydrolytic enzymes constituting about 60% of total worldwide sales of industrial enzymes due to their wide applications in detergent, leather, textile, food and pharmaceutical industry. Microbial proteases have been preferred over animal and plant proteases because of their fundamental features and ease in production. Bacillus infantis SKS1, an alkaline protease producing bacteria has been isolated from garden soil of north India and identified using morphological, biochemical and molecular methods. 16S rDNA sequence amplified using universal primers has 99% sequence identity with corresponding gene sequence of Bacillus infantis strain FM 34 and Bacillus sp. Beige. The bacterial culture and its 16S rDNA gene sequence have been deposited to Microbial Culture Collection (Pune, India) with accession number MCC 3035 and GenBank with accession number KR092197 respectively. The partially purified extract of Bacillus infantis SKS1 was thermostable and active in presence of Mg2+, acetyl acetone and laundry detergents implicating its application in industry. Production of these enzymes using this strain was maximized by optimization of various parameters including temperature, pH, media components and other growth conditions. Our results show that fructose and dextrose serve as the best carbon sources for production of these enzymes, highlighting the use of this strain for enzyme production utilizing relatively inexpensive substrates like beet molasses and corn steep liquor. Additionally, this strain showed maximum production of enzymes at 40°C similar to bacterial species used for commercial production of alkaline proteases. Characterization of alkaline proteases from this strain of Bacillus infantis and optimization of parameters for its production would help in understanding its industrial application and large-scale production.
Saggu, Sandeep Kaur
2017-01-01
Proteases are one of the largest groups of hydrolytic enzymes constituting about 60% of total worldwide sales of industrial enzymes due to their wide applications in detergent, leather, textile, food and pharmaceutical industry. Microbial proteases have been preferred over animal and plant proteases because of their fundamental features and ease in production. Bacillus infantis SKS1, an alkaline protease producing bacteria has been isolated from garden soil of north India and identified using morphological, biochemical and molecular methods. 16S rDNA sequence amplified using universal primers has 99% sequence identity with corresponding gene sequence of Bacillus infantis strain FM 34 and Bacillus sp. Beige. The bacterial culture and its 16S rDNA gene sequence have been deposited to Microbial Culture Collection (Pune, India) with accession number MCC 3035 and GenBank with accession number KR092197 respectively. The partially purified extract of Bacillus infantis SKS1 was thermostable and active in presence of Mg2+, acetyl acetone and laundry detergents implicating its application in industry. Production of these enzymes using this strain was maximized by optimization of various parameters including temperature, pH, media components and other growth conditions. Our results show that fructose and dextrose serve as the best carbon sources for production of these enzymes, highlighting the use of this strain for enzyme production utilizing relatively inexpensive substrates like beet molasses and corn steep liquor. Additionally, this strain showed maximum production of enzymes at 40°C similar to bacterial species used for commercial production of alkaline proteases. Characterization of alkaline proteases from this strain of Bacillus infantis and optimization of parameters for its production would help in understanding its industrial application and large-scale production. PMID:29190780
Sekaran, G; Karthikeyan, S; Gupta, V K; Boopathy, R; Maharaja, P
2013-03-01
Xenobiotic compounds are used in considerable quantities in leather industries besides natural organic and inorganic compounds. These compounds resist biological degradation and thus they remain in the treated wastewater in the unaltered molecular configurations. Immobilization of organisms in carrier matrices protects them from shock load application and from the toxicity of chemicals in bulk liquid phase. Mesoporous activated carbon (MAC) has been considered in the present study as the carrier matrix for the immobilization of Bacillus sp. isolated from Effluent Treatment Plant (ETP) employed for the treatment of wastewater containing sulphonated phenolic (SP) compounds. Temperature, pH, concentration, particle size and mass of MAC were observed to influence the immobilization behavior of Bacillus sp. The percentage immobilization of Bacillus sp. was the maximum at pH 7.0, temperature 20 °C and at particle size 300 μm. Enthalpy, free energy and entropy of immobilization were -46.9 kJ mol(-1), -1.19 kJ mol(-1) and -161.36 JK(-1)mol(-1) respectively at pH 7.0, temperature 20 °C and particle size 300 μm. Higher values of ΔH(0) indicate the firm bonding of the Bacillus sp. in MAC. Degradation of aqueous sulphonated phenolic compound by Bacillus sp. immobilized in MAC followed pseudo first order rate kinetics with rate constant 1.12 × 10(-2) min(-1). Copyright © 2012 Elsevier B.V. All rights reserved.
