Sample records for background atp-binding cassette

  1. ATP binding cassette G transporters and plant male reproduction

    PubMed Central

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing


    ABSTRACT The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field. PMID:26906115

  2. ATP-binding cassette transporters in reproduction: a new frontier

    PubMed Central

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.


    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  3. ATP-Binding Cassette Efflux Transporters in Human Placenta

    PubMed Central

    Ni, Zhanglin; Mao, Qingcheng


    Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087

  4. Influence of ATP-binding cassette transporters in root exudation of phytoalexins, signals, and disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The roots of plants secrete compounds as a way to exchange information with organ-isms living in the soil. Here, we report the involvement of seven root-expressed ATP-binding cassette (ABC) transporters corresponding to both full and half-size molecules (Atabcg36, Atabcg37, Atabcc5, Atabcf1, Atabcf3...

  5. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum

    PubMed Central


    Background The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control. PMID:23324493

  6. ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Jielou


    Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.

  7. The Lipid Bilayer Modulates the Structure and Function of an ATP-binding Cassette Exporter.


    Zoghbi, Maria E; Cooper, Rebecca S; Altenberg, Guillermo A


    ATP-binding cassette exporters use the energy of ATP hydrolysis to transport substrates across membranes by switching between inward- and outward-facing conformations. Essentially all structural studies of these proteins have been performed with the proteins in detergent micelles, locked in specific conformations and/or at low temperature. Here, we used luminescence resonance energy transfer spectroscopy to study the prototypical ATP-binding cassette exporter MsbA reconstituted in nanodiscs at 37 °C while it performs ATP hydrolysis. We found major differences when comparing MsbA in these native-like conditions with double electron-electron resonance data and the crystal structure of MsbA in the open inward-facing conformation. The most striking differences include a significantly smaller separation between the nucleotide-binding domains and a larger fraction of molecules with associated nucleotide-binding domains in the nucleotide-free apo state. These studies stress the importance of studying membrane proteins in an environment that approaches physiological conditions.

  8. Formation of a Chloride-conducting State in the Maltose ATP-binding Cassette (ABC) Transporter.


    Carlson, Michael L; Bao, Huan; Duong, Franck


    ATP-binding cassette transporters use an alternating access mechanism to move substrates across cellular membranes. This mode of transport ensures the selective passage of molecules while preserving membrane impermeability. The crystal structures of MalFGK2, inward- and outward-facing, show that the transporter is sealed against ions and small molecules. It has yet to be determined whether membrane impermeability is maintained when MalFGK2 cycles between these two conformations. Through the use of a mutant that resides in intermediate conformations close to the transition state, we demonstrate that not only is chloride conductance occurring, but also to a degree large enough to compromise cell viability. Introduction of mutations in the periplasmic gate lead to the formation of a channel that is quasi-permanently open. MalFGK2 must therefore stay away from these ion-conducting conformations to preserve the membrane barrier; otherwise, a few mutations that increase access to the ion-conducting states are enough to convert an ATP-binding cassette transporter into a channel.

  9. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.


    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  10. Transport in technicolor: Mapping ATP-binding cassette transporters in sea urchin embryos

    PubMed Central

    Gökirmak, Tufan; Shipp, Lauren E.; Campanale, Joseph P.; Nicklisch, Sascha C.T.; Hamdoun, Amro


    One quarter of eukaryotic genes encode membrane proteins. These include nearly 1000 transporters that translocate nutrients, signaling molecules, and xenobiotics across membranes. While it is well appreciated that membrane transport is critical for development, the specific roles of many transporters have remained cryptic, in part because of their abundance and the diversity of their substrates. Multi-drug resistance ATP-binding cassette (ABC) efflux transporters are one example of cryptic membrane proteins. Although most organisms utilize these ABC transporters during embryonic development, many of these transporters have broad substrate specificity, and their developmental functions remain incompletely understood. Here, we review advances in our understanding of ABC transporters in sea urchin embryos, and methods developed to spatially and temporally map these proteins. These studies reveal that multifunctional transporters are required for signaling, homeostasis, and protection of the embryo, and shed light on how they are integrated into ancestral developmental pathways recapitulated in disease. PMID:25156004

  11. ATP-binding cassette transporters in tumor endothelial cells and resistance to metronomic chemotherapy.


    Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro


    Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters.

  12. Protection against chemotherapy-induced alopecia: targeting ATP-binding cassette transporters in the hair follicle?


    Haslam, Iain S; Pitre, Aaron; Schuetz, John D; Paus, Ralf


    Currently, efficacious treatments for chemotherapy-induced alopecia (hair loss) are lacking, and incidences of permanent hair loss following high-dose chemotherapy are on the increase. In this article, we describe mechanisms by which the pharmacological defense status of the hair follicle might be enhanced, thereby reducing the accumulation of cytotoxic cancer drugs and preventing or reducing hair loss and damage. We believe this could be achieved via the selective increase in ATP-binding cassette (ABC) transporter expression within the hair follicle epithelium, following application of topical agonists for regulatory nuclear receptors. Clinical application would require the development of hair follicle-targeted formulations, potentially utilizing nanoparticle technology. This novel approach has the potential to yield entirely new therapeutic options for the treatment and management of chemotherapy-induced alopecia, providing significant psychological and physical benefit to cancer patients.

  13. The ATP binding cassette transporter, ABCG1, localizes to cortical actin filaments

    PubMed Central

    Pandzic, Elvis; Gelissen, Ingrid C.; Whan, Renee; Barter, Philip J.; Sviridov, Dmitri; Gaus, Katharina; Rye, Kerry-Anne; Cochran, Blake J.


    The ATP-binding cassette sub-family G member 1 (ABCG1) exports cellular cholesterol to high-density lipoproteins (HDL). However, a number of recent studies have suggested ABCG1 is predominantly localised to intracellular membranes. In this study, we found that ABCG1 was organized into two distinct cellular pools: one at the plasma membrane and the other associated with the endoplasmic reticulum (ER). The plasma membrane fraction was organized into filamentous structures that were associated with cortical actin filaments. Inhibition of actin polymerization resulted in complete disruption of ABCG1 filaments. Cholesterol loading of the cells increased the formation of the filamentous ABCG1, the proximity of filamentous ABCG1 to actin filaments and the diffusion rate of membrane associated ABCG1. Our findings suggest that the actin cytoskeleton plays a critical role in the plasma membrane localization of ABCG1. PMID:28165022

  14. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3

    PubMed Central

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea


    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter. PMID:26295388

  15. Structure-Function Analysis of Peroxisomal ATP-binding Cassette Transporters Using Chimeric Dimers*

    PubMed Central

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W.; Lopez, Tatiana E.; Dias, Alexandre M. M.; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J.; Trompier, Doriane; Savary, Stéphane


    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. PMID:25043761


    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  17. Biophysical Approaches Facilitate Computational Drug Discovery for ATP-Binding Cassette Proteins

    PubMed Central

    Molinski, Steven V.; Bozóky, Zoltán; Iram, Surtaj H.


    Although membrane proteins represent most therapeutically relevant drug targets, the availability of atomic resolution structures for this class of proteins has been limited. Structural characterization has been hampered by the biophysical nature of these polytopic transporters, receptors, and channels, and recent innovations to in vitro techniques aim to mitigate these challenges. One such class of membrane proteins, the ATP-binding cassette (ABC) superfamily, are broadly expressed throughout the human body, required for normal physiology and disease-causing when mutated, yet lacks sufficient structural representation in the Protein Data Bank. However, recent improvements to biophysical techniques (e.g., cryo-electron microscopy) have allowed for previously “hard-to-study” ABC proteins to be characterized at high resolution, providing insight into molecular mechanisms-of-action as well as revealing novel druggable sites for therapy design. These new advances provide ample opportunity for computational methods (e.g., virtual screening, molecular dynamics simulations, and structure-based drug design) to catalyze the discovery of novel small molecule therapeutics that can be easily translated from computer to bench and subsequently to the patient's bedside. In this review, we explore the utility of recent advances in biophysical methods coupled with well-established in silico techniques towards drug development for diseases caused by dysfunctional ABC proteins.

  18. Caveolin-1 and ATP binding cassette transporter A1 and G1-mediated cholesterol efflux.


    Wang, Faqi; Gu, Hong-mei; Zhang, Da-wei


    Atherosclerosis is one major cause of cardiovascular diseases, the leading cause of death in industrialized countries. Reverse cholesterol transport (RCT) is thought to be one primary pathway to protect against atherosclerosis. The first and rate-limiting step of RCT is ATP-binding cassette transport A1 (ABCA1) and ABCG1-mediated cholesterol efflux from the cells. Recently, caveolin-1 (CAV1), a scaffolding protein that organizes and concentrates certain caveolin-interacting signaling molecules and receptors within caveolae membranes, has been shown to regulate ABCA1 and ABCG1-mediated cholesterol efflux probably via interacting with them. In the present review, we summarize the current knowledge and views on the regulatory role of CAV1 on the cholesterol homeostasis with emphasis on the association of CAV1 with ABCA1 and ABCG1. We conclude that the dominance of the positive regulation by CAV1 on the ABCA1 and ABCG1-mediated cholesterol efflux is depending on the species, cell types, as well as the levels of CAV1 expression.

  19. Molecular Characterization of LjABCG1, an ATP-Binding Cassette Protein in Lotus japonicus

    PubMed Central

    Sugiyama, Akifumi; Fukuda, Shoju; Takanashi, Kojiro; Yoshioka, Miki; Yoshioka, Hirofumi; Narusaka, Yoshihiro; Narusaka, Mari; Kojima, Mikiko; Sakakibara, Hitoshi; Shitan, Nobukazu; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Yazaki, Kazufumi


    LjABCG1, a full-size ABCG subfamily of ATP-binding cassette proteins of a model legume, Lotus japonicus, was reported as a gene highly expressed during the early stages of nodulation, but have not been characterized in detail. In this study we showed that the induction of LjABCG1 expression was remarkable by methyl jasmonate treatment, and reporter gene experiments indicated that LjABCG1 was strongly expressed in the nodule parenchyma and cell layers adjacent to the root vascular tissue toward the nodule. LjABCG1 was suggested to be localized at the plasma membrane based on the fractionation of microsomal membranes as well as separation via aqueous two-phase partitioning. The physiological functions of LjABCG1 in symbiosis and pathogenesis were analyzed in homologous and heterologous systems. LjABCG1 knock-down L. japonicus plants did not show clear phenotypic differences in nodule formation, and not in defense against Pseudomonas syringae, either. In contrast, when LjABCG1 was expressed in the Arabidopsis pdr8-1 mutant, the penetration frequency of Phytophthora infestans, a potato late blight pathogen, was significantly reduced in LjABCG1/pdr8-1 than in pdr8-1 plants. This finding indicated that LjABCG1, at least partially, complemented the phenotype of pdr8 in Arabidopsis, suggesting the multiple roles of this protein in plant-microbe interactions. PMID:26418593

  20. A conserved mitochondrial ATP-binding cassette transporter exports glutathione polysulfide for cytosolic metal cofactor assembly.


    Schaedler, Theresia A; Thornton, Jeremy D; Kruse, Inga; Schwarzländer, Markus; Meyer, Andreas J; van Veen, Hendrik W; Balk, Janneke


    An ATP-binding cassette transporter located in the inner mitochondrial membrane is involved in iron-sulfur cluster and molybdenum cofactor assembly in the cytosol, but the transported substrate is unknown. ATM3 (ABCB25) from Arabidopsis thaliana and its functional orthologue Atm1 from Saccharomyces cerevisiae were expressed in Lactococcus lactis and studied in inside-out membrane vesicles and in purified form. Both proteins selectively transported glutathione disulfide (GSSG) but not reduced glutathione in agreement with a 3-fold stimulation of ATPase activity by GSSG. By contrast, Fe(2+) alone or in combination with glutathione did not stimulate ATPase activity. Arabidopsis atm3 mutants were hypersensitive to an inhibitor of glutathione biosynthesis and accumulated GSSG in the mitochondria. The growth phenotype of atm3-1 was strongly enhanced by depletion of the mitochondrion-localized, GSH-dependent persulfide oxygenase ETHE1, suggesting that the physiological substrate of ATM3 contains persulfide in addition to glutathione. Consistent with this idea, a transportomics approach using mass spectrometry showed that glutathione trisulfide (GS-S-SG) was transported by Atm1. We propose that mitochondria export glutathione polysulfide, containing glutathione and persulfide, for iron-sulfur cluster assembly in the cytosol.

  1. The role of ATP binding cassette transporters in tissue defense and organ regeneration.


    Huls, Miriam; Russel, Frans G M; Masereeuw, Rosalinde


    ATP binding cassette (ABC) transporters are ATP-dependent membrane proteins predominantly expressed in excretory organs, such as the liver, intestine, blood-brain barrier, blood-testes barrier, placenta, and kidney. Here, they play an important role in the absorption, distribution, and excretion of drugs, xenobiotics, and endogenous compounds. In addition, the ABC transporters, P-glycoprotein (P-gp/ABCB1) and breast cancer resistance protein (BCRP/ABCG2), are highly expressed in a population of primitive stem cells: the side population (SP). SP cells were originally discovered in bone marrow by their capacity to exclude rhodamine 123 and Hoechst dye 33342; however, extensive research also revealed their presence in other nonhematopoietic tissues. The expression levels of BCRP and P-gp are tightly controlled and may determine the differentiation of SP cells toward other more specialized cell types. Although their exact function in these cells is still not clear, they may protect the cells by pumping out toxicants and harmful products of oxidative stress. Transplantation studies in animals revealed that bone marrow-derived SP cells contribute to organ repopulation and tissue repair after damage, e.g., in liver and heart. The role of SP cells in regeneration of damaged kidney segments is not yet clarified. This review focuses on the role of ABC transporters in tissue defense and regeneration, with specific attention to P-gp and BCRP in organ regeneration and repair.

  2. An ATP-binding cassette transporter is a major glycoprotein of sea urchin sperm membranes.


    Mengerink, Kathryn J; Vacquier, Victor D


    Sperm are terminally differentiated cells that undergo several membrane-altering events before fusion with eggs. One event, the sea urchin sperm acrosome reaction (AR), is blocked by the lectin wheat germ agglutinin (WGA). In an effort to identify proteins involved in the AR induction, the peptide sequence was obtained from a 220-kDa WGA-binding protein. Degenerate PCR and library screening resulted in the full-length deduced amino acid sequence of an ATP-binding cassette transporter, suABCA. The protein of 1,764 residues has two transmembrane regions, two nucleotide-binding domains, and is most closely related to the human ABC subfamily A member 3 transporter (ABCA3). Sequence analysis suggests a large extracellular loop between transmembrane spanning segments 7 and 8, with five N-linked glycosylation sites. An antibody made to the loop region binds to non-permeabilized cells, supporting that this region is extracellular. suABCA is found in sperm membrane vesicles, it can be solubilized with nonionic detergents, and it shifts from 220 to 200 kDa upon protein:N-glycanase F digestion. suABCA localizes to the entire surface of sperm in a punctate pattern, but is not detected in lipid rafts. Based on its relationship to subfamily A, suABCA is most likely involved in phospholipid or cholesterol transport. This is the first investigation of an ABC transporter in animal sperm.

  3. Detergent-free purification of ABC (ATP-binding-cassette) transporters.


    Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J


    ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.

  4. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos


    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  5. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.


    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  6. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells

    PubMed Central

    Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.


    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  7. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells.


    Lara, Flavio Alves; Pohl, Paula C; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H F; Almeida, Igor C; Vaz, Itabajara da Silva; Oliveira, Pedro L


    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  8. Adipocyte ATP-binding cassette G1 promotes triglyceride storage, fat mass growth, and human obesity.


    Frisdal, Eric; Le Lay, Soazig; Hooton, Henri; Poupel, Lucie; Olivier, Maryline; Alili, Rohia; Plengpanich, Wanee; Villard, Elise F; Gilibert, Sophie; Lhomme, Marie; Superville, Alexandre; Miftah-Alkhair, Lobna; Chapman, M John; Dallinga-Thie, Geesje M; Venteclef, Nicolas; Poitou, Christine; Tordjman, Joan; Lesnik, Philippe; Kontush, Anatol; Huby, Thierry; Dugail, Isabelle; Clement, Karine; Guerin, Maryse; Le Goff, Wilfried


    The role of the ATP-binding cassette G1 (ABCG1) transporter in human pathophysiology is still largely unknown. Indeed, beyond its role in mediating free cholesterol efflux to HDL, the ABCG1 transporter equally promotes lipid accumulation in a triglyceride (TG)-rich environment through regulation of the bioavailability of lipoprotein lipase (LPL). Because both ABCG1 and LPL are expressed in adipose tissue, we hypothesized that ABCG1 is implicated in adipocyte TG storage and therefore could be a major actor in adipose tissue fat accumulation. Silencing of Abcg1 expression by RNA interference in 3T3-L1 preadipocytes compromised LPL-dependent TG accumulation during the initial phase of differentiation. Generation of stable Abcg1 knockdown 3T3-L1 adipocytes revealed that Abcg1 deficiency reduces TG storage and diminishes lipid droplet size through inhibition of Pparγ expression. Strikingly, local inhibition of adipocyte Abcg1 in adipose tissue from mice fed a high-fat diet led to a rapid decrease of adiposity and weight gain. Analysis of two frequent ABCG1 single nucleotide polymorphisms (rs1893590 [A/C] and rs1378577 [T/G]) in morbidly obese individuals indicated that elevated ABCG1 expression in adipose tissue was associated with increased PPARγ expression and adiposity concomitant to increased fat mass and BMI (haplotype AT>GC). The critical role of ABCG1 in obesity was further confirmed in independent populations of severe obese and diabetic obese individuals. This study identifies for the first time a major role of adipocyte ABCG1 in adiposity and fat mass growth and suggests that adipose ABCG1 might represent a potential therapeutic target in obesity.

  9. ATP binding cassette modulators control abscisic acid-regulated slow anion channels in guard cells

    PubMed Central

    Leonhardt, N; Vavasseur, A; Forestier, C


    In animal cells, ATP binding cassette (ABC) proteins are a large family of transporters that includes the sulfonylurea receptor and the cystic fibrosis transmembrane conductance regulator (CFTR). These two ABC proteins possess an ion channel activity and bind specific sulfonylureas, such as glibenclamide, but homologs have not been identified in plant cells. We recently have shown that there is an ABC protein in guard cells that is involved in the control of stomatal movements and guard cell outward K+ current. Because the CFTR, a chloride channel, is sensitive to glibenclamide and able to interact with K+ channels, we investigated its presence in guard cells. Potent CFTR inhibitors, such as glibenclamide and diphenylamine-2-carboxylic acid, triggered stomatal opening in darkness. The guard cell protoplast slow anion current that was recorded using the whole-cell patch-clamp technique was inhibited rapidly by glibenclamide in a dose-dependent manner; the concentration producing half-maximum inhibition was at 3 &mgr;M. Potassium channel openers, which bind to and act through the sulfonylurea receptor in animal cells, completely suppressed the stomatal opening induced by glibenclamide and recovered the glibenclamide-inhibited slow anion current. Abscisic acid is known to regulate slow anion channels and in our study was able to relieve glibenclamide inhibition of slow anion current. Moreover, in epidermal strip bioassays, the stomatal closure triggered by Ca2+ or abscisic acid was reversed by glibenclamide. These results suggest that the slow anion channel is an ABC protein or is tightly controlled by such a protein that interacts with the abscisic acid signal transduction pathway in guard cells. PMID:10368184

  10. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.


    Yang, Nuan; Driessen, Arnold J M


    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  11. Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus

    PubMed Central


    Background The otrC gene of Streptomyces rimosus was previously annotated as an oxytetracycline (OTC) resistance protein. However, the amino acid sequence analysis of OtrC shows that it is a putative ATP-binding cassette (ABC) transporter with multidrug resistance function. To our knowledge, none of the ABC transporters in S. rimosus have yet been characterized. In this study, we aimed to characterize the multidrug exporter function of OtrC and evaluate its relevancy to OTC production. Results In order to investigate OtrC’s function, otrC is cloned and expressed in E. coli The exporter function of OtrC was identified by ATPase activity determination and ethidium bromide efflux assays. Also, the susceptibilities of OtrC-overexpressing cells to several structurally unrelated drugs were compared with those of OtrC-non-expressing cells by minimal inhibitory concentration (MIC) assays, indicating that OtrC functions as a drug exporter with a broad range of drug specificities. The OTC production was enhanced by 1.6-fold in M4018 (P = 0.000877) and 1.4-fold in SR16 (P = 0.00973) duplication mutants, while it decreased to 80% in disruption mutants (P = 0.0182 and 0.0124 in M4018 and SR16, respectively). Conclusions The results suggest that OtrC is an ABC transporter with multidrug resistance function, and plays an important role in self-protection by drug efflux mechanisms. This is the first report of such a protein in S. rimosus, and otrC could be a valuable target for genetic manipulation to improve the production of industrial antibiotics. PMID:22906146

  12. In vitro reassembly of the ribose ATP-binding cassette transporter reveals a distinct set of transport complexes.


    Clifton, Matthew C; Simon, Michael J; Erramilli, Satchal K; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A; Stauffacher, Cynthia V


    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg(2+). We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg(2+), and VO4); a RbsAC complex in the presence of ADP and Mg(2+); and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters.

  13. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes

    SciTech Connect

    Miao, Y.C.; Liu, C.


    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  14. Structure, function, and evolution of bacterial ATP-binding cassette systems

    SciTech Connect

    Davidson, A.L.; Dassa, E.; Orelle, C.; Chen, J.


    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed in Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and

  15. CpABC, a Cryptosporidium parvum ATP-binding cassette protein at the host–parasite boundary in intracellular stages

    PubMed Central

    Perkins, Margaret E.; Riojas, Ynolde A.; Wu, Teresa W.; Le Blancq, Sylvie M.


    The intracellular parasite Cryptosporidium parvum develops inside a vacuole at the apex of its epithelial host cell. The developing parasite is separated from the host cell cytoplasm by a zone of attachment that consists of an extensively folded membranous structure known as the feeder organelle. It has been proposed that the feeder organelle is the site of regulation of transport of nutrients and drugs into the parasite. In this report, we localize an ≈200-kDa integral membrane protein, CpABC, from Cryptosporidium parvum to the host–parasite boundary, possibly the feeder organelle. The predicted amino acid sequence of CpABC has significant structural similarity with the cystic fibrosis conductance regulator and the multidrug resistance protein subfamily of ATP-binding cassette proteins. This is an example of a parasite-encoded transport protein localized at the parasite–host interface of an intracellular protozoan. PMID:10318953

  16. Simulation of the coupling between nucleotide binding and transmembrane domains in the ATP binding cassette transporter BtuCD.


    Sonne, Jacob; Kandt, Christian; Peters, Günther H; Hansen, Flemming Y; Jensen, Morten Ø; Tieleman, D Peter


    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B(12) importer BtuCD using perturbed elastic network calculations and biased molecular dynamics simulations. Both models predict that nucleotide release decreases the tilt between the two transmembrane domains and opens the cytoplasmic gate. Nucleotide binding has the opposite effect. The observed coupling may be relevant for all ABC transporters because of the conservation of nucleotide binding domains and the shared role of ATP in ABC transporters. The rearrangements in the cytoplasmic gate region do not provide enough space for B(12) to diffuse from the transporter pore into the cytoplasm, which could suggest that peristaltic forces are needed to exclude B(12) from the transporter pore.

  17. In Vitro Reassembly of the Ribose ATP-binding Cassette Transporter Reveals a Distinct Set of Transport Complexes*

    PubMed Central

    Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.


    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465

  18. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification

    PubMed Central

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.


    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175

  19. An ATP-binding cassette transporter-like complex governs cell-wall hydrolysis at the bacterial cytokinetic ring.


    Yang, Desirée C; Peters, Nick T; Parzych, Katherine R; Uehara, Tsuyoshi; Markovski, Monica; Bernhardt, Thomas G


    ATP-binding cassette transporters are ubiquitous membrane protein complexes that move substrates across membranes. They do so using ATP-induced conformational changes in their nucleotide-binding domains to alter the conformation of the transport cavity formed by their transmembrane domains. In Escherichia coli, an ATP-binding cassette transporter-like complex composed of FtsE (nucleotide-binding domain) and FtsX (transmembrane domain) has long been known to be important for cytokinesis, but its role in the process has remained mysterious. Here we identify FtsEX as a regulator of cell-wall hydrolysis at the division site. Cell-wall material synthesized by the division machinery is shared initially by daughter cells and must be split by hydrolytic enzymes called "amidases" to drive daughter-cell separation. We recently showed that the amidases require activation at the cytokinetic ring by proteins with LytM domains, of which EnvC is the most critical. In this report, we demonstrate that FtsEX directly recruits EnvC to the septum via an interaction between EnvC and a periplasmic loop of FtsX. Importantly, we also show that FtsEX variants predicted to be ATPase defective still recruit EnvC to the septum but fail to promote cell separation. Our results thus suggest that amidase activation via EnvC in the periplasm is regulated by conformational changes in the FtsEX complex mediated by ATP hydrolysis in the cytoplasm. Since FtsE has been reported to interact with the tubulin-like FtsZ protein, our model provides a potential mechanism for coupling amidase activity with the contraction of the FtsZ cytoskeletal ring.

  20. Regulation of ATP-binding cassette transporters and cholesterol efflux by glucose in primary human monocytes and murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...

  1. LrABCF1, a GCN-type ATP-binding cassette transporter from Lilium regale, is involved in defense responses against viral and fungal pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...

  2. The PAL1 gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae

    PubMed Central


    The PAL1 gene was isolated using PCR and degenerate oligonucleotide primers corresponding to highly conserved amino acid sequence motifs diagnostic of the ATP-binding cassette domain of the superfamily of membrane-bound transport proteins typified by mammalian multidrug resistance transporter 1 and Saccharomyces cerevisiae Ste6. The deduced PAL1 gene product is similar in length to, has the same predicted topology as, and shares the highest degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP- binding cassette transporters thought to be constituents of the peroxisomal membrane. As judged by hybridization of a PAL1 probe to isolated RNA and by expression of a PAL1-lacZ fusion, a PAL1 transcript was only detectable when cells were grown on oleic acid, a carbon source which requires the biogenesis of functional peroxisomes for its metabolism. A pal1delta mutant grew normally on either glucose- or glycerol-containing media; however, unlike PAL1+ cells (or the pal1delta mutant carrying the PAL1 gene on a plasmid), pal1delta cells were unable to grow on either a solid medium or a liquid medium containing oleic acid as the sole carbon source. Antibodies raised against a chimeric protein in which the COOH-terminal domain of Pal1 was fused to glutathione S-transferase specifically recognized a protein in extracts from wild-type cells only when grown on oleic acid; this species represents the PAL1 gene product because it was missing in pal1delta cells and more abundant in pal1delta cells expressing PAL1 from a multicopy plasmid. The Pal1 polypeptide was highly enriched in the organellar pellet fraction prepared from wild-type cells by differential centrifugation and comigrated upon velocity sedimentation in a Nycodenz gradient with a known component of the peroxisomal matrix, e-oxoacyl-CoA thiolase. As judged by both subcellular fractionation and indirect

  3. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera.


    Çakır, Birsen; Kılıçkaya, Ozan


    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 "full-size," 41 "half-size," and 15 "soluble" putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera.

  4. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W


    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  5. Modulating the function of ATP-binding cassette subfamily G member 2 (ABCG2) with inhibitor cabozantinib.


    Zhang, Guan-Nan; Zhang, Yun-Kai; Wang, Yi-Jun; Barbuti, Anna Maria; Zhu, Xi-Jun; Yu, Xin-Yue; Wen, Ai-Wen; Wurpel, John N D; Chen, Zhe-Sheng


    Cabozantinib (XL184) is a small molecule tyrosine kinase receptor inhibitor, which targets c-Met and VEGFR2. Cabozantinib has been approved by the Food and Drug Administration to treat advanced medullary thyroid cancer and renal cell carcinoma. In the present study, we evaluated the ability of cabozantinib to modulate the function of the ATP-binding cassette subfamily G member 2 (ABCG2) by sensitizing cells that are resistant to ABCG2 substrate antineoplastic drugs. We used a drug-selected resistant cell line H460/MX20 and three ABCG2 stable transfected cell lines ABCG2-482-R2, ABCG2-482-G2, and ABCG2-482-T7, which overexpress ABCG2. Cabozantinib, at non-toxic concentrations (3 or 5μM), sensitized the ABCG2-overexpressing cells to mitoxantrone, SN-38, and topotecan. Our results indicate that cabozantinib reverses ABCG2-mediated multidrug resistance by antagonizing the drug efflux function of the ABCG2 transporter instead of downregulating its expression. The molecular docking analysis indicates that cabozantinib binds to the drug-binding site of the ABCG2 transporter. Overall, our findings demonstrate that cabozantinib inhibits the ABCG2 transporter function and consequently enhances the effect of the antineoplastic agents that are substrates of ABCG2. Cabozantinib may be a useful agent in anticancer treatment regimens for patients who are resistant to ABCG2 substrate drugs.

  6. ABCC1, an ATP Binding Cassette Protein from Grape Berry, Transports Anthocyanidin 3-O-Glucosides[W][OA

    PubMed Central

    Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka


    Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325

  7. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification.


    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L


    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.

  8. The ATP-binding cassette transporter-2 (ABCA2) regulates esterification of plasma membrane cholesterol by modulation of sphingolipid metabolism.


    Davis, Warren


    The ATP-binding cassette transporters are a large family (~48 genes divided into seven families A-G) of proteins that utilize the energy of ATP-hydrolysis to pump substrates across lipid bilayers against a concentration gradient. The ABC "A" subfamily is comprised of 13 members and transport sterols, phospholipids and bile acids. ABCA2 is the most abundant ABC transporter in human and rodent brain with highest expression in oligodendrocytes, although it is also expressed in neurons. Several groups have studied a possible connection between ABCA2 and Alzheimer's disease as well as early atherosclerosis. ABCA2 expression levels have been associated with changes in cholesterol and sphingolipid metabolism. In this paper, we hypothesized that ABCA2 expression level may regulate esterification of plasma membrane-derived cholesterol by modulation of sphingolipid metabolism. ABCA2 overexpression in N2a neuroblastoma cells was associated with an altered bilayer distribution of the sphingolipid ceramide that inhibited acylCoA:cholesterol acyltransferase (ACAT) activity and cholesterol esterification. In contrast, depletion of endogenous ABCA2 in the rat schwannoma cell line D6P2T increased esterification of plasma membrane cholesterol following treatment with exogenous bacterial sphingomyelinase. These findings suggest that control of ABCA2 expression level may be a key locus of regulation for esterification of plasma membrane-derived cholesterol through modulation of sphingolipid metabolism.

  9. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).


    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli


    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions.

  10. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.


    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang


    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  11. Linsitinib (OSI-906) antagonizes ATP-binding cassette subfamily G member 2 and subfamily C member 10-mediated drug resistance.


    Zhang, Hui; Kathawala, Rishil J; Wang, Yi-Jun; Zhang, Yun-Kai; Patel, Atish; Shukla, Suneet; Robey, Robert W; Talele, Tanaji T; Ashby, Charles R; Ambudkar, Suresh V; Bates, Susan E; Fu, Li-Wu; Chen, Zhe-Sheng


    In this study we investigated the effect of linsitinib on the reversal of multidrug resistance (MDR) mediated by the overexpression of the ATP-binding cassette (ABC) subfamily members ABCB1, ABCG2, ABCC1 and ABCC10. Our results indicate for the first time that linsitinib significantly potentiate the effect of anti-neoplastic drugs mitoxantrone (MX) and SN-38 in ABCG2-overexpressing cells; paclitaxel, docetaxel and vinblastine in ABCC10-overexpressing cells. Linsitinib moderately enhanced the cytotoxicity of vincristine in cell lines overexpressing ABCB1, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, linsitinib significantly increased the intracellular accumulation and decreased the efflux of [(3)H]-MX in ABCG2-overexpressing cells and [(3)H]-paclitaxel in ABCC10-overexpressing cells. However, linsitinib, at a concentration that reversed MDR, did not significantly alter the expression levels of either the ABCG2 or ABCC10 transporter proteins. Furthermore, linsitinib did not significantly alter the intracellular localization of ABCG2 or ABCC10. Moreover, linsitinib stimulated the ATPase activity of ABCG2 in a concentration-dependent manner. Overall, our study suggests that linsitinib attenuates ABCG2- and ABCC10-mediated MDR by directly inhibiting their function as opposed to altering ABCG2 or ABCC10 protein expression.

  12. Multiple ATP-binding cassette transporters are involved in insecticide resistance in the small brown planthopper, Laodelphax striatellus.


    Sun, H; Pu, J; Chen, F; Wang, J; Han, Z


    ATP-binding cassette (ABC) transporters are membrane-bound proteins involved in the movement of various substrates, including drugs and insecticides, across the lipid membrane. Demonstration of the role of human ABC transporters in multidrug resistance has led to speculation that they might be an important mechanism controlling the fate of insecticides in insects. However, the role of ABC transporters in insects remains largely unknown. The small brown planthopper, Laodelphax striatellus Fallén, has developed resistance to most of the insecticides used for its control. Our goals were to identify the ABC transporters in La. striatellus and to examine their involvement in resistance mechanisms, using related strains resistant to chlorpyrifos, deltamethrin and imidacloprid, compared with the susceptible strain. Based on the transcriptome of La. striatellus, 40 full-length ABC transporters belonging to the ABCA-ABCH subfamilies were identified. Quantitative PCR revealed that over 20% of genes were significantly up-regulated in different resistant strains, and eight genes from the ABCB/C/D/G subfamilies were up-regulated in all three resistant strains, compared with the susceptible strain. Furthermore, synergism studies showed verapamil significantly enhanced insecticide toxicity in various resistant strains but not in the susceptible strain. These results suggest that ABC transporters might be involved in resistance to multiple insecticides in La. striatellus.

  13. Trapping the transition state of an ATP-binding cassette transporter: Evidence for a concerted mechanism of maltose transport

    PubMed Central

    Chen, Jue; Sharma, Susan; Quiocho, Florante A.; Davidson, Amy L.


    High-affinity uptake into bacterial cells is mediated by a large class of periplasmic binding protein-dependent transport systems, members of the ATP-binding cassette superfamily. In the maltose transport system of Escherichia coli, the periplasmic maltose-binding protein binds its substrate maltose with high affinity and, in addition, stimulates the ATPase activity of the membrane-associated transporter when maltose is present. Vanadate inhibits maltose transport by trapping ADP in one of the two nucleotide-binding sites of the membrane transporter immediately after ATP hydrolysis, consistent with its ability to mimic the transition state of the γ-phosphate of ATP during hydrolysis. Here we report that the maltose-binding protein becomes tightly associated with the membrane transporter in the presence of vanadate and simultaneously loses its high affinity for maltose. These results suggest a general model explaining how ATP hydrolysis is coupled to substrate transport in which a binding protein stimulates the ATPase activity of its cognate transporter by stabilizing the transition state. PMID:11171984

  14. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.


    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou


    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  15. Stickleback embryos use ATP-binding cassette transporters as a buffer against exposure to maternally derived cortisol

    PubMed Central

    Bukhari, Syed Abbas; Bell, Alison M.


    Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623

  16. Fructose Uptake in Sinorhizobium meliloti Is Mediated by a High-Affinity ATP-Binding Cassette Transport System

    PubMed Central

    Lambert, Annie; Østerås, Magne; Mandon, Karine; Poggi, Marie-Christine; Le Rudulier, Daniel


    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (Km of 6 μM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  17. Fructose uptake in Sinorhizobium meliloti is mediated by a high-affinity ATP-binding cassette transport system.


    Lambert, A; Østerås, M; Mandon, K; Poggi, M C; Le Rudulier, D


    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (K(m) of 6 microM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  18. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance.


    Aberuyi, N; Rahgozar, S; Moafi, A


    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols.

  19. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance

    PubMed Central

    Aberuyi, N; Rahgozar, S; Moafi, A


    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols. PMID:25254091

  20. Functional Characterization of ATP-Binding Cassette Transporter A3 Mutations from Infants with Respiratory Distress Syndrome.


    Wambach, Jennifer A; Yang, Ping; Wegner, Daniel J; Heins, Hillary B; Kaliberova, Lyudmila N; Kaliberov, Sergey A; Curiel, David T; White, Frances V; Hamvas, Aaron; Hackett, Brian P; Cole, F Sessions


    Mutations in the ATP-binding cassette transporter A3 gene (ABCA3) result in severe neonatal respiratory distress syndrome and childhood interstitial lung disease. As most ABCA3 mutations are rare or private, determination of mutation pathogenicity is often based on results from in silico prediction tools, identification in unrelated diseased individuals, statistical association studies, or expert opinion. Functional biologic studies of ABCA3 mutations are needed to confirm mutation pathogenicity and inform clinical decision making. Our objective was to functionally characterize two ABCA3 mutations (p.R288K and p.R1474W) identified among term and late-preterm infants with respiratory distress syndrome with unclear pathogenicity in a genetically versatile model system. We performed transient transfection of HEK293T cells with wild-type or mutant ABCA3 alleles to assess protein processing with immunoblotting. We used transduction of A549 cells with adenoviral vectors, which concurrently silenced endogenous ABCA3 and expressed either wild-type or mutant ABCA3 alleles (p.R288K and p.R1474W) to assess immunofluorescent localization, ATPase activity, and organelle ultrastructure. Both ABCA3 mutations (p.R288K and p.R1474W) encoded proteins with reduced ATPase activity but with normal intracellular localization and protein processing. Ultrastructural phenotypes of lamellar body-like vesicles in A549 cells transduced with mutant alleles were similar to wild type. Mutant proteins encoded by ABCA3 mutations p.R288K and p.R1474W had reduced ATPase activity, a biologically plausible explanation for disruption of surfactant metabolism by impaired phospholipid transport into the lamellar body. These results also demonstrate the usefulness of a genetically versatile, human model system for functional characterization of ABCA3 mutations with unclear pathogenicity.

  1. Computational characterization of TTHA0379: A potential glycerophosphocholine binding protein of Ugp ATP-binding cassette transporter.


    Chandravanshi, Monika; Gogoi, Prerana; Kanaujia, Shankar Prasad


    For the de novo biosynthesis of phospholipids, byproducts such as sn-glycerol-3-phosphate (G3P) and glycerophosphocholine (GPC) of glycerophospholipid metabolic pathway are imported inside the cell by an ATP-binding cassette (ABC) transporter known as UgpABCE. Of which, UgpA and UgpE constitutes the transmembrane domains (TMDs), UgpC forms the dimer of ATP-hydrolyzing component and UgpB is the periplasmic substrate binding protein. Structurally, UgpABCE transporter displays similarity to the maltose ABC transporter of Escherichia coli; thus, has been grouped into the CUT1 (Carbohydrate Uptake Transporter-1) family of bacterial ABC transporters. Being a member of CUT1 family, several Ugp (Uptake glycerol phosphate) protein sequences in biological database(s) exhibit sequence and structure similarity to sugar ABC transporters and have been annotated as sugar binding proteins; one of such proteins is TTHA0379 from Thermus thermophilus HB8. Here, in this study, we used computational method(s) to distinguish UgpB and sugar binding proteins based on their primary and tertiary structure features. A comprehensive analysis of these proteins indicates that they are evolutionarily related to each other having common conserved features at their primary and tertiary structure levels. However, they display differences at their active sites owing to the dissimilarity in their ligand preferences. In addition, phylogenetic analysis of TTHA0379 along with UgpB and sugar binding proteins reveals that both the groups of proteins forms two distinct clades and TTHA0379 groups with UgpB proteins. Furthermore, analysis of the ligand binding pocket shows that all the essential features of glycerophosphocholine binding protein i.e. UgpB, are conserved in TTHA0379 as well. Combining these features, here, we designate TTHA0379 to be a GPC binding protein.

  2. Alternating access to the transmembrane domain of the ATP-binding cassette protein cystic fibrosis transmembrane conductance regulator (ABCC7).


    Wang, Wuyang; Linsdell, Paul


    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is a member of the ATP-binding cassette (ABC) protein family, most members of which act as active transporters. Actively transporting ABC proteins are thought to alternate between "outwardly facing" and "inwardly facing" conformations of the transmembrane substrate pathway. In CFTR, it is assumed that the outwardly facing conformation corresponds to the channel open state, based on homology with other ABC proteins. We have used patch clamp recording to quantify the rate of access of cysteine-reactive probes to cysteines introduced into two different transmembrane regions of CFTR from both the intracellular and extracellular solutions. Two probes, the large [2-sulfonatoethyl]methanethiosulfonate (MTSES) molecule and permeant Au(CN)(2)(-) ions, were applied to either side of the membrane to modify cysteines substituted for Leu-102 (first transmembrane region) and Thr-338 (sixth transmembrane region). Channel opening and closing were altered by mutations in the nucleotide binding domains of the channel. We find that, for both MTSES and Au(CN)(2)(-), access to these two cysteines from the cytoplasmic side is faster in open channels, whereas access to these same sites from the extracellular side is faster in closed channels. These results are consistent with alternating access to the transmembrane regions, however with the open state facing inwardly and the closed state facing outwardly. Our findings therefore prompt revision of current CFTR structural and mechanistic models, as well as having broader implications for transport mechanisms in all ABC proteins. Our results also suggest possible locations of both functional and dysfunctional ("vestigial") gates within the CFTR permeation pathway.

  3. Osimertinib (AZD9291) Attenuates the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCB1 in Vitro.


    Hsiao, Sung-Han; Lu, Yu-Jen; Li, Yan-Qing; Huang, Yang-Hui; Hsieh, Chia-Hung; Wu, Chung-Pu


    The effectiveness of cancer chemotherapy is often circumvented by multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) drug transporter ABCB1 (MDR1, P-glycoprotein). Several epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been shown previously capable of modulating the function of ABCB1 and reversing ABCB1-mediated MDR in human cancer cells. Furthermore, some TKIs are transported by ABCB1, which results in low oral bioavailability, reduced distribution, and the development of acquired resistance to these TKIs. In this study, we investigated the interaction between ABCB1 and osimertinib, a novel selective, irreversible third-generation EGFR TKI that has recently been approved by the U.S. Food and Drug Administration. We also evaluated the potential impact of ABCB1 on the efficacy of osimertinib in cancer cells, which can present a therapeutic challenge to clinicians in the future. We revealed that although osimertinib stimulates the ATPase activity of ABCB1, overexpression of ABCB1 does not confer resistance to osimertinib. Our results suggest that it is unlikely that the overexpression of ABCB1 can be a major contributor to the development of osimertinib resistance in cancer patients. More significantly, we revealed an additional action of osimertinib that directly inhibits the function of ABCB1 without affecting the expression level of ABCB1, enhances drug-induced apoptosis, and reverses the MDR phenotype in ABCB1-overexpressing cancer cells. Considering that osimertinib is a clinically approved third-generation EGFR TKI, our findings suggest that a combination therapy with osimertinib and conventional anticancer drugs may be beneficial to patients with MDR tumors.

  4. Genome-Wide Identification, Evolution, and Expression Analysis of the ATP-Binding Cassette Transporter Gene Family in Brassica rapa

    PubMed Central

    Yan, Chao; Duan, Weike; Lyu, Shanwu; Li, Ying; Hou, Xilin


    ATP-binding cassette (ABC) proteins can act as transporters of different substrates across biological membranes by hydrolyzing ATP. However, little information is available about ABC transporters in Brassica rapa, an important leafy vegetable. In the present study, we carried out genome-wide identification, characterization and molecular evolution analyses of ABC gene family in B. rapa and 9 other plant species. A total of 179 B. rapa ABC genes (BraABCs) were identified. Among them, 173 BraABCs were identified on 10 chromosomes. Based on phylogenetic analysis and domain organization, the BraABC family could be grouped into eight subfamilies. BraABCs in the same subfamily showed similar motif composition and exon-intron organization. Common and unique cis-elements involved in the transcriptional regulation were also identified in the promoter regions of BraABCs. Tissue-expression analysis of BraABCs demonstrated their diverse spatiotemporal expression profiles. Influences of the whole genome triplication (WGT) on the evolution of BraABCs were studied in detail. BraABCs were preferentially retained compared with their neighboring genes during diploidization after WGT. Synteny analysis identified 76 pairs of syntenic BraABC paralogs among the three subgenomes of B. rapa, and 10 paralog pairs underwent positive selection with ω (= Ka/Ks) ratios greater than 1. Analyses of the expression patterns of syntenic BraABC paralogs pairs across five tissues and under stress treatments revealed their functional conservation, sub-functionalization, neo-functionalization and pseudogenization during evolution. Our study presents a comprehensive overview of the ABC gene family in B. rapa and will be helpful for the further functional study of BraABCs in plant growth, development, and stress responses. PMID:28367152

  5. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis)

    PubMed Central

    Heumann, Jan; Taggart, John B.; Gharbi, Karim; Bron, James E.; Bekaert, Michaël; Sturm, Armin


    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance. PMID:26418738

  6. HER2 as therapeutic target for overcoming ATP-binding cassette transporter-mediated chemoresistance in small cell lung cancer.


    Minami, Toshiyuki; Kijima, Takashi; Otani, Yasushi; Kohmo, Satoshi; Takahashi, Ryo; Nagatomo, Izumi; Hirata, Haruhiko; Suzuki, Mayumi; Inoue, Koji; Takeda, Yoshito; Kida, Hiroshi; Tachibana, Isao; Kumanogoh, Atsushi


    Small cell lung cancer (SCLC) easily acquires multidrug resistance after successful initial therapy. Overexpression of ATP-binding cassette (ABC) transporters is important for the multidrug resistance. Among them, ABCB1 and ABCG2 are known to be upregulated in chemoresistant SCLC cells. We found that human epidermal growth factor receptor 2 (HER2) expressions are also upregulated in chemoresistant SBC-3/ETP, SBC-3/SN-38, and SBC-3/CDDP cells, compared with chemosensitive SBC-3 cells. Lapatinib, a tyrosine kinase inhibitor of HER2, could not suppress proliferation of these HER2-positive SCLC cells alone but successfully restored chemosensitivity to etoposide and SN-38 with a clinically applicable concentration. The reversal effect of lapatinib was thought to be caused by inhibition of drug efflux pump functions of ABC transporters, although lapatinib itself has been reported to be a substrate for them. Moreover, knocking down of HER2 by an short interfering RNA weakened the effect of lapatinib on ABCB1, indicating the involvement of HER2 in the inhibitory mechanisms. Notably, we showed that caveolin-1 and Src play key roles in modulating ABCB1 function via HER2 inactivation. In SBC-3/ETP cells, dephosphorylation of HER2 by lapatinib activates Src and successively leads to increased caveolin-1 phosphorylation. Through this process, caveolin-1 dissociates from HER2 and strengthens association with ABCB1, and finally impairs the pump functions. Furthermore, we showed that treatment by lapatinib in combination with etoposide or irinotecan significantly suppresses the growth of subcutaneous SBC-3/ETP and SBC-3/SN-38 tumors in mice, respectively. Collectively, these results indicate that combination therapy with lapatinib and cytotoxic agents could conquer ABC transporter-mediated chemoresistance especially in HER2-positive SCLC.

  7. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine


    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  8. A Novel ATP-Binding Cassette Transporter Involved in Multidrug Resistance in the Phytopathogenic Fungus Penicillium digitatum

    PubMed Central

    Nakaune, Ryoji; Adachi, Kiichi; Nawata, Osamu; Tomiyama, Masamitsu; Akutsu, Katsumi; Hibi, Tadaaki


    Demethylation inhibitor (DMI)-resistant strains of the plant pathogenic fungus Penicillium digitatum were shown to be simultaneously resistant to cycloheximide, 4-nitroquinoline-N-oxide (4NQO), and acriflavine. A PMR1 (Penicillium multidrug resistance) gene encoding an ATP-binding cassette (ABC) transporter (P-glycoprotein) was cloned from a genomic DNA library of a DMI-resistant strain (LC2) of Penicillium digitatum by heterologous hybridization with a DNA fragment containing an ABC-encoding region from Botrytis cinerea. Sequence analysis revealed significant amino acid homology to the primary structures of PMR1 (protein encoded by the PMR1 gene) and ABC transporters of Saccharomyces cerevisiae (PDR5 and SNQ2), Schizosaccharomyces pombe (HBA2), Candida albicans (CDR1), and Aspergillus nidulans (AtrA and AtrB). Disruption of the PMR1 gene of P. digitatum DMI-resistant strain LC2 demonstrated that PMR1 was an important determinant of resistance to DMIs. The effective concentrations inhibiting radial growth by 50% (EC50s) and the MICs of fenarimol and bitertanol for the PMR1 disruptants (Δpmr1 mutants) were equivalent to those for DMI-sensitive strains. Northern blot analysis indicated that severalfold more PMR1 transcript accumulated in the DMI-resistant strains compared with those in DMI-sensitive strains in the absence of fungicide. In both DMI-resistant and -sensitive strains, transcription of PMR1 was strongly enhanced within 10 min after treatment with the DMI fungicide triflumizole. These results suggested that the toxicant efflux system comprised of PMR1 participates directly in the DMI resistance of the fungus. PMID:9758830

  9. Multidrug resistance in cancer chemotherapy and xenobiotic protection mediated by the half ATP-binding cassette transporter ABCG2.


    Han, B; Zhang, J-T


    ABCG2, also termed BCRP/MXR/ABCP, is a half ATP-binding cassette (ABC) transporter expressed on plasma membranes. ABCG2 was independently cloned from placenta as well as cell lines selected for resistance to mitoxantrone or anthracyclines. ABCG2 consists of a nucleotide-binding domain (NBD) at the amino terminus and a transmembrane domain (TMD) at the carboxyl terminus and it is postulated to form a homodimer to perform its biological functions. Over-expression of ABCG2 in cell lines confers resistance on a wide variety of anticancer drugs including mitoxantrone, daunorubicin, doxorubicin, topotecan and epirubicin. The expression of ABCG2 has been implicated in multidrug resistance (MDR) of acute myeloid leukemia and some solid tumors. In addition, ABCG2 can transport several fluorescent dyes or toxins. ABCG2 is found to be expressed in epithelial cells of intestine and colon, liver canaliculi, and renal tubules, where it serves to eliminate the plasma level of orally administered anticancer drugs as well as ingested toxins. ABCG2 is found to be highly expressed in placenta and the luminal surface of microvessel endothelium blood-brain barrier where it may play a role in limiting the penetration of drugs, such as topotecan from the maternal plasma into the fetus and from blood to brain. A variety of inhibitors for ABCG2 including GF120918 may prove useful for sensitizing cancer cells to chemotherapy or altering the distribution of orally administered drug substrates of ABCG2. Interestingly, ABCG2 is also expressed highly in hematopoietic stem cells. However, the function of ABCG2 in stem cells is currently unknown, although it may provide protection to stem cells from a variety of xenobiotics.

  10. Variations in ATP-Binding Cassette Transporter Regulation during the Progression of Human Nonalcoholic Fatty Liver DiseaseS⃞

    PubMed Central

    Hardwick, Rhiannon N.; Fisher, Craig D.; Canet, Mark J.; Scheffer, George L.


    Transporters located on the sinusoidal and canalicular membranes of hepatocytes regulate the efflux of drugs and metabolites into blood and bile, respectively. Changes in the expression or function of these transporters during liver disease may lead to a greater risk of adverse drug reactions. Nonalcoholic fatty liver disease (NAFLD) is a progressive condition encompassing the relatively benign steatosis and the more severe, inflammatory state of nonalcoholic steatohepatitis (NASH). Here, we present an analysis of the effect of NAFLD progression on the major ATP-binding cassette (ABC) efflux transport proteins ABCC1–6, ABCB1, and ABCG2. Human liver samples diagnosed as normal, steatotic, NASH (fatty), and NASH (not fatty) were analyzed. Increasing trends in mRNA expression of ABCC1, ABCC4–5, ABCB1, and ABCG2 were found with NAFLD progression, whereas protein levels of all transporters exhibited increasing trends with disease progression. Immunohistochemical staining of ABCC3, ABCB1, and ABCG2 revealed no alterations in cellular localization during NAFLD progression. ABCC2 staining revealed an alternative mechanism of regulation in NASH in which the transporter appears to be internalized away from the canalicular membrane. This correlated with a preferential shift in the molecular mass of ABCC2 from 200 to 180 kDa in NASH, which has been shown to be associated with a loss of glycosylation and internalization of the protein. These data demonstrate increased expression of multiple efflux transporters as well as altered cellular localization of ABCC2 in NASH, which may have profound effects on the ability of patients with NASH to eliminate drugs in an appropriate manner. PMID:21878559

  11. Up-Regulation of the ATP-Binding Cassette Transporter A1 Inhibits Hepatitis C Virus Infection

    PubMed Central

    Gondeau, Claire; Douam, Florian; Lebreton, Stéphanie; Lagaye, Sylvie; Pol, Stanislas; Helle, François; Plengpanich, Wanee; Guérin, Maryse; Bourgine, Maryline; Michel, Marie Louise; Lavillette, Dimitri; Roingeard, Philippe; le Goff, Wilfried; Budkowska, Agata


    Hepatitis C virus (HCV) establishes infection using host lipid metabolism pathways that are thus considered potential targets for indirect anti-HCV strategies. HCV enters the cell via clathrin-dependent endocytosis, interacting with several receptors, and virus-cell fusion, which depends on acidic pH and the integrity of cholesterol-rich domains of the hepatocyte membrane. The ATP-binding Cassette Transporter A1 (ABCA1) mediates cholesterol efflux from hepatocytes to extracellular Apolipoprotein A1 and moves cholesterol within cell membranes. Furthermore, it generates high-density lipoprotein (HDL) particles. HDL protects against arteriosclerosis and cardiovascular disease. We show that the up-regulation of ABCA1 gene expression and its cholesterol efflux function in Huh7.5 hepatoma cells, using the liver X receptor (LXR) agonist GW3965, impairs HCV infection and decreases levels of virus produced. ABCA1-stimulation inhibited HCV cell entry, acting on virus-host cell fusion, but had no impact on virus attachment, replication, or assembly/secretion. It did not affect infectivity or properties of virus particles produced. Silencing of the ABCA1 gene and reduction of the specific cholesterol efflux function counteracted the inhibitory effect of the GW3965 on HCV infection, providing evidence for a key role of ABCA1 in this process. Impaired virus-cell entry correlated with the reorganisation of cholesterol-rich membrane microdomains (lipid rafts). The inhibitory effect could be reversed by an exogenous cholesterol supply, indicating that restriction of HCV infection was induced by changes of cholesterol content/distribution in membrane regions essential for virus-cell fusion. Stimulation of ABCA1 expression by GW3965 inhibited HCV infection of both human primary hepatocytes and isolated human liver slices. This study reveals that pharmacological stimulation of the ABCA1-dependent cholesterol efflux pathway disrupts membrane cholesterol homeostasis, leading to the

  12. Poloxamines display a multiple inhibitory activity of ATP-binding cassette (ABC) transporters in cancer cell lines.


    Cuestas, María L; Sosnik, Alejandro; Mathet, Verónica L


    Primary hepatocellular carcinoma is the third most common fatal cancer worldwide with more than 500,000 annual deaths. Approximately 40% of the patients with HCC showed tumoral overexpression of transmembrane proteins belonging to the ATP-binding cassette protein superfamily (ABC) which pump drugs out of cells. The overexpression of these efflux transporters confers on the cells a multiple drug resistance phenotype, which is considered a crucial cause of treatment refractoriness in patients with cancer. The aim of this study was to investigate the inhibitory effect of different concentrations of pH- and temperature-responsive X-shaped poly(ethylene oxide)-poly(propylene oxide) block copolymers (poloxamines, Tetronic, PEO-PPO) showing a wide range of molecular weights and EO/PO ratios on the functional activity of three different ABC proteins, namely P-glycoprotein (P-gp or MDR1), breast cancer resistance protein (BCRP), and multidrug resistance-associated protein MRP1, in two human hepatocarcinoma cell lines, HepG2 and Huh7. First, the cytotoxicity of the different copolymers (at different concentrations) on both liver carcinoma cell lines was thoroughly evaluated by means of apoptosis analysis using annexin V and propidium iodide (PI). Thus, viable cells (AV-/PI-), early apoptotic cells (AV+/PI-) and late apoptotic cells (V-FITC+/PI+) were identified. Results pointed out copolymers of intermediate to high hydrophobicity and intermediate molecular weight (e.g., T904) as the most cytotoxic. Then, DiOC2, rhodamine 123 and vinblastine were used as differential substrates of these pumps. HeLa, an epithelial cell line of human cervical cancer that does not express P-gp, was used exclusively as a control and enabled the discerning between P-gp and MRP1 inhibition. Moderate to highly hydrophobic poloxamines T304, T904 and T1301 showed inhibitory activity against P-gp and BCRP but not against MRP1 in both hepatic cell lines. A remarkable dependence of this effect on the

  13. Evaluation of the role of ATP-binding cassette transporters as a defence mechanism against temephos in populations of Aedes aegypti

    PubMed Central

    Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim, Modesto Leite


    The role of ATP-binding cassette (ABC) transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM). The best result in the series was obtained with the addition of verapamil (40 μM), which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.

  14. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed Central

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul


    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters. PMID:12057006

  15. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    SciTech Connect

    Zoghbi, M. E.; Altenberg, G. A.


    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.

  16. Structural characterization of an MJ1267 ATP-binding cassette crystal with a complex pattern of twinning caused by promiscuous fiber packing.


    Yuan, Yu-Ren; Martsinkevich, Oskana; Hunt, John F


    ATP-binding cassettes represent the motor domains in ABC transporters, a superfamily of integral membrane-protein pumps that couple the hydrolysis of ATP to transmembrane solute translocation. A crystal of a Mg-ADP complex of the MJ1267 ATP-binding cassette was obtained that produced a diffraction pattern characterized by pathological streaking of the spots in the a* x b* plane. While the Laue symmetry of the diffraction pattern was P3;1m, the crystal was determined to be twinned based on intensity statistics, molecular-replacement analysis and difference Fourier analysis of an engineered single-site methylmercury derivative. The unit cell contains three similar 3(1) fibers, with two of them related by primarily translational non-crystallographic symmetry (NCS) and the third related to the first two by approximate twofold screw operations whose rotational components are very similar to the twinning operator. The promiscuous packing of these 3(1) fibers, which make both parallel and antiparallel interactions in the primary crystal lattice, can explain the twinning tendency based on the ability of the twin-related lattices to interact with one another while making only one slightly sub-optimal intermolecular contact per unit cell in the boundary region. The promiscuous fiber packing can also explain the streaking in the diffraction pattern based on the ability to form a variety of different lattices with similar inter-fiber packing interactions. The crystal structure was refined as a twin in space group P3(1) using the program CNS, yielding a free R factor of 28.9% at 2.6 A and a refined twin fraction of 0.50. The structure shows a rigid-body rotation of the ABC-transporter-specific alpha-helical subdomain (ABCalpha subdomain) in MJ1267 compared with the conformation observed for the same protein in a C2 crystal lattice; this observation suggests that the ABCalpha subdomain is flexibly attached to the F1-type ATP-binding core of the ATP-binding cassette when Mg

  17. Association of ATP-Binding Cassette Transporter A1 (ABCA1)-565 C/T Gene Polymorphism with Hypoalphalipoproteinemia and Serum Lipids, IL-6 and CRP Levels

    PubMed Central

    Babashamsi, Mohammad Mahdi; Halalkhor, Sohrab; Moradi Firouzjah, Hamid; Parsian, Hadi; Jalali, Seyed Farzad; Babashamsi, Mohammad


    Background: ATP-binding cassette transporter A1 (ABCA1) is a membrane integral protein which plays a vital role in High Density Lipoprotein (HDL) metabolism and exerts a protective effect against Hypoalphalipoproteinemia (HA) by mediation of rate-limiting step in HDL biogenesis. In addition, this protein possesses anti-inflammatory effects by inhibiting the production of some inflammatory cytokines in macrophages. This study investigated the association of ABCA1-565 C/T gene polymorphism with HA and serum lipids, IL-6 and CRP levels. Methods: A population which consisted of 101 HA and 95 normal subjects were genotyped for ABCA1-565C/T polymorphism by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). The serum concentrations of lipids, IL-6 and high sensitive-CRP (hs-CRP) were measured by the relevant methods. Results: The frequency of T allele was significantly higher in the HA group than the controls (31.7 vs. 19.5%, p=0.002). Thus, carriers of the T allele (CT and TT genotypes) had a higher risk for HA (p=0.016, OR=2.04, 95% CI=1.14–3.63). T allele carriers demonstrated decreased HDL-C and increased triglyceride, IL-6 and CRP levels than those with the CC genotype. Conclusion: This study suggests that the-565 C/T polymorphism of ABCA1 gene is associated with an increased risk of HA, decreased HDL-C and increased TG, IL-6 and CRP. PMID:28090279

  18. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.


