Gossypolhemiquinone, a dimeric sesquiterpenoid identified in cotton (Gossypium)
USDA-ARS?s Scientific Manuscript database
The report that the cotton leaf perforator, Bucculatrix thurberiella, is one of the few insect herbivores to attack Gossypium thurberi prompted an investigation of the terpenoids present in the leaves of this wild species of cotton. Members of Gossypium produce subepidermal pigment glands in their ...
Comparative phenotypic analysis of Gossypium raimondii with Upland cotton
USDA-ARS?s Scientific Manuscript database
Gossypium raimondii Ulbr., a wild species with a diploid genome, has been sequenced due to its small genome size and sequence similarity with the polyploidy cultivated Gossypium species. Accessibility of the G. raimondii genome has made the species a reference used extensively in cotton genomic and...
Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres.
Paterson, Andrew H; Wendel, Jonathan F; Gundlach, Heidrun; Guo, Hui; Jenkins, Jerry; Jin, Dianchuan; Llewellyn, Danny; Showmaker, Kurtis C; Shu, Shengqiang; Udall, Joshua; Yoo, Mi-jeong; Byers, Robert; Chen, Wei; Doron-Faigenboim, Adi; Duke, Mary V; Gong, Lei; Grimwood, Jane; Grover, Corrinne; Grupp, Kara; Hu, Guanjing; Lee, Tae-ho; Li, Jingping; Lin, Lifeng; Liu, Tao; Marler, Barry S; Page, Justin T; Roberts, Alison W; Romanel, Elisson; Sanders, William S; Szadkowski, Emmanuel; Tan, Xu; Tang, Haibao; Xu, Chunming; Wang, Jinpeng; Wang, Zining; Zhang, Dong; Zhang, Lan; Ashrafi, Hamid; Bedon, Frank; Bowers, John E; Brubaker, Curt L; Chee, Peng W; Das, Sayan; Gingle, Alan R; Haigler, Candace H; Harker, David; Hoffmann, Lucia V; Hovav, Ran; Jones, Donald C; Lemke, Cornelia; Mansoor, Shahid; ur Rahman, Mehboob; Rainville, Lisa N; Rambani, Aditi; Reddy, Umesh K; Rong, Jun-kang; Saranga, Yehoshua; Scheffler, Brian E; Scheffler, Jodi A; Stelly, David M; Triplett, Barbara A; Van Deynze, Allen; Vaslin, Maite F S; Waghmare, Vijay N; Walford, Sally A; Wright, Robert J; Zaki, Essam A; Zhang, Tianzhen; Dennis, Elizabeth S; Mayer, Klaus F X; Peterson, Daniel G; Rokhsar, Daniel S; Wang, Xiyin; Schmutz, Jeremy
2012-12-20
Polyploidy often confers emergent properties, such as the higher fibre productivity and quality of tetraploid cottons than diploid cottons bred for the same environments. Here we show that an abrupt five- to sixfold ploidy increase approximately 60 million years (Myr) ago, and allopolyploidy reuniting divergent Gossypium genomes approximately 1-2 Myr ago, conferred about 30-36-fold duplication of ancestral angiosperm (flowering plant) genes in elite cottons (Gossypium hirsutum and Gossypium barbadense), genetic complexity equalled only by Brassica among sequenced angiosperms. Nascent fibre evolution, before allopolyploidy, is elucidated by comparison of spinnable-fibred Gossypium herbaceum A and non-spinnable Gossypium longicalyx F genomes to one another and the outgroup D genome of non-spinnable Gossypium raimondii. The sequence of a G. hirsutum A(t)D(t) (in which 't' indicates tetraploid) cultivar reveals many non-reciprocal DNA exchanges between subgenomes that may have contributed to phenotypic innovation and/or other emergent properties such as ecological adaptation by polyploids. Most DNA-level novelty in G. hirsutum recombines alleles from the D-genome progenitor native to its New World habitat and the Old World A-genome progenitor in which spinnable fibre evolved. Coordinated expression changes in proximal groups of functionally distinct genes, including a nuclear mitochondrial DNA block, may account for clusters of cotton-fibre quantitative trait loci affecting diverse traits. Opportunities abound for dissecting emergent properties of other polyploids, particularly angiosperms, by comparison to diploid progenitors and outgroups.
A draft physical map of a D-genome cotton species (Gossypium raimondii)
2010-01-01
Background Genetically anchored physical maps of large eukaryotic genomes have proven useful both for their intrinsic merit and as an adjunct to genome sequencing. Cultivated tetraploid cottons, Gossypium hirsutum and G. barbadense, share a common ancestor formed by a merger of the A and D genomes about 1-2 million years ago. Toward the long-term goal of characterizing the spectrum of diversity among cotton genomes, the worldwide cotton community has prioritized the D genome progenitor Gossypium raimondii for complete sequencing. Results A whole genome physical map of G. raimondii, the putative D genome ancestral species of tetraploid cottons was assembled, integrating genetically-anchored overgo hybridization probes, agarose based fingerprints and 'high information content fingerprinting' (HICF). A total of 13,662 BAC-end sequences and 2,828 DNA probes were used in genetically anchoring 1585 contigs to a cotton consensus genetic map, and 370 and 438 contigs, respectively to Arabidopsis thaliana (AT) and Vitis vinifera (VV) whole genome sequences. Conclusion Several lines of evidence suggest that the G. raimondii genome is comprised of two qualitatively different components. Much of the gene rich component is aligned to the Arabidopsis and Vitis vinifera genomes and shows promise for utilizing translational genomic approaches in understanding this important genome and its resident genes. The integrated genetic-physical map is of value both in assembling and validating a planned reference sequence. PMID:20569427
Gossypolhemiquinone, a dimeric sesquiterpenoid identified in cotton (Gossypium).
Stipanovic, Robert; Puckhaber, Lorraine; Frelichowski, James; Esquivel, Jesus; Westbrook, John; O'Neil, Mike; Bell, Alois; Dowd, Michael; Hake, Kater; Duke, Sara
2016-02-01
The report that the cotton leaf perforator, Bucculatrix thurberiella, is one of the few insect herbivores to attack Gossypium thurberi prompted an investigation of the terpenoids present in the leaves of this wild species of cotton. Members of Gossypium produce subepidermal pigment glands in their leaves that contain the dimeric sesquiterpenoid gossypol as well as other biosynthetically related terpenoids. In addition to gossypol, a previously unknown dimeric sesquiterpenoid, gossypolhemiquinone (GHQ), was identified in trace amounts in G. thurberi, a member of the D genome. Other members of the D genome of Gossypium were subsequently found to contain this compound, but GHQ was not detected in commercial cotton cultivars. When fed to Helicoverpa zea in an artificial diet, GHQ delayed days-to-pupation, reduced pupal weights, and survival to adulthood to a lesser or equal extent than gossypol in comparison to the control diet. However, GHQ had a synergistic effect on survival and days-to-pupation when combined with gossypol at the highest dosage tested (0.18%; 15.5:84.5 GHQ:gossypol). Because gossypol exhibits anti-cancer activity, GHQ was also evaluated for its anti-cancer activity against the National Cancer Institute's 60-Human Tumor Cell Line Screen. Significant inhibitory activity against most of these cell lines was not observed, but the results may offer some promise against leukemia cancer cell lines. Published by Elsevier Ltd.
Gossypolone and Gossypolhemiquinone: Biological activity of terpenoids found in cotton (Gossypium)
USDA-ARS?s Scientific Manuscript database
The wild cotton plant, Gossypium thurberi grows in the Sonoran Desert in northern Mexico and southern Arizona, and is attacked by few herbivorous insects (Korban, 1999). In general, members of Gossypium produce a rich assortment of sesquiterpenoid and sesterterpenoids in the subepidermal pigment gl...
CMD: a Cotton Microsatellite Database resource for Gossypium genomics
Blenda, Anna; Scheffler, Jodi; Scheffler, Brian; Palmer, Michael; Lacape, Jean-Marc; Yu, John Z; Jesudurai, Christopher; Jung, Sook; Muthukumar, Sriram; Yellambalase, Preetham; Ficklin, Stephen; Staton, Margaret; Eshelman, Robert; Ulloa, Mauricio; Saha, Sukumar; Burr, Ben; Liu, Shaolin; Zhang, Tianzhen; Fang, Deqiu; Pepper, Alan; Kumpatla, Siva; Jacobs, John; Tomkins, Jeff; Cantrell, Roy; Main, Dorrie
2006-01-01
Background The Cotton Microsatellite Database (CMD) is a curated and integrated web-based relational database providing centralized access to publicly available cotton microsatellites, an invaluable resource for basic and applied research in cotton breeding. Description At present CMD contains publication, sequence, primer, mapping and homology data for nine major cotton microsatellite projects, collectively representing 5,484 microsatellites. In addition, CMD displays data for three of the microsatellite projects that have been screened against a panel of core germplasm. The standardized panel consists of 12 diverse genotypes including genetic standards, mapping parents, BAC donors, subgenome representatives, unique breeding lines, exotic introgression sources, and contemporary Upland cottons with significant acreage. A suite of online microsatellite data mining tools are accessible at CMD. These include an SSR server which identifies microsatellites, primers, open reading frames, and GC-content of uploaded sequences; BLAST and FASTA servers providing sequence similarity searches against the existing cotton SSR sequences and primers, a CAP3 server to assemble EST sequences into longer transcripts prior to mining for SSRs, and CMap, a viewer for comparing cotton SSR maps. Conclusion The collection of publicly available cotton SSR markers in a centralized, readily accessible and curated web-enabled database provides a more efficient utilization of microsatellite resources and will help accelerate basic and applied research in molecular breeding and genetic mapping in Gossypium spp. PMID:16737546
Khatoon, Sameena; Kumar, Abhinav; Sarin, Neera B; Khan, Jawaid A
2016-08-01
Cotton leaf curl disease (CLCuD) is caused by several distinct begomovirus species in association with disease-specific betasatellite essential for induction of disease symptoms. CLCuD is a serious threat for the cultivation of cotton (Gossypium sp.) and several species in the family Malvaceae. In this study, RNAi-based approach was applied to generate transgenic cotton (Gossypium hirsutum) plants resistant to Cotton leaf curl Rajasthan virus (CLCuRV). An intron hairpin (ihp) RNAi construct capable of expressing dsRNA homologous to the intergenic region (IR) of CLCuRV was designed and developed. Following Agrobacterium tumefaciens-mediated transformation of cotton (G. hirsutum cv. Narasimha) plants with the designed ihpRNAi construct, a total of 9 independent lines of transformed cotton were obtained. The presence of the potential stretch of IR in the transformed cotton was confirmed by PCR coupled with Southern hybridization. Upon inoculation with viruliferous whiteflies, the transgenic plants showed high degree of resistance. None of them displayed any CLCuD symptoms even after 90 days post inoculation. The transformed cotton plants showed the presence of siRNAs. The present study demonstrated that ihp dsRNA-mediated resistance strategy of RNAi is an effective means to combat the CLCuD infection in cotton.
Xu, Zhanyou; Yu, Jing; Kohel, Russell J; Percy, Richard G; Beavis, William D; Main, Dorrie; Yu, John Z
2015-07-01
Cotton fiber represents the largest single cell in plants and they serve as models to study cell development. This study investigated the distribution and evolution of fiber Unigenes anchored to recombination hotspots between tetraploid cotton (Gossypium hirsutum) At and Dt subgenomes, and within a parental diploid cotton (Gossypium raimondii) D genome. Comparative analysis of At vs D and Dt vs D showed that 1) the D genome provides many fiber genes after its merger with another parental diploid cotton (Gossypium arboreum) A genome although the D genome itself does not produce any spinnable fiber; 2) similarity of fiber genes is higher between At vs D than between Dt vs D genomic hotspots. This is the first report that fiber genes have higher similarity between At and D than between Dt and D. The finding provides new insights into cotton genomic regions that would facilitate genetic improvement of natural fiber properties. Published by Elsevier Inc.
Nardeli, Sarah Muniz; Artico, Sinara; Aoyagi, Gustavo Mitsunori; de Moura, Stéfanie Menezes; da Franca Silva, Tatiane; Grossi-de-Sa, Maria Fatima; Romanel, Elisson; Alves-Ferreira, Marcio
2018-06-01
The MADS-box gene family encodes transcription factors that share a highly conserved domain known to bind to DNA. Members of this family control various processes of development in plants, from root formation to fruit ripening. In this work, a survey of diploid (Gossypium raimondii and Gossypium arboreum) and tetraploid (Gossypium hirsutum) cotton genomes found a total of 147, 133 and 207 MADS-box genes, respectively, distributed in the MIKC, Mα, Mβ, Mγ, and Mδ subclades. A comparative phylogenetic analysis among cotton species, Arabidopsis, poplar and grapevine MADS-box homologous genes allowed us to evaluate the evolution of each MADS-box lineage in cotton plants and identify sequences within well-established subfamilies. Chromosomal localization and phylogenetic analysis revealed that G. raimondii and G. arboreum showed a conserved evolution of the MIKC subclade and a distinct pattern of duplication events in the Mα, Mγ and Mδ subclades. Additionally, G. hirsutum showed a combination of its parental subgenomes followed by a distinct evolutionary history including gene gain and loss in each subclade. qPCR analysis revealed the expression patterns of putative homologs in the AP1, AP3, AGL6, SEP4, AGL15, AG, AGL17, TM8, SVP, SOC and TT16 subfamilies of G. hirsutum. The identification of putative cotton orthologs is discussed in the light of evolution and gene expression data from other plants. This analysis of the MADS-box genes in Gossypium species opens an avenue to understanding the origin and evolution of each gene subfamily within diploid and polyploid species and paves the way for functional studies in cotton species. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Genetic control of flame retardancy in white lint cotton (gossypium hirsutum)
USDA-ARS?s Scientific Manuscript database
Varieties of cotton (Gossypium hirsutum L.) exhibit differences in fiber combustion properties and flame retardancy (FR) as measured by microscale combustion calorimetry (MCC) and standardized flammability testing. Some naturally colored brown lint cotton lines produce fibers that can create self-ex...
New DNA Markers for the Use in Cotton (Gossypium spp.) Improvement
USDA-ARS?s Scientific Manuscript database
SSR markers, also known as DNA microsatellite markers, are proving to be very useful for saturation of the large and complex upland cotton (Gossypium hirsutum genetic linkage map. Monsanto Company has invested heavily in development of cotton SSRs and has implemented molecular breeding technologies ...
Reinisch, A. J.; Dong, J. M.; Brubaker, C. L.; Stelly, D. M.; Wendel, J. F.; Paterson, A. H.