Menéndez Díaz, Zulema; Rodríguez Rodríguez, Jinnay; Gato Armas, René; Companioni Ibañez, Ariamys; Díaz Pérez, Manuel; Bruzón Aguila, Rosa Yirian
2012-01-01
the integration of chemical and biological methods is one of the strategies for the vector control, due to the existing environmental problems and the concerns of the community as a result of the synthetic organic insecticide actions. The bacterium called Bacillus thuringiensis var. israelensis in liquid formulation has been widely used in the vector control programs in several countries and has shown high efficacy at lab in Cuba. to determine the susceptibility of Aedes aegypti collected in the municipalities of La Habana province to Bacillus thuringiensis var. israelensis. fifteen Aedes aegypti strains, one from each municipality, were used including larvae and pupas collected in 2010 and one reference strain known as Rockefeller. The aqueous formulation of Bacillus thuringiensis var. israelensis (Bactivec, Labiofam, Cuba) was used. The bioassays complied with the World Health Organization guidelines for use of bacterial larvicides in the public health sector. The larval mortality was read after 24 hours and the results were processed by the statistical system SPSS (11.0) through Probit analysis. the evaluated mosquito strains showed high susceptibility to biolarvicide, there were no significant differences in LC50 values of Ae. aegypti strains, neither in the comparison of these values with those of the reference strain. the presented results indicate that the use of Bacillus thuringiensis var. israelensis continues to be a choice for the control of Aedes aegypti larval populations in La Habana province.
Kjeldal, Henrik; Zhou, Nicolette A; Wissenbach, Dirk K; von Bergen, Martin; Gough, Heidi L; Nielsen, Jeppe L
2016-01-19
Gemfibrozil is a widely used hypolipidemic and triglyceride lowering drug. Excess of the drug is excreted and discharged into the environment primarily via wastewater treatment plant effluents. Bacillus sp. GeD10, a gemfibrozil-degrader, was previously isolated from activated sludge. It is the first identified bacterium capable of degrading gemfibrozil. Gemfibrozil degradation by Bacillus sp. GeD10 was here studied through genome sequencing, quantitative proteomics and metabolite analysis. From the bacterial proteome of Bacillus sp. GeD10 1974 proteins were quantified, of which 284 proteins were found to be overabundant by more than 2-fold (FDR corrected p-value ≤0.032, fold change (log2) ≥ 1) in response to gemfibrozil exposure. Metabolomic analysis identified two hydroxylated intermediates as well as a glucuronidated hydroxyl-metabolite of gemfibrozil. Overall, gemfibrozil exposure in Bacillus sp. GeD10 increased the abundance of several enzymes potentially involved in gemfibrozil degradation as well as resulted in the production of several gemfibrozil metabolites. The potential catabolic pathway/modification included ring-hydroxylation preparing the substrate for subsequent ring cleavage by a meta-cleaving enzyme. The identified genes may allow for monitoring of potential gemfibrozil-degrading organisms in situ and increase the understanding of microbial processing of trace level contaminants. This study represents the first omics study on a gemfibrozil-degrading bacterium.
2009-01-09
LOPEZ P., ESPINOSA M., PIECHOWSAK M., SHUGAR D., WARREN R.: Uptake and fate of ΦW-14 DNA in competent Bacillus subtilis . J.Bacteriol. 149, 595–605...Among Bacillus anthracis Isolates and Related Species by Historical Movement and Horizontal Transfer J.L. KIELa, J.E. PARKERa, E.A. HOLWITTa, R.P...The geographical distribution of Bacillus anthracis strains and isolates bearing some of the same genetic markers as the Amerithrax Ames isolate was
Assembly and Function of the Bacillus anthracis S-Layer.
Missiakas, Dominique; Schneewind, Olaf
2017-09-08
Bacillus anthracis, the anthrax agent, is a member of the Bacillus cereus sensu lato group, which includes invasive pathogens of mammals or insects as well as nonpathogenic environmental strains. The genes for anthrax pathogenesis are located on two large virulence plasmids. Similar virulence plasmids have been acquired by other B. cereus strains and enable the pathogenesis of anthrax-like diseases. Among the virulence factors of B. anthracis is the S-layer-associated protein BslA, which endows bacilli with invasive attributes for mammalian hosts. BslA surface display and function are dependent on the bacterial S-layer, whose constituents assemble by binding to the secondary cell wall polysaccharide (SCWP) via S-layer homology (SLH) domains. B. anthracis and other pathogenic B. cereus isolates harbor genes for the secretion of S-layer proteins, for S-layer assembly, and for synthesis of the SCWP. We review here recent insights into the assembly and function of the S-layer and the SCWP.