    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D


    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  19. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense1

    PubMed Central

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc


    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865

  20. Isolation and characterization of the ATP-binding cassette (ABC) transporter system genes from loofah witches' broom phytoplasma.


    Huang, Chun-Lin; Ho, Kuo-Chieh


    A clone containing a 3903 bp EcoRI-restriction fragment was obtained from a lambda(ZAP) genomic library of loofah witches' broom (LfWB) phytoplasma by plaque hybridization using a PCR fragment as a probe. Sequence analysis revealed that this fragment contained three open reading frames (ORFs). The deduced amino acid sequences of ORF 1 and ORF 2 showed a high homology with the ATP-binding proteins of the ABC transporter system genes of prokaryotes and eukaryotes, and encoded proteins with a molecular mass of 36 and 30 kDa, respectively. Based on amino acid sequence similarity, secondary structure, hydrophilicity and a signal peptide sequence at the N-terminus, we predicted that ORF 3 might encode a specific solute-binding prolipoprotein of the ABC transporter system with a molecular mass of 62 kDa. The cleavage site of this prolipoprotein signal peptide was similar to those of gram-positive bacteria. In addition to nutrient uptake, ABC transporter systems of bacteria also play a role in signal transduction, drug-resistance and perhaps virulence. The possible implications of the system to the survival and the pathogenesis of phytoplasma were discussed.

  1. Transgenic hybrid aspen overexpressing the Atwbc19 gene encoding an ATP-binding cassette transporter confers resistance to four aminoglycoside antibiotics.


    Kang, Byung-Guk; Ye, Xia; Osburn, Lori D; Stewart, C N; Cheng, Zong-Ming


    Antibiotic-resistance genes of bacterial origin are invaluable markers for plant genetic engineering. However, these genes are feared to pose possible risk to human health by horizontal gene transfer from transgenic plants to bacteria, potentially resulting in antibiotic-resistant pathogenic bacteria; this is a considerable regulatory concern in some countries. The Atwbc19 gene, encoding an Arabidopsis thaliana ATP-binding cassette transporter, has been reported to confer resistance to kanamycin specifically as an alternative to bacterial antibiotic-resistance genes. In this report, we transformed hybrid aspen (Populus canescens x P. grandidentata) with the Atwbc19 gene. Unlike Atwbc19-transgenic tobacco that was only resistant to kanamycin, the transgenic Populus plants also showed resistance to three other aminoglycoside antibiotics (neomycin, geneticin, and paromomycin) at comparable levels to plants containing a CaMV35S-nptII cassette. Although it is unknown why the transgenic Populus with the Atwbc19 gene is resistant to all aminoglycoside antibiotics tested, the broad utility of the Atwbc19 gene as a reporter gene is confirmed here in a second dicot species. Because the Atwbc19 gene is plant-ubiquitous, it might serve as an alternative selectable marker to current bacterial antibiotic-resistance marker genes and alleviate the potential risk for horizontal transfer of bacterial-resistance genes in transgenic plants.

  2. Reversible transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense of downhill ethidium uptake.


    Balakrishnan, Lekshmy; Venter, Henrietta; Shilling, Richard A; van Veen, Hendrik W


    The ATP dependence of ATP-binding cassette (ABC) transporters has led to the widespread acceptance that these systems are unidirectional. Interestingly, in the presence of an inwardly directed ethidium concentration gradient in ATP-depleted cells of Lactococcus lactis, the ABC multidrug transporter LmrA mediated the reverse transport (or uptake) of ethidium with an apparent K(t) of 2.0 microm. This uptake reaction was competitively inhibited by the LmrA substrate vinblastine and was significantly reduced by an E314A substitution in the membrane domain of the transporter. Similar to efflux, LmrA-mediated ethidium uptake was inhibited by the E512Q replacement in the Walker B region of the nucleotide-binding domain of the protein, which strongly reduced its drug-stimulated ATPase activity, consistent with published observations for other ABC transporters. The notion that ethidium uptake is coupled to the catalytic cycle in LmrA was further corroborated by studies in LmrA-containing cells and proteoliposomes in which reverse transport of ethidium was associated with the net synthesis of ATP. Taken together, these data demonstrate that the conformational changes required for drug transport by LmrA are (i) not too far from equilibrium under ATP-depleted conditions to be reversed by appropriate changes in ligand concentrations and (ii) not necessarily coupled to ATP hydrolysis, but associated with a reversible catalytic cycle. These findings and their thermodynamic implications shed new light on the mechanism of energy coupling in ABC transporters and have implications for the development of new modulators that could enable reverse transport-associated drug delivery in cells through their ability to uncouple ATP binding/hydrolysis from multidrug efflux.

  3. Maltose-binding protein effectively stabilizes the partially closed conformation of the ATP-binding cassette transporter MalFGK2.


    Weng, Jingwei; Gu, Shuo; Gao, Xin; Huang, Xuhui; Wang, Wenning


    Maltose transporter MalFGK2 is a type-I importer in the ATP-binding cassette (ABC) transporter superfamily. Upon the binding of its periplasmic binding protein, MalE, the ATPase activity of MalFGK2 can be greatly enhanced. Crystal structures of the MalFGK2-MalE-maltose complex in a so-called "pretranslocation" ("pre-T") state with a partially closed conformation suggest that the formation of this MalE-stabilized intermediate state is a key step leading to the outward-facing catalytic state. On the contrary, crosslinking and fluorescence studies suggest that ATP binding alone is sufficient to promote the outward-facing catalytic state, thereby doubting the role of MalE binding. To clarify the role of MalE binding and to gain deeper understanding of the molecular mechanisms of MalFGK2, we calculated the free energy surfaces (FESs) related to the lateral motion in the presence and absence of MalE using atomistic metadynamics simulations. The results showed that, in the absence of MalE, laterally closing motion was energetically forbidden but, upon MalE binding, more closed conformations similar to the pre-T state become more stable. The significant effect of MalE binding on the free energy landscapes was in agreement with crystallographic studies and confirmed the important role of MalE in stabilizing the pre-T state. Our simulations also revealed that the allosteric effect of MalE stimulation originates from the MalE-binding-promoted vertical motion between MalF and MalG cores, which was further supported by MD simulation of the MalE-independent mutant MalF500.

  4. Domain Interactions in the Yeast ATP Binding Cassette Transporter Ycf1p: Intragenic Suppressor Analysis of Mutations in the Nucleotide Binding Domains

    PubMed Central

    Falcón-Pérez, Juan M.; Martínez-Burgos, Mónica; Molano, Jesús; Mazón, María J.; Eraso, Pilar


    The yeast cadmium factor (Ycf1p) is a vacuolar ATP binding cassette (ABC) transporter required for heavy metal and drug detoxification. Cluster analysis shows that Ycf1p is strongly related to the human multidrug-associated protein (MRP1) and cystic fibrosis transmembrane conductance regulator and therefore may serve as an excellent model for the study of eukaryotic ABC transporter structure and function. Identifying intramolecular interactions in these transporters may help to elucidate energy transfer mechanisms during transport. To identify regions in Ycf1p that may interact to couple ATPase activity to substrate binding and/or movement across the membrane, we sought intragenic suppressors of ycf1 mutations that affect highly conserved residues presumably involved in ATP binding and/or hydrolysis. Thirteen intragenic second-site suppressors were identified for the D777N mutation which affects the invariant Asp residue in the Walker B motif of the first nucleotide binding domain (NBD1). Two of the suppressor mutations (V543I and F565L) are located in the first transmembrane domain (TMD1), nine (A1003V, A1021T, A1021V, N1027D, Q1107R, G1207D, G1207S, S1212L, and W1225C) are found within TMD2, one (S674L) is in NBD1, and another one (R1415G) is in NBD2, indicating either physical proximity or functional interactions between NBD1 and the other three domains. The original D777N mutant protein exhibits a strong defect in the apparent affinity for ATP and Vmax of transport. The phenotypic characterization of the suppressor mutants shows that suppression does not result from restoring these alterations but rather from a change in substrate specificity. We discuss the possible involvement of Asp777 in coupling ATPase activity to substrate binding and/or transport across the membrane. PMID:11466279

  5. Expression of ATP-Binding Cassette Transporters B1 and C1 after Severe Traumatic Brain Injury in Humans

    PubMed Central

    Willyerd, F. Anthony; Empey, Philip E.; Philbrick, Ashley; Ikonomovic, Milos D.; Puccio, Ava M.; Kochanek, Patrick M.; Okonkwo, David O.


    Abstract Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI) on ABCC1 and ABCB1 expression in humans is unknown. We hypothesized that ABCC1 and ABCB1 expression would be altered in brain tissue from patients acutely after severe TBI. Archived TBI samples (n=10) from our Brain Trauma Research Center and control samples (n=7) from our Alzheimer Disease Research Center were obtained under Institutional Review Board approval. Protein was extracted from fresh frozen cortical brain tissue for Western blot analysis and sections were obtained from fixed cortical tissue for immunohistochemistry. Relative abundance of ABCC1 was increased in samples from TBI versus controls (2.8±2.5 fold; p=0.005). ABCC1 immunohistochemistry was consistent with Western blot data, with increased immunoreactivity in cerebral blood vessel walls, as well as cells with the morphological appearance of neurons and glia in TBI versus controls. Relative abundance of ABCB1 was similar between TBI and controls (p=0.76), and ABCB1 immunoreactivity was primarily associated with cerebral blood vessels in both groups. These human data show that TBI increases ABCC1 expression in the brain, consistent with possible implications for both patients receiving pharmacological inhibitors and/or substrates of ABCC1 after TBI. PMID:25891836

  6. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.


    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood


    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  7. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism.


    Cho, Misuk; Henry, Elizabeth M; Lewis, Daniel R; Wu, Guosheng; Muday, Gloria K; Spalding, Edgar P


    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target.

  8. Lobular Distribution and Variability in Hepatic ATP Binding Cassette Protein B1 (ABCB1, P-gp): Ontogenetic Differences and Potential for Toxicity

    PubMed Central

    Abanda, Ngu Njei; Riches, Zoe; Collier, Abby C.


    The ATP Binding Cassette B1 (ABCB1) transporter has critical roles in endo- and xenobiotic efficacy and toxicity. To understand population variability in hepatic transport we determined ABCB1 mRNA and protein levels in total liver lysates sampled from 8 pre-defined sites (n = 24, 18–69 years), and in S9 from randomly acquired samples (n = 87, 7 days–87 years). ABCB1 levels did not differ significantly throughout individual livers and showed 4.4-fold protein variation between subjects. Neither mRNA nor protein levels varied with sex, ethnicity, obesity or triglycerides in lysates or S9 (that showed the same relationships), but protein levels were lower in pediatric S9 (p < 0.0001), with 76% of adult ABCB1 present at birth and predicted to mature in 5 years. Pediatric total liver lysates were not available. In summary, opportunistic collection for studying human hepatic ABCB1 is acceptable. Additionally, ABCB1 may be lower in children, indicating differential potential for toxicity and response to therapy in this special population. PMID:28218636

  9. Structural and functional characterization of an orphan ATP-binding cassette ATPase involved in manganese utilization and tolerance in Leptospira spp.


    Benaroudj, Nadia; Saul, Frederick; Bellalou, Jacques; Miras, Isabelle; Weber, Patrick; Bondet, Vincent; Murray, Gerald L; Adler, Ben; Ristow, Paula; Louvel, Hélène; Haouz, Ahmed; Picardeau, Mathieu


    Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn(2+), we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn(2+), suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn(2+) toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg(2+)-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.

  10. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.


    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N


    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  11. A 20(S)-protopanoxadiol derivative overcomes multi-drug resistance by antagonizing ATP-binding cassette subfamily B member 1 transporter function

    PubMed Central

    Chen, Wantao; Xu, Qin; Xiao, Meng; Hu, Lihong; Mao, Li; Wang, Xu


    In cancer cells, failure of chemotherapy is often caused by the ATP-binding cassette subfamily B member 1 (ABCB1), and few drugs have been successfully developed to overcome ABCB1-mediated multi-drug resistance (MDR). To suppress ABCB1 activity, we previously designed and synthesized a new series of derivatives based on 20(S)-protopanoxadiol (PPD). In the present study, we investigated the role of PPD derivatives in the function of ABC transporters. Non-toxic concentrations of the PPD derivative PPD12 sensitized ABCB1-overexpressing cells to their anti-cancer substrates better than either the parental PPD or inactive PPD11. PPD12 increased intracellular accumulation of adriamycin and rhodamine123 in resistant cancer cells. Although PPD12 did not suppress the expression of ABCB1 mRNA or protein, it stimulated the activity of ABCB1 ATPase. Because PPD12 is a competitive inhibitor, it was predicted to bind to the large hydrophobic cavity of homology-modeled human ABCB1. PPD12 also enhanced the efficacy of adriamycin against ABCB1-overexpressing KB/VCR xenografts in nude mice. In conclusion, PPD12 enhances the efficacy of substrate drugs in ABCB1-overexpressing cancer cells. These findings suggest that a combination therapy consisting of PPD12 with conventional chemotherapeutic agents may be an effective treatment for ABCB1-mediated MDR cancer patients. PMID:26824187

  12. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells.


    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao


    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  13. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    PubMed Central

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.


    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters. PMID:11514522

  14. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.


    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  15. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.


    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles


    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  16. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.


    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng


    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  17. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie


    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  18. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.


    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong


    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families.

  19. Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptis japonica

    PubMed Central

    Shitan, Nobukazu; Bazin, Ingrid; Dan, Kazuyuki; Obata, Kazuaki; Kigawa, Koji; Ueda, Kazumitsu; Sato, Fumihiko; Forestier, Cyrille; Yazaki, Kazufumi


    Alkaloids comprise one of the largest groups of plant secondary metabolites. Berberine, a benzylisoquinoline alkaloid, is preferentially accumulated in the rhizome of Coptis japonica, a ranunculaceous plant, whereas gene expression for berberine biosynthetic enzymes has been observed specifically in root tissues, which suggests that berberine synthesized in the root is transported to the rhizome, where there is high accumulation. We recently isolated a cDNA encoding a multidrug-resistance protein (MDR)-type ATP-binding cassette (ABC) transporter (Cjmdr1) from berberine-producing cultured C. japonica cells, which is highly expressed in the rhizome. Functional analysis of Cjmdr1 by using a Xenopus oocyte expression system showed that CjMDR1 transported berberine in an inward direction, resulting in a higher accumulation of berberine in Cjmdr1-injected oocytes than in the control. Typical inhibitors of ABC proteins, such as vanadate, nifedipine, and glibenclamide, as well as ATP depletion, clearly inhibited this CjMDR1-dependent berberine uptake, suggesting that CjMDR1 functioned as an ABC transporter. Conventional membrane separation methods showed that CjMDR1 was localized in the plasma membrane of C. japonica cells. In situ hybridization indicated that Cjmdr1 mRNA was expressed preferentially in xylem tissues of the rhizome. These findings strongly suggest that CjMDR1 is involved in the translocation of berberine from the root to the rhizome. PMID:12524452

  20. Genome-wide identification of ATP-binding cassette (ABC) transporters and conservation of their xenobiotic transporter function in the monogonont rotifer (Brachionus koreanus).


    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Young Hwan; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong


    The ATP-binding cassette (ABC) transporter family is one of the largest gene family in animals, and members of this family are known to be involved in various biological processes due to their ability to transport a wide range of substrates across membranes using ATP cleavage-derived energy. We identified 61 ABC transporters in the genome of the monogonont rotifer Brachionus koreanus, and classified these into eight distinct subfamilies (A-H) by phylogenetic analysis. ABC transporters in the rotifer B. koreanus are comprised of 11 ABCA genes, 19 ABCB genes, 14 ABCC genes, 3 ABCD genes, 1 ABCE gene, 3 ABCF genes, 8 ABCG genes, and 2 ABCH genes. Extensive gene duplication and loss events in synteny were observed in several subfamilies. In particular, massive gene duplications of P-glycoproteins (P-gps), multidrug resistance proteins (MRPs), and Bk-Abcg-like proteins were observed. The ability of these B. koreanus proteins to function as multixenobiotic resistance (MXR) ABC transporters was validated using specific fluorescence substrates/inhibitors. The ABC transporter superfamily members identified in this study will be useful in future toxicological studies, and will facilitate comparative studies of the evolution of the ABC transporter superfamily in invertebrates.

  1. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter

    PubMed Central

    Alvarez, Frances Joan D.; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R. Michael; Klug, Candice S.; Davidson, Amy L.


    Summary MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance (EPR) spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP. PMID:26268698

  2. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    SciTech Connect

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao


    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  3. Roles of aldo-keto reductases 1B10 and 1C3 and ATP-binding cassette transporter in docetaxel tolerance.


    Matsunaga, Toshiyuki; Saito, Haruhi; Endo, Satoshi; Iguchi, Kazuhiro; Soda, Midori; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira


    Docetaxel (DTX) is widely used for treatment of inveterate lung and prostate cancers, but its continuous administration elicits the hyposensitivity. Here, we established the DTX-resistant variants of human lung cancer A549 and androgen-independent prostate cancer Du145 cells and found that the resistance development provoked aberrant up-regulations of aldo-keto reductase (AKR) 1B10 and AKR1C3 in A549 and Du145 cells, respectively. In addition, the sensitivity to the DTX toxicity was significantly decreased and increased by overexpression and knockdown of the two AKR isoforms, respectively. Furthermore, the resistant cells exhibited a decreased level of reactive 4-hydroxy-2-nonenal formed during DTX treatment, and the decrease was alleviated by adding the AKR inhibitors, inferring that the two AKRs confer the chemoresistance through elevating the antioxidant properties. The development of DTX resistance was also associated with enhanced expression of an ATP-binding cassette (ABC) transporter ABCB1 among the ABC transporter isoforms. The combined treatment with inhibitors of the two AKRs and ABCB1 additively sensitized the resistant cells to DTX. Intriguingly, the AKR1B10 inhibitor also suppressed the lung cancer cross-resistance against cisplatin. The results suggest that combined treatment with AKRs (1B10 and 1C3) and ABCB1 inhibitors exerts overcoming effect against the cancer resistance to DTX and cisplatin, and can be used as the adjuvant therapy.

  4. Role of NH{sub 2}-terminal hydrophobic motif in the subcellular localization of ATP-binding cassette protein subfamily D: Common features in eukaryotic organisms

    SciTech Connect

    Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi


    Highlights: • ABCD proteins classifies based on with or without NH{sub 2}-terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH{sub 2}-terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH{sub 2}-terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH{sub 2}-terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH{sub 2}-terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH{sub 2}-terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH{sub 2}-terminal H0 motif in organelle targeting is widely conserved in living organisms.

  5. Inherited surfactant deficiency due to uniparental disomy of rare mutations in the surfactant protein-B and ATP binding cassette, subfamily A, member 3 genes

    PubMed Central

    Hamvas, Aaron; Nogee, Lawrence M.; Wegner, Daniel J.; DePass, Kelcey; Christodoulou, John; Bennetts, Bruce; McQuade, Leon R.; Gray, Peter H.; Deterding, Robin R.; Carroll, Travis R.; Kammesheidt, Anja; Kasch, Laura M.; Kulkarni, Shashikant; Cole, F. Sessions


    Objective To characterize inheritance of homozygous, rare, recessive loss-of-function mutations in the surfactant protein-B (SFTPB) or ATP binding cassette, subfamily A, member 3 (ABCA3) genes in newborns with lethal respiratory failure. Study design We resequenced parents whose infants were homozygous for mutations in SFTPB or ABCA3. For infants with only one heterozygous parent, we performed microsatellite analysis for chromosomes 2 (SFTPB) and 16 (ABCA3). Results We identified one infant homozygous for the c.1549C>GAA mutation (121ins2) in SFTPB for whom only the mother was heterozygous and 3 infants homozygous for mutations in ABCA3 (p.K914R, p.P147L, and c.806_7insGCT) for whom only the fathers were heterozygous. For the SP-B deficient infant, microsatellite markers confirmed maternal heterodisomy with segmental isodisomy. Microsatellite analysis confirmed paternal isodisomy for the three ABCA3 deficient infants. Two ABCA3 deficient infants underwent lung transplantation at 3 and 5 months of age, respectively, and two infants died. None exhibited any non-pulmonary phenotype. Conclusions Uniparental disomy should be suspected in infants with rare homozygous mutations in SFTPB or ABCA3. Confirmation of parental carrier status is important to provide recurrence risk and to monitor expression of other phenotypes that may emerge through reduction to homozygosity of recessive alleles. PMID:19647838

  6. Altered Profile of Secondary Metabolites in the Root Exudates of Arabidopsis ATP-Binding Cassette Transporter Mutants1[C][W][OA

    PubMed Central

    Badri, Dayakar V.; Loyola-Vargas, Victor M.; Broeckling, Corey D.; De-la-Peña, Clelia; Jasinski, Michal; Santelia, Diana; Martinoia, Enrico; Sumner, Lloyd W.; Banta, Lois M.; Stermitz, Frank; Vivanco, Jorge M.


    Following recent indirect evidence suggesting a role for ATP-binding cassette (ABC) transporters in root exudation of phytochemicals, we identified 25 ABC transporter genes highly expressed in the root cells most likely to be involved in secretion processes. Of these 25 genes, we also selected six full-length ABC transporters and a half-size transporter for in-depth molecular and biochemical analyses. We compared the exuded root phytochemical profiles of these seven ABC transporter mutants to those of the wild type. There were three nonpolar phytochemicals missing in various ABC transporter mutants compared to the wild type when the samples were analyzed by high-performance liquid chromatography-mass spectrometry. These data suggest that more than one ABC transporter can be involved in the secretion of a given phytochemical and that a transporter can be involved in the secretion of more than one secondary metabolite. The primary and secondary metabolites present in the root exudates of the mutants were also analyzed by gas chromatography-mass spectrometry, which allowed for the identification of groups of compounds differentially found in some of the mutants compared to the wild type. For instance, the mutant Atpdr6 secreted a lower level of organic acids and Atmrp2 secreted a higher level of amino acids as compared to the wild type. We conclude that the release of phytochemicals by roots is partially controlled by ABC transporters. PMID:18065561

  7. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae.

    PubMed Central

    Egner, R; Mahé, Y; Pandjaitan, R; Kuchler, K


    Multidrug resistance (MDR) to different cytotoxic compounds in the yeast Saccharomyces cerevisiae can arise from overexpression of the Pdr5 (Sts1, Ydr1, or Lem1) ATP-binding cassette (ABC) multidrug transporter. We have raised polyclonal antibodies recognizing the yeast Pdr5 ABC transporter to study its biogenesis and to analyze the molecular mechanisms underlying MDR development. Subcellular fractionation and indirect immunofluorescence experiments showed that Pdr5 is localized in the plasma membrane. In addition, pulse-chase radiolabeling of cells and immunoprecipitation indicated that Pdr5 is a short-lived membrane protein with a half-life of about 60 to 90 min. A dramatic metabolic stabilization of Pdr5 was observed in delta pep4 mutant cells defective in vacuolar proteinases, and indirect immunofluorescence showed that Pdr5 accumulates in vacuoles of stationary-phase delta pep4 mutant cells, demonstrating that Pdr5 turnover requires vacuolar proteolysis. However, Pdr5 turnover does not require a functional proteasome, since the half-life of Pdr5 was unaffected in either pre1-1 or pre1-1 pre2-1 mutants defective in the multicatalytic cytoplasmic proteasome that is essential for cytoplasmic protein degradation. Immunofluorescence analysis revealed that vacuolar delivery of Pdr5 is blocked in conditional end4 endocytosis mutants at the restrictive temperature, showing that endocytosis delivers Pdr5 from the plasma membrane to the vacuole. PMID:7565740

  8. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action.


    Bordignon, Enrica; Grote, Mathias; Schneider, Erwin


    The maltose/maltodextrin transport system of Escherichia coli/Salmonella, composed of periplasmic maltose-binding protein, MalE, the pore-forming subunits MalF and MalG, and a homodimer of the nucleotide-binding subunit, MalK, serves as a model for canonical ATP-binding cassette importers in general. The wealth of knowledge accumulated on the maltose transporter in more than three decades by genetic, molecular genetic and biochemical means was complemented more recently by crystal structures of the isolated MalK dimer and of two conformational states of the full transporter. Here, we summarize insights into the transport mechanism provided by these structures and draw the reader's attention to experimental tools by which the dynamics of the transporter can be studied during substrate translocation. A transport model is presented that integrates currently available biochemical, biophysical and structural data. We also present the state of knowledge on regulatory functions of the maltose transporter associated with the C-terminal domain of MalK. Finally, we will address the application of coarse-grained modelling to visualize the progression of the conformational changes of an ABC transporter with special emphasis on the maltose system, which can provide a model platform for testing and validating the bioinformatic tools.

  9. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter.


    Alvarez, Frances Joan D; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R Michael; Klug, Candice S; Davidson, Amy L


    MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP.

  10. Cuticular Defects in Oryza sativa ATP-binding Cassette Transporter G31 Mutant Plants Cause Dwarfism, Elevated Defense Responses and Pathogen Resistance.


    Garroum, Imène; Bidzinski, Przemyslaw; Daraspe, Jean; Mucciolo, Antonio; Humbel, Bruno M; Morel, Jean-Benoit; Nawrath, Christiane


    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between plant and environment. Homologs of the ATP-binding cassette (ABC) transporter AtABCG32/HvABCG31 clade are necessary for the formation of a functional cuticle in both monocots and dicots. Here we characterize the osabcg31 knockout mutant and hairpin RNA interference (RNAi)-down-regulated OsABCG31 plant lines having reduced plant growth and a permeable cuticle. The reduced content of cutin in leaves and structural alterations in the cuticle and at the cuticle-cell wall interface in plants compromised in OsABCG31 expression explain the cuticle permeability. Effects of modifications of the cuticle on plant-microbe interactions were evaluated. The cuticular alterations in OsABCG31-compromised plants did not cause deficiencies in germination of the spores or the formation of appressoria of Magnaporthe oryzae on the leaf surface, but a strong reduction of infection structures inside the plant. Genes involved in pathogen resistance were constitutively up-regulated in OsABCG31-compromised plants, thus being a possible cause of the resistance to M. oryzae and the dwarf growth phenotype. The findings show that in rice an abnormal cuticle formation may affect the signaling of plant growth and defense.

  11. The Role of Arabidopsis ABCG9 and ABCG31 ATP Binding Cassette Transporters in Pollen Fitness and the Deposition of Steryl Glycosides on the Pollen Coat[W

    PubMed Central

    Choi, Hyunju; Ohyama, Kiyoshi; Kim, Yu-Young; Jin, Jun-Young; Lee, Saet Buyl; Yamaoka, Yasuyo; Muranaka, Toshiya; Suh, Mi Chung; Fujioka, Shozo; Lee, Youngsook


    The pollen coat protects pollen grains from harmful environmental stresses such as drought and cold. Many compounds in the pollen coat are synthesized in the tapetum. However, the pathway by which they are transferred to the pollen surface remains obscure. We found that two Arabidopsis thaliana ATP binding cassette transporters, ABCG9 and ABCG31, were highly expressed in the tapetum and are involved in pollen coat deposition. Upon exposure to dry air, many abcg9 abcg31 pollen grains shriveled up and collapsed, and this phenotype was restored by complementation with ABCG9pro:GFP:ABCG9. GFP-tagged ABCG9 or ABCG31 localized to the plasma membrane. Electron microscopy revealed that the mutant pollen coat resembled the immature coat of the wild type, which contained many electron-lucent structures. Steryl glycosides were reduced to about half of wild-type levels in the abcg9 abcg31 pollen, but no differences in free sterols or steryl esters were observed. A mutant deficient in steryl glycoside biosynthesis, ugt80A2 ugt80B1, exhibited a similar phenotype. Together, these results indicate that steryl glycosides are critical for pollen fitness, by supporting pollen coat maturation, and that ABCG9 and ABCG31 contribute to the accumulation of this sterol on the surface of pollen. PMID:24474628

  12. Effect of tacrolimus on activity and expression of P-glycoprotein and ATP-binding cassette transporter A5 (ABCA5) proteins in hematoencephalic barrier cells.


    Quezada, Claudia Andrea; Garrido, Wallys Ximena; González-Oyarzún, Mauricio Alejandro; Rauch, María Cecilia; Salas, Mónica Roxana; San Martín, Rody Enrique; Claude, Alejandro Andrés; Yañez, Alejandro Javier; Slebe, Juan Carlos; Cárcamo, Juan Guillermo


    Tacrolimus is an agent used in clinical immunosuppressive drug therapies. A wide spectrum of adverse effects has been reported in association with this immunosuppressor, including neurotoxic effect. The upper limit of therapeutic blood concentrations of tacrolimus has been described as 30 ng/ml in immunosuppressed patients. We investigated the effect of this therapeutic dose of tacrolimus on the expression and activity of the multidrug resistance protein 1 (MDR1 or Pgp, P-glycoprotein) and ATP-binding cassette transporters A5 (ABCA5) in human brain microvascular endothelial cells (HBMEC), derived from Blood-Brain Barrier (BBB) endothelium, these being the most predominantly expressed transcripts in these cells. The expression and activity of MDR1 transporter decreased with 30 ng/ml tacrolimus. The cell viability was not changed with the therapeutic dose used. By contrast, ABCA5 transcripts, of unknown role as yet, increased their expression at this concentration. We propose that the secondary cytotoxic effects of this immunosuppressor on CSN, besides the functional blockade related to multidrug resistance proteins, such as MDR1, and probably ABCA5, could be linked to variations in the expression levels of these proteins at the BBB.

  13. Molecular phylogenetic study and expression analysis of ATP-binding cassette transporter gene family in Oryza sativa in response to salt stress.


    Saha, Jayita; Sengupta, Atreyee; Gupta, Kamala; Gupta, Bhaskar


    ATP-binding cassette (ABC) transporter is a large gene superfamily that utilizes the energy released from ATP hydrolysis for transporting myriad of substrates across the biological membranes. Although many investigations have been done on the structural and functional analysis of the ABC transporters in Oryza sativa, much less is known about molecular phylogenetic and global expression pattern of the complete ABC family in rice. In this study, we have carried out a comprehensive phylogenetic analysis constructing neighbor-joining and maximum-likelihood trees based on various statistical methods of different ABC protein subfamily of five plant lineages including Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Selaginella moellendorffii (lycophyte), Arabidopsis thaliana (dicot) and O. sativa (monocot) to explore the origin and evolutionary patterns of these ABC genes. We have identified several conserved motifs in nucleotide binding domain (NBD) of ABC proteins among all plant lineages during evolution. Amongst the different ABC protein subfamilies, 'ABCE' has not yet been identified in lower plant genomes (algae, moss and lycophytes). The result indicated that gene duplication and diversification process acted upon these genes as a major operative force creating new groups and subgroups and functional divergence during evolution. We have demonstrated that rice ABCI subfamily consists of only half size transporters that represented highly dynamic members showing maximum sequence variations among the other rice ABC subfamilies. The evolutionary and the expression analysis contribute to a deep insight into the evolution and diversity of rice ABC proteins and their roles in response to salt stress that facilitate our further understanding on rice ABC transporters.

  14. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard


    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg−1 min−1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ∼1 and 0.01 s−1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm−1), ADP (1101 and 1205 cm−1), and free phosphate (1078 cm−1). Cleavage of the β-phosphate–γ-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  15. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris


    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  16. The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells.


    Davis, Warren


    The ATP-binding cassette transporter-2 (ABCA2) has been identified as a possible regulator of lipid metabolism. ABCA2 is most highly expressed in the brain but its effects on cholesterol homeostasis in neuronal-type cells have not been characterized. It is important to study the role of ABCA2 in regulating cholesterol homeostasis in neuronal-type cells because ABCA2 has been identified as a possible genetic risk factor for Alzheimer's disease. In this study, the effects of ABCA2 expression on cholesterol homeostasis were examined in mouse N2a neuroblastoma cells. ABCA2 reduced total, free- and esterified cholesterol levels as well as membrane cholesterol but did not perturb cholesterol distribution in organelle or lipid raft compartments. ABCA2 did not modulate de novo cholesterol biosynthesis from acetate. Cholesterol trafficking to the plasma membrane was not affected by ABCA2 but efflux to the physiological acceptor ApoE3 and mobilization of plasma membrane cholesterol to the endoplasmic reticulum for esterification were reduced by ABCA2. ABCA2 reduced esterification of serum and low-density lipoprotein-derived cholesterol but not 25-hydroxycholesterol. ABCA2 decreased low-density lipoprotein receptor (LDLR) mRNA and protein levels and increased its turnover rate. The surface expression of LDLR as well as the uptake of fluroresecent DiI-LDL was also reduced by ABCA2. Reduction of endogenous ABCA2 expression by RNAi treatment of N2a cells and rat primary cortical neurons produced the opposite effects of over-expression of ABCA2, increasing LDLR protein levels. This report identifies ABCA2 as a key regulator of cholesterol homeostasis and LDLR metabolism in neuronal cells.

  17. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B


    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  18. A Mutation within the Extended X Loop Abolished Substrate-induced ATPase Activity of the Human Liver ATP-binding Cassette (ABC) Transporter MDR3*

    PubMed Central

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz


    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467

  19. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.


    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz


    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain.

  20. Polycyclic aromatic hydrocarbons (PAHs) mediate transcriptional activation of the ATP binding cassette transporter ABCB6 gene via the aryl hydrocarbon receptor (AhR).


    Chavan, Hemantkumar; Krishnamurthy, Partha


    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics.

  1. Effects of silencing the ATP-binding cassette protein E1 gene by electroporation on the proliferation and migration of EC109 human esophageal cancer cells.


    Li, Xiao-Rui; Yang, Liu-Zhong; Huo, Xiao-Qing; Wang, Ying; Yang, Qing-Hui; Zhang, Qing-Qin


    In the present study, the gene expression of ATP-binding cassette protein E1 (ABCE1) in the EC109 human esophageal cancer cell line was silenced using electroporation to examine the effect if the ABCE1 gene on the growth migration and cell cycle of cancer cells. The small interference (si)RNA sequence of ABCE1 was designed and synthesized to transfect the EC109 cells by electroporation. The mRNA and protein expression levels of ABCE1 were then detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The analysis of the cell cycle and apoptosis was performed using flow cytometry. The effect of silencing the ABCE1 gene on the proliferation, migration and invasive ability of the EC109 human esophageal cancer cells were assessed using a Cell counting kit-8 (CCK-8) and with proliferation, wound-healing and cell invasion assays. The mRNA and protein expression levels of ABCE1 were significantly lower in the experimental group compared with the control group (P<0.05). The apoptotic rate of the experimental group was markedly higher than the control group and blank group (P<0.01). The CCK-8 proliferation assay revealed that, compared with the control and blank groups, the proliferation of the EC109 cells in the experimental group was significantly inhibited (P<0.05). The wound healing assay revealed that the migration capacity of the cells in the experimental group was significantly decreased (P<0.05). The Transwell chamber assay demonstrated that the invasive ability of the EC109 cells in the experimental group was significantly decreased (P<0.01). These results revealed that ABCE1 is closely associated with cell proliferation, invasion and migration in esophageal cancer and silencing the ABCE1 gene by electroporation can significantly reduce the proliferation, invasion and migration capacity of EC109 cells in vitro.

  2. Human Immunodeficiency Virus Protease Inhibitors Interact with ATP Binding Cassette Transporter 4/Multidrug Resistance Protein 4: A Basis for Unanticipated Enhanced Cytotoxicity

    PubMed Central

    Fukuda, Yu; Takenaka, Kazumasa; Sparreboom, Alex; Cheepala, Satish B.; Wu, Chung-Pu; Ekins, Sean; Ambudkar, Suresh V.


    Human immunodeficiency virus (HIV) pharmacotherapy, by combining different drug classes such as nucleoside analogs and HIV protease inhibitors (PIs), has increased HIV-patient life expectancy. Consequently, among these patients, an increase in non-HIV–associated cancers has produced a patient cohort requiring both HIV and cancer chemotherapy. We hypothesized that multidrug resistance protein 4/ATP binding cassette transporter 4 (MRP4/ABCC4), a widely expressed transporter of nucleoside-based antiviral medications as well as cancer therapeutics might interact with PIs. Among the PIs evaluated (nelfinavir, ritonavir, amprenavir, saquinavir, and indinavir), only nelfinavir both effectively stimulated MRP4 ATPase activity and inhibited substrate-stimulated ATPase activity. Saos2 and human embryonic kidney 293 cells engineered to overexpress MRP4 were then used to assess transport and cytotoxicity. MRP4 expression reduced intracellular accumulation of nelfinavir and consequently conferred survival advantage to nelfinavir cytotoxicity. Nelfinavir blocked Mrp4-mediated export, which is consistent with its ability to increase the sensitivity of MRP4-expressing cells to methotrexate. In contrast, targeted inactivation of Abcc4/Mrp4 in mouse cells specifically enhanced nelfinavir and 9-(2-phosphonylmethoxyethyl) adenine cytotoxicity. These results suggest that nelfinavir is both an inhibitor and substrate of MRP4. Because nelfinavir is a new MRP4/ABCC4 substrate, we developed a MRP4/ABCC4 pharmacophore model, which showed that the nelfinavir binding site is shared with chemotherapeutic substrates such as adefovir and methotrexate. Our studies reveal, for the first time, that nelfinavir, a potent and cytotoxic PI, is both a substrate and inhibitor of MRP4. These findings suggest that HIV-infected cancer patients receiving nelfinavir might experience both enhanced antitumor efficacy and unexpected adverse toxicity given the role of MRP4/ABCC4 in exporting nucleoside

  3. Functional interplay between the ATP binding cassette Msr(D) protein and the membrane facilitator superfamily Mef(E) transporter for macrolide resistance in Escherichia coli.


    Nunez-Samudio, Virginia; Chesneau, Olivier


    Macrolides have wide clinical applications in the treatment of community-acquired respiratory tract infections, among which streptococci are the most frequent causative agents. An active efflux-based mechanism of macrolide resistance, referred to as the M phenotype in streptococcal isolates, has been associated with the presence of mef genes that encode a subset of major facilitator superfamily (MFS) transporters like Mef(E). An msr(D) gene, adjacent to and co-transcribed with mef in the presence of erythromycin, has also been implicated in drug efflux, but its role remains elusive. Msr(D) belongs to the ATP binding cassette (ABC) proteins and harbors two fused nucleotide-binding domains with no membrane-spanning domains. The present work indicates that the major resistance traits of the M phenotype in Escherichia coli may be due to Msr(D) and not to Mef(E). Fluorescence microscopy using Mef(E) tagged with GFP linked low efficacy of the chimera in conferring macrolide resistance with improper subcellular localization. The active role of Msr(D) in directing Mef(E)-GFP to the cell poles was demonstrated, as was synergistic effect in terms of levels of resistance when both proteins were expressed. A trans-dominant negative mutation within ABC Msr(D) affecting MFS Mef(E) strongly suggests that both proteins can interact in vivo, and such a physical interaction was supported in vitro. This is the first reported example of a functional interplay between an ABC component and an MFS transporter. The direct involvement of Msr(D) in the efflux of macrolides remains to be demonstrated.

  4. Bacteriophage-mediated Glucosylation Can Modify Lipopolysaccharide O-Antigens Synthesized by an ATP-binding Cassette (ABC) Transporter-dependent Assembly Mechanism.


    Mann, Evan; Ovchinnikova, Olga G; King, Jerry D; Whitfield, Chris


    Lysogenic bacteriophages may encode enzymes that modify the structures of lipopolysaccharide O-antigen glycans, altering the structure of the bacteriophage receptor and resulting in serotype conversion. This can enhance virulence and has implications for antigenic diversity and vaccine development. Side chain glucosylation is a common modification strategy found in a number of bacterial species. To date, glucosylation has only been observed in O-antigens synthesized by Wzy-dependent pathways, one of the two most prevalent O-antigen synthesis systems. Here we exploited a heterologous system to study the glucosylation potential of a model O-antigen produced in an ATP-binding cassette (ABC) transporter-dependent system. Although O-antigen production is cryptic in Escherichia coli K-12, because of a mutation in the synthesis genes, it possesses a prophage glucosylation cluster, which modifies the GlcNAc residue in an α-l-Rha-(1→3)-d-GlcNAc motif found in the original O16 antigen. Raoultella terrigena ATCC 33257 produces an O-antigen possessing the same disaccharide motif, but its assembly uses an ABC transporter-dependent system. E. coli harboring the R. terrigena O-antigen biosynthesis genes produced an O-antigen displaying reduced reactivity toward antisera raised against the native R. terrigena repeat structure, indicative of an altered chemical structure. Structural determination using NMR revealed the addition of glucose side chains to the repeat units. O-antigen modification was dependent on a functional ABC transporter, consistent with modification in the periplasm, and was eliminated by deletion of the glucosylation genes from the E. coli chromosome, restoring native level antisera sensitivity and structure. There are therefore no intrinsic mechanistic barriers for bacteriophage-mediated O-antigen glucosylation in ABC transporter-dependent pathways.

  5. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.


    Schäfer-Somi, S; Palme, N


    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as < 50% progressive motility and/or > 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings.

  6. AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.

    PubMed Central

    Lu, Y P; Li, Z S; Drozdowicz, Y M; Hortensteiner, S; Martinoia, E; Rea, P A


    Three ATP binding cassette (ABC) transporter-like activities directed toward large amphipathic organic anions have recently been identified on the vacuolar membrane of plant cells. These are the Mg-ATP-energized, vanadate-inhibitable vacuolar accumulation of glutathione S-conjugates (GS conjugates), chlorophyll catabolites, and bile acids, respectively. Although each of these activities previously had been assigned to distinct pumps in native plant membranes, we describe here the molecular cloning, physical mapping, and heterologous expression of a gene, AtMRP2, from Arabidopsis thaliana that encodes a multispecific ABC transporter competent in the transport of both GS conjugates and chlorophyll catabolites. Unlike its isoform, AtMRP1, which transports the model Brassica napus chlorophyll catabolite transporter substrate Bn-NCC-1 at low efficiency, heterologously expressed AtMRP2 has the facility for simultaneous high-efficiency parallel transport of GS conjugates and Bn-NCC-1. The properties of AtMRP2 therefore establish a basis for the manipulation of two previously identified plant ABC transporter activities and provide an explanation for how the comparable transporter in native plant membranes would be systematically mistaken for two distinct transporters. These findings are discussed with respect to the functional organization of AtMRP2, the inability of AtMRP2 and AtMRP1 to transport the model bile acid transporter substrate taurocholate (despite the pronounced sensitivity of both to direct inhibition by this agent), the differential patterns of expression of their genes in the intact plant, and the high capacity of AtMRP2 for the transport of glutathionated herbicides and anthocyanins. PMID:9490749

  7. ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-Altritol and Galactitol Catabolic Pathways in Agrobacterium tumefaciens C58*

    PubMed Central

    Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.


    Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925

  8. Drug interaction between sunitinib and cimetidine and contribution of the efflux transporter ATP-binding cassette C2 to biliary excretion of sunitinib in rats.


    Arakawa-Todo, Maki; Ueyama, Jun; Nomura, Hiroshi; Abe, Fumie; Tsukiyama, Ikuto; Matsuura, Katsuhiko; Hasegawa, Takaaki


    The present study investigated the effect of the H2 antagonist cimetidine on the pharmacokinetics of a multi-targeted receptor tyrosine kinase (RTK) inhibitor, sunitinib, in Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic mutant rats (EHBR) lacking the efflux transporter, ATP-binding cassette C2 protein (ABCC2). Rats received an intraperitoneal injection of cimetidine (10 mg/kg) once a day for three days. On day 4, sunitinib (3 mg/kg) was administered intravenously 30 min after the final injection of cimetidine or saline to SD rats. Disappearance of sunitinib from plasma was significantly delayed by cimetidine. The pharmacokinetic parameter of sunitinib, systemic clearance (CLSYS), was significantly reduced and the half-life was significantly prolonged, with no change in the volume of distribution at steady-state (VSS). When the effect of cimetidine on the biliary excretion of sunitinib at steady-state condition was investigated in SD rats, cimetidine had no effect on some transporter-mediated biliary excretion of sunitinib. Furthermore, the contribution of ABCC2 to the biliary excretion of sunitinib was also examined in SD rats and EHBR. The biliary clearance of sunitinib was significantly lower in EHBR, but the biliary excretion rate of EHBR was not different from that of SD rats, and the contribution of biliary excretion to systemic elimination was small, suggesting that sunitinib is mainly eliminated by cytochrome P450 3A4 (CYP3A4)-mediated metabolism and is not excreted into the bile via ABCC2. These findings indicate that co-administration of cimetidine alters the pharmacokinetics of sunitinib probably due to inhibition of CYP3A4, suggesting the possibility that cimetidine should be used carefully for patients with cancer being treated with sunitinib therapy.

  9. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico


    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  10. Effect of ATP-binding Cassette Transporter A1 (ABCA1) Gene Polymorphisms on Plasma Lipid Variables and Common Demographic Parameters in Greek Nurses

    PubMed Central

    Kolovou, Vana; Marvaki, Apostolia; Boutsikou, Maria; Vasilopoulos, Georgios; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa


    Objective: The present study is on line with our previous studies evaluating the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms on the lipid variables of Greek student-nurses. The current study was undertaken to (1) estimate the influence of variant(s) such as rs2066715 (V825I), R219K, R1587K, I883M of ABCA1 gene on lipid variables and (2) evaluate the effect of all four ABCA1 polymorphisms on common demographic parameters. Methods: The study population involved 432 unrelated nurses (86 men) who were genotyped for ABCA1 polymorphisms and correlated according to lipid variables [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] and demographic parameters (age, gender, BMI, waist circumference). Results: According to lipid variables concentration there was no difference between genotypes and alleles of V825I, R219K and I883M polymorphisms. The LDL-C concentration was 13% lower in RR compared with RK genotype (100.7 vs. 113.9 mg/dl, p=0.013) of R1587K gene polymorphism. In regression analysis the effects of age, gender and only R1587K gene polymorphism on LDL-C concentrations were proved significant. Additionally, LDL-C was increased (by 1.29 mg/dl on average) by every year of increase of age. Moreover, females had lower LDL-C concentrations as compared with males. Conclusion: Findings suggested that only R1587K polymorphism of ABCA1 gene was associated with lipid variables, age, and gender of Greek nurses. These findings may be helpful in assessing the risk factors for premature coronary heart disease and distinct individuals with lower/higher atherosclerotic burden. PMID:27990182

  11. Mycophenolic acid induces ATP-binding cassette transporter A1 (ABCA1) expression through the PPAR{gamma}-LXR{alpha}-ABCA1 pathway

    SciTech Connect

    Xu, Yanni; Lai, Fangfang; Xu, Yang; Wu, Yexiang; Liu, Qi; Li, Ni; Wei, Yuzhen; Feng, Tingting; Zheng, Zhihui; Jiang, Wei; Yu, Liyan; Hong, Bin; Si, Shuyi


    Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1. Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.

  12. Effects of a fixed-intensity of endurance training and pistacia atlantica supplementation on ATP-binding cassette G4 expression

    PubMed Central


    Background Adenosine triphosphate-cassette binding protein (ABC) type G is considered as a part of reverse cholesterol transport (RCT) process in modification and metabolism of plasma and tissue cholesterol. This study aims to evaluate the effect of endurance training with or without Pistacia atlantica (Baneh) supplementation on the female rat tissues ABC type G expression and its correlation with plasma high-density lipoprotein cholesterol (HDL-C) concentration. Methods Twenty Wistar rats (six to eight weeks old, 125–135 g weight) were arbitrarily allocated into training (n = 10) and control (n = 10) groups and further divided into saline-control (n = 5), saline-training (n = 5), Baneh-control (n = 5), and Baneh-training (n = 5). The training groups were given exercise on a motor-driven treadmill at 25 m/min (0% grade) for 60 min/day, 5 days/week for eight weeks. The rats were fed orally with Baneh extract and saline for six weeks. Seventy-two hours after the last training session, the rats were sacrificed and their tissues were excised for tissues ABCG4 expression which was detected by Real-time PCR method. Results The ABCG4 gene expressions were significantly higher in liver (P = 02), small intestine (P = 06), and visceral fat tissues (P = 04) of the trained rats compared to the tissues of the control rats, but were lower in Baneh treated rats (liver P = 045, small intestine P = 06 and visceral fat P = 004) with lower HDL-C concentrations (P = 008). Conclusions The Baneh administration lowered tissues ABCG4 expression and plasma HDL-C concentrations while endurance training increased the expression in female rat tissues. PMID:24267473

  13. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.


    Chen, H Y; Weng, S F; Lin, J W


    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  14. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.


    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane


    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  15. Genetic variant of V825I in the ATP-binding cassette transporter A1 gene and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

    PubMed Central


    Background Several genetic variants in the ATP-binding cassette transporter A1 (ABCA1) gene have associated with modifications of serum high-density lipoprotein cholesterol (HDL-C) levels and the susceptibility for coronary heart disease, but the findings are still controversial in diverse racial/ethnic groups. Bai Ku Yao is an isolated subgroup of the Yao minority in southern China. The present study was undertaken to detect the possible association of V825I (rs2066715) polymorphism in the ABCA1 gene and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 677 subjects of Bai Ku Yao and 646 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Polymerase chain reaction and restriction fragment length polymorphism assay combined with gel electrophoresis were performed for the genotyping of V825I variant, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), HDL-C, apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.01 for all). The frequency of G and A alleles was 57.4% and 42.6% in Bai Ku Yao, and 57.7% and 42.3% in Han (P > 0.05); respectively. The frequency of GG, GA and AA genotypes was 33.7%, 47.4% and 18.9% in Bai Ku Yao, and 33.4%, 48.6% and 18.0% in Han (P > 0.05); respectively. There was no difference in the genotypic and allelic frequencies between males and females in the both ethnic groups. The subjects with AA genotype in Bai Ku Yao had higher serum TC levels than the subjects with GG and GA genotypes (P < 0.05). The participants with AA genotype in Han had lower serum HDL-C and ApoAI levels than the participants with GG and GA genotypes (P < 0.05 for each), but these results were found in males but not in females. Multivariate linear regression analysis showed that the levels of TC in Bai Ku Yao and HDL-C and ApoAI in male Han were correlated with genotypes (P < 0

  16. An attenuated mutant of the Rv1747 ATP-binding cassette transporter of Mycobacterium tuberculosis and a mutant of its cognate kinase, PknF, show increased expression of the efflux pump-related iniBAC operon

    PubMed Central

    Spivey, Vicky L; Whalan, Rachael H; Hirst, Elizabeth M A; Smerdon, Stephen J; Buxton, Roger S


    The ATP-binding cassette transporter Rv1747 is required for the growth of Mycobacterium tuberculosis in mice and in macrophages. Its structure suggests it is an exporter. Rv1747 forms a two-gene operon with pknF coding for the serine/threonine protein kinase PknF, which positively modulates the function of the transporter. We show that deletion of Rv1747 or pknF results in a number of transcriptional changes which could be complemented by the wild type allele, most significantly up-regulation of the iniBAC genes. This operon is inducible by isoniazid and ethambutol and by a broad range of inhibitors of cell wall biosynthesis and is required for efflux pump functioning. However, neither the Rv1747 or pknF mutant showed increased susceptibility to a range of drugs and cell wall stress reagents including isoniazid and ethambutol, cell wall structure and cell division appear normal by electron microscopy, and no differences in lipoarabinomannan were found. Transcription from the pknF promoter was not induced by a range of stress reagents. We conclude that the loss of Rv1747 affects cell wall biosynthesis leading to the production of intermediates that cause induction of iniBAC transcription and implicates it in exporting a component of the cell wall, which is necessary for virulence. PMID:23915284

  17. Change in ATP-binding cassette B1/19, glutamine synthetase and alcohol dehydrogenase gene expression during root elongation in Betula pendula Roth and Alnus glutinosa L. Gaertn in response to leachate and leonardite humic substances.


    Tahiri, Abdelghani; Delporte, Fabienne; Muhovski, Yordan; Ongena, Marc; Thonart, Philippe; Druart, Philippe


    Humic substances (HS) are complex and heterogeneous compounds of humified organic matter resulting from the chemical and microbiological decomposition of organic residues. HS have a positive effect on plant growth and development by improving soil structure and fertility. They have long been recognized as plant growth-promoting substances, particularly with regard to influencing nutrient uptake, root growth and architecture. The biochemical and molecular mechanisms through which HS influence plant physiology are not well understood. This study evaluated the bioactivity of landfill leachate and leonardite HS on alder (Alnus glutinosa L. Gaertn) and birch (Betula pendula Roth) during root elongation in vitro. Changes in root development were studied in relation to auxin, carbon and nitrogen metabolisms, as well as to the stress adaptive response. The cDNA fragments of putative genes encoding two ATP-binding cassette (ABC) transporters (ABCB1 and ABCB19) belonging to the B subfamily of plant ABC auxin transporters were cloned and sequenced. Molecular data indicate that HS and their humic acid (HA) fractions induce root growth by influencing polar auxin transport (PAT), as illustrated by the modulation of the ABCB transporter transcript levels (ABCB1 and ABCB19). There were also changes in alcohol dehydrogenase (ADH) and glutamine synthetase (GS) gene transcript levels in response to HS exposure. These findings confirmed that humic matter affects plant growth and development through various metabolic pathways, including hormonal, carbon and nitrogen metabolisms and stress response or signalization.

  18. Functional Dynamics Revealed by the Structure of the SufBCD Complex, a Novel ATP-binding Cassette (ABC) Protein That Serves as a Scaffold for Iron-Sulfur Cluster Biogenesis*

    PubMed Central

    Hirabayashi, Kei; Yuda, Eiki; Tanaka, Naoyuki; Katayama, Sumie; Iwasaki, Kenji; Matsumoto, Takashi; Kurisu, Genji; Outten, F. Wayne; Fukuyama, Keiichi; Takahashi, Yasuhiro; Wada, Kei


    ATP-binding cassette (ABC)-type ATPases are chemomechanical engines involved in diverse biological pathways. Recent genomic information reveals that ABC ATPase domains/subunits act not only in ABC transporters and structural maintenance of chromosome proteins, but also in iron-sulfur (Fe-S) cluster biogenesis. A novel type of ABC protein, the SufBCD complex, functions in the biosynthesis of nascent Fe-S clusters in almost all Eubacteria and Archaea, as well as eukaryotic chloroplasts. In this study, we determined the first crystal structure of the Escherichia coli SufBCD complex, which exhibits the common architecture of ABC proteins: two ABC ATPase components (SufC) with function-specific components (SufB-SufD protomers). Biochemical and physiological analyses based on this structure provided critical insights into Fe-S cluster assembly and revealed a dynamic conformational change driven by ABC ATPase activity. We propose a molecular mechanism for the biogenesis of the Fe-S cluster in the SufBCD complex. PMID:26472926

  19. The bovine ATP-binding cassette transporter ABCG2 Tyr581Ser single-nucleotide polymorphism increases milk secretion of the fluoroquinolone danofloxacin.


    Otero, Jon A; Real, Rebeca; de la Fuente, Álvaro; Prieto, Julio G; Marqués, Margarita; Álvarez, Ana I; Merino, Gracia


    The bovine adenosine triphosphate-binding cassette transporter G2 (ABCG2/breast cancer resistance protein) polymorphism Tyr581Ser (Y581S) has recently been shown to increase in vitro transepithelial transport of antibiotics. Since this transporter has been extensively related to the active secretion of drugs into milk, the potential in vivo effect of this polymorphism on secretion of xenobiotics in livestock could have striking consequences for milk production, the dairy industry, and public health. Our purpose was to study the in vivo effect of this polymorphism on the secretion of danofloxacin, a widely used veterinary antibiotic, into milk. Danofloxacin (1.25 mg/kg) was administered to six Y/Y 581 homozygous and six Y/S 581 heterozygous lactating cows, and plasma and milk samples were collected and analyzed by high-performance liquid chromatography. No differences were found in the pharmacokinetic parameters of danofloxacin in plasma between the two groups of animals. In contrast, Y/S heterozygous cows showed a 2-fold increase in danofloxacin levels in milk. In addition, the pharmacokinetic elimination parameters, mean residence time and elimination half-life, were significantly lower in the milk of the animals carrying the Y/S polymorphism. These in vivo results are in agreement with our previously published in vitro data, which showed a greater capacity of the S581 variant in accumulation assays, and demonstrate, for the first time, an important effect of the Y581S single-nucleotide polymorphism on antibiotic secretion into cow milk. These findings could be extended to other ABCG2 substrates, and may be relevant for the treatment of mastitis and for the design of accurate and novel strategies to handle milk residues.

  20. Quercetin up-regulates expressions of peroxisome proliferator-activated receptor γ, liver X receptor α, and ATP binding cassette transporter A1 genes and increases cholesterol efflux in human macrophage cell line.


    Lee, Seung-Min; Moon, Jiyoung; Cho, Yoonsu; Chung, Ji Hyung; Shin, Min-Jeong


    Cholesterol-laden macrophages trigger accumulation of foam cells and increase the risk of developing atherosclerosis. We hypothesized that quercetin could lower the content of cholesterol in macrophages by regulating the expression of the ATP binding cassette transporter A1 (ABCA1) gene in differentiated human acute monocyte leukemia cell line (THP-1) cells and thereby reducing the chance of forming foam cells. Quercetin, in concentrations up to 30 μM, was not cytotoxic to differentiated THP-1 cells. Quercetin up-regulated both ABCA1 messenger RNA and protein expression in differentiated THP-1 cells, and its maximum effects were demonstrated at 0.3 μM for 4 to 8 hours in incubation. In addition, quercetin increased protein levels of peroxisome proliferator-activated receptor γ (PPARγ) and liver X receptor α (LXRα) within 2 hours of treatment. Because PPARγ and LXRα are important transcriptional factors for ABCA1, quercetin-induced up-regulation of ABCA1 may be mediated by increased expression levels of the PPARγ and LXRα genes. Furthermore, quercetin-enhanced cholesterol efflux from differentiated THP-1 cells to both high-density lipoprotein (HDL) and apolipoprotein A1. Quercetin at the dose of 0.15 μM elevated the cholesterol efflux only for HDL. At the dose of 0.3 μM, quercetin demonstrated effects both on HDL and apolipoprotein A1. Our data demonstrated that quercetin increased the expressions of PPARγ, LXRα, and ABCA1 genes and cholesterol efflux from THP-1 macrophages. Quercetin-induced expression of PPARγ and LXRα might subsequently affect up-regulation of their target gene ABCA1. Taken together, ingestion of quercetin or quercetin-rich foods could be an effective way to improve cholesterol efflux from macrophages, which would contribute to lowering the risk of atherosclerosis.

  1. Inducer exclusion in Firmicutes: Insights into the regulation of a carbohydrate ATP binding cassette transporter from Lactobacillus casei BL23 by the signal transducing protein P-Ser46-HPr.