1994-01-01
We employ a detailed restriction fragment length polymorphism (RFLP) map to investigate chromosome organization and evolution in cotton, a disomic polyploid. About 46.2% of nuclear DNA probes detect RFLPs distinguishing Gossypium hirsutum and Gossypium barbadense; and 705 RFLP loci are assembled into 41 linkage groups and 4675 cM. The subgenomic origin (A vs. D) of most, and chromosomal identity of 14 (of 26), linkage groups is shown. The A and D subgenomes show similar recombinational length, suggesting that repetitive DNA in the physically larger A subgenome is recombinationally inert. RFLPs are somewhat more abundant in the D subgenome. Linkage among duplicated RFLPs reveals 11 pairs of homoeologous chromosomal regions-two appear homosequential, most differ by inversions, and at least one differs by a translocation. Most homoeologies involve chromosomes from different subgenomes, putatively reflecting the n = 13 to n = 26 polyploidization event of 1.1-1.9 million years ago. Several observations suggest that another, earlier, polyploidization event spawned n = 13 cottons, at least 25 million years ago. The cotton genome contains about 400-kb DNA per cM, hence map-based gene cloning is feasible. The cotton map affords new opportunities to study chromosome evolution, and to exploit Gossypium genetic resources for improvement of the world's leading natural fiber. PMID:7851778
USDA-ARS?s Scientific Manuscript database
Gossypium hirsutum is the predominant cotton of commerce and all cultivars of this species are susceptible to the reniform nematode, Rotylenchulus reniformis. To introgress resistance to R. reniformis into the tetraploid 2(AD1) G. hirsutum, a resistant diploid A2-genome G. arboreum accession (A2-19...
Natural hybridization between Gossypium mustelinum and exotic allotetraploid cotton species.
de Menezes, I P P; da Silva, J O; Malafaia, G; Silveira, R D D; Barroso, P A V
2015-10-30
Cotton has been collected in Brazil for decades for its conservation, evaluation, and the use of its genetic resources. Gossypium mustelinum is an allotetraploid cotton species that only occurs in Brazil, and little is known about its genetic potential for improvement. However, the species is threatened by habitat fragmentation and interspecific hybridization with exotic species of cotton. In this study, we investigated the rate of natural hybridization in two populations of G. mustelinum in Bahia, Brazil, with G. hirsutum and G. barbadense using a set of microsatellite markers.
Measuring diversity in Gossypium hirsutum using the CottonSNP63K Array
USDA-ARS?s Scientific Manuscript database
A CottonSNP63K array and accompanying cluster file has been developed and includes 45,104 intra-specific SNPs and 17,954 inter-specific SNPs for automated genotyping of cotton (Gossypium spp.) samples. Development of the cluster file included genotyping of 1,156 samples, a subset of which were iden...
Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing
2017-10-01
Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.
Avci, Utku; Pattathil, Sivakumar; Singh, Bir; Brown, Virginia L; Hahn, Michael G; Haigler, Candace H
2013-01-01
Cotton fiber is an important natural textile fiber due to its exceptional length and thickness. These properties arise largely through primary and secondary cell wall synthesis. The cotton fiber of commerce is a cellulosic secondary wall surrounded by a thin cuticulated primary wall, but there were only sparse details available about the polysaccharides in the fiber cell wall of any cotton species. In addition, Gossypium hirsutum (Gh) fiber was known to have an adhesive cotton fiber middle lamella (CFML) that joins adjacent fibers into tissue-like bundles, but it was unknown whether a CFML existed in other commercially important cotton fibers. We compared the cell wall chemistry over the time course of fiber development in Gh and Gossypium barbadense (Gb), the two most important commercial cotton species, when plants were grown in parallel in a highly controlled greenhouse. Under these growing conditions, the rate of early fiber elongation and the time of onset of secondary wall deposition were similar in fibers of the two species, but as expected the Gb fiber had a prolonged elongation period and developed higher quality compared to Gh fiber. The Gb fibers had a CFML, but it was not directly required for fiber elongation because Gb fiber continued to elongate rapidly after CFML hydrolysis. For both species, fiber at seven ages was extracted with four increasingly strong solvents, followed by analysis of cell wall matrix polysaccharide epitopes using antibody-based Glycome Profiling. Together with immunohistochemistry of fiber cross-sections, the data show that the CFML of Gb fiber contained lower levels of xyloglucan compared to Gh fiber. Xyloglucan endo-hydrolase activity was also higher in Gb fiber. In general, the data provide a rich picture of the similarities and differences in the cell wall structure of the two most important commercial cotton species.
QTL mapping for flowering-time and photoperiod insensitivity of wild cotton Gossypium darwinii Watt
USDA-ARS?s Scientific Manuscript database
Most wild and semi-wild species of the genus Gossypium are sensitive to photoperiodism. The wild germplasm cotton collection is a valuable source of genes for genetic improvement of current cotton cultivars. For the purpose of identifying quantitative trait loci (QTLs) controlling flowering, a bi-pa...
He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming
2011-01-01
The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.
RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres
USDA-ARS?s Scientific Manuscript database
Emergent phenotypes are common in polyploids relative to their diploid progenitors, a phenomenon exemplified by spinnable cotton fibers. Following 15-18 fold paleopolyploidy, allopolyploidy 1-2 million years ago reunited divergent Gossypium genomes, imparting new combinatorial complexity that might ...
USDA-ARS?s Scientific Manuscript database
Genetic and genomic analyses of Upland cotton (Gossypium hirsutum) are difficult because it has a complex allotetraploid (AADD; 2n = 4x = 52) genome. Here we sequenced, assembled and analyzed the world's most important cultivated cotton genome with 246.2 gigabase (Gb) clean data obtained using whol...
Lu, Cairui; Zou, Changsong; Zhang, Youping; Yu, Daoqian; Cheng, Hailiang; Jiang, Pengfei; Yang, Wencui; Wang, Qiaolian; Feng, Xiaoxu; Prosper, Mtawa Andrew; Guo, Xiaoping; Song, Guoli
2015-02-06
Tetraploid cotton contains two sets of homologous chromosomes, the At- and Dt-subgenomes. Consequently, many markers in cotton were mapped to multiple positions during linkage genetic map construction, posing a challenge to anchoring linkage groups and mapping economically-important genes to particular chromosomes. Chromosome-specific markers could solve this problem. Recently, the genomes of two diploid species were sequenced whose progenitors were putative contributors of the At- and Dt-subgenomes to tetraploid cotton. These sequences provide a powerful tool for developing chromosome-specific markers given the high level of synteny among tetraploid and diploid cotton genomes. In this study, simple sequence repeats (SSRs) on each chromosome in the two diploid genomes were characterized. Chromosome-specific SSRs were developed by comparative analysis and proved to distinguish chromosomes. A total of 200,744 and 142,409 SSRs were detected on the 13 chromosomes of Gossypium arboreum L. and Gossypium raimondii Ulbrich, respectively. Chromosome-specific SSRs were obtained by comparing SSR flanking sequences from each chromosome with those from the other 25 chromosomes. The average was 7,996 per chromosome. To confirm their chromosome specificity, these SSRs were used to distinguish two homologous chromosomes in tetraploid cotton through linkage group construction. The chromosome-specific SSRs and previously-reported chromosome markers were grouped together, and no marker mapped to another homologous chromosome, proving that the chromosome-specific SSRs were unique and could distinguish homologous chromosomes in tetraploid cotton. Because longer dinucleotide AT-rich repeats were the most polymorphic in previous reports, the SSRs on each chromosome were sorted by motif type and repeat length for convenient selection. The primer sequences of all chromosome-specific SSRs were also made publicly available. Chromosome-specific SSRs are efficient tools for chromosome
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)
Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).
Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.
Lu, Quanwei; Shi, Yuzhen; Xiao, Xianghui; Li, Pengtao; Gong, Juwu; Gong, Wankui; Liu, Aiying; Shang, Haihong; Li, Junwen; Ge, Qun; Song, Weiwu; Li, Shaoqi; Zhang, Zhen; Rashid, Md Harun Or; Peng, Renhai; Yuan, Youlu; Huang, Jinling
2017-10-05
As high-strength cotton fibers are critical components of high quality cotton, developing cotton cultivars with high-strength fibers as well as high yield is a top priority for cotton development. Recently, chromosome segment substitution lines (CSSLs) have been developed from high-yield Upland cotton ( Gossypium hirsutum ) crossed with high-quality Sea Island cotton ( G. barbadense ). Here, we constructed a CSSL population by crossing CCRI45, a high-yield Upland cotton cultivar, with Hai1, a Sea Island cotton cultivar with superior fiber quality. We then selected two CSSLs with significantly higher fiber strength than CCRI45 (MBI7747 and MBI7561), and one CSSL with lower fiber strength than CCRI45 (MBI7285), for further analysis. We sequenced all four transcriptomes at four different time points postanthesis, and clustered the 44,678 identified genes by function. We identified 2200 common differentially-expressed genes (DEGs): those that were found in both high quality CSSLs (MBI7747 and MBI7561), but not in the low quality CSSL (MBI7285). Many of these genes were associated with various metabolic pathways that affect fiber strength. Upregulated DEGs were associated with polysaccharide metabolic regulation, single-organism localization, cell wall organization, and biogenesis, while the downregulated DEGs were associated with microtubule regulation, the cellular response to stress, and the cell cycle. Further analyses indicated that three genes, XLOC_036333 [mannosyl-oligosaccharide-α-mannosidase ( MNS1 )], XLOC_029945 ( FLA8 ), and XLOC_075372 ( snakin-1 ), were potentially important for the regulation of cotton fiber strength. Our results suggest that these genes may be good candidates for future investigation of the molecular mechanisms of fiber strength formation and for the improvement of cotton fiber quality through molecular breeding. Copyright © 2017 Lu et al.
New HPLC methods to quantitate terpenoid aldehydes in foliage of cotton (Gossypium)
USDA-ARS?s Scientific Manuscript database
The cotton plant (Gossypium) produces protective terpenoid aldehydes in lysigenous pigment glands. These terpenoids include hemigossypolone, hemigossypolone-6-methyl ether, gossypol, gossypol-6-methyl ether, gossypol-6,6'-dimethyl ether, heliocides H1, H2, H3 and H4, and heliocides B1, B2, B3 and B4...
Virus-Induced Gene Silencing in Cultivated Cotton (Gossypium spp.) Using Tobacco Rattle Virus.
Mustafa, Roma; Shafiq, Muhammad; Mansoor, Shahid; Briddon, Rob W; Scheffler, Brian E; Scheffler, Jodi; Amin, Imran
2016-01-01
The study described here has optimized the conditions for virus-induced gene silencing (VIGS) in three cultivated cotton species (Gossypium hirsutum, G. arboreum, and G. herbaceum) using a Tobacco rattle virus (TRV) vector. The system was used to silence the homolog of the Arabidopsis thaliana chloroplastos alterados 1 (AtCLA1) gene, involved in chloroplast development, in G. herbaceum, G. arboreum, and six commercial G. hirsutum cultivars. All plants inoculated with the TRV vector to silence CLA1 developed a typical albino phenotype indicative of silencing this gene. Although silencing in G. herbaceum and G. arboreum was complete, silencing efficiency differed for each G. hirsutum cultivar. Reverse transcriptase polymerase chain reaction (PCR) and real-time quantitative PCR showed a reduction in mRNA levels of the CLA1 homolog in all three species, with the highest efficiency (lowest CLA1 mRNA levels) in G. arboreum followed by G. herbaceum and G. hirsutum. The results indicate that TRV is a useful vector for VIGS in Gossypium species. However, selection of host cultivar is important. With the genome sequences of several cotton species recently becoming publicly available, this system has the potential to provide a very powerful tool for the rapid, large-scale reverse-genetic analysis of genes in Gossypium spp.
USDA-ARS?s Scientific Manuscript database
Gossypium hirsutum cellulose synthase catalytic subunit 4 (GhCesA4) plays an important role in cellulose biosynthesis during cotton fiber development. The transcript levels of GhCesA4 are significantly up-regulated as secondary cell wall cellulose is produced in developing cotton fibers. To unders...
USDA-ARS?s Scientific Manuscript database
Information of genetic diversity in germplasm for cotton leaf curl disease (CLCuD) resistance/susceptibility and economic characters is essential before starting a breeding program to development germplasm with disease resistance. In this study, 17 conventional cotton (Gossypium hirsutum L.) genoty...
Zhang, Xianwen; Ye, Zhenwei; Wang, Tiankang; Xiong, Hairong; Yuan, Xiaoling; Zhang, Zhigang; Yuan, Youlu; Liu, Zhi
2014-11-10
Cotton is an important fiber plant, and it's attractive to elucidate the molecular mechanism of anther development due to the close relationship between the anther fertility and boll-setting, and also fiber yield. In the present paper, 47.2 million paired-end reads with average length of 82.87 bp from the anthers of TM-1 (Gossypium hirsutum L.), a genetic standard line, were generated through transcriptome sequencing, and 210,965 unigenes of more than 100 bp were obtained. BLAST, KEGG, COG, and GO analyses showed that the genes were enriched in the processes of transcription, translation, and post-translation as well as hormone signal transduction, the transcription factor families, and cell wall-related genes mainly participating in cell expansion and carbohydrate metabolism. Further analysis identified 11,153 potential SSRs. A suit of 5122 primer pair sequences were designed, and 82 of 300 randomly selected primer pairs produced reproducible amplicons that were polymorphic among 22 cotton accessions from G. hirsutum, Gossypium barbadense and Gossypium arboreum. The UPGMA clustering analysis further confirmed high quality and effectiveness of these novel SSR markers. The present study provided insights into the transcriptome profile of the cotton and established a public information platform for functional genomics and molecular breeding. Copyright © 2014 Elsevier B.V. All rights reserved.
Hinze, Lori L; Fang, David D; Gore, Michael A; Scheffler, Brian E; Yu, John Z; Frelichowski, James; Percy, Richard G
2015-02-01
A core marker set containing markers developed to be informative within a single commercial cotton species can elucidate diversity structure within a multi-species subset of the Gossypium germplasm collection. An understanding of the genetic diversity of cotton (Gossypium spp.) as represented in the US National Cotton Germplasm Collection is essential to develop strategies for collecting, conserving, and utilizing these germplasm resources. The US collection is one of the largest world collections and includes not only accessions with improved yield and fiber quality within cultivated species, but also accessions possessing sources of abiotic and biotic stress resistance often found in wild species. We evaluated the genetic diversity of a subset of 272 diploid and 1,984 tetraploid accessions in the collection (designated the Gossypium Diversity Reference Set) using a core set of 105 microsatellite markers. Utility of the core set of markers in differentiating intra-genome variation was much greater in commercial tetraploid genomes (99.7 % polymorphic bands) than in wild diploid genomes (72.7 % polymorphic bands), and may have been influenced by pre-selection of markers for effectiveness in the commercial species. Principal coordinate analyses revealed that the marker set differentiated interspecific variation among tetraploid species, but was only capable of partially differentiating among species and genomes of the wild diploids. Putative species-specific marker bands in G. hirsutum (73) and G. barbadense (81) were identified that could be used for qualitative identification of misclassifications, redundancies, and introgression within commercial tetraploid species. The results of this broad-scale molecular characterization are essential to the management and conservation of the collection and provide insight and guidance in the use of the collection by the cotton research community in their cotton improvement efforts.