Complete Genome Sequence of the Poly-γ-Glutamate-Synthesizing Bacterium Bacillus subtilis Bs-115.
Wang, Fengqing; Gong, Lijuan; Zhou, Lihong; Liang, Jinzhong
2018-04-19
Bacillus subtilis Bs-115 was isolated from the soil of a corn field in Yutai County, Jinan City, Shandong Province, People's Republic of China, and is characterized by the efficient synthesis of poly-γ-glutamate (γ-PGA), with corn saccharification liquid as the sole energy and carbon source during the process of γ-PGA formation. Here, we report the complete genome sequence of Bacillus subtilis Bs-115 and the genes associated with poly-γ-glutamate synthesis. Copyright © 2018 Wang et al.
1986-07-01
demonstrated that plasmid pLS20 of B. subtilis ( natto ) is capa le of promoting the transfer of pBC16 from B. subtilis to a variety of Bacillus s ecies...anthracis. Hofetver, results of recent experiments demonstrate that pL320, a 34-megadalton plasmid of B. subtilis ( natto ), is capable of promoting the...plasmid in Bacillus subtilis ( natto ).20 IV. Determination of the size of pX02 by restriction analysis-....... 24 V. Transfer of pXO1 by the B
Zheng, L; Li, D; Li, Z-L; Kang, L-N; Jiang, Y-Y; Liu, X-Y; Chi, Y-P; Li, Y-Q; Wang, J-H
2017-12-01
This study evaluated the effects of Bacillus fermentation on soybean meal protein (SBMP) microstructure and major anti-nutritional factors (ANFs) in soybean meal (SBM). The Bacillus siamensis isolate JL8 producing high yield of protease at 519·1 U g -1 was selected for the laboratory production of fermented soybean meal (FSBM). After 24 h fermentation, the FSBM showed better properties compared with those of SBM, the ANFs such as glycinin, β-conglycinin and trypsin inhibitor significantly decreased by 86·0, 70·3 and 95·01%, while in vitro digestibility and absorbability increased by 8·7 and 18·9% respectively. Scanning electron microscopy (SEM) image of fermented soybean meal protein showed smaller aggregates and looser network than that of SBMP. Secondary structure examination of proteins revealed fermentation significantly decreased the content of β-sheet structure by 43·2% and increased the random coil structure by 59·9%. It is demonstrated that Bacillus fermentation improved the nutritional quality of SBM through degrading ANFs and changing the microstructure of SBMP. There is limited information about the structural property changes of soybean protein during fermentation. In this study, physicochemical analysis of soybean meal protein showed evidence that the increase in in vitro digestibility and absorbability of fermented soybean meal reflected the decrease in β-conformation and destruction of original structure in soybean meal protein. The results directly gained the understanding of nutritional quality improvement of soybean meal by Bacillus fermentation, and supply the potential use of Bacillus siamensis for fermented soybean meal production. © 2017 The Society for Applied Microbiology.
NASA Technical Reports Server (NTRS)
2004-01-01
Bacillus thuringiensis (Bt), a natural bacteria found all over the Earth, has a fairly novel way of getting rid of unwanted insects. Bt forms a protein substance (shown on the right) that is not harmful to humans, birds, fish or other vertebrates. When eaten by insect larvae the protein causes a fatal loss of appetite. For over 25 years agricultural chemical companies have relied heavily upon safe Bt pesticides. New space based research promises to give the insecticide a new dimension in effectiveness and applicability. Researchers from the Consortium for Materials Development in Space along with industrial affiliates such as Abott Labs and Pern State University flew Bt on a Space Shuttle mission in the fall of 1996. Researchers expect that the Shuttle's microgravity environment will reveal new information about the protein that will make it more effective against a wider variety of pests.
Effect of Mono and Di-rhamnolipids on Biofilms Pre-formed by Bacillus subtilis BBK006.