    Homburg, Constanze; Bommer, Martin; Wuttge, Steven; Hobe, Carolin; Beck, Sebastian; Dobbek, Holger; Deutscher, Josef; Licht, Anke; Schneider, Erwin


    Catabolite repression is a mechanism that enables bacteria to control carbon utilization. As part of this global regulatory network, components of the phosphoenolpyruvate:carbohydrate phosphotransferase system inhibit the uptake of less favourable sugars when a preferred carbon source such as glucose is available. This process is termed inducer exclusion. In bacteria belonging to the phylum Firmicutes, HPr, phosphorylated at serine 46 (P-Ser46-HPr) is the key player but its mode of action is elusive. To address this question at the level of purified protein components, we have chosen a homolog of the E. coli maltose/maltodextrin ATP-binding cassette transporter from Lactobacillus casei (MalE1-MalF1G1K12 ) as a model system. We show that the solute binding protein, MalE1, binds linear and cyclic maltodextrins but not maltose. Crystal structures of MalE1 complexed with these sugars provide a clue why maltose is not a substrate. P-Ser46-HPr inhibited MalE1/maltotetraose-stimulated ATPase activity of the transporter incorporated in proteoliposomes. Furthermore, cross-linking experiments revealed that P-Ser46-HPr contacts the nucleotide-binding subunit, MalK1, in proximity to the Walker A motif. However, P-Ser46-HPr did not block binding of ATP to MalK1. Together, our findings provide first biochemical evidence that P-Ser-HPr arrests the transport cycle by preventing ATP hydrolysis at the MalK1 subunits of the transporter. This article is protected by copyright. All rights reserved.

  2. Natural allelic variants of bovine ATP-binding cassette transporter ABCG2: increased activity of the Ser581 variant and development of tools for the discovery of new ABCG2 inhibitors.


    Merino, Gracia; Real, Rebeca; Baro, Marta F; Gonzalez-Lobato, Lucia; Prieto, Julio G; Alvarez, Ana I; Marques, Margarita M


    ATP-binding cassette transporter ABCG2 [breast cancer resistance protein (BCRP)] is a member of the ABC transporter superfamily that actively extrudes xenotoxins from cells and is a major determinant of the bioavailability of many compounds. ABCG2 expression is strongly induced during lactation in the mammary gland and is related to the active secretion of drugs into the milk. The presence of drug residues and environmental pollutants in milk is an outstanding problem for human milk consumption and milk industrial processes, involving important risks to public health and the dairy industry. In cows, a single nucleotide polymorphism (SNP) in this protein has been described previously (Tyr581) and is associated with higher fat and protein percentages and lower milk yield. However, whether this amino acid substitution affects ABCG2-mediated drug transport in cows, including milk secretion, required further exploration. We cloned the two variants of bovine ABCG2 and evaluated the effect of this SNP on mitoxantrone accumulation assays performed in ovine primary fibroblasts transiently expressing either of the variants. It is interesting to note that statistically significant differences in activity between both variants were observed, and the Ser581 variant was related with an increased efflux activity. In addition, we demonstrated that genistein is a very good inhibitor of bovine ABCG2 and identified new inhibitors of the transporter, such as the macrocyclic lactones, ivermectin, and selamectin. Moreover, the inhibitory effect of these compounds on human and murine ABCG2 homologs was confirmed using transduced Marbin-Dabin canine kidney II cells. These findings may have important implications regarding the presence of drug residues in milk and drug interactions affecting the pharmacological behavior of ABCG2 substrates.

  3. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.


    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P


    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have therefore investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies therefore reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages. This article is protected by copyright. All rights reserved.

  4. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.


    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P


    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have, therefore, investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies, therefore, reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages.

  5. Modulation of microRNA Expression in Subjects with Metabolic Syndrome and Decrease of Cholesterol Efflux from Macrophages via microRNA-33-Mediated Attenuation of ATP-Binding Cassette Transporter A1 Expression by Statins

    PubMed Central

    Tseng, Pei-Chi; Lee, Tzong-Shyuan; Lee, Wen-Jane; Chang, Pey-Jium; Chiang, An-Na


    Metabolic syndrome (MetS) is a complicated health problem that encompasses a variety of metabolic disorders. In this study, we analyzed the relationship between the major biochemical parameters associated with MetS and circulating levels of microRNA (miR)-33, miR-103, and miR-155. We found that miRNA-33 levels were positively correlated with levels of fasting blood glucose, glycosylated hemoglobin A1c, total cholesterol, LDL-cholesterol, and triacylglycerol, but negatively correlated with HDL-cholesterol levels. In the cellular study, miR-33 levels were increased in macrophages treated with high glucose and cholesterol-lowering drugs atorvastatin and pitavastatin. miR-33 has been reported to play an essential role in cholesterol homeostasis through ATP-binding cassette transporter A1 (ABCA1) regulation and reverse cholesterol transport. However, the molecular mechanism underlying the linkage between miR-33 and statin treatment remains unclear. In the present study, we investigated whether atorvastatin and pitavastatin exert their functions through the modulation of miR-33 and ABCA1-mediated cholesterol efflux from macrophages. The results showed that treatment of the statins up-regulated miR-33 expression, but down-regulated ABCA1 mRNA levels in RAW264.7 cells and bone marrow-derived macrophages. Statin-mediated ABCA1 regulation occurs at the post-transcriptional level through targeting of the 3′-UTR of the ABCA1 transcript by miR-33. Additionally, we found significant down-regulation of ABCA1 protein expression in macrophages treated with statins. Finally, we showed that high glucose and statin treatment significantly suppressed cholesterol efflux from macrophages. These findings have highlighted the complexity of statins, which may exert detrimental effects on metabolic abnormalities through regulation of miR-33 target genes. PMID:27139226

  6. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.


    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O


    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia.

  7. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia*

    PubMed Central

    Dong, Qian; Ernst, Sarah E.; Ostedgaard, Lynda S.; Shah, Viral S.; Ver Heul, Amanda R.; Welsh, Michael J.; Randak, Christoph O.


    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P1,P5-di(adenosine-5′) pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5′-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5′-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl− channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. PMID:25887396

  8. Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice.


    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Park, Bo-Kyoung; Hahn, Tae-Wook


    Brucella abortus RB51 is an attenuated vaccine strain that has been most frequently used for bovine brucellosis. Although it is known to provide good protection in cattle, it still has some drawbacks including resistance to rifampicin, residual virulence and pathogenicity in humans. Thus, there has been a continuous interest on new safe and effective bovine vaccine candidates. In the present study, we have constructed unmarked mutants by deleting singly cydD and cydC genes, which encode ATP-binding cassette transporter proteins, from the chromosome of the virulent Brucella abortus isolate from Korean cow (referred to as IVK15). Both IVK15ΔcydD and ΔcydC mutants showed increased sensitivity to metal ions, hydrogen peroxide and acidic pH, which are mimic to intracellular environment during host infection. Additionally, the mutants exhibited a significant growth defect in RAW264.7 cells and greatly attenuated in mice. Vaccination of mice with either IVK15ΔcydC or IVK15ΔcydD mutant could elicit an anti-Brucella specific immunoglobulin G (IgG) and IgG subclass responses as well as enhance the secretion of interferon-gamma, and provided better protection against challenge with B. abortus strain 2308 than with the commercial B. abortus strain RB51 vaccine. Collectively, these results suggest that both IVK15ΔcydC and IVK15ΔcydD mutants could be an attenuated vaccine candidate against B. abortus.

  9. Phytosterols reduce cholesterol absorption by inhibition of 27-hydroxycholesterol generation, liver X receptor α activation, and expression of the basolateral sterol exporter ATP-binding cassette A1 in Caco-2 enterocytes.


    Brauner, Reinhard; Johannes, Christian; Ploessl, Florian; Bracher, Franz; Lorenz, Reinhard L


    Phytosterol-enriched foods are increasingly marketed to lower cholesterol levels and atherosclerosis in the general population. Phytosterols reduce cholesterol absorption, but the molecular mechanism is controversial. We therefore investigated the phytosterol effects on cholesterol metabolism in human enterocyte, hepatocyte, and macrophage models relevant for sterol absorption, reverse transport, and excretion. Isomolar sitosterol (50 μmol/L) was less effectively taken up by enterocytes than cholesterol but suppressed apical cholesterol uptake by 50% (P < 0.01) and basolateral secretion by two-thirds (P < 0.01) whether added in micelles or ethanol or complexed to cyclodextrin. In contrast, enterocytes handled nanomolar (3)H-sitosterol similarly to cholesterol. Enterocytes selectively oxidized all sterols to 27-hydroxy- and 27-carboxy-sterols. Conversion rates were much lower for sitosterol (0.05 ± 0.02 nmol/mg protein) and campesterol (0.48 ± 0.10) compared with cholesterol (3.73 ± 0.60) (P < 0.001). 27-Hydroxycholesterol (27OH-C) activated liver-X-receptor alpha (LXRα) (P < 0.01) and stimulated ATP-binding cassette transporter (ABC) A1 expression (P < 0.001) and basolateral systemic cholesterol secretion from enterocytes (P < 0.05). In co-incubations, phytosterols inhibited 27OH-C generation by sterol 27-hydroxylase (P < 0.001) and reduced LXRα-mediated ABCA1 expression (P < 0.01) and basolateral systemic cholesterol secretion. In contrast, ABCG8 transcription and apical sterol resecretion was unchanged by LXRα activation in human enterocytes. Exogenous LXRα agonists reverted sterol selectivity and phytosterol cholesterol interaction. Due to constitutive apical expression of ABCG5/G8 and LXRα-enhanced basolateral expression of ABCA1 in enterocytes, interference of phytosterols with the generation of the dominating LXRα-agonist 27OH-C blocks the self-priming component of cholesterol absorption. This local LXRα antagonism of dietary phytosterols

  10. Hospicells promote upregulation of the ATP-binding cassette genes by insulin-like growth factor-I via the JAK2/STAT3 signaling pathway in an ovarian cancer cell line

    PubMed Central



    Interaction between tumor cells and their microenvironment has a crucial role in the development, progression and drug resistance of cancer. Our objective was to confirm the role of Hospicells, which are stromal cells from the cancer microenvironment, in drug resistance and tumor cell growth. We demonstrated that soluble factors secreted by Hospicells activate several genes and upregulate the JAK/STAT signaling pathway in ovarian cancer cell lines. Hospicells express all insulin-like growth factor (IGF) family as detected by gene array, RT-PCR, protein array and immunocytochemistry. While focusing attention on the microenvironment, we considered the role of IGF-I in proliferation and survival of ovarian cancer cells. Indeed, IGF-I is a major regulator of different stages of cancer development. We studied the effect of exogenously added IGF-I on the regulation of ATP-binding cassette (ABC) genes (MDR1, MRP1, MRP2, MRP3, MRP5 and BCRP) in the ovarian cancer cell line OVCAR3 and validated the results obtained using the IGF-IR antagonist picropodophyllin. IGF-I regulates the expression of ABC genes in OVCAR3 cells via the PI3-kinase, MEK and JAK2/STAT3 signaling pathways. The OVCAR3 cell line when co-cultured with Hospicells showed a marked degree of drug resistance. The drug resistance observed could be amplified with exogenous IGF-I. Addition of IGF-IR inhibitor, however, reduced the degree of resistance in these exposed cells. Cells that were treated with anticancer drugs and then exposed to IGF-I showed an increase in drug resistance and, thereby, an increase in cell survival. This observation indicates that drug resistance of OVCAR3 cells increases when there is synergy between OVCAR3 cells and Hospicells and it is amplified when IGF-I was exogenously added. In conclusion, inhibition of IGF-IR and targeting of the JAK2/STAT3 signaling pathway can be a target for ovarian cancer therapy. PMID:23857432

  11. Pharmacophore modeling of nilotinib as an inhibitor of ATP-binding cassette drug transporters and BCR-ABL kinase using a three-dimensional quantitative structure-activity relationship approach.


    Shukla, Suneet; Kouanda, Abdul; Silverton, Latoya; Talele, Tanaji T; Ambudkar, Suresh V


    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure-activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [(125)I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  12. Pharmacophore Modeling of Nilotinib as an Inhibitor of ATP-Binding Cassette Drug Transporters and BCR-ABL Kinase Using a Three-Dimensional Quantitative Structure–Activity Relationship Approach

    PubMed Central


    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure–activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [125I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  13. Co-expression of pregnane X receptor and ATP-binding cassette sub-family B member 1 in peripheral blood: A prospective indicator for drug resistance prediction in non-small cell lung cancer

    PubMed Central



    The aim of the present study was to investigate the protein expression profiling of pregnane X receptor (PXR) and ATP-binding cassette sub-family B member 1 (ABCB1; also known as MDR1 or P-gp), present in the peripheral blood mononuclear cells (PBMCs) and cancerous tissues of cases of non-small cell lung cancer (NSCLC). Furthermore, the study aimed to assess the feasibility of predicting drug resistance through the medium of PBMCs. Of the subjects included in the study, 37 were histopathologically diagnosed with NSCLC and 17 were control patients without cancer. ThinPrep liquid-based smears with cytosine were applied in the examination of the PBMCs and proved quite effective in preserving the morphology and surface antigens of the lymphocytes. Measurements of expression levels in the PBMCs and cancerous tissues were obtained by immunohistochemical means. The results showed that, with the exception of the selective PXR expression in the normal lung tissues, the two types of proteins existed extensively throughout the PBMCs, normal tissues and tumors. Among the cancer patients, prior to chemotherapy, a significant rise in ABCB1 expression could be observed in the PBMCs, together with a similar rise in ABCB1 and PXR expression in the tumor specimens. Marked upregulation of the two proteins was detected in the PBMCs following 1 cycle of first-line chemotherapy. ABCB1 expression, correlated with PXR, persisted mostly in the PBMCs and tissue samples. When bound to and activated by ligands, PXR translocates from the cytoplasm to the nucleus of the cells. PXR subsequently binds to its DNA response elements as a heterodimer with the retinoid X receptor. A PXR translocation of moderate or low differentiation was identified in 3 cases of adenocarcinoma, which were co-expressing the two genes in the PBMCs prior to chemotherapy. During follow-up visits, tumor recurrence was observed within 3 months in 5 cases, which were characterized by PXR translocation. These findings

  14. Co-expression of pregnane X receptor and ATP-binding cassette sub-family B member 1 in peripheral blood: A prospective indicator for drug resistance prediction in non-small cell lung cancer.


    Kong, Qingnuan; Han, Zenglei; Zuo, Xiaoli; Wei, Hongjun; Huang, Weiqing


    The aim of the present study was to investigate the protein expression profiling of pregnane X receptor (PXR) and ATP-binding cassette sub-family B member 1 (ABCB1; also known as MDR1 or P-gp), present in the peripheral blood mononuclear cells (PBMCs) and cancerous tissues of cases of non-small cell lung cancer (NSCLC). Furthermore, the study aimed to assess the feasibility of predicting drug resistance through the medium of PBMCs. Of the subjects included in the study, 37 were histopathologically diagnosed with NSCLC and 17 were control patients without cancer. ThinPrep liquid-based smears with cytosine were applied in the examination of the PBMCs and proved quite effective in preserving the morphology and surface antigens of the lymphocytes. Measurements of expression levels in the PBMCs and cancerous tissues were obtained by immunohistochemical means. The results showed that, with the exception of the selective PXR expression in the normal lung tissues, the two types of proteins existed extensively throughout the PBMCs, normal tissues and tumors. Among the cancer patients, prior to chemotherapy, a significant rise in ABCB1 expression could be observed in the PBMCs, together with a similar rise in ABCB1 and PXR expression in the tumor specimens. Marked upregulation of the two proteins was detected in the PBMCs following 1 cycle of first-line chemotherapy. ABCB1 expression, correlated with PXR, persisted mostly in the PBMCs and tissue samples. When bound to and activated by ligands, PXR translocates from the cytoplasm to the nucleus of the cells. PXR subsequently binds to its DNA response elements as a heterodimer with the retinoid X receptor. A PXR translocation of moderate or low differentiation was identified in 3 cases of adenocarcinoma, which were co-expressing the two genes in the PBMCs prior to chemotherapy. During follow-up visits, tumor recurrence was observed within 3 months in 5 cases, which were characterized by PXR translocation. These findings

  15. Kaempferol suppresses lipid accumulation in macrophages through the downregulation of cluster of differentiation 36 and the upregulation of scavenger receptor class B type I and ATP-binding cassette transporters A1 and G1.


    Li, Xiu-Ying; Kong, Ling-Xi; Li, Juan; He, Hai-Xia; Zhou, Yuan-Da


    The accumulation of foam cells in atherosclerotic lesions is a hallmark of early-stage atherosclerosis. Kaempferol has been shown to inhibit oxidized low-density lipoprotein (oxLDL) uptake by macrophages; however, the underlying molecular mechanisms are not yet fully investigated. In this study, we shown that treatment with kaempferol markedly suppresses oxLDL-induced macrophage foam cell formation, which occurs due to a decrease in lipid accumulation and an increase in cholesterol efflux from THP-1-derived macrophages. Additionally, the kaempferol treatment of macrophages led to the downregulation of cluster of differentiation 36 (CD36) protein levels, the upregulation of ATP-binding cassette (ABC) transporter A1 (ABCA1), scavenger receptor class B type I (SR-BI) and ABCG1 protein levels, while no effects on scavenger receptor A (SR-A) expression were observed. Kaempferol had similar effects on the mRNA and protein expression of ABCA1, SR-BI, SR-A, CD36 and ABCG1. The reduced CD36 expression following kaempferol treatment involved the inhibition of c-Jun-activator protein-1 (AP-1) nuclear translocation. The inhibition of AP-1 using the inhibitor, SP600125, confirmed this involvement, as the AP-1 inhibition significantly augmented the kaempferol-induced reduction in CD36 expression. Accordingly, the kaempferol-mediated suppression of lipid accumulation in macrophages was also augmented by SP600125. The increased expression of ABCA1, SR-BI and ABCG1 following kaempferol treatment was accompanied by the enhanced protein expression of heme oxygenase-1 (HO-1). This increase was reversed following the knockdown of the HO-1 gene using small hairpin RNA (shRNA). Moreover, the kaempferol-mediated attenuation of lipid accumulation and the promotion of cholesterol efflux was also inhibited by HO-1 shRNA. In conclusion, the c-Jun-AP‑1-dependent downregulation of CD36 and the HO-1-dependent upregulation of ABCG1, SR-BI and ABCA1 may mediate the beneficial effects of

  16. Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.


    Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K


    The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium.

  17. AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana

    PubMed Central

    Gaillard, Stéphane; Jacquet, Hélène; Vavasseur, Alain; Leonhardt, Nathalie; Forestier, Cyrille


    Background ABC proteins constitute one of the largest families of transporters found in all living organisms. In Arabidopsis thaliana, 120 genes encoding ABC transporters have been identified. Here, the characterization of one member of the MRP subclass, AtMRP6, is described. Results This gene, located on chromosome 3, is bordered by AtMRP3 and AtMRP7. Using real-time quantitative PCR (RT-Q-PCR) and the GUS reporter gene, we found that this gene is essentially expressed during early seedling development, in the apical meristem and at initiation point of secondary roots, especially in xylem-opposite pericycle cells where lateral roots initiate. The level of expression of AtMRP6 in response to various stresses was explored and a significant up-regulation after cadmium (Cd) treatment was detected. Among the three T-DNA insertion lines available from the Salk Institute library, two knock-out mutants, Atmrp6.1 and Atmrp6.2 were invalidated for the AtMRP6 gene. In the presence of Cd, development of leaves was more affected in the mutants than wild-type plants, whereas root elongation and ramification was comparable. Conclusion The position of AtMRP6 on chromosome 3, flanked by two other MRP genes, (all of which being induced by Cd) suggests that AtMRP6 is part of a cluster involved in metal tolerance, although additional functions in planta cannot be discarded. PMID:18307782

  18. MicroRNA-320a and microRNA-4496 attenuate Helicobacter pylori cytotoxin-associated gene A (CagA)-induced cancer-initiating potential and chemoresistance by targeting β-catenin and ATP-binding cassette, subfamily G, member 2.


    Kang, Dong Woo; Yang, Eun Sun; Noh, Yu Na; Hwang, Won Chan; Jo, Se-Young; Suh, Young-Ah; Park, Won Sang; Choi, Kang-Yell; Min, Do Sik


    Infection with Helicobacter pylori is closely linked to an increased risk of gastric cancer. Although cytotoxin-associated gene A (CagA), a major virulence factor of H. pylori, is known to be a causal factor for gastric carcinogenesis, the molecular link between CagA and gastric cancer-initiating cell (CIC)-like properties remains elusive. Here, we demonstrate that CagA is required for increased expression of β-catenin and its target CIC markers via downregulation of microRNA (miR)-320a and miR-4496. CagA promoted gastric CIC properties and was responsible for chemoresistance. miR-320a and miR-4496 attenuated the in vitro self-renewal and tumour-initiating capacity of CagA-expressing CICs by targeting β-catenin. Moreover, miR-320a and miR-4496 decreased CagA-induced chemoresistance by targeting ATP-binding cassette, subfamily G, member 2 (ABCG2) at the transcriptional and post-transcriptional levels, respectively. Combination therapy with 5-fluorouracil and miR-320a/miR-4496 suppressed gastric tumourigenesis and metastatic potential in an orthotopic mouse model, probably via suppression of CagA-induced CIC properties and chemoresistance. Our results provide novel evidence that CIC properties, chemoresistance and tumourigenesis associated with H. pylori are linked to CagA-induced upregulation of β-catenin and ABCG2. These data provide novel insights into the molecular mechanisms of CagA-induced carcinogenisis and the therapeutic potential of of miR-320a and miR-4496. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  19. The power stroke driven by ATP binding in CFTR as studied by molecular dynamics simulations.


    Furukawa-Hagiya, Tomoka; Furuta, Tadaomi; Chiba, Shuntaro; Sohma, Yoshiro; Sakurai, Minoru


    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the ATP binding cassette (ABC) protein superfamily. Currently, it remains unclear how ATP binding causes the opening of the channel gate at the molecular level. To clarify this mechanism, we first constructed an atomic model of the inward-facing CFTR using the X-ray structures of other ABC proteins. Molecular dynamics (MD) simulations were then performed to explore the structure and dynamics of the inward-facing CFTR in a membrane environment. In the MgATP-bound state, two nucleotide-binding domains (NBDs) formed a head-to-tail type of dimer, in which the ATP molecules were sandwiched between the Walker A and signature motifs. Alternatively, one of the final MD structures in the apo state was similar to that of a "closed-apo" conformation found in the X-ray analysis of ATP-free MsbA. Principal component analysis for the MD trajectory indicated that NBD dimerization causes significant structural and dynamical changes in the transmembrane domains (TMDs), which is likely indicative of the formation of a chloride ion access path. This study suggests that the free energy gain from ATP binding acts as a driving force not only for NBD dimerization but also for NBD-TMD concerted motions.

  20. Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.


    Bompadre, Silvia G; Hwang, Tzyh-Chang


    The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

  1. Functionally Important ATP Binding and Hydrolysis Sites in Escherichia coli MsbA †

    PubMed Central

    Westfahl, Kathryn M.; Merten, Jacqueline A.; Buchaklian, Adam H.; Klug, Candice S.


    ATP-binding cassette (ABC) transporters make up one of the largest classes of proteins found in nature, and their ability to move a variety of substrates across the membrane using energy from the binding or hydrolysis of ATP is essential to an array of human pathologies and to bacterial viability. MsbA is an essential ABC transporter that specifically transports lipid A across the inner membranes of Gram-negative organisms such as Escherichia coli. The exact mechanisms of function during the binding and hydrolysis of ATP at the molecular level remain unclear. The studies presented and summarized in this work directly address the role and local dynamics of specific residues within the conserved ABC motifs in E. coli MsbA using in vivo growth and biochemical activity assays coupled with site-directed spin labeling electron paramagnetic resonance (EPR) spectroscopy motional and accessibility analysis. This first comprehensive analysis of the specific residues in these motifs within MsbA indicates that closure of the dimer interface does not occur upon ATP binding in this transporter. PMID:19053284

  2. About a switch: how P-glycoprotein (ABCB1) harnesses the energy of ATP binding and hydrolysis to do mechanical work.


    Sauna, Zuben E; Ambudkar, Suresh V


    The efflux of drugs by the multidrug transporter P-glycoprotein (Pgp; ABCB1) is one of the principal means by which cancer cells evade chemotherapy and exhibit multidrug resistance. Mechanistic studies of Pgp-mediated transport, however, transcend the importance of this protein per se as they help us understand the transport pathway of the ATP-binding cassette proteins in general. The ATP-binding cassette proteins comprise one of the largest protein families, are central to cellular physiology, and constitute important drug targets. The functional unit of Pgp consists of two nucleotide-binding domains (NBD) and two transmembrane domains that are involved in the transport of drug substrates. Early studies postulated that conformational changes as a result of ATP hydrolysis were transmitted to the transmembrane domains bringing about drug transport. More recent structural and biochemical studies on the other hand suggested that ATP binds at the interface of the two NBDs and induces the formation of a closed dimer, and it has been hypothesized that this dimerization and subsequent ATP hydrolysis powers transport. Based on the mutational and biochemical work on Pgp and structural studies with isolated NBDs, we review proposed schemes for the catalytic cycle of ATP hydrolysis and the transport pathway.

  3. ATP-binding cassette G5/G8 deficiency causes hypertriglyceridemia by affecting multiple metabolic pathways.


    Méndez-González, Jesús; Julve, Josep; Rotllan, Noemí; Llaverias, Gemma; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles


    Mutations in ABCG5 or ABCG8 transporters are responsible for sitosterolemia, an autosomal recessive disease characterized by the accumulation of plant sterols. The aim of this study was to investigate the effects of ABCG5 and ABCG8 deficiency on TG metabolism in mice. Experiments were carried out in wild-type (G5/G8+/+) mice, mice heterozygous for ABCG5 and ABCG8 deficiency (G5/G8+/-) and ABCG5/G8-deficient (G5/G8-/-) mice fed a chow diet. Plasma TG were 2.6 and 4.3-fold higher in fasted G5/G8+/- and G5/G8-/- mice, respectively, than in G5/G8+/+ mice. Postprandial TG were 5-fold higher in G5/G8-/- mice. TG metabolism studies indicate that: first, the fractional catabolic rate was significantly lower in G5/G8+/- (1.3-fold) and G5/G8-/- mice (1.5-fold) compared to G5/G8+/+ and postheparin plasma lipoprotein lipase activities were significantly lower in G5/G8+/- (1.8-fold) and G5/G8-/- mice (5.4-fold) than in G5/G8+/+. Second, liver TG secretion was 1.3-fold higher in G5/G8+/- and G5/G8-/- than in G5/G8+/+ mice and this was associated with an increase in liver LXR, FAS, ACAC and CD36 gene expression. Third, TG intestinal secretion, determined after an oral fat gavage of glycerol tri[9,10(n)-(3)H] oleate, was 5.8-fold higher in G5/G8-/- than in G5/G8+/+ mice. Also, the HOMA index was 2.6-fold higher in G5/G8-/- than in G5/G8+/+ mice, reflecting a degree of insulin resistance. In conclusion, ABCG5/G8 deficiency in mice fed a chow diet markedly raises TG levels by impairing TG catabolism and by increasing liver and intestinal TG secretion.

  4. The ABCC6 transporter: what lessons can be learnt from other ATP-binding cassette transporters?

    PubMed Central

    Vanakker, Olivier M.; Hosen, Mohammad J.; Paepe, Anne De


    ABC transporters represent a large family of ATP-driven transmembrane transporters involved in uni- or bidirectional transfer of a large variety of substrates. Divided in seven families, they represent 48 transporter proteins, several of which have been associated with human disease. Among the latter is ABCC6, a unidirectional exporter protein primarily expressed in liver and kidney. ABCC6 deficiency has been shown to cause the ectopic mineralization disorder pseudoxanthoma elasticum (PXE), characterized by calcification and fragmentation of elastic fibers, resulting in oculocutaneous and cardiovascular symptoms. Unique in the group of connective tissue disorders, the pathophysiological relation between the ABCC6 transporter and ectopic mineralization in PXE remains enigmatic, not in the least because of lack of knowledge on the substrate(s) of ABCC6 and its unusual expression pattern. Because many features, including structure and transport mechanism, are shared by many ABC transporters, it is worthwhile to evaluate if and to what extent the knowledge on the physiology and pathophysiology of these other transporters may provide useful clues toward understanding the (patho)physiological role of ABCC6 and how its deficiency may be dealt with. PMID:24137173

  5. Marine medaka ATP-binding cassette (ABC) superfamily and new insight into teleost Abch nomenclature

    PubMed Central

    Jeong, Chang-Bum; Kim, Bo-Mi; Kang, Hye-Min; Choi, Ik-Young; Rhee, Jae-Sung; Lee, Jae-Seong


    The ABC gene family is recognized as one of the largest gene families in all kingdoms of life. Although many genes involved in the ABC superfamily have been annotated from several fish species, information on large sets of the ABC superfamily and their evolutionary characterization are still unclear. In the marine medaka Oryzias melastigma, 50 ABC transporters were identified with bioinformatics-aided in silico analyses, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that they could be classified into the eight subfamilies (A–H) that include all members of all ABC subfamilies. Interestingly, several teleosts’ Abcg members were closely clustered with Abch members in a distinctive clade. The abch gene was also observed in the coelacanth and the spotted gar, suggesting that this gene was retained from a bilaterian ancestor and that a gene loss event recently occurred in the tetrapod lineage. In teleosts, the nomenclature of previously annotated abcg genes should be considered carefully, as they form a distinctive clade with the marine medaka abch subfamily and other teleost abch genes, but not with the members of the Abcg subfamily. PMID:26472499

  6. ATP-binding cassette transporter enhances tolerance to DDT in Tetrahymena.


    Ning, YingZhi; Dang, Huai; Liu, GuangLong; Xiong, Jie; Yuan, DongXia; Feng, LiFang; Miao, Wei


    The reuse of dichlorodiphenyltrichloroethane (DDT) as an indoor residual spray was permitted by the World Health Organization in 2007, and approximately 14 countries still use DDT to control disease vectors. The extensive exposure of insects to DDT has resulted in the emergence of DDT resistance, especially in mosquitoes, and the mechanism for this resistance in mosquitoes has been widely reported. Spraying can also introduce DDT directly into surface water, and DDT can subsequently accumulate in microorganisms, but the mechanism for the resistance to DDT degradation in microorganisms is unclear. Using whole-genome microarray analysis, we detected an abcb15 gene that was up-regulated in a specific manner by DDT treatment in T. thermophile. The deduced ABCB15 peptide sequence had two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs) to form the structure TMD-NBD-TMD-NBD, and each NBD contained three conserved motifs: Walker-A, C-loop, and Walker-B, which indicated the T. thermophila abcb15 was a typical ABC transporter gene. The expression of ABCB15 fused with a C-terminal green fluorescent protein was found to be on the periphery of the cell, suggesting that ABCB15 was a membrane pump protein. In addition, cells with abcb15 partially knocked down (abcb15-KD) grew slower than wild-type cells in the presence of 256 mg L(-1) DDT, indicating the tolerance of abcb15-KD strain to DDT exposure was decreased. Thus, we suggest that in Tetrahymena, the membrane pump protein encoded by ABCT gene abcb15 can enhance the tolerance to DDT and protect cells from this exogenous toxin by efficiently pumping it to the extracellular space.

  7. ATP alone triggers the outward facing conformation of the maltose ATP-binding cassette transporter.


    Bao, Huan; Duong, Franck


    The maltose transporter MalFGK(2) is a study prototype for ABC importers. During catalysis, the MalFG membrane domain alternates between inward and outward facing conformations when the MalK dimer closes and hydrolyzes ATP. Because a rapid ATP hydrolysis depends on MalE and maltose, it has been proposed that closed liganded MalE facilitates the transition to the outward facing conformation. Here we find that, in contrast to the expected, ATP is sufficient for the closure of MalK and for the conversion of MalFG to the outward facing state. The outward facing transporter binds MalE with nanomolar affinity, yet neither MalE nor maltose is necessary or facilitates the transition. Thus, the rapid hydrolysis of ATP observed in the presence of MalE and maltose is not because closed liganded MalE accelerates the formation of the outward facing conformation. These findings have fundamental implications for the description of the transport reaction.

  8. A Plant Plasma Membrane ATP Binding Cassette–Type Transporter Is Involved in Antifungal Terpenoid Secretion

    PubMed Central

    Jasiński, Michal; Stukkens, Yvan; Degand, Hervé; Purnelle, Bénédicte; Marchand-Brynaert, Jacqueline; Boutry, Marc


    ATP binding cassette (ABC) transporters, which are found in all species, are known mainly for their ability to confer drug resistance. To date, most of the ABC transporters characterized in plants have been localized in the vacuolar membrane and are considered to be involved in the intracellular sequestration of cytotoxins. Working on the assumption that certain ABC transporters might be involved in defense metabolite secretion and their expression might be regulated by the concentration of these metabolites, we treated a Nicotiana plumbaginifolia cell culture with sclareolide, a close analog of sclareol, an antifungal diterpene produced at the leaf surface of Nicotiana spp; this resulted in the appearance of a 160-kD plasma membrane protein, which was partially sequenced. The corresponding cDNA (NpABC1) was cloned and shown to encode an ABC transporter. In vitro and in situ immunodetection showed NpABC1 to be localized in the plasma membrane. Under normal conditions, expression was found in the leaf epidermis. In cell culture and in leaf tissues, NpABC1 expression was strongly enhanced by sclareolide and sclareol. In parallel with NpABC1 induction, cells acquired the ability to excrete a labeled synthetic sclareolide derivative. These data suggest that NpABC1 is involved in the secretion of a secondary metabolite that plays a role in plant defense. PMID:11340184

  9. Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics.


    Pan, Lurong; Aller, Stephen G


    P-glycoprotein (Pgp) is an ATP-binding cassette (ABC) transporter that alternates between inward- and outward-facing conformations to capture and force substrates out of cells like a peristaltic pump. The high degree of similarity in outward-facing structures across evolution of ABC transporters allowed construction of a high-confidence outward-facing Pgp atomic model based on crystal structures of outward-facing Sav1866 and inward-facing Pgp. The model adhered to previous experimentally determined secondary- and tertiary- configurations during all-atom molecular dynamics simulations in the presence or absence of MgATP. Three long lasting (>100 ns) meta-stable states were apparent in the presence of MgATP revealing new insights into alternating access. The two ATP-binding pockets are highly asymmetric resulting in differential control of overall structural dynamics and allosteric regulation of the drug-binding pocket. Equilibrated Pgp has a considerably different electrostatic profile compared to Sav1866 that implicates significant kinetic and thermodynamic differences in transport mechanisms.

  10. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    NASA Astrophysics Data System (ADS)

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus


    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH. radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD.-, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396-. Its negative charge could trigger conformational changes necessary for signal transduction.

  11. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    PubMed Central

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus


    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH· radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD·−, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396−. Its negative charge could trigger conformational changes necessary for signal transduction. PMID:24898692

  12. Optimization of the degenerated interfacial ATP binding site improves the function of disease-related mutant cystic fibrosis transmembrane conductance regulator (CFTR) channels.


    Tsai, Ming-Feng; Jih, Kang-Yang; Shimizu, Hiroyasu; Li, Min; Hwang, Tzyh-Chang


    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, an ATP binding cassette (ABC) protein whose defects cause the deadly genetic disease cystic fibrosis (CF), encompasses two nucleotide binding domains (NBD1 and NBD2). Recent studies indicate that in the presence of ATP, the two NBDs coalesce into a dimer, trapping an ATP molecule in each of the two interfacial composite ATP binding sites (site 1 and site 2). Experimental evidence also suggests that CFTR gating is mainly controlled by ATP binding and hydrolysis in site 2, whereas site 1, which harbors several non-canonical substitutions in ATP-interacting motifs, is considered degenerated. The CF-associated mutation G551D, by introducing a bulky and negatively charged side chain into site 2, completely abolishes ATP-induced openings of CFTR. Here, we report a strategy to optimize site 1 for ATP binding by converting two amino acid residues to ABC consensus (i.e. H1348G) or more commonly seen residues in other ABC proteins (i.e. W401Y,W401F). Introducing either one or both of these mutations into G551D-CFTR confers ATP responsiveness for this disease-associated mutant channel. We further showed that the same maneuver also improved the function of WT-CFTR and the most common CF-associated ΔF508 channels, both of which rely on site 2 for gating control. Thus, our results demonstrated that the degenerated site 1 can be rebuilt to complement or support site 2 for CFTR function. Possible approaches for developing CFTR potentiators targeting site 1 will be discussed.

  13. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.


    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  14. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric


    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  15. Cassette Books.

    ERIC Educational Resources Information Center

    Library of Congress, Washington, DC. National Library Service for the Blind and Physically Handicapped.

    This catalog lists cassette books produced by the National Library Service for the Blind and Physically Handicapped during 1989. Books are listed alphabetically within subject categories under nonfiction and fiction headings. Nonfiction categories include: animals and wildlife, the arts, bestsellers, biography, blindness and physical handicaps,…

  16. Do ATP-binding cassette transporters cause pharmacoresistance in epilepsy? Problems and approaches in determining which antiepileptic drugs are affected.


    Löscher, Wolfgang; Luna-Tortós, Carlos; Römermann, Kerstin; Fedrowitz, Maren


    Resistance to multiple antiepileptic drugs (AEDs) is a common problem in epilepsy, affecting at least 30% of patients. One prominent hypothesis to explain this resistance suggests an inadequate penetration or excess efflux of AEDs across the blood - brain barrier (BBB) as a result of overexpressed efflux transporters such as P-glycoprotein (Pgp), the encoded product of the multidrug resistance- 1 (MDR1, ABCB1) gene. Pgp and MDR1 are markedly increased in epileptogenic brain tissue of patients with AED-resistant partial epilepsy and following seizures in rodent models of partial epilepsy. In rodent models, AED-resistant rats exhibit higher Pgp levels than responsive animals; increased Pgp expression is associated with lower brain levels of AEDs; and, most importantly, co-administration of Pgp inhibitors reverses AED resistance. Thus, it is reasonable to conclude that Pgp plays a significant role in mediating resistance to AEDs in rodent models of epilepsy - however, whether this phenomenon extends to at least some human refractory epilepsy remains unclear, particularly because it is still a matter of debate which AEDs, if any, are transported by human Pgp. The difficulty in determining which AEDs are substrates of human Pgp is mainly a consequence of the fact that AEDs are highly permeable compounds, which are not easily identified as Pgp substrates in in vitro models of the BBB, such as monolayer (Transwell(®)) efflux assays. By using a modified assay (concentration equilibrium transport assay; CETA), which minimizes the influence of high transcellular permeability, two groups have recently demonstrated that several major AEDs are transported by human Pgp. Importantly, it was demonstrated in these studies that Pgp-mediated transport highly depends on the AED concentration and may not be identified if concentrations below or above the therapeutic range are used. In addition to the efflux transporters, seizure-induced alterations in BBB integrity and activity of drug metabolizing enzymes (CYPs) affect the brain uptake of AEDs. For translating these findings to the clinical arena, in vivo imaging studies using positron emission tomography (PET) with (11)C-labelled AEDs in epileptic patients are under way.

  17. Linoleic acid suppresses cholesterol efflux and ATP-binding cassette transporters in murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus (T2DM) are at increased risk of developing cardiovascular disease (CVD), possibly associated with elevated plasma free fatty acid concentrations. Paradoxically, evidence suggests that unsaturated, compared to saturated fatty acids, suppress macrophage chole...

  18. Heterocyclic cyclohexanone monocarbonyl analogs of curcumin can inhibit the activity of ATP-binding cassette transporters in cancer multidrug resistance.


    Revalde, Jezrael L; Li, Yan; Hawkins, Bill C; Rosengren, Rhonda J; Paxton, James W


    Curcumin (CUR) is a phytochemical that inhibits the xenobiotic ABC efflux transporters implicated in cancer multidrug resistance (MDR), such as P-glycoprotein (P-gp), breast cancer resistance protein (BCRP) and multidrug resistance-associated proteins 1 and 5 (MRP1 and MRP5). The use of CUR in the clinic however, is complicated by its instability and poor pharmacokinetic profile. Monocarbonyl analogs of CUR (MACs) are compounds without CUR's unstable β-diketone moiety and were reported to have improved stability and in vivo disposition. Whether the MACs can be used as MDR reversal agents is less clear, as the absence of a β-diketone may negatively impact transporter inhibition. In this study, we investigated 23 heterocyclic cyclohexanone MACs for inhibitory effects against P-gp, BCRP, MRP1 and MRP5. Using flow cytometry and resistance reversal assays, we found that many of these compounds inhibited the transport activity of the ABC transporters investigated, often with much greater potency than CUR. Overall the analogs were most effective at inhibiting BCRP and we identified three compounds, A12 (2,6-bis((E)-2,5-dimethoxy-benzylidene)cyclohexanone), A13 (2,6-bis((E)-4-hydroxyl-3-methoxybenzylidene)-cyclohexanone) and B11 (3,5-bis((E)-2-fluoro-4,5-dimethoxybenzylidene)-1-methylpiperidin-4-one), as the most promising BCRP inhibitors. These compounds inhibited BCRP activity in a non-cell line, non-substrate-specific manner. Their inhibition occurred by direct transporter interaction rather than modulating protein or cell surface expression. From these results, we concluded that MACs, such as the heterocyclic cyclohexanone analogs in this study, also have potential as MDR reversal agents and may be superior alternatives to the unstable parent compound, CUR.

  19. Gene expression profiling of transporters in the solute carrier and ATP-binding cassette superfamilies in human eye substructures.


    Dahlin, Amber; Geier, Ethan; Stocker, Sophie L; Cropp, Cheryl D; Grigorenko, Elena; Bloomer, Michele; Siegenthaler, Julie; Xu, Lu; Basile, Anthony S; Tang-Liu, Diane D-S; Giacomini, Kathleen M


    The barrier epithelia of the cornea and retina control drug and nutrient access to various compartments of the human eye. While ocular transporters are likely to play a critical role in homeostasis and drug delivery, little is known about their expression, localization and function. In this study, the mRNA expression levels of 445 transporters, metabolic enzymes, transcription factors and nuclear receptors were profiled in five regions of the human eye: cornea, iris, ciliary body, choroid and retina. Through RNA expression profiling and immunohistochemistry, several transporters were identified as putative targets for drug transport in ocular tissues. Our analysis identified SLC22A7 (OAT2), a carrier for the antiviral drug acyclovir, in the corneal epithelium, in addition to ABCG2 (BCRP), an important xenobiotic efflux pump, in retinal nerve fibers and the retinal pigment epithelium. Collectively, our results provide an understanding of the transporters that serve to maintain ocular homeostasis and which may be potential targets for drug delivery to deep compartments of the eye.

  20. Regulation and expression of the ATP-binding cassette transporter ABCG2 in human embryonic stem cells.


    Padmanabhan, Raji; Chen, Kevin G; Gillet, Jean-Pierre; Handley, Misty; Mallon, Barbara S; Hamilton, Rebecca S; Park, Kyeyoon; Varma, Sudhir; Mehaffey, Michele G; Robey, Pamela G; McKay, Ronald D G; Gottesman, Michael M


    The expression and function of several multidrug transporters (including ABCB1 and ABCG2) have been studied in human cancer cells and in mouse and human adult stem cells. However, the expression of ABCG2 in human embryonic stem cells (hESCs) remains unclear. Limited and contradictory results in the literature from two research groups have raised questions regarding its expression and function. In this study, we used quantitative real-time PCR, Northern blots, whole genome RNA sequencing, Western blots, and immunofluorescence microscopy to study ABCG2 expression in hESCs. We found that full-length ABCG2 mRNA transcripts are expressed in undifferentiated hESC lines. However, ABCG2 protein was undetectable even under embryoid body differentiation or cytotoxic drug induction. Moreover, surface ABCG2 protein was coexpressed with the differentiation marker stage-specific embryonic antigen-1 of hESCs, following constant BMP-4 signaling at days 4 and 6. This expression was tightly correlated with the downregulation of two microRNAs (miRNAs) (i.e., hsa-miR-519c and hsa-miR-520h). Transfection of miRNA mimics and inhibitors of these two miRNAs confirmed their direct involvement in the regulation ABCG2 translation. Our findings clarify the controversy regarding the expression of the ABCG2 gene and also provide new insights into translational control of the expression of membrane transporter mRNAs by miRNAs in hESCs.

  1. Probabilistic orthology analysis of the ATP-binding cassette transporters: implications for the development of multiple drug resistance phenotype.


    Fisher, Ciaran; Coleman, Tanya; Plant, Nick


    Drug transporters are rapidly becoming recognized as central to determining a chemical's fate within the body. This action is a double-edged sword, protecting the body from toxicants, but also potentially leading to reduced clinical efficacy of drugs through multiple drug resistance phenotype. To examine the interrelationship of this superfamily, we have constructed phylogenetic trees over an extended evolutionary distance representing each of the seven subfamilies. In addition, using protein sequences from species important in the design and evaluation of novel chemicals, namely human, macaque, rat, mouse, and dog, we have undertaken probabilistic orthology analysis to examine speciation probabilities within this phylogeny. These data allow us to accurately predict orthologous sequences across these species, an important confirmatory step with implications for cross-species extrapolation of data during drug safety testing. Finally, we present the first complete phylogeny for subfamilies within humans constructed using the entire coding sequences, at both the DNA and protein levels. We demonstrate for the first time that genes associated with the multiple drug resistance phenotype cluster separately from other genes within the same subfamily, suggestive of a conserved, fundamental, difference in these proteins. Such work may help guide future studies on the mechanisms underlying multiple drug resistance as well as the development of novel therapeutic approaches to mitigate against its development.

  2. Enhancement of avermectin and ivermectin production by overexpression of the maltose ATP-binding cassette transporter in Streptomyces avermitilis.


    Li, Meng; Chen, Zhi; Zhang, Xuan; Song, Yuan; Wen, Ying; Li, Jilun


    We investigated the function of maltose ABC transporter system encoded by malEFG-a and the effect of its overexpression on antibiotic production in Streptomyces avermitilis. A malEFG-a deletion mutant was unable to grow in a minimal medium with maltose as sole carbon source and produce avermectin. Maltose utilization and avermectin production were restored by introduction of a single copy of malEFG-a. RT-PCR analysis showed that the expression of malE-a was induced by maltose, and was strongly repressed by glucose. When multi-copy, integrative malEFG-a gene expression vectors were introduced into wild-type strain ATCC31267 and ivermectin-producer OI-31, antibiotic production increased by 2.6- to 3.3-fold and the time required for fermentation decreased by about 10%. The overexpression of malEFG-a improved the utilization rate of starch, and thereby enhanced avermectin production. Such an approach would be useful for the improvement of commercial antibiotic production using starch as the main carbon source in the fermentation process.

  3. Structural and Enzymatic Insights into the ATP Binding and Autophosphorylation Mechanism of a Sensor Histidine Kinase*

    PubMed Central

    Trajtenberg, Felipe; Graña, Martin; Ruétalo, Natalia; Botti, Horacio; Buschiazzo, Alejandro


    DesK is a sensor histidine kinase (HK) that allows Bacillus subtilis to respond to cold shock, triggering the adaptation of membrane fluidity via transcriptional control of a fatty acid desaturase. It belongs to the HK family HPK7, which includes the nitrogen metabolism regulators NarX/Q and the antibiotic sensor LiaS among other important sensor kinases. Structural information on different HK families is still scarce and several questions remain, particularly concerning the molecular features that determine HK specificity during its catalytic autophosphorylation and subsequent response-regulator phosphotransfer reactions. To analyze the ATP-binding features of HPK7 HKs and dissect their mechanism of autophosphorylation at the molecular level, we have studied DesK in complex with ATP using high resolution structural approaches in combination with biochemical studies. We report the first crystal structure of an HK in complex with its natural nucleotidic substrate. The general fold of the ATP-binding domain of DesK is conserved, compared with well studied members of other families. Yet, DesK displays a far more compact structure at the ATP-binding pocket: the ATP lid loop is much shorter with no secondary structural organization and becomes ordered upon ATP loading. Sequence conservation mapping onto the molecular surface, semi-flexible protein-protein docking simulations, and structure-based point mutagenesis allow us to propose a specific domain-domain geometry during autophosphorylation catalysis. Supporting our hypotheses, we have been able to trap an autophosphorylating intermediate state, by protein engineering at the predicted domain-domain interaction surface. PMID:20507988

  4. The nodulin vfENOD18 is an ATP-binding protein in infected cells of Vicia faba L. nodules.


    Becker, J D; Moreira, L M; Kapp, D; Frosch, S C; Pühler, A; Perlic, A M


    Recently we described the novel nodulin gene VfENOD18, whose corresponding transcripts were restricted to the nitrogen-fixing zone III of broad bean root nodules. To characterize VfENOD18 on the protein level, polyclonal antibodies were generated using the purified recombinant VfENOD18 protein produced in Escherichia coli by employing the pMAL-c expression system. These antibodies recognized immunoreactive proteins isolated from indeterminate nodules of different leguminous plants, but also from non-symbiotic tissues of Glycine max and from tissues of Arabidopsis thaliana and Zea mays. Using immunogold labelling the nodulin VfENOD18 was localized to the cytoplasm of infected cells in the nitrogen-fixing zone of broad bean nodules. Due to the homology of the VfENOD18 sequence to that of the ATP-binding protein MJ0577 from the hyperthermophile Methanococcus jannaschii the recombinant VfENOD18 protein was tested for ATP-binding. Using the biotin photoaffinity ATP analogue 8N3ATP[gamma]biotin it could be demonstrated that VfENOD18 is an ATP-binding protein. PCR experiments revealed that the amino acid sequences of the putative C-terminal ATP-binding sites of the VfENOD 18 homologues from Lens culinaris, Vicia hirsuta, Vicia sativa and Vicia villosa were conserved. We propose that VfENOD18 is a member of a novel family of ATP-binding proteins in plants.

  5. Human erythrocyte dematin and protein 4.2 (pallidin) are ATP binding proteins.


    Azim, A C; Marfatia, S M; Korsgren, C; Dotimas, E; Cohen, C M; Chishti, A H


    Dematin and protein 4.2 are peripheral membrane proteins associated with the cytoplasmic surface of the human erythrocyte plasma membrane. Isoforms of dematin and protein 4.2 exist in many nonerythroid cells. In solution, dematin is a trimeric protein containing two subunits of 48 kDa and one subunit of 52 kDa. Recent determination of the primary structure of the 52 kDa subunit of dematin showed that it contains an additional 22-amino acid sequence in the headpiece domain. An alignment of the 22-amino acid insertion sequence revealed that the 52 kDa subunit of dematin shares a novel 11-amino acid motif with protein 4.2. In this communication, we report that the conserved 11-amino acid motif in dematin52 and protein 4.2 contains a nucleotide binding P-loop. Direct binding of ATP is demonstrated to the glutathione S-transferase fusion proteins containing corresponding segments of dematin52 and protein 4.2 as well as to purified protein 4.2. The binding of ATP to the recombinant domains of dematin52 and protein 4.2 is specific, saturable, and of high affinity. The nucleotide specificity of the P-loop is restricted to ATP since no detectable binding was observed with GTP. These results show that the 11-amino acid motif provides an ATP binding site in dematin52 and protein 4.2. Although the functional significance of ATP binding is not yet clear, our findings open new perspectives for the function of dematin and protein 4.2 in vivo.

  6. Complexed Structures of Formylglycinamide Ribonucleotide Amidotransferase from Thermotoga maritima Describe a Novel ATP Binding Protein Superfamily

    SciTech Connect

    Morar, Mariya; Anand, Ruchi; Hoskins, Aaron A.; Stubbe, JoAnne; Ealick, Steven E.


    Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent synthesis of formylglycinamidine ribonucleotide (FGAM) from formylglycinamide ribonucleotide (FGAR) and glutamine in the fourth step of the purine biosynthetic pathway. FGAR-AT is encoded by the purL gene. Two types of PurL have been detected. The first type, found in eukaryotes and Gram-negative bacteria, consists of a single 140 kDa polypeptide chain and is designated large PurL (lgPurL). The second type, small PurL (smPurL), is found in archaea and Gram-positive bacteria and consists of an 80 kDa polypeptide chain. SmPurL requires two additional gene products, PurQ and PurS, for activity. PurL is a member of a protein superfamily that contains a novel ATP-binding domain. Structures of several members of this superfamily are available in the unliganded form. We determined five different structures of FGAR-AT from Thermotoga maritima in the presence of substrates, a substrate analogue, and a product. These complexes have allowed a detailed description of the novel ATP-binding motif. The availability of a ternary complex enabled mapping of the active site, thus identifying potential residues involved in catalysis. The complexes show a conformational change in the active site compared to the unliganded structure. Surprising discoveries, an ATP molecule in an auxiliary site of the protein and the conformational changes associated with its binding, provoke speculation about the regulatory role of the auxiliary site in formation of the PurLSQ complex as well as the evolutionary relationship of PurLs from different organisms.

  7. Identification of ATP-binding regions in the RyR1 Ca²⁺ release channel.


    Popova, Olga B; Baker, Mariah R; Tran, Tina P; Le, Tri; Serysheva, Irina I


    ATP is an important modulator of gating in type 1 ryanodine receptor (RyR1), also known as a Ca²⁺ release channel in skeletal muscle cells. The activating effect of ATP on this channel is achieved by directly binding to one or more sites on the RyR1 protein. However, the number and location of these sites have yet to be determined. To identify the ATP-binding regions within RyR1 we used 2N₃ATP-2',3'-Biotin-LC-Hydrazone (BioATP-HDZ), a photo-reactive ATP analog to covalently label the channel. We found that BioATP-HDZ binds RyR1 specifically with an IC₅₀ = 0.6±0.2 mM, comparable with the reported EC50 for activation of RyR1 with ATP. Controlled proteolysis of labeled RyR1 followed by sequence analysis revealed three fragments with apparent molecular masses of 95, 45 and 70 kDa that were crosslinked by BioATP-HDZ and identified as RyR1 sequences. Our analysis identified four glycine-rich consensus motifs that can potentially constitute ATP-binding sites and are located within the N-terminal 95-kDa fragment. These putative nucleotide-binding sequences include amino acids 699-704, 701-706, 1081-1084 and 1195-1200, which are conserved among the three RyR isoforms. Located next to the N-terminal disease hotspot region in RyR1, these sequences may communicate the effects of ATP-binding to channel function by tuning conformational motions within the neighboring cytoplasmic regulatory domains. Two other labeled fragments lack ATP-binding consensus motifs and may form non-canonical ATP-binding sites. Based on domain topology in the 3D structure of RyR1 it is also conceivable that the identified ATP-binding regions, despite their wide separation in the primary sequence, may actually constitute the same non-contiguous ATP-binding pocket within the channel tetramer.

  8. Video Cartridges and Cassettes.

    ERIC Educational Resources Information Center

    Kletter, Richard C.; Hudson, Heather

    The economic and social significance of video cassettes (viewer-controlled playback system) is explored in this report. The potential effect of video cassettes on industrial training, education, libraries, and television is analyzed in conjunction with the anticipated hardware developments. The entire video cassette industry is reviewed firm by…

  9. Agrobacterium rhizogenes GALLS Protein Contains Domains for ATP Binding, Nuclear Localization, and Type IV Secretion▿

    PubMed Central

    Hodges, Larry D.; Vergunst, Annette C.; Neal-McKinney, Jason; den Dulk-Ras, Amke; Moyer, Deborah M.; Hooykaas, Paul J. J.; Ream, Walt


    Agrobacterium tumefaciens and Agrobacterium rhizogenes are closely related plant pathogens that cause different diseases, crown gall and hairy root. Both diseases result from transfer, integration, and expression of plasmid-encoded bacterial genes located on the transferred DNA (T-DNA) in the plant genome. Bacterial virulence (Vir) proteins necessary for infection are also translocated into plant cells. Transfer of single-stranded DNA (ssDNA) and Vir proteins requires a type IV secretion system, a protein complex spanning the bacterial envelope. A. tumefaciens translocates the ssDNA-binding protein VirE2 into plant cells, where it binds single-stranded T-DNA and helps target it to the nucleus. Although some strains of A. rhizogenes lack VirE2, they are pathogenic and transfer T-DNA efficiently. Instead, these bacteria express the GALLS protein, which is essential for their virulence. The GALLS protein can complement an A. tumefaciens virE2 mutant for tumor formation, indicating that GALLS can substitute for VirE2. Unlike VirE2, GALLS contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. Both GALLS and VirE2 contain nuclear localization sequences and a C-terminal type IV secretion signal. Here we show that mutations in any of these domains abolished the ability of GALLS to substitute for VirE2. PMID:17012398

  10. Structure-guided Development of Specific Pyruvate Dehydrogenase Kinase Inhibitors Targeting the ATP-binding Pocket*

    PubMed Central

    Tso, Shih-Chia; Qi, Xiangbing; Gui, Wen-Jun; Wu, Cheng-Yang; Chuang, Jacinta L.; Wernstedt-Asterholm, Ingrid; Morlock, Lorraine K.; Owens, Kyle R.; Scherer, Philipp E.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.


    Pyruvate dehydrogenase kinase isoforms (PDKs 1–4) negatively regulate activity of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation. PDK isoforms are up-regulated in obesity, diabetes, heart failure, and cancer and are potential therapeutic targets for these important human diseases. Here, we employed a structure-guided design to convert a known Hsp90 inhibitor to a series of highly specific PDK inhibitors, based on structural conservation in the ATP-binding pocket. The key step involved the substitution of a carbonyl group in the parent compound with a sulfonyl in the PDK inhibitors. The final compound of this series, 2-[(2,4-dihydroxyphenyl)sulfonyl]isoindoline-4,6-diol, designated PS10, inhibits all four PDK isoforms with IC50 = 0.8 μm for PDK2. The administration of PS10 (70 mg/kg) to diet-induced obese mice significantly augments pyruvate dehydrogenase complex activity with reduced phosphorylation in different tissues. Prolonged PS10 treatments result in improved glucose tolerance and notably lessened hepatic steatosis in the mouse model. The results support the pharmacological approach of targeting PDK to control both glucose and fat levels in obesity and type 2 diabetes. PMID:24356970

  11. Conformational Changes Produced by ATP Binding to the Plasma Membrane Calcium Pump*

    PubMed Central

    Mangialavori, Irene C.; Ferreira-Gomes, Mariela S.; Saffioti, Nicolás A.; González-Lebrero, Rodolfo M.; Rossi, Rolando C.; Rossi, Juan Pablo F. C.


    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[125I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca2+ with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2′(3′)-O-(2,4,6-trinitrophenyl)adenosine 5′-triphosphate. To assess the conformational behavior of the Ca2+ binding domain, we also studied the occlusion of Ca2+, both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca2+ and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only. PMID:24025327

  12. ATP binding by NLRP7 is required for inflammasome activation in response to bacterial lipopeptides.


    Radian, Alexander D; Khare, Sonal; Chu, Lan H; Dorfleutner, Andrea; Stehlik, Christian


    Nucleotide-binding oligimerization domain (NOD)-like receptors (NLRs) are pattern recognition receptors (PRRs) involved in innate immune responses. NLRs encode a central nucleotide-binding domain (NBD) consisting of the NAIP, CIITA, HET-E and TP1 (NACHT) domain and the NACHT associated domain (NAD), which facilitates receptor oligomerization and downstream inflammasome signaling. The NBD contains highly conserved regions, known as Walker motifs, that are required for nucleotide binding and hydrolysis. The NLR containing a PYRIN domain (PYD) 7 (NLRP7) has been recently shown to assemble an ASC and caspase-1-containing high molecular weight inflammasome complex in response to microbial acylated lipopeptides and Staphylococcus aureus infection. However, the molecular mechanism responsible for NLRP7 inflammasome activation is still elusive. Here we demonstrate that the NBD of NLRP7 is an ATP binding domain and has ATPase activity. We further show that an intact nucleotide-binding Walker A motif is required for NBD-mediated nucleotide binding and hydrolysis, oligomerization, and NLRP7 inflammasome formation and activity. Accordingly, THP-1 cells expressing a mutated Walker A motif display defective NLRP7 inflammasome activation, interleukin (IL)-1β release and pyroptosis in response to acylated lipopeptides and S. aureus infection. Taken together, our results provide novel insights into the mechanism of NLRP7 inflammasome assembly.

  13. Conformational changes produced by ATP binding to the plasma membrane calcium pump.


    Mangialavori, Irene C; Ferreira-Gomes, Mariela S; Saffioti, Nicolás A; González-Lebrero, Rodolfo M; Rossi, Rolando C; Rossi, Juan Pablo F C


    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[(125)I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca(2+) with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. To assess the conformational behavior of the Ca(2+) binding domain, we also studied the occlusion of Ca(2+), both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca(2+) and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only.

  14. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    SciTech Connect

    C Simmons; C Magee; D Smith; L Lauman; J Chaput; J Allen


    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADP cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.