Virus-induced gene silencing in cultivated cotton (Gossypium spp.) using Tobacco rattle virus
USDA-ARS?s Scientific Manuscript database
The study described here has optimized the conditions for virus induced gene silencing (VIGS) in three cultivated cotton species (Gossypium hirsutum, G. arboreum and G. herbaceum) using a Tobacco rattle virus (TRV) vector. The system was used to silence the homolog of the Arabidopsis thaliana chloro...
Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing
2014-11-06
Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved
Richard C. Cronn; Randall L. Small; Tamara Hanselkorn; Jonathan F. Wendel
2002-01-01
Previous molecular phylogenetic studies have failed to resolve the branching order among the major cotton (Gossypium) lineages, and it has been unclear whether this reflects actual history (rapid radiation) or sampling properties of the genes evaluated. In this paper, we reconsider the phylogenetic relationships of diploid cotton genome groups using DNA sequences from...
USDA-ARS?s Scientific Manuscript database
Increasing fructokinase (FRK) activity in cotton (Gossypium hirsutum L.) plants may reduce fructose inhibition of sucrose synthase (Sus) and lead to improved fibre yield and quality. Cotton was transformed with a tomato (Solanum lycopersicum L.) fructokinase gene (LeFRK1) under the control of the C...
Long noncoding RNAs and their proposed functions in fibre development of cotton (Gossypium spp.).
Wang, Maojun; Yuan, Daojun; Tu, Lili; Gao, Wenhui; He, Yonghui; Hu, Haiyan; Wang, Pengcheng; Liu, Nian; Lindsey, Keith; Zhang, Xianlong
2015-09-01
Long noncoding RNAs (lncRNAs) are transcripts of at least 200 bp in length, possess no apparent coding capacity and are involved in various biological regulatory processes. Until now, no systematic identification of lncRNAs has been reported in cotton (Gossypium spp.). Here, we describe the identification of 30 550 long intergenic noncoding RNA (lincRNA) loci (50 566 transcripts) and 4718 long noncoding natural antisense transcript (lncNAT) loci (5826 transcripts). LncRNAs are rich in repetitive sequences and preferentially expressed in a tissue-specific manner. The detection of abundant genome-specific and/or lineage-specific lncRNAs indicated their weak evolutionary conservation. Approximately 76% of homoeologous lncRNAs exhibit biased expression patterns towards the At or Dt subgenomes. Compared with protein-coding genes, lncRNAs showed overall higher methylation levels and their expression was less affected by gene body methylation. Expression validation in different cotton accessions and coexpression network construction helped to identify several functional lncRNA candidates involved in cotton fibre initiation and elongation. Analysis of integrated expression from the subgenomes of lncRNAs generating miR397 and its targets as a result of genome polyploidization indicated their pivotal functions in regulating lignin metabolism in domesticated tetraploid cotton fibres. This study provides the first comprehensive identification of lncRNAs in Gossypium. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
USDA-ARS?s Scientific Manuscript database
The effects of cotton (Gossypium hirsutum L.):soybean [Glycine max (L.) Merr.] rotations on the soil fertility levels are limited. An irrigated soybean:cotton rotation experiment was conducted from 2012 through 2015 near Elizabeth, MS. Rotation sequences were; continuous soybean, continuous cotton...
Wang, W; Zhang, M; Chen, H D; Cai, X X; Xu, M L; Lei, K Y; Niu, J H; Deng, L; Liu, J; Ge, Z J; Yu, S X; Wang, B H
2016-10-06
In this study, a methylation-sensitive amplification polymorphism analysis system was used to analyze DNA methylation level in three cotton accessions. Two disease-sensitive near-isogenic lines, PD94042 and IL41, and one disease-resistant Gossypium mustelinum accession were exposed to Verticillium wilt, to investigate molecular disease resistance mechanisms in cotton. We observed multiple different DNA methylation types across the three accessions following Verticillium wilt exposure. These included hypomethylation, hypermethylation, and other patterns. In general, the global DNA methylation level was significantly increased in the disease-resistant accession G. mustelinum following disease exposure. In contrast, there was no significant difference in the disease-sensitive accession PD94042, and a significant decrease was observed in IL41. Our results suggest that disease-resistant cotton might employ a mechanism to increase methylation level in response to disease stress. The differing methylation patterns, together with the increase in global DNA methylation level, might play important roles in tolerance to Verticillium wilt in cotton. Through cloning and analysis of differently methylated DNA sequences, we were also able to identify several genes that may contribute to disease resistance in cotton. Our results revealed the effect of DNA methylation on cotton disease resistance, and also identified genes that played important roles, which may shed light on the future cotton disease-resistant molecular breeding.
USDA-ARS?s Scientific Manuscript database
Recent Meta-analysis of quantitative trait loci (QTL) in tetraploid cotton (Gossypium spp.) has identified regions of the genome with high concentrations of various trait QTL called clusters, and specific trait QTL called hotspots. The Meta-analysis included all population types of Gossypium mixing ...
Genome-wide comparative analysis of NBS-encoding genes in four Gossypium species
USDA-ARS?s Scientific Manuscript database
Nucleotide binding site (NBS) genes encode a large family of disease resistance (R) proteins in plants. The availability of genomic data of the two diploid cotton species, Gossypium arboreum and Gossypium raimondii, and the two allotetraploid cotton species, Gossypium hirsutum (TM-1) and Gossypium ...
Wei, Yangyang; Xu, Yanchao; Lu, Pu; Wang, Xingxing; Li, Zhenqing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Yuhong; Zhang, Zhenmei; Lin, Zhongxu; Liu, Fang; Wang, Kunbo
2017-01-01
Cotton is a pioneer of saline land crop, while salt stress still causes its growth inhibition and fiber production decrease. Phenotype identification showed better salt tolerance of a wild diploid cotton species Gossypium klotzschianum. To elucidate the salt-tolerant mechanisms in G. klotzschianum, we firstly detected the changes in hormones, H2O2 and glutathione (GSSH and GSH), then investigated the gene expression pattern of roots and leaves treated with 300 mM NaCl for 0, 3, 12, 48 h, and each time control by RNA-seq on the Illumina-Solexa platform. Physiological determination proved that the significant increase in hormone ABA at 48 h, while that in H2O2 was at 12 h, likewise, the GSH content decrease at 48 h and the GSSH content increase at 48 h, under salt stress. In total, 37,278 unigenes were identified from the transcriptome data, 8,312 and 6,732 differentially expressed genes (DEGs) were discovered to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation and expression analysis elucidated hormone biosynthesis and signal transduction, reactive oxygen species (ROS), and salt overly sensitive (SOS) signal transduction related genes revealed the important roles of them in signal transmission, oxidation balance and ion homeostasis in response to salinity stress. This is a report which focuses on primary response to highly salty stress (upto 300 mM NaCl) in cotton using a wild diploid Gossypium species, broadening our understanding of the salt tolerance mechanism in cotton and laying a solid foundation of salt resistant for the genetic improvement of upland cotton with the resistance to salt stress.
Wang, Xingxing; Li, Zhenqing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Yuhong; Zhang, Zhenmei; Liu, Fang
2017-01-01
Cotton is a pioneer of saline land crop, while salt stress still causes its growth inhibition and fiber production decrease. Phenotype identification showed better salt tolerance of a wild diploid cotton species Gossypium klotzschianum. To elucidate the salt-tolerant mechanisms in G. klotzschianum, we firstly detected the changes in hormones, H2O2 and glutathione (GSSH and GSH), then investigated the gene expression pattern of roots and leaves treated with 300 mM NaCl for 0, 3, 12, 48 h, and each time control by RNA-seq on the Illumina-Solexa platform. Physiological determination proved that the significant increase in hormone ABA at 48 h, while that in H2O2 was at 12 h, likewise, the GSH content decrease at 48 h and the GSSH content increase at 48 h, under salt stress. In total, 37,278 unigenes were identified from the transcriptome data, 8,312 and 6,732 differentially expressed genes (DEGs) were discovered to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation and expression analysis elucidated hormone biosynthesis and signal transduction, reactive oxygen species (ROS), and salt overly sensitive (SOS) signal transduction related genes revealed the important roles of them in signal transmission, oxidation balance and ion homeostasis in response to salinity stress. This is a report which focuses on primary response to highly salty stress (upto 300 mM NaCl) in cotton using a wild diploid Gossypium species, broadening our understanding of the salt tolerance mechanism in cotton and laying a solid foundation of salt resistant for the genetic improvement of upland cotton with the resistance to salt stress. PMID:28552980
Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system.
Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei
2017-03-13
The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H + -pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6-81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome.
Diversity analysis of cotton (Gossypium hirsutum L.) germplasm using the CottonSNP63K Array.
Hinze, Lori L; Hulse-Kemp, Amanda M; Wilson, Iain W; Zhu, Qian-Hao; Llewellyn, Danny J; Taylor, Jen M; Spriggs, Andrew; Fang, David D; Ulloa, Mauricio; Burke, John J; Giband, Marc; Lacape, Jean-Marc; Van Deynze, Allen; Udall, Joshua A; Scheffler, Jodi A; Hague, Steve; Wendel, Jonathan F; Pepper, Alan E; Frelichowski, James; Lawley, Cindy T; Jones, Don C; Percy, Richard G; Stelly, David M
2017-02-03
Cotton germplasm resources contain beneficial alleles that can be exploited to develop germplasm adapted to emerging environmental and climate conditions. Accessions and lines have traditionally been characterized based on phenotypes, but phenotypic profiles are limited by the cost, time, and space required to make visual observations and measurements. With advances in molecular genetic methods, genotypic profiles are increasingly able to identify differences among accessions due to the larger number of genetic markers that can be measured. A combination of both methods would greatly enhance our ability to characterize germplasm resources. Recent efforts have culminated in the identification of sufficient SNP markers to establish high-throughput genotyping systems, such as the CottonSNP63K array, which enables a researcher to efficiently analyze large numbers of SNP markers and obtain highly repeatable results. In the current investigation, we have utilized the SNP array for analyzing genetic diversity primarily among cotton cultivars, making comparisons to SSR-based phylogenetic analyses, and identifying loci associated with seed nutritional traits. The SNP markers distinctly separated G. hirsutum from other Gossypium species and distinguished the wild from cultivated types of G. hirsutum. The markers also efficiently discerned differences among cultivars, which was the primary goal when designing the CottonSNP63K array. Population structure within the genus compared favorably with previous results obtained using SSR markers, and an association study identified loci linked to factors that affect cottonseed protein content. Our results provide a large genome-wide variation data set for primarily cultivated cotton. Thousands of SNPs in representative cotton genotypes provide an opportunity to finely discriminate among cultivated cotton from around the world. The SNPs will be relevant as dense markers of genome variation for association mapping approaches aimed at
GrTEdb: the first web-based database of transposable elements in cotton (Gossypium raimondii).
Xu, Zhenzhen; Liu, Jing; Ni, Wanchao; Peng, Zhen; Guo, Yue; Ye, Wuwei; Huang, Fang; Zhang, Xianggui; Xu, Peng; Guo, Qi; Shen, Xinlian; Du, Jianchang
2017-01-01
Although several diploid and tetroploid Gossypium species genomes have been sequenced, the well annotated web-based transposable elements (TEs) database is lacking. To better understand the roles of TEs in structural, functional and evolutionary dynamics of the cotton genome, a comprehensive, specific, and user-friendly web-based database, Gossypium raimondii transposable elements database (GrTEdb), was constructed. A total of 14 332 TEs were structurally annotated and clearly categorized in G. raimondii genome, and these elements have been classified into seven distinct superfamilies based on the order of protein-coding domains, structures and/or sequence similarity, including 2929 Copia-like elements, 10 368 Gypsy-like elements, 299 L1 , 12 Mutators , 435 PIF-Harbingers , 275 CACTAs and 14 Helitrons . Meanwhile, the web-based sequence browsing, searching, downloading and blast tool were implemented to help users easily and effectively to annotate the TEs or TE fragments in genomic sequences from G. raimondii and other closely related Gossypium species. GrTEdb provides resources and information related with TEs in G. raimondii , and will facilitate gene and genome analyses within or across Gossypium species, evaluating the impact of TEs on their host genomes, and investigating the potential interaction between TEs and protein-coding genes in Gossypium species. http://www.grtedb.org/. © The Author(s) 2017. Published by Oxford University Press.
Wang, Baohua; Draye, Xavier; Zhuang, Zhimin; Zhang, Zhengsheng; Liu, Min; Lubbers, Edward L; Jones, Don; May, O Lloyd; Paterson, Andrew H; Chee, Peng W
2017-06-01
QTLs for fiber length mapped in three generations of advanced backcross populations derived from crossing Gossypium hirsutum and Gossypium mustelinum showed opportunities to improve elite cottons by introgression from wild relatives. The molecular basis of cotton fiber length in crosses between Gossypium hirsutum and Gossypium mustelinum was dissected using 21 BC 3 F 2 and 12 corresponding BC 3 F 2:3 and BC 3 F 2:4 families. Sixty-five quantitative trait loci (QTLs) were detected by one-way analysis of variance. The QTL numbers detected for upper-half mean length (UHM), fiber uniformity index (UI), and short fiber content (SFC) were 19, 20, and 26 respectively. Twenty-three of the 65 QTLs could be detected at least twice near adjacent markers in the same family or near the same markers across different families/generations, and 32 QTLs were detected in both one-way variance analyses and mixed model-based composite interval mapping. G. mustelinum alleles increased UHM and UI and decreased SFC for five, one, and one QTLs, respectively. In addition to the main-effect QTLs, 17 epistatic QTLs were detected which helped to elucidate the genetic basis of cotton fiber length. Significant among-family genotypic effects were detected at 18, 16, and 16 loci for UHM, UI, and SFC, respectively. Six, two, and two loci showed genotype × family interaction for UHM, UI and SFC, respectively, illustrating complexities that might be faced in introgression of exotic germplasm into cultivated cotton. Co-location of many QTLs for UHM, UI, and SFC accounted for correlations among these traits, and selection of these QTLs may improve the three traits simultaneously. The simple sequence repeat (SSR) markers associated with G. mustelinum QTLs will assist breeders in transferring and maintaining valuable traits from this exotic source during cultivar development.
USDA-ARS?s Scientific Manuscript database
To identify the impact of different water stress deficits on the boll distribution of elite Upland cotton (Gossypium hirsutum L.) cultivars in the Texas High Plains, cultivars which represent the diverse gene-pools of the private sector were subjected to three different water deficit regimes. This s...
Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system
Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei
2017-01-01
The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H+-pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6–81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome. PMID:28287154
Andres, Ryan J; Bowman, Daryl T; Kaur, Baljinder; Kuraparthy, Vasu
2014-01-01
A major leaf shape locus (L) was mapped with molecular markers and genomically targeted to a small region in the D-genome of cotton. By using expression analysis and candidate gene mapping, two LMI1 -like genes are identified as possible candidates for leaf shape trait in cotton. Leaf shape in cotton is an important trait that influences yield, flowering rates, disease resistance, lint trash, and the efficacy of foliar chemical application. The leaves of okra leaf cotton display a significantly enhanced lobing pattern, as well as ectopic outgrowths along the lobe margins when compared with normal leaf cotton. These phenotypes are the hallmark characteristics of mutations in various known modifiers of leaf shape that culminate in the mis/over-expression of Class I KNOX genes. To better understand the molecular and genetic processes underlying leaf shape in cotton, a normal leaf accession (PI607650) was crossed to an okra leaf breeding line (NC05AZ21). An F2 population of 236 individuals confirmed the incompletely dominant single gene nature of the okra leaf shape trait in Gossypium hirsutum L. Molecular mapping with simple sequence repeat markers localized the leaf shape gene to 5.4 cM interval in the distal region of the short arm of chromosome 15. Orthologous mapping of the closely linked markers with the sequenced diploid D-genome (Gossypium raimondii) tentatively resolved the leaf shape locus to a small genomic region. RT-PCR-based expression analysis and candidate gene mapping indicated that the okra leaf shape gene (L (o) ) in cotton might be an upstream regulator of Class I KNOX genes. The linked molecular markers and delineated genomic region in the sequenced diploid D-genome will assist in the future high-resolution mapping and map-based cloning of the leaf shape gene in cotton.
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
As an initial step to explore the transcriptome genetic diversity and to discover single nucleotide polymorphic (SNP)-biomarkers for marker assisted breeding within Pima (Gossypium barbadense L.) cotton, leaves from 25 day plants of three diverse genotypes were used to develop cDNA libraries. Using ...
Genetic diversity in Gossypium genus
USDA-ARS?s Scientific Manuscript database
The overall objectives of this paper are to report on cotton germplasm resources, morphobiological and agronomic diversity of Gossypium genus and review efforts on molecular genetic diversity of cotton gene pools as well as on the challenges and perspectives of exploiting genetic diversity in cotton...
Li, Wen; Li, Deng-Di; Han, Li-Hong; Tao, Miao; Hu, Qian-Qian; Wu, Wen-Ying; Zhang, Jing-Bo; Li, Xue-Bao; Huang, Geng-Qing
2017-08-31
TCP proteins are plant-specific transcription factors (TFs), and perform a variety of physiological functions in plant growth and development. In this study, 74 non-redundant TCP genes were identified in upland cotton (Gossypium hirsutum L.) genome. Cotton TCP family can be classified into two classes (class I and class II) that can be further divided into 11 types (groups) based on their motif composition. Quantitative RT-PCR analysis indicated that GhTCPs display different expression patterns in cotton tissues. The majority of these genes are preferentially or specifically expressed in cotton leaves, while some GhTCP genes are highly expressed in initiating fibers and/or elongating fibers of cotton. Yeast two-hybrid results indicated that GhTCPs can interact with each other to form homodimers or heterodimers. In addition, GhTCP14a and GhTCP22 can interact with some transcription factors which are involved in fiber development. These results lay solid foundation for further study on the functions of TCP genes during cotton fiber development.
Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).
Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F
2006-01-01
Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium spp.), like many crop species worldwide, suffers from low levels of natural genetic diversity. Ethyl MethaneSulfonate (EMS) causes random mutations and has been used as a tool to increase genetic diversity. Therefore, this novel genetic diversity was used for identifying drought to...
USDA-ARS?s Scientific Manuscript database
Next generation sequencing offers new ways to identify the genetic mechanisms that underlie mutant phenotypes. The release of a reference diploid Gossypium raimondii (D5) genome and bioinformatics tools to sort tetraploid reads into subgenomes has brought cotton genetic mapping into the genomics er...
Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad
2018-01-05
Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.
McLoud, Laura Ann; Knutson, Allen; Campos-Figueroa, Manuel; Smith, C Wayne; Hague, Steven
2015-08-01
Cotton fleahopper (Pseudatomoscelis seriatus Reuter) (Hemiptera: Miridae) is a piercing-sucking insect that has emerged as a major pest of cotton (Gossypium hirsutum L.) in Texas. Cotton fleahoppers feed on floral buds, commonly referred to as squares, causing damage and abscission, and subsequent yield loss. Previous studies indicate that plant resistance to cotton fleahopper is present in upland cotton, but the mechanism of resistance remains undetermined. In this study, Pilose, a cultigen of G. hirsutum, was examined as a source of resistance to cotton fleahopper, focusing on mechanism of resistance and heritability of the resistance trait. Results indicated that the resistance trait in Pilose is heritable and that pubescence is causative of resistance or that the resistance trait may be tightly linked to genes controlling pubescence. Behavioral assays indicated nonpreference as a mode of resistance in plants with dense pubescence. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
USDA-ARS?s Scientific Manuscript database
RMBUP-C4 (Random Mated Barbadense Upland Population Cycle 4) (Reg. No. GP_____: PI______) is a unique random mated germplasm population of Upland cotton (Gossypium hirsutum L.) which has introgression of G. barbadense L. alleles. This population involved five cycles of random mating beginning ...
USDA-ARS?s Scientific Manuscript database
Cotton productivity is affected by water deficit, and little is known about the molecular basis of drought tolerance in cotton. In this study, microarray analysis was conducted to identify drought-responsive genes in the third topmost leaves of the field-grown drought-tolerant cotton (Gossypium hirs...
I. Alvarez; R. Cronn; J.F. Wendel
2005-01-01
American diploid cottons (Gossypium L., subgenus Houzingenia Fryxell) form a monophyletic group of 13 species distributed mainly in western Mexico, extending into Arizona, Baja California, and with one disjunct species each in the Galapagos Islands and Peru. Prior phylogenetic analyses based on an alcohol dehydrogenase gene (...
Proteomic profiling of developing cotton fibers from wild and domesticated Gossypium barbadense.
Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Grupp, Kara; Chen, Sixue; Wendel, Jonathan F
2013-10-01
Pima cotton (Gossypium barbadense) is widely cultivated because of its long, strong seed trichomes ('fibers') used for premium textiles. These agronomically advanced fibers were derived following domestication and thousands of years of human-mediated crop improvement. To gain an insight into fiber development and evolution, we conducted comparative proteomic and transcriptomic profiling of developing fiber from an elite cultivar and a wild accession. Analyses using isobaric tag for relative and absolute quantification (iTRAQ) LC-MS/MS technology identified 1317 proteins in fiber. Of these, 205 were differentially expressed across developmental stages, and 190 showed differential expression between wild and cultivated forms, 14.4% of the proteome sampled. Human selection may have shifted the timing of developmental modules, such that some occur earlier in domesticated than in wild cotton. A novel approach was used to detect possible biased expression of homoeologous copies of proteins. Results indicate a significant partitioning of duplicate gene expression at the protein level, but an approximately equal degree of bias for each of the two constituent genomes of allopolyploid cotton. Our results demonstrate the power of complementary transcriptomic and proteomic approaches for the study of the domestication process. They also provide a rich database for mining for functional analyses of cotton improvement or evolution. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.
Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong
2016-01-01
TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372
Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong
2016-02-09
TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.
Zhang, Xiaohong; Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun
2016-01-01
Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton.
Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun
2016-01-01
Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton. PMID:27552108
Gao, Jun-Shan; Wu, Nan; Shen, Zhi-Lin; Lv, Kai; Qian, Sen-He; Guo, Ning; Sun, Xu; Cai, Yong-Ping; Lin, Yi
2016-02-01
Transparent Testa 12 (TT12) is a kind of transmembrane transporter of proanthocyanidins (PAs), which belongs to a membrane-localized multidrug and toxin efflux (MATE) family, but the molecular basis of PAs transport is still poorly understood. Here, we cloned a full-length TT12 cDNA from the fiber of brown cotton (Gossypium hirsutum), named GhTT12 (GenBank accession No. KF240564), which comprised 1733 bp with an open reading frame (ORF) of 1503 bp and encoded a putative protein containing 500 amino acid residues with a typical MATE conserved domain. The GhTT12 gene had 96.8% similarity to AA genome in Gossypium arboretum. Quantitative RT-PCR analysis denoted that the relative expression of GhTT12 in brown cotton was 1-5 folds higher than that in white cotton. The mRNA level was the highest at 5 days post anthesis (DPA) and reduced gradually during the fiber development. Expressing GhTT12-fused green fluorescent protein (GFP) in Nicotiana tabacum showed that GhTT12-GFP was localized in the vacuole membrane. The content of PAs increased firstly and decreased afterwards, and reached the maximum at 15 DPA in brown cotton. But for white cotton, the content of PAs remained at a low level during the fiber development. We speculate that GhTT12 may participate in the transportation of PAs from the cytoplasmic matrix to the vacuole. Taken together, our data revealed that GhTT12 was functional as a PAs transmembrane transporter. Copyright © 2015 Elsevier B.V. All rights reserved.
Bowman, Megan J.; Park, Wonkeun; Bauer, Philip J.; Udall, Joshua A.; Page, Justin T.; Raney, Joshua; Scheffler, Brian E.; Jones, Don. C.; Campbell, B. Todd
2013-01-01
An RNA-Seq experiment was performed using field grown well-watered and naturally rain fed cotton plants to identify differentially expressed transcripts under water-deficit stress. Our work constitutes the first application of the newly published diploid D5 Gossypium raimondii sequence in the study of tetraploid AD1 upland cotton RNA-seq transcriptome analysis. A total of 1,530 transcripts were differentially expressed between well-watered and water-deficit stressed root tissues, in patterns that confirm the accuracy of this technique for future studies in cotton genomics. Additionally, putative sequence based genome localization of differentially expressed transcripts detected A2 genome specific gene expression under water-deficit stress. These data will facilitate efforts to understand the complex responses governing transcriptomic regulatory mechanisms and to identify candidate genes that may benefit applied plant breeding programs. PMID:24324815
A global assembly of cotton ESTs
Udall, Joshua A.; Swanson, Jordan M.; Haller, Karl; Rapp, Ryan A.; Sparks, Michael E.; Hatfield, Jamie; Yu, Yeisoo; Wu, Yingru; Dowd, Caitriona; Arpat, Aladdin B.; Sickler, Brad A.; Wilkins, Thea A.; Guo, Jin Ying; Chen, Xiao Ya; Scheffler, Jodi; Taliercio, Earl; Turley, Ricky; McFadden, Helen; Payton, Paxton; Klueva, Natalya; Allen, Randell; Zhang, Deshui; Haigler, Candace; Wilkerson, Curtis; Suo, Jinfeng; Schulze, Stefan R.; Pierce, Margaret L.; Essenberg, Margaret; Kim, HyeRan; Llewellyn, Danny J.; Dennis, Elizabeth S.; Kudrna, David; Wing, Rod; Paterson, Andrew H.; Soderlund, Cari; Wendel, Jonathan F.
2006-01-01
Approximately 185,000 Gossypium EST sequences comprising >94,800,000 nucleotides were amassed from 30 cDNA libraries constructed from a variety of tissues and organs under a range of conditions, including drought stress and pathogen challenges. These libraries were derived from allopolyploid cotton (Gossypium hirsutum; AT and DT genomes) as well as its two diploid progenitors, Gossypium arboreum (A genome) and Gossypium raimondii (D genome). ESTs were assembled using the Program for Assembling and Viewing ESTs (PAVE), resulting in 22,030 contigs and 29,077 singletons (51,107 unigenes). Further comparisons among the singletons and contigs led to recognition of 33,665 exemplar sequences that represent a nonredundant set of putative Gossypium genes containing partial or full-length coding regions and usually one or two UTRs. The assembly, along with their UniProt BLASTX hits, GO annotation, and Pfam analysis results, are freely accessible as a public resource for cotton genomics. Because ESTs from diploid and allotetraploid Gossypium were combined in a single assembly, we were in many cases able to bioinformatically distinguish duplicated genes in allotetraploid cotton and assign them to either the A or D genome. The assembly and associated information provide a framework for future investigation of cotton functional and evolutionary genomics. PMID:16478941
Li, Peng-Tao; Wang, Mi; Lu, Quan-Wei; Ge, Qun; Rashid, Md Harun Or; Liu, Ai-Ying; Gong, Ju-Wu; Shang, Hai-Hong; Gong, Wan-Kui; Li, Jun-Wen; Song, Wei-Wu; Guo, Li-Xue; Su, Wei; Li, Shao-Qi; Guo, Xiao-Ping; Shi, Yu-Zhen; Yuan, You-Lu
2017-09-08
How to develop new cotton varieties possessing high yield traits of Upland cotton and superior fiber quality traits of Sea Island cotton remains a key task for cotton breeders and researchers. While multiple attempts bring in little significant progresses, the development of Chromosome Segment Substitution Lines (CSSLs) from Gossypium barbadense in G. hirsutum background provided ideal materials for aforementioned breeding purposes in upland cotton improvement. Based on the excellent fiber performance and relatively clear chromosome substitution segments information identified by Simple Sequence Repeat (SSR) markers, two CSSLs, MBI9915 and MBI9749, together with the recurrent parent CCRI36 were chosen to conduct transcriptome sequencing during the development stages of fiber elongation and Secondary Cell Wall (SCW) synthesis (from 10DPA and 28DPA), aiming at revealing the mechanism of fiber development and the potential contribution of chromosome substitution segments from Sea Island cotton to fiber development of Upland cotton. In total, 15 RNA-seq libraries were constructed and sequenced separately, generating 705.433 million clean reads with mean GC content of 45.13% and average Q30 of 90.26%. Through multiple comparisons between libraries, 1801 differentially expressed genes (DEGs) were identified, of which the 902 up-regulated DEGs were mainly involved in cell wall organization and response to oxidative stress and auxin, while the 898 down-regulated ones participated in translation, regulation of transcription, DNA-templated and cytoplasmic translation based on GO annotation and KEGG enrichment analysis. Subsequently, STEM software was performed to explicate the temporal expression pattern of DEGs. Two peroxidases and four flavonoid pathway-related genes were identified in the "oxidation-reduction process", which could play a role in fiber development and quality formation. Finally, the reliability of RNA-seq data was validated by quantitative real-time PCR
Evolutionary Conservation and Divergence of Gene Coexpression Networks in Gossypium (Cotton) Seeds.