De Rienzo, Mayri A Díaz; Martin, Peter J
2016-08-01
Different microbial inhibition strategies based on the planktonic bacterial physiology have been known to have limited efficacy on the growth of biofilms communities. This problem can be exacerbated by the emergence of increasingly resistant clinical strains. Biosurfactants have merited renewed interest in both clinical and hygienic sectors due to their potential to disperse microbial biofilms. In this work, we explore the aspects of Bacillus subtilis BBK006 biofilms and examine the contribution of biologically derived surface-active agents (rhamnolipids) to the disruption or inhibition of microbial biofilms produced by Bacillus subtilis BBK006. The ability of mono-rhamnolipids (Rha-C10-C10) produced by Pseudomonas aeruginosa ATCC 9027 and the di-rhamnolipids (Rha-Rha-C14-C14) produced by Burkholderia thailandensis E264, and phosphate-buffered saline to disrupt biofilm of Bacillus subtilis BBK006 was evaluated. The biofilm produced by Bacillus subtilis BBK006 was more sensitive to the di-rhamnolipids (0.4 g/L) produced by Burkholderia thailandensis than the mono-rhamnolipids (0.4 g/L) produced by Pseudomonas aeruginosa ATCC 9027. Rhamnolipids are biologically produced compounds safe for human use. This makes them ideal candidates for use in new generations of bacterial dispersal agents and useful for use as adjuvants for existing microbial suppression or eradication strategies.
Bacillus subtilis as a bioindicator for estimating pentachlorophenol toxicity and concentration.
Ayude, M A; Okada, E; González, J F; Haure, P M; Murialdo, S E
2009-05-01
Pentachlorophenol (PCP) and its sodium salt (Na-PCP) are extremely toxic chemicals responsible for important soil and groundwater pollution, mainly caused by wastes from wood-treatment plants, because chlorinated phenols are widely used as wood preservatives. The methods most commonly used for routine analysis of pesticides such as PCP and Na-PCP are high-performance liquid chromatography (HPLC) and gas chromatography-mass spectroscopy (GC-MS). A variety of rapid biological screening tests using marine organisms, bioluminescent bacteria, and enzymes have also been reported. In this study, rapid biological screening analysis using Bacillus subtilis was developed, to assess the biodegradation of PCP and its by-products in liquid samples. An empirical model is proposed for spectrophotometric analysis of Na-PCP concentration after growth of Bacillus subtilis.
Chlorxanthomycin, a Fluorescent, Chlorinated, Pentacyclic Pyrene from a Bacillus sp.†
Magyarosy, Andrew; Ho, Jonathan Z.; Rapoport, Henry; Dawson, Scott; Hancock, Joe; Keasling, Jay D.
2002-01-01
A gram-positive Bacillus sp. that fluoresces yellow under long-wavelength UV light on several common culture media was isolated from soil samples. On the basis of carbon source utilization studies, fatty acid methyl ester analysis, and 16S ribosomal DNA analysis, this bacterium was most similar to Bacillus megaterium. Chemical extraction yielded a yellow-orange fluorescent pigment, which was characterized by X-ray crystallography, mass spectrometry, and nuclear magnetic resonance spectroscopy. The fluorescent compound, chlorxanthomycin, is a pentacyclic, chlorinated molecule with the molecular formula C22H15O6Cl and a molecular weight of 409.7865. Chlorxanthomycin appears to be located in the cytoplasm, does not diffuse out of the cells into the culture medium, and has selective antibiotic activity. PMID:12147512
Omony, Jimmy; de Jong, Anne; Krawczyk, Antonina O.; Eijlander, Robyn T.; Kuipers, Oscar P.
2018-01-01
Sporulation is a survival strategy, adapted by bacterial cells in response to harsh environmental adversities. The adaptation potential differs between strains and the variations may arise from differences in gene regulation. Gene networks are a valuable way of studying such regulation processes and establishing associations between genes. We reconstructed and compared sporulation gene co-expression networks (GCNs) of the model laboratory strain Bacillus subtilis 168 and the food-borne industrial isolate Bacillus amyloliquefaciens. Transcriptome data obtained from samples of six stages during the sporulation process were used for network inference. Subsequently, a gene set enrichment analysis was performed to compare the reconstructed GCNs of B. subtilis 168 and B. amyloliquefaciens with respect to biological functions, which showed the enriched modules with coherent functional groups associated with sporulation. On basis of the GCNs and time-evolution of differentially expressed genes, we could identify novel candidate genes strongly associated with sporulation in B. subtilis 168 and B. amyloliquefaciens. The GCNs offer a framework for exploring transcription factors, their targets, and co-expressed genes during sporulation. Furthermore, the methodology described here can conveniently be applied to other species or biological processes. PMID:29424683
Omony, Jimmy; de Jong, Anne; Krawczyk, Antonina O; Eijlander, Robyn T; Kuipers, Oscar P
2018-02-09
Sporulation is a survival strategy, adapted by bacterial cells in response to harsh environmental adversities. The adaptation potential differs between strains and the variations may arise from differences in gene regulation. Gene networks are a valuable way of studying such regulation processes and establishing associations between genes. We reconstructed and compared sporulation gene co-expression networks (GCNs) of the model laboratory strain Bacillus subtilis 168 and the food-borne industrial isolate Bacillus amyloliquefaciens. Transcriptome data obtained from samples of six stages during the sporulation process were used for network inference. Subsequently, a gene set enrichment analysis was performed to compare the reconstructed GCNs of B. subtilis 168 and B. amyloliquefaciens with respect to biological functions, which showed the enriched modules with coherent functional groups associated with sporulation. On basis of the GCNs and time-evolution of differentially expressed genes, we could identify novel candidate genes strongly associated with sporulation in B. subtilis 168 and B. amyloliquefaciens. The GCNs offer a framework for exploring transcription factors, their targets, and co-expressed genes during sporulation. Furthermore, the methodology described here can conveniently be applied to other species or biological processes.