  15. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi


    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  16. Molecular determinants for ATP-binding in proteins: a data mining and quantum chemical analysis.


    Mao, Lisong; Wang, Yanli; Liu, Yuemin; Hu, Xiche


    intermolecular interactions of large biomolecular systems becomes computationally feasible. The establishment of the molecular basis for recognition of the adenine moiety of ATP in proteins will directly impact molecular design of ATP-binding site targeted enzyme inhibitors such as kinase inhibitors.

  17. Activity-Based Proteomics Reveals Heterogeneous Kinome and ATP-Binding Proteome Responses to MEK Inhibition in KRAS Mutant Lung Cancer.


    Kim, Jae-Young; Stewart, Paul A; Borne, Adam L; Fang, Bin; Welsh, Eric A; Chen, Yian Ann; Eschrich, Steven A; Koomen, John M; Haura, Eric B


    One way cancer cells can escape from targeted agents is through their ability to evade drug effects by rapidly rewiring signaling networks. Many protein classes, such as kinases and metabolic enzymes, are regulated by ATP binding and hydrolysis. We hypothesized that a system-level profiling of drug-induced alterations in ATP-binding proteomes could offer novel insights into adaptive responses. Here, we mapped global ATP-binding proteomes perturbed by two clinical MEK inhibitors, AZD6244 and MEK162, in KRAS mutant lung cancer cells as a model system harnessing a desthiobiotin-ATP probe coupled with LC-MS/MS. We observed strikingly unique ATP-binding proteome responses to MEK inhibition, which revealed heterogeneous drug-induced pathway signatures in each cell line. We also identified diverse kinome responses, indicating each cell adapts to MEK inhibition in unique ways. Despite the heterogeneity of kinome responses, decreased probe labeling of mitotic kinases and an increase of kinases linked to autophagy were identified to be common responses. Taken together, our study revealed a diversity of adaptive ATP-binding proteome and kinome responses to MEK inhibition in KRAS mutant lung cancer cells, and our study further demonstrated the utility of our approach to identify potential candidates of targetable ATP-binding enzymes involved in adaptive resistance and to develop rational drug combinations.

  18. ATP binding and hydrolysis-driven rate-determining events in the RFC-catalyzed PCNA clamp loading reaction.


    Sakato, Miho; Zhou, Yayan; Hingorani, Manju M


    The multi-subunit replication factor C (RFC) complex loads circular proliferating cell nuclear antigen (PCNA) clamps onto DNA where they serve as mobile tethers for polymerases and coordinate the functions of many other DNA metabolic proteins. The clamp loading reaction is complex, involving multiple components (RFC, PCNA, DNA, and ATP) and events (minimally: PCNA opening/closing, DNA binding/release, and ATP binding/hydrolysis) that yield a topologically linked clamp·DNA product in less than a second. Here, we report pre-steady-state measurements of several steps in the reaction catalyzed by Saccharomyces cerevisiae RFC and present a comprehensive kinetic model based on global analysis of the data. Highlights of the reaction mechanism are that ATP binding to RFC initiates slow activation of the clamp loader, enabling it to open PCNA (at ~2 s(-1)) and bind primer-template DNA (ptDNA). Rapid binding of ptDNA leads to formation of the RFC·ATP·PCNA(open)·ptDNA complex, which catalyzes a burst of ATP hydrolysis. Another slow step in the reaction follows ATP hydrolysis and is associated with PCNA closure around ptDNA (8 s(-1)). Dissociation of PCNA·ptDNA from RFC leads to catalytic turnover. We propose that these early and late rate-determining events are intramolecular conformational changes in RFC and PCNA that control clamp opening and closure, and that ATP binding and hydrolysis switch RFC between conformations with high and low affinities, respectively, for open PCNA and ptDNA, and thus bookend the clamp loading reaction.

  19. Formycin triphosphate as a probe for the ATP binding site involved in the activation of guanylate cyclase.


    Chang, C H; Yu, Z N; Song, D L


    Formycin A triphosphate (FTP), a fluorescent analog of ATP, slightly increased basal guanylate cyclase activity, but significantly potentiated guanylate cyclase activity stimulated by atrial natriuretic factor (ANF) in rat lung membranes. FTP potentiated ANF-stimulated guanylate cyclase activity with an EC50 at about 90 microM and inhibited ATP-stimulated guanylate cyclase activity with an IC50 at about 100 microM. These results indicate that FTP binds more tightly than ATP for the same binding site. Therefore, FTP would be an excellent tool for studying the ATP binding site.

  20. Variants in the ATP-Binding Cassette Transporter (ABCA7), Apolipoprotein E ε4, and the Risk of Late-Onset Alzheimer Disease in African Americans

    PubMed Central

    Reitz, Christiane; Jun, Gyungah; Naj, Adam; Rajbhandary, Ruchita; Vardarajan, Badri Narayan; Wang, Li-San; Valladares, Otto; Lin, Chiao-Feng; Larson, Eric B.; Graff-Radford, Neill R.; Evans, Denis; De Jager, Philip L.; Crane, Paul K.; Buxbaum, Joseph D.; Murrell, Jill R.; Raj, Towfique; Ertekin-Taner, Nilufer; Logue, Mark; Baldwin, Clinton T.; Green, Robert C.; Barnes, Lisa L.; Cantwell, Laura B.; Fallin, M. Daniele; Go, Rodney C. P.; Griffith, Patrick; Obisesan, Thomas O.; Manly, Jennifer J.; Lunetta, Kathryn L.; Kamboh, M. Ilyas; Lopez, Oscar L.; Bennett, David A.; Hendrie, Hugh; Hall, Kathleen S.; Goate, Alison M.; Byrd, Goldie S.; Kukull, Walter A.; Foroud, Tatiana M.; Haines, Jonathan L.; Farrer, Lindsay A.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Mayeux, Richard


    Importance Genetic variants associated with susceptibility to late-onset Alzheimer disease are known for individuals of European ancestry, but whether the same or different variants account for the genetic risk of Alzheimer disease in African American individuals is unknown. Identification of disease-associated variants helps identify targets for genetic testing, prevention, and treatment. Objective To identify genetic loci associated with late-onset Alzheimer disease in African Americans. Design, Setting, and Participants The Alzheimer Disease Genetics Consortium (ADGC) assembled multiple data sets representing a total of 5896 African Americans (1968 case participants, 3928 control participants) 60 years or older that were collected between 1989 and 2011 at multiple sites. The association of Alzheimer disease with genotyped and imputed single-nucleotide polymorphisms (SNPs) was assessed in case-control and in family-based data sets. Results from individual data sets were combined to perform an inverse variance–weighted meta-analysis, first with genome-wide analyses and subsequently with gene-based tests for previously reported loci. Main Outcomes and Measures Presence of Alzheimer disease according to standardized criteria. Results Genome-wide significance in fully adjusted models (sex, age, APOE genotype, population stratification) was observed for a SNP in ABCA7 (rs115550680, allele = G; frequency, 0.09 cases and 0.06 controls; odds ratio [OR], 1.79 [95% CI, 1.47-2.12]; P = 2.2 × 10–9), which is in linkage disequilibrium with SNPs previously associated with Alzheimer disease in Europeans (0.8

  1. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP

    PubMed Central

    Lempers, Vincent J. C.; van den Heuvel, Jeroen J. M. W.; Russel, Frans G. M.; Aarnoutse, Rob E.; Burger, David M.; Koenderink, Jan B.


    Inhibition of ABC transporters is a common mechanism underlying drug-drug interactions (DDIs). We determined the inhibitory potential of antifungal drugs currently used for invasive fungal infections on ABC transporters P-glycoprotein (P-gp), MRP1 to MRP5, BCRP, and BSEP in vitro. Membrane vesicles isolated from transporter-overexpressing HEK 293 cells were used to investigate the inhibitory potential of antifungal drugs (250 μM) on transport of model substrates. Concentration-inhibition curves were determined if transport inhibition was >60%. Fifty percent inhibitory concentrations (IC50s) for P-gp and BCRP were both 2 μM for itraconazole, 5 and 12 μM for hydroxyitraconazole, 3 and 6 μM for posaconazole, and 3 and 11 μM for isavuconazole, respectively. BSEP was strongly inhibited by itraconazole and hydroxyitraconazole (3 and 17 μM, respectively). Fluconazole and voriconazole did not inhibit any transport for >60%. Micafungin uniquely inhibited all transporters, with strong inhibition of MRP4 (4 μM). Anidulafungin and caspofungin showed strong inhibition of BCRP (7 and 6 μM, respectively). Amphotericin B only weakly inhibited BCRP-mediated transport (127 μM). Despite their wide range of DDIs, azole antifungals exhibit selective inhibition on efflux transporters. Although echinocandins display low potential for clinically relevant DDIs, they demonstrate potent in vitro inhibitory activity. This suggests that inhibition of ABC transporters plays a crucial role in the inexplicable (non-cytochrome P450-mediated) DDIs with antifungal drugs. PMID:27001813

  2. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP.


    Lempers, Vincent J C; van den Heuvel, Jeroen J M W; Russel, Frans G M; Aarnoutse, Rob E; Burger, David M; Brüggemann, Roger J; Koenderink, Jan B


    Inhibition of ABC transporters is a common mechanism underlying drug-drug interactions (DDIs). We determined the inhibitory potential of antifungal drugs currently used for invasive fungal infections on ABC transporters P-glycoprotein (P-gp), MRP1 to MRP5, BCRP, and BSEP in vitro Membrane vesicles isolated from transporter-overexpressing HEK 293 cells were used to investigate the inhibitory potential of antifungal drugs (250 μM) on transport of model substrates. Concentration-inhibition curves were determined if transport inhibition was >60%. Fifty percent inhibitory concentrations (IC50s) for P-gp and BCRP were both 2 μM for itraconazole, 5 and 12 μM for hydroxyitraconazole, 3 and 6 μM for posaconazole, and 3 and 11 μM for isavuconazole, respectively. BSEP was strongly inhibited by itraconazole and hydroxyitraconazole (3 and 17 μM, respectively). Fluconazole and voriconazole did not inhibit any transport for >60%. Micafungin uniquely inhibited all transporters, with strong inhibition of MRP4 (4 μM). Anidulafungin and caspofungin showed strong inhibition of BCRP (7 and 6 μM, respectively). Amphotericin B only weakly inhibited BCRP-mediated transport (127 μM). Despite their wide range of DDIs, azole antifungals exhibit selective inhibition on efflux transporters. Although echinocandins display low potential for clinically relevant DDIs, they demonstrate potent in vitro inhibitory activity. This suggests that inhibition of ABC transporters plays a crucial role in the inexplicable (non-cytochrome P450-mediated) DDIs with antifungal drugs.

  3. Construction of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette (ABC) transporters and analysis of their growth under stress conditions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Listeria monocytogenes is a foodborne pathogen that is difficult to eliminate since it can survive under multiple stress conditions such as low pH and low temperature. Understanding its survival under stress conditions is important to control this pathogen in food. ABC transporters have been shown...

  4. Up-regulation of ATP-binding cassette transporters in the THP-1 human macrophage cell line by the antichagasic benznidazole

    PubMed Central

    Perdomo, Virginia G; Rigalli, Juan P; Luquita, Marcelo G; Pellegrino, José M; Ruiz, María Laura; Catania, Viviana A


    The effect of benznidazole (BZL) on the expression and activity of P-glycoprotein (P-gp, ABCB1) and multidrug resistance-associated protein 2 (MRP2, ABCC2), the two major transporters of endogenous and exogenous compounds, was evaluated in differentiated THP-1 cells. BZL induced P-gp and MRP2 proteins in a concentration-dependent manner. The increase in mRNA levels of both transporters suggests transcriptional regulation. P-gp and MRP2 activities correlated with increased protein levels. BZL intracellular accumulation was significantly lower in BZL-pre-treated cells than in control cells. PSC833 (a P-gp inhibitor) increased the intracellular BZL concentration in both pre-treated and control cells, confirming P-gp participation in BZL efflux. PMID:27783718

  5. ATP Binding Cassette Transporter ABCA7 Regulates NKT Cell Development and Function by Controlling CD1d Expression and Lipid Raft Content

    PubMed Central

    Nowyhed, Heba N.; Chandra, Shilpi; Kiosses, William; Marcovecchio, Paola; Andary, Farah; Zhao, Meng; Fitzgerald, Michael L.; Kronenberg, Mitchell; Hedrick, Catherine C.


    ABCA7 is an ABC transporter expressed on the plasma membrane, and actively exports phospholipid complexes from the cytoplasmic to the exocytoplasmic leaflet of membranes. Invariant NKT (iNKT) cells are a subpopulation of T lymphocytes that recognize glycolipid antigens in the context of CD1d-mediated antigen presentation. In this study, we demonstrate that ABCA7 regulates the development of NKT cells in a cell-extrinsic manner. We found that in Abca7−/− mice there is reduced expression of CD1d accompanied by an alteration in lipid raft content on the plasma membrane of thymocytes and antigen presenting cells. Together, these alterations caused by absence of ABCA7 negatively affect NKT cell development and function. PMID:28091533

  6. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette Transporter (ΔabcBA) Protects against Wild Type Brucella ovis in Rams

    PubMed Central

    Silva, Ana Patrícia C.; Macêdo, Auricélio A.; Costa, Luciana F.; Rocha, Cláudia E.; Garcia, Luize N. N.; Farias, Jade R. D.; Gomes, Priscilla P. R.; Teixeira, Gustavo C.; Fonseca, Kessler W. J.; Maia, Andréa R. F.; Neves, Gabriela G.; Romão, Everton L.; Silva, Teane M. A.; Mol, Juliana P. S.; Oliveira, Renata M.; Araújo, Márcio S. S.; Nascimento, Ernane F.; Martins-Filho, Olindo A.; Brandão, Humberto M.; Paixão, Tatiane A.; Santos, Renato L.


    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  7. Activation of ATP binding for the autophosphorylation of DosS, a Mycobacterium tuberculosis histidine kinase lacking an ATP lid motif.


    Cho, Ha Yeon; Lee, Young-Hoon; Bae, Young-Seuk; Kim, Eungbin; Kang, Beom Sik


    The sensor histidine kinases of Mycobacterium tuberculosis, DosS and DosT, are responsible for sensing hypoxic conditions and consist of sensor and kinase cores responsible for accepting signals and phosphorylation activity, respectively. The kinase core contains a dimerization and histidine phosphate-accepting (DHp) domain and an ATP binding domain (ABD). The 13 histidine kinase genes of M. tuberculosis can be grouped based on the presence or absence of the ATP lid motif and F box (elements known to play roles in ATP binding) in their ABDs; DosS and DosT have ABDs lacking both these elements, and the crystal structures of their ABDs indicated that they were unsuitable for ATP binding, as a short loop covers the putative ATP binding site. Although the ABD alone cannot bind ATP, the kinase core is functional in autophosphorylation. Appropriate spatial arrangement of the ABD and DHp domain within the kinase core is required for both autophosphorylation and ATP binding. An ionic interaction between Arg(440) in the DHp domain and Glu(537) in the short loop of the ABD is available and may open the ATP binding site, by repositioning the short loop away from the site. Mutations at Arg(440) and Glu(537) reduce autophosphorylation activity. Unlike other histidine kinases containing an ATP lid, which protects bound ATP, DosS is unable to accept ATP until the ABD is properly positioned relative to the histidine; this may prevent unexpected ATP reactions. ATP binding can, therefore, function as a control mechanism for histidine kinase activity.

  8. The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity

    PubMed Central

    Tameling, Wladimir I. L.; Elzinga, Sandra D. J.; Darmin, Patricia S.; Vossen, Jack H.; Takken, Frank L. W.; Haring, Michel A.; Cornelissen, Ben J. C.


    Most plant disease resistance (R) genes known today encode proteins with a central nucleotide binding site (NBS) and a C-terminal Leu-rich repeat (LRR) domain. The NBS contains three ATP/GTP binding motifs known as the kinase-1a or P-loop, kinase-2, and kinase-3a motifs. In this article, we show that the NBS of R proteins forms a functional nucleotide binding pocket. The N-terminal halves of two tomato R proteins, I-2 conferring resistance to Fusarium oxysporum and Mi-1 conferring resistance to root-knot nematodes and potato aphids, were produced as glutathione S-transferase fusions in Escherichia coli. In a filter binding assay, purified I-2 was found to bind ATP rather than other nucleoside triphosphates. ATP binding appeared to be fully dependent on the presence of a divalent cation. A mutant I-2 protein containing a mutation in the P-loop showed a strongly reduced ATP binding capacity. Thin layer chromatography revealed that both I-2 and Mi-1 exerted ATPase activity. Based on the strong conservation of NBS domains in R proteins of the NBS-LRR class, we propose that they all are capable of binding and hydrolyzing ATP. PMID:12417711

  9. Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

    NASA Astrophysics Data System (ADS)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Klimanova, Elizaveta A.; Dergousova, Elena A.; Lopina, Olga D.; Makarov, Alexander A.


    Active transport of sodium and potassium ions by Na,K-ATPase is accompanied by the enzyme conformational transition between E1 and E2 states. ATP and ADP bind to Na,K-ATPase in the E1 conformation with similar affinity but the properties of enzyme in complexes with these nucleotides are different. We have studied thermodynamics of Na,K-ATPase binding with adenine nucleotides at different temperatures using isothermal titration calorimetry. Our data indicate that β-phosphate is involved in complex formation by increasing the affinity of adenine nucleotides to Na,K-ATPase by an order of magnitude, while γ-phosphate does not affect it. ATP binding to Na,K-ATPase in contrast to ADP binding generates a structural transition in the enzyme, which is consistent with the movement of a significant portion of the surface area to a solvent-protected state. We propose that ATP binding leads to convergence of the nucleotide-binding and phosphorylation domains transferring the enzyme from the ``E1-open'' to ``E1-closed'' conformation ready for phosphorylation.

  10. ATP-Binding Pocket-Targeted Suppression of Src and Syk by Luteolin Contributes to Its Anti-Inflammatory Action

    PubMed Central

    Lee, Jeong-Oog; Jeong, Deok; Kim, Mi-Yeon; Cho, Jae Youl


    Luteolin is a flavonoid identified as a major anti-inflammatory component of Artemisia asiatica. Numerous reports have demonstrated the ability of luteolin to suppress inflammation in a variety of inflammatory conditions. However, its exact anti-inflammatory mechanism has not been fully elucidated. In the present study, the anti-inflammatory mode of action in activated macrophages of luteolin from Artemisia asiatica was examined by employing immunoblotting analysis, a luciferase reporter gene assay, enzyme assays, and an overexpression strategy. Luteolin dose-dependently inhibited the secretion of nitric oxide (NO) and prostaglandin E2 (PGE2) and diminished the levels of mRNA transcripts of inducible NO synthase (iNOS), tumor necrosis factor- (TNF-) α, and cyclooxygenase-2 (COX-2) in lipopolysaccharide- (LPS-) and pam3CSK-treated macrophage-like RAW264.7 cells without displaying cytotoxicity. Luteolin displayed potent NO-inhibitory activity and also suppressed the nuclear translocation of NF-κB (p65 and p50) via blockade of Src and Syk, but not other mitogen-activated kinases. Overexpression of wild type Src and point mutants thereof, and molecular modelling studies, suggest that the ATP-binding pocket may be the luteolin-binding site in Src. These results strongly suggest that luteolin may exert its anti-inflammatory action by suppressing the NF-κB signaling cascade via blockade of ATP binding in Src and Syk. PMID:26236111

  11. ATP binding and hydrolysis steps of the uni-site catalysis by the mitochondrial F(1)-ATPase are affected by inorganic phosphate.


    Milgrom, Yakov M


    The effect of inorganic phosphate (P(i)) on uni-site ATP binding and hydrolysis by the nucleotide-depleted F(1)-ATPase from beef heart mitochondria (ndMF(1)) has been investigated. It is shown for the first time that P(i) decreases the apparent rate constant of uni-site ATP binding by ndMF(1) 3-fold with the K(d) of 0.38+/-0.14mM. During uni-site ATP hydrolysis, P(i) also shifts equilibrium between bound ATP and ADP+P(i) in the direction of ATP synthesis with the K(d) of 0.17+/-0.03mM. However, 10mM P(i) does not significantly affect ATP binding during multi-site catalysis.

  12. The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase

    PubMed Central

    Ding, Hao; Guo, Manhong; Vidhyasagar, Venkatasubramanian; Talwar, Tanu; Wu, Yuliang


    Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI). The Q motif, consisting of nine amino acids (GFXXPXPIQ) with an invariant glutamine (Q) residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11) gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase. PMID:26474416

  13. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.


    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  14. Automated cassette-to-cassette substrate handling system

    SciTech Connect

    Kraus, Joseph Arthur; Boyer, Jeremy James; Mack, Joseph; DeChellis, Michael; Koo, Michael


    An automated cassette-to-cassette substrate handling system includes a cassette storage module for storing a plurality of substrates in cassettes before and after processing. A substrate carrier storage module stores a plurality of substrate carriers. A substrate carrier loading/unloading module loads substrates from the cassette storage module onto the plurality of substrate carriers and unloads substrates from the plurality of substrate carriers to the cassette storage module. A transport mechanism transports the plurality of substrates between the cassette storage module and the plurality of substrate carriers and transports the plurality of substrate carriers between the substrate carrier loading/unloading module and a processing chamber. A vision system recognizes recesses in the plurality of substrate carriers corresponding to empty substrate positions in the substrate carrier. A processor receives data from the vision system and instructs the transport mechanism to transport substrates to positions on the substrate carrier in response to the received data.

  15. Simulated microgravity alters the expression of cytoskeleton- and ATP-binding-related genes in MLO-Y4 osteocytes

    NASA Astrophysics Data System (ADS)

    Chen, Zhihao; Zhao, Fan; Qi, Yiduo; Hu, Lifang; Li, Dijie; Yin, Chong; Su, Peihong; Zhang, Yan; Ma, Jianhua; Qian, Jing; Zhou, Hongpo; Zou, Yiwei; Qian, Airong


    Bone undergoes dynamic modelling and remodelling processes, and it requires gravity-mediated mechanical stimulation for the maintenance of mineral content and structure. Osteocytes are the most commonly found cells in the mature bone, and they are sensitive to mechanical changes. The purpose of this study was to investigate the effects of microgravity simulated with a random position machine (RPM) on the gene expression profile of osteocytes. Genes sensitive to RPM treatment were sorted on the basis of biological processes, interactions and signalling pathways. Overall, 504 differentially expressed genes (DEGs) in osteocytes cultured under RPM conditions were found. The DEGs were further analysed using bioinformatics tools such as DAVID and iReport. A total of 15 ATP-binding and cytoskeleton-related genes were further confirmed by quantitative real-time PCR (qRT-PCR). Our findings demonstrate that the RPM affected the expression of genes involved in cytoskeleton remodelling and the energy-transfer process in osteocytes. The identification of mechanosensitive genes may enhance our understanding of the roles of osteocytes in mechanosensation and may provide some potential targets for preventing and treating bone-related diseases.

  16. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    SciTech Connect

    Kerem, B.; Zielenski, J.; Markiewicz, D.; Bozon, D.; Kennedy, D.; Rommens, J.M. ); Gazit, E. ); Yahav, J. ); Riordan, J.R. ); Collins, F.S. ); Tsui, Lapchee Univ. of Toronto, Ontario )


    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probably affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.

  17. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

    PubMed Central

    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi


    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer. PMID:28245558

  18. Consensus topography in the ATP binding site of the simian virus 40 and polyomavirus large tumor antigens

    SciTech Connect

    Bradley, M.K.; Smith, T.F.; Lathrop, R.H.; Livingston, D.M.; Webster, T.A.


    The location and sequence composition of a consensus element of the nucleotide binding site in both simian virus 40 (SV40) and polyomavirus (PyV) large tumor antigens (T antigens) can be predicted with the assistance of a computer-based pattern-matching system, ARIADNE. The latter was used to optimally align elements of T antigen primary sequence and predicted secondary structure with a descriptor for a mononucleotide binding fold. Additional consensus elements of the nucleotide binding site in these two proteins were derived from comparisons of T antigen primary and predicted secondary structures with x-ray structures of the nucleotide binding sites in four otherwise unrelated proteins. Each of these elements was predicted to be encompassed within a 110-residue segment that is highly conserved between the two T antigens residues 418-528 in SV 40 T antigen and residues 565-675 in PyV. Results of biochemical and immunologic experiments on the nucleotide binding behavior of these proteins using (/sup 32/P)-Amp-labeled SV40 T antigen, were found to be consistent with these predictions. Taken together, the latter have resulted in a topological model of the ATP binding site in these two oncogene products.

  19. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2

    PubMed Central



    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC. PMID:26640560

  20. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2.


    Li, Qiongyu; Wang, Xiangfeng; Shen, Aling; Zhang, Yuchen; Chen, Youqin; Sferra, Thomas J; Lin, Jiumao; Peng, Jun


    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC.

  1. Solution structure and function in trifluoroethanol of PP-50, an ATP-binding peptide from F1ATPase.


    Chuang, W J; Abeygunawardana, C; Gittis, A G; Pedersen, P L; Mildvan, A S


    PP-50, a synthetic peptide, based on residues 141-190 of the beta-subunit of mitochondrial F1ATPase, containing the GX4GKT consensus sequence for nucleoside triphosphate binding, binds ATP tightly (Kd = 17.5 microM) as found by fluorescence titration at pH 4.0. CD and 2D proton NMR studies at pH 4.0 revealed two beta-turns, regions of extended secondary structure, transient tertiary structure, and flexibility in the GX4GKT region (W.J. Chuang, C. Abeygunawardana, P. L. Pedersen, and A. S. Mildvan, 1992, Biochemistry 31, 7915-7921). CD titration of PP-50 with trifluoroethanol (TFE) reveals a decrease in ellipticity at 208 and 222 nm, saturating at 25% TFE. Computer analysis indicates that 25% TFE increases the helix content from 5.8 to 28.6%, decreases the beta-structure from 30.2 to 20.2% and decreases the coil content from 64 to 51.2%. Fluorescence titrations of H2ATP2- with PP-50 in 25% TFE yields a Kd of 7.3 microM, 2.4-fold tighter than in H2O, probably due to TFE increasing the activity of H2ATP2- . PP-50 completely quenches the fluorescence of H2ATP2- in 25% TFE, while in H2O the fluorescence quenching is only 62%. In H2O the binding of H2ATP2- increases the structure of PP-50 as detected by CD, but in 25% TFE no significant change in CD is found on binding either H2ATP2- or Mg2+ HATP (Kd = 14 microM). The complete proton NMR spectrum of PP-50 in 25% TFE has been assigned. The solution structure, determined by distance geometry, molecular dynamics with simulated annealing, and energy minimization, consists of a coil (residues 1-8), a strand (residues 9-12), a loop (residues 13-22) containing the GX4GKT consensus sequence (residues 16-23), an alpha-helix (residues 23-36), a turn (residues 38-41), and a coil (residues 42-50), similar to that of the corresponding region of the X-ray structure of F1ATPase (J.P. Abrahams, A.G.W. Leslie, R. Lutter, and J. E. Walker, 1994 Nature 370, 621-628) and to the structure of a homologous peptide from the ATP-binding site of

  2. Identification of a MAP 2-like ATP-binding protein associated with axoplasmic vesicles that translocate on isolated microtubules

    PubMed Central


    Axoplasmic vesicles were purified and observed to translocate on isolated microtubules in an ATP-dependent, trypsin-sensitive manner, implying that ATP-binding polypeptides essential for force generation were present on the vesicle surface. To identify these proteins [alpha 32P]8-azidoadenosine 5'-triphosphate ([alpha 32P]8-N3ATP), a photoaffinity analogue of ATP, was used. The results presented here identify and characterize a vesicle-associated polypeptide having a relative molecular mass of 292 kD that bound [alpha 32P]8-N3ATP. The incorporation of label is ultraviolet light-dependent and ATP- sensitive. Moreover, the 292-kD polypeptide could be isolated in association with vesicles or microtubules, depending on the conditions used, and the data indicate that the 292-kD polypeptide is similar to mammalian brain microtubule-associated protein 2 (MAP 2) for the following reasons: The 292-kD polypeptide isolated from either squid axoplasm or optic lobe cross-reacts with antiserum to porcine brain MAP 2. Furthermore, it purifies with taxol-stabilized microtubules and is released with salt. Based on these characteristics, the 292-kD polypeptide is distinct from the known force-generating molecules myosin and flagellar dynein, as well as the 110-130-kD kinesin-like polypeptides that have recently been described (Brady, S. T., 1985, Nature (Lond.), 317:73-75; Vale, R. D., T. S. Reese, and M. P. Sheetz, 1985b, Cell, 42:39-50; Scholey, J. M., M. E. Porter, P. M. Grissom, and J. R. McIntosh, 1985, Nature (Lond.), 318:483-486). Because the 292-kD polypeptide binds ATP and is associated with vesicles that translocate on purified MAP-free microtubules in an ATP-dependent fashion, it is therefore believed to be involved in vesicle-microtubule interactions that promote organelle motility. PMID:3091608

  3. The Hypertrophic Cardiomyopathy Myosin Mutation R453C Alters ATP Binding and Hydrolysis of Human Cardiac β-Myosin*

    PubMed Central

    Bloemink, Marieke; Deacon, John; Langer, Stephen; Vera, Carlos; Combs, Ariana; Leinwand, Leslie; Geeves, Michael A.


    The human hypertrophic cardiomyopathy mutation R453C results in one of the more severe forms of the myopathy. Arg-453 is found in a conserved surface loop of the upper 50-kDa domain of the myosin motor domain and lies between the nucleotide binding pocket and the actin binding site. It connects to the cardiomyopathy loop via a long α-helix, helix O, and to Switch-2 via the fifth strand of the central β-sheet. The mutation is, therefore, in a position to perturb a wide range of myosin molecular activities. We report here the first detailed biochemical kinetic analysis of the motor domain of the human β-cardiac myosin carrying the R453C mutation. A recent report of the same mutation (Sommese, R. F., Sung, J., Nag, S., Sutton, S., Deacon, J. C., Choe, E., Leinwand, L. A., Ruppel, K., and Spudich, J. A. (2013) Proc. Natl. Acad. Sci. U.S.A. 110, 12607–12612) found reduced ATPase and in vitro motility but increased force production using an optical trap. Surprisingly, our results show that the mutation alters few biochemical kinetic parameters significantly. The exceptions are the rate constants for ATP binding to the motor domain (reduced by 35%) and the ATP hydrolysis step/recovery stroke (slowed 3-fold), which could be the rate-limiting step for the ATPase cycle. Effects of the mutation on the recovery stroke are consistent with a perturbation of Switch-2 closure, which is required for the recovery stroke and the subsequent ATP hydrolysis. PMID:24344137

  4. Relationship between a point mutation S97C in CK1δ protein and its affect on ATP-binding affinity.


    Kumar, Ambuj; Rajendran, Vidya; Sethumadhavan, Rao; Purohit, Rituraj


    CK1δ (Casein kinase I isoform delta) is a member of CK1 kinase family protein that mediates neurite outgrowth and the function as brain-specific microtubule-associated protein. ATP binding kinase domain of CK1δ is essential for regulating several key cell cycle signal transduction pathways. Mutation in CK1δ protein is reported to cause cancers and affects normal brain development. S97C mutation in kinase domain of CK1δ protein has been involved to induce breast cancer and ductal carcinoma. We performed molecular docking studies to examine the effect of this mutation on its ATP-binding affinity. Further, we conducted molecular dynamics simulations to understand the structural consequences of S97C mutation over the kinase domain of CK1δ protein. Docking results indicated the loss of ATP-binding affinity of mutant structure, which were further rationalized by molecular dynamics simulations, where a notable loss in 3-D conformation of CK1δ kinase domain was observed in mutant as compared to native. Our results explained the underlying molecular mechanism behind the observed cancer associated phenotype caused by S97C mutation in CK1δ protein.

  5. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site

    PubMed Central

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R.; Phillips, Chris; Augustin, Martin A.; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek


    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5–inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  6. The Deviant ATP-binding Site of the Multidrug Efflux Pump Pdr5 Plays an Active Role in the Transport Cycle*

    PubMed Central

    Furman, Christopher; Mehla, Jitender; Ananthaswamy, Neeti; Arya, Nidhi; Kulesh, Bridget; Kovach, Ildiko; Ambudkar, Suresh V.; Golin, John


    Pdr5 is the founding member of a large subfamily of evolutionarily distinct, clinically important fungal ABC transporters containing a characteristic, deviant ATP-binding site with altered Walker A, Walker B, Signature (C-loop), and Q-loop residues. In contrast to these motifs, the D-loops of the two ATP-binding sites have similar sequences, including a completely conserved aspartate residue. Alanine substitution mutants in the deviant Walker A and Signature motifs retain significant, albeit reduced, ATPase activity and drug resistance. The D-loop residue mutants D340A and D1042A showed a striking reduction in plasma membrane transporter levels. The D1042N mutation localized properly had nearly WT ATPase activity but was defective in transport and was profoundly hypersensitive to Pdr5 substrates. Therefore, there was a strong uncoupling of ATPase activity and drug efflux. Taken together, the properties of the mutants suggest an additional, critical intradomain signaling role for deviant ATP-binding sites. PMID:24019526

  7. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Icyuz, Mert; Chauvet, Sylvain; Tao, Binli; Hartman, John L.; Kirk, Kevin L.


    The ABCC transporter subfamily includes pumps, the long and short multidrug resistance proteins (MRPs), and an ATP-gated anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR). We show that despite their thermodynamic differences, these ABCC transporter subtypes use broadly similar mechanisms to couple their extracellular gates to the ATP occupancies of their cytosolic nucleotide binding domains. A conserved extracellular phenylalanine at this gate was a prime location for producing gain of function (GOF) mutants of a long MRP in yeast (Ycf1p cadmium transporter), a short yeast MRP (Yor1p oligomycin exporter), and human CFTR channels. Extracellular gate mutations rescued ATP binding mutants of the yeast MRPs and CFTR by increasing ATP sensitivity. Control ATPase-defective MRP mutants could not be rescued by this mechanism. A CFTR double mutant with an extracellular gate mutation plus a cytosolic GOF mutation was highly active (single-channel open probability >0.3) in the absence of ATP and protein kinase A, each normally required for CFTR activity. We conclude that all 3 ABCC transporter subtypes use similar mechanisms to couple their extracellular gates to ATP occupancy, and highly active CFTR channels that bypass defects in ATP binding or phosphorylation can be produced.—Wei, S., Roessler, B. C., Icyuz, M., Chauvet, S., Tao, B., Hartman IV, J. L., Kirk, K. L. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels. PMID:26606940

  8. The effects of ABCG5/G8 polymorphisms on HDL-cholesterol concentrations depend on ABCA1 genetic variants in the Boston Puerto Rican health study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background and aims: ATP-binding cassette transporters G5/G8 (ABCG5/G8) are associated with HDL-C concentrations. To assess whether the effect of ABCG5/G8 genetic variants on HDL-C concentrations is dependent on ATP-binding cassette transporters A1 (ABCA1), we studied potential interactions between ...

  9. Structural Models of Zebrafish (Danio rerio) NOD1 and NOD2 NACHT Domains Suggest Differential ATP Binding Orientations: Insights from Computational Modeling, Docking and Molecular Dynamics Simulations

    PubMed Central

    Maharana, Jitendra; Sahoo, Bikash Ranjan; Bej, Aritra; Sahoo, Jyoti Ranjan; Dehury, Budheswar; Patra, Mahesh Chandra; Martha, Sushma Rani; Balabantray, Sucharita; Pradhan, Sukanta Kumar; Behera, Bijay Kumar


    Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) and NOD2 are cytosolic pattern recognition receptors playing pivotal roles in innate immune signaling. NOD1 and NOD2 recognize bacterial peptidoglycan derivatives iE-DAP and MDP, respectively and undergoes conformational alternation and ATP-dependent self-oligomerization of NACHT domain followed by downstream signaling. Lack of structural adequacy of NACHT domain confines our understanding about the NOD-mediated signaling mechanism. Here, we predicted the structure of NACHT domain of both NOD1 and NOD2 from model organism zebrafish (Danio rerio) using computational methods. Our study highlighted the differential ATP binding modes in NOD1 and NOD2. In NOD1, γ-phosphate of ATP faced toward the central nucleotide binding cavity like NLRC4, whereas in NOD2 the cavity was occupied by adenine moiety. The conserved ‘Lysine’ at Walker A formed hydrogen bonds (H-bonds) and Aspartic acid (Walker B) formed electrostatic interaction with ATP. At Sensor 1, Arg328 of NOD1 exhibited an H-bond with ATP, whereas corresponding Arg404 of NOD2 did not. ‘Proline’ of GxP motif (Pro386 of NOD1 and Pro464 of NOD2) interacted with adenine moiety and His511 at Sensor 2 of NOD1 interacted with γ-phosphate group of ATP. In contrast, His579 of NOD2 interacted with the adenine moiety having a relatively inverted orientation. Our findings are well supplemented with the molecular interaction of ATP with NLRC4, and consistent with mutagenesis data reported for human, which indicates evolutionary shared NOD signaling mechanism. Together, this study provides novel insights into ATP binding mechanism, and highlights the differential ATP binding modes in zebrafish NOD1 and NOD2. PMID:25811192

  10. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.


    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A


    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  11. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.


    Fry, D C; Kuby, S A; Mildvan, A S


    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme.

  12. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.


    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés


    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  13. The rem Mutations in the ATP-Binding Groove of the Rad3/XPD Helicase Lead to Xeroderma pigmentosum-Cockayne Syndrome-Like Phenotypes

    PubMed Central

    Montelone, Beth A.; Aguilera, Andrés


    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease. PMID:25500814

  14. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed Central

    Fry, D C; Kuby, S A; Mildvan, A S


    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme. Images PMID:2869483

  15. Conservation of an ATP-binding domain among RecA proteins from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r.


    Knight, K L; Hess, R M; McEntee, K


    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N3ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the [alpha-32P]8N3ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T31 of the E. coli K-12 RecA protein, which was the unique site of 8N3ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10(7) years.

  16. Conservation of an ATP-binding domain among recA proteins from Proteus vulgaris, erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r

    SciTech Connect

    Knight, K.L.; Hess, R.M.; McEntee, K.


    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N/sub 3/ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the (..cap alpha..-/sup 32/P)8N/sub 3/ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T/sub 31/ of the E. coli K-12 RecA protein, which was the unique site of 8N/sub 3/ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10/sup 7/ years.

  17. ATP–Binding Cassette Transporter Structure Changes Detected by Intramolecular Fluorescence Energy Transfer for High-Throughput Screening

    PubMed Central

    Iram, Surtaj H.; Gruber, Simon J.; Raguimova, Olga N.; Thomas, David D.


    Multidrug resistance protein 1 (MRP1) actively transports a wide variety of drugs out of cells. To quantify MRP1 structural dynamics, we engineered a “two-color MRP1” construct by fusing green fluorescent protein (GFP) and TagRFP to MRP1 nucleotide–binding domains NBD1 and NBD2, respectively. The recombinant MRP1 protein expressed and trafficked normally to the plasma membrane. Two-color MRP1 transport activity was normal, as shown by vesicular transport of [3H]17β-estradiol-17-β-(d-glucuronide) and doxorubicin efflux in AAV-293 cells. We quantified fluorescence resonance energy transfer (FRET) from GFP to TagRFP as an index of NBD conformational changes. Our results show that ATP binding induces a large-amplitude conformational change that brings the NBDs into closer proximity. FRET was further increased by substrate in the presence of ATP but not by substrate alone. The data suggest that substrate binding is required to achieve a fully closed and compact structure. ATP analogs bind MRP1 with reduced apparent affinity, inducing a partially closed conformation. The results demonstrate the utility of the two-color MRP1 construct for investigating ATP-binding cassette transporter structural dynamics, and it holds great promise for high-throughput screening of chemical libraries for unknown activators, inhibitors, or transportable substrates of MRP1. PMID:25924616

  18. ATP utilization by yeast replication factor C. IV. RFC ATP-binding mutants show defects in DNA replication, DNA repair, and checkpoint regulation.


    Schmidt, S L; Pautz, A L; Burgers, P M


    Replication factor C is required to load proliferating cell nuclear antigen onto primer-template junctions, using the energy of ATP hydrolysis. Four of the five RFC genes have consensus ATP-binding motifs. To determine the relative importance of these sites for proper DNA metabolism in the cell, the conserved lysine in the Walker A motif of RFC1, RFC2, RFC3, or RFC4 was mutated to either arginine or glutamic acid. Arginine mutations in all RFC genes tested permitted cell growth, although poor growth was observed for rfc2-K71R. A glutamic acid substitution resulted in lethality in RFC2 and RFC3 but not in RFC1 or RFC4. Most double mutants combining mutations in two RFC genes were inviable. Except for the rfc1-K359R and rfc4-K55E mutants, which were phenotypically similar to wild type in every assay, the mutants were sensitive to DNA-damaging agents. The rfc2-K71R and rfc4-K55R mutants show checkpoint defects, most likely in the intra-S phase checkpoint. Regulation of the damage-inducible RNR3 promoter was impaired in these mutants, and phosphorylation of Rad53p in response to DNA damage was specifically defective when cells were in S phase. No dramatic defects in telomere length regulation were detected in the mutants. These data demonstrate that the ATP binding function of RFC2 is important for both DNA replication and checkpoint function and, for the first time, that RFC4 also plays a role in checkpoint regulation.

  19. Sensitivity of a renal K+ channel (ROMK2) to the inhibitory sulfonylurea compound glibenclamide is enhanced by coexpression with the ATP-binding cassette transporter cystic fibrosis transmembrane regulator.

    PubMed Central

    McNicholas, C M; Guggino, W B; Schwiebert, E M; Hebert, S C; Giebisch, G; Egan, M E


    We demonstrate here that coexpression of ROMK2, an inwardly rectifying ATP-sensitive renal K+ channel (IKATP) with cystic fibrosis transmembrane regulator (CFTR) significantly enhances the sensitivity of ROMK2 to the sulfonylurea compound glibenclamide. When expressed alone, ROMK2 is relatively insensitive to glibenclamide. The interaction between ROMK2, CFTR, and glibenclamide is modulated by altering the phosphorylation state of either ROMK2, CFTR, or an associated protein, as exogenous MgATP and the catalytic subunit of protein kinase A significantly attenuate the inhibitory effect of glibenclamide on ROMK2. Thus CFTR, which has been demonstrated to interact with both Na+ and Cl- channels in airway epithelium, modulates the function of renal ROMK2 K+ channels. PMID:8755607

  20. Computer modelling reveals new conformers of the ATP binding loop of Na+/K+-ATPase involved in the transphosphorylation process of the sodium pump

    PubMed Central

    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm


    Hydrolysis of ATP by Na+/K+-ATPase, a P-Type ATPase, catalyzing active Na+ and K+ transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp369 to allow the transfer of ATP’s terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp369 is achieved, analogous molecular modeling of the M4–M5 loop of ATPase was performed using the crystal data of Na+/K+-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr338 and Ile760 of the α2-subunit of Na+/K+-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe475 in the N-domain, the other one close to Asp369 in the P-domain. However, binding of Mg2+•ATP to any of these sites in the “open conformation” may not lead to phosphorylation of Asp369. Additional conformations of the cytoplasmic loop were found wobbling between “open conformation” <==> “semi-open conformation <==> “closed conformation” in the absence of 2Mg2+•ATP. The cytoplasmic loop’s conformational change to the “semi-open conformation”—characterized by a hydrogen bond between Arg543 and Asp611—triggers by binding of 2Mg2+•ATP to a single ATP site and conversion to the “closed conformation” the phosphorylation of Asp369 in the P-domain, and hence the start of Na+/K+-activated ATP hydrolysis. PMID:28316890

  1. Evaluation of a Brucella melitensis mutant deficient in O-polysaccharide export system ATP-binding protein as a rough vaccine candidate.


    Wang, Zhen; Niu, Jian Rui; Wang, Xiao Lei; Wu, Tong Lei; Cheng, Jie; Lu, Lin; Wu, Qing Min


    Rough Brucella mutants have been sought as vaccine candidates that do not interfere with the conventional serological diagnosis of brucellosis. In this study, a rough mutant of Brucella melitensis was generated by the disruption of the wzt gene, which encodes the O-polysaccharide (O-PS) export system ATP-binding protein. In vivo, the mutant 16MΔwzt was attenuated and conferred a level of protection against B. melitensis 16M challenge similar to that conferred by the vaccine strain B. melitensis M5 in mice. In pregnant sheep, the mutant 16MΔwzt did not induce abortion. In vitro, 16MΔwzt was more susceptible to polymyxin B and complement-mediated killing than B. melitensis 16M was. Most importantly, although 16MΔwzt had a rough phenotype, it was able to synthesize O-PS and did not induce detectable specific antibodies in sheep. These results suggested that 16MΔwzt deserved to further systematic evaluation as a vaccine for target animal hosts due to its promising features.

  2. Identification of a gene linked to Rhizobium meliloti ntrA whose product is homologous to a family to ATP-binding proteins.

    PubMed Central

    Albright, L M; Ronson, C W; Nixon, B T; Ausubel, F M


    The ntrA gene of Rhizobium meliloti has recently been identified and shown to be required for a diverse set of metabolic functions (C. W. Ronson, B. T. Nixon, L. M. Albright, and F. M. Ausubel, J. Bacteriol. 169:2424-2431, 1987). As a result of sequencing the ntrA gene and its flanking regions from R. meliloti, we identified an open reading frame directly upstream of ntrA, ORF1, whose predicted product is homologous to a superfamily of ATP-binding proteins involved in transport, cell division, nodulation, and DNA repair. The homology of ORF1 to this superfamily and its proximity to ntrA led us to investigate its role in symbiosis by mutagenesis and expression studies. We were unable to isolate an insertion mutation in ORF1, suggesting that ORF1 may code for an essential function. We identified the start of transcription for the ntrA gene in vegetative cells and bacteroids and showed that ORF1 and ntrA are transcriptionally unlinked. ORF1 appears to be in an operon with one or more upstream genes. Images PMID:2703463

  3. Immature human chorionic gonadotropin (hCG) in first trimester placental cells is bound to an ATP-binding protein forming high-molecular-weight hCG.


    Shimojo, M; Sakakibara, R; Ishiguro, M


    Human chorionic gonadotropin (hCG) in first trimester placental cells is made up of immature alpha- and beta-subunits containing only N-linked high-mannose sugar chains, which are of 21 kDa for the alpha-subunit and 23 and 19 kDa for the beta-subunit. However, the apparent molecular weight of immature hCG from placental cell extracts has been estimated from gel filtration to be much higher (100-200 kDa; high molecular weight-hCG, HMW-hCG) based on gel filtration than the theoretical value (approximately 44 kDa) of the alpha beta dimer (alpha beta-hCG). We prepared a gel-filtered fraction containing HMW-hCG and investigated treatments for converting it to alpha beta-hCG. We found that the molecular weight of HMW-hCG was decreased to close to that of alpha beta-hCG by treatment with acetone, proteases, or chelating agents. These treatments also shifted the isoelectric point of HMW-hCG from the acidic region (pI = 4-6) to the alkaline (pI = 9-11), approximating to that of alpha beta-hCG. We also found that HMW-hCG, but not acetone-treated HMW-hCG, bound to ATP-agarose resin. These results suggested that the immature alpha beta-hCG molecule in placental cells may be bound to an acidic ATP-binding protein to form HMW-hCG.

  4. ATP binding by the P-loop NTPase OsYchF1 (an unconventional G protein) contributes to biotic but not abiotic stress responses

    PubMed Central

    Cheung, Ming-Yan; Li, Xiaorong; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yung, Yuk-Lin; Yu, Mei-Hui; Wong, Kam-Bo; Lam, Hon-Ming


    G proteins are involved in almost all aspects of the cellular regulatory pathways through their ability to bind and hydrolyze GTP. The YchF subfamily, interestingly, possesses the unique ability to bind both ATP and GTP, and is possibly an ancestral form of G proteins based on phylogenetic studies and is present in all kingdoms of life. However, the biological significance of such a relaxed ligand specificity has long eluded researchers. Here, we have elucidated the different conformational changes caused by the binding of a YchF homolog in rice (OsYchF1) to ATP versus GTP by X-ray crystallography. Furthermore, by comparing the 3D relationships of the ligand position and the various amino acid residues at the binding sites in the crystal structures of the apo-bound and ligand-bound versions, a mechanism for the protein’s ability to bind both ligands is revealed. Mutation of the noncanonical G4 motif of the OsYchF1 to the canonical sequence for GTP specificity precludes the binding/hydrolysis of ATP and prevents OsYchF1 from functioning as a negative regulator of plant-defense responses, while retaining its ability to bind/hydrolyze GTP and its function as a negative regulator of abiotic stress responses, demonstrating the specific role of ATP-binding/hydrolysis in disease resistance. This discovery will have a significant impact on our understanding of the structure–function relationships of the YchF subfamily of G proteins in all kingdoms of life. PMID:26912459

  5. Whatever happened to cassette-dosing pharmacokinetics?


    Manitpisitkul, Prasarn; White, Ronald E


    Cassette dosing is a procedure that is used for rapidly assessing the pharmacokinetics of a series of discovery drug candidates by dosing a mixture of compounds rather than a single compound. Cassette dosing has advantages and disadvantages associated with its use, which leads to controversy about how and if it should be used. To assess the current practices of the pharmaceutical industry regarding cassette dosing, a survey of several pharmaceutical companies was conducted. Analysis of the survey revealed that opinion on this subject is divided within the pharmaceutical industry. In addition, it was determined that approximately only a half of those companies that perform in vivo pharmacokinetic screening use cassette dosing for this purpose.

  6. Cassette for handling banknotes or the like


    Lundblad, Leif


    A cassette for banknotes and like valuable articles is provided with a displaceable lid (6) and locking means (10) for latching the lid of the cassette when the cassette is located outside a housing (25) in which it is intended to be placed. An operating means (8) is arranged to co-act with the locking means and with a latching element (15). The latching element is arranged to be released in dependence upon a pre-set program. A signal circuit is arranged to send a code signal to a detector circuit (23) when electrical contact elements on the cassette and the housing co-act with one another, which detector circuit, when the signal coincides with the signal program in the detector circuit, causes a signal to be sent for moving the latching means to a non-latching position.

  7. Solution structure of the 45-residue MgATP-binding peptide of adenylate kinase as examined by 2-D NMR, FTIR, and CD spectroscopy.


    Fry, D C; Byler, D M; Susi, H; Brown, E M; Kuby, S A; Mildvan, A S


    The structure of a synthetic peptide corresponding to residues 1-45 of rabbit muscle adenylate kinase has been studied in aqueous solution by two-dimensional NMR, FTIR, and CD spectroscopy. This peptide, which binds MgATP and is believed to represent most of the MgATP-binding site of the enzyme [Fry, D.C., Kuby, S.A., & Mildvan, A.S. (1985) Biochemistry 24, 4680-4694], appears to maintain a conformation similar to that of residues 1-45 in the X-ray structure of intact porcine adenylate kinase [Sachsenheimer, W., & Schulz, G.E. (1977) J. Mol. Biol. 114, 23-26], with 42% of the residues of the peptide showing NOEs indicative of phi and psi angles corresponding to those found in the protein. The NMR studies suggest that the peptide is composed of two helical regions of residues 4-7 and 23-29, and three stretches of beta-strand at residues 8-15, 30-32, and 35-40, yielding an overall secondary structure consisting of 24% alpha-helix, 38% beta-structure, and 38% aperiodic. Although the resolution-enhanced amide I band of the peptide FTIR spectrum is broad and rather featureless, possibly due to disorder, it can be fit by using methods developed on well-characterized globular proteins. On this basis, the peptide consists of 35 +/- 10% beta-structure, 60 +/- 12% turns and aperiodic structure, and not more than 10% alpha-helix. The CD spectrum is best fit by assuming the presence of at most 13% alpha-helix in the peptide, 24 +/- 2% beta-structure, and 66 +/- 4% aperiodic. The inability of the high-frequency FTIR and CD methods to detect helices in the amount found by NMR may result from the short helical lengths as well as from static and dynamic disorder in the peptide. Upon binding of MgATP, numerous conformational changes in the backbone of the peptide are detected by NMR, with smaller alterations in the overall secondary structure as assessed by CD. Detailed assignments of resonances in the peptide spectrum and intermolecular NOEs between protons of bound MgATP and

  8. Miniaturized technology for DNA typing: cassette PCR.


    Manage, Dammika P; Pilarski, Linda M


    With the smaller size, low cost, and rapid testing capabilities, miniaturized lab-on-a-chip devices can change the way medical diagnostics are currently performed in the health-care system. We have demonstrated such a device that is self-contained, simple, disposable, and inexpensive. It is capable of performing DNA amplification on an inexpensive instrument suitable for near point of care settings. This technology will enable on the spot evaluation of patients in the clinic for faster medical decision-making and more informed therapeutic choices. Our device, a gel capillary cassette, termed cassette PCR, contains capillary reaction units each holding a defined primer set, with arrays of capillary reaction units for simultaneously detecting multiple targets. With the exception of the sample to be tested, each capillary reaction unit holds all the reagents needed for PCR in a desiccated form that can be stored at room temperature for up to 3 months and even longer in colder conditions. It relies on capillary forces for sample delivery of microliter volumes through capillaries, hence avoiding the need for pumps or valves. In the assembled cassette, the wax architecture supporting the capillaries melts during the PCR and acts as a vapor barrier as well as segregating capillaries with different primer sets. No other chip sealing techniques are required. Cassette PCR accepts raw samples such as urine, genital swabs, and blood. The cassette is made with off-the-shelf components and contains integrated positive and negative controls.

  9. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  10. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  11. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  12. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  13. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  14. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  15. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  16. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  17. 21 CFR 892.1860 - Radiographic film/cassette changer.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film/cassette changer. 892.1860... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1860 Radiographic film/cassette changer. (a) Identification. A radiographic film/cassette changer is a device intended to be used during...

  18. 21 CFR 892.1850 - Radiographic film cassette.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film cassette. 892.1850 Section 892...) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1850 Radiographic film cassette. (a) Identification. A radiographic film cassette is a device intended for use during diagnostic x-ray procedures...

  19. CryoEM and Molecular Dynamics of the Circadian KaiB-KaiC Complex Indicates That KaiB Monomers Interact with KaiC and Block ATP Binding Clefts

    SciTech Connect

    Villarreal, Seth A.; Pattanayek, Rekha; Williams, Dewight R.; Mori, Tetsuya; Qin, Ximing; Johnson, Carl H.; Egli, Martin; Stewart, Phoebe L.


    The circadian control of cellular processes in cyanobacteria is regulated by a posttranslational oscillator formed by three Kai proteins. During the oscillator cycle, KaiA serves to promote autophosphorylation of KaiC while KaiB counteracts this effect. Here, we present a crystallographic structure of the wild-type Synechococcus elongatus KaiB and a cryo-electron microscopy (cryoEM) structure of a KaiBC complex. The crystal structure shows the expected dimer core structure and significant conformational variations of the KaiB C-terminal region, which is functionally important in maintaining rhythmicity. The KaiBC sample was formed with a C-terminally truncated form of KaiC, KaiC-Δ489, which is persistently phosphorylated. The KaiB–KaiC-Δ489 structure reveals that the KaiC hexamer can bind six monomers of KaiB, which form a continuous ring of density in the KaiBC complex. We performed cryoEM-guided molecular dynamics flexible fitting simulations with crystal structures of KaiB and KaiC to probe the KaiBC protein–protein interface. This analysis indicated a favorable binding mode for the KaiB monomer on the CII end of KaiC, involving two adjacent KaiC subunits and spanning an ATP binding cleft. A KaiC mutation, R468C, which has been shown to affect the affinity of KaiB for KaiC and lengthen the period in a bioluminescence rhythm assay, is found within the middle of the predicted KaiBC interface. The proposed KaiB binding mode blocks access to the ATP binding cleft in the CII ring of KaiC, which provides insight into how KaiB might influence the phosphorylation status of KaiC.

  20. Phosphorylation at Ser²⁶ in the ATP-binding site of Ca²⁺/calmodulin-dependent kinase II as a mechanism for switching off the kinase activity.


    Yilmaz, Mehtap; Gangopadhyay, Samudra S; Leavis, Paul; Grabarek, Zenon; Morgan, Kathleen G


    CaMKII (Ca²⁺/calmodulin-dependent kinase II) is a serine/threonine phosphotransferase that is capable of long-term retention of activity due to autophosphorylation at a specific threonine residue within each subunit of its oligomeric structure. The γ isoform of CaMKII is a significant regulator of vascular contractility. Here, we show that phosphorylation of CaMKII γ at Ser²⁶, a residue located within the ATP-binding site, terminates the sustained activity of the enzyme. To test the physiological importance of phosphorylation at Ser²⁶, we generated a phosphospecific Ser²⁶ antibody and demonstrated an increase in Ser²⁶ phosphorylation upon depolarization and contraction of blood vessels. To determine if the phosphorylation of Ser²⁶ affects the kinase activity, we mutated Ser²⁶ to alanine or aspartic acid. The S26D mutation mimicking the phosphorylated state of CaMKII causes a dramatic decrease in Thr²⁸⁷ autophosphorylation levels and greatly reduces the catalytic activity towards an exogenous substrate (autocamtide-3), whereas the S26A mutation has no effect. These data combined with molecular modelling indicate that a negative charge at Ser²⁶ of CaMKII γ inhibits the catalytic activity of the enzyme towards its autophosphorylation site at Thr²⁸⁷ most probably by blocking ATP binding. We propose that Ser²⁶ phosphorylation constitutes an important mechanism for switching off CaMKII activity.

  1. A Cassette Based System for Hydrogen Storage and Delivery

    SciTech Connect

    Britton Wayne E.


    A hydrogen storage system is described and evaluated. This is based upon a cassette, that is a container for managing hydrogen storage materials. The container is designed to be safe, modular, adaptable to different chemistries, inexpensive, and transportable. A second module receives the cassette and provides the necessary infrastructure to deliver hydrogen from the cassette according to enduser requirements. The modular concept has a number of advantages over approaches that are all in one stand alone systems. The advantages of a cassette based system are discussed, along with results from model and laboratory testing.

  2. Finger-Actuated, Self-Contained Immunoassay Cassettes

    PubMed Central

    Qiu, Xianbo; Thompson, Jason A.; Chen, Zongyuan; Liu, Changchun; Chen, Dafeng; Ramprasad, Sudhir; Mauk, Michael G.; Ongagna, Serge; Barber, Cheryl; Abrams, William R.; Malamud, Daniel; Corstjens, Paul L.A.M.; Bau, Haim H.


    The building blocks for an inexpensive, disposable, luminescence-based microfluidic immunoassay cassette are described, and their integration in a point-of-care diagnostic system is demonstrated. Fluid motion in the cassette is driven by depressing finger-actuated pouches. All reagents needed for the immunoassay can be stored in the cassette in liquid form. Prior to use, the cassette consists of two separate parts. A top storage component contains pouches, sealed storage chambers, a metering chamber, and needle seats. The bottom processing component contains connection needles, a mixing chamber, and a detection chamber with immobilized proteins. Subsequent to sample introduction, the storage and processing components are mated. The needles form hydraulic connections between the two parts and, in some cases, close valves. The pouches are then actuated sequentially to induce flow of various reagents and facilitate process operations. The cassette is compatible with different detection modalities. Both a cassette with immunochromatographic-based detection and a cassette with microbead-based detection were constructed and evaluated. The immunochromatographic cassette was used to detect antibodies to HIV in saliva samples. The bead-based cassette was used to detect the proinflammatory chemokine IL-8. The experimental data demonstrates good repeatability and reasonable sensitivity. PMID:19597994

  3. Characterization of a multiple endogenously expressed adenosine triphosphate-binding cassette transporters using nuclear and cellular membrane affinity chromatography columns.