Hu, Guanjing; Hovav, Ran; Grover, Corrinne E; Faigenboim-Doron, Adi; Kadmon, Noa; Page, Justin T; Udall, Joshua A; Wendel, Jonathan F
2016-12-01
The cotton genus (Gossypium) provides a superior system for the study of diversification, genome evolution, polyploidization, and human-mediated selection. To gain insight into phenotypic diversification in cotton seeds, we conducted coexpression network analysis of developing seeds from diploid and allopolyploid cotton species and explored network properties. Key network modules and functional associations were identified related to seed oil content and seed weight. We compared species-specific networks to reveal topological changes, including rewired edges and differentially coexpressed genes, associated with speciation, polyploidy, and cotton domestication. Network comparisons among species indicate that topologies are altered in addition to gene expression profiles, indicating that changes in transcriptomic coexpression relationships play a role in the developmental architecture of cotton seed development. The global network topology of allopolyploids, especially for domesticated G. hirsutum, resembles the network of the A-genome diploid more than that of the D-genome parent, despite its D-like phenotype in oil content. Expression modifications associated with allopolyploidy include coexpression level dominance and transgressive expression, suggesting that the transcriptomic architecture in polyploids is to some extent a modular combination of that of its progenitor genomes. Among allopolyploids, intermodular relationships are more preserved between two different wild allopolyploid species than they are between wild and domesticated forms of a cultivated cotton, and regulatory connections of oil synthesis-related pathways are denser and more closely clustered in domesticated vs. wild G. hirsutum. These results demonstrate substantial modification of genic coexpression under domestication. Our work demonstrates how network inference informs our understanding of the transcriptomic architecture of phenotypic variation associated with temporal scales ranging from
Dai, Baosheng; Guo, Huanle; Huang, Cong; Zhang, Xianlong; Lin, Zhongxu
2016-04-12
Hybrid breakdown has been well documented in various species. Relationships between genomic heterozygosity and traits-fitness have been extensively explored especially in the natural populations. But correlations between genomic heterozygosity and vegetative and reproductive traits in cotton interspecific populations have not been studied. In the current study, two reciprocal F2 populations were developed using Gossypium hirsutum cv. Emian 22 and G. barbadense acc. 3-79 as parents to study hybrid breakdown in cotton. A total of 125 simple sequence repeat (SSR) markers were used to genotype the two F2 interspecific populations. To guarantee mutual independence among the genotyped markers, the 125 SSR markers were checked by the linkage disequilibrium analysis. To our knowledge, this is a novel approach to evaluate the individual genomic heterozygosity. After marker checking, 83 common loci were used to assess the extent of genomic heterozygosity. Hybrid breakdown was found extensively in the two interspecific F2 populations particularly on the reproductive traits because of the infertility and the bare seeds. And then, the relationships between the genomic heterozygosity and the vegetative reproductive traits were investigated. The only relationships between hybrid breakdown and heterozygosity were observed in the (Emian22 × 3-79) F2 population for seed index (SI) and boll number per plant (BN). The maternal cytoplasmic environment may have a significant effect on genomic heterozygosity and on correlations between heterozygosity and reproductive traits. A novel approach was used to evaluate genomic heterozygosity in cotton; and hybrid breakdown was observed in reproductive traits in cotton. These findings may offer new insight into hybrid breakdown in allotetraploid cotton interspecific hybrids, and may be useful for the development of interspecific hybrids for cotton genetic improvement.
USDA-ARS?s Scientific Manuscript database
Crosses between Gossypium barbadense L. and Upland (G. hirsutum L.) have produced limited success in introgressing fiber quality genes into Upland cotton. Chrosome substitution lines (CSL) have chromosomes or arms from G. barbadense, line 3-79, substituted for the corresponding chromosome or arm in ...
USDA-ARS?s Scientific Manuscript database
Changes in temperature, atmospheric [CO2] and precipitation under the scenarios of projected climate change present a challenge to crop production, and may have significant impacts on the physiology, growth and yield of cotton (Gossypium hirsutum L.). A glasshouse experiment explored the early growt...
USDA-ARS?s Scientific Manuscript database
MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...
Chen, Wen; Si, Guo-Yang; Zhao, Gang; Abdullah, Muhammad; Guo, Ning; Li, Da-Hui; Sun, Xu; Cai, Yong-Ping; Lin, Yi; Gao, Jun-Shan
2018-05-05
Plant P-type H⁺-ATPase (P-ATPase) is a membrane protein existing in the plasma membrane that plays an important role in the transmembrane transport of plant cells. To understand the variety and quantity of P-ATPase proteins in different cotton species, we combined four databases from two diploid cotton species ( Gossypium raimondii and G. arboreum ) and two tetraploid cotton species ( G. hirsutum and G. barbadense ) to screen the P-ATPase gene family and resolved the evolutionary relationships between the former cotton species. We identified 53, 51, 99 and 98 P-ATPase genes from G. arboretum, G. raimondii , G. barbadense and G. hirsutum , respectively. The structural and phylogenetic analyses revealed that the gene structure was consistent between P-ATPase genes, with a close evolutionary relationship. The expression analysis of P-ATPase genes showed that many P-ATPase genes were highly expressed in various tissues and at different fiber developmental stages in G. hirsutum , suggesting that they have potential functions during growth and fiber development in cotton.
QTL mapping for flowering-time and photoperiod insensitivity of cotton Gossypium darwinii Watt.
Kushanov, Fakhriddin N; Buriev, Zabardast T; Shermatov, Shukhrat E; Turaev, Ozod S; Norov, Tokhir M; Pepper, Alan E; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Jenkins, Johnie N; Abdukarimov, Abdusattor; Abdurakhmonov, Ibrokhim Y
2017-01-01
Most wild and semi-wild species of the genus Gossypium are exhibit photoperiod-sensitive flowering. The wild germplasm cotton is a valuable source of genes for genetic improvement of modern cotton cultivars. A bi-parental cotton population segregating for photoperiodic flowering was developed by crossing a photoperiod insensitive irradiation mutant line with its pre-mutagenesis photoperiodic wild-type G. darwinii Watt genotype. Individuals from the F2 and F3 generations were grown with their parental lines and F1 hybrid progeny in the long day and short night summer condition (natural day-length) of Uzbekistan to evaluate photoperiod sensitivity, i.e., flowering-time during the seasons 2008-2009. Through genotyping the individuals of this bi-parental population segregating for flowering-time, linkage maps were constructed using 212 simple-sequence repeat (SSR) and three cleaved amplified polymorphic sequence (CAPS) markers. Six QTLs directly associated with flowering-time and photoperiodic flowering were discovered in the F2 population, whereas eight QTLs were identified in the F3 population. Two QTLs controlling photoperiodic flowering and duration of flowering were common in both populations. In silico annotations of the flanking DNA sequences of mapped SSRs from sequenced cotton (G. hirsutum L.) genome database has identified several potential 'candidate' genes that are known to be associated with regulation of flowering characteristics of plants. The outcome of this research will expand our understanding of the genetic and molecular mechanisms of photoperiodic flowering. Identified markers should be useful for marker-assisted selection in cotton breeding to improve early flowering characteristics.
GhNAC12, a neutral candidate gene, leads to early aging in cotton (Gossypium hirsutum L).
Zhao, Fengli; Ma, Jianhui; Li, Libei; Fan, Shuli; Guo, Yaning; Song, Meizhen; Wei, Hengling; Pang, Chaoyou; Yu, Shuxun
2016-01-15
NAC (NAM, ATAF, and CUC) is one of the largest transcription factor families in plants, and its members play various roles in plant growth, development, and the response to biotic and abiotic stresses. Currently, 77 NAC genes have been reported in cotton (Gossypium hirsutum L.). And GhNAC12 showed up-regulation during leaf senescence, but its role in this process is poorly understood. In the present study, a preliminary function analysis of GhNAC12 was performed during leaf senescence. qRT-PCR analysis indicated that GhNAC12 expression increased during the early-aging process and the aging of cotyledons. Additionally, we observed that overexpression of GhNAC12 in Arabidopsis led to early senescence (early aging). Our findings suggest that GhNAC12 is a candidate gene for early aging in upland cotton cultivars. Neutrality tests suggested that there was no selection pressure imposed on GhNAC12 during the domestication of upland cotton. Copyright © 2015 Elsevier B.V. All rights reserved.
Li, Fangjun; Li, Maoying; Wang, Ping; Cox, Kevin L; Duan, Liusheng; Dever, Jane K; Shan, Libo; Li, Zhaohu; He, Ping
2017-09-01
Drought is a key limiting factor for cotton (Gossypium spp.) production, as more than half of the global cotton supply is grown in regions with high water shortage. However, the underlying mechanism of the response of cotton to drought stress remains elusive. By combining genome-wide transcriptome profiling and a loss-of-function screen using virus-induced gene silencing, we identified Gossypium hirsutum GhWRKY59 as an important transcription factor that regulates the drought stress response in cotton. Biochemical and genetic analyses revealed a drought stress-activated mitogen-activated protein (MAP) kinase cascade consisting of GhMAP3K15-Mitogen-activated Protein Kinase Kinase 4 (GhMKK4)-Mitogen-activated Protein Kinase 6 (GhMPK6) that directly phosphorylates GhWRKY59 at residue serine 221. Interestingly, GhWRKY59 is required for dehydration-induced expression of GhMAPK3K15, constituting a positive feedback loop of GhWRKY59-regulated MAP kinase activation in response to drought stress. Moreover, GhWRKY59 directly binds to the W-boxes of DEHYDRATION-RESPONSIVE ELEMENT-BINDING PROTEIN 2 (GhDREB2), which encodes a dehydration-inducible transcription factor regulating the plant hormone abscisic acid (ABA)-independent drought response. Our study identified a complete MAP kinase cascade that phosphorylates and activates a key WRKY transcription factor, and elucidated a regulatory module, consisting of GhMAP3K15-GhMKK4-GhMPK6-GhWRKY59-GhDREB2, that is involved in controlling the cotton drought response. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Ashfaq, Muhammad; Asif, Muhammad; Anjum, Zahid Iqbal; Zafar, Yusuf
2013-07-01
Although two plastid regions have been adopted as the standard markers for plant DNA barcoding, their limited resolution has provoked the consideration of other gene regions, especially in taxonomically diverse genera. The genus Gossypium (cotton) includes eight diploid genome groups (A-G, and K) and five allotetraploid species which are difficult to discriminate morphologically. In this study, we tested the effectiveness of three widely used markers (matK, rbcL, and ITS2) in the discrimination of 20 diploid and five tetraploid species of cotton. Sequences were analysed locus-wise and in combinations to determine the most effective strategy for species identification. Sequence recovery was high, ranging from 92% to 100% with mean pairwise interspecific distance highest for ITS2 (3.68%) and lowest for rbcL (0.43%). At a 0.5% threshold, the combination of matK+ITS2 produced the greatest number of species clusters. Based on 'best match' analysis, the combination of matK+ITS2 was best, while based on 'all species barcodes' analysis, ITS2 gave the highest percentage of correct species identifications (98.93%). The combination of sequences for all three markers produced the best resolved tree. The disparity index test based on matK+rbcL+ITS2 was significant (P < 0.05) for a higher number of species pairs than the individual gene sequences. Although all three barcodes separated the species with respect to their genome type, no single combination of barcodes could differentiate all the Gossypium species, and tetraploid species were particularly difficult. © 2013 John Wiley & Sons Ltd.
USDA-ARS?s Scientific Manuscript database
To Identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode and fungal disease resistance traits, a series of interspecific cotton (Gossypium spp.) chromosome substitution (CS) lines were used in this study. The CS lines were developed in ...
Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping
2012-01-01
Background Cotton (Gossypium spp.) is a model system for the analysis of polyploidization. Although ascertaining the donor species of allotetraploid cotton has been intensively studied, sequence comparison of Gossypium chloroplast genomes is still of interest to understand the mechanisms underlining the evolution of Gossypium allotetraploids, while it is generally accepted that the parents were A- and D-genome containing species. Here we performed a comparative analysis of 13 Gossypium chloroplast genomes, twelve of which are presented here for the first time. Methodology/Principal Findings The size of 12 chloroplast genomes under study varied from 159,959 bp to 160,433 bp. The chromosomes were highly similar having >98% sequence identity. They encoded the same set of 112 unique genes which occurred in a uniform order with only slightly different boundary junctions. Divergence due to indels as well as substitutions was examined separately for genome, coding and noncoding sequences. The genome divergence was estimated as 0.374% to 0.583% between allotetraploid species and A-genome, and 0.159% to 0.454% within allotetraploids. Forty protein-coding genes were completely identical at the protein level, and 20 intergenic sequences were completely conserved. The 9 allotetraploids shared 5 insertions and 9 deletions in whole genome, and 7-bp substitutions in protein-coding genes. The phylogenetic tree confirmed a close relationship between allotetraploids and the ancestor of A-genome, and the allotetraploids were divided into four separate groups. Progenitor allotetraploid cotton originated 0.43–0.68 million years ago (MYA). Conclusion Despite high degree of conservation between the Gossypium chloroplast genomes, sequence variations among species could still be detected. Gossypium chloroplast genomes preferred for 5-bp indels and 1–3-bp indels are mainly attributed to the SSR polymorphisms. This study supports that the common ancestor of diploid A-genome species in
Zhang, Feng; Zhu, Guozhong; Du, Lei; Shang, Xiaoguang; Cheng, Chaoze; Yang, Bing; Hu, Yan; Cai, Caiping; Guo, Wangzhen
2016-01-01
Cotton is an economically important crop throughout the world, and is a pioneer crop in salt stress tolerance research. Investigation of the genetic regulation of salinity tolerance will provide information for salt stress-resistant breeding. Here, we employed next-generation RNA-Seq technology to elucidate the salt-tolerant mechanisms in cotton using the diploid cotton species Gossypium davidsonii which has superior stress tolerance. A total of 4744 and 5337 differentially expressed genes (DEGs) were found to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation elucidated salt overly sensitive (SOS) and reactive oxygen species (ROS) signaling pathways. Furthermore, we found that photosynthesis pathways and metabolism play important roles in ion homeostasis and oxidation balance. Moreover, our studies revealed that alternative splicing also contributes to salt-stress responses at the posttranscriptional level, implying its functional role in response to salinity stress. This study not only provides a valuable resource for understanding the genetic control of salt stress in cotton, but also lays a substantial foundation for the genetic improvement of crop resistance to salt stress. PMID:26838812
Zhang, Feng; Zhu, Guozhong; Du, Lei; Shang, Xiaoguang; Cheng, Chaoze; Yang, Bing; Hu, Yan; Cai, Caiping; Guo, Wangzhen
2016-02-03
Cotton is an economically important crop throughout the world, and is a pioneer crop in salt stress tolerance research. Investigation of the genetic regulation of salinity tolerance will provide information for salt stress-resistant breeding. Here, we employed next-generation RNA-Seq technology to elucidate the salt-tolerant mechanisms in cotton using the diploid cotton species Gossypium davidsonii which has superior stress tolerance. A total of 4744 and 5337 differentially expressed genes (DEGs) were found to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation elucidated salt overly sensitive (SOS) and reactive oxygen species (ROS) signaling pathways. Furthermore, we found that photosynthesis pathways and metabolism play important roles in ion homeostasis and oxidation balance. Moreover, our studies revealed that alternative splicing also contributes to salt-stress responses at the posttranscriptional level, implying its functional role in response to salinity stress. This study not only provides a valuable resource for understanding the genetic control of salt stress in cotton, but also lays a substantial foundation for the genetic improvement of crop resistance to salt stress.