Yeo, In-Cheol; Lee, Nam Keun; Yang, Byung Wook; Hahm, Young Tae
2014-01-01
Bacillus subtilis SC-8 produces an antibiotic that has narrow antagonistic activity against bacteria in the Bacillus cereus group. In B. cereus group bacteria, peptide-activating PlcR (PapR) plays a significant role in regulating the transcription of virulence factors. When B. subtilis SC-8 and B. cereus are co-cultured, PapR is assumed to stimulate antibiotic production by B. subtilis SC-8. To better understand the effect of PapR on this interspecies interaction, the global transcriptome profile of B. subtilis SC-8 was analyzed in the presence of PapR. Significant changes were detected in 12.8 % of the total transcripts. Genes related to amino acid transport and metabolism (16.5 %) and transcription (15 %) were mainly upregulated, whereas genes involved in carbohydrate transport and metabolism (12.7 %) were markedly downregulated. The expression of genes related to transcription, including several transcriptional regulators and proteins involved in tRNA biosynthesis, was increased. The expression levels of genes associated with several transport systems, such as antibiotic, cobalt, and iron complex transporters, was also significantly altered. Among the downregulated genes were transcripts associated with spore formation, the subtilosin A gene cluster, and nitrogen metabolism.
Decolourization of 4-Chloro-2-Nitrophenol by a Soil Bacterium, Bacillus subtilis RKJ 700
Arora, Pankaj Kumar
2012-01-01
A 4-Chloro-2-nitrophenol (4C2NP) decolourizing strain RKJ 700 was isolated from soil collected from a pesticide contaminated site of India and identified as Bacillus subtilis on the basis of the 16S rRNA gene sequence analysis. Bacillus subtilis RKJ 700 decolourized 4C2NP up to concentration of 1.5 mM in the presence of additional carbon source. The degradation pathway of 4C2NP was studied and 4-chloro-2-aminophenol, 4-chloro-2-acetaminophenol and 5-chloro-2-methylbenzoxazole (5C2MBZ) were identified as metabolites by high performance liquid chromatography and gas chromatography-mass spectrometry. Resting cell studies showed that Bacillus subtilis RKJ 700 depleted 4C2NP completely with stoichiometric formation of 5C2MBZ. This is the first report of (i) the degradation of 4C2NP at high concentration (1.5 mM) and, (ii) the formation of 5C2MBZ by a soil bacterium. PMID:23251673
Decolourization of 4-chloro-2-nitrophenol by a soil bacterium, Bacillus subtilis RKJ 700.
Arora, Pankaj Kumar
2012-01-01
A 4-Chloro-2-nitrophenol (4C2NP) decolourizing strain RKJ 700 was isolated from soil collected from a pesticide contaminated site of India and identified as Bacillus subtilis on the basis of the 16S rRNA gene sequence analysis. Bacillus subtilis RKJ 700 decolourized 4C2NP up to concentration of 1.5 mM in the presence of additional carbon source. The degradation pathway of 4C2NP was studied and 4-chloro-2-aminophenol, 4-chloro-2-acetaminophenol and 5-chloro-2-methylbenzoxazole (5C2MBZ) were identified as metabolites by high performance liquid chromatography and gas chromatography-mass spectrometry. Resting cell studies showed that Bacillus subtilis RKJ 700 depleted 4C2NP completely with stoichiometric formation of 5C2MBZ. This is the first report of (i) the degradation of 4C2NP at high concentration (1.5 mM) and, (ii) the formation of 5C2MBZ by a soil bacterium.