    Habicht, K-L; Singh, N S; Khadeer, M A; Shimmo, R; Wainer, I W; Moaddel, R


    Glioblastoma multiforme is an aggressive form of human astrocytoma, with poor prognosis due to multi-drug resistance to a number of anticancer drugs. The observed multi-drug resistance is primarily due to the efflux activity of ATP-Binding Cassette (ABC) efflux transporters such as Pgp, MRP1 and BCRP. The expression of these transporters has been demonstrated in nuclear and cellular membranes of the LN-229 human glioblastoma cell line. Nuclear membrane and cellular membrane fragments from LN-229 cells were immobilized on the IAM stationary phase to create nuclear and cellular membrane affinity chromatography columns, (NMAC(LN-229)) and (CMAC(LN-229)), respectively. Pgp, MRP1 and BCRP transporters co-immobilized on both columns were characterized and compared by establishing the binding affinities for estrone-3-sulfate (3.8 vs. 3.7μM), verapamil (0.6 vs. 0.7μM) and prazosin (0.099 vs. 0.033μM) on each column and no significant differences were observed. Since the marker ligands had overlapping selectivities, the selective characterization of each transporter was carried out by saturation of the binding sites of the non-targeted transporters. The addition of verapamil (Pgp and MRP1 substrate) to the mobile phase allowed the comparative screening of eight compounds at the nuclear and cellular BCRP using etoposide as the marker ligand. AZT increased the retention of etoposide (+15%), a positive allosteric interaction, on the CMAC(LN-229) column and decreased it (-5%) on the NMAC(LN-229), while the opposite effect was produced by rhodamine. The results indicate that there are differences between the cellular and nuclear membrane expressed BCRP and that NMAC and CMAC columns can be used to probe these differences.

  4. Cross-reactivity of Antibodies Directed to the Gram-Negative Bacterium Neisseria gonorrhoeae With Heat Shock Protein 60 and ATP-Binding Protein Correlates to Reduced Mitochondrial Activity in HIBCPP Choroid Plexus Papilloma Cells.


    Reuss, B; Schroten, H; Ishikawa, H; Asif, A R


    Antibacterial antibodies can cause neurologic side-effects by cross-reactivity with cellular antigens. Here we investigated interactions of antibodies to Neisseria gonorrhoeae (α-NG) - maternal infections by which increases the offspring's risk for later psychosis-with HIBCPP cells, a cell culture model of choroid plexus epithelium. Immunocytochemistry and Western blotting with α-NG, revealed organelle-like intracellular staining in HIBCPP cells, and labelling of several immunoreactive bands in cellular protein. Two-dimensional Western blotting revealed several immunopositive spots, most prominent of which were identified by mass spectrometry as mitochondrially localized proteins heat shock protein 60 (Hsp60) and ATP-binding protein β-subunit (ATPB). Similarly α-NG interacted with commercial samples of these proteins as revealed by Western blotting. Three alternative methods (JC-1, Janus green and MTT staining) revealed α-NG to cause in HIBCPP cells a significant decrease in mitochondrial activity, which could be reverted by neuroleptic drugs. Immunoreactivity of α-NG with choroid plexus epithelium in human post mortem samples suggests in vivo relevance of these findings. Finally, distinctly different staining patterns of antibodies against Neisseria meningitidis (α-NM), confirmed antibody specificity. To our knowledge this is the first report that α-NG cross-reactivity with Hsp60 and ATPB impairs mitochondrial activity in choroid plexus epithelial cells, pathogenetic relevance of which needs further clarification.

  5. 4,6-Substituted-1,3,5-triazin-2(1H)-ones as monocyclic catalytic inhibitors of human DNA topoisomerase IIα targeting the ATP binding site.


    Pogorelčnik, Barbara; Janežič, Matej; Sosič, Izidor; Gobec, Stanislav; Solmajer, Tom; Perdih, Andrej


    Human DNA topoisomerase IIα (htIIα) is a validated target for the development of novel anticancer agents. Starting from our discovered 4-amino-1,3,5-triazine inhibitors of htIIα, we investigated a library of 2,4,6-trisubstituted-1,3,5-triazines for novel inhibitors that bind to the htIIα ATP binding site using a combination of structure-based and ligand-based pharmacophore models and molecular docking. 4,6-substituted-1,3,5-triazin-2(1H)-ones 8, 9 and 14 were identified as novel inhibitors with activity comparable to the established drug etoposide (1). Compound 8 inhibits the htIIα decatenation in a superior fashion to etoposide. Cleavage assays demonstrated that selected compounds 8 and 14 do not act as poisons and antagonize the poison effect of etoposide. Microscale thermophoresis (MST) confirmed binding of compound 8 to the htIIα ATPase domain and compound 14 effectively inhibits the htIIα mediated ATP hydrolysis. The molecular dynamics simulation study provides further insight into the molecular recognition. The 4,6-disubstituted-1,3,5-triazin-2(1H)-ones represent the first validated monocyclic class of catalytic inhibitors that bind to the to the htIIα ATPase domain.

  6. Apparatus and method for loading and unloading multiple digital tape cassettes utilizing a removable magazine


    Lindenmeyer, C.W.


    An apparatus and method to automate the handling of multiple digital tape cassettes for processing by commercially available cassette tape readers and recorders. A removable magazine rack stores a plurality of tape cassettes, and cooperates with a shuttle device that automatically inserts and removes cassettes from the magazine to the reader and vice-versa. Photocells are used to identify and index to the desired tape cassette. The apparatus allows digital information stored on multiple cassettes to be processed without significant operator intervention.

  7. Apparatus and method for loading and unloading multiple digital tape cassettes utilizing a removable magazine


    Lindenmeyer, Carl W.


    An apparatus and method to automate the handling of multiple digital tape cassettes for processing by commercially available cassette tape readers and recorders. A removable magazine rack stores a plurality of tape cassettes, and cooperates with a shuttle device that automatically inserts and removes cassettes from the magazine to the reader and vice-versa. Photocells are used to identify and index to the desired tape cassette. The apparatus allows digital information stored on multiple cassettes to be processed without significant operator intervention.

  8. Multiple-step kinetic mechanism of DNA-independent ATP binding and hydrolysis by Escherichia coli replicative helicase DnaB protein: quantitative analysis using the rapid quench-flow method.


    Rajendran, S; Jezewska, M J; Bujalowski, W


    The kinetic mechanism of DNA-independent binding and hydrolysis of ATP by the E. coli replicative helicase DnaB protein has been quantitatively examined using the rapid quench-flow technique. Single-turnover studies of ATP hydrolysis, in a non-interacting active site of the helicase, indicate that bimolecular association of ATP with the site is followed by the reversible hydrolysis of nucleotide triphosphate and subsequent conformational transition of the enzyme-product complex. The simplest mechanism, which describes the data, is a three-step sequential process defined by:¿eqalign¿¿¿rm Helicase+ATP¿&¿mathop¿¿rightleftharpoons¿ ¿k_1¿_¿k_¿-1¿¿¿¿rm (H-ATP)¿¿mathop¿¿rightleftharpoons¿ ¿k_2¿_¿k_¿-2¿¿¿¿rm (H-ADP¿cdot Pi)¿¿cr &¿mathop¿¿rightleftharpoons¿ ¿k_3¿_¿k_¿-3¿¿¿¿rm (H-ADP¿cdot Pi)¿ *¿The sequential character of the mechanism excludes conformational transitions of the DnaB helicase prior to ATP binding. Analysis of relaxation times and amplitudes of the reaction allowed us to estimate all rate and equilibrium constants of partial steps of the proposed mechanism. The intrinsic binding constant for the formation of the (H-ATP) complex is K(ATP)=(1.3+/-0.5)x10(5) M(-1). The analysis of the data indicates that a part of the ATP binding energy originates from induced structural changes of the DnaB protein-ATP complex prior to ATP hydrolysis. The equilibrium constant of the chemical interconversion is K(H)=k(2)/k(-2) approximately 2 while the subsequent conformational transition is characterized by K(3)=k(3)/k(-3) approximately 30. The low value of K(H) and the presence of the subsequent energetically favorable conformational step(s) strongly suggest that free energy is released from the enzyme-product complex in the conformational transitions following the chemical step and before the product release.The combined application of single and multiple-turnover approaches show that all six nucleotide-binding sites of the Dna

  9. Replicative resolution of integron cassette insertion

    PubMed Central

    Loot, Céline; Ducos-Galand, Magaly; Escudero, José Antonio; Bouvier, Marie; Mazel, Didier


    Site-specific recombination catalyzed by tyrosine recombinases follows a common pathway consisting of two consecutive strand exchanges. The first strand exchange generates a Holliday junction (HJ), which is resolved by a second strand exchange. In integrons, attC sites recombine as folded single-stranded substrates. Only one of the two attC site strands, the bottom one, is efficiently bound and cleaved by the integrase during the insertion of gene cassettes at the double-stranded attI site. Due to the asymmetry of this complex, a second strand exchange on the attC bottom strand (bs) would form linearized abortive recombination products. We had proposed that HJ resolution would rely on an uncharacterized mechanism, probably replication. Using an attC site carried on a plasmid with each strand specifically tagged, we followed the destiny of each strand after recombination. We demonstrated that only one strand, the one carrying the attC bs, is exchanged. Furthermore, we show that the recombination products contain the attC site bs and its entire de novo synthesized complementary strand. Therefore, we demonstrate the replicative resolution of single-strand recombination in integrons and rule out the involvement of a second strand exchange of any kind in the attC × attI reaction. PMID:22740653

  10. Characterization of [35S]-ATP alpha S and [3H]-alpha, beta-MeATP binding sites in rat brain cortical synaptosomes: regulation of ligand binding by divalent cations.


    Schäfer, R; Reiser, G


    1. We made a comparative analysis of the binding characteristics of the radioligands [35S]-ATP alpha S and [3H]-alpha, beta-MeATP in order to test whether these ligands can be used to analyse P2-purinoceptors in synaptosomal membranes from rat brain cortex. 2. Synaptosomes possess sites with high affinity for [35S]-ATP alpha S (Kd = 22.2 +/- 9.1 nM, Bmax = 14.8 pmol mg-1 protein). The rank order of the competition potency of the different compounds (ATP alpha S, ATP, ATP gamma S > ADP beta S, 2-MeSATP > deoxyATP, ADP > > UTP, alpha, beta-MeATP, AMP, Reactive Blue-2, suramin, isoPPADS) is consistent with pharmacological properties of P2Y-purinoceptors. 3. Under identical conditions [35S]-ATP alpha S and [3H]-alpha, beta-MeATP bind to different binding sites at synaptosomal membranes from rat brain cortex. The affinity of the [3H]-alpha, beta-MeATP binding sites (Kd = 13.7 +/- 1.8 nM, Bmax = 6.34 +/- 0.28 pmol mg-1 protein) was 38 fold higher than the potency of alpha, beta-MeATP to displace [35S]-ATP alpha S binding (Ki = 0.52 microM). ATP and ADP beta S competed at both binding sites with different affinities, 60 fold and 175 fold, respectively. The other agonists tested (2-MeSATP, UTP, GTP) did not affect specific [35H]-alpha, beta-MeATP binding at concentrations up to 100 microM. The antagonists (suramin, isoPPADS, Evan's Blue) showed completely different affinities for both binding sites. 4. Binding of [35S]-ATP alpha S on synaptosomes was regulated by GTP, which is indicative for G-protein coupled receptors. The Kd value for the high affinity binding site was reduced in the presence of GTP about 5 fold (from 1.8 nM to 8.6 nM). In the presence of Mg2+ the affinity was increased (Kd 1.8 nM versus 22 nM in the absence of Mg2+). 5. The binding of both radioligands was regulated in an opposite manner by physiological concentrations of Ca2+ and Mg2+. Binding of [3H]-alpha, beta-MeATP to synaptosomal membranes was increased 3 fold by raising the Ca2+ concentration

  11. Excisable cassettes: new tools for functional analysis of Streptomyces genomes.


    Raynal, Alain; Karray, Fatma; Tuphile, Karine; Darbon-Rongère, Emmanuelle; Pernodet, Jean-Luc


    The functional analysis of microbial genomes often requires gene inactivation. We constructed a set of cassettes consisting of single antibiotic resistance genes flanked by the attL and attR sites resulting from site-specific integration of the Streptomyces pSAM2 element. These cassettes can easily be used to inactivate genes by in-frame deletion in Streptomyces by a three-step strategy. In the first step, in Escherichia coli, the cassette is inserted into a cloned copy of the gene to be inactivated. In the second step, the gene is replaced by homologous recombination in Streptomyces, allowing substitution of the wild-type target gene with its inactivated counterpart. In the third step, the cassette can be removed by expression of the pSAM2 genes xis and int. The resulting strains are marker-free and contain an "attB-like" sequence of 33, 34, or 35 bp with no stop codon if the cassette is correctly chosen. Thus, a gene can be disrupted by creating an in-frame deletion, avoiding polar effects if downstream genes are cotranscribed with the target gene. A set of cassettes was constructed to contain a hygromycin or gentamicin resistance gene flanked by the attL and attR sites. The initial constructions carrying convenient cloning sites allow the insertion of any other marker gene. We tested insertion and excision by inserting a cassette into orf3, the third gene of an operon involved in spiramycin biosynthesis. We verified that the cassette exerted a polar effect on the transcription of downstream genes but that, after excision, complementation with orf3 alone restored spiramycin production.

  12. Excisable Cassettes: New Tools for Functional Analysis of Streptomyces Genomes

    PubMed Central

    Raynal, Alain; Karray, Fatma; Tuphile, Karine; Darbon-Rongère, Emmanuelle; Pernodet, Jean-Luc


    The functional analysis of microbial genomes often requires gene inactivation. We constructed a set of cassettes consisting of single antibiotic resistance genes flanked by the attL and attR sites resulting from site-specific integration of the Streptomyces pSAM2 element. These cassettes can easily be used to inactivate genes by in-frame deletion in Streptomyces by a three-step strategy. In the first step, in Escherichia coli, the cassette is inserted into a cloned copy of the gene to be inactivated. In the second step, the gene is replaced by homologous recombination in Streptomyces, allowing substitution of the wild-type target gene with its inactivated counterpart. In the third step, the cassette can be removed by expression of the pSAM2 genes xis and int. The resulting strains are marker-free and contain an “attB-like” sequence of 33, 34, or 35 bp with no stop codon if the cassette is correctly chosen. Thus, a gene can be disrupted by creating an in-frame deletion, avoiding polar effects if downstream genes are cotranscribed with the target gene. A set of cassettes was constructed to contain a hygromycin or gentamicin resistance gene flanked by the attL and attR sites. The initial constructions carrying convenient cloning sites allow the insertion of any other marker gene. We tested insertion and excision by inserting a cassette into orf3, the third gene of an operon involved in spiramycin biosynthesis. We verified that the cassette exerted a polar effect on the transcription of downstream genes but that, after excision, complementation with orf3 alone restored spiramycin production. PMID:16820478

  13. Self-illuminative cascade-reaction-driven anticancer therapeutic cassettes made of cooperatively interactive nanocomplexes.


    Song, Woo Chul; Shin, Seung Won; Park, Kyung Soo; Jang, Min Su; Choi, Jin-Ha; Oh, Byung-Keun; Um, Soong Ho


    Therapeutic options based on near-infrared (NIR) wavelengths have attracted attention owing to in vivo lowest-background interventions and the development of several nano-architectures with localized surface plasmon resonance. Because of their limited tissue penetration, the clinical use of NIR light-driven treatments is not widespread; this technology is inapplicable to infection sites in the deeper areas of internal tissues. In this study, we demonstrate a self-illuminative therapeutic cassette able to exert anticancer effects via a series of enzymatic, chemical, and optical cooperative cascade reactions. It consists of (1) NIR-illuminative nanocomplexes and (2) NIR-sensitive therapeutic cassettes, which demonstrate a 60% chemically-induced killing effect in a prostate cancer model without external NIR irradiation. This technology can also be actively exploited as an imaging agent due to adaptation of a self-illuminating nanocomplex. Consequently, these novel therapeutic cassettes, which work not only as a powerful internal NIR stimulant, but also as a biological imaging platform, provide a new rational design concept for biomedical use.

  14. Kanamycin Resistance Cassette for Genetic Manipulation of Treponema denticola.


    Li, Yuebin; Ruby, John; Wu, Hui


    Treponema denticola has been recognized as an important oral pathogen of the "red complex" bacterial consortium that is associated with the pathogenesis of endodontal and periodontal diseases. However, little is known about the virulence of T. denticola due to its recalcitrant genetic system. The difficulty in genetically manipulating oral spirochetes is partially due to the lack of antibiotic resistance cassettes that are useful for gene complementation following allelic replacement mutagenesis. In this study, a kanamycin resistance cassette was identified and developed for the genetic manipulation of T. denticola ATCC 35405. Compared to the widely used ermF-ermAM cassette, the kanamycin cassette used in the transformation experiments gave rise to additional antibiotic-resistant T. denticola colonies. The kanamycin cassette is effective for allelic replacement mutagenesis as demonstrated by inactivation of two open reading frames of T. denticola, TDE1430 and TDE0911. In addition, the cassette is also functional in trans-chromosomal complementation. This was determined by functional rescue of a periplasmic flagellum (PF)-deficient mutant that had the flgE gene coding for PF hook protein inactivated. The integration of the full-length flgE gene into the genome of the flgE mutant rescued all of the defects associated with the flgE mutant that included the lack of PF filament and spirochetal motility. Taken together, we demonstrate that the kanamycin resistance gene is a suitable cassette for the genetic manipulation of T. denticola that will facilitate the characterization of virulence factors attributed to this important oral pathogen.

  15. A Portable Analyzer for Pouch-Actuated, Immunoassay Cassettes

    PubMed Central

    Qiu, Xianbo; Liu, Changchun; Mauk, Michael G.; Hart, Robert W.; Chen, Dafeng; Qiu, Jing; Kientz, Terry; Fiene, Jonathan; Bau, Haim H.


    A portable, small footprint, light, general purpose analyzer (processor) to control the flow in immunoassay cassettes and to facilitate the detection of test results is described. The durable analyzer accepts disposable cassettes that contain pouches and reaction chambers for various unit operations such as hydration of dry reagents, stirring, and incubation. The analyzer includes individually controlled, linear actuators to compress the pouches in the cassette, which facilitates the pumping and mixing of sample and reagents, and to close diaphragm-based valves for flow control. The same types of actuators are used to compress pouches and actuate valves. The analyzer also houses a compact OEM scanner/reader to excite fluorescence and detect emission from labels. The analyzer is hydraulically isolated from the cassette, reducing the possibility of cross-contamination. The analyzer facilitates programmable, automated execution of a sequence of operations such as pumping and valving in a timely fashion, reducing the level of expertise required from the operator and the possibility for errors. The analyzer’s design is modular and expandable to accommodate cassettes of various complexities and additional functionalities. In this paper, the utility of the analyzer has been demonstrated with the execution of a simple, consecutive, lateral flow assay of a model biological system and the test results were detected with up converting phosphor labels that are excited at infrared frequencies and emit in the visible spectrum. PMID:22125359

  16. Self-Paced Physics [Talking Book Cassette Tapes].

    ERIC Educational Resources Information Center

    New York Inst. of Tech., Old Westbury.

    As one of three audiovisual media in the U. S. Naval Academy Self-Paced Physics Course, 16 cassette tapes relating to lectures of mechanics, electricity, and magnetism are prepared for enriching and supplementary purposes. The material is designed to be used in combination with the talking book where illustrations, formulas, behavioral objectives,…

  17. Directory of Spoken-Voice Audio-Cassettes, 1972.

    ERIC Educational Resources Information Center

    McKee, Gerald, Ed.

    Most listings in this catalog, which draws on many sources of production and is not a guide to one company's output, are for programs of college or adult level interest, with the exception of the "Careers" listings, geared toward high school students. The catalog also has lists of producers of children's cassettes and those designed for school…

  18. Cassette Braille: A New Communication Tool for Blind People.

    ERIC Educational Resources Information Center

    Doorlag, Deanne M.; Doorlag, Donald H.


    The VersaBraille System, which incorporates cassettes with braille, has been successfully implemented in the San Diego Unified School District. Preliminary results indicate that the system promoted reading and writing rates and was more easily and quietly operated than the mechanical brailler. Users rated the system positively. (Author/CL)

  19. The Real World French Cassette Program. Script Book.

    ERIC Educational Resources Information Center

    Sternburg, Sheldon G.; Sammarco, Anthony M., Jr.

    This dual cassette package, accompanied by a script book, is designed to give students listening practice in French, particularly for regional differences of pronunciation and for variety in idiomatic constructions. The program may be integrated with texts used in intermediate and advanced levels of instruction. The announcements, jingles, and…

  20. The Real World Spanish Cassette Program. Script Book.

    ERIC Educational Resources Information Center

    Sternburg, Sheldon G.

    This dual cassette program, accompanied by a script book, is designed to give students listening practice in Spanish, particularly for regional differences of pronunciation and for variety in idiomatic construction. The program may be integrated with texts used in intermediate and advanced levels of instruction. The announcements, jingles, and…

  1. A chloride-inducible gene expression cassette and its use in induced lysis of Lactococcus lactis.

    PubMed Central

    Sanders, J W; Venema, G; Kok, J


    A chloride-inducible promoter previously isolated from the chromosome of Lactococcus lactis (J. W. Sanders, G. Venema, J. Kok, and K. Leenhouts, Mol. Gen. Genet., in press) was exploited for the inducible expression of homologous and heterologous genes. An expression cassette consisting of the positive-regulator gene gadR, the chloride-inducible promoter Pgad, and the translation initiation signals of gadC was amplified by PCR. The cassette was cloned upstream of Escherichia coli lacZ, the holin-lysin cassette (lytPR) of the lactococcal bacteriophage r1t, and the autolysin gene of L. lactis, acmA. Basal activity of Pgad resulted in a low level of expression of all three proteins. Growth in the presence of 0.5 M NaCl of a strain containing the gadC::lacZ fusion resulted in a 1,500-fold increase of beta-galactosidase activity. The background activity levels of LytPR and AcmA had no deleterious effects on cell growth, but induction of lysin expression by addition of 0.5 M NaCl resulted in inhibition of growth. Lysis was monitored by following the release of the cytoplasmic marker enzyme PepX. Released PepX activity was maximal at 1 day after induction of lytPR expression with 0.1 M NaCl. Induction of acmA expression resulted in slower release of PepX from the cells. The presence of the inducing agent NaCl resulted in the stabilization of osmotically fragile cells. PMID:9406408

  2. The effect of ABCG5/G8 polymorphisms on plasma HDL cholesterol levels depends on the ABCA1 gene variation in the Boston Puerto Rican Health Study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: ATP-binding cassette transporters G5/G8 have shown an association with HDL-C. One of the most likely mechanisms to explain those associations is through ABCA1. Objective: To assess whether the effect of ABCG5/G8 polymorphisms on HDL-C is dependent on ABCA1, we studied potential interacti...

  3. Reaching Out: The Role of Audio Cassette Communication in Rural Development. Occasional Paper 19.

    ERIC Educational Resources Information Center

    Adhikarya, Ronny; Colle, Royal D.

    This report describes the state-of-the-art of audio cassette technology (ACT) and reports findings from field tests, case studies, and pilot projects in several countries which demonstrate the potential of audio cassettes as a medium for communicating with rural people. Specific guidance is also offered on how a project can use cassettes as a…

  4. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  5. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  6. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  7. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  8. 21 CFR 892.1870 - Radiographic film/cassette changer programmer.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Radiographic film/cassette changer programmer. 892... SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1870 Radiographic film/cassette changer programmer. (a) Identification. A radiographic film/cassette changer programmer is...

  9. Patterns of Availability and Use of Audiotape Cassettes in Special Libraries. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Hughes, J. M., II


    The availability and use of audiotape cassettes is studied in terms of user requirements. The following factors were examined: how special libraries utilize audiotape cassettes; who the users of the medium are; how the libraries acquire and maintain their collection; and opinions of librarians as to the value of the audiotape cassette as a medium for dissemination of information.


    SciTech Connect

    Brisson, M.


    The measurement of aerosol dusts has long been utilized to assess the exposure of workers to metals. Tools used to sample and measure aerosol dusts have gone through many transitions over the past century. In particular, there have been several different techniques used to sample for beryllium, not all of which might be expected to produce the same result. Today, beryllium samples are generally collected using filters housed in holders of several different designs, some of which are expected to produce a sample that mimics the human capacity for dust inhalation. The presence of dust on the interior walls of cassettes used to hold filters during metals sampling has been discussed in the literature for a number of metals, including beryllium, with widely varying data. It appears that even in the best designs, particulates can enter the sampling cassette and deposit on the interior walls rather than on the sampling medium. The causes are not well understood but are believed to include particle bounce, electrostatic forces, particle size, particle density, and airflow turbulence. Historically, the filter catch has been considered to be the sample, but the presence of wall deposits, and the potential that the filter catch is not representative of the exposure to the worker, puts that historical position into question. This leads to a fundamental question: What is the sample? This article reviews the background behind the issue, poses the above-mentioned question, and discusses options and a possible path forward for addressing that question.

  11. Expression of antibiotic resistance genes in the integrated cassettes of integrons.

    PubMed Central

    Collis, C M; Hall, R M


    Plasmids containing cloned integron fragments which differ only with respect to either the sequence of the promoter(s) or the number and order of inserted cassettes were used to examine the expression of resistance genes encoded in integron-associated gene cassettes. All transcripts detected commenced at the common promoter P(ant), and alterations in the sequence of P(ant) affected the level of resistance expressed by cassette genes. When both P(ant) and the secondary promoter P2 were present, transcription from both promoters was detected. When more than one cassette was present, the position of the cassette in the array influenced the level of antibiotic resistance expressed by the cassette gene. In all cases, the resistance level was highest when the gene was in the first cassette, i.e., closest to P(ant), and was reduced to different extents by the presence of individual upstream cassettes. In Northern (RNA) blots, multiple discrete transcripts originating at P(ant) were detected, and only the longer transcripts contained the distal genes. Together, these data suggest that premature transcription termination occurs within the cassettes. The most abundant transcripts appeared to contain one or more complete cassettes, and is possible that the 59-base elements found at the end of the cassettes (3' to the coding region) not only function as recombination sites but may also function as transcription terminators. PMID:7695299

  12. A simplified erythromycin resistance cassette for Treponema denticola mutagenesis

    PubMed Central

    Goetting-Minesky, M. Paula; Fenno, J. Christopher


    The primary selectable marker for genetic studies of Treponema denticola is a hybrid gene cassette containing both ermF and ermAM (ermB) genes. ErmB functions in Escherichia coli, while ErmF has been assumed to confer resistance in T. denticola. We demonstrate here that ErmB is sufficient for erythromycin selection in T. denticola and that the native ermB promoter drives ErmB expression. PMID:20691222

  13. Cassette less SOFC stack and method of assembly


    Meinhardt, Kerry D


    A cassette less SOFC assembly and a method for creating such an assembly. The SOFC stack is characterized by an electrically isolated stack current path which allows welded interconnection between frame portions of the stack. In one embodiment electrically isolating a current path comprises the step of sealing a interconnect plate to a interconnect plate frame with an insulating seal. This enables the current path portion to be isolated from the structural frame an enables the cell frame to be welded together.

  14. Optimization of transplastomic production of hemicellulases in tobacco: effects of expression cassette configuration and tobacco cultivar used as production platform on recombinant protein yields

    PubMed Central


    Background Chloroplast transformation in tobacco has been used extensively to produce recombinant proteins and enzymes. Chloroplast expression cassettes can be designed with different configurations of the cis-acting elements that govern foreign gene expression. With the aim to optimize production of recombinant hemicellulases in transplastomic tobacco, we developed a set of cassettes that incorporate elements known to facilitate protein expression in chloroplasts and examined expression and accumulation of a bacterial xylanase XynA. Biomass production is another important factor in achieving sustainable and high-volume production of cellulolytic enzymes. Therefore, we compared productivity of two tobacco cultivars – a low-alkaloid and a high-biomass - as transplastomic expression platforms. Results Four different cassettes expressing XynA produced various mutant phenotypes of the transplastomic plants, affected their growth rate and resulted in different accumulation levels of the XynA enzyme. The most productive cassette was identified and used further to express XynA and two additional fungal xylanases, Xyn10A and Xyn11B, in a high-biomass tobacco cultivar. The high biomass cultivar allowed for a 60% increase in XynA production per plant. Accumulation of the fungal enzymes reached more than 10-fold higher levels than the bacterial enzyme, constituting up to 6% of the total soluble protein in the leaf tissue. Use of a well-characterized translational enhancer with the selected expression cassette revealed inconsistent effects on accumulation of the recombinant xylanases. Additionally, differences in the enzymatic activity of crude plant extracts measured in leaves of different age suggest presence of a specific xylanase inhibitor in the green leaf tissue. Conclusion Our results demonstrate the pivotal importance of the expression cassette design and appropriate tobacco cultivar for high-level transplastomic production of recombinant proteins. PMID:23642171

  15. Existence of a low-affinity ATP-binding site in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles: evidence from binding of 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP and -[3H]ATP.


    Suzuki, H; Kubota, T; Kubo, K; Kanazawa, T


    ATP-binding sites in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles were titrated with 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP (TNP-AMP) or -[3H]ATP (TNP-ATP) in the absence of Ca2+ at pH 7.0 and 0 degrees C by using a centrifugation procedure. In some measurements, the bound TNP-nucleotides were chased with ATP. The data were analyzed by best-fit computer programs as well as by Scatchard plots. The results showed the existence of 1 mol of TNP-AMP binding sites with high affinity (Kd = 7.62 nM) per mole of phosphorylatable sites. The affinity of these sites for ATP (Kd = 10.1 microM) agreed with that of catalytic sites for ATP in the absence of Ca2+. The results further showed the existence of 2 mol of TNP-ATP binding sites with uniform affinity (Kd = 156 nM) per mole of phosphorylatable sites. Half of the bound TNP-ATP was fully chased by low concentrations of ATP. The affinity of this class of the sites for ATP (Kd = 8.9 microM) again agreed with that of catalytic sites for ATP. The other half of the bound TNP-ATP was fully chased only by much higher concentrations of ATP. Thus, the affinity of this class of the sites for ATP (Kd = 791 microM) was much lower than that of catalytic sites for ATP. Similar measurements were performed with sarcoplasmic reticulum vesicles pretreated by N-(iodoacetyl)-N'-(5-sulfo-1-naphthyl)ethylenediamine. Although the affinities for TNP-ATP and for ATP were appreciably altered by this pretreatment, the results were essentially the same as those obtained with native vesicles.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Cassettes for solid-oxide fuel cell stacks and methods of making the same

    SciTech Connect

    Weil, K. Scott; Meinhardt, Kerry D; Sprenkle, Vincent L


    Solid-oxide fuel cell (SOFC) stack assembly designs are consistently investigated to develop an assembly that provides optimal performance, and durability, within desired cost parameters. A new design includes a repeat unit having a SOFC cassette and being characterized by a three-component construct. The three components include an oxidation-resistant, metal window frame hermetically joined to an electrolyte layer of a multi-layer, anode-supported ceramic cell and a pre-cassette including a separator plate having a plurality of vias that provide electrical contact between an anode-side collector within the pre-cassette and a cathode-side current collector of an adjacent cell. The third component is a cathode-side seal, which includes a standoff that supports a cathode channel spacing between each of the cassettes in a stack. Cassettes are formed by joining the pre-cassette and the window frame.

  17. Is this charred material from a VHS video cassette?

    NASA Astrophysics Data System (ADS)

    Fruchtenicht, Tara; Blackledge, Robert D.; Williams, Teresa R.


    At his residence, a victim in a double homicide had installed a home-built video surveillance system. The suspects either knew of or discovered this system and removed it. In a backyard at a location associated with the suspects was a barrel used for burning trash. Could charred debris recovered from a metal bowl found among the contents of the barrel be the remains of a VHS video cassette? A positive answer to the question was obtained through a combination of optical microscopy, Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), and Energy Dispersive Spectroscopy (EDS).

  18. Chromosome inversions, adaptive cassettes and the evolution of species' ranges.


    Kirkpatrick, Mark; Barrett, Brian


    A chromosome inversion can spread when it captures locally adapted alleles or when it is introduced into a species by hybridization with adapted alleles that were previously absent. We present a model that shows how both processes can cause a species range to expand. Introgression of an inversion that carries novel, locally adapted alleles is a particularly powerful mechanism for range expansion. The model supports the earlier proposal that introgression of an inversion triggered a large range expansion of a malaria mosquito. These results suggest a role for inversions as cassettes of genes that can accelerate adaptation by crossing species boundaries, rather than protecting genomes from introgression.

  19. Versatile gene cassette plasmids to facilitate the construction of generalized and specialized cloning vectors.


    Mongkolsuk, S; Vattanaviboon, P; Rabibhadana, S; Kiatpapan, P


    We have built a series of useful gene cassette plasmids to facilitate the construction of generalized and specialized cloning vectors. The gene cassettes consist of two promoter-less genes, cat and gus, a selectable marker gene (tet) and an IncP mob sequence. All of these genes in the cassette vectors are flanked by many unique restriction sites to facilitate their use in the construction of cloning vectors.

  20. Antibiotic resistance gene cassettes derived from the omega interposon for use in E. coli and Streptomyces.


    Blondelet-Rouault, M H; Weiser, J; Lebrihi, A; Branny, P; Pernodet, J L


    Three antibiotic resistance gene cassettes, derived from the omega interposon (Prentki and Krisch (1984) Gene 29, 303-313) were constructed. These cassettes carry different antibiotic resistance genes, conferring resistance to geneticin, hygromycin or viomycin, flanked by short inverted repeats containing transcription and translation termination signals and synthetic polylinkers. These cassettes were designated omega aac, omega hyg and omega vph. Resistance phenotypes conferred by these constructions are selectable in E. coli and Streptomyces. These cassettes can be used for insertional mutagenesis or for vector construction.

  1. Screening Foodstuffs for Class 1 Integrons and Gene Cassettes.


    Waldron, Liette S; Gillings, Michael R


    Antibiotic resistance is one of the greatest threats to health in the 21st century. Acquisition of resistance genes via lateral gene transfer is a major factor in the spread of diverse resistance mechanisms. Amongst the DNA elements facilitating lateral transfer, the class 1 integrons have largely been responsible for spreading antibiotic resistance determinants amongst Gram negative pathogens. In total, these integrons have acquired and disseminated over 130 different antibiotic resistance genes. With continued antibiotic use, class 1 integrons have become ubiquitous in commensals and pathogens of humans and their domesticated animals. As a consequence, they can now be found in all human waste streams, where they continue to acquire new genes, and have the potential to cycle back into humans via the food chain. This protocol details a streamlined approach for detecting class 1 integrons and their associated resistance gene cassettes in foodstuffs, using culturing and PCR. Using this protocol, researchers should be able to: collect and prepare samples to make enriched cultures and screen for class 1 integrons; isolate single bacterial colonies to identify integron-positive isolates; identify bacterial species that contain class 1 integrons; and characterize these integrons and their associated gene cassettes.

  2. Staphylococcal cassette chromosome mec-like element in Macrococcus caseolyticus.


    Tsubakishita, Sae; Kuwahara-Arai, Kyoko; Baba, Tadashi; Hiramatsu, Keiichi


    Macrococcus is a bacterial genus that is closely related to Staphylococcus, which typically is isolated from animal skin and products. The genome analysis of multidrug-resistant Macrococcus caseolyticus strain JCSC5402, isolated from chicken, previously led to the identification of plasmid pMCCL2, which carries a transposon containing an unusual form of the Macrococcus mec gene complex (mecA(m)-mecR1(m)-mecI(m)-blaZ(m)). In M. caseolyticus strain JCSC7096, this mec transposon containing the mec gene complex (designated Tn6045 in this study) was found integrated downstream of orfX on the chromosome. Tn6045 of JCSC7096 was bracketed by the direct repeat sequences (DR) specifically recognized by cassette chromosome recombinase (CCR). A non-mecA-containing staphylococcal cassette chromosome (SCC) element, designated SCC(7096), was integrated next to the mec transposon and separated from the latter by a DR. Nested PCR experiments showed that the mec transposon not only was excised singly but also coexcised with SCC(7096) from the chromosome at the DRs. The coexcised elements formed the extrachromosomal closed circular DNA of the SCCmec-like element. SCCmec is known to be the mobile element conveying methicillin (meticillin) resistance in staphylococci. However, its origin has been unknown. Our observation revealed a potential mechanism of the generation of a new SCCmec-like element in M. caseolyticus, a commensal bacterium of food animals.

  3. Autonomous Bioluminescent Expression of the Bacterial Luciferase Gene Cassette (lux) in a Mammalian Cell Line

    PubMed Central

    Close, Dan M.; Patterson, Stacey S.; Ripp, Steven; Baek, Seung J.; Sanseverino, John; Sayler, Gary S.


    Background The bacterial luciferase (lux) gene cassette consists of five genes (luxCDABE) whose protein products synergistically generate bioluminescent light signals exclusive of supplementary substrate additions or exogenous manipulations. Historically expressible only in prokaryotes, the lux operon was re-synthesized through a process of multi-bicistronic, codon-optimization to demonstrate for the first time self-directed bioluminescence emission in a mammalian HEK293 cell line in vitro and in vivo. Methodology/Principal Findings Autonomous in vitro light production was shown to be 12-fold greater than the observable background associated with untransfected control cells. The availability of reduced riboflavin phosphate (FMNH2) was identified as the limiting bioluminescence substrate in the mammalian cell environment even after the addition of a constitutively expressed flavin reductase gene (frp) from Vibrio harveyi. FMNH2 supplementation led to a 151-fold increase in bioluminescence in cells expressing mammalian codon-optimized luxCDE and frp genes. When injected subcutaneously into nude mice, in vivo optical imaging permitted near instantaneous light detection that persisted independently for the 60 min length of the assay with negligible background. Conclusions/Significance The speed, longevity, and self-sufficiency of lux expression in the mammalian cellular environment provides a viable and powerful alternative for real-time target visualization not currently offered by existing bioluminescent and fluorescent imaging technologies. PMID:20805991

  4. Motion Pictures and Video Cassettes 1971. AV-USA Supplement 2.

    ERIC Educational Resources Information Center

    Hope, Thomas W.

    The financial status of the motion picture and of the video cassette industry in 1970 are reviewed. Based on production rates and income of these industries, trends are discovered. Figures on local origination of television programing and commercials are also included. The section on video cassettes includes the following information: the current…

  5. Natural transformation with synthetic gene cassettes: new tools for integron research and biotechnology.


    Gestal, Alicia M; Liew, Elissa F; Coleman, Nicholas V


    Integrons are genetic elements that can capture and express genes packaged as gene cassettes. Here we report new methods that allow integrons to be studied and manipulated in their native bacterial hosts. Synthetic gene cassettes encoding gentamicin resistance (aadB) and green fluorescence (gfp), or lactose metabolism (lacZY), were made by PCR and self-ligation, converted to large tandem arrays by multiple displacement amplification, and introduced into Escherichia coli or Pseudomonas stutzeri strains via electroporation or natural transformation. Recombinants (Gm(R) or Lac(+)) were obtained at frequencies ranging from 10(1) to 10(6) c.f.u. (µg DNA)(-1). Cassettes were integrated by site-specific recombination at the integron attI site in nearly all cases examined (370/384), including both promoterless and promoter-containing cassettes. Fluorometric analysis of gfp-containing recombinants revealed that expression levels from the integron-associated promoter P(C) were five- to 10-fold higher in the plasmid-borne integron In3 compared with the P. stutzeri chromosomal integrons. Integration of lacZY cassettes into P. stutzeri integrons allowed the bacteria to grow on lactose, and the lacZY gene cassette was stably maintained in the absence of selection. This study is believed to be the first to show natural transformation by gene cassettes, and integron-mediated capture of catabolic gene cassettes.

  6. Cassette Sound Filmstrip Viewers -- Evaluations of Nine Machines. An In Depth Report

    ERIC Educational Resources Information Center

    Educational Product Report, 1974


    In evaluating cassette sound filmstrip viewers, many criteria are the same as those applied to cassette recorders in Educational Product Report; v7 n5 Nov '73 and silent filmstrip viewers in Educational Product Report; v6 n5 Feb '73. These criteria cover output power; frequency response; tape speed accuracy including drift, wow, and flutter; and…

  7. Syntheses, photophysical properties, and application of through-bond energy-transfer cassettes for biotechnology.


    Jiao, Guan-Sheng; Thoresen, Lars H; Kim, Taeg Gyum; Haaland, Wade C; Gao, Feng; Topp, Michael R; Hochstrasser, Robin M; Metzker, Michael L; Burgess, Kevin


    We have designed fluorescent "through-bond energy-transfer cassettes" that can harvest energy of a relatively short wavelength (e.g., 490 nm), and emit it at appreciably longer wavelengths without significant loss of intensity. Probes of this type could be particularly useful in biotechnology for multiplexing experiments in which several different outputs are to be observed from a single excitation source. Cassettes 1-4 were designed, prepared, and studied as model systems to achieve this end. They were synthesized through convergent routes that feature coupling of specially prepared fluorescein- and rhodamine-derived fragments. The four cassettes were shown to emit strongly, with highly efficient energy transfer. Their emission maxima cover a broad range of wavelengths (broader than the four dye cassettes currently used for most high-throughput DNA sequencing), and they exhibit faster energy-transfer rates than a similar through-space energy-transfer cassette. Specifically, energy-transfer rates in these cassettes is around 6-7 ps, in contrast to a similar through-space energy-transfer system shown to have a decay time of around 35 ps. Moreover, the cassettes are considerably more stable to photobleaching than fluorescein, even though they each contain fluorescein-derived donors. This was confirmed by bulk fluorescent measurements, and in single-molecule-detection studies. Modification of a commercial automated DNA-sequencing apparatus to detect the emissions of these four energy-transfer cassettes enabled single-color dye-primer sequencing.

  8. Molecular characterization of class 1 integrons and gene cassettes in multidrug resistant (MDR) Klebsiella spp. isolated from hospitalized and outpatients in Iran, 2009

    PubMed Central

    Salimizand, Himen; Shahcheraghi, Fereshteh; Kalantar, Enayatollah; Badmasti, Farzad


    Background and objectives Klebsiella species are of the most common bacteria involved in nosocomial and urinary tract infections. Genetic elements such as class 1 integrons have an important role in the resistance development. In this study, the share of class 1 integrons, the genetic characterization of the integron cassettes and PFGE profiles of the clinical Klebsiella isolates are evaluated in Besat University hospital of Sanandaj, Iran. Methods Isolates from 17890 clinical specimens were identified by API20E. Antibiotic susceptibility testing and MIC were done for MDR isolates. For investigating class 1 integrons and gene cassettes, PCR by intI1 integrase and 5’-CS/3’-CS were performed. Integrated gene cassettes were analyzed by PCR-RFLP and sequencing. Pulsed-Field Gel Electrophoresis was carried out for studying of clonality outbreak of isolates. Results Thirty five Klebsiella spp. were isolated and included 29 K. pneumoniae and 6 K. oxytoca. All the isolates were susceptible to carbapenems while other antibiotics showed high resistant profile. In all Klebsiella spp. PCR for intI1 integrase and 5’-CS/3’-CS were positive (100%). Sequencing for prevalent bands of internal variable regions between 5’-CS/3’-CS showed arr-5, orfD-aacA4 and aad5- dfrA17. PFGE Analysis showed 18 clusters in K. pneumoniae with clonality relatedness in some cases but no relatedness among K. oxytoca isolates. Conclusion High prevalence of class 1 integron carrying gene cassettes confirms that integron-mediated antimicrobial gene cassettes are important in Klebsiella spp. resistance profile. Clone diffusions of MDR Klebsiella spp. which harbor class 1 integrons have threaten the potential in the resistance development in our clinical settings. PMID:23466743

  9. Integron-associated gene cassettes in Halifax Harbour: assessment of a mobile gene pool in marine sediments.


    Koenig, J E; Boucher, Yan; Charlebois, Robert L; Nesbø, Camilla; Zhaxybayeva, Olga; Bapteste, Eric; Spencer, Matthew; Joss, Michael J; Stokes, H W; Doolittle, W F


    The integron/gene cassette systems identified in bacteria comprise a class of genetic elements that allow adaptation by acquisition of gene cassettes. Integron gene cassettes have been shown to facilitate the spread of drug resistance in human pathogens but their role outside a clinical setting has not been explored extensively. We sequenced 2145 integron gene cassettes from four marine sediment samples taken from the vicinity of Halifax Nova Scotia, Canada, increasing the number of gene cassettes obtained from environmental microbial communities by 10-fold. Sequence analyses reveals that the majority of these cassettes encode novel proteins and that this study is consistent with previous claims of high cassette diversity as we estimate a Chao1 diversity index of approximately 3000 cassettes from these samples. The functional distribution of environmental cassettes recovered in this study, when compared with that of cassettes from the only other source with significant sampling (Vibrio genomes) suggests that alternate selection regimes might be acting on these two gene pools. The majority of cassettes recovered in this study encode novel, unknown proteins. In instances where we obtained multiple alleles of a novel protein we demonstrate that non-synonymous versus synonymous substitution rates ratios suggest relaxed selection. Cassette-encoded proteins with known homologues represent a variety of functions and prevalent among these are isochorismatases; proteins involved in iron scavenging. Phylogenetic analysis of these isochorismatases as well as of cassette-encoded acetyltransferases reveals a patchy distribution, suggesting multiple sources for the origin of these cassettes. Finally, the two most environmentally similar sample sites considered in this study display the greatest overlap of cassette types, consistent with the hypothesis that cassette genes encode adaptive proteins.

  10. Enhancing functional production of a chaperone-dependent lipase in Escherichia coli using the dual expression cassette plasmid

    PubMed Central


    Abstracts Background The lipase subfamilies I.1 and I.2 show more than 33% homology in the amino acid sequences and most members share another common property that their genes are clustered with the secondary genes whose protein products are required for folding the lipase into an active conformation and secretion into the culture medium. In previous studies, the lipase (LipA) and its chaperone (LipB) from Ralstonia sp. M1 were overexpressed in E. coli and the lipase was successfully refolded in vitro. The purpose of this study was to enhance the production of the active lipase LipA from Ralstonia sp. M1 in the heterologous host E. coli without in vitro refolding process, using two-plasmid co-expression systems and dual expression cassette plasmid systems. Results To produce more active lipase from Ralstonia sp. M1 in E. coli without in vitro refolding process but with the help of overexpression of the chaperone (LipB1 and LipB3 corresponding to 56-aa truncated and 26-aa truncated chaperone LipB), six different expression systems including 2 two-plasmid co-expression systems (E. coli BL21/pELipABa + pELipB1k and BL21/pELipABa + pELipB3k) and 4 dual expression cassette plasmid systems (BL21/pELipAB-LipB1a, BL21/pELipAB-LipB3a, BL21/pELipA-LipB1a, and BL21/pELipA-LipB3a) were constructed. The two-plasmid co-expression systems (E. coli BL21/pELipABa + pELipB1k and BL21/pELipABa + pELipB3k) produced the active lipase at a level of 4 times as high as the single expression cassette plasmid system E. coli BL21/pELipABa did. For the first time, the dual expression cassette plasmid systems BL21/pELipAB-LipB1a and BL21/pELipAB-LipB3a yielded 29- and 19-fold production of the active lipase in comparison with the single expression cassette plasmid system E. coli BL21/pELipABa, respectively. Although the lipase amount was equally expressed in all these expression systems (40% of total cellular protein) and only a small fraction of the overexpressed lipase was folded in vivo

  11. Flipase-mediated cassette exchange in Sf9 insect cells for stable gene expression.


    Fernandes, Fabiana; Vidigal, João; Dias, Mafalda M; Prather, Kristala L J; Coroadinha, Ana S; Teixeira, Ana P; Alves, Paula M


    Site-specific DNA integration allows predictable heterologous gene expression and circumvents extensive clone screening. Herein, the establishment of a Flipase (Flp)-mediated cassette exchange system in Sf9 insect cells for targeted gene integration is described. A tagging cassette harboring a reporter dsRed gene was randomly introduced into the cell genome after screening different transfection protocols. Single-copy integration clones were then co-transfected with both Flp-containing plasmid and an EGFP-containing targeting cassette. Successful cassette exchange was suggested by emergence of G418-resistant green colonies and confirmed by PCR analysis, showing the absence of the tagging cassette and single integration of the targeting cassette in the same locus. Upon cassette exchange, uniform EGFP expression between clones derived from the same integration site was obtained. Moreover, the resulting cell clones exhibited the expression properties of the parental cell line. EGFP production titers over 40 mg/L were of the same order of magnitude as those achieved through baculovirus infection. This Sf9 master cell line constitutes a versatile and re-usable platform to produce multiple recombinant proteins for fundamental and applied research.

  12. Differences in Integron Cassette Excision Dynamics Shape a Trade-Off between Evolvability and Genetic Capacitance

    PubMed Central

    Loot, Céline; Nivina, Aleksandra; Cury, Jean; Escudero, José Antonio; Ducos-Galand, Magaly; Bikard, David; Rocha, Eduardo P. C.


    ABSTRACT Integrons ensure a rapid and “on demand” response to environmental stresses driving bacterial adaptation. They are able to capture, store, and reorder functional gene cassettes due to site-specific recombination catalyzed by their integrase. Integrons can be either sedentary and chromosomally located or mobile when they are associated with transposons and plasmids. They are respectively called sedentary chromosomal integrons (SCIs) and mobile integrons (MIs). MIs are key players in the dissemination of antibiotic resistance genes. Here, we used in silico and in vivo approaches to study cassette excision dynamics in MIs and SCIs. We show that the orientation of cassette arrays relative to replication influences attC site folding and cassette excision by placing the recombinogenic strands of attC sites on either the leading or lagging strand template. We also demonstrate that stability of attC sites and their propensity to form recombinogenic structures also regulate cassette excision. We observe that cassette excision dynamics driven by these factors differ between MIs and SCIs. Cassettes with high excision rates are more commonly found on MIs, which favors their dissemination relative to SCIs. This is especially true for SCIs carried in the Vibrio genus, where maintenance of large cassette arrays and vertical transmission are crucial to serve as a reservoir of adaptive functions. These results expand the repertoire of known processes regulating integron recombination that were previously established and demonstrate that, in terms of cassette dynamics, a subtle trade-off between evolvability and genetic capacitance has been established in bacteria. PMID:28351923

  13. The use of carbon fibre material in radiographic cassettes: estimation of the dose and contrast advantages.


    Dance, D R; Lester, S A; Carlsson, G A; Sandborg, M; Persliden, J


    A Monte Carlo simulation has been used to estimate the dose and contrast advantages of replacing radiographic cassette fronts fabricated from aluminium with cassette fronts fabricated from low atomic number material (carbon fibre). The simulation used a realistic imaging geometry and calculations were made both with and without an anti-scatter grid. Account was taken of the scatter generated in the cassette front and the effect of beam hardening on primary contrast. Dose and contrast were evaluated for a range of cassette front thicknesses and tube potentials (60-150 kV) as well as for four examinations representative of situations with varying amounts of scatter. The results with an anti-scatter grid show a clear dose and contrast advantage in all cases when an aluminium cassette front is replaced with a low attenuation cassette front. The contrast advantage is dependent upon the examination and is generally greater for imaging bony structures than for imaging soft tissue. If a 1.74 mm aluminium cassette front is compared with a 1.1 mm carbon fibre cassette front, then the dose advantages are 16%, 9%, 8% and 6% and the contrast advantages are 10%, 7%, 4% and 5% for the AP paediatric pelvis examination at 60 kV, the anteroposterior (AP) lumbar spine examination at 80 kV, the lateral lumbar spine examination at 100 kV and the posteroanterior (PA) chest examination at 150 kV, respectively. The results without an anti-scatter grid show an increased dose advantage when a low attenuation cassette front is used, but the contrast advantage is small and in some situations negative.

  14. Improved antibiotic resistance gene cassette for marker exchange mutagenesis in Ralstonia solanacearum and Burkholderia species.


    Um, Hae Young; Chung, Eunsook; Lee, Jai-Heon; Lee, Seon-Woo


    Marker exchange mutagenesis is a fundamental approach to understanding gene function at a molecular level in bacteria. New plasmids carrying a kanamycin resistance gene or a trimethoprim resistance gene were constructed to provide antibiotic resistance cassettes for marker exchange mutagenesis in Ralstonia solanacearum and many antibiotic-resistant Burkholderia spp. Insertion sequences present in the flanking sequences of the antibiotic resistance cassette were removed to prevent aberrant gene replacement and polar mutation during mutagenesis in wild-type bacteria. Plasmids provided in this study would be convenient for use in gene cassettes for gene replacement in other Gram-negative bacteria.

  15. Radiation exposure reduction by use of Kevlar cassettes in the neonatal nursery

    SciTech Connect

    Herman, M.W.; Mak, H.K.; Lachman, R.S.


    A study was performed to determine whether the use of Kevlar cassettes in the neonatal intensive care nursery would reduce radiation exposure to patients. The radiation dose to the neonates was measured by using thermoluminescent dosimeters. In addition, the attenuation of the Kevlar cassettes and the sensitivity of the film-screen combination were compared with the previously used system. The greatest radiation reduction using a mobile X-ray unit was 27%; based on sensitivity measurements, the theoretical reduction averaged 38%. The reduction in radiation exposure resulted from reduced attenuation by the Kevlar cassette.

  16. Radiation exposure reduction by use of Kevlar cassettes in the neonatal nursery.


    Herman, M W; Mak, H K; Lachman, R S


    A study was performed to determine whether the use of Kevlar cassettes in the neonatal intensive care nursery would reduce radiation exposure to patients. The radiation dose to the neonates was measured by using thermoluminescent dosimeters. In addition, the attenuation of the Kevlar cassettes and the sensitivity of the film-screen combination were compared with the previously used system. The greatest radiation reduction using a mobile X-ray unit was 27%; based on sensitivity measurements, the theoretical reduction averaged 38%. The reduction in radiation exposure resulted from reduced attenuation by the Kevlar cassette.

  17. How To Choose Audio and Video Tape and Cassettes That Best Fit Your Needs

    ERIC Educational Resources Information Center

    Smith, Judson


    An audiovisual consultant presents a guide to selecting suitable and cost effective tape and cassettes. He describes and illustrates physical properties of tapes and includes a list of manufacturers and suppliers. (MF)

  18. Novel integrons and gene cassettes from a Cascadian submarine gas-hydrate-bearing core.


    Elsaied, Hosam; Stokes, Hatch W; Yoshioka, Hideyoshi; Mitani, Yasuo; Maruyama, Akihiko


    To determine whether integrons are present in a submarine gas hydrate community, metagenomic DNA was extracted from a gas-hydrate-bearing core, 150 m below the seafloor, from the Cascadian Margin. Integrons and gene cassettes were recovered by PCR from metagenomic DNA and sequenced. Thirty-seven integron integrase phylotypes were identified. The phylotypes were diverse and included members with homology to integrases from Methylomonas methanica, Desulfuromonas acetoxidans, Thermodesulfatator indicus, and marine uncultured bacteria. The gene cassette composition, 153 gene cassettes, was dominated by two types of encoded putative proteins. The first of these was predicted oxidoreductases, such as iron/sulfur cluster-binding proteins. A second type was alkyl transferases. Some cassette proteins showed homologies with those from methane-related archaea. These observations suggest that integrons may assist in the adaptation of microbial communities in this environment.

  19. Bridging the Gap: Integrating Video and Audio Cassettes into Literature Programs.

    ERIC Educational Resources Information Center

    Avery, Kay Beth; Avery, Charles W.; Pace, Debra Partin


    Describes 12 practical activities that use video and audio cassettes to build bridges to printed texts, and thus ease students into analyzing complex ideas and into complex examinations of themes, symbols, and literary technique. (SR)

  20. Dispersal and regulation of an adaptive mutagenesis cassette in the bacteria domain

    PubMed Central

    Erill, Ivan; Campoy, Susana; Mazon, Gerard; Barbé, Jordi


    Recently, a multiple gene cassette with mutagenic translation synthesis activity was identified and shown to be under LexA regulation in several proteobacteria species. In this work, we have traced down instances of this multiple gene cassette across the bacteria domain. Phylogenetic analyses show that this cassette has undergone several reorganizations since its inception in the actinobacteria, and that it has dispersed across the bacterial domain through a combination of vertical inheritance, lateral gene transfer and duplication. In addition, our analyses show that LexA regulation of this multiple gene cassette is persistent in all the phyla in which it has been detected, and suggest that this regulation is prompted by the combined activity of two of its constituent genes: a polymerase V homolog and an alpha subunit of the DNA polymerase III. PMID:16407325

  1. Integron Gene Cassettes: A Repository of Novel Protein Folds with Distinct Interaction Sites

    PubMed Central

    Sureshan, Visaahini; Deshpande, Chandrika N.; Boucher, Yan; Koenig, Jeremy E.; Stokes, H. W.; Harrop, Stephen J.; Curmi, Paul M. G.; Mabbutt, Bridget C.


    Mobile gene cassettes captured within integron arrays encompass a vast and diverse pool of genetic novelty. In most cases, functional annotation of gene cassettes directly recovered by cassette-PCR is obscured by their characteristically high sequence novelty. This inhibits identification of those specific functions or biological features that might constitute preferential factors for lateral gene transfer via the integron system. A structural genomics approach incorporating x-ray crystallography has been utilised on a selection of cassettes to investigate evolutionary relationships hidden at the sequence level. Gene cassettes were accessed from marine sediments (pristine and contaminated sites), as well as a range of Vibrio spp. We present six crystal structures, a remarkably high proportion of our survey of soluble proteins, which were found to possess novel folds. These entirely new structures are diverse, encompassing all-α, α+β and α/β fold classes, and many contain clear binding pocket features for small molecule substrates. The new structures emphasise the large repertoire of protein families encoded within the integron cassette metagenome and which remain to be characterised. Oligomeric association is a notable recurring property common to these new integron-derived proteins. In some cases, the protein–protein contact sites utilised in homomeric assembly could instead form suitable contact points for heterogeneous regulator/activator proteins or domains. Such functional features are ideal for a flexible molecular componentry needed to ensure responsive and adaptive bacterial functions. PMID:23349695

  2. Evolutionary origin of the staphylococcal cassette chromosome mec (SCCmec).


    Rolo, Joana; Worning, Peder; Nielsen, Jesper Boye; Bowden, Rory; Bouchami, Ons; Damborg, Peter; Guardabassi, Luca; Perreten, Vincent; Tomasz, Alexander; Westh, Henrik; de Lencastre, Hermínia; Miragaia, Maria


    Several lines of evidence indicate that the most primitive staphylococcal species, the Staphylococcus sciuri group, were involved in the first stages of evolution of SCCmec - the genetic element carrying the β-lactam resistance gene mecA. However, many steps are still missing from this evolutionary history. In particular, it is not known how mecA was incorporated into the mobile element SCC prior to dissemination among Staphylococcus aureus and other pathogenic staphylococcal species.To gain insights into the possible contribution of several species of the Staphylococcussciuri group to the assembly of SCCmec, we sequenced the genomes of 106 isolates, comprising S. sciuri (n=76), Staphylococcus vitulinus (n=18) and Staphylococcus fleurettii (n=12) from animal and human sources, and characterized the native location of mecA and the SCC insertion site using a variety of comparative genomic approaches. Moreover, we performed a SNP analysis of the genomes, in order to understand SCCmec evolution in relation to phylogeny.We found that each of three species of the S. sciuri group contributed to the evolution of SCCmec: S. vitulinus and S. fleurettii to the assembly of the mec complex, and S. sciuri most likely provided the mobile element in which mecA was later incorporated. We hypothesize that an ancestral SCCmec III cassette (an element carried by one of the most epidemic methicillin-resistant S. aureus clones), originated in S. sciuri possibly by a recombination event in a human host or a human-created environment and later was transferred to S. aureus.