Said, Joseph I; Knapka, Joseph A; Song, Mingzhou; Zhang, Jinfa
2015-08-01
A specialized database currently containing more than 2200 QTL is established, which allows graphic presentation, visualization and submission of QTL. In cotton quantitative trait loci (QTL), studies are focused on intraspecific Gossypium hirsutum and interspecific G. hirsutum × G. barbadense populations. These two populations are commercially important for the textile industry and are evaluated for fiber quality, yield, seed quality, resistance, physiological, and morphological trait QTL. With meta-analysis data based on the vast amount of QTL studies in cotton it will be beneficial to organize the data into a functional database for the cotton community. Here we provide a tool for cotton researchers to visualize previously identified QTL and submit their own QTL to the Cotton QTLdb database. The database provides the user with the option of selecting various QTL trait types from either the G. hirsutum or G. hirsutum × G. barbadense populations. Based on the user's QTL trait selection, graphical representations of chromosomes of the population selected are displayed in publication ready images. The database also provides users with trait information on QTL, LOD scores, and explained phenotypic variances for all QTL selected. The CottonQTLdb database provides cotton geneticist and breeders with statistical data on cotton QTL previously identified and provides a visualization tool to view QTL positions on chromosomes. Currently the database (Release 1) contains 2274 QTLs, and succeeding QTL studies will be updated regularly by the curators and members of the cotton community that contribute their data to keep the database current. The database is accessible from http://www.cottonqtldb.org.
Li, Ruijuan; Rashotte, Aaron M; Singh, Narendra K; Lawrence, Kathy S; Weaver, David B; Locy, Robert D
2015-01-01
Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.). An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747), resistant (BARBREN-713), and hypersensitive (LONREN-1) genotypes of cotton (Gossypium hirsutum L.) with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.
Nazeer, W; Ahmad, S; Mahmood, K; Tipu, A L; Mahmood, A; Zhou, B
2014-02-21
Cotton leaf curl virus disease is a major hurdle for successful cotton production in Pakistan. There has been considerable economic loss due to this disease during the last decade. It would be desirable to have cotton varieties resistant to this disease. We explored the possibility of transferring virus resistant genes from the wild species Gossypium stocksii into MNH-786, a cultivar of G. hirsutum. Hybridization was done under field condition at the Cotton Research Station, Multan, during 2010-11. Boll shedding was controlled by application of exogenous hormones. F1 seeds were treated with 0.03% colchicine solution for 6 h and germinated. Cytological observations at peak squaring/flowering stage showed that these plants were hexaploid, having 2n = 6x = 78 chromosomes. The F1 plants showed intermediate expression for leaf size, leaf area, petiole length, bracteole number and size, bracteole area, bracteole dentation, flower size, pedicel size, and petal number and size. Moreover it possessed high fiber strength of 54.4 g/tex, which is 54% greater than that of the check variety, i.e. MNH-786 (G. hirsutum). The F1 population did not show any symptom of CLCuVD in the field, tested by grafting with CLCuVD susceptible rootstock (var. S12). We conclude that it is possible to transfer CLCuVD resistance and high fiber strength from G. stocksii to G. hirsutum.
Yan, Jun; Li, Guilin; Guo, Xingqi; Li, Yang; Cao, Xuecheng
2018-01-01
The protein kinase (PK, kinome) family is one of the largest families in plants and regulates almost all aspects of plant processes, including plant development and stress responses. Despite their important functions, comprehensive functional classification, evolutionary analysis and expression patterns of the cotton PK gene family has yet to be performed on PK genes. In this study, we identified the cotton kinomes in the Gossypium raimondii, Gossypium arboretum, Gossypium hirsutum and Gossypium barbadense genomes and classified them into 7 groups and 122–24 subfamilies using software HMMER v3.0 scanning and neighbor-joining (NJ) phylogenetic analysis. Some conserved exon-intron structures were identified not only in cotton species but also in primitive plants, ferns and moss, suggesting the significant function and ancient origination of these PK genes. Collinearity analysis revealed that 16.6 million years ago (Mya) cotton-specific whole genome duplication (WGD) events may have played a partial role in the expansion of the cotton kinomes, whereas tandem duplication (TD) events mainly contributed to the expansion of the cotton RLK group. Synteny analysis revealed that tetraploidization of G. hirsutum and G. barbadense contributed to the expansion of G. hirsutum and G. barbadense PKs. Global expression analysis of cotton PKs revealed stress-specific and fiber development-related expression patterns, suggesting that many cotton PKs might be involved in the regulation of the stress response and fiber development processes. This study provides foundational information for further studies on the evolution and molecular function of cotton PKs. PMID:29768506
Zhang, Jinfa; Wu, Man; Yu, Jiwen; Li, Xingli; Pei, Wenfeng
2016-01-01
Upland cotton (Gossypium hirstum L.), which produces more than 95% of the world natural cotton fibers, has a narrow genetic base which hinders progress in cotton breeding. Introducing germplasm from exotic sources especially from another cultivated tetraploid G. barbadense L. can broaden the genetic base of Upland cotton. However, the breeding potential of introgression lines (ILs) in Upland cotton with G. barbadense germplasm integration has not been well addressed. This study involved six ILs developed from an interspecific crossing and backcrossing between Upland cotton and G. barbadense and represented one of the first studies to investigate breeding potentials of a set of ILs using a full diallel analysis. High mid-parent heterosis was detected in several hybrids between ILs and a commercial cultivar, which also out-yielded the high-yielding cultivar parent in F1, F2 and F3 generations. A further analysis indicated that general ability (GCA) variance was predominant for all the traits, while specific combining ability (SCA) variance was either non-existent or much lower than GCA. The estimated GCA effects and predicted additive effects for parents in each trait were positively correlated (at P<0.01). Furthermore, GCA and additive effects for each trait were also positively correlated among generations (at P<0.05), suggesting that F2 and F3 generations can be used as a proxy to F1 in analyzing combining abilities and estimating genetic parameters. In addition, differences between reciprocal crosses in F1 and F2 were not significant for yield, yield components and fiber quality traits. But maternal effects appeared to be present for seed oil and protein contents in F3. This study identified introgression lines as good general combiners for yield and fiber quality improvement and hybrids with high heterotic vigor in yield, and therefore provided useful information for further utilization of introgression lines in cotton breeding.
2013-01-01
Background Cotton, one of the world’s leading crops, is important to the world’s textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. Results We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome
Genetic diversity of sea-island cotton (Gossypium barbadense) revealed by mapped SSRs.
Wang, X Q; Feng, C H; Lin, Z X; Zhang, X L
2011-12-08
In order to evaluate the genetic diversity of sea-island cotton (Gossypium barbadense), 237 commonly mapped SSR markers covering the cotton genome were used to genotype 56 sea-island cotton accessions. A total of 218 polymorphic primer pairs (91.98%) amplified 361 loci, with a mean of 1.66 loci. Polymorphism information content values of the SSR primers ranged from 0.035 to 0.862, with a mean of 0.320. The highest mean polymorphism information content value for the SSR motifs was from a compound motif (0.402), and for the chromosomes it was Chr10 (0.589); the highest ratio of polymorphic primers in Xinjiang accessions was from Chr21 (83.33%). Genetic diversity was high in Xinjiang accessions. AMOVA showed that variation was 8 and 92% among populations and within populations, respectively. The 56 sea-island accessions were divided into three groups in the UPGMA dendrogram: Xinhai5 was in the first group; accessions from Xinjiang, except the five main ones, were in the second group, and the other 34 accessions were in the third group. Accessions from the former Soviet Union and Xinjiang main accessions were closely related. Both PCA and UPGMA confirmed that Xinhai5 was distinct from the other accessions, and accessions from Xinjiang were in an independent group. Given the differences between principal components analysis and UPGMA results, it is necessary to combine molecular markers and pedigree information so that genetic diversity can be objectively analyzed.
Xu, Zhenzhen; Zhang, Chaojun; Ge, Xiaoyang; Wang, Ni; Zhou, Kehai; Yang, Xiaojie; Wu, Zhixia; Zhang, Xueyan; Liu, Chuanliang; Yang, Zuoren; Li, Changfeng; Liu, Kun; Yang, Zhaoen; Qian, Yuyuan; Li, Fuguang
2015-07-01
The first high-density linkage map was constructed to identify quantitative trait loci (QTLs) for somatic embryogenesis (SE) in cotton ( Gossypium hirsutum L.) using leaf petioles as explants. Cotton transformation is highly limited by only a few regenerable genotypes and the lack of understanding of the genetic and molecular basis of somatic embryogenesis (SE) in cotton (Gossypium hirsutum L.). To construct a more saturated linkage map and further identify quantitative trait loci (QTLs) for SE using leaf petioles as explants, a high embryogenesis frequency line (W10) from the commercial Chinese cotton cultivar CRI24 was crossed with TM-1, a genetic standard upland cotton with no embryogenesis frequency. The genetic map spanned 2300.41 cM in genetic distance and contained 411 polymorphic simple sequence repeat (SSR) loci. Of the 411 mapped loci, 25 were developed from unigenes identified for SE in our previous study. Six QTLs for SE were detected by composite interval mapping method, each explaining 6.88-37.07% of the phenotypic variance. Single marker analysis was also performed to verify the reliability of QTLs detection, and the SSR markers NAU3325 and DPL0209 were detected by the two methods. Further studies on the relatively stable and anchoring QTLs/markers for SE in an advanced population of W10 × TM-1 and other cross combinations with different SE abilities may shed light on the genetic and molecular mechanism of SE in cotton.
Li, Xingli; Pei, Wenfeng
2016-01-01
Upland cotton (Gossypium hirstum L.), which produces more than 95% of the world natural cotton fibers, has a narrow genetic base which hinders progress in cotton breeding. Introducing germplasm from exotic sources especially from another cultivated tetraploid G. barbadense L. can broaden the genetic base of Upland cotton. However, the breeding potential of introgression lines (ILs) in Upland cotton with G. barbadense germplasm integration has not been well addressed. This study involved six ILs developed from an interspecific crossing and backcrossing between Upland cotton and G. barbadense and represented one of the first studies to investigate breeding potentials of a set of ILs using a full diallel analysis. High mid-parent heterosis was detected in several hybrids between ILs and a commercial cultivar, which also out-yielded the high-yielding cultivar parent in F1, F2 and F3 generations. A further analysis indicated that general ability (GCA) variance was predominant for all the traits, while specific combining ability (SCA) variance was either non-existent or much lower than GCA. The estimated GCA effects and predicted additive effects for parents in each trait were positively correlated (at P<0.01). Furthermore, GCA and additive effects for each trait were also positively correlated among generations (at P<0.05), suggesting that F2 and F3 generations can be used as a proxy to F1 in analyzing combining abilities and estimating genetic parameters. In addition, differences between reciprocal crosses in F1 and F2 were not significant for yield, yield components and fiber quality traits. But maternal effects appeared to be present for seed oil and protein contents in F3. This study identified introgression lines as good general combiners for yield and fiber quality improvement and hybrids with high heterotic vigor in yield, and therefore provided useful information for further utilization of introgression lines in cotton breeding. PMID:26730964
Artico, Sinara; Ribeiro-Alves, Marcelo; Oliveira-Neto, Osmundo Brilhante; de Macedo, Leonardo Lima Pepino; Silveira, Sylvia; Grossi-de-Sa, Maria Fátima; Martinelli, Adriana Pinheiro; Alves-Ferreira, Marcio
2014-10-04
Cotton is a major fibre crop grown worldwide that suffers extensive damage from chewing insects, including the cotton boll weevil larvae (Anthonomus grandis). Transcriptome analysis was performed to understand the molecular interactions between Gossypium hirsutum L. and cotton boll weevil larvae. The Illumina HiSeq 2000 platform was used to sequence the transcriptome of cotton flower buds infested with boll weevil larvae. The analysis generated a total of 327,489,418 sequence reads that were aligned to the G. hirsutum reference transcriptome. The total number of expressed genes was over 21,697 per sample with an average length of 1,063 bp. The DEGseq analysis identified 443 differentially expressed genes (DEG) in cotton flower buds infected with boll weevil larvae. Among them, 402 (90.7%) were up-regulated, 41 (9.3%) were down-regulated and 432 (97.5%) were identified as orthologues of A. thaliana genes using Blastx. Mapman analysis of DEG indicated that many genes were involved in the biotic stress response spanning a range of functions, from a gene encoding a receptor-like kinase to genes involved in triggering defensive responses such as MAPK, transcription factors (WRKY and ERF) and signalling by ethylene (ET) and jasmonic acid (JA) hormones. Furthermore, the spatial expression pattern of 32 of the genes responsive to boll weevil larvae feeding was determined by "in situ" qPCR analysis from RNA isolated from two flower structures, the stamen and the carpel, by laser microdissection (LMD). A large number of cotton transcripts were significantly altered upon infestation by larvae. Among the changes in gene expression, we highlighted the transcription of receptors/sensors that recognise chitin or insect oral secretions; the altered regulation of transcripts encoding enzymes related to kinase cascades, transcription factors, Ca2+ influxes, and reactive oxygen species; and the modulation of transcripts encoding enzymes from phytohormone signalling pathways. These
Test cross evaluation of upland cotton accessions for selected fiber properties
USDA-ARS?s Scientific Manuscript database
Texas A&M AgriLife Research released several upland cotton (Gossypium hirsutum L.) germplasm lines that exhibit near extra-long and extra-long staple (ELS) upper half mean length (UHML) fibers, similar to those produced by pima cotton (Gossypium barbadense L.) and significantly longer than those of ...