Sujatha, V.; Sridhar, Bharat; Krishnamurthy, Srinath; Vinod Kumar, K. S.; Senthil Kumar, K.; Gautam, Pennathur
2010-01-01
The use of tetraammonium tetrakis(4-sulphonato)phenyl porphyrin (TPPS), a water-soluble anionic compound, as a stain to analyse bacterial cells using fluorescent microscopy was investigated. TPPS was effectively used to analyse two different bacteria: Pseudomonas aeruginosa and Bacillus cereus. The variation in brightness with varying concentrations of TPPS was studied. The patterns of variations for these bacteria were found to be the same, but with consistently higher brightness for Bacillus cereus. PMID:20811478
NASA Technical Reports Server (NTRS)
Venkateswaran, Kasthuri; Kempf, Michael; Chen, Fei; Satomi, Masataka; Nicholson, Wayne; Kern, Roger
2003-01-01
One of the spore-formers isolated from a spacecraft-assembly facility, belonging to the genus Bacillus, is described on the basis of phenotypic characterization, 16S rDNA sequence analysis and DNA-DNA hybridization studies. It is a Gram-positive, facultatively anaerobic, rod-shaped eubacterium that produces endospores. The spores of this novel bacterial species exhibited resistance to UV, gamma-radiation, H2O2 and desiccation. The 18S rDNA sequence analysis revealed a clear affiliation between this strain and members of the low G+C Firmicutes. High 16S rDNA sequence similarity values were found with members of the genus Bacillus and this was supported by fatty acid profiles. The 16S rDNA sequence similarity between strain FO-92T and Bacillus benzoevorans DSM 5391T was very high. However, molecular characterizations employing small-subunit 16S rDNA sequences were at the limits of resolution for the differentiation of species in this genus, but DNA-DNA hybridization data support the proposal of FO-92T as Bacillus nealsonii sp. nov. (type strain is FO-92T =ATCC BAAM-519T =DSM 15077T).
Kim, Seungjin; Bae, Wookeun; Hwang, Jungmin; Park, Jaewoo
2010-01-01
The degradation rates of toluene and trichloroethylene (TCE) by Pseudomonas putida and Bacillus spp. that were encapsulated in polyethylene glycol (PEG) polymers were evaluated in comparison with the results of exposure to suspended cultures. PEG monomers were polymerized together with TCE-degrading microorganisms, such that the cells were encapsulated in and protected by the matrices of the PEG polymers. TCE concentrations were varied from 0.1 to 1.5 mg/L. In the suspended cultures of P. putida, the TCE removal rate decreased as the initial TCE concentration increased, revealing TCE toxicity or a limitation of reducing power, or both. When the cells were encapsulated, an initial lag period of about 10-20 h was observed for toluene degradation. Once acclimated, the encapsulated P. putida cultures were more tolerant to TCE at an experimental range of 0.6-1.0 mg/L and gave higher transfer efficiencies (mass TCE transformed/mass toluene utilized). When the TCE concentration was low (e.g., 0.1 mg/L) the removal of TCE per unit mass of cells (specific removal) was significantly lower, probably due to a diffusion limitation into the PEG pellet. Encapsulated Bacillus spp. were able to degrade TCE cometabolically. The encapsulated Bacillus spp. gave significantly higher values than did P. putida in the specific removal and the transfer efficiency, particularly at relatively high TCE concentration of approximately 1.0±0.5 mg/L. The transfer efficiency by encapsulated Bacillus spp. in this study was 0.27 mgTCE/mgToluene, which was one to two orders of magnitude greater than the reported values.
Interactions of transgenic Bacillus thuringiensis insecticidal crops with spiders (Araneae)
USDA-ARS?s Scientific Manuscript database
Genetically modified crops expressing insecticidal proteins from Bacillus thuringiensis (Bt) have dramatically increased in acreage since their introduction in the mid-1990’s. Although the insecticidal mechanisms of Bt target specific pests, concerns persist regarding direct and indirect effects on...
Summers, R. J.; Boudreaux, D. P.; Srinivasan, V. R.