  3. Ground Testing of the EMCS Seed Cassette for Biocompatibility with the Tardigrade, Hypsibius dujardini

    NASA Technical Reports Server (NTRS)

    Reinsch, Sigrid; Myers, Zachary Alan; DeSimone, Julia Carol; Freeman, John L.; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David


    The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. We performed ground testing to determine whether ARC EMCS seed cassettes could be adapted for use with tardigrades for future spaceflight experiments. Tardigrades (water bears) are small invertebrates that enter the tun state in response to desiccation or other environmental stresses. Tardigrade tuns have suspended metabolism and have been shown to be survive exposure to space vacuum, high pressure, temperature and other stresses. For spaceflight experiments using the EMCS, the organisms ideally must be able to survive desiccation and storage in the cassette at ambient temperature for several weeks prior to the initiation of the experiment by the infusion of water to the cassette during spaceflight. The ability of tardigrades to survive extremes by entering the tun state make them ideal candidates for growth experiments in the EMCS cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membrane contains dried growth medium. The goals of our study were to (1) determine whether tardigrades survive and reproduce on PES membranes, (2) develop a consistent method for dehydration of the tardigrades with high recovery rates upon rehydration, (3) to determine an appropriate food source for the tardigrades that can also be dehydrated/rehydrated and (4) successful mock rehydration experiment in cassettes with appropriate food source. We present results that show successful multigenerational growth of tardigrades on PES membranes with a variety of wet food sources. We have successfully performed a mock rehydration with tardigrades and at least one candidate food, protonema of the moss Polytrichum, that supports multigenerational growth and whose spores germinate quickly enough to match tardigrade feeding patterns post rehydration. Our results indicate that experiments on the ISS using the tardigrade, Hypsibius dujardini

  4. A prototype stable RNA identification cassette for monitoring plasmids of genetically engineered microorganisms

    NASA Technical Reports Server (NTRS)

    Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.


    A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.

  5. The application of cassette dosing for pharmacokinetic screening in small-molecule cancer drug discovery.


    Smith, Nicola F; Raynaud, Florence I; Workman, Paul


    Pharmacokinetic evaluation is an essential component of drug discovery and should be conducted early in the process so that those compounds with the best chance of success are prioritized and progressed. However, pharmacokinetic analysis has become a serious bottleneck during the 'hit-to-lead' and lead optimization phases due to the availability of new targets and the large numbers of compounds resulting from advances in synthesis and screening technologies. Cassette dosing, which involves the simultaneous administration of several compounds to a single animal followed by rapid sample analysis by liquid chromatography/tandem mass spectrometry, was developed to increase the throughput of in vivo pharmacokinetic screening. Although cassette dosing is advantageous in terms of resources and throughput, there are possible complications associated with this approach, such as the potential for compound interactions. Following an overview of the cassette dosing literature, this article focuses on the application of the technique in anticancer drug discovery. Specific examples are discussed, including the evaluation of cassette dosing to assess pharmacokinetic properties in the development of cyclin-dependent kinase and heat shock protein 90 inhibitors. Subject to critical analysis and validation in each case, the use of cassette dosing is recommended in appropriate chemical series to enhance the efficiency of drug discovery and reduce animal usage.

  6. The Evolution of the Bacterial Luciferase Gene Cassette (lux) as a Real-Time Bioreporter

    PubMed Central

    Close, Dan; Xu, Tingting; Smartt, Abby; Rogers, Alexandra; Crossley, Robert; Price, Sarah; Ripp, Steven; Sayler, Gary


    The bacterial luciferase gene cassette (lux) is unique among bioluminescent bioreporter systems due to its ability to synthesize and/or scavenge all of the substrate compounds required for its production of light. As a result, the lux system has the unique ability to autonomously produce a luminescent signal, either continuously or in response to the presence of a specific trigger, across a wide array of organismal hosts. While originally employed extensively as a bacterial bioreporter system for the detection of specific chemical signals in environmental samples, the use of lux as a bioreporter technology has continuously expanded over the last 30 years to include expression in eukaryotic cells such as Saccharomyces cerevisiae and even human cell lines as well. Under these conditions, the lux system has been developed for use as a biomedical detection tool for toxicity screening and visualization of tumors in small animal models. As the technologies for lux signal detection continue to improve, it is poised to become one of the first fully implantable detection systems for intra-organismal optical detection through direct marriage to an implantable photon-detecting digital chip. This review presents the basic biochemical background that allows the lux system to continuously autobioluminesce and highlights the important milestones in the use of lux-based bioreporters as they have evolved from chemical detection platforms in prokaryotic bacteria to rodent-based tumorigenesis study targets. In addition, the future of lux imaging using integrated circuit microluminometry to image directly within a living host in real-time will be introduced and its role in the development of dose/response therapeutic systems will be highlighted. PMID:22368493

  7. Comparative genome analysis: selection pressure on the Borrelia vls cassettes is essential for infectivity

    PubMed Central

    Glöckner, Gernot; Schulte-Spechtel, Ulrike; Schilhabel, Markus; Felder, Marius; Sühnel, Jürgen; Wilske, Bettina; Platzer, Matthias


    Background At least three species of Borrelia burgdorferi sensu lato (Bbsl) cause tick-borne Lyme disease. Previous work including the genome analysis of B. burgdorferi B31 and B. garinii PBi suggested a highly variable plasmid part. The frequent occurrence of duplicated sequence stretches, the observed plasmid redundancy, as well as the mainly unknown function and variability of plasmid encoded genes rendered the relationships between plasmids within and between species largely unresolvable. Results To gain further insight into Borreliae genome properties we completed the plasmid sequences of B. garinii PBi, added the genome of a further species, B. afzelii PKo, to our analysis, and compared for both species the genomes of pathogenic and apathogenic strains. The core of all Bbsl genomes consists of the chromosome and two plasmids collinear between all species. We also found additional groups of plasmids, which share large parts of their sequences. This makes it very likely that these plasmids are relatively stable and share common ancestors before the diversification of Borrelia species. The analysis of the differences between B. garinii PBi and B. afzelii PKo genomes of low and high passages revealed that the loss of infectivity is accompanied in both species by a loss of similar genetic material. Whereas B. garinii PBi suffered only from the break-off of a plasmid end, B. afzelii PKo lost more material, probably an entire plasmid. In both cases the vls gene locus encoding for variable surface proteins is affected. Conclusion The complete genome sequences of a B. garinii and a B. afzelii strain facilitate further comparative studies within the genus Borrellia. Our study shows that loss of infectivity can be traced back to only one single event in B. garinii PBi: the loss of the vls cassettes possibly due to error prone gene conversion. Similar albeit extended losses in B. afzelii PKo support the hypothesis that infectivity of Borrelia species depends heavily on

  8. Mass spectrometry imaging of cassette-dosed drugs for higher throughput pharmacokinetic and biodistribution analysis.


    Swales, John G; Tucker, James W; Strittmatter, Nicole; Nilsson, Anna; Cobice, Diego; Clench, Malcolm R; Mackay, C Logan; Andren, Per E; Takáts, Zoltán; Webborn, Peter J H; Goodwin, Richard J A


    Cassette dosing of compounds for preclinical drug plasma pharmacokinetic analysis has been shown to be a powerful strategy within the pharmaceutical industry for increasing throughput while decreasing the number of animals used. Presented here for the first time is data on the application of a cassette dosing strategy for label-free tissue distribution studies. The aim of the study was to image the spatial distribution of eight nonproprietary drugs (haloperidol, bufuralol, midazolam, clozapine, terfenadine, erlotinib, olanzapine, and moxifloxacin) in multiple tissues after oral and intravenous cassette dosing (four compounds per dose route). An array of mass spectrometry imaging technologies, including matrix-assisted laser desorption ionization mass spectrometry imaging (MALDI MSI), liquid extraction surface analysis tandem mass spectrometry (LESA-MS/MS), and desorption electrospray ionization mass spectrometry (DESI-MS) was used. Tissue analysis following intravenous and oral administration of discretely and cassette-dosed compounds demonstrated similar relative abundances across a range of tissues indicating that a cassette dosing approach was applicable. MALDI MSI was unsuccessful in detecting all of the target compounds; therefore, DESI MSI, a complementary mass spectrometry imaging technique, was used to detect additional target compounds. In addition, by adapting technology used for tissue profiling (LESA-MS/MS) low spatial resolution mass spectrometry imaging (∼1 mm) was possible for all targets across all tissues. This study exemplifies the power of multiplatform MSI analysis within a pharmaceutical research and development (R&D) environment. Furthermore, we have illustrated that the cassette dosing approach can be readily applied to provide combined, label-free pharmacokinetic and drug distribution data at an early stage of the drug discovery/development process while minimizing animal usage.

  9. Stable Recombinase-Mediated Cassette Exchange in Arabidopsis Using Agrobacterium tumefaciens1

    PubMed Central

    Louwerse, Jeanine D.; van Lier, Miranda C.M.; van der Steen, Dirk M.; de Vlaam, Clementine M.T.; Hooykaas, Paul J.J.; Vergunst, Annette C.


    Site-specific integration is an attractive method for the improvement of current transformation technologies aimed at the production of stable transgenic plants. Here, we present a Cre-based targeting strategy in Arabidopsis (Arabidopsis thaliana) using recombinase-mediated cassette exchange (RMCE) of transferred DNA (T-DNA) delivered by Agrobacterium tumefaciens. The rationale for effective RMCE is the precise exchange of a genomic and a replacement cassette both flanked by two heterospecific lox sites that are incompatible with each other to prevent unwanted cassette deletion. We designed a strategy in which the coding region of a loxP/lox5171-flanked bialaphos resistance (bar) gene is exchanged for a loxP/lox5171-flanked T-DNA replacement cassette containing the neomycin phosphotransferase (nptII) coding region via loxP/loxP and lox5171/lox5171 directed recombination. The bar gene is driven by the strong 35S promoter, which is located outside the target cassette. This placement ensures preferential selection of RMCE events and not random integration events by expression of nptII from this same promoter. Using root transformation, during which Cre was provided on a cotransformed T-DNA, 50 kanamycin-resistant calli were selected. Forty-four percent contained a correctly exchanged cassette based on PCR analysis, indicating the stringency of the selection system. This was confirmed for the offspring of five analyzed events by Southern-blot analysis. In four of the five analyzed RMCE events, there were no additional T-DNA insertions or they easily segregated, resulting in high-efficiency single-copy RMCE events. Our approach enables simple and efficient selection of targeting events using the advantages of Agrobacterium-mediated transformation. PMID:17921337

  10. Analysis of the effect of the bovine adenosine triphosphate-binding cassette transporter G2 single nucleotide polymorphism Y581S on transcellular transport of veterinary drugs using new cell culture models.


    Real, R; González-Lobato, L; Baro, M F; Valbuena, S; de la Fuente, A; Prieto, J G; Alvarez, A I; Marques, M M; Merino, G


    In commercial dairy production, the risk of drug residues and environmental pollutants in milk from ruminants has become an outstanding problem. One of the main determinants of active drug secretion into milk is the ATP-binding cassette transporter G2/breast cancer resistance protein (ABCG2/BCRP). It is located in several organs associated with drug absorption, metabolism, and excretion, and its expression is highly induced during lactation in the mammary gland of ruminants, mice, and humans. As a consequence, potential contamination of milk could expose suckling infants to xenotoxins. In cows, a SNP for this protein affecting quality and quantity of milk production has been described previously (Y581S). In this study, our main purpose was to determine whether this polymorphism has an effect on transcellular transport of veterinary drugs because this could alter substrate pharmacokinetics and milk residues. We stably expressed the wild-type bovine ABCG2 and the Y581S variant in Madin-Darby canine kidney epithelial cells (MDCKII) and MEF3.8 cell lines generating cell models in which the functionality of the bovine transporter could be addressed. Functional studies confirmed the greater functional activity in mitoxantrone accumulation assays for the Y581S variant with a greater relative V(MAX) value (P = 0.040) and showed for the first time that the Y581S variant presents greater transcellular transport of the model ABCG2 substrate nitrofurantoin (P = 0.024) and of 3 veterinary antibiotics, the fluoroquinolone agents enrofloxacin (P = 0.035), danofloxacin (P = 0.001), and difloxacin (P = 0.008), identified as new substrates of the bovine ABCG2. In addition, the inhibitory effect of the macrocyclic lactone ivermectin on the activity of wild-type bovine ABCG2 and the Y581S variant was also confirmed, showing a greater inhibitory potency on the wild-type protein at all the concentrations tested (5 μM, P = 0.017; 10 μM, P = 0.001; 25 μM, P = 0.008; and 50 μM, P = 0

  11. An integron cassette encoding erythromycin esterase, ere(A), from Providencia stuartii.


    Plante, Isabelle; Centrón, Daniela; Roy, Paul H


    We have mapped the variable region of the two class 1 integrons found in the multiresistant strain Providencia stuartii 1723. Integron 1 contains a new arrangement of gene cassettes, aacA4-aadB-aadA1, conferring resistance to all aminoglycosides used for clinical treatment. Integron 2 contains a variant of the gene cassette ere(A), coding for an erythromycin esterase, whose nucleotide sequence shares 93.7% DNA identity with ere(A) from Escherichia coli BM2195 plasmid pIP1100.

  12. Construction of New Campylobacter Cloning Vectors and a New Mutational Cat Cassette

    DTIC Science & Technology


    mutational cat cassette PE - 61102A PR - 3M161102 6. AUTHOR(S) TA - BS13AK Yao R, Aim RA, Trust TJ, Guerry P WU- 1291 7. PERFORMING ORGANIZATION NAME(S) AND...mutational cat cassette %~ccesion For (Site-specific mutagenesis; recombinant DNA; multiple cloning site; PCR; shuttle vectors) NTIS CRA&I OTIC TAB E...incompatibility plasmids can mobilize shuttle vectors containing E. coi and C. coi plasmid Systems of experimental genetics are in the early stages replicons

  13. Class 1 Integron Containing a New Gene Cassette, aadA10, Associated with Tn1404 from R151

    PubMed Central

    Partridge, Sally R.; Collis, Christina M.; Hall, Ruth M.


    The carbenicillin, gentamicin, kanamycin, streptomycin, spectinomycin, sulfonamide, and tobramycin resistance determinants found on Pseudomonas aeruginosa plasmid R151 have previously been shown to translocate to another plasmid, R388, and it was inferred that a transposon, Tn1404, carried the resistance determinants. Sequencing of the cassette array from the plasmid known as R388::Tn1404 revealed two known gene cassettes, oxa10 and aadB, and a previously unidentified cassette determining resistance to streptomycin and spectinomycin, here designated aadA10, in the order oxa10-aadB-aadA10. These cassettes replaced the dfrB2-orfA cassette array of R388, indicating that movement of the resistance determinants from R151 to R388 resulted from recombinational exchange between two class 1 integrons rather than transposition. The AadA10 protein is most closely related to AadA6 (85% identical) and AadA7 (80% identical). The aadA10 cassette found here has only a simple site containing a 7-bp spacer derived from attI1 in place of a 59-base element and is likely to represent a derivative of the complete cassette. IntI1-mediated deletion of the aadA10 cassette was not detected, indicating that this single simple site is either inactive or only weakly active. PMID:12121911

  14. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  15. A test cassette for x-ray-exposure experiments at the National Ignition Facility

    SciTech Connect

    Fournier, K. B.; Celeste, J.; Rekow, V.; Bopp, D. R.; May, M. J.; Fisher, J. H.; Horton, R.; Newlander, C. D.; Jenkins, P.; Trautz, K.


    We present the design and operation of a test cassette for exposure of samples to radiation environments at the National Ignition Facility. The cassette provides options for square and round samples and exposure areas; the cassette provides for multiple levels of filtration on a single sample, which allows dynamic range in experiments. The samples had normal lines of sight to the x-ray source in order to have uniform x-ray illumination. The incident x-radiation onto the samples was determined by the choice of filter thicknesses and materials. The samples were held at precise locations, accurate to within a few hundred microns, in the target chamber in order to have a known fluence incident. In the cassette, the samples were held in place in such a way that a minimal “line contact” allows them to have the maximal mechanical response to the x-ray load. We present postshot images of the debris found on films used for filters, and pre- and postexposure specimens.

  16. STS-37 crewmembers watch Pilot Cameron juggle cassettes on OV-104's middeck

    NASA Technical Reports Server (NTRS)


    STS-37 crewmembers watch Pilot Kenneth D. Cameron juggle cassette tapes on the middeck of Atlantis, Orbiter Vehicle (OV) 104. Laughing at Cameron's stunt are Mission Specialist (MS) Linda M. Godwin (foreground), Commander Steven R. Nagel (behind Cameron), and MS Jerry L. Ross (at floor level). Ross snacks on chocolate candy during the performance.

  17. Cytosine deaminase MX cassettes as positive/negative selectable markers in Saccharomyces cerevisiae.


    Hartzog, Phillip E; Nicholson, Bradly P; McCusker, John H


    We describe positive/negative selectable cytosine deaminase MX cassettes for use in Saccharomyces cerevisiae. The basis of positive selection for cytosine deaminase (Fcy1) activity is that (a) fcy1 strains are unable to grow on medium containing cytosine as a sole nitrogen source and (b) fcy1 ura3 strains are unable to grow on medium containing cytosine as the sole pyrimidine source. Conversely, as 5-fluorocytosine (5FC) is toxic to cytosine deaminase-producing cells, fcy1 strains are resistant to 5FC. FCY1MX and FCA1MX cassettes, containing open reading frames (ORFs) of S. cerevisiae FCY1 and Candida albicans FCA1, respectively, were constructed and used to disrupt targeted genes in S. cerevisiae fcy1 strains. In addition, new direct repeat cassettes, kanPR, FCA1PR, FCY1PR and CaURA3PR, were developed to allow efficient deletion of target genes in cells containing MX3 repeats. Finally, the FCY1- and FCA1MX3 or PR direct repeat cassettes can be readily recycled after 5FC counter-selection on both synthetic and rich media.

  18. A timer-actuated immunoassay cassette for detecting molecular markers in oral fluids.


    Liu, Changchun; Qiu, Xianbo; Ongagna, Serge; Chen, Dafeng; Chen, Zongyuan; Abrams, William R; Malamud, Daniel; Corstjens, Paul L A M; Bau, Haim H


    An inexpensive, hand-held, point-of-care, disposable, self-contained immunoassay cassette comprised of air pouches for pumping, a metering chamber, reagents storage chambers, a mixer, and a lateral flow strip was designed, constructed, and tested. The assay was carried out in a consecutive flow format. The detection was facilitated with up-converting phosphor (UCP) reporter particles. The automated, timely pumping of the various reagents was driven by a spring-loaded timer. The utility of the cassette was demonstrated by detecting antibodies to HIV in saliva samples and further evaluated with a non-contagious, haptenized DNA assay. The cassette has several advantages over dip sticks such as sample preprocessing, integrated storage of reagents, and automated operation that reduces operator errors and training. The cassette and actuator described herein can readily be extended to detect biomarkers of other diseases in body fluids and other fluids at the point of care. The system is particularly suitable for resource-poor countries, where funds and trained personnel are in short supply.

  19. 21 CFR 892.1880 - Wall-mounted radiographic cassette holder.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Wall-mounted radiographic cassette holder. 892.1880 Section 892.1880 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1880...

  20. 21 CFR 892.1880 - Wall-mounted radiographic cassette holder.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Wall-mounted radiographic cassette holder. 892.1880 Section 892.1880 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1880...

  1. 21 CFR 892.1880 - Wall-mounted radiographic cassette holder.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Wall-mounted radiographic cassette holder. 892.1880 Section 892.1880 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1880...

  2. 21 CFR 892.1880 - Wall-mounted radiographic cassette holder.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Wall-mounted radiographic cassette holder. 892.1880 Section 892.1880 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1880...

  3. 21 CFR 892.1880 - Wall-mounted radiographic cassette holder.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Wall-mounted radiographic cassette holder. 892.1880 Section 892.1880 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1880...

  4. Construction of heterologous gene expression cassettes for the development of recombinant Clostridium beijerinckii.


    Oh, Young Hoon; Eom, Gyeong Tae; Kang, Kyoung Hee; Joo, Jeong Chan; Jang, Young-Ah; Choi, Jae Woo; Song, Bong Keun; Lee, Seung Hwan; Park, Si Jae


    Gene-expression cassettes for the construction of recombinant Clostridium beijerinckii were developed as potential tools for metabolic engineering of C. beijerinckii. Gene expression cassettes containing ColE1 origin and pAMB origin along with the erythromycin resistance gene were constructed, in which promoters from Escherichia coli, Lactococcus lactis, Ralstonia eutropha, C. acetobutylicum, and C. beijerinckii are examined as potential promoters in C. beijerinckii. Zymogram analysis of the cell extracts and comparison of lipase activities of the recombinant C. beijerinckii strains expressing Pseudomonas fluorescens tliA gene suggested that the tliA gene was functionally expressed by all the examined promoters with different expression level. Also, recombinant C. beijerinckii expressing C. beijerinckii secondary alcohol dehydrogenase by the constructed expression cassettes successfully produced 2-propanol from glucose. The best promoter for TliA expression was the R. eutropha phaP promoter while that for 2-propanol production was the putative C. beijerinckii pta promoter. Gene expression cassettes developed in this study may be useful tools for the construction of recombinant C. beijerinckii strains as host strains for the valuable chemicals and fuels from renewable resources.

  5. Storing self-contained gel capillary cassettes for POC medical diagnostics.


    Manage, Dammika P; Lauzon, Jana; Zahariadis, George; Pilarski, Linda M


    For effective clinical uptake of the lab on a chip/point of care technology (LOC-POC), in addition to cost advantages LOC-POC devices should offer multiple patient screening panels for related diseases as well as cold-chain transportation and storage abilities. We recently described a device that performs polymerase chain reaction (PCR) to simultaneously screen raw clinical samples from up to 16 patients for multiple infectious agents (Manage et al., Lab Chip, 2013, 13, 2576-2584). This cassette contains glass capillaries with desiccated semi-solid acrylamide gels that include all the reagents except for the sample, with integrated quality control. Here we report the development of protocols to store assembled PCR cassettes at room temperature, 4 °C or -20 °C as well as at +40 °C. We show that our cassettes are stable, with no loss of activity for at least 3 months at RT and at least 7 months at 4 °C and -20 °C. However, the activity of desiccated cassettes degrades when stored for more than 2 weeks at 40 °C, insufficient time for post-manufacture delivery and use of cassette PCR. To address this, we have evaluated two stage storage protocols. PCR cassettes can initially be stored at 4 °C and -20 °C for prolonged periods of time and removed for shorter term storage at RT, retaining activity for at least a month, which would facilitate transport to remote areas for testing. Effective use of cassette PCR in high temperature regions of the world, for experimental purposes defined here as 40 °C, appears to be feasible only after a first stage storage in the cold, followed by no more than 1 week at 40 °C. This should allow sufficient time for delivery by the manufacturer to a central area well served by power and refrigeration, for later ambient temperature transport and use in under-resourced areas that lack refrigeration.

  6. Utilizing ARC EMCS Seedling Cassettes as Highly Versatile Miniature Growth Chambers for Model Organism Experiments

    NASA Technical Reports Server (NTRS)

    Freeman, John L.; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David; Reinsch, S.; DeSimone, Julia C.; Myers, Zachary A.


    The aim of our ground testing was to demonstrate the capability of safely putting specific model organisms into dehydrated stasis, and to later rehydrate and successfully grow them inside flight proven ARC EMCS seedling cassettes. The ARC EMCS seedling cassettes were originally developed to support seedling growth during space flight. The seeds are attached to a solid substrate, launched dry, and then rehydrated in a small volume of media on orbit to initiate the experiment. We hypothesized that the same seedling cassettes should be capable of acting as culture chambers for a wide range of organisms with minimal or no modification. The ability to safely preserve live organisms in a dehydrated state allows for on orbit experiments to be conducted at the best time for crew operations and more importantly provides a tightly controlled physiologically relevant growth experiment with specific environmental parameters. Thus, we performed a series of ground tests that involved growing the organisms, preparing them for dehydration on gridded Polyether Sulfone (PES) membranes, dry storage at ambient temperatures for varying periods of time, followed by rehydration. Inside the culture cassettes, the PES membranes were mounted above blotters containing dehydrated growth media. These were mounted on stainless steel bases and sealed with plastic covers that have permeable membrane covered ports for gas exchange. The results showed we were able to demonstrate acceptable normal growth of C.elegans (nematodes), E.coli (bacteria), S.cerevisiae (yeast), Polytrichum (moss) spores and protonemata, C.thalictroides (fern), D.discoideum (amoeba), and H.dujardini (tardigrades). All organisms showed acceptable growth and rehydration in both petri dishes and culture cassettes initially, and after various time lengths of dehydration. At the end of on orbit ISS European Modular Cultivation System experiments the cassettes could be frozen at ultra-low temperatures, refrigerated, or chemically

  7. Ground Testing of the EMCS Seed Cassette for Biocompatibility with the Cellular Slime Mold, Dictyostelium Discoideum

    NASA Technical Reports Server (NTRS)

    Hanely, Julia C.; Reinsch, Sigrid; Myers, Zachary A.; Freeman, John; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David G.


    The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. To expand the use of flight verified hardware for various model organisms, we performed ground experiments to determine whether ARC EMCS Seed Cassettes could be adapted for use with cellular slime mold for future space flight experiments. Dictyostelium is a cellular slime mold that can exist both as a single-celled independent organism and as a part of a multicellular colony which functions as a unit (pseudoplasmodium). Under certain stress conditions, individual amoebae will aggregate to form multicellular structures. Developmental pathways are very similar to those found in Eukaryotic organisms, making this a uniquely interesting organism for use in genetic studies. Dictyostelium has been used as a genetic model organism for prior space flight experiments. Due to the formation of spores that are resistant to unfavorable conditions such as desiccation, Dictyostelium is also a good candidate for use in the EMCS Seed Cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membranes contains dried growth medium. The goals of this study were to (1) verify that Dictyostelium are capable of normal growth and development on PES membranes, (2) develop a method for dehydration of Dictyostelium spores with successful recovery and development after rehydration, and (3) successful mock rehydration experiments in cassettes. Our results show normal developmental progression in two strains of Dictyostelium discoideum on PES membranes with a bacterial food source. We have successfully performed a mock rehydration of spores with developmental progression from aggregation to slug formation, and production of morphologically normal spores within 9 days of rehydration. Our results indicate that experiments on the ISS using the slime mold, Dictyostelium discoideum could potentially be performed in the flight verified hardware of

  8. An integrated, self-contained microfluidic cassette for isolation, amplification, and detection of nucleic acids.


    Chen, Dafeng; Mauk, Michael; Qiu, Xianbo; Liu, Changchun; Kim, Jitae; Ramprasad, Sudhir; Ongagna, Serge; Abrams, William R; Malamud, Daniel; Corstjens, Paul L A M; Bau, Haim H


    A self-contained, integrated, disposable, sample-to-answer, polycarbonate microfluidic cassette for nucleic acid-based detection of pathogens at the point of care was designed, constructed, and tested. The cassette comprises on-chip sample lysis, nucleic acid isolation, enzymatic amplification (polymerase chain reaction and, when needed, reverse transcription), amplicon labeling, and detection. On-chip pouches and valves facilitate fluid flow control. All the liquids and dry reagents needed for the various reactions are pre-stored in the cassette. The liquid reagents are stored in flexible pouches formed on the chip surface. Dry (RT-)PCR reagents are pre-stored in the thermal cycling, reaction chamber. The process operations include sample introduction; lysis of cells and viruses; solid-phase extraction, concentration, and purification of nucleic acids from the lysate; elution of the nucleic acids into a thermal cycling chamber and mixing with pre-stored (RT-)PCR dry reagents; thermal cycling; and detection. The PCR amplicons are labeled with digoxigenin and biotin and transmitted onto a lateral flow strip, where the target analytes bind to a test line consisting of immobilized avidin-D. The immobilized nucleic acids are labeled with up-converting phosphor (UCP) reporter particles. The operation of the cassette is automatically controlled by an analyzer that provides pouch and valve actuation with electrical motors and heating for the thermal cycling. The functionality of the device is demonstrated by detecting the presence of bacterial B.Cereus, viral armored RNA HIV, and HIV I virus in saliva samples. The cassette and actuator described here can be used to detect other diseases as well as the presence of bacterial and viral pathogens in the water supply and other fluids.

  9. An integrated, self-contained microfluidic cassette for isolation, amplification, and detection of nucleic acids

    PubMed Central

    Chen, Dafeng; Mauk, Michael; Qiu, Xianbo; Liu, Changchun; Kim, Jitae; Ramprasad, Sudhir; Ongagna, Serge; Abrams, William R.; Malamud, Daniel; Corstjens, Paul L. A. M.


    A self-contained, integrated, disposable, sample-to-answer, polycarbonate microfluidic cassette for nucleic acid—based detection of pathogens at the point of care was designed, constructed, and tested. The cassette comprises on-chip sample lysis, nucleic acid isolation, enzymatic amplification (polymerase chain reaction and, when needed, reverse transcription), amplicon labeling, and detection. On-chip pouches and valves facilitate fluid flow control. All the liquids and dry reagents needed for the various reactions are pre-stored in the cassette. The liquid reagents are stored in flexible pouches formed on the chip surface. Dry (RT-)PCR reagents are pre-stored in the thermal cycling, reaction chamber. The process operations include sample introduction; lysis of cells and viruses; solid-phase extraction, concentration, and purification of nucleic acids from the lysate; elution of the nucleic acids into a thermal cycling chamber and mixing with pre-stored (RT-)PCR dry reagents; thermal cycling; and detection. The PCR amplicons are labeled with digoxigenin and biotin and transmitted onto a lateral flow strip, where the target analytes bind to a test line consisting of immobilized avidin-D. The immobilized nucleic acids are labeled with up-converting phosphor (UCP) reporter particles. The operation of the cassette is automatically controlled by an analyzer that provides pouch and valve actuation with electrical motors and heating for the thermal cycling. The functionality of the device is demonstrated by detecting the presence of bacterial B.Cereus, viral armored RNA HIV, and HIV I virus in saliva samples. The cassette and actuator described here can be used to detect other diseases as well as the presence of bacterial and viral pathogens in the water supply and other fluids. PMID:20401537

  10. Concordant activity of transgene expression cassettes inserted into E1, E3 and E4 cloning sites in the adenovirus genome

    PubMed Central

    Pham, Linh; Nakamura, Takafumi; Rosales, A. Gabriela; Carlson, Stephanie K.; Bailey, Kent R.; Peng, Kah-Whye; Russell, Stephen J.


    Background Expression cassettes can be inserted at several positions into recombinant adenoviral genomes but the implications of this choice for transgene expression level have not been determined. Knowledge of the relative expression levels of transgenes inserted at different sites in the adenoviral genome is of particular significance for transgene expression monitoring approaches that rely on the concordant expression of a marker transgene inserted elsewhere in the viral genome. Methods Three expression cassettes, each comprising a cytomegalovirus promoter driving one of three marker peptides [serum carcinoembryonic antigen (sCEA), beta subunit of human chorionic gonadotropin (βhCG) or human sodium iodide symporter (hNIS)], were inserted into E1, E3 or E4 cloning sites in a recombinant adenoviral vector backbone. High titer stocks of bicistronic adenoviral vectors coding for combinations of marker peptides were prepared. A panel of human cells of various lineages was infected with the vectors and expression ratios of the transgene-encoded proteins were analysed. Serum levels of the soluble proteins and hepatic uptake of radioactive iodine were also compared in vivo in nude rats after intravenous vector infusion. Results High concordance of expression between the inserted transgenes was observed in all of the bicistronic vectors irrespective of whether the expression cassettes were placed in the E1, E3 or E4 regions. Concordance was maintained across multiple cell lineages. In vivo, in athymic rats, blood and urine levels of βhCG were highly concordant with serum levels of sCEA at all timepoints after intravenous infusion of the bicistronic vectors encoding both of these soluble markers. Hepatic radioiodine uptake was concordant with serum CEA concentration in mice infused with a bicistronic vector expressing CEA and NIS. Conclusions The expression level of a given transgene in an adenoviral vector genome can be accurately and quantitatively inferred from the

  11. Background ionising radiation: a pictorial perspective.


    Bibbo, Giovanni; Piotto, Lino


    Ionising radiation from natural sources, known as background radiation, has existed on earth since the earth's formation. The exposure of humans and other living creatures to this radiation is a feature of the earth's environment which is continuing and inescapable. The word "radiation" brings fear to many people: a fear of the unknown, as human's senses cannot detect the presence of ionising radiation. In this study, a catalogue of images of the distribution of radioactivity in every day objects and foods has been produced using an imaging plate from a computed radiography cassette. The aim of the study is that by visually demonstrating that every day objects and foods are radioactive would alleviate the fear of "radiation" by becoming aware that we live in a radioactive environment and even our body is radioactive.

  12. Nanoparticle-delivered VEGF-silencing cassette and suicide gene expression cassettes inhibit colon carcinoma growth in vitro and in vivo.


    Leng, Aimin; Yang, Jing; Liu, Ting; Cui, Jianfang; Li, Xiu-Hua; Zhu, Yanan; Xiong, Ting; Chen, Yuxiang


    The strategies for tumor-specific expression of suicide genes and target tumor angiogenesis have been tested in tumors. However, the anti-tumor efficacy of the combination of these two strategies, particularly, delivering suicide gene and anti-angiogenesis agent by nanoparticles, has not yet been evaluated in colon carcinoma. We constructed a cassette to silence VEGF-A expression and express a fused yCDglyTK gene driven by tumor-specific promoter (shVEGF-CDTK). The DNA carrying shVEGF-CDTK was delivered into colon carcinoma cells by calcium phosphate nanoparticles (CPNPs). Cell proliferation was measured by MTT assay, and apoptosis was detected by flow cytometry. The anti-tumor effect of the combined cassette was tested in xenograft animal model. With 5-fluorocytosine (5-FC), CPNP-delivered shVEGF-CDTK DNA (CPNP-shVEGF-CDTK) showed high expression of fused yCDglyTK gene and effectively silenced VEGF-A expression in vitro and in vivo, which significantly inhibited colon carcinoma cell proliferation and induced apoptosis in vitro. With 5-FC, the systemic delivery of CPNP-shVEGF-CDTK significantly inhibited tumor growth in the colon carcinoma xenograft animal model. The combined cassette is obviously effective in inhibiting tumor cell proliferation and inducing apoptosis in vitro and tumor growth in vivo than the CPNP-shVEGF or CPNP-CDTK alone. The combination of VEGF-A-silencing and tumor-specific expression of suicide gene is an effective strategy for colon carcinoma treatment.

  13. A high capacity data recording device based on a digital audio processor and a video cassette recorder.

    PubMed Central

    Bezanilla, F


    A modified digital audio processor, a video cassette recorder, and some simple added circuitry are assembled into a recording device of high capacity. The unit converts two analog channels into digital form at 44-kHz sampling rate and stores the information in digital form in a common video cassette. Bandwidth of each channel is from direct current to approximately 20 kHz and the dynamic range is close to 90 dB. The total storage capacity in a 3-h video cassette is 2 Gbytes. The information can be retrieved in analog or digital form. PMID:3978213

  14. Light without substrate amendment: the bacterial luciferase gene cassette as a mammalian bioreporter

    NASA Astrophysics Data System (ADS)

    Close, Dan M.; Xu, Tingting; Smartt, Abby E.; Jegier, Pat; Ripp, Steven A.; Sayler, Gary S.


    Bioluminescent production represents a facile method for bioreporter detection in mammalian tissues. The lack of endogenous bioluminescent reactions in these tissues allows for high signal to noise ratios even at low signal strength compared to fluorescent signal detection. While the luciferase enzymes commonly employed for bioluminescent detection are those from class Insecta (firefly and click beetle luciferases), these are handicapped in that they require concurrent administration of a luciferin compound to elicit a bioluminescent signal. The bacterial luciferase (lux) gene cassette offers the advantages common to other bioluminescent proteins, but is simultaneously capable of synthesizing its own luciferin substrates using endogenously available cellular compounds. The longstanding shortcoming of the lux cassette has been its recalcitrance to function in the mammalian cellular environment. This paper will present an overview of the work completed to date to overcome this limitation and provide examples of mammalian lux-based bioreporter technologies that could provide the framework for advanced, biomedically relevant real-time sensor development.

  15. A BODIPY-luminol chemiluminescent resonance energy-transfer (CRET) cassette for imaging of cellular superoxide.


    Bag, S; Tseng, J-C; Rochford, J


    Spectroscopic and in cellulo studies are here reported on the very first BODIPY-luminol chemiluminescent resonance energy-transfer (CRET) cassette where the luminol CL agent is covalently linked to the BODIPY energy-transfer acceptor in a molecular dyad. The efficiency of intramolecular CRET investigated for the BODIPY-luminol dyad was found to be 64% resulting in a dual emissive response. Successful in cellulo biochemiluminescence via CRET was achieved in PMA activated splenocytes.

  16. Methicillin-resistant Staphylococcus saprophyticus in Sweden carries various types of staphylococcal cassette chromosome mec (SCCmec).


    Söderquist, B; Berglund, C


    Staphylococcus saprophyticus is a common cause of uncomplicated urinary tract infections and is usually susceptible to the antimicrobial agents used for their treatment. However, S. saprophyticus resistant to beta-lactam antibiotics and carrying mecA has been reported. Eight Swedish isolates of mecA-positive S. saprophyticus with diverse origin carrying at least three different types of staphylococcal cassette chromosome mec (SCCmec) are described here.

  17. New enzymes from environmental cassette arrays: Functional attributes of a phosphotransferase and an RNA-methyltransferase

    PubMed Central

    Nield, Blair S.; Willows, Robert D.; Torda, Andrew E.; Gillings, Michael R.; Holmes, Andrew J.; Nevalainen, K.M. Helena; Stokes, H.W.; Mabbutt, Bridget C.


    By targeting gene cassettes by polymerase chain reaction (PCR) directly from environmentally derived DNA, we are able to amplify entire open reading frames (ORFs) independently of prior sequence knowledge. Approximately 10% of the mobile genes recovered by these means can be attributed to known protein families. Here we describe the characterization of two ORFs which show moderate homology to known proteins: (1) an aminoglycoside phosphotransferase displaying 25% sequence identity with APH(7″) from Streptomyces hygroscopicus, and (2) an RNA methyltransferase sharing 25%–28% identity with a group of recently defined bacterial RNA methyltransferases distinct from the SpoU enzyme family. Our novel genes were expressed as recombinant products and assayed for appropriate enzyme activity. The aminoglycoside phosphotransferase displayed ATPase activity, consistent with the presence of characteristic Mg2+-binding residues. Unlike related APH(4) or APH(7″) enzymes, however, this activity was not enhanced by hygromycin B or kanamycin, suggesting the normal substrate to be a different aminoglycoside. The RNA methyltransferase contains sequence motifs of the RNA methyltransferase superfamily, and our recombinant version showed methyltransferase activity with RNA. Our data confirm that gene cassettes present in the environment encode folded enzymes with novel sequence variation and demonstrable catalytic activity. Our PCR approach (cassette PCR) may be used to identify a diverse range of ORFs from any environmental sample, as well as to directly access the gene pool found in mobile gene cassettes commonly associated with integrons. This gene pool can be accessed from both cultured and uncultured microbial samples as a source of new enzymes and proteins. PMID:15152095

  18. Development of a low resource RNA extraction cassette based on surface tension valves

    PubMed Central

    Bordelon, Hali; Adams, Nicholas M.; Klemm, Amy S.; Russ, Patricia K.; Williams, John V.; Talbot, H. Keipp; Wright, David W.; Haselton, Frederick R.


    Nucleic acid-based diagnostics are highly sensitive and specific, but are easily disrupted by the presence of interferents in biological samples. In a laboratory or hospital setting, the influence of these interferents can be minimized using an RNA or DNA extraction procedure prior to analysis. However, in low resource settings, limited access to specialized instrumentation and trained personnel presents challenges that impede sample preparation. We have developed a self-contained nucleic acid extraction cassette suitable for operation in a low resource setting. This simple design contains processing solutions preloaded within a continuous length of 1.6 mm inner diameter Tygon tubing. Processing solutions are separated by air gaps and held in place during processing by the surface tension forces at the liquid-air interface, viz. surface tension valves. Nucleic acids preferentially adsorbed to silica-coated magnetic particles are separated from sample interferents by using an external magnet to transfer the nucleic acid biomarker through successive solutions to precipitate, wash and elute in the final cassette solution. The efficiency of the extraction cassette was evaluated using quantitative reverse transcriptase PCR (qRT-PCR) following extraction of respiratory syncytial virus (RSV) RNA. RNA was recovered from TE buffer or from lysates of RSV infected HEp-2 cells with 55 and 33% efficiency, respectively, of the Qiagen RNeasy kit. Recovery of RSV RNA from RSV infected HEp-2 cells was similar at 30% of the RNeasy kit. An overall limit of detection after extraction was determined to be nearly identical (97.5%) to a laboratory-based commercially available kit. These results indicate that this extraction cassette design has the potential to be an effective sample preparation device suitable for use in a low resource setting. PMID:21604768

  19. Strong stimulation of recombinant protein production in Escherichia coli by combining stimulatory control elements in an expression cassette

    PubMed Central


    Background The XylS/Pm expression system has been used to produce recombinant proteins at industrial levels in Escherichia coli. Activation of transcription from the Pm promoter takes place in the presence of benzoic acid or derivatives of it. Previous mutagenesis studies resulted in identification of several variants of the expression control elements xylS (X), Pm (P) and the 5'-untranslated region (U) that individually gave rise to strongly stimulated expression. The goal of this study was to test if combination of such stimulatory mutations in the same expression vectors would lead to further increase of expression levels. Results We combined X, P and U variants that were originally identified due to their ability to strongly stimulate expression of the reporter gene bla (resistance to penicillin). Combination of optimized elements stimulated bla expression up to 75-fold (X, P and U combined) relative to the wild-type system, while accumulated transcript levels increased about 50-fold. This is much more than for the elements individually. We also tested combination of the variant elements on two other and unrelated genes, celB (encoding phosphoglucomutase) and the human growth factor gene gm-csf. Protein production from these genes is much more efficient than from bla in the wild-type system, but expression was still significantly stimulated by the combination of X, P and U variants, although not to the same extent as for bla. We also integrated a single copy of the expression cassette with each gene into the E. coli chromosome and found that the expression level from this single copy was higher for bla than for the wild-type plasmid system, while it was lower for celB and gm-csf. Conclusion Our results show that combination of stimulatory expression control elements can be used to further increase production of different proteins in E. coli. For one reporter gene (bla) this allowed for more protein production from a single gene copy integrated on the chromosome

  20. Optimized invertase expression and secretion cassette for improving Yarrowia lipolytica growth on sucrose for industrial applications.


    Lazar, Zbigniew; Rossignol, Tristan; Verbeke, Jonathan; Crutz-Le Coq, Anne-Marie; Nicaud, Jean-Marc; Robak, Małgorzata


    Yarrowia lipolytica requires the expression of a heterologous invertase to grow on a sucrose-based substrate. This work reports the construction of an optimized invertase expression cassette composed of Saccharomyces cerevisiae Suc2p secretion signal sequence followed by the SUC2 sequence and under the control of the strong Y. lipolytica pTEF promoter. This new construction allows a fast and optimal cleavage of sucrose into glucose and fructose and allows cells to reach the maximum growth rate. Contrary to pre-existing constructions, the expression of SUC2 is not sensitive to medium composition in this context. The strain JMY2593, expressing this new cassette with an optimized secretion signal sequence and a strong promoter, produces 4,519 U/l of extracellular invertase in bioreactor experiments compared to 597 U/l in a strain expressing the former invertase construction. The expression of this cassette strongly improved production of invertase and is suitable for simultaneously high production level of citric acid from sucrose-based media.

  1. Conceptual Design Studies of the KSTAR Bay-Nm Cassette and Thomson Scattering Optics

    SciTech Connect

    Feder, R.; Ellis, R.; Johnson, D.; Park, H.; Lee, H. G.


    A Multi-Channel Thomson Scattering System viewing the edge and core of the KSTAR plasma will be installed at the mid-plane port Bay-N. An engineering design study was undertaken at PPPL in collaboration with the Korea Basic Science Institute (KBSI) to determine the optimal optics and cassette design. Design criteria included environmental, mechanical and optical factors. All of the optical design options have common design features; the Thomson Scattering laser, an in-vacuum shutter, a quartz heat shield and primary vacuum window, a set of optical elements and a fiber optic bundle. Neutron radiation damage was a major factor in the choice of competing lens-based and mirror-based optical designs. Both the mirror based design and the lens design are constrained by physical limits of the Bay-N cassette and interference with the Bay-N micro-wave launcher. The cassette will contain the optics and a rail system for maintenance of the optics.

  2. Modulation of Gene Expression by Polymer Nanocapsule Delivery of DNA Cassettes Encoding Small RNAs.


    Yan, Ming; Wen, Jing; Liang, Min; Lu, Yunfeng; Kamata, Masakazu; Chen, Irvin S Y


    Small RNAs, including siRNAs, gRNAs and miRNAs, modulate gene expression and serve as potential therapies for human diseases. Delivery to target cells remains the fundamental limitation for use of these RNAs in humans. To address this challenge, we have developed a nanocapsule delivery technology that encapsulates small DNA molecules encoding RNAs into a small (30 nm) polymer nanocapsule. For proof of concept, we transduced DNA expression cassettes for three small RNAs. In one application, the DNA cassette encodes an shRNA transcriptional unit that downregulates CCR5 and protects from HIV-1 infection. The DNA cassette nanocapsules were further engineered for timed release of the DNA cargo for prolonged knockdown of CCR5. Secondly, the nanocapsules provide an efficient means for delivery of gRNAs in the CRISPR/Cas9 system to mutate integrated HIV-1. Finally, delivery of microRNA-125b to mobilized human CD34+ cells enhances survival and expansion of the CD34+ cells in culture.

  3. Transient expression of minimum linear gene cassettes in onion epidermal cells via direct transformation.


    Cheng, Yun-Qing; Yang, Jun; Xu, Feng-Ping; An, Li-Jia; Liu, Jian-Feng; Chen, Zhi-Wen


    A new method without any special devices for direct transformation of linear gene cassettes was developed. Its feasibility was verified through 5'-fluorescent dye (fluorescein isothiocyanate, FITC)-labeled fluorescent tracing and transient expression of a gus reporter gene. Minimal linear gene cassettes, containing necessary regulation elements and a gus reporter gene, was prepared by polymerase chain reaction and dissolved in transformation buffer solution to 100 ng/mL. The basic transformation solution used was Murashige and Skoog basal salt mixture (MS) liquid medium. Hypertonic pretreatment of explants and transformation cofactors, including Ca(2+), surfactant assistants, Agrobacterium LBA4404 cell culture on transformation efficiency were evaluated. Prior to the incubation of the explants and target linear cassette in each designed transformation solution for 3 h, the onion low epidermal explants were pre-cultured in darkness at 27 degrees C for 48 h and then transferred to MS solid media for 72 h. FITC-labeled linear DNA was used to trace the delivery of DNA entry into the cell and the nuclei. By GUS staining and flow-cytometry-mediated fluorescent detection, a significant increase of the ratios of fluorescent nuclei as well as expression of the gus reporter gene was observed by each designed transformation solution. This potent and feasible method showed prospective applications in plant transgenic research.

  4. Linear friction weld process monitoring of fixture cassette deformations using empirical mode decomposition

    NASA Astrophysics Data System (ADS)

    Bakker, O. J.; Gibson, C.; Wilson, P.; Lohse, N.; Popov, A. A.


    Due to its inherent advantages, linear friction welding is a solid-state joining process of increasing importance to the aerospace, automotive, medical and power generation equipment industries. Tangential oscillations and forge stroke during the burn-off phase of the joining process introduce essential dynamic forces, which can also be detrimental to the welding process. Since burn-off is a critical phase in the manufacturing stage, process monitoring is fundamental for quality and stability control purposes. This study aims to improve workholding stability through the analysis of fixture cassette deformations. Methods and procedures for process monitoring are developed and implemented in a fail-or-pass assessment system for fixture cassette deformations during the burn-off phase. Additionally, the de-noised signals are compared to results from previous production runs. The observed deformations as a consequence of the forces acting on the fixture cassette are measured directly during the welding process. Data on the linear friction-welding machine are acquired and de-noised using empirical mode decomposition, before the burn-off phase is extracted. This approach enables a direct, objective comparison of the signal features with trends from previous successful welds. The capacity of the whole process monitoring system is validated and demonstrated through the analysis of a large number of signals obtained from welding experiments.

  5. Detachable timing gear cassette unit for an explosion or internal combustion engine

    SciTech Connect

    Kohler, B.


    A detachable timing gear cassette unit is described for attaching to a crankshaft and a camshaft of a cylinder block of an engine, the timing gear cassette unit comprising: a housing formed by at least two sealingly interconnected side walls, the housing, including the at least two interconnected side walls, being attachable and detachable as a unit from the cylinder block; and synchronization means disposed within the housing, the synchronization means comprising: first means for producing an input movement for connection to the crankshaft; at least one second means for producing an output movement for connection to the camshaft; third means interconnecting the first and at least one second, and third means being prepositioned and communicating such that the third means drivingly connects the first means to the at least one second means whereby the output movement is driven in synchronism with the input movement; and positioning means located adjacent the first and at least one second means for maintaining the first means and the at least one second means in position during attachment of the timing gear cassette unit to the cylinder block.

  6. Genomic donor cassette sharing during VLRA and VLRC assembly in jawless vertebrates.


    Das, Sabyasachi; Li, Jianxu; Holland, Stephen J; Iyer, Lakshminarayan M; Hirano, Masayuki; Schorpp, Michael; Aravind, L; Cooper, Max D; Boehm, Thomas


    Lampreys possess two T-like lymphocyte lineages that express either variable lymphocyte receptor (VLR) A or VLRC antigen receptors. VLRA(+) and VLRC(+) lymphocytes share many similarities with the two principal T-cell lineages of jawed vertebrates expressing the αβ and γδ T-cell receptors (TCRs). During the assembly of VLR genes, several types of genomic cassettes are inserted, in step-wise fashion, into incomplete germ-line genes to generate the mature forms of antigen receptor genes. Unexpectedly, the structurally variable components of VLRA and VLRC receptors often possess partially identical sequences; this phenomenon of module sharing between these two VLR isotypes occurs in both lampreys and hagfishes. By contrast, VLRA and VLRC molecules typically do not share their building blocks with the structurally analogous VLRB receptors that are expressed by B-like lymphocytes. Our studies reveal that VLRA and VLRC germ-line genes are situated in close proximity to each other in the lamprey genome and indicate the interspersed arrangement of isotype-specific and shared genomic donor cassettes; these features may facilitate the shared cassette use. The genomic structure of the VLRA/VLRC locus in lampreys is reminiscent of the interspersed nature of the TCRA/TCRD locus in jawed vertebrates that also allows the sharing of some variable gene segments during the recombinatorial assembly of TCR genes.

  7. Product variability of the 'cineole cassette' monoterpene synthases of related Nicotiana species.


    Fähnrich, Anke; Krause, Katrin; Piechulla, Birgit


    Nicotiana species of the section Alatae characteristically emit the floral scent compounds of the 'cineole cassette' comprising 1,8-cineole, limonene, myrcene, α-pinene, β-pinene, sabinene, and α-terpineol. We successfully isolated genes of Nicotiana alata and Nicotiana langsdorfii that encoded enzymes, which produced the characteristic monoterpenes of this 'cineole cassette' with α-terpineol being most abundant in the volatile spectra. The amino acid sequences of both terpineol synthases were 99% identical. The enzymes cluster in a monophyletic branch together with the closely related cineole synthase of Nicotiana suaveolens and monoterpene synthase 1 of Solanum lycopersicum. The cyclization reactions (α-terpineol to 1,8-cineole) of the terpineol synthases of N. alata and N. langsdorfii were less efficient compared to the 'cineole cassette' monoterpene synthases of Arabidopsis thaliana, N. suaveolens, Salvia fruticosa, Salvia officinalis, and Citrus unshiu. The terpineol synthases of N. alata and N. langsdorfii were localized in pistils and in the adaxial and abaxial epidermis of the petals. The enzyme activities reached their maxima at the second day after anthesis when flowers were fully opened and the enzyme activity in N. alata was highest at the transition from day to night (diurnal rhythm).

  8. Circulating cathodic antigen cassette test versus haematuria strip test in diagnosis of urinary schistosomiasis.


    El-Ghareeb, Azza S; Abd El Motaleb, Ghada S; Waked, Nevien Maher; Osman Hany Kamel, Nancy; Aly, Nagwa Shaban


    Urinary schistosomiasis caused by Schistosoma haematobium constitutes a major public health problem in many tropical and sub-tropical countries. This study was conducted to evaluate circulating cathodic antigen cassette test and haematuria strip test for detection of S. haematobium in urine samples and to evaluate their screening performance among the study population. Microscopy was used as a gold standard. A total of 600 urine samples were examined by microscopy for detection of S. haematobium eggs, screened for microhaematuria using Self-Stik reagent strips and screened for circulating cathodic antigen (CCA) using the urine-CCA cassette test. The specificity of CCA, microhaematuria and macrohaematuria was 96.4, 40.6 and 31.2 % respectively while the sensitivity was 88.2, 99.3 and 100 % respectively which was statistically significant (P < 0.001). These findings suggest that using of urine-CCA cassette test in diagnosis of urinary schistosomiasis is highly specific (96.4 %) compared with the highly sensitive haematuria strip test (100 %). The degree of agreement between microscopic examination and CCA detection was 99.3 % with highly statistically significant difference (P < 0.001). The combination of two techniques could potentially use for screening and mapping of S. haematobium infection.

  9. Novel Streptomycin and Spectinomycin Resistance Gene as a Gene Cassette within a Class 1 Integron Isolated from Escherichia coli

    PubMed Central

    Sandvang, Dorthe


    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate. PMID:10582907

  10. Increased maintenance and persistence of transgenes by excision of expression cassettes from plasmid sequences in vivo.


    Riu, Efren; Grimm, Dirk; Huang, Zan; Kay, Mark A


    Persistence of transgene expression is a major limitation for nonvirus-mediated gene therapy approaches. We have suggested that covalent linkage of bacterial DNA to the expression cassette plays a critical role in transcriptional silencing of transgenes in vivo. To gain insight into the role of the covalent linkage of plasmid DNA to the expression cassette and transcriptional repression, and whether this silencing effect could be alleviated by altering the molecular structure of vector DNAs in vivo, we generated a scheme for converting routine plasmids into a purified expression cassette, free of bacterial DNA after gene transfer in vivo. To do this, the human alpha-1-antitrypsin (hAAT) and human clotting factor IX (hfIX) reporter genes were flanked by two ISceI endonuclease recognition sites, and coinjected together with a plasmid encoding the I-SceI cDNA or a control plasmid into mouse liver. Two weeks after DNA administration, mice injected with the reporter gene alone or with the irrelevant control plasmid showed low serum levels of hAAT or hFIX, which remained low throughout the length of the experiment. However, animals that expressed I-SceI had a 5- to 10-fold increase in serum hAAT or hFIX that persisted for at least 8 months (length of study). Expression of I-SceI resulted in cleavage and excision of the expression cassettes from the plasmid backbone, forming mostly circles devoid of bacterial DNA sequences, as established by a battery of different Southern blot and polymerase chain reaction analyses in both C57BL/6 and scid treated mice. In contrast, only the input parental circular plasmid DNA band was detected in mice injected with the reporter gene alone, or an I-SceI plasmid together with the hAAT reporter plasmid lacking the I-SceI sites. Similar results were obtained when the Flp recombinase system was used to make mini-plasmids in mouse liver in vivo. This study presents further independent evidence that removing the covalent linkage between

  11. Enhanced performance of methamphetamine lateral flow cassettes using an electronic lateral flow reader.


    Smith, Jerome P; Sammons, Deborah L; Robertson, Shirley A; Snawder, John E


    Surface contamination from methamphetamine in meth labs continues to be a problem. We had previously developed a lateral flow assay cassette for field detection of methamphetamine contamination that is commercially available and has been used by a number of groups to assess contamination. This cassette uses the complete disappearance of the test line as an end point for detection of 50 ng/100 cm2 of methamphetamine contamination for surface sampling with cotton swabs. In the present study, we further evaluate the response of the cassettes using an electronic lateral flow reader to measure the intensities of the test and control lines. The cassettes were capable of detecting 0.25 ng/ml for calibration solutions. For 100 cm2 ceramic tiles that were spiked with methamphetamine and wiped with cotton-tipped wooden swabs wetted in assay/sampling buffer, 1 ng/tile was detected using the reader. Semi-quantitative results can be produced over the range 0-10 ng/ml for calibration solutions and 0-25 ng/tile for spiked tiles using either a 4-parameter logistic fit of test line intensity versus concentration or spiked mass or the ratio of the control line to the test line intensity fit to concentration or spiked mass. Recovery from the tiles was determined to be about 30% using the fitted curves. Comparison of the control line to the test line was also examined as a possible visual detection end point and it was found that the control line became more intense than the test line at 0.5 to 1 ng/ml for calibration solutions or 1 to 2 ng/tile for spiked tiles. Thus the lateral flow cassettes for methamphetamine have the potential to produce more sensitive semi-quantitative results if an electronic lateral flow reader is used and can be more sensitive for detection if the comparison of the control line to the test line is used as the visual end point.

  12. Enhanced performance of methamphetamine lateral flow cassettes using an electronic lateral flow reader

    PubMed Central

    Smith, Jerome P.; Sammons, Deborah L.; Robertson, Shirley A.; Snawder, John E.


    Surface contamination from methamphetamine in meth labs continues to be a problem. We had previously developed a lateral flow assay cassette for field detection of methamphetamine contamination that is commercially available and has been used by a number of groups to assess contamination. This cassette uses the complete disappearance of the test line as an end point for detection of 50 ng/100 cm2 of methamphetamine contamination for surface sampling with cotton swabs. In the present study, we further evaluate the response of the cassettes using an electronic lateral flow reader to measure the intensities of the test and control lines. The cassettes were capable of detecting 0.25 ng/ml for calibration solutions. For 100 cm2 ceramic tiles that were spiked with methamphetamine and wiped with cotton tipped wooden swabs wetted in assay/sampling buffer, 1 ng/tile was detected using the reader. Semi-quantitative results can be produced over the range 0–10 ng/ml for calibration solutions and 0–25 ng/tile for spiked tiles using either a 4-parameter logistic fit of test line intensity versus concentration or spiked mass or the ratio of the control line to the test line intensity fit to concentration or spiked mass. Recovery from the tiles was determined to be about 30% using the fitted curves. Comparison of the control line to the test line was also examined as a possible visual detection end point and it was found that the control line became more intense than the test line at 0.5 to 1 ng/ml for calibration solutions or 1 to 2 ng/tile for spiked tiles. Thus the lateral flow cassettes for methamphetamine have the potential to produce more sensitive semi-quantitative results if an electronic lateral flow reader is used and can be more sensitive for detection if the comparison of the control line to the test line is used as the visual end point. PMID:25379615

  13. Ubiquitin promoter-terminator cassette promotes genetically stable expression of the taste-modifying protein miraculin in transgenic lettuce.


    Hirai, Tadayoshi; Shohael, Abdullah Mohammad; Kim, You-Wang; Yano, Megumu; Ezura, Hiroshi


    Lettuce is a commercially important leafy vegetable that is cultivated worldwide, and it is also a target crop for plant factories. In this study, lettuce was selected as an alternative platform for recombinant miraculin production because of its fast growth, agronomic value, and wide availability. The taste-modifying protein miraculin is a glycoprotein extracted from the red berries of the West African native shrub Richadella dulcifica. Because of its limited natural availability, many attempts have been made to produce this protein in suitable alternative hosts. We produced transgenic lettuce with miraculin gene driven either by the ubiquitin promoter/terminator cassette from lettuce or a 35S promoter/nos terminator cassette. Miraculin gene expression and miraculin accumulation in both cassettes were compared by quantitative real-time PCR analysis, Western blotting, and enzyme-linked immunosorbent assay. The expression level of the miraculin gene and protein in transgenic lettuce was higher and more genetically stable in the ubiquitin promoter/terminator cassette than in the 35S promoter/nos terminator cassette. These results demonstrated that the ubiquitin promoter/terminator cassette is an efficient platform for the genetically stable expression of the miraculin protein in lettuce and hence this platform is of benefit for recombinant miraculin production on a commercial scale.

  14. Novel and diverse integron integrase genes and integron-like gene cassettes are prevalent in deep-sea hydrothermal vents.