Paterson, Andrew H.; Wang, Xuelin; Xu, Yiqing; Wu, Dongyang; Qu, Yanshu; Jiang, Anna; Ye, Qiaolin
2016-01-01
Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp) genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt) DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb) in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense) than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants. PMID:27847816
Hinze, Lori L; Gazave, Elodie; Gore, Michael A; Fang, David D; Scheffler, Brian E; Yu, John Z; Jones, Don C; Frelichowski, James; Percy, Richard G
2016-05-01
A diversity reference set has been constructed for the Gossypium accessions in the US National Cotton Germplasm Collection to facilitate more extensive evaluation and utilization of accessions held in the Collection. A set of 105 mapped simple sequence repeat markers was used to study the allelic diversity of 1933 tetraploid Gossypium accessions representative of the range of diversity of the improved and wild accessions of G. hirsutum and G. barbadense. The reference set contained 410 G. barbadense accessions and 1523 G. hirsutum accessions. Observed numbers of polymorphic and private bands indicated a greater diversity in G. hirsutum as compared to G. barbadense as well as in wild-type accessions as compared to improved accessions in both species. The markers clearly differentiated the 2 species. Patterns of diversity within species were observed but not clearly delineated, with much overlap occurring between races and regions of origin for wild accessions and between historical and geographic breeding pools for cultivated accessions. Although the percentage of accessions showing introgression was higher among wild accessions than cultivars in both species, the average level of introgression within individual accessions, as indicated by species-specific bands, was much higher in wild accessions of G. hirsutum than in wild accessions of G. barbadense. The average level of introgression within individual accessions was higher in improved G. barbadense cultivars than in G. hirsutum cultivars. This molecular characterization reveals the levels and distributions of genetic diversity that will allow for better exploration and utilization of cotton genetic resources. Published by Oxford University Press on behalf of the American Genetic Association 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.
USDA-ARS?s Scientific Manuscript database
Some naturally-colored brown cotton fibers from accessions of Gossypium hirsutum L. can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fiber loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the me...
USDA-ARS?s Scientific Manuscript database
Some naturally-coloured brown cotton fibres from accessions of Gossypium hirsutum can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have yet to be identified, and the mechan...
Anwaar, Shad Ali; Ali, Shafaqat; Ali, Skhawat; Ishaque, Wajid; Farid, Mujahid; Farooq, Muhammad Ahsan; Najeeb, Ullah; Abbas, Farhat; Sharif, Muhammad
2015-03-01
Silicon (Si) is as an important fertilizer element, which has been found effective in enhancing plant tolerance to variety of biotic and a-biotic stresses. This study investigates the Si potential to alleviate zinc (Zn) toxicity stress in cotton (Gossypium hirsutum L.). Cotton plants were grown in hydroponics and exposed to different Zn concentration, 0, 25, and 50 μM, alone and/or in combination with 1 mM Si. Incremental Zn concentration in growth media instigated the cellular oxidative damage that was evident from elevated levels of hydrogen peroxide (H2O2), electrolyte leakage, and malondialdehyde (MDA) and consequently inhibited cotton growth, biomass, chlorophyll pigments, and photosynthetic process. Application of Si significantly suppressed Zn accumulation in various plant parts, i.e., roots, stems, and leaves and thus promoted biomass, photosynthetic, growth parameters, and antioxidant enzymes activity of Zn-stressed as well unstressed plants. In addition, Si reduced the MDA and H2O2 production and electrolyte leakage suggesting its role in protecting cotton plants from Zn toxicity-induced oxidative damage. Thus, the study indicated that exogenous Si application could improve growth and development of cotton crop experiencing Zn toxicity stress by limiting Zn bioavailability and oxidative damage.
Portable DNA markers tailored for systematic characterization of Gossypium germplasm
USDA-ARS?s Scientific Manuscript database
Many small-scale ad-hoc studies on characterization of Gossypium germplasm have been conducted that use different sets of markers. Coordination with the cotton community is needed to reach a consensus on the appropriate initial set of DNA markers. In consultation with the cotton community, a set o...
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
The cotton centromere contains a Ty3-gypsy-like LTR retroelement.
Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto
2012-01-01
The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species.
Pollen genotyping in cotton for genetic linkage analysis
USDA-ARS?s Scientific Manuscript database
Cotton is an important fiber and oil crop and thus makes very important contributions to US agricultural security and sustainable agriculture. Two species are vital for American cotton industry, i.e., Upland cotton (Gossypium hirsutum) and Pima cotton (G. barbadense) that are prized for high yields...
Li, Libei; Zhao, Shuqi; Su, Junji; Fan, Shuli; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Gu, Lijiao; Zhang, Chi; Liu, Guoyuan; Yu, Dingwei; Liu, Qibao; Zhang, Xianlong; Yu, Shuxun
2017-01-01
Due to China's rapidly increasing population, the total arable land area has dramatically decreased; as a consequence, the competition for farming land allocated for grain and cotton production has become fierce. Therefore, to overcome the existing contradiction between cotton grain and fiber production and the limited farming land, development of early-maturing cultivars is necessary. In this research, a high-density linkage map of upland cotton was constructed using genotyping by sequencing (GBS) to discover single nucleotide polymorphism (SNP) markers associated with early maturity in 170 F2 individuals derived from a cross between LU28 and ZHONG213. The high-density genetic map, which was composed of 3978 SNP markers across the 26 cotton chromosomes, spanned 2480 cM with an average genetic distance of 0.62 cM. Collinearity analysis showed that the genetic map was of high quality and accurate and agreed well with the Gossypium hirsutum reference genome. Based on this high-density linkage map, QTL analysis was performed on cotton early-maturity traits, including FT, FBP, WGP, NFFB, HNFFB and PH. A total 47 QTLs for the six traits were detected; each of these QTLs explained between 2.61% and 32.57% of the observed phenotypic variation. A major region controlling early-maturity traits in Gossypium hirsutum was identified for FT, FBP, WGP, NFFB and HNFFB on chromosome D03. QTL analyses revealed that phenotypic variation explained (PVE) ranged from 10.42% to 32.57%. Two potential candidate genes, Gh_D03G0885 and Gh_D03G0922, were predicted in a stable QTL region and had higher expression levels in the early-maturity variety ZHONG213 than in the late-maturity variety LU28. However, further evidence is required for functional validation. This study could provide useful information for the dissection of early-maturity traits and guide valuable genetic loci for molecular-assisted selection (MAS) in cotton breeding.
Li, Libei; Zhao, Shuqi; Su, Junji; Fan, Shuli; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Gu, Lijiao; Zhang, Chi; Liu, Guoyuan; Yu, Dingwei; Liu, Qibao; Zhang, Xianlong
2017-01-01
Due to China’s rapidly increasing population, the total arable land area has dramatically decreased; as a consequence, the competition for farming land allocated for grain and cotton production has become fierce. Therefore, to overcome the existing contradiction between cotton grain and fiber production and the limited farming land, development of early-maturing cultivars is necessary. In this research, a high-density linkage map of upland cotton was constructed using genotyping by sequencing (GBS) to discover single nucleotide polymorphism (SNP) markers associated with early maturity in 170 F2 individuals derived from a cross between LU28 and ZHONG213. The high-density genetic map, which was composed of 3978 SNP markers across the 26 cotton chromosomes, spanned 2480 cM with an average genetic distance of 0.62 cM. Collinearity analysis showed that the genetic map was of high quality and accurate and agreed well with the Gossypium hirsutum reference genome. Based on this high-density linkage map, QTL analysis was performed on cotton early-maturity traits, including FT, FBP, WGP, NFFB, HNFFB and PH. A total 47 QTLs for the six traits were detected; each of these QTLs explained between 2.61% and 32.57% of the observed phenotypic variation. A major region controlling early-maturity traits in Gossypium hirsutum was identified for FT, FBP, WGP, NFFB and HNFFB on chromosome D03. QTL analyses revealed that phenotypic variation explained (PVE) ranged from 10.42% to 32.57%. Two potential candidate genes, Gh_D03G0885 and Gh_D03G0922, were predicted in a stable QTL region and had higher expression levels in the early-maturity variety ZHONG213 than in the late-maturity variety LU28. However, further evidence is required for functional validation. This study could provide useful information for the dissection of early-maturity traits and guide valuable genetic loci for molecular-assisted selection (MAS) in cotton breeding. PMID:28809947
Zhang, Xiaohong; Wei, Jianghui; Fan, Shuli; Song, Meizhen; Pang, Chaoyou; Wei, Hengling; Wang, Chengshe; Yu, Shuxun
2016-01-01
In Arabidopsis flowering pathway, MADS-box genes encode transcription factors, with their structures and functions highly conserved in many species. In our study, two MADS-box genes GhSOC1 and GhMADS42 (Gossypium hirsutum L.) were cloned from upland cotton CCRI36 and transformed into Arabidopsis. GhSOC1 was additionally transformed into upland cotton. Comparative analysis demonstrated sequence conservation between GhSOC1 and GhMADS42 and genes of other plant species. Tissue-specific expression analysis of GhSOC1 and GhMADS42 revealed spatiotemporal expression patterns involving high transcript levels in leaves, shoot apical buds, and flowers. In addition, overexpression of both GhSOC1 and GhMADS42 in Arabidopsis accelerated flowering, with GhMADS42 transgenic plants showing abnormal floral organ phenotypes. Overexpression of GhSOC1 in upland cotton also produced variations in floral organs. Furthermore, chromatin immunoprecipitation assay demonstrated that GhSOC1 could regulate GhMADS41 and GhMADS42, but not FLOWERING LOCUS T, by directly binding to the genes promoter. Finally, yeast two-hybrid and bimolecular fluorescence complementation approaches were undertaken to better understand the interaction of GhSOC1 and other MADS-box factors. These experiments showed that GhSOC1 can interact with APETALA1/FRUITFULL-like proteins in cotton. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Hulse-Kemp, Amanda M.; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A.; Scheffler, Brian E.; Fang, David D.; Chen, Z. Jeffrey; Van Deynze, Allen; Stelly, David M.
2015-01-01
A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies. PMID:25858960
Hulse-Kemp, Amanda M; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A; Scheffler, Brian E; Fang, David D; Chen, Z Jeffrey; Van Deynze, Allen; Stelly, David M
2015-04-09
A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies. Copyright © 2015 Hulse-Kemp et al.
Ademe, Mulugeta Seyoum; He, Shoupu; Pan, Zhaoe; Sun, Junling; Wang, Qinglian; Qin, Hongde; Liu, Jinhai; Liu, Hui; Yang, Jun; Xu, Dongyong; Yang, Jinlong; Ma, Zhiying; Zhang, Jinbiao; Li, Zhikun; Cai, Zhongmin; Zhang, Xuelin; Zhang, Xin; Huang, Aifen; Yi, Xianda; Zhou, Guanyin; Li, Lin; Zhu, Haiyong; Pang, Baoyin; Wang, Liru; Jia, Yinhua; Du, Xiongming
2017-12-01
Fiber yield and quality are the most important traits for Upland cotton (Gossypium hirsutum L.). Identifying high yield and good fiber quality genes are the prime concern of researchers in cotton breeding. Association mapping offers an alternative and powerful method for detecting those complex agronomic traits. In this study, 198 simple sequence repeats (SSRs) were used to screen markers associated with fiber yield and quality traits with 302 elite Upland cotton accessions that were evaluated in 12 locations representing the Yellow River and Yangtze River cotton growing regions of China. Three subpopulations were found after the estimation of population structure. The pair-wise kinship values varied from 0 to 0.867. Only 1.59% of the total marker locus pairs showed significant linkage disequilibrium (LD, p < 0.001). The genome-wide LD decayed within the genetic distance of ~30 to 32 cM at r 2 = 0.1, and decreased to ~1 to 2 cM at r 2 = 0.2, indicating the potential for association mapping. Analysis based on a mixed linear model detected 57 significant (p < 0.01) marker-trait associations, including seven associations for fiber length, ten for fiber micronaire, nine for fiber strength, eight for fiber elongation, five for fiber uniformity index, five for fiber uniformity ratio, six for boll weight and seven for lint percent, for a total of 35 SSR markers, of which 11 markers were associated with more than one trait. Among marker-trait associations, 24 associations coincided with the previously reported quantitative trait loci (QTLs), the remainder were newly identified QTLs/genes. The QTLs identified in this study will potentially facilitate improvement of fiber yield and quality in the future cotton molecular breeding programs.
Status of the global cotton germplasm resources
USDA-ARS?s Scientific Manuscript database
The cultivated Gossypium spp. (cotton) represents the single most important, natural fiber crop in the world. In addition to its fiber, the oil and protein portion of the cottonseed also represents significant economic value. To protect the world-wide economic value of cotton fiber and cotton byprod...
Shangguan, Xiao-Xia; Yang, Chang-Qing; Zhang, Xiu-Fang; Wang, Ling-Jian
2016-10-01
Cotton fiber is proposed to share some similarity with the Arabidopsis thaliana leaf trichome, which is regulated by the MYB-bHLH-WD40 transcription complex. Although several MYB transcription factors and WD40 family proteins in cotton have been characterized, little is known about the role of bHLH family proteins in cotton. Here, we report that GhDEL65, a bHLH protein from cotton (Gossypium hirsutum), is a functional homologue of Arabidopsis GLABRA3 (GL3) and ENHANCER OF GLABRA3 (EGL3) in regulating trichome development. Transcripts of GhDEL65 were detected in 0 ∼ 1 days post-anthesis (DPA) ovules and abundant in 3-DPA fibers, implying that GhDEL65 may act in early fiber development. Ectopic expression of GhDEL65 in Arabidopsis gl3 egl3 double mutant partly rescued the trichome development, and constitutive expression of GhDEL65 in wild-type plants led to increased trichome density on rosette leaves and stems, mainly by activating the transcription of two key positive regulators of trichome development, GLABRA1 (GL1) and GLABRA2 (GL2), and suppressed the expression of a R3 single-repeat MYB factor TRIPTYCHON (TRY). GhDEL65 could interact with cotton R2R3 MYB transcription factors GhMYB2 and GhMYB3, as well as the WD40 protein GhTTG3, suggesting that the MYB-bHLH-WD40 protein complex also exists in cotton fiber cell, though its function in cotton fiber development awaits further investigation. © 2016 Scandinavian Plant Physiology Society.
The Cotton Centromere Contains a Ty3-gypsy-like LTR Retroelement
Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto
2012-01-01
The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species. PMID:22536361
Genetic characterization of reniform nematode resistance for Gossypium arboreum accession PI 417895
USDA-ARS?s Scientific Manuscript database
Reniform nematode (Rotylenchulus reniformis) is an important root pathogen of cotton in the southeastern United States and management is hindered by the lack of host-plant resistance in upland cotton (Gossypium hirsutum). The G. arboreum germplasm collection is an important source of resistance. Tra...