1979-01-01
Steady-state continuous culture was used to optimize lean chemically defined media for a Cellulomonas sp. and Bacillus cereus strain T. Both organisms were extremely sensitive to variations in trace-metal concentrations. However, medium optimization by this technique proved rapid, and multifactor screening was easily conducted by using a minimum of instrumentation. The optimized media supported critical dilution rates of 0.571 and 0.467 h−1 for Cellulomonas and Bacillus, respectively. These values approximated maximum growth rate values observed in batch culture. PMID:16345417
Xu Zhou, K; Wisnivesky, F; Wilson, D I; Christie, G
2017-07-01
The influence of variable culture conditions on the size and wet density of spores of Bacillus cereus and Bacillus megaterium were examined in this work. Culture temperature and initial pH was shown to have a significant impact on the size of both species, with increasingly alkaline culture media and elevated culture temperatures resulting in spores that were, on average, up to 25% reduced in volume. Increasing concentrations of inorganic salts in sporulation media exerted differing effects on each species; whereas a fivefold increase in the concentration of all salts resulted in only minor differences to the dimensions of B. cereus spores, B. megaterium spores became more elongated, displaying an average increase in volume of almost 30%. Similarly, as the spore elongated to yield aspect ratios larger than 1·4, their shape changed from typical prolate spheroids to cylinders with hemispherical ends. In contrast with previous studies, culture conditions employed in this study exerted no discernible impact on the wet density of B. cereus or B. megaterium spores. Bacterial spores of the genera Bacillus and Clostridium represent nature's most durable cells in terms of their extreme resistance to a variety of deleterious environments. As a result, they are of concern in the food processing, healthcare and other sectors, and are of increasing biotechnological interest. Improved understanding of variance in spore size, morphology and density may aid the development of certain spore-associated applications (e.g. spore surface display) while contributing to active areas of research such as spore adhesion and resistance to heat. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.
Frederiksen, Kristine; Rosenquist, Hanne; Jørgensen, Kirsten; Wilcks, Andrea
2006-01-01
A total of 128 Bacillus cereus-like strains isolated from fresh fruits and vegetables for sale in retail shops in Denmark were characterized. Of these strains, 39% (50/128) were classified as Bacillus thuringiensis on the basis of their content of cry genes determined by PCR or crystal proteins visualized by microscopy. Random amplified polymorphic DNA analysis and plasmid profiling indicated that 23 of the 50 B. thuringiensis strains were of the same subtype as B. thuringiensis strains used as commercial bioinsecticides. Fourteen isolates were indistinguishable from B. thuringiensis subsp. kurstaki HD1 present in the products Dipel, Biobit, and Foray, and nine isolates grouped with B. thuringiensis subsp. aizawai present in Turex. The commercial strains were primarily isolated from samples of tomatoes, cucumbers, and peppers. A multiplex PCR method was developed to simultaneously detect all three genes in the enterotoxin hemolysin BL (HBL) and the nonhemolytic enterotoxin (NHE), respectively. This revealed that the frequency of these enterotoxin genes was higher among the strains indistinguishable from the commercial strains than among the other B. thuringiensis and B. cereus-like strains isolated from fruits and vegetables. The same was seen for a third enterotoxin, CytK. In conclusion, the present study strongly indicates that residues of B. thuringiensis-based insecticides can be found on fresh fruits and vegetables and that these are potentially enterotoxigenic. PMID:16672488
Bacillus caseinilyticus sp. nov., an alkali- and thermotolerant bacterium isolated from a soda lake.
Vishnuvardhan Reddy, Sultanpuram; Thirumala, Mothe; Farooq, Mohammed
2015-08-01
A novel Gram-stain-positive, rod-shaped, motile, endospore-forming and proteolytic bacterial strain, SPT, was isolated from Lonar soda lake, in India. On the basis of 16S rRNA gene sequence analysis it was identified as belonging to the class Firmibacteria and was most closely related to Bacillus cellulosilyticus DSM 2522T (96.7%) and other members of the genus Bacillus ( < 95.9%). Strain SPT was catalase- and oxidase-positive. The cell-wall peptidoglycan of strain SPT contained meso-diaminopimelic acid. Polar lipids included diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, three phospholipids, two aminolipids and two unknown lipids. The predominant isoprenoid quinone was MK-7. Anteiso-C15 : 0 (26.8%) was the predominant fatty acid and significant proportions (>5%) of iso-C15 : 0 (20.9%), C16 : 1ω7c alcohol (6.3%), iso-C16 : 0 (6.3%) and anteiso-C17 : 0 (5.3 %) were also detected in strain SPT. The DNA G+C content of strain SPT was 38.9 mol%. The results of phylogenetic, chemotaxonomic and biochemical tests allowed a clear differentiation of strain SPT from all other members of the genus Bacillus. Strain SPT represents a novel member of the genus Bacillus, for which the name Bacilluscaseinilyticus sp. nov. is proposed. The type strain is SPT ( = MCC 2612T = JCM 30246T).