    Elsaied, Hosam; Stokes, H W; Nakamura, Takamichi; Kitamura, Keiko; Fuse, Hiroyuki; Maruyama, Akihiko


    The lack of information about mobile DNA in deep-sea hydrothermal vents limits our understanding of the phylogenetic diversity of the mobile genome of bacteria in these environments. We used culture-independent techniques to explore the diversity of the integron/mobile gene cassette system in a variety of hydrothermal vent communities. Three samples, which included two different hydrothermal vent fluids and a mussel species that contained essentially monophyletic sulfur-oxidizing bacterial endosymbionts, were collected from Suiyo Seamount, Izu-Bonin, Japan, and Pika site, Mariana arc. First, using degenerate polymerase chain reaction (PCR) primers, we amplified integron integrase genes from metagenomic DNA from each sample. From vent fluids, we discovered 74 new integrase genes that were classified into 11 previously undescribed integron classes. One integrase gene was recorded in the mussel symbiont and was phylogenetically distant from those recovered from vent fluids. Second, using PCR primers targeting the gene cassette recombination site (59-be), we amplified and subsequently identified 60 diverse gene cassettes. In multicassette amplicons, a total of 13 59-be sites were identified. Most of these sites displayed features that were atypical of the features previously well conserved in this family. The Suiyo vent fluid was characterized by gene cassette open reading frames (ORFs) that had significant homologies with transferases, DNA-binding proteins and metal transporter proteins, while the majority of Pika vent fluid gene cassettes contained novel ORFs with no identifiable homologues in databases. The symbiont gene cassette ORFs were found to be matched with DNA repair proteins, methionine aminopeptidase, aminopeptidase N, O-sialoglycoprotein endopeptidase and glutamate synthase, which are proteins expected to play a role in animal/symbiont metabolism. The success of this study indicates that the integron/gene cassette system is common in deep-sea hydrothermal

  15. A field comparison of the IOM inhalable aerosol sampler and a modified 37-mm cassette.


    Clinkenbeard, R E; England, E C; Johnson, D L; Esmen, N A; Hall, T A


    This research focused on comparing a modified 37-mm (Mod37) sampling cassette with an IOM inhalable dust sampler. Paired IOM and Mod37 breathing-zone air samples were collected for workers engaged in corrosion control maintenance operations on several types of aircraft at several U.S. Air Force bases in the United States. Sampled operations included hand and power sanding, blow-down and wipe-down to remove dust, and spray finishing. The cassettes' interior surfaces were swabbed and the swabs combined with the filters for chromium analysis by NIOSH Method 7300. This approach utilized total chromium as a sensitive surrogate indicator of total aspirated mass. The influences of work location, work type, sample duration, and sampler type on measured concentration were evaluated using analysis of variance techniques. Only work type (process) was found to be a statistically significant predictor of measured concentration. The relationship between IOM- and Mod37-measured values for paired samples was evaluated by work type using linear regression techniques. Linear regressions showed that the modified 37-mm cassette over-samples aerosol by 35 percent compared to the IOM when a wide range of aerosol concentrations and compositions for divergent work tasks in multiple field locations are sampled. Interpretation of these results in light of previous results involving filter-only Mod37 analyses suggests that while the Mod37 has a higher aspiration efficiency than the IOM, substantial Mod37 wall losses result in underestimation of exposure when only the 37-mm filter is analyzed rather than filters plus wall swabs.

  16. Marine integrons containing novel integrase genes, attachment sites, attI, and associated gene cassettes in polluted sediments from Suez and Tokyo Bays.


    Elsaied, Hosam; Stokes, Hatch W; Kitamura, Keiko; Kurusu, Yasurou; Kamagata, Yoichi; Maruyama, Akihiko


    In order to understand the structure and biological significance of integrons and associated gene cassettes in marine polluted sediments, metagenomic DNAs were extracted from sites at Suez and Tokyo Bays. PCR amplicons containing new integrase genes, intI, linked with novel gene cassettes, were recovered and had sizes from 1.8 to 2.5 kb. This approach uncovered, for the first time, the structure and diversity of both marine integron attachment site, attI, and the first gene cassette, the most efficiently expressed integron-associated gene cassette. The recovered 13 and 20 intI phylotypes, from Suez and Tokyo Bay samples, respectively, showed a highly divergence, suggesting a difference in integron composition between the sampling sites. Some intI phylotypes showed similarity with that from Geobacter metallireducens, belonging to Deltaproteobacteria, the dominant class in both sampling sites, as determined by 16S rRNA gene analysis. Thirty distinct families of putative attI site, as determined by the presence of an attI-like simple site, were recovered. A total of 146 and 68 gene cassettes represented Suez and Tokyo Bay unsaturated cassette pools, respectively. Gene cassettes, including a first cassette, from both sampling sites encoded two novel families of glyoxalase/bleomycin antibiotic-resistance protein. Gene cassettes from Suez Bay encoded proteins similar to haloacid dehalogenases, protein disulfide isomerases and death-on-curing and plasmid maintenance system killer proteins. First gene cassettes from Tokyo Bay encoded a xenobiotic-degrading protein, cardiolipin synthetase, esterase and WD40-like β propeller protein. Many of the first gene cassettes encoded proteins with no ascribable function but some of them were duplicated and possessed signal functional sites, suggesting efficient adaptive functions to their bacterial sources. Thus, each sampling site had a specific profile of integrons and cassette types consistent with the hypothesis that the

  17. Identification and analysis of integrons and cassette arrays in bacterial genomes

    PubMed Central

    Cury, Jean; Jové, Thomas; Touchon, Marie; Néron, Bertrand; Rocha, Eduardo PC


    Integrons recombine gene arrays and favor the spread of antibiotic resistance. Their broader roles in bacterial adaptation remain mysterious, partly due to lack of computational tools. We made a program – IntegronFinder – to identify integrons with high accuracy and sensitivity. IntegronFinder is available as a standalone program and as a web application. It searches for attC sites using covariance models, for integron-integrases using HMM profiles, and for other features (promoters, attI site) using pattern matching. We searched for integrons, integron-integrases lacking attC sites, and clusters of attC sites lacking a neighboring integron-integrase in bacterial genomes. All these elements are especially frequent in genomes of intermediate size. They are missing in some key phyla, such as α-Proteobacteria, which might reflect selection against cell lineages that acquire integrons. The similarity between attC sites is proportional to the number of cassettes in the integron, and is particularly low in clusters of attC sites lacking integron-integrases. The latter are unexpectedly abundant in genomes lacking integron-integrases or their remains, and have a large novel pool of cassettes lacking homologs in the databases. They might represent an evolutionary step between the acquisition of genes within integrons and their stabilization in the new genome. PMID:27130947

  18. Use of cassette-electrode microbial fuel cell for wastewater treatment.


    Miyahara, Morio; Hashimoto, Kazuhito; Watanabe, Kazuya


    Cassette-electrode microbial fuel cells (CE-MFCs) have been developed for the conversion of biomass wastes into electric energy. The present study modified CE-MFC for its application to wastewater treatment and examined its utility in a long-term (240 days) experiment to treat a synthetic wastewater, containing starch, yeast extract, peptone, plant oil, and a detergent (approximately 500 mg of total chemical oxygen demand [COD] per liter). A test MFC reactor (1 l in capacity) was equipped with 10 cassette electrodes with total anode and cathode projection areas of 1440 cm(2), and the operation was initiated by inoculating with rice paddy-field soil. It was demonstrated that CE-MFC achieved COD removal rates of 80% at hydraulic-retention times of 6 h or greater, and electricity was generated at a maximum power density of 150 mW m(-2) and Coulombic efficiency of 20%. Microbial communities established on anodes of CEs were analyzed by pyrosequencing of PCR-amplified 16S rRNA gene fragments, showing that Geobacter, Clostridium, and Geothrix were abundantly detected in anode biofilms. These results demonstrate the utility of CE-MFC for wastewater treatment, in which Geobacter and Geothrix would be involved in the electricity generation.

  19. Phototoxic Risk Assessments on Benzophenone Derivatives: Photobiochemical Assessments and Dermal Cassette-Dosing Pharmacokinetic Study.


    Seto, Yoshiki; Ohtake, Hiroto; Kato, Masashi; Onoue, Satomi


    This study aimed to qualify photosafety screening on the basis of photochemical and pharmacokinetic (PK) data on dermally applied chemicals. Six benzophenone derivatives (BZPs) were selected as model compounds, and in vitro photochemical/phototoxic characterization and dermal cassette-dosing PK study were carried out. For comparison, an in vivo phototoxicity test was also conducted. All of the BZPs exhibited strong UVA/UVB absorption with molar extinction coefficients of over 2000 M(-1) × cm(-1), and benzophenone and ketoprofen exhibited significant reactive oxygen species (ROS) generation upon exposure to simulated sunlight (about 2.0 mW/cm(2)); however, ROS generation from sulisobenzone and dioxybenzone was negligible. To verify in vitro phototoxicity, a 3T3 neutral red uptake phototoxicity test was carried out, and benzophenone and ketoprofen were categorized to be phototoxic chemicals. The dermal PK parameters of ketoprofen were indicative of the highest dermal distribution of all BZPs tested. On the basis of its in vitro photochemical/phototoxic and PK data, ketoprofen was deduced to be highly phototoxic. The rank of predicted phototoxic risk of BZPs on the basis of the proposed screening strategy was almost in agreement with the results from the in vivo phototoxicity test. The combined use of photochemical and cassette-dosing PK data would provide reliable predictions of phototoxic risk for candidates with high productivity.

  20. Site-specific recombination in the chicken genome using Flipase recombinase-mediated cassette exchange.


    Lee, Hong Jo; Lee, Hyung Chul; Kim, Young Min; Hwang, Young Sun; Park, Young Hyun; Park, Tae Sub; Han, Jae Yong


    Targeted genome recombination has been applied in diverse research fields and has a wide range of possible applications. In particular, the discovery of specific loci in the genome that support robust and ubiquitous expression of integrated genes and the development of genome-editing technology have facilitated rapid advances in various scientific areas. In this study, we produced transgenic (TG) chickens that can induce recombinase-mediated gene cassette exchange (RMCE), one of the site-specific recombination technologies, and confirmed RMCE in TG chicken-derived cells. As a result, we established TG chicken lines that have, Flipase (Flp) recognition target (FRT) pairs in the chicken genome, mediated by piggyBac transposition. The transgene integration patterns were diverse in each TG chicken line, and the integration diversity resulted in diverse levels of expression of exogenous genes in each tissue of the TG chickens. In addition, the replaced gene cassette was expressed successfully and maintained by RMCE in the FRT predominant loci of TG chicken-derived cells. These results indicate that targeted genome recombination technology with RMCE could be adaptable to TG chicken models and that the technology would be applicable to specific gene regulation by cis-element insertion and customized expression of functional proteins at predicted levels without epigenetic influence.

  1. Design, simplified cloning, and in-silico analysis of multisite small interfering RNA-targeting cassettes

    PubMed Central

    Baghban-Kohnehrouz, Bahram; Nayeri, Shahnoush


    Multiple gene silencing is being required to target and tangle metabolic pathways in eukaryotes and researchers have to develop a subtle method for construction of RNA interference (RNAi) cassettes. Although, several vectors have been developed due to different screening and cloning strategies but still some potential limitations remain to be dissolved. Here, we worked out a simple cloning strategy to develop multisite small interfering RNA (siRNA) cassette from different genes by two cloning steps. In this method, effective siRNA sites in the target messenger RNAs (mRNAs) were determined using in silico analysis and consecutively arranged to reduce length of inverted repeats. Here, we used one-step (polymerase chain reaction) PCR by designed long primer sets covering the selected siRNA sites. Rapid screening, cost-effective and shorten procedure are advantages of this method compare to PCR classic cloning. Validity of constructs was confirmed by optimal centroid secondary structures with high stability in plants. PMID:27844018

  2. Electricity generation from model organic wastewater in a cassette-electrode microbial fuel cell.


    Shimoyama, Takefumi; Komukai, Shoko; Yamazawa, Akira; Ueno, Yoshiyuki; Logan, Bruce E; Watanabe, Kazuya


    A new highly scalable microbial fuel cell (MFC) design, consisting of a series of cassette electrodes (CE), was examined for increasing power production from organic matter in wastewater. Each CE chamber was composed of a box-shaped flat cathode (two air cathodes on both sides) sandwiched in between two proton-exchange membranes and two graphite-felt anodes. Due to the simple design of the CE-MFC, multiple cassettes can be combined to form a single unit and inserted into a tank to treat wastewater. A 12-chamber CE-MFC was tested using a synthetic wastewater containing starch, peptone, and fish extract. Stable performance was obtained after 15 days of operation in fed-batch mode, with an organic removal efficiency of 95% at an organic loading rate of 2.9 kg chemical oxygen demand (COD) per cubic meter per day and an efficiency of 93% at 5.8 kg COD per cubic meter per day. Power production was stable during this period, reaching maximum power densities of 129 W m(-3) (anode volume) and 899 mW m(-2) (anode projected area). The internal resistance of CE-MFC decreased from 2.9 (day 4) to 0.64 Omega (day 25). These results demonstrate the usefulness of the CE-MFC design for energy production and organic wastewater treatment.

  3. Staphylococcal chromosomal cassettes mec (SCCmec): A mobile genetic element in methicillin-resistant Staphylococcus aureus.


    Liu, Junyan; Chen, Dingqiang; Peters, Brian M; Li, Lin; Li, Bing; Xu, Zhenbo; Shirliff, Mark E


    Considered to be a potential "superbug", methicillin-resistant Staphylococcus aureus (MRSA) has been one of the major recent infectious pathogens and thus poses a challenge to hospital infection control. The mobile genetic element staphylococcal chromosomal cassette mec (SCCmec) carries both the mecA or mecC gene, encoding for a novel specific penicillin-binding protein (PBP2a), and site-specific recombinase genes ccrAB or/and ccrC. In MRSA, the acquisition of SCCmec leads to the resistance to the β-lactam antibiotics. As SCCmec plays a core role in the antimicrobial resistance characteristics, molecular epidemiology and evolution of MRSA, a thorough summary and comprehensive understanding of the prevalence and structural characteristics of SCCmec may aid in global surveillance, implementation and investigation on MRSA isolates, as well as further development of preventive and therapeutic approaches. Consequently, this review is aimed at describing the history, prevalence, types and subtypes, and current typing methods of SCCmec, with the focus on the typical structures of the SCCmec cassette.

  4. Identification and analysis of integrons and cassette arrays in bacterial genomes.


    Cury, Jean; Jové, Thomas; Touchon, Marie; Néron, Bertrand; Rocha, Eduardo Pc


    Integrons recombine gene arrays and favor the spread of antibiotic resistance. Their broader roles in bacterial adaptation remain mysterious, partly due to lack of computational tools. We made a program - IntegronFinder - to identify integrons with high accuracy and sensitivity. IntegronFinder is available as a standalone program and as a web application. It searches for attC sites using covariance models, for integron-integrases using HMM profiles, and for other features (promoters, attI site) using pattern matching. We searched for integrons, integron-integrases lacking attC sites, and clusters of attC sites lacking a neighboring integron-integrase in bacterial genomes. All these elements are especially frequent in genomes of intermediate size. They are missing in some key phyla, such as α-Proteobacteria, which might reflect selection against cell lineages that acquire integrons. The similarity between attC sites is proportional to the number of cassettes in the integron, and is particularly low in clusters of attC sites lacking integron-integrases. The latter are unexpectedly abundant in genomes lacking integron-integrases or their remains, and have a large novel pool of cassettes lacking homologs in the databases. They might represent an evolutionary step between the acquisition of genes within integrons and their stabilization in the new genome.

  5. Electricity generation from cattle manure slurry by cassette-electrode microbial fuel cells.


    Inoue, Kengo; Ito, Toshihiro; Kawano, Yoshihiro; Iguchi, Atsushi; Miyahara, Morio; Suzuki, Yoshihiro; Watanabe, Kazuya


    Cassette-electrode microbial fuel cells (CE-MFCs) are efficient and scalable devices for electricity production from organic waste. Previous studies have demonstrated that CE-MFCs are capable of generating electricity from artificial wastewater at relatively high efficiencies. In this study, a single-cassette CE-MFC was constructed, and its capacity for electricity generation from cattle manure suspended in water (solid to water ratio of 1:50) was examined. The CE-MFC reactor was operated in batch mode for 49 days; electricity generation became stable 2 weeks after initiating the operation. The maximum power density was measured at 16.3 W m⁻³ on day 26. Sequencing analysis of PCR-amplified 16S rRNA gene fragments obtained from the original manure and from anode biofilms suggested that Chloroflexi and Geobacteraceae were abundant in the anode biofilm (29% and 18%, respectively), whereas no Geobacteraceae sequences were detected in the original manure sample. The results of this study suggest that CE-MFCs can be used to generate electricity from water-suspended cattle manure in a scalable MFC system.

  6. Recent advances on host plants and expression cassettes' structure and function in plant molecular pharming.


    Makhzoum, Abdullah; Benyammi, Roukia; Moustafa, Khaled; Trémouillaux-Guiller, Jocelyne


    Plant molecular pharming is a promising system to produce important recombinant proteins such as therapeutic antibodies, pharmaceuticals, enzymes, growth factors, and vaccines. The system provides an interesting alternative method to the direct extraction of proteins from inappropriate source material while offering the possibility to overcome problems related to product safety and source availability. Multiple factors including plant hosts, genes of interest, expression vector cassettes, and extraction and purification techniques play important roles in the plant molecular pharming. Plant species, as a biosynthesis platform, are a crucial factor in achieving high yields of recombinant protein in plant. The choice of recombinant gene and its expression strategy is also of great importance in ensuring a high amount of the recombinant proteins. Many studies have been conducted to improve expression, accumulation, and purification of the recombinant protein from molecular pharming systems. Re-engineered vectors and expression cassettes are also pivotal tools in enhancing gene expression at the transcription and translation level, and increasing protein accumulation, stability, retention and targeting of specific organelles. In this review, we report recent advances and strategies of plant molecular pharming while focusing on the choice of plant hosts and the role of some molecular pharming elements and approaches: promoters, codon optimization, signal sequences, and peptides used for upstream design, purification and downstream processing.

  7. Site-specific integration and tailoring of cassette design for sustainable gene transfer.


    Lombardo, Angelo; Cesana, Daniela; Genovese, Pietro; Di Stefano, Bruno; Provasi, Elena; Colombo, Daniele F; Neri, Margherita; Magnani, Zulma; Cantore, Alessio; Lo Riso, Pietro; Damo, Martina; Pello, Oscar M; Holmes, Michael C; Gregory, Philip D; Gritti, Angela; Broccoli, Vania; Bonini, Chiara; Naldini, Luigi


    Integrative gene transfer methods are limited by variable transgene expression and by the consequences of random insertional mutagenesis that confound interpretation in gene-function studies and may cause adverse events in gene therapy. Site-specific integration may overcome these hurdles. Toward this goal, we studied the transcriptional and epigenetic impact of different transgene expression cassettes, targeted by engineered zinc-finger nucleases to the CCR5 and AAVS1 genomic loci of human cells. Analyses performed before and after integration defined features of the locus and cassette design that together allow robust transgene expression without detectable transcriptional perturbation of the targeted locus and its flanking genes in many cell types, including primary human lymphocytes. We thus provide a framework for sustainable gene transfer in AAVS1 that can be used for dependable genetic manipulation, neutral marking of the cell and improved safety of therapeutic applications, and demonstrate its feasibility by rapidly generating human lymphocytes and stem cells carrying targeted and benign transgene insertions.

  8. Sewage treatment plant serves as a hot-spot reservoir of integrons and gene cassettes.


    Ma, Liping; Zhang, Xu-Xiang; Zhao, Fuzheng; Wu, Bing; Cheng, Shupei; Yang, Liuyan


    This study investigated the occurrence and abundance of class 1 integrons and related antibiotic resistance genes (ARGs) in a sewage treatment plant (STP) of China. Totally, 189 bacterial strains were isolated from influent, activated sludge and effluent, and 40 isolates contained the integons with a complete structure. The intl1-carrying isolates were found to harbor two types of gene cassettes: dfr17-aadA5 and aadA2, conferring resistances to trimethoprim and streptomycin, which were further confirmed by antimicrobial susceptibility analysis. Many other gene cassettes were carried on integron, including qnrVC1, catB-8-blaoxa-10-aadA1-aac(6'), aadB-aacA29b, aadA2, aac(6')-1b, aadA6 and aadA12, which were detected using DNA cloning. Quantitative real time PCR showed that over 99% of the integrons was eliminated in activated sludge process, but average copy number of integrons in given bacterial cells was increased by 56% in treated sewage. Besides integrons, other mobile gene elements (MGEs) were present in the STP with high abundance. MGEs and the associated ARGs may be wide-spread in STPs, which constitute a potential hot spot for selection of antibiotic resistant bacteria and horizontal transfer of ARGs.

  9. Fully Automated Data Collection Using PAM and the Development of PAM/SPACE Reversible Cassettes

    NASA Astrophysics Data System (ADS)

    Hiraki, Masahiko; Watanabe, Shokei; Chavas, Leonard M. G.; Yamada, Yusuke; Matsugaki, Naohiro; Igarashi, Noriyuki; Wakatsuki, Soichi; Fujihashi, Masahiro; Miki, Kunio; Baba, Seiki; Ueno, Go; Yamamoto, Masaki; Suzuki, Mamoru; Nakagawa, Atsushi; Watanabe, Nobuhisa; Tanaka, Isao


    To remotely control and automatically collect data in high-throughput X-ray data collection experiments, the Structural Biology Research Center at the Photon Factory (PF) developed and installed sample exchange robots PAM (PF Automated Mounting system) at PF macromolecular crystallography beamlines; BL-5A, BL-17A, AR-NW12A and AR-NE3A. We developed and installed software that manages the flow of the automated X-ray experiments; sample exchanges, loop-centering and X-ray diffraction data collection. The fully automated data collection function has been available since February 2009. To identify sample cassettes, PAM employs a two-dimensional bar code reader. New beamlines, BL-1A at the Photon Factory and BL32XU at SPring-8, are currently under construction as part of Targeted Proteins Research Program (TPRP) by the Ministry of Education, Culture, Sports, Science and Technology of Japan. However, different robots, PAM and SPACE (SPring-8 Precise Automatic Cryo-sample Exchanger), will be installed at BL-1A and BL32XU, respectively. For the convenience of the users of both facilities, pins and cassettes for PAM and SPACE are developed as part of the TPRP.

  10. VLPC Single Cassette Cryostat Christmas Tree Temperature as Related to Annulus Flow and LHe Level

    SciTech Connect

    Olis, D.; /Fermilab


    theory is that the GHe used to apply positve pressure to the cassette space is leaking out the cassette top and is causing the change in y-intercepts. A leak in the cassette top would allow warm GHe to enter the cassette volume. Further tests will be done to see if this cassette leak is in fact the problem. The above equation cannot be applied at some instant to determine the annulus flow required at some LHe level to produce a desired tree temperature. Rather its value is that it shows the relative contribution of the two variables to the temperature and the temperature's sensitivity to them. It seems regulation of the tree temperature would best be achieved by providing a feedback loop between temperature and shield flow while maintaining a relatively steady ({+-}5%) LHe level. As one last note, I found that regulating the LHe level with the inlet valve caused disturbances in the cryostat that resulted in temperature drops as great as 0.2 K. To prevent this, when LHe levels fell too low, I would remove the boil-off hose from the regulator for a few minutes until the LHe level was back to a satisfactory level. From this it seems that the LHe level can be controlled by the boil-off regulator with less upset than by adjusting the LHe inlet valve.

  11. A Self-deleting Cre-lox-ermAM Cassette, CHESHIRE, for marker-less gene deletion in Streptococcus pneumoniae

    PubMed Central

    Weng, Liming; Biswas, Indranil; Morrison, Donald A.


    Although targeted mutagenesis of Streptococcus pneumoniae is readily accomplished with the aid of natural genetic transformation and chimeric donor DNA constructs assembled in vitro, the drug resistance markers often employed for selection of recombinant products can themselves be undesirable by-products of the genetic manipulation. A new cassette carrying the erythromycin-resistance marker ermAM is described that can be used as a temporary marker for selection of desired recombinants. The cassette may subsequently be removed at will by virtue of an embedded fucose-regulated Cre recombinase gene and terminal lox66 and lox71 Cre recognition sites, with retention of 34 bp from the cassette as an inert residual double-mutant lox72 site. PMID:19850089

  12. Evaluation of D-1 tape and cassette characteristics: Moisture content of Sony and Ampex D-1 tapes when delivered

    NASA Astrophysics Data System (ADS)

    Ashton, Gary

    Commercial D-1 cassette tapes and their associated recorders were designed to operate in broadcast studios and record in accordance with the International Radio Consultative Committee (CCIR) 607 digital video standards. The D-1 recorder resulted in the Society of Motion Picture and Television Engineers (SMPTE) standards 224 to 228 and is the first digital video recorder to be standardized for the broadcast industry. The D-1 cassette and associated media are currently marketed for broadcast use. The recorder was redesigned for data applications and is in the early stages of being evaluated. The digital data formats used are specified in MIL-STD-2179 and the American National Standards Institute (ANSI) X3.175-190 standard. In early 1990, the National Media Laboratory (NML) was asked to study the effects of time, temperature, and relative humidity on commercial D-1 cassettes. The environmental range to be studied was the one selected for the Advanced Tactical Air Reconnaissance System (ATARS) program. Several discussions between NML personnel, ATARS representatives, recorder contractors, and other interested parties were held to decide upon the experimental plan to be implemented. Review meetings were held periodically during the course of the experiment. The experiments were designed to determine the dimensional stability of the media and cassette since this is one of the major limiting factors of helical recorders when the media or recorders are subjected to non-broadcasting environments. Measurements were also made to characterize each sample of cassettes to give preliminary information on which purchase specifications could be developed. The actual tests performed on the cassettes and media before and after aging fall into the general categories listed.

  13. A Cassette Containing Thiostrepton, Gentamicin Resistance Genes, and dif sequences Is Effective in Construction of Recombinant Mycobacteria

    PubMed Central

    Mugweru, Julius; Makafe, Gaelle; Cao, Yuanyuan; Zhang, Yang; Wang, Bangxing; Huang, Shaobo; Njire, Moses; Chhotaray, Chiranjibi; Tan, Yaoju; Li, Xinjie; Liu, Jianxiong; Tan, Shouyong; Deng, Jiaoyu; Zhang, Tianyu


    The genetic manipulation of Mycobacterium tuberculosis genome is limited by the availability of selection markers. Spontaneous resistance mutation rate of M. tuberculosis to the widely used kanamycin is relatively high which often leads to some false positive transformants. Due to the few available markers, we have created a cassette containing thiostrepton resistance gene (tsr) for selection in M. tuberculosis and M. bovis BCG, and gentamicin resistance gene (aacC1) for Escherichia coli and M. smegmatis mc2155, flanked with dif sequences recognized by the Xer system of mycobacteria. This cassette adds to the limited available selection markers for mycobacteria. PMID:28392781

  14. Background sources at PEP

    SciTech Connect

    Lynch, H.; Schwitters, R.F.; Toner, W.T.


    Important sources of background for PEP experiments are studied. Background particles originate from high-energy electrons and positrons which have been lost from stable orbits, ..gamma..-rays emitted by the primary beams through bremsstrahlung in the residual gas, and synchrotron radiation x-rays. The effect of these processes on the beam lifetime are calculated and estimates of background rates at the interaction region are given. Recommendations for the PEP design, aimed at minimizing background are presented. 7 figs., 4 tabs.

  15. Copiers and Duplicators for Audio Tape Cassettes: Criteria for Selection, Laboratory Test Findings, Manufacturers' Data Reports. EPIE Report: Number 84e.

    ERIC Educational Resources Information Center

    Educational Products Information Exchange Inst., Stony Brook, NY.

    Because needs for cassette duplication equipment differ, the user must match his requirements to the capabilities of manufactured products, and the essential product characteristics. To help educators in choosing cassette duplicators, EPIE has gathered data from manufacturers and tested 11 units. The first section of the report explains the…

  16. Efficient Genome Editing in Caenorhabditis elegans with a Toolkit of Dual-Marker Selection Cassettes.


    Norris, Adam D; Kim, Hyun-Min; Colaiácovo, Mónica P; Calarco, John A


    Use of the CRISPR/Cas9 RNA-guided endonuclease complex has recently enabled the generation of double-strand breaks virtually anywhere in the C. elegans genome. Here, we present an improved strategy that makes all steps in the genome editing process more efficient. We have created a toolkit of template-mediated repair cassettes that contain an antibiotic resistance gene to select for worms carrying the repair template and a fluorescent visual marker that facilitates identification of bona fide recombinant animals. Homozygous animals can be identified as early as 4-5 days post-injection, and minimal genotyping by PCR is required. We demonstrate that our toolkit of dual-marker vectors can generate targeted disruptions, deletions, and endogenous tagging with fluorescent proteins and epitopes. This strategy should be useful for a wide variety of additional applications and will provide researchers with increased flexibility when designing genome editing experiments.

  17. Site-Specific Cassette Exchange Systems in the Aedes aegypti Mosquito and the Plutella xylostella Moth

    PubMed Central

    Haghighat-Khah, Roya Elaine; Scaife, Sarah; Martins, Sara; St John, Oliver; Matzen, Kelly Jean; Morrison, Neil; Alphey, Luke


    Genetically engineered insects are being evaluated as potential tools to decrease the economic and public health burden of mosquitoes and agricultural pest insects. Here we describe a new tool for the reliable and targeted genome manipulation of pest insects for research and field release using recombinase mediated cassette exchange (RMCE) mechanisms. We successfully demonstrated the established ΦC31-RMCE method in the yellow fever mosquito, Aedes aegypti, which is the first report of RMCE in mosquitoes. A new variant of this RMCE system, called iRMCE, combines the ΦC31-att integration system and Cre or FLP-mediated excision to remove extraneous sequences introduced as part of the site-specific integration process. Complete iRMCE was achieved in two important insect pests, Aedes aegypti and the diamondback moth, Plutella xylostella, demonstrating the transferability of the system across a wide phylogenetic range of insect pests. PMID:25830287

  18. Identification of antibiotic resistance cassettes in class 1 integrons in Aeromonas spp. strains isolated from fresh fish (Cyprinus carpio L.).


    Sarria-Guzmán, Yohanna; López-Ramírez, María Patricia; Chávez-Romero, Yosef; Ruiz-Romero, Erick; Dendooven, Luc; Bello-López, Juan Manuel


    Forty-six Aeromonas spp. strains were isolated from fresh fish and investigated for their antimicrobial susceptibility, detection of Class 1 integrons by PCR, and arrangement of gene cassettes. Selected isolates were further characterized by enterobacterial repetitive intergenic consensus-PCR. Twenty isolates were found to carry Class 1 integrons. Amplification of the variable regions of the integrons revealed diverse bands ranging in size from 150 to 1,958 pb. Sequence analysis of the variable regions revealed the presence of several gene cassettes, such as adenylyl transferases (aadA2 and aadA5), dihydrofolate reductases (dfrA17 and dfrA1), chloramphenicol acetyl transferase (catB3), β-lactamase (oxa2), lincosamide nucleotidil transferase (linF), aminoglycoside-modifying enzyme (apha15), and oxacillinase (bla OXA-10). Two open reading frames with an unknown function were identified as orfC and orfD. The aadA2 cassette was the most common integron found in this study. Interestingly, five integrons were detected in the plasmids that might be involved in the transfer of resistance genes to other bacteria. This is a first report of cassette encoding for lincosamides (linF) resistance in Aeromonas spp. Implications on the incidence of integrons in isolates of Aeromonas spp. from fresh fish for human consumption, and its possible consequences to human health are discussed.

  19. A simple polymerase chain reaction-based method for the construction of recombinase-mediated cassette exchange donor vectors.


    Bateman, Jack R; Wu, C-ting


    Here we describe a simple method for generating donor vectors suitable for targeted transgenesis via recombinase-mediated cassette exchange (RMCE) using the PhiC31 integrase. This PCR-based strategy employs small attB "tails" on the primers used to amplify a sequence of interest, permitting the rapid creation of transgenes for in vivo analysis.

  20. Lactobacillus hilgardii plasmid pLAB1000 consists of two functional cassettes commonly found in other gram-positive organisms.

    PubMed Central

    Josson, K; Soetaert, P; Michiels, F; Joos, H; Mahillon, J


    A Lactobacillus hilgardii plasmid, pLAB1000, was studied to understand the organization of autonomous replicons from lactobacilli. Two cassettes could be identified. First, the replication region consisted of a sequence coding for a replication protein (Rep) and its corresponding target site, similar to those from plasmids pUB110, pC194 (Staphylococcus aureus), pFTB14, pBAA1 (Bacillus sp.), and pLP1 (Lactobacillus sp.). Sequence analysis indicated the possible synthesis of an antisense RNA that might regulate Rep production. The results also suggested that pLAB1000 replicates via a single-stranded DNA intermediate, and a putative lagging-strand initiation site was found that had similarities to those of alpha 3, St-1, and G4 isometric bacteriophages. The second cassette of pLAB1000 consisted of a sequence coding for a putative mobilization protein (Mob) and its corresponding RSA site. This cassette was similar to those found in pT181, pUB110, pE194 (S. aureus), and pG12 (Bacillus sp.), and it was found to be conserved among different Lactobacillus plasmid replicons. The origin and evolution of these functional cassettes are also discussed. Images PMID:2188951

  1. Detection of E. coli O157:H7 with a reporter phage containing the luxCDABE cassette

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacteriophage and reporter phage are used for typing and/or detection of pathogens. The temperate tailed phage fV10 has been utilized for phage-typing E. coli O157:H7. By modifying fV10 to transduce kanamycin resistance and the a luxCDABE cassette, we developed a reporter bacteriophage (fV10-lux) p...

  2. An Evaluative Directory to Producers and Distributors of Unabridged Books on Cassette Tape. Occasional Papers Number 184.

    ERIC Educational Resources Information Center

    Hoffman, Preston Jones

    A study gathered information about producers and distributors of unabridged books on cassette tape for the use of librarians engaged in collection development. Questionnaires were distributed to 48 public libraries and 45 producers/distributors. This report includes an introduction covering the history of this medium and a rationale for collecting…

  3. Design and construction of an in-plant activation cassette for transgene expression and recombinant protein production in plants.


    Dugdale, Benjamin; Mortimer, Cara L; Kato, Maiko; James, Tess A; Harding, Robert M; Dale, James L


    Virus-based transgene expression systems have become particularly valuable for recombinant protein production in plants. The dual-module in-plant activation (INPACT) expression platform consists of a uniquely designed split-gene cassette incorporating the cis replication elements of Tobacco yellow dwarf geminivirus (TYDV) and an ethanol-inducible activation cassette encoding the TYDV Rep and RepA replication-associated proteins. The INPACT system is essentially tailored for recombinant protein production in stably transformed plants and provides both inducible and high-level transient transgene expression with the potential to be adapted to diverse crop species. The construction of a novel split-gene cassette, the inducible nature of the system and the ability to amplify transgene expression via rolling-circle replication differentiates this system from other DNA- and RNA-based virus vector systems used for stable or transient recombinant protein production in plants. Here we provide a detailed protocol describing the design and construction of a split-gene INPACT cassette, and we highlight factors that may influence optimal activation and amplification of gene expression in transgenic plants. By using Nicotiana tabacum, the protocol takes 6-9 months to complete, and recombinant proteins expressed using INPACT can accumulate to up to 10% of the leaf total soluble protein.

  4. Consumer Education Resources Catalog. 1980 Supplement. 16mm Films, Multi Media Kits, Video Cassettes, Simulations & Games, Printed Material.

    ERIC Educational Resources Information Center

    Jones, Sandra

    This supplement to the Consumer Education Resources Catalog (see note) lists teaching-learning resources available for preview at the Michigan Consumer Education Center. A subject index to multi-media identifies titles of films, video cassettes, multi-media kits, and games under seven specific subjects. These are (1) Factors Affecting Consumer…

  5. Consumer Education Resources Catalog: 16mm Films, Multi Media Kits, Video Cassettes, Simulations & Games, Printed Materials. 1978 Edition.

    ERIC Educational Resources Information Center

    Jones, Sandra; Neal, Kathy

    This consumer education resources catalog provides an annotated guide to 16mm films, multi-media kits, video cassettes, simulations and games, and printed materials related to consumer education available from Michigan Department of Education's Regional Education Media Centers. The first major section lists available media by specific subject…

  6. Educational and Cost Comparisons Between Open-Network, Cable and Cassette Systems of Multi-Media Teaching.

    ERIC Educational Resources Information Center

    Bates, A. W.

    The Open University of Great Britain provides home-based instruction via broadcasts and correspondence. Since technical arguments for the superiority of open-network, cable, or cassette television systems are inconclusive, the university has been forced to develop a decision-making model to determine which system is the most cost effective. For…

  7. Endotoxin deposits on the inner surfaces of closed-face cassettes during bioaerosol sampling: a field investigation at composting facilities.


    Duquenne, Philippe; Simon, Xavier; Demange, Valérie; Harper, Martin; Wild, Pascal


    A set of 270 bioaerosol samples was taken from 15 composting facilities using polystyrene closed-face filter cassettes (CFCs). The objective was to measure the quantity of endotoxin deposits on the inner surfaces of the cassettes (sometimes referred to as 'wall deposits'). The results show that endotoxins are deposited on the inner surfaces of the CFCs through sampling and/or handling of samples. The quantity of endotoxins measured on inner surfaces range between 0.05 (the limit of detection of the method) and 3100 endotoxin units per cassette. The deposits can represent a large and variable percentage of the endotoxins sampled. More than a third of the samples presented a percentage of inner surface deposits >40% of the total quantity of endotoxins collected (filter + inner surfaces). Omitting these inner surface deposits in the analytical process lead to measurement errors relative to sampling all particles entering the CFC sampler, corresponding to a developing consensus on matching the inhalable particulate sampling convention. The result would be underestimated exposures and could affect the decision as to whether or not a result is acceptable in comparison to airborne concentration limits defined in terms of the inhalability convention. The results of this study suggest including the endotoxins deposited on the inner surfaces of CFCs during analysis. Further researches are necessary to investigate endotoxin deposits on the inner cassette surfaces in other working sectors.

  8. A new set of rDNA-NTS-based multiple integrative cassettes for the development of antibiotic-marker-free recombinant yeasts.


    Moon, Hye Yun; Lee, Dong Wook; Sim, Gyu Hun; Kim, Hong-Jin; Hwang, Jee Youn; Kwon, Mun-Gyeong; Kang, Bo-Kyu; Kim, Jong Man; Kang, Hyun Ah


    The traditional yeast Saccharomyces cerevisiae has been widely used as a host system to produce recombinant proteins and metabolites of great commercial value. To engineer recombinant yeast that stably maintains expression cassettes without an antibiotic resistance gene, we developed new multiple integration cassettes by exploiting the non-transcribed spacer (NTS) of ribosomal DNA (rDNA) in combination with defective selection markers. The 5' and 3'-fragments of rDNA-NTS2 were used as flanking sequences for the expression cassettes carrying a set of URA3, LEU2, HIS3, and TRP1 selection markers with truncated promoters of different lengths. The integration numbers of NTS-based expression cassettes, ranging from one to ∼30 copies, showed a proportional increase with the extent of decreased expression of the auxotrophic markers. The NTS-based cassettes were used to construct yeast strains expressing the capsid protein of red-spotted grouper necrosis virus (RG-NNVCP) in a copy number-dependent manner. Oral administration of the recombinant yeast, harboring ∼30 copies of the integrated RG-NNVCP cassettes, provoked efficient immune responses in mice. In contrast, for the NTS cassettes expressing a truncated 3-hydroxyl-3-methylglutaryl-CoA reductase, the integrant carrying only 4 copies was screened as the highest producer of squalene, showing a 150-fold increase compared to that of the wild-type strain. The multiple integrated cassettes were stably retained under prolonged nonselective conditions. Altogether, our results strongly support that rDNA-NTS integrative cassettes are useful tools to construct recombinant yeasts carrying optimal copies of a desired expression cassette without an antibiotic marker gene, which are suitable as oral vaccines or feed additives for animal and human consumption.

  9. The Cosmic Background Explorer.

    ERIC Educational Resources Information Center

    Gulkis, Samuel; And Others


    Outlines the Cosmic Background Explorer (COBE) mission to measure celestial radiation. Describes the instruments used and experiments involving differential microwave radiometers, and a far infrared absolute spectrophotometer. (YP)

  10. Correlators in nontrivial backgrounds

    SciTech Connect

    Mello Koch, Robert de; Ives, Norman; Stephanou, Michael


    Operators in N=4 super Yang-Mills theory with an R-charge of O(N{sup 2}) are dual to backgrounds which are asymtotically AdS{sub 5}xS{sup 5}. In this article we develop efficient techniques that allow the computation of correlation functions in these backgrounds. We find that (i) contractions between fields in the string words and fields in the operator creating the background are the field theory accounting of the new geometry, (ii) correlation functions of probes in these backgrounds are given by the free field theory contractions but with rescaled propagators and (iii) in these backgrounds there are no open string excitations with their special end point interactions; we have only closed string excitations.

  11. The Athena Background

    NASA Astrophysics Data System (ADS)

    Piro, Luigi; Lotti, Simone; Macculi, Claudio; Molendi, Silvano; Eraerds, Tanja; Laurent, Philippe


    Estimating, reducing and controlling the residual particle background is fundamental for achieving the objectives of several science topics of Athena, in particular those connected with background dominated observations of faint and/or diffuse sources. This requires assessing the particle environment in L2, propagating the various particle components throughout the mirror, spacecraft, and instruments via proper modelling and simulations of various physical processes, implementing design and h/w measures at instrument and mission level to reduce the un-rejected background and identifying proper calibration methods to control the background variations. Likewise, an adequate knowledge of the XRB, made of components that may vary spatially or temporally, is required as well. Here we will review the present status of the background knowledge, and summarize the activities on-going within Athena at various levels.

  12. Comparison of a Wipe Method With and Without a Rinse to Recover Wall Losses in Closed Face 37-mm Cassettes used for Sampling Lead Dust Particulates.


    Ceballos, Diana; King, Bradley; Beaucham, Catherine; Brueck, Scott E


    Closed-face 37-mm polystyrene cassettes are often used for exposure monitoring of metal particulates. Several methods have been proposed to account for the wall loss in air sampling cassettes, including rinsing, wiping, within-cassette dissolution, and an internal capsule fused to the filter that could be digested with the filter. Until internal capsules replace filters, other methods for assessing wall losses may be considered. To determine if rinsing and wiping or wiping alone is adequate to determine wall losses on cassettes, we collected 54 full-shift area air samples at a battery recycling facility. We collected six replicate samples at three locations within the facility for three consecutive days. The wall losses of three replicate cassettes from each day-location were analyzed following a rinse and two consecutive wipes. The wall losses of the other three replicates from each day-location were analyzed following two consecutive wipes only. Mixed-cellulose ester membrane filter, rinse, and wipes were analyzed separately following NIOSH Method 7303. We found an average of 29% (range: 8-54%) recovered lead from the cassette walls for all samples. We also found that rinsing prior to wiping the interior cassette walls did not substantially improve recovery of wall losses compared to wiping alone. A rinse plus one wipe recovered on average 23% (range: 13-33%) of the lead, while one wipe alone recovered on average 21% (range: 16-22%). Similarly, we determined that a second wipe did not provide substantial additional recovery of lead (average: 4%, range: 0.4-19%) compared to the first wipe disregarding the rinse (average: 18%, range: 4-39%). We concluded that when an internal capsule is not used, wall losses of lead dust in air sampling cassettes can be adequately recovered by wiping the internal wall surfaces of the cassette with a single wipe.

  13. The cosmic neutrino background

    NASA Technical Reports Server (NTRS)

    Dar, Arnon


    The cosmic neutrino background is expected to consist of relic neutrinos from the big bang, of neutrinos produced during nuclear burning in stars, of neutrinos released by gravitational stellar collapse, and of neutrinos produced by cosmic ray interactions with matter and radiation in the interstellar and intergalactic medium. Formation of baryonic dark matter in the early universe, matter-antimatter annihilation in a baryonic symmetric universe, and dark matter annihilation could have also contributed significantly to the cosmic neutrino background. The purpose of this paper is to review the properties of these cosmic neutrino backgrounds, the indirect evidence for their existence, and the prospects for their detection.

  14. Background Underground at WIPP

    NASA Astrophysics Data System (ADS)

    Esch, Ernst-Ingo; Hime, A.; Bowles, T. J.


    Recent interest to establish a dedicated underground laboratory in the United States prompted an experimental program at to quantify the enviromental backgrounds underground at the Waste Isolation Pilot Plant (WIPP) in Carlsbad, New Mexico. An outline of this program is provided along with recent experimental data on the cosmic ray muon flux at the 650 meter level of WIPP. The implications of the cosmic ray muon and fast neutron background at WIPP will be discussed in the context of new generation, low background experiments envisioned in the future.

  15. The chromosome 3q26 OncCassette: a multigenic driver of human cancer

    PubMed Central

    Fields, Alan P.; Justilien, Verline; Murray, Nicole R.


    a “3q26 OncCassette” that mediates 3q26 CNG-driven tumorigenesis. Genomic analysis indicates that the 3q26 OncCassette also operates in other major tumor types that exhibit frequent 3q26 CNGs, including head and neck squamous cell carcinoma (HNSCC), ovarian serous cancer and cervical cancer. Finally, we discuss how the 3q26 OncCassette represents a tractable target for development of novel therapeutic intervention strategies that hold promise for improving treatment of 3q26-driven cancers. PMID:26754874

  16. Notification: Background Investigation Services

    EPA Pesticide Factsheets

    Project #OA-FY15-0029, February 26, 2015. The Office of Inspector General (OIG) for the U.S. Environmental Protection Agency (EPA) plans to begin field work for our audit of background investigation services.

  17. The GLAST Background Model

    SciTech Connect

    Ormes, J. F.; Atwood, W.; Burnett, T.; Grove, E.; Longo, F.; McEnery, J.; Ritz, S.; Mizuno, T.


    In order to estimate the ability of the GLAST/LAT to reject unwanted background of charged particles, optimize the on-board processing, size the required telemetry and optimize the GLAST orbit, we developed a detailed model of the background particles that would affect the LAT. In addition to the well-known components of the cosmic radiation, we included splash and reentrant components of protons, electrons (e+ and e-) from 10 MeV and beyond as well as the albedo gamma rays produced by cosmic ray interactions with the atmosphere. We made estimates of the irreducible background components produced by positrons and hadrons interacting in the multilayered micrometeorite shield and spacecraft surrounding the LAT and note that because the orbital debris has increased, the shielding required and hence the background are larger than were present in EGRET. Improvements to the model are currently being made to include the east-west effect.

  18. The GLAST Background Model

    SciTech Connect

    Ormes, J.F.; Atwood, W.; Burnett, T.; Grove, E.; Longo, F.; McEnery, J.; Mizuno, T.; Ritz, S.; /NASA, Goddard


    In order to estimate the ability of the GLAST/LAT to reject unwanted background of charged particles, optimize the on-board processing, size the required telemetry and optimize the GLAST orbit, we developed a detailed model of the background particles that would affect the LAT. In addition to the well-known components of the cosmic radiation, we included splash and reentrant components of protons, electrons (e+ and e-) from 10 MeV and beyond as well as the albedo gamma rays produced by cosmic ray interactions with the atmosphere. We made estimates of the irreducible background components produced by positrons and hadrons interacting in the multilayered micrometeorite shield and spacecraft surrounding the LAT and note that because the orbital debris has increased, the shielding required and hence the background are larger than were present in EGRET. Improvements to the model are currently being made to include the east-west effect.

  19. Distributed interactive simulation virtual cassette recorder (DIS VCR); A datalogger with variable speed replay

    NASA Astrophysics Data System (ADS)

    Fortner, Jonathan L.


    The overall objective of the Distributed Interactive Simulation Virtual Cassette Recorder (DIS VCR) is to add a flexible replay capability to any DIS environment and specifically to the Remote Debriefing Tool (RDT). The DIS VCR's abilities include selective filtering of incoming DIS Protocol Data Units (PDUs), variable-speed replays, ability to pause, fast-forward, rewind, efficient data storage and retrieval, and an interface that simplifies the execution of those functions. The thesis includes a DIS VCR-compatible design for concurrent replay of audio extracted from signal PDUs and an extension to the replay design that supports unmodifiable rendering or receiving applications. For variable-speed replays, the authors created a scalable simulation clock and a new PDU (the Replay PDU). Applications modified for replays use the simulation clock to govern their dead reckoning algorithms while the DIS VCR uses it to control the timed release of stored PDUs. The Replay PDU communicates mode and speed changes between the DIS VCR and replay-modified applications. The DIS VCR's full functionality was successfully demonstrated at the 1994 AFA convention.

  20. A translation-coupling DNA cassette for monitoring protein translation in Escherichia coli.


    Mendez-Perez, Daniel; Gunasekaran, Suman; Orler, Victor J; Pfleger, Brian F


    A major challenge to using heterologous expression in metabolic engineering experiments is the inability to quickly dissect experiments that have failed at the stage of translating mRNA. While many methods of detecting proteins exist, methods that detect untagged proteins at low levels are limited. Here, we describe a method to quickly determine whether Escherichia coli is capable of expressing the product of any target gene by coupling translation of a target gene to a detectable response gene. A translational coupling cassette was designed to encode a mRNA sequence that forms a secondary structure in the absence of translation and contains the translational start sequence of a detectable response gene. The translational coupling method was successfully tested with fluorescent proteins and antibiotic resistance markers. Only when the target gene was fully translated was the response observed. Further characterization demonstrated that translational coupling functions at both low and high levels of expression and that the response signal is proportional to the amount of target gene product. The translational coupling system was used to determine that a large multi-domain enzyme was not actively translated in E. coli, to isolate the translation problems to the C-terminal domains, and to optimize conditions for expressing a codon-optimized sequence variant.

  1. The effects on hearing from portable cassette players: A follow-up study

    NASA Astrophysics Data System (ADS)

    Hellström, P. A.


    The high-frequency hearing loss (3-8 kHz) in 230 male and 238 female subjects (age 16) was compared concerning their habits of listening to portable cassette players (PCPs). In the group that listened to PCPs daily, we found fewer subjects with high-frequency hearing loss compared to the group that never listened to PCPs. In a temporary threshold shift (TTS) study, three groups of subjects with different listening habits to music were exposed to {1}/{3} octave band noise (2 kHz). These groups participated in a TTS study on another occasion, on which they listened to music from PCPs at a high but comfortable level for 1 hour. Together with the music exposure, the sound pressure level ( SPL) was measured in the external auditory canal with a probe-provided mini-microphone (MMP). There was no significant difference in TTS between groups from the noise exposure. There were significant differences in listening levels and in the resulting TTS between groups. The noise exposure resulted in significantly higher TTS than the music exposure at comparable exposure levels.

  2. Patients' preferences for video cassette recorded information: effect of age, sex and ethnic group.


    Thomas, R; Deary, A; Kaminski, E; Stockton, D; De Zueew, N


    The emotional turmoil patients endure following a diagnosis of cancer can impair their ability to retain complex treatment-related information. Manoeuvres which increase the intensity of information have been shown to increase the amount retained. Providing details of treatment in a video format is one method of intensifying information provision, but the attitudes of patients to this format have not previously been evaluated. In this pilot study, the attitudes of 300 patients to video directed information were evaluated via questionnaires, of which 210 (70%) were returned. Eighty-nine per cent had easy access to a video cassette player. A highly significant number felt that the video would be very helpful or helpful (78%) compared to not helpful, worrying or equivocal 21% (P < 0.0001). This trend was particularly strong in patients < 60 years (83% versus 17%) (P < 0.0001) and those from ethnic groups (95% versus 5%) (P < 0.0001). As a result of this trial, a 20-min film (HEP) has been commissioned. It describes details of the two main treatments for cancer after surgery, namely chemotherapy and radiotherapy, shows patients actually having treatment, and explains the common side-effects and ways to alleviate them. Patients satisfaction with the film and its effect on anxiety and depression are currently being evaluated in an international prospective randomized trial. If it proves advantageous for patients--in view of the ethnic group bias in this study--it will be translated into the ethnic languages of the UK.

  3. Energy use of televisions and video cassette recorders in the U.S.

    SciTech Connect

    Meier, Alan; Rosen, Karen


    In an effort to more accurately determine nationwide energy consumption, the U.S. Department of Energy has recently commissioned studies with the goal of improving its understanding of the energy use of appliances in the miscellaneous end-use category. This study presents an estimate of the residential energy consumption of two of the most common domestic appliances in the miscellaneous end-use category: color televisions (TVs) and video cassette recorders (VCRs). The authors used a bottom-up approach in estimating national TV and VCR energy consumption. First, they obtained estimates of stock and usage from national surveys, while TV and VCR power measurements and other data were recorded at repair and retail shops. Industry-supplied shipment and sales distributions were then used to minimize bias in the power measurement samples. To estimate national TV and VCR energy consumption values, ranges of power draw and mode usage were created to represent situations in homes with more than one unit. Average energy use values for homes with one unit, two units, etc. were calculated and summed to provide estimates of total national TV and VCR energy consumption.

  4. Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange

    PubMed Central

    Kelton, William; Waindok, Ann Cathrin; Pesch, Theresa; Pogson, Mark; Ford, Kyle; Parola, Cristina; Reddy, Sai T.


    The development of programmable nucleases has enabled the application of new genome engineering strategies for cellular immunotherapy. While targeted nucleases have mostly been used to knock-out or knock-in genes in immune cells, the scarless exchange of entire immunogenomic alleles would be of great interest. In particular, reprogramming the polymorphic MHC locus could enable the creation of matched donors for allogeneic cellular transplantation. Here we show a proof-of-concept for reprogramming MHC-specificity by performing CRISPR-Cas9-assisted cassette exchange. Using murine antigen presenting cell lines (RAW264.7 macrophages), we demonstrate that the generation of Cas9-induced double-stranded breaks flanking the native MHC-I H2-Kd locus led to exchange of an orthogonal H2-Kb allele. MHC surface expression allowed for easy selection of reprogrammed cells by flow cytometry, thus obviating the need for additional selection markers. MHC-reprogrammed cells were fully functional as they could present H2-Kd-restricted peptide and activate cognate T cells. Finally, we investigated the role of various donor template formats on exchange efficiency, discovering that templates that underwent in situ linearization resulted in the highest MHC-reprogramming efficiency. These findings highlight a potential new approach for the correcting of MHC mismatches in cellular transplantation. PMID:28374766

  5. Plug-and-Play Genetic Access to Drosophila Cell Types Using Exchangeable Exon Cassettes

    PubMed Central

    Diao, Fengqiu; Ironfield, Holly; Luan, Haojiang; Diao, Feici; Shropshire, William C.; Ewer, John; Marr, Elizabeth; Potter, Christopher J.; Landgraf, Matthias; White, Benjamin H.


    Summary Genetically encoded effectors are important tools for probing cellular function in living animals, but improved methods for directing their expression to specific cell types are required. Here we introduce a simple, versatile method for achieving cell type-specific expression of transgenes that leverages the untapped potential of “coding introns” (i.e. introns between coding exons). Our method couples the expression of a transgene to that of a native gene expressed in the cells of interest using intronically inserted “plug-and-play” cassettes (called “Trojan exons”) that carry a splice acceptor site followed by the coding sequences of T2A peptide and an effector transgene. We demonstrate the efficacy of this approach in Drosophila using lines containing suitable MiMIC transposons and a palette of Trojan exons capable of expressing a range of commonly used transcription factors. We also introduce an exchangeable, MiMIC-like Trojan exon construct that can be targeted to coding introns using the Crispr/Cas system. PMID:25732830

  6. Charge-transfer contributions to the excitonic coupling matrix element in BODIPY-based energy transfer cassettes

    NASA Astrophysics Data System (ADS)

    Spiegel, J. Dominik; Lyskov, Igor; Kleinschmidt, Martin; Marian, Christel M.


    BODIPY-based dyads serve as model systems for the investigation of excitation energy transfer (EET). Through-space EET is brought about by direct and exchange interactions between the transition densities of donor and acceptor localized states. The presence of a molecular linker gives rise to additional charge transfer (CT) contributions. Here, we present a novel approach for the calculation of the excitonic coupling matrix element (ECME) including CT contributions which is based on supermolecular one-electron transition density matrices (STD). The validity of the approach is assessed for a model system of two π -stacked ethylene molecules at varying intermolecular separation. Wave functions and electronic excitation energies of five EET cassettes comprising anthracene as exciton donor and BODIPY as exciton acceptor are obtained by the redesigned combined density functional theory and multireference configuration interaction (DFT/MRCI-R) method. CT contributions to the ECME are shown to be important in the covalently linked EET cassettes.

  7. Recombinase-mediated cassette exchange (RMCE) and BAC engineering via VCre/VloxP and SCre/SloxP systems.


    Minorikawa, Sachiko; Nakayama, Manabu


    Site-specific recombination is a powerful biotechnological tool for genome engineering. We previously reported two novel site-specific recombination systems, VCre/VloxP and SCre/SloxP, that do not cross-react with Cre/loxP and Flp/FRT in culture cells and mouse embryonic stem (ES) cells. In this study, a site-specific recombination assay in Escherichia coli was used to examine the activity of mutant VCre (H314L and Y349F) and mutant SCre (H317L and Y352F), in which both mutated residues lie within the active center of Cre recombination. The site-specific recombination activity of both mutants was significantly decreased. Recombinase-mediated cassette exchange (RMCE) using VloxP and the Vlox2272 mutant site was performed in E. coli by introducing a cassette bearing VloxP and Vlox2272 into a recipient plasmid bearing the same sites. RMCE using SloxP and Slox2272 was also performed by SCre recombinase. Moreover, BAC engineering via Red recombination and VCre/VloxP were demonstrated. First, the DNA cassette for modification was introduced into a BAC clone via Red recombination; second, the antibiotics resistance gene flanked by VloxP was removed from the BAC clone by induction of VCre recombinase. Such site-specific recombination systems may effectively be used in combination with other site-specific recombination systems or engineering tools (e.g., Red recombination).

  8. An automated system to mount cryo-cooled protein crystals on a synchrotron beam line, using compact sample cassettes and a small-scale robot

    PubMed Central

    Cohen, Aina E.; Ellis, Paul J.; Miller, Mitchell D.; Deacon, Ashley M.; Phizackerley, R. Paul


    An automated system for mounting and dismounting pre-frozen crystals has been implemented at the Stanford Synchrotron Radiation Laboratory (SSRL). It is based on a small industrial robot and compact cylindrical cassettes, each holding up to 96 crystals mounted on Hampton Research sample pins. For easy shipping and storage, the cassette fits inside several popular dry-shippers and long-term storage Dewars. A dispensing Dewar holds up to three cassettes in liquid nitrogen adjacent to the beam line goniometer. The robot uses a permanent magnet tool to extract samples from, and insert samples into a cassette, and a cryo-tong tool to transfer them to and from the beam line goniometer. The system is simple, with few moving parts, reliable in operation and convenient to use. PMID:24899734

  9. The Cosmic Background Explorer

    NASA Technical Reports Server (NTRS)

    Gulkis, Samuel; Lubin, Philip M.; Meyer, Stephan S.; Silverberg, Robert F.


    The Cosmic Background Explorer (CBE), NASA's cosmological satellite which will observe a radiative relic of the big bang, is discussed. The major questions connected to the big bang theory which may be clarified using the CBE are reviewed. The satellite instruments and experiments are described, including the Differential Microwave Radiometer, which measures the difference between microwave radiation emitted from two points on the sky, the Far-Infrared Absolute Spectrophotometer, which compares the spectrum of radiation from the sky at wavelengths from 100 microns to one cm with that from an internal blackbody, and the Diffuse Infrared Background Experiment, which searches for the radiation from the earliest generation of stars.

  10. Berkeley Low Background Facility

    SciTech Connect

    Thomas, K. J.; Norman, E. B.; Smith, A. R.; Poon, A. W. P.; Chan, Y. D.; Lesko, K. T.