Ahamd, Maqshoof; Abbasi, Waleed Mumtaz; Jamil, Moazzam; Iqbal, Muhammad; Hussain, Azhar; Akhtar, Muhammad Fakhar-U-Zaman; Nazli, Farheen
2017-06-01
Incorporation of genetically modified crops in the cropping system raises the need for studying the effect of these crops on the soil ecosystem. The current study aimed to compare the effect of Bacillus thuringiensis (Bt)- and non-Bt-cotton (Gossypium hirsutum L.) genotypes on rhizosphere properties under fertilized and unfertilized soil conditions. One non-Bt-cotton (IUB 75) and four Bt-cotton varieties (IUB-222, MM-58, IUB-13, FH-142) were sown in a Randomized Complete Block Design (RCBD) in a factorial fashion with three replications under unfertilized (T1) and fertilized (T2 at NPK 310-170-110 kg ha -1 ) soil conditions. The culturable soil bacterial population was recorded at flowering, boll opening, and harvesting stages, while other rhizosphere biological and chemical properties were recorded at harvesting. Results revealed that Bt-cotton genotypes IUB-222 and FH-142 showed significantly higher rhizosphere total nitrogen, NH 4 + -N, available phosphorus, and available potassium. Total organic carbon and microbial biomass carbon was also maximum in the rhizosphere of IUB-222 under fertilized conditions. Similarly, bacterial population (CFU g -1 ) at flowering stage and at harvesting was significantly higher in the rhizosphere of IUB-222 as compared to non-Bt- (IUB-75) and other Bt-cotton genotypes under same growth conditions. It showed that Bt genotypes can help in maintaining soil macronutrients (total nitrogen, available phosphorus, and available potassium) under proper nutrient management. Moreover, Bt-cotton genotypes seem to strengthen certain biological properties of the soil, thus increasing the growth and yield capability, maintaining available nutrients in the soil as compared to non-Bt cotton, while no harmful effects of Bt cotton on soil properties was detected.
USDA-ARS?s Scientific Manuscript database
The infection of Upland cotton (Gossypium hirsutum L.) by the root parasite Rotylenchulus reniformis (Linford & Oliveira), the reniform nematode, results in massive annual yield losses throughout the southeastern United States and portions of Texas. Resistance to reniform nematode was identified in...
Gong, Qian; Yang, Zhaoen; Wang, Xiaoqian; Butt, Hamama Islam; Chen, Eryong; He, Shoupu; Zhang, Chaojun; Zhang, Xueyan; Li, Fuguang
2017-03-03
Verticillium dahliae is a phytopathogenic fungal pathogen that causes vascular wilt diseases responsible for considerable decreases in cotton yields. The complex mechanism underlying cotton resistance to Verticillium wilt remains uncharacterized. Identifying an endogenous resistance gene may be useful for controlling this disease. We cloned the ribosomal protein L18 (GaRPL18) gene, which mediates resistance to Verticillium wilt, from a wilt-resistant cotton species (Gossypium arboreum). We then characterized the function of this gene in cotton and Arabidopsis thaliana plants. GaRPL18 encodes a 60S ribosomal protein subunit important for intracellular protein biosynthesis. However, previous studies revealed that some ribosomal proteins are also inhibitory toward oncogenesis and congenital diseases in humans and play a role in plant disease defense. Here, we observed that V. dahliae infections induce GaRPL18 expression. Furthermore, we determined that the GaRPL18 expression pattern is consistent with the disease resistance level of different cotton varieties. GaRPL18 expression is upregulated by salicylic acid (SA) treatments, suggesting the involvement of GaRPL18 in the SA signal transduction pathway. Virus-induced gene silencing technology was used to determine whether the GaRPL18 expression level influences cotton disease resistance. Wilt-resistant cotton species in which GaRPL18 was silenced became more susceptible to V. dahliae than the control plants because of a significant decrease in the abundance of immune-related molecules. We also transformed A. thaliana ecotype Columbia (Col-0) plants with GaRPL18 according to the floral dip method. The plants overexpressing GaRPL18 were more resistant to V. dahliae infections than the wild-type Col-0 plants. The enhanced resistance of transgenic A. thaliana plants to V. dahliae is likely mediated by the SA pathway. Our findings provide new insights into the role of GaRPL18, indicating that it plays a crucial role in
2012-01-01
Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource
Lu, Nan; Roldan, Marissa; Dixon, Richard A
2017-08-01
Two TT2-type MYB transcription factors identified from tetraploid cotton are involved in regulating proanthocyanidin biosynthesis, providing new strategies for engineering condensed tannins in crops. Proanthocyanidins (PAs), also known as condensed tannins, are important secondary metabolites involved in stress resistance in plants, and are health supplements that help to reduce cholesterol levels. As one of the most widely grown crops in the world, cotton provides the majority of natural fabrics and is a supplemental food for ruminant animals. The previous studies have suggested that PAs present in cotton are a major contributor to fiber color. However, the biosynthesis of PAs in cotton still remains to be elucidated. AtTT2 (transparent testa 2) is a MYB family transcription factor from Arabidopsis that initiates the biosynthesis of PAs by inducing the expression of multiple genes in the pathway. In this study, we isolated two R2R3-type MYB transcription factors from Gossypium hirsutum that are homologous to AtTT2. Expression analysis showed that both genes were expressed at different levels in various cotton tissues, including leaf, seed coat, and fiber. Protoplast transactivation assays revealed that these two GhMYBs were able to activate promoters of genes encoding enzymes in the PA biosynthesis pathway, namely anthocyanidin reductase and leucoanthocyanidin reductase. Complementation experiments showed that both of the GhMYBs were able to recover the transparent testa seed coat phenotype of the Arabidopsis tt2 mutant by restoring PA biosynthesis. Ectopic expression of either of the two GhMYBs in Medicago truncatula hairy roots increased the contents of anthocyanins and PAs compared to control lines expressing the GUS gene, and expression levels of MtDFR, MtLAR, and MtANR were also elevated in lines expressing GhMYBs. Together, these data provide new insights into engineering condensed tannins in cotton.
Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun
2013-01-01
Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305
Gu, Lijiao; Li, Libei; Wei, Hengling; Wang, Hantao; Su, Junji; Guo, Yaning; Yu, Shuxun
2018-01-01
WRKY transcription factors play important roles in plant defense, stress response, leaf senescence, and plant growth and development. Previous studies have revealed the important roles of the group IIa GhWRKY genes in cotton. To comprehensively analyze the group IIa GhWRKY genes in upland cotton, we identified 15 candidate group IIa GhWRKY genes in the Gossypium hirsutum genome. The phylogenetic tree, intron-exon structure, motif prediction and Ka/Ks analyses indicated that most group IIa GhWRKY genes shared high similarity and conservation and underwent purifying selection during evolution. In addition, we detected the expression patterns of several group IIa GhWRKY genes in individual tissues as well as during leaf senescence using public RNA sequencing data and real-time quantitative PCR. To better understand the functions of group IIa GhWRKYs in cotton, GhWRKY17 (KF669857) was isolated from upland cotton, and its sequence alignment, promoter cis-acting elements and subcellular localization were characterized. Moreover, the over-expression of GhWRKY17 in Arabidopsis up-regulated the senescence-associated genes AtWRKY53, AtSAG12 and AtSAG13, enhancing the plant's susceptibility to leaf senescence. These findings lay the foundation for further analysis and study of the functions of WRKY genes in cotton.
Gu, Lijiao; Li, Libei; Wei, Hengling; Wang, Hantao; Su, Junji; Guo, Yaning
2018-01-01
WRKY transcription factors play important roles in plant defense, stress response, leaf senescence, and plant growth and development. Previous studies have revealed the important roles of the group IIa GhWRKY genes in cotton. To comprehensively analyze the group IIa GhWRKY genes in upland cotton, we identified 15 candidate group IIa GhWRKY genes in the Gossypium hirsutum genome. The phylogenetic tree, intron-exon structure, motif prediction and Ka/Ks analyses indicated that most group IIa GhWRKY genes shared high similarity and conservation and underwent purifying selection during evolution. In addition, we detected the expression patterns of several group IIa GhWRKY genes in individual tissues as well as during leaf senescence using public RNA sequencing data and real-time quantitative PCR. To better understand the functions of group IIa GhWRKYs in cotton, GhWRKY17 (KF669857) was isolated from upland cotton, and its sequence alignment, promoter cis-acting elements and subcellular localization were characterized. Moreover, the over-expression of GhWRKY17 in Arabidopsis up-regulated the senescence-associated genes AtWRKY53, AtSAG12 and AtSAG13, enhancing the plant’s susceptibility to leaf senescence. These findings lay the foundation for further analysis and study of the functions of WRKY genes in cotton. PMID:29370286
Thyssen, Gregory N; Song, Xianliang; Naoumkina, Marina; Kim, Hee-Jin; Fang, David D
2014-07-01
The mitochondrial genomes of flowering plants exist both as a "master circle" chromosome and as numerous subgenomic sublimons that are generated by intramolecular recombination. Differential stability or replication of these sublimons allows individual mitochondrial gene copy numbers to vary independently between different cell types and developmental stages. Our objective was to determine the relationship between mitochondrial gene copy number and transcript abundance in the elongating fiber cells of Upland cotton (Gossypium hirsutum L.). We compared RNA and DNA from cotton fiber cells at five developmental time points from early elongation through secondary cell wall thickening from the Ligon-lintless 2 (Li2) short fiber mutant and its wild type near isogenic line (NIL) DP5690. Mitochondrial gene copy number decreased from 3 to 8-DPA in the developing cotton fiber cells while transcript levels remained low. As secondary cell wall biosynthesis began in developing fibers, the expression levels and copy numbers of mitochondrial genes involved in energy production and respiration were up-regulated in wild type cotton DP5690. However, the short fiber mutant Li2, failed to increase expression of these genes, which include three subunits of ATP synthase, atp1, atp8 and atp9 and two cytochrome genes cox1 and cob. At the same time, Li2 failed to increase the copy numbers of these highly expressed genes. Surprisingly, we found that when mitochondrial genes were highly transcribed, they also had very high copy numbers. This observation suggests that in developing cotton fibers, increased mitochondrial sublimon replication may support increases in gene transcription. Published by Elsevier B.V.
The elusive search for reniform nematode resistance in cotton
USDA-ARS?s Scientific Manuscript database
The reniform nematode (Rotylenchulus reniformis Linford and Oliveira) has emerged as the most important plant parasitic nematode of cotton in the US cotton belt. Success in the development of reniform nematode resistant upland cotton cultivars (Gossypium hirsutum L.) has not been realized despite ov...
USDA-ARS?s Scientific Manuscript database
Limited polymorphism and narrow genetic base, due to genetic bottleneck through historic domestication, highlight a need for comprehensive characterization and utilization of existing genetic diversity in cotton germplasm collections. In this study, 288 worldwide Gossypium barbadense L. cotton germ...
Xiao, Yanqing; Chen, Yanli; Ding, Yanpeng; Wu, Jie; Wang, Peng; Yu, Ya; Wei, Xi; Wang, Ye; Zhang, Chaojun; Li, Fuguang; Ge, Xiaoyang
2018-05-01
The WUSCHEL (WUS) gene encodes a plant-specific homeodomain-containing transcriptional regulator, which plays important roles during embryogenesis, as well as in the formation of shoot and flower meristems. Here, we isolated two homologues of Arabidopsis thaliana WUS (AtWUS), GhWUS1a_At and GhWUS1b_At, from upland cotton (Gossypium hirsutum). Domain analysis suggested that the two putative GhWUS proteins contained a highly conserved DNA-binding HOX domain and a WUS-box. Expression profile analysis showed that GhWUSs were predominantly expressed during the embryoid stage. Ectopic expression of GhWUSs in Arabidopsis could induce somatic embryo and shoot formation from seedling root tips. Furthermore, in the absence of exogenous hormone, overexpression of GhWUSs in Arabidopsis could promote shoot regeneration from excised roots, and in the presence of exogenous auxin, excised roots expressing GhWUS could be induced to produce somatic embryo. In addition, expression of the chimeric GhWUS repressor in cotton callus inhibited embryogenic callus formation. Our results show that GhWUS is an important regulator of somatic embryogenesis and shoot regeneration. Copyright © 2018 Elsevier B.V. All rights reserved.
Polyploidy and the evolutionary history of cotton.
Jonathan F. Wendel; R.C. Cronn
2002-01-01
The cotton genus (Gossypium) includes approximately 50 species distributed in arid to semi-arid regions of the tropic and subtropics. Included are four species that have independently been domesticated for their fiber, two each in AfricaâAsia and the Americas. Gossypium species exhibit extraordinary morphological variation, ranging from herbaceous perennials to small...
Zahoor, Rizwan; Zhao, Wenqing; Dong, Haoran; Snider, John L; Abid, Muhammad; Iqbal, Babar; Zhou, Zhiguo
2017-10-01
To investigate whether potassium (K) application enhances the potential of cotton (Gossypium hirsutum L.) plants to maintain physiological functions during drought and recovery, low K-sensitive (Siza 3) and -tolerant (Simian 3) cotton cultivars were exposed to three K rates (0, 150, and 300 K 2 O kg ha -1 ) and either well-watered conditions or severe drought stress followed by a recovery period. Under drought stress, cotton plants showed a substantial decline in leaf water potential, stomatal conductance, photosynthetic rate, and the maximum and actual quantum yield of PSII, resulting in greater non-photochemical quenching and lipid peroxidation as compared to well-watered plants. However, plants under K application not only showed less of a decline in these traits but also displayed greater potential to recover after rewatering as compared to the plants without K application. Plants receiving K application showed lower lipid peroxidation, higher antioxidant enzyme activities, and increased proline accumulation as compared to plants without K application. Significant relationships between rates of photosynthetic recovery and K application were observed. The cultivar Siza 3 exhibited a more positive response to K application than Simian 3. The results suggest that K application enhances the cotton plant's potential to maintain functionality under drought and facilitates recovery after rewatering. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Increased Terpenoid Accumulation in Cotton (Gossypium hirsutum) Foliage is a General Wound Response
Kunert, Grit; Gershenzon, Jonathan
2008-01-01
The subepidermal pigment glands of cotton accumulate a variety of terpenoid products, including monoterpenes, sesquiterpenes, and terpenoid aldehydes that can act as feeding deterrents against a number of insect herbivore species. We compared the effect of herbivory by Spodoptera littoralis caterpillars, mechanical damage by a fabric pattern wheel, and the application of jasmonic acid on levels of the major representatives of the three structural classes of terpenoids in the leaf foliage of 4-week-old Gossypium hirsutum plants. Terpenoid levels increased successively from control to mechanical damage, herbivory, and jasmonic acid treatments, with E-β-ocimene and heliocide H1 and H4 showing the highest increases, up to 15-fold. Herbivory or mechanical damage to older leaves led to terpenoid increases in younger leaves. Leaf-by-leaf analysis of terpenes and gland density revealed that higher levels of terpenoids were achieved by two mechanisms: (1) increased filling of existing glands with terpenoids and (2) the production of additional glands, which were found to be dependent on damage intensity. As the relative response of individual terpenoids did not differ substantially among herbivore, mechanical damage, and jasmonic acid treatments, the induction of terpenoids in cotton foliage appears to represent a non-specific wound response mediated by jasmonic acid. Electronic supplementary material The online version of this article (doi:10.1007/s10886-008-9453-z) contains supplementary material, which is available to authorized users. PMID:18386096
Wubben, Martin J; Callahan, Franklin E; Velten, Jeff; Burke, John J; Jenkins, Johnie N
2015-02-01
Transgene-based analysis of the MIC-3 gene provides the first report of a cotton gene having a direct role in mediating cotton resistance to root-knot nematode. Major quantitative