Shobharani, Papanna; Padmaja, Radhakrishnan J; Halami, Prakash M
2015-01-01
The aim of the present study was to investigate the characteristic diversity and stability of antimicrobial compounds produced by two probiotic strains of Bacillus licheniformis (MCC2514 and MCC2512). Antimicrobial compounds from the two strains notably varied, related to stability and potency. The inhibitory spectrum of B. licheniformis MCC2512 was higher than MCC2514, but, related to the effect on Micrococcus luteus ATCC9341, MCC2514 (LD50 = 450 AU ml(-1)) was more potent than MCC2512 (LD50 = 750 AU ml(-1)). The compounds were thermo-resistant and stable at a wide range of pH and exhibited considerable resistance to digestive enzymes and bile salts (anionic biological detergents), contributing to their appropriate application in various food systems. The isolate B. licheniformis MCC2512 gave a positive response to Bacillus subtilis-based biosensors BSF2470 and BS168.BS2, confirming the mode of action on the cell wall and subtilin-type, respectively. For B. licheniformis MCC2514, the mode of action was characterized by constructing B. subtilis reporters that interfered in five major biosynthetic pathways, i.e., biosynthesis of DNA, RNA, protein, the cell wall and fatty acids. B. licheniformis MCC2514 responded to the yvgS reporter, indicating it as an RNA synthesis inhibitor. Overall, the investigation reveals variability of the antimicrobial compounds from B. licheniformis of different origins and for their possible application as biopreservative agents. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Proteomics and bioinformatics strategies to design countermeasures against infectious threat agents.
Khan, Akbar S; Mujer, Cesar V; Alefantis, Timothy G; Connolly, Joseph P; Mayr, Ulrike Beate; Walcher, Petra; Lubitz, Werner; Delvecchio, Vito G
2006-01-01
The potential devastation resulting from an intentional outbreak caused by biological warfare agents such as Brucella abortus and Bacillus anthracis underscores the need for next generation vaccines. Proteomics, genomics, and systems biology approaches coupled with the bacterial ghost (BG) vaccine delivery strategy offer an ideal approach for developing safer, cost-effective, and efficacious vaccines for human use in a relatively rapid time frame. Critical to any subunit vaccine development strategy is the identification of a pathogen's proteins with the greatest potential of eliciting a protective immune response. These proteins are collectively referred to as the pathogen's immunome. Proteomics provides high-resolution identification of these immunogenic proteins using standard proteomic technologies, Western blots probed with antisera from infected patients, and the pathogen's sequenced and annotated genome. Selected immunoreactive proteins can be then cloned and expressed in nonpathogenic Gram-negative bacteria. Subsequently, a temperature shift or chemical induction process is initiated to induce expression of the PhiX174 E-lysis gene, whose protein product forms an E tunnel between the inner and outer membrane of the bacteria, expelling all intracellular contents. The BG vaccine system is a proven strategy developed for many different pathogens and tested in a complete array of animal models. The BG vaccine system also has great potential for producing multiagent vaccines for protection to multiple species in a single formulation.
A microarray immunoassay for simultaneous detection of proteins and bacteria
NASA Technical Reports Server (NTRS)
Delehanty, James B.; Ligler, Frances S.
2002-01-01
We report the development and characterization of an antibody microarray biosensor for the rapid detection of both protein and bacterial analytes under flow conditions. Using a noncontact microarray printer, biotinylated capture antibodies were immobilized at discrete locations on the surface of an avidin-coated glass microscope slide. Preservation of capture antibody function during the deposition process was accomplished with the use of a low-salt buffer containing sucrose and bovine serum albumin. The slide was fitted with a six-channel flow module that conducted analyte-containing solutions over the array of capture antibody microspots. Detection of bound analyte was subsequently achieved using fluorescent tracer antibodies. The pattern of fluorescent complexes was interrogated using a scanning confocal microscope equipped with a 635-nm laser. This microarray system was employed to detect protein and bacterial analytes both individually and in samples containing mixtures of analytes. Assays were completed in 15 min, and detection of cholera toxin, staphylococcal enterotoxin B, ricin, and Bacillus globigii was demonstrated at levels as low as 8 ng/mL, 4 ng/mL, 10 ng/mL, and 6.2 x 10(4) cfu/mL, respectively. The assays presented here are very fast, as compared to previously published methods for measuring antibody-antigen interactions using microarrays (minutes versus hours).