    The Berkeley Low Background Facility (BLBF) at Lawrence Berkeley National Laboratory (LBNL) in Berkeley, California provides low background gamma spectroscopy services to a wide array of experiments and projects. The analysis of samples takes place within two unique facilities; locally within a carefully-constructed, low background laboratory on the surface at LBNL and at the Sanford Underground Research Facility (SURF) in Lead, SD. These facilities provide a variety of gamma spectroscopy services to low background experiments primarily in the form of passive material screening for primordial radioisotopes (U, Th, K) or common cosmogenic/anthropogenic products; active screening via neutron activation analysis for U,Th, and K as well as a variety of stable isotopes; and neutron flux/beam characterization measurements through the use of monitors. A general overview of the facilities, services, and sensitivities will be presented. Recent activities and upgrades will also be described including an overview of the recently installed counting system at SURF (recently relocated from Oroville, CA in 2014), the installation of a second underground counting station at SURF in 2015, and future plans. The BLBF is open to any users for counting services or collaboration on a wide variety of experiments and projects.

  11. Nonthermal cosmic neutrino background

    NASA Astrophysics Data System (ADS)

    Chen, Mu-Chun; Ratz, Michael; Trautner, Andreas


    We point out that, for Dirac neutrinos, in addition to the standard thermal cosmic neutrino background (C ν B ), there could also exist a nonthermal neutrino background with comparable number density. As the right-handed components are essentially decoupled from the thermal bath of standard model particles, relic neutrinos with a nonthermal distribution may exist until today. The relic density of the nonthermal (nt) background can be constrained by the usual observational bounds on the effective number of massless degrees of freedom Neff and can be as large as nν nt≲0.5 nγ. In particular, Neff can be larger than 3.046 in the absence of any exotic states. Nonthermal relic neutrinos constitute an irreducible contribution to the detection of the C ν B and, hence, may be discovered by future experiments such as PTOLEMY. We also present a scenario of chaotic inflation in which a nonthermal background can naturally be generated by inflationary preheating. The nonthermal relic neutrinos, thus, may constitute a novel window into the very early Universe.

  12. China: Background Notes Series.

    ERIC Educational Resources Information Center

    Reams, Joanne Reppert

    Concise background information on the People's Republic of China is provided. The publication begins with a profile of the country, outlining the people, geography, economy, and membership in international organizations. The bulk of the document then discusses in more detail China's people, geography, history, government, education, economy, and…

  13. Building Background Knowledge

    ERIC Educational Resources Information Center

    Fisher, Douglas; Ross, Donna; Grant, Maria


    Too often, students enter our classrooms with insufficient knowledge of physical science. As a result, they have a difficult time understanding content in texts, lectures, and laboratory activities. This lack of background knowledge can have an impact on their ability to ask questions and wonder--both key components of inquiry. In this article,…

  14. Sampling efficiency of modified 37-mm sampling cassettes using computational fluid dynamics.


    Anthony, T Renée; Sleeth, Darrah; Volckens, John


    In the U.S., most industrial hygiene practitioners continue to rely on the closed-face cassette (CFC) to assess worker exposures to hazardous dusts, primarily because ease of use, cost, and familiarity. However, mass concentrations measured with this classic sampler underestimate exposures to larger particles throughout the inhalable particulate mass (IPM) size range (up to aerodynamic diameters of 100 μm). To investigate whether the current 37-mm inlet cap can be redesigned to better meet the IPM sampling criterion, computational fluid dynamics (CFD) models were developed, and particle sampling efficiencies associated with various modifications to the CFC inlet cap were determined. Simulations of fluid flow (standard k-epsilon turbulent model) and particle transport (laminar trajectories, 1-116 μm) were conducted using sampling flow rates of 10 L min(-1) in slow moving air (0.2 m s(-1)) in the facing-the-wind orientation. Combinations of seven inlet shapes and three inlet diameters were evaluated as candidates to replace the current 37-mm inlet cap. For a given inlet geometry, differences in sampler efficiency between inlet diameters averaged less than 1% for particles through 100 μm, but the largest opening was found to increase the efficiency for the 116 μm particles by 14% for the flat inlet cap. A substantial reduction in sampler efficiency was identified for sampler inlets with side walls extending beyond the dimension of the external lip of the current 37-mm CFC. The inlet cap based on the 37-mm CFC dimensions with an expanded 15-mm entry provided the best agreement with facing-the-wind human aspiration efficiency. The sampler efficiency was increased with a flat entry or with a thin central lip adjacent to the new enlarged entry. This work provides a substantial body of sampling efficiency estimates as a function of particle size and inlet geometry for personal aerosol samplers.

  15. Comprehensive evaluation of formulation factors for ocular penetration of fluoroquinolones in rabbits using cassette dosing technique

    PubMed Central

    Sharma, Charu; Biswas, Nihar R; Ojha, Shreesh; Velpandian, Thirumurthy


    Objective Corneal permeability of drugs is an important factor used to assess the efficacy of topical preparations. Transcorneal penetration of drugs from aqueous formulation is governed by various physiological, physiochemical, and formulation factors. In the present study, we investigated the effect of formulation factors like concentration, pH, and volume of instillation across the cornea using cassette dosing technique for ophthalmic fluoroquinolones (FQs). Materials and methods Sterile cocktail formulations were prepared using four congeneric ophthalmic FQs (ofloxacin, sparfloxacin, pefloxacin mesylate, and gatifloxacin) at concentrations of 0.025%, 0.5%, and 0.1%. Each formulation was adjusted to different pH ranges (4.5, 7.0, and 8.0) and assessed for transcorneal penetration in vivo in rabbit’s cornea (n=4 eyes) at three different volumes (12.5, 25, and 50 μL). Aqueous humor was aspirated through paracentesis after applying local anesthesia at 0, 5, 15, 30, 60, 120, and 240 minutes postdosing. The biosamples collected from a total of 27 groups were analyzed using liquid chromatography–tandem mass spectroscopy to determine transcorneal permeability of all four FQs individually. Results Increase in concentration showed an increase in penetration up to 0.05%; thereafter, the effect of concentration was found to be dependent on volume of instillation as we observed a decrease in transcorneal penetration. The highest transcorneal penetration of all FQs was observed at pH 7.0 at concentration 0.05% followed by 0.025% at pH 4.5. Lastly, increasing the volume of instillation from 12.5 to 50 μL showed a significant fall in transcorneal penetration. Conclusion The study concludes that formulation factors showed discernible effect on transcorneal permeation; therefore, due emphasis should be given on drug development and design of ophthalmic formulation. PMID:26955263

  16. Population dynamics and current-generation mechanisms in cassette-electrode microbial fuel cells.


    Watanabe, Kazuya; Miyahara, Morio; Shimoyama, Takefumi; Hashimoto, Kazuhito


    Cassette-electrode microbial fuel cells (CE-MFCs) have been demonstrated useful to treat biomass wastes and recover electric energy from them. In order to reveal electricity-generation mechanisms in CE-MFCs, the present study operated a bench-scale reactor (1 l in capacity; approximately 1,000 cm(2) in anode and cathode areas) for treating a high-strength model organic wastewater (comprised of starch, peptone, and fish extract). Approximately 1 month was needed for the bench reactor to attain a stable performance, after which volumetric maximum power densities persisted between 120 and 150 mW/l throughout the experiment (for over 2 months). Temporal increases in the external resistance were found to induce subsequent increases in power outputs. After electric output became stable, electrolyte and anode were sampled from the reactor for evaluating their current-generation abilities; it was estimated that most of current (over 80%) was generated by microbes in the electrolyte. Cyclic voltammetry of an electrolyte supernatant detected several electron shuttles with different standard redox potentials at high concentrations (equivalent to or more than 100 μM 5-hydroxy-1,4-naphthoquinone). Denaturing gradient gel electrophoresis and quantitative real-time PCR of 16S ribosomal RNA gene fragments showed that bacteria related to the genus Dysgonomonas occurred abundantly in association with the increases in power outputs. These results suggest that mediated electron transfer was the main mechanism for electricity generation in CE-MFC, where high-concentration electron shuttles and Dysgonomonas bacteria played important roles.

  17. Comparison of lead and tin concentrations in air at a solder manufacturer from the closed-face 37-mm cassette with and without a custom cellulose-acetate cassette insert.


    Lee, Eun Gyung; Chisholm, William P; Burns, Dru A; Nelson, John H; Kashon, Michael L; Harper, Martin


    A polyvinyl chloride (PVC) cassette insert with PVC filter (ACCU-CAP) in a 37-mm closed-face cassette (CFC) was designed for gravimetric analysis. A customized version of the ACCU-CAP, also to be used in the CFC, was manufactured from an acid-digestible cellulose-acetate cassette insert joined to a mixed cellulose ester (MCE) filter for wet chemical analysis. The aim of this study was to compare metal particle concentrations as sampled by the customized insert (CI) in a CFC sampler with the traditional sampling method using only a MCE filter in the CFC. Thirty-nine personal and 13 area samples were taken using paired filter-based CFC and the CI in CFC samplers at a solder manufacturing plant. The CI was removed from its CFC, and digested and analyzed as a whole. The MCE filter from the typical CFC was removed for analysis and then the interior of the cassette was wiped with Ghost Wipe for a separate analysis. The MCE filter only, Ghost Wipe, and CI were separately dissolved in heated nitric acid for ICP-MS analysis. Overall, the geometric mean concentration of the filter-only (FO) samples was considerably lower than that of the CI samples, by 53% for lead and 32% for tin. However, if the FO analysis was added to the corresponding Ghost Wipe analysis, i.e., filter+interior wipe (FW), the geometric mean concentrations of the FW results were similar to those of the CI results (by 113% for lead and 98% for tin). For both lead and tin the comparison of (log-transformed) metal concentrations between the FW and CI results showed no statistically significant difference (p-value = 0.3009 for lead and 0.800 for tin), while the comparison between the FO and CI results shows statistically significant differences (all p-values < 0.05). In conclusion, incorporating the sampler internal non-filter deposits by wiping or use of an internal filter capsule gave higher results than analyzing only the filter. Close agreement between the two methods of including non-filter deposits is

  18. Ultraviolet Background Radiation (Preprint)

    DTIC Science & Technology


    5.4 Apollo-Soyuz 3 5 5.5 Evidence for Scattering From Dust ? 3 8 5.6 More Evidence For Scattering From Dust ? 4 0 5.7 More Observations 4 2...Emission from cold interstellar dust . This has been observed by IRAS as the 100 u.m cosmic cirrus (64). The existence of such dust at moderate and... DUST 4 6 CONCLUSIONS 4 7 6.1 Spectral Structure in the Diffuse 4 7 Ultraviolet Background 6.2 Is There Light Scattered From Dust ? 4 7 6.3

  19. Cosmic Background Radiation

    NASA Astrophysics Data System (ADS)

    Sidharth, B. G.; Valluri, S. R.


    It is shown that a collection of photons with nearly the same frequency exhibits a "condensation" type of phenomenon corresponding to a peak intensity. The observed cosmic background radiation can be explained from this standpoint. We have obtained analogous results by extremization of the occupation number for photons with the use of the Lambert W function. Some of the interesting applications of this function are briefly discussed in the context of graphene which exhibits an interesting two dimensional structure with several characteristic properties and diverse practical applications.

  20. The Backgrounds Data Center

    NASA Technical Reports Server (NTRS)

    Snyder, W. A.; Gursky, H.; Heckathorn, H. M.; Lucke, R. L.; Berg, S. L.; Dombrowski, E. G.; Kessel, R. A.


    The Strategic Defense Initiative Organization has created data centers for midcourse, plumes, and backgrounds phenomenologies. The Backgrounds Data Center (BDC) has been designated as the prime archive for data collected by SDIO programs. The BDC maintains a Summary Catalog that contains 'metadata,' that is, information about data, such as when the data were obtained, what the spectral range of the data is, and what region of the Earth or sky was observed. Queries to this catalog result in a listing of all data sets (from all experiments in the Summary Catalog) that satisfy the specified criteria. Thus, the user can identify different experiments that made similar observations and order them from the BDC for analysis. On-site users can use the Science Analysis Facility (SAFE for this purpose. For some programs, the BDC maintains a Program Catalog, which can classify data in as many ways as desired (rather than just by position, time, and spectral range as in the Summary Catalog). For example, data sets could be tagged with such diverse parameters as solar illumination angle, signal level, or the value of a particular spectral ratio, as long as these quantities can be read from the digital record or calculated from it by the ingest program. All unclassified catalogs and unclassified data will be remotely accessible.

  1. Extragalactic Backgrounds after Planck

    NASA Astrophysics Data System (ADS)

    Dore, Olivier

    Among the potentially most important results of cosmology in the last decade is the realization that the star formation rate at redshifts greater than 1 is higher than at present by about an order of magnitude, and that half of the energy produced since the surface of last scattering has been absorbed and reemitted by dust. Most of the light produced by stars at high redshifts thus reaches us in the far infrared. This radiation is referred to as the cosmic infrared background (CIB) and is emitted primarily by dusty, star-forming galaxies at redshift z=1-4. Embedded in far infrared emission of the CIB is the history of star formation, dust production, and the growth of large scale structures. Our research project aims at shedding new light on several extragalactic backgrounds investigated by NASA surveys, in light of recent observational progresses in mapping the CIB. Most lately, two new missions, Planck and Herschel, released ground-breaking measurements of the CIB. These measurements are an order of magnitude deeper and wider than previous ones, and they are literally revolutionizing the field. Our understanding of these data is now advanced enough for us to leverage our measurement of the CIB in Planck and Herschel, in order to extract new scientific insights from past missions. We propose to combine Planck and Herschel public data with archival data from WISE, GALEX, Chandra and Fermi. Not only original, the impact of our research project should be immediate. Using the CIB as a full sky, bright, high redshift reference extragalactic background, we will exploit the underlying physical connection among these various cosmological datasets. We expect new insights about the CIB, but also about the multiple extragalactic backgrounds probed in combination with it. In particular, we will investigate the cosmic star formation history at a period where it peaks, and because the clustering of matter is driven by dark matter, the measurement of the CIB clustering also

  2. Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette.


    Szewczyk, Edyta; Kasuga, Takao; Fan, Zhiliang


    Despite its long-standing history as a model organism, Neurospora crassa has limited tools for repetitive gene deletions utilizing recyclable self-excising marker systems. Here we describe, for the first time, the functionality of a bacterial recombination system employing β-recombinase acting on six recognition sequences (β-rec/six) in N. crassa, which allowed repetitive site-specific gene deletion and marker recycling. We report generating the mus-51 deletion strain using this system, recycling the marker cassette, and subsequently deleting the global transcriptional regulator gene cre-1.

  3. Efficiency of integron cassette insertion in correct orientation is ensured by the interplay of the three unpaired features of attC recombination sites

    PubMed Central

    Nivina, Aleksandra; Escudero, José Antonio; Vit, Claire; Mazel, Didier; Loot, Céline


    The integron is a bacterial recombination system that allows acquisition, stockpiling and expression of cassettes carrying protein-coding sequences, and is responsible for the emergence and rise of multiresistance in Gram-negative bacteria. The functionality of this system depends on the insertion of promoterless cassettes in correct orientation, allowing their expression from the promoter located upstream of the cassette array. Correct orientation is ensured by strand selectivity of integron integrases for the bottom strand of cassette recombination sites (attC), recombined in form of folded single-stranded hairpins. Here, we investigated the basis of such strand selectivity by comparing recombination of wild-type and mutated attC sites with different lengths, sequences and structures. We show that all three unpaired structural features that distinguish the bottom and top strands contribute to strand selectivity. The localization of Extra-Helical Bases (EHBs) directly favors integrase binding to the bottom strand. The Unpaired Central Spacer (UCS) and the Variable Terminal Structure (VTS) influence strand selectivity indirectly, probably through the stabilization of the bottom strand and the resulting synapse due to the nucleotide skew between the two strands. These results underscore the importance of the single-stranded nature of the attC site that allows such tight control over integron cassette orientation. PMID:27496283

  4. Coupling between ATP Binding and DNA Cleavage by DNA Topoisomerase II

    PubMed Central

    Mueller-Planitz, Felix; Herschlag, Daniel


    DNA topoisomerase II is a molecular machine that couples ATP hydrolysis to the transport of one DNA segment through a transient break in another segment. To learn about the energetic connectivity that underlies this coupling, we investigated how the ATPase domains exert control over DNA cleavage. We dissected the DNA cleavage reaction by measuring rate and equilibrium constants for the individual reaction steps utilizing defined DNA duplexes in the presence and absence of the nonhydrolyzable ATP analog 5′-adenylyl-β,γ-imidodiphosphate (AMPPNP). Our results revealed the existence of two enzyme conformations whose relative abundance is sensitive to the presence of nucleotides. The predominant species in the absence of nucleotides binds DNA at a diffusion limited rate but cannot efficiently cleave DNA. In the presence of AMPPNP, most of the enzyme is converted to a state in which DNA binding and release is extremely slow but which allows DNA cleavage. A minimal kinetic and thermodynamic framework is established that accounts for the cooperativity of cleavage of the two DNA strands in the presence and absence of bound AMPPNP and includes conformational steps revealed in the kinetic studies. The model unifies available kinetic, thermodynamic, and structural data to provide a description for the reaction in terms of the order and rate of individual reaction steps and the physical nature of the species on the reaction path. Furthermore, this reaction framework provides a foundation for a future in-depth analysis of energy transduction by topoisomerase II, for guiding and interpreting future structural studies, and for analyzing the mechanism of drugs that convert topoisomerase into a cellular poison. PMID:18403371

  5. The Streptomyces ATP-binding component MsiK assists in cellobiose and maltose transport.

    PubMed Central

    Schlösser, A; Kampers, T; Schrempf, H


    Streptomyces reticuli harbors an msiK gene which encodes a protein with an amino acid identify of 90% to a corresponding protein previously identified in Streptomyces lividans. Immunological studies revealed that S. lividans and S. reticuli synthesize their highest levels of MsiK during growth with cellobiose, but not with glucose. Moreover, moderate amounts of MsiK are produced by both species in the course of growth with maltose, melibiose, and xylose and by S. lividans in the presence of xylobiose and raffinose. In contrast, a recently identified cellobiose-binding protein and its distantly related homolog were only found if S. reticuli or S. lividans, respectively, was cultivated with cellobiose. Uptake of cellobiose and maltose was tested and ascertained for S. reticuli and S. lividans, but not for an msiK S. lividans mutant. However, transformants of this mutant carrying the S. reticuli or S. lividans msiK gene on a multicopy plasmid had regained the ability to transport both sugars. The data show that MsiK assists two ABC transport systems. PMID:9068663

  6. Coordinating Role of His216 in MgATP Binding and Cleavage in Pyruvate Carboxylase

    PubMed Central


    His216 is a well-conserved residue in pyruvate carboxylases and, on the basis of structures of the enzyme, appears to have a role in the binding of MgATP, forming an interaction with the 3′-hydroxyl group of the ribose ring. Mutation of this residue to asparagine results in a 9-fold increase in the Km for MgATP in its steady-state cleavage in the absence of pyruvate and a 3-fold increase in the Km for MgADP in its steady-state phosphorylation by carbamoyl phosphate. However, from single-turnover experiments of MgATP cleavage, the Kd of the enzyme·MgATP complex is essentially the same in the wild-type enzyme and H216N. Direct stopped-flow measurements of nucleotide binding and release using the fluorescent analogue FTP support these observations. However, the first-order rate constant for MgATP cleavage in the single-turnover experiments in H216N is only 0.75% of that for the wild-type enzyme, and thus, the MgATP cleavage step is rate-limiting in the steady state for H216N but not for the wild-type enzyme. Close examination of the structure of the enzyme suggested that His216 may also interact with Glu218, which in turn interacts with Glu305 to form a proton relay system involved in the deprotonation of bicarbonate. Single-turnover MgATP cleavage experiments with mutations of these two residues resulted in kinetic parameters similar to those observed in H216N. We suggest that the primary role of His216 is to coordinate the binding of MgATP and the deprotonation of bicarbonate in the reaction to form the putative carboxyphosphate intermediate by participation in a proton relay system involving Glu218 and Glu305. PMID:24460480

  7. Probing the ATP-Binding Pocket of Protein Kinase DYRK1A with Benzothiazole Fragment Molecules.


    Rothweiler, Ulli; Stensen, Wenche; Brandsdal, Bjørn Olav; Isaksson, Johan; Leeson, Frederick Alan; Engh, Richard Alan; Svendsen, John S Mjøen


    DYRK1A has emerged as a potential target for therapies of Alzheimer's disease using small molecules. On the basis of the observation of selective DYRK1A inhibition by firefly d-luciferin, we have explored static and dynamic structural properties of fragment sized variants of the benzothiazole scaffold with respect to DYRK1A using X-ray crystallography and NMR techniques. The compounds have excellent ligand efficiencies and show a remarkable diversity of binding modes in dynamic equilibrium. Binding geometries are determined in part by interactions often considered "weak", including "orthogonal multipolar" types represented by, for example, F-CO, sulfur-aromatic, and halogen-aromatic interactions, together with hydrogen bonds that are modulated by variation of electron withdrawing groups. These studies show how the benzothiazole scaffold is highly promising for the development of therapeutic DYRK1A inhibitors. In addition, the subtleties of the binding interactions, including dynamics, show how full structural studies are required to fully interpret the essential physical determinants of binding.

  8. Methicillin-Resistant Staphylococcus aureus Isolated From Various Types of Hospital Infections in Pediatrics: Panton-Valentine Leukocidin, Staphylococcal Chromosomal Cassette mec SCCmec Phenotypes and Antibiotic Resistance Properties

    PubMed Central

    Dormanesh, Banafshe; Siroosbakhat, Soheila; Khodaverdi Darian, Ebrahim; Afsharkhas, Ladan


    Background: Staphylococcus aureus has long been considered as a major pathogen of hospital infections. Objectives: The present investigation was carried out to study the distribution of Staphylococcal Chromosomal Cassette mec (SCCmec) types, Panton-Valentine Leukocidin (PVL) gene and antibiotic resistance properties of Methicillin Resistant Staphylococcus aureus (MRSA) strains isolated from various types of infections found in Iranian pediatric patients. Patients and Methods: Two-hundred and fifty-five clinical specimens were collected from four major provinces of Iran. Samples were cultured and the MRSA strains were subjected to Polymerase Chain Reaction (PCR). The patterns of antibiotic resistance were determined using the disk diffusion method. Results: Seventy-four out of 255 (29.01%) clinical samples were positive for MRSA. Of the 74 MRSA strains, 47 (63.51%) were PVL positive. The clinical samples of respiratory tract infections (36.36%), those from the Shiraz province (37.87%) and samples collected during the summer season (56.48%) were the most commonly infected samples. The most commonly detected antibiotic resistance genes were tetK (89.18%), mecA (71.62%), msrA (56.75%) and tetM (54.05%). Methicillin Resistant Staphylococcus aureus had the highest levels of resistance against penicillin (100%), tetracycline (98.64%), ampicillin (93.24%) and oxacillin (93.24%). The most commonly detected SCCmec types in the MRSA strains were type V (18.91%) and III (17.56%). Conclusions: Regular surveillance of hospital-associated infections and monitoring of the antibiotic sensitivity patterns are required to reduce the prevalence of MRSA. We recommend initial management of children affected by MRSA with imipenem, lincomycin and cephalothin prescriptions. PMID:26862375

  9. The cosmic background explorer

    SciTech Connect

    Gulkis, G. ); Lubin, P.M. ); Meyer, S.S. ); Silverberg, R.F.


    Late last year the National Aeronautics and Space Administration launched its first satellite dedicated to the study of phenomena related to the origins of the universe. The satellite, called the Cosmic Background Explorer (COBE), carries three complementary detectors that will make fundamental measurements of the celestial radiation. Part of that radiation is believed to have originated in processes that occurred at the very dawn of the universe. By measuring the remnant radiation at wavelengths from one micrometer to one centimeter across the entire sky, scientists hope to be able to solve many mysteries regarding the origin and evolution of the early universe. Unfortunately, these radiative relics of the early universe are weak and veiled by local astrophysical and terrestrial sources of radiation. The wavelengths of the various cosmic components may also overlap, thereby making the understanding of the diffuse celestial radiation a challenge. Nevertheless, the COBE instruments, with their full-sky coverage, high sensitivity to a wide range of wavelengths and freedom from interference from the earth's atmosphere, will constitute for astrophysicists an observatory of unprecedented sensitivity and scope. The interesting cosmic signals will then be separated from one another and from noncosmic radiation sources by a comprehensive analysis of the data.

  10. Broad 4-Hydroxyphenylpyruvate Dioxygenase Inhibitor Herbicide Tolerance in Soybean with an Optimized Enzyme and Expression Cassette[W][OPEN

    PubMed Central

    Siehl, Daniel L.; Tao, Yumin; Albert, Henrik; Dong, Yuxia; Heckert, Matthew; Madrigal, Alfredo; Lincoln-Cabatu, Brishette; Lu, Jian; Fenwick, Tamara; Bermudez, Ericka; Sandoval, Marian; Horn, Caroline; Green, Jerry M.; Hale, Theresa; Pagano, Peggy; Clark, Jenna; Udranszky, Ingrid A.; Rizzo, Nancy; Bourett, Timothy; Howard, Richard J.; Johnson, David H.; Vogt, Mark; Akinsola, Goke; Castle, Linda A.


    With an optimized expression cassette consisting of the soybean (Glycine max) native promoter modified for enhanced expression driving a chimeric gene coding for the soybean native amino-terminal 86 amino acids fused to an insensitive shuffled variant of maize (Zea mays) 4-hydroxyphenylpyruvate dioxygenase (HPPD), we achieved field tolerance in transgenic soybean plants to the HPPD-inhibiting herbicides mesotrione, isoxaflutole, and tembotrione. Directed evolution of maize HPPD was accomplished by progressively incorporating amino acids from naturally occurring diversity and novel substitutions identified by saturation mutagenesis, combined at random through shuffling. Localization of heterologously expressed HPPD mimicked that of the native enzyme, which was shown to be dually targeted to chloroplasts and the cytosol. Analysis of the native soybean HPPD gene revealed two transcription start sites, leading to transcripts encoding two HPPD polypeptides. The N-terminal region of the longer encoded peptide directs proteins to the chloroplast, while the short form remains in the cytosol. In contrast, maize HPPD was found almost exclusively in chloroplasts. Evolved HPPD enzymes showed insensitivity to five inhibitor herbicides. In 2013 field trials, transgenic soybean events made with optimized promoter and HPPD variant expression cassettes were tested with three herbicides and showed tolerance to four times the labeled rates of mesotrione and isoxaflutole and two times the labeled rates of tembotrione. PMID:25192697

  11. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus.


    Ito, T; Katayama, Y; Asada, K; Mori, N; Tsutsumimoto, K; Tiensasitorn, C; Hiramatsu, K


    The beta-lactam resistance gene mecA of Staphylococcus aureus is carried by a novel mobile genetic element, designated staphylococcal cassette chromosome mec (SCCmec), identified in the chromosome of a Japanese methicillin-resistant S. aureus (MRSA) strain. We now report identification of two additional types of mecA-carrying genetic elements found in the MRSA strains isolated in other countries of the world. There were substantial differences in the size and nucleotide sequences between the elements and the SCCmec. However, new elements shared the chromosomal integration site with the SCCmec. Structural analysis of the new elements revealed that they possessed all of the salient features of the SCCmec: conserved terminal inverted repeats and direct repeats at the integration junction points, conserved genetic organization around the mecA gene, and the presence of cassette chromosome recombinase (ccr) genes responsible for the movements of SCCmec. The elements, therefore, were considered to comprise the SCCmec family of staphylococcal mobile genetic elements together with the previously identified SCCmec. Among 38 epidemic MRSA strains isolated in 20 countries, 34 were shown to possess one of the three typical SCCmec elements on the chromosome. Our findings indicated that there are at least three distinct MRSA clones in the world with different types of SCCmec in their chromosome.

  12. Integrable Background Geometries

    NASA Astrophysics Data System (ADS)

    Calderbank, David M. J.


    This work has its origins in an attempt to describe systematically the integrable geometries and gauge theories in dimensions one to four related to twistor theory. In each such dimension, there is a nondegenerate integrable geometric structure, governed by a nonlinear integrable differential equation, and each solution of this equation determines a background geometry on which, for any Lie group G, an integrable gauge theory is defined. In four dimensions, the geometry is selfdual conformal geometry and the gauge theory is selfdual Yang-Mills theory, while the lower-dimensional structures are nondegenerate (i.e., non-null) reductions of this. Any solution of the gauge theory on a k-dimensional geometry, such that the gauge group H acts transitively on an ℓ-manifold, determines a (k+ℓ)-dimensional geometry (k+ℓ≤4) fibering over the k-dimensional geometry with H as a structure group. In the case of an ℓ-dimensional group H acting on itself by the regular representation, all (k+ℓ)-dimensional geometries with symmetry group H are locally obtained in this way. This framework unifies and extends known results about dimensional reductions of selfdual conformal geometry and the selfdual Yang-Mills equation, and provides a rich supply of constructive methods. In one dimension, generalized Nahm equations provide a uniform description of four pole isomonodromic deformation problems, and may be related to the {SU}(∞) Toda and dKP equations via a hodograph transformation. In two dimensions, the {Diff}(S^1) Hitchin equation is shown to be equivalent to the hyperCR Einstein-Weyl equation, while the {SDiff}(Σ^2) Hitchin equation leads to a Euclidean analogue of Plebanski's heavenly equations. In three and four dimensions, the constructions of this paper help to organize the huge range of examples of Einstein-Weyl and selfdual spaces in the literature, as well as providing some new ! ones. The nondegenerate reductions have a long ancestry. More ! recently

  13. Enhanced Grain Iron Levels in Rice Expressing an IRON-REGULATED METAL TRANSPORTER, NICOTIANAMINE SYNTHASE, and FERRITIN Gene Cassette

    PubMed Central

    Boonyaves, Kulaporn; Wu, Ting-Ying; Gruissem, Wilhelm; Bhullar, Navreet K.


    Micronutrient malnutrition is widespread, especially in poor populations across the globe, and iron deficiency anemia is one of the most prevalent forms of micronutrient deficiencies. Iron deficiency anemia has severe consequences for human health, working ability, and quality of life. Several interventions including iron supplementation and food fortification have been attempted and met with varied degrees of success. Rice, which is a staple food for over half of the world’s population, is an important target crop for iron biofortification. The genetic variability of iron content in the rice germplasm is very narrow, and thus, conventional breeding has not been successful in developing high iron rice varieties. Therefore, genetic engineering approaches have targeted at increasing iron uptake, translocation, and storage in the rice endosperm. We previously reported that AtIRT1, when expressed together with AtNAS1 and PvFERRITIN (PvFER) in high-iron (NFP) rice, has a synergistic effect of further increasing the iron concentration of polished rice grains. We have now engineered rice expressing AtIRT1, AtNAS1, and PvFER as a single locus gene cassette and compared the resulting lines with transgenic lines expressing AtIRT1 and PvFER gene cassettes. We also evaluated the efficacies of the MsENOD12B and native AtIRT1 promoters for the expression of AtIRT1 in rice in both types of gene cassettes, and found the native AtIRT1 promoter to be a better choice for driving the AtIRT1 expression in our biofortification strategy. All the single insertion transgenic lines have significant increases of iron concentration, both in polished and unpolished grains, but the concerted expression of AtIRT1, AtNAS1, and PvFER resulted to be a more effective strategy in achieving the highest iron increases of up to 10.46 μg/g dry weight. Furthermore, the transformed high iron lines grew better under iron deficiency growth conditions and also have significantly increased grain zinc

  14. A comparative proteomic study identified LRPPRC and MCM7 as putative actors in imatinib mesylate cross-resistance in Lucena cell line

    PubMed Central


    Background Although chronic myeloid leukemia (CML) treatment has improved since the introduction of imatinib mesylate (IM), cases of resistance have been reported. This resistance has been associated with the emergence of multidrug resistance (MDR) phenotype, as a BCR-ABL independent mechanism. The classic pathway studied in MDR promotion is ATP-binding cassette (ABC) family transporters expression, but other mechanisms that drive drug resistance are largely unknown. To better understand IM therapy relapse due to the rise of MDR, we compared the proteomic profiles of K562 and Lucena (K562/VCR) cells. Results The use of 2-DE coupled with a MS approach resulted in the identification of 36 differentially expressed proteins. Differential mRNA levels of leucine-rich PPR motif-containing (LRPPRC) protein, minichromosome maintenance complex component 7 (MCM7) and ATP-binding cassette sub-family B (MDR/TAP) member 1 (ABCB1) were capable of defining samples from CML patients as responsive or resistant to therapy. Conclusions Through the data presented in this work, we show the relevance of MDR to IM therapy. In addition, our proteomic approach identified candidate actors involved in resistance, which could lead to additional information on BCR-ABL-independent molecular mechanisms. PMID:22458888

  15. Characterization of a Novel Composite Staphylococcal Cassette Chromosome mec in Methicillin-Resistant Staphylococcus pseudintermedius from Thailand.


    Chanchaithong, Pattrarat; Prapasarakul, Nuvee; Perreten, Vincent; Schwendener, Sybille


    A novel staphylococcal cassette chromosome mec (SCCmec) composite island (SCCmecAI16-SCCczrAI16-CI) was identified in Staphylococcus pseudintermedius. Four integration site sequences for SCC subdivided the 60,734-bp island into 41,232-bp SCCmecAI16, 19,400-bp SCCczrAI16, and 102-bp SCC-likeAI16 elements. SCCmecAI16 represents a new combination of ccrA1B3 genes with a class A mec complex. SCCczrAI16 contains ccrA1B6 and genes related to restriction modification and heavy metal resistance. SCCmecAI16-SCCczrAI16-CI was found in methicillin-resistant S. pseudintermedius sequence type 112 (ST112) and ST111 isolated from dogs and veterinarians in Thailand.

  16. Characterization of a Novel Composite Staphylococcal Cassette Chromosome mec in Methicillin-Resistant Staphylococcus pseudintermedius from Thailand

    PubMed Central

    Chanchaithong, Pattrarat; Prapasarakul, Nuvee; Schwendener, Sybille


    A novel staphylococcal cassette chromosome mec (SCCmec) composite island (SCCmecAI16-SCCczrAI16-CI) was identified in Staphylococcus pseudintermedius. Four integration site sequences for SCC subdivided the 60,734-bp island into 41,232-bp SCCmecAI16, 19,400-bp SCCczrAI16, and 102-bp SCC-likeAI16 elements. SCCmecAI16 represents a new combination of ccrA1B3 genes with a class A mec complex. SCCczrAI16 contains ccrA1B6 and genes related to restriction modification and heavy metal resistance. SCCmecAI16-SCCczrAI16-CI was found in methicillin-resistant S. pseudintermedius sequence type 112 (ST112) and ST111 isolated from dogs and veterinarians in Thailand. PMID:26643350

  17. Remote detection of human toxicants in real time using a human-optimized, bioluminescent bacterial luciferase gene cassette bioreporter

    NASA Astrophysics Data System (ADS)

    Close, Dan; Webb, James; Ripp, Steven; Patterson, Stacey; Sayler, Gary


    Traditionally, human toxicant bioavailability screening has been forced to proceed in either a high throughput fashion using prokaryotic or lower eukaryotic targets with minimal applicability to humans, or in a more expensive, lower throughput manner that uses fluorescent or bioluminescent human cells to directly provide human bioavailability data. While these efforts are often sufficient for basic scientific research, they prevent the rapid and remote identification of potentially toxic chemicals required for modern biosecurity applications. To merge the advantages of high throughput, low cost screening regimens with the direct bioavailability assessment of human cell line use, we re-engineered the bioluminescent bacterial luciferase gene cassette to function autonomously (without exogenous stimulation) within human cells. Optimized cassette expression provides for fully endogenous bioluminescent production, allowing continuous, real time monitoring of the bioavailability and toxicology of various compounds in an automated fashion. To access the functionality of this system, two sets of bioluminescent human cells were developed. The first was programed to suspend bioluminescent production upon toxicological challenge to mimic the non-specific detection of a toxicant. The second induced bioluminescence upon detection of a specific compound to demonstrate autonomous remote target identification. These cells were capable of responding to μM concentrations of the toxicant n-decanal, and allowed for continuous monitoring of cellular health throughout the treatment process. Induced bioluminescence was generated through treatment with doxycycline and was detectable upon dosage at a 100 ng/ml concentration. These results demonstrate that leveraging autonomous bioluminescence allows for low-cost, high throughput direct assessment of toxicant bioavailability.

  18. Integron-associated mobile gene cassettes code for folded proteins: the structure of Bal32a, a new member of the adaptable alpha+beta barrel family.


    Robinson, Andrew; Wu, Peter S-C; Harrop, Stephen J; Schaeffer, Patrick M; Dosztányi, Zsuzsanna; Gillings, Michael R; Holmes, Andrew J; Nevalainen, K M Helena; Stokes, H W; Otting, Gottfried; Dixon, Nicholas E; Curmi, Paul M G; Mabbutt, Bridget C


    The wide-ranging physiology and large genetic variability observed for prokaryotes is largely attributed, not to the prokaryotic genome itself, but rather to mechanisms of lateral gene transfer. Cassette PCR has been used to sample the integron/gene cassette metagenome from different natural environments without laboratory cultivation of the host organism, and without prior knowledge of any target protein sequence. Since over 90% of cassette genes are unrelated to any sequence in the current databases, it is not clear whether these genes code for folded functional proteins. We have selected a sample of eight cassette-encoded genes with no known homologs; five have been isolated as soluble protein products and shown by biophysical techniques to be folded. In solution, at least three of these proteins organise as stable oligomeric assemblies. The tertiary structure of one of these, Bal32a derived from a contaminated soil site, has been solved by X-ray crystallography to 1.8 A resolution. From the three-dimensional structure, Bal32a is found to be a member of the highly adaptable alpha+beta barrel family of transport proteins and enzymes. In Bal32a, the barrel cavity is unusually deep and inaccessible to solvent. Polar side-chains in its interior are reminiscent of catalytic sites of limonene-1,2-epoxide hydrolase and nogalonic acid methyl ester cyclase. These studies demonstrate the viability of direct sampling of mobile DNA as a route for the discovery of novel proteins.

  19. In situ cryopreservation of human embryonic stem cells in gas-permeable membrane culture cassettes for high post-thaw yield and good manufacturing practice.


    Amps, K J; Jones, M; Baker, D; Moore, H D


    The development of efficient and robust methods for the cryopreservation of human embryonic stem cells (hESCs) is important for the production of master and working cell banks for future clinical applications. Such methods must meet requirements of good manufacturing practice (GMP) and maintain genetic stability of the cell line. We investigated the culture of four Shef hESC lines in gas permeable 'culture cassettes' which met GMP compliance. hESCs adhered rapidly to the membrane and colonies displayed good proliferation and expansion. After 5-7 days of culture, hESCs were cryopreserved in situ using 10% dimethyl sulphoxide in foetal calf serum at approximately 1 degrees C/min. This method was compared with a control of standard flask culture and cryopreservation in vials. Post-thaw cassette culture displayed relative proliferation ratios (fold increase above flask/cryovial culture) of 114 (Shef 4), 8.2 (Shef 5), 195 (shef 6) and 17.5 (Shef 7). The proportion of cells expressing pluripotency markers after cryopreservation was consistently greater in cassette culture than for the control with the markers SSEA3 and SSEA4 exhibiting a significant increase (P> or =0.05). The efficiency of cell line culture in cassette was associated with the overall passage number of the cell line. The procedure enables cryopreservation of relatively large quantities of hESCs in situ, whilst returning high yields of viable, undifferentiated stem cells, thereby increasing capacity to scale up with greater efficacy.

  20. Background

    NASA Technical Reports Server (NTRS)


    An analysis was made of the UF6 fueled gas core reactor as a function of cavity reactor criticality and fluid mechanics tests, investigations of uranium optical emission spectra, and radiant heat transfer power plant studies. Data are also given on nuclear and thermodynamic cycle analysis.

  1. Diffuse Cosmic Infrared Background Radiation

    NASA Technical Reports Server (NTRS)

    Dwek, Eli


    The diffuse cosmic infrared background (CIB) consists of the cumulative radiant energy released in the processes of structure formation that have occurred since the decoupling of matter and radiation following the Big Bang. In this lecture I will review the observational data that provided the first detections and limits on the CIB, and the theoretical studies explaining the origin of this background. Finally, I will also discuss the relevance of this background to the universe as seen in high energy gamma-rays.

  2. Background reduction in cryogenic detectors

    SciTech Connect

    Bauer, Daniel A.; /Fermilab


    This paper discusses the background reduction and rejection strategy of the Cryogenic Dark Matter Search (CDMS) experiment. Recent measurements of background levels from CDMS II at Soudan are presented, along with estimates for future improvements in sensitivity expected for a proposed SuperCDMS experiment at SNOLAB.

  3. Lattice QCD in Background Fields

    SciTech Connect

    William Detmold, Brian Tiburzi, Andre Walker-Loud


    Electromagnetic properties of hadrons can be computed by lattice simulations of QCD in background fields. We demonstrate new techniques for the investigation of charged hadron properties in electric fields. Our current calculations employ large electric fields, motivating us to analyze chiral dynamics in strong QED backgrounds, and subsequently uncover surprising non-perturbative effects present at finite volume.

  4. Background events in microchannel plates

    NASA Technical Reports Server (NTRS)

    Siegmund, O. H. W.; Vallerga, J.; Wargelin, B.


    Measurements have been made to assess the characteristics and origins of background events in microchannel plates (MCPs). An overall background rate of about 0.4 events/sq cm persec has been achieved consistently for MCPs that have been baked and scrubbed. The temperature and gain of the MCPs are found to have no significant effect on the background rate. Detection of 1.46-MeV gamma rays from the MCP glass confirms the presence of K-40, with a concentration of 0.0007 percent, in MCP glass. It is shown that beta decay from K-40 is sufficient to cause the background rate and spectrum observed. Anticoincidence measurements indicate the the background rate caused by cosmic ray interactions is small (less than 0.016 events/sq cm per sec).

  5. Low background counting at the LBNL low background facility

    SciTech Connect

    Thomas, K. J.; Norman, E. B.; Smith, A. R.; Chan, Y. D.; Hurley, D. L.; Wang, B. S.


    The Low Background Facility (LBF) at the Lawrence Berkeley National Laboratory (LBNL) in Berkeley, California provides low background gamma spectroscopy services to end-users in two unique facilities: locally within a carefully-constructed, low background laboratory space; and a satellite underground station (600 m.w.e) in Oroville, CA. These facilities provide a variety of gamma spectroscopy services to low background experiments primarily in the form of passive material screening for primordial radioisotopes (U, Th, K) or common cosmogenic and anthropogenic products, as well as active screening via neutron activation analysis for specific applications. A general overview of the facilities, services, and capabilities will be discussed. Recent activities will also be presented, including the recent installation of a 3π muon veto at the surface facility, cosmogenic activation studies of TeO{sub 2} for CUORE, and environmental monitoring of Fukushima fallout.

  6. Aluminum as a source of background in low background experiments

    NASA Astrophysics Data System (ADS)

    Majorovits, B.; Abt, I.; Laubenstein, M.; Volynets, O.


    Neutrinoless double beta decay would be a key to understanding the nature of neutrino masses. The next generation of High Purity Germanium experiments will have to be operated with a background rate of better than 10 -5 counts/(kg y keV) in the region of interest around the Q-value of the decay. Therefore, so far irrelevant sources of background have to be considered. The metalization of the surface of germanium detectors is in general done with aluminum. The background from the decays of 22Na, 26Al, 226Ra and 228Th introduced by this metalization is discussed. It is shown that only a special selection of aluminum can keep these background contributions acceptable.

  7. Identification of the rate-determining process in the hepatic clearance of atorvastatin in a clinical cassette microdosing study.


    Maeda, K; Ikeda, Y; Fujita, T; Yoshida, K; Azuma, Y; Haruyama, Y; Yamane, N; Kumagai, Y; Sugiyama, Y


    Clearance of atorvastatin occurs through hepatic uptake by organic anion transporting polypeptides (OATPs) and subsequent metabolism by cytochrome P450 (CYP) 3A4. To demonstrate the relative importance of OATPs and CYP3A4 in the hepatic elimination of atorvastatin in vivo, a clinical cassette microdose study was performed. A cocktail consisting of a microdose of atorvastatin along with probe substrates for OATPs (pravastatin) and CYP3A4 (midazolam) was orally administered to eight healthy volunteers. The pharmacokinetics of this cocktail was observed at baseline, after an oral dose of 600 mg rifampicin (an inhibitor of OATPs), and after an intravenous dose of 200 mg itraconazole (a CYP3A4 inhibitor). Rifampicin increased the pravastatin dose-normalized area under the plasma concentration-time curve (AUC) (4.6-fold), and itraconazole significantly increased the midazolam dose-normalized AUC (1.7-fold). The atorvastatin dose-normalized AUC increased 12-fold when coadministered with rifampicin but did not change when coadministered with itraconazole. These results indicate that hepatic uptake via OATPs makes the dominant contribution to the hepatic elimination of atorvastatin at a subtherapeutic microdose.

  8. Comparison of efficiency between FLPe and Cre for recombinase-mediated cassette exchange in vitro and in adenovirus vector production.


    Takata, Yuki; Kondo, Saki; Goda, Naoki; Kanegae, Yumi; Saito, Izumu


    Cre and FLP recombinases mediate not only specific deletions and insertions, but also the recombinase-mediated cassette exchange (RMCE) reaction, which is used in cell biotechnology including ES cells and mouse genetics. However, comparison of efficiencies for Cre and FLP in RMCE has not been made. We here examined the detailed process of RMCE with Cre and FLP in vitro using mutant loxP 2272 and three mutant FRTs (FRT G, FRT H, and FRT F3) and then quantitatively compared the RMCE reactions in vitro. Interestingly, in the in vitro reactions, the RMCE efficiency of Cre reached a plateau level of approximately 5% and did not proceed further, whereas that of FLPe reached approximately 12-13%, showing that FLPe reached a higher level of efficiency than Cre possibly when they were supplied at a very high concentration. Moreover, we quantitatively compared the production efficiency of E1-deleted adenovirus vector using the RMCE method with Cre or FLP. The results showed that FLPe was again found more efficient than Cre in RMCE reaction. Thus, although Cre is considered more active than, or similar to, FLPe, it may not be necessarily true for RMCE reaction. Possible reasons explaining these results are discussed.

  9. Cre/lox-Recombinase-Mediated Cassette Exchange for Reversible Site-Specific Genomic Targeting of the Disease Vector, Aedes aegypti

    PubMed Central

    Häcker, Irina; Harrell II, Robert A.; Eichner, Gerrit; Pilitt, Kristina L.; O’Brochta, David A.; Handler, Alfred M.; Schetelig, Marc F.


    Site-specific genome modification (SSM) is an important tool for mosquito functional genomics and comparative gene expression studies, which contribute to a better understanding of mosquito biology and are thus a key to finding new strategies to eliminate vector-borne diseases. Moreover, it allows for the creation of advanced transgenic strains for vector control programs. SSM circumvents the drawbacks of transposon-mediated transgenesis, where random transgene integration into the host genome results in insertional mutagenesis and variable position effects. We applied the Cre/lox recombinase-mediated cassette exchange (RMCE) system to Aedes aegypti, the vector of dengue, chikungunya, and Zika viruses. In this context we created four target site lines for RMCE and evaluated their fitness costs. Cre-RMCE is functional in a two-step mechanism and with good efficiency in Ae. aegypti. The advantages of Cre-RMCE over existing site-specific modification systems for Ae. aegypti, phiC31-RMCE and CRISPR, originate in the preservation of the recombination sites, which 1) allows successive modifications and rapid expansion or adaptation of existing systems by repeated targeting of the same site; and 2) provides reversibility, thus allowing the excision of undesired sequences. Thereby, Cre-RMCE complements existing genomic modification tools, adding flexibility and versatility to vector genome targeting. PMID:28266580

  10. Cre/lox-Recombinase-Mediated Cassette Exchange for Reversible Site-Specific Genomic Targeting of the Disease Vector, Aedes aegypti.


    Häcker, Irina; Harrell Ii, Robert A; Eichner, Gerrit; Pilitt, Kristina L; O'Brochta, David A; Handler, Alfred M; Schetelig, Marc F


    Site-specific genome modification (SSM) is an important tool for mosquito functional genomics and comparative gene expression studies, which contribute to a better understanding of mosquito biology and are thus a key to finding new strategies to eliminate vector-borne diseases. Moreover, it allows for the creation of advanced transgenic strains for vector control programs. SSM circumvents the drawbacks of transposon-mediated transgenesis, where random transgene integration into the host genome results in insertional mutagenesis and variable position effects. We applied the Cre/lox recombinase-mediated cassette exchange (RMCE) system to Aedes aegypti, the vector of dengue, chikungunya, and Zika viruses. In this context we created four target site lines for RMCE and evaluated their fitness costs. Cre-RMCE is functional in a two-step mechanism and with good efficiency in Ae. aegypti. The advantages of Cre-RMCE over existing site-specific modification systems for Ae. aegypti, phiC31-RMCE and CRISPR, originate in the preservation of the recombination sites, which 1) allows successive modifications and rapid expansion or adaptation of existing systems by repeated targeting of the same site; and 2) provides reversibility, thus allowing the excision of undesired sequences. Thereby, Cre-RMCE complements existing genomic modification tools, adding flexibility and versatility to vector genome targeting.

  11. Methicillin-resistant Staphylococcus saprophyticus isolates carrying staphylococcal cassette chromosome mec have emerged in urogenital tract infections.


    Higashide, Masato; Kuroda, Makoto; Omura, Carlos Takashi Neves; Kumano, Miyuki; Ohkawa, Saburo; Ichimura, Sadahiro; Ohta, Toshiko


    Staphylococcus saprophyticus is a uropathogenic bacterium that causes acute uncomplicated urinary tract infections, particularly in female outpatients. We investigated the dissemination and antimicrobial susceptibilities of 101 S. saprophyticus isolates from the genitourinary tracts of patients in Japan. Eight of these isolates were mecA positive and showed beta-lactam resistance. Pulsed-field gel electrophoresis showed that only some isolates were isogenic, indicating that the mecA gene was apparently acquired independently by mecA-positive isolates through staphylococcal cassette chromosome mec (SCCmec). Type determination of SCCmec by multiplex PCR showed a nontypeable element in the eight mecA-positive isolates. Sequence analysis of the entire SCCmec element from a prototype S. saprophyticus strain revealed that it was nontypeable with the current SCCmec classification due to the novel composition of the class A mec gene complex (IS431-mecA-mecR1-mecI genes) and the ccrA1/ccrB3 gene complex. Intriguingly, the attachment sites of SCCmec are similar to those of type I SCCmec in S. aureus NCTC 10442. Furthermore, the genes around the mec gene complex are similar to those of type II/III SCCmec in S. aureus, while those around the ccr gene complex are similar to those of SCC15305RM found in S. saprophyticus ATCC 15305. In comparison with known SCCmec elements, this S. saprophyticus SCCmec is a novel type.

  12. Production of rotavirus core-like particles in Sf9 cells using recombinase-mediated cassette exchange.


    Fernandes, Fabiana; Dias, Mafalda M; Vidigal, João; Sousa, Marcos F Q; Patrone, Marco; Teixeira, Ana P; Alves, Paula M


    A flexible Sf9 insect cell line was recently developed leveraging the recombinase-mediated cassette exchange (RMCE) technology, which competes with the popular baculovirus expression vector system (BEVS) in terms of speed to produce new proteins. Herein, the ability of this cell platform to produce complex proteins, such as rotavirus core-like particles, was evaluated. A gene construct coding for a VP2-GFP fusion protein was targeted to a pre-characterized high recombination efficiency locus flanked by flipase (Flp) recognition target sites and, after three weeks in selection, an isogenic cell population was obtained. Despite the lower cell specific productivities with respect to those obtained by baculovirus infection, the titers of VP2-GFP reached in shake flask batch cultures were comparable as a result of higher cell densities. To further improve the VP2-GFP levels from stable expression, analysis of exhausted medium was undertaken to design feeding strategies enabling higher cell densities as well as increased culture duration. The implementation of the best strategy allowed reaching 20 million cells per ml in bioreactor cultures; the integrity of the rotavirus core-like particles could be confirmed by electron microscopy. Overall, we show that this Sf9-Flp cell platform represents a valuable alternative to the BEVS for producing complex recombinant proteins, such as rotavirus core-like particles.

  13. Recombinant industrial brewing yeast strains with ADH2 interruption using self-cloning GSH1+CUP1 cassette.


    Wang, Zhao-Yue; Wang, Jin-Jing; Liu, Xi-Feng; He, Xiu-Ping; Zhang, Bo-Run


    A self-cloning module for gene knock-out and knock-in in industrial brewing yeast strain was constructed that contains copper resistance and gamma-glutamylcysteine synthetase gene cassette, flanked by alcohol dehydrogenase II gene (ADH2) of Saccharomyces cerevisiae. The module was used to obtain recombined strains RY1 and RY2 by targeting the ADH2 locus of host Y1. RY1 and RY2 were genetically stable. PCR and enzyme activity analysis of RY1 and RY2 cells showed that one copy of ADH2 was deleted by GSH1+CUP1 insertion, and an additional copy of wild type was still present. The fermentation ability of the recombinants was not changed after genetic modification, and a high level of glutathione (GSH) was secreted, resulting from GSH1 overexpression, which codes for gamma-glutamylcysteine synthetase. A pilot-scale brewing test for RY1 and RY2 indicated that acetaldehyde content in fermenting liquor decreased by 21-22%, GSH content increased by 20-22% compared with the host, the antioxidizability of the recombinants was improved, and the sensorial evaluation was also better than that of the host. No heterologous DNA was harbored in the recombinants; therefore, they could be applied in the beer industry in terms of their biosafety.

  14. Recombinations in staphylococcal cassette chromosome mec elements compromise the molecular detection of methicillin resistance in Staphylococcus aureus.


    Hill-Cawthorne, Grant A; Hudson, Lyndsey O; El Ghany, Moataz Fouad Abd; Piepenburg, Olaf; Nair, Mridul; Dodgson, Andrew; Forrest, Matthew S; Clark, Taane G; Pain, Arnab


    Clinical laboratories are increasingly using molecular tests for methicillin-resistant Staphylococcus aureus (MRSA) screening. However, primers have to be targeted to a variable chromosomal region, the staphylococcal cassette chromosome mec (SCCmec). We initially screened 726 MRSA isolates from a single UK hospital trust by recombinase polymerase amplification (RPA), a novel, isothermal alternative to PCR. Undetected isolates were further characterised using multilocus sequence, spa typing and whole genome sequencing. 96% of our tested phenotypically MRSA isolates contained one of the six orfX-SCCmec junctions our RPA test and commercially available molecular tests target. However 30 isolates could not be detected. Sequencing of 24 of these isolates demonstrated recombinations within the SCCmec element with novel insertions that interfered with the RPA, preventing identification as MRSA. This result suggests that clinical laboratories cannot rely solely upon molecular assays to reliably detect all methicillin-resistance. The presence of significant recombinations in the SCCmec element, where the majority of assays target their primers, suggests that there will continue to be isolates that escape identification. We caution that dependence on amplification-based molecular assays will continue to result in failure to diagnose a small proportion (∼4%) of MRSA isolates, unless the true level of SCCmec natural diversity is determined by whole genome sequencing of a large collection of MRSA isolates.

  15. Recombinations in Staphylococcal Cassette Chromosome mec Elements Compromise the Molecular Detection of Methicillin Resistance in Staphylococcus aureus

    PubMed Central

    Hill-Cawthorne, Grant A.; Hudson, Lyndsey O.; El Ghany, Moataz Fouad Abd; Piepenburg, Olaf; Nair, Mridul; Dodgson, Andrew; Forrest, Matthew S.


    Clinical laboratories are increasingly using molecular tests for methicillin-resistant Staphylococcus aureus (MRSA) screening. However, primers have to be targeted to a variable chromosomal region, the staphylococcal cassette chromosome mec (SCCmec). We initially screened 726 MRSA isolates from a single UK hospital trust by recombinase polymerase amplification (RPA), a novel, isothermal alternative to PCR. Undetected isolates were further characterised using multilocus sequence, spa typing and whole genome sequencing. 96% of our tested phenotypically MRSA isolates contained one of the six orfX-SCCmec junctions our RPA test and commercially available molecular tests target. However 30 isolates could not be detected. Sequencing of 24 of these isolates demonstrated recombinations within the SCCmec element with novel insertions that interfered with the RPA, preventing identification as MRSA. This result suggests that clinical laboratories cannot rely solely upon molecular assays to reliably detect all methicillin-resistance. The presence of significant recombinations in the SCCmec element, where the majority of assays target their primers, suggests that there will continue to be isolates that escape identification. We caution that dependence on amplification-based molecular assays will continue to result in failure to diagnose a small proportion (∼4%) of MRSA isolates, unless the true level of SCCmec natural diversity is determined by whole genome sequencing of a large collection of MRSA isolates. PMID:24972080

  16. Synthesis of 'cineole cassette' monoterpenes in Nicotiana section Alatae: gene isolation, expression, functional characterization and phylogenetic analysis.


    Fähnrich, Anke; Brosemann, Anne; Teske, Laura; Neumann, Madeleine; Piechulla, Birgit


    The scent bouquets of flowers of Nicotiana species, particularly those of section Alatae, are rich in monoterpenes, including 1,8-cineole, limonene, β-myrcene, α- and β-pinene, sabinene, and α-terpineol. New terpene synthase genes were isolated from flowers of Nicotiana bonariensis, N. forgetiana, N. longiflora, and N. mutabilis. The recombinant enzymes synthesize simultaneously the characteristic 'cineole cassette' monoterpenes with 1,8-cineole as the dominant volatile product. Interestingly, amino acid sequence comparison and phylogenetic tree construction clustered the newly isolated cineole synthases (CIN) of section Alatae together with the catalytically similar CIN of N. suaveolens of section Suaveolentes, thus suggesting a common ancestor. These CIN genes of N. bonariensis, N. forgetiana, N. longiflora, and N. mutabilis are distinct from the terpineol synthases (TERs) of the taxonomically related N. alata and N. langsdorfii (both Alatae), thus indicating gene diversification of monoterpene synthases in section Alatae. Furthermore, the presence of CINs in species of the American section Alatae supports the hypothesis that one parent of the Australian section Suaveolentes was a member of the present section Alatae. Amino acid sequences of the Nicotiana CINs and TERs were compared to identify relevant amino acids of the cyclization reaction from α-terpineol to 1,8-cineole.

  17. Structural Basis for the Unique Multivalent Readout of Unmodified H3 Tail by Arabidopsis ORC1b BAH-PHD Cassette.


    Li, Sisi; Yang, Zhenlin; Du, Xuan; Liu, Rui; Wilkinson, Alex W; Gozani, Or; Jacobsen, Steven E; Patel, Dinshaw J; Du, Jiamu


    DNA replication initiation relies on the formation of the origin recognition complex (ORC). The plant ORC subunit 1 (ORC1) protein possesses a conserved N-terminal BAH domain with an embedded plant-specific PHD finger, whose function may be potentially regulated by an epigenetic mechanism. Here, we report structural and biochemical studies on the Arabidopsis thaliana ORC1b BAH-PHD cassette which specifically recognizes the unmodified H3 tail. The crystal structure of ORC1b BAH-PHD cassette in complex with an H3(1-15) peptide reveals a strict requirement for the unmodified state of R2, T3, and K4 on the H3 tail and a novel multivalent BAH and PHD readout mode for H3 peptide recognition. Such recognition may contribute to epigenetic regulation of the initiation of DNA replication.

  18. Analysis of the XRS background

    NASA Technical Reports Server (NTRS)

    Kilbourne, Caroline A.; Boyce, K. R.; Brown, G. V.; Cottam, J.; Fujimoto, R.; Furusho, T.; Ishisaki, Y.; Kelley, R. L.; McCammon, D.; Mitsuda, K.


    Background counts on the XRS Calorimeter spectrometer of Astro-E2 have several sources, including primary cosmic rays and secondary particles interacting with the pixels and with the silicon structure of the array. After rejecting events coincident between pixels or between a pixel and the anti-coincidence detector behind the calorimeter array, the residual background on the ground in the 0.1 - 10 keV band is 1e-3 counts/s (8e-3 counts/s/sq cm). We will present the details of the ground background events and the rejection criteria required lo remove them while minimizing deadtime. We will also present preliminary analysis of the in-orbit background.

  19. Greater need for background checks.


    Fiesta, J


    The push is on for a more uniform system of background checks for health care employees. Studies and crimes against patients have prompted regulation by the Health Care Financing Administration (HCFA), state governments, hospitals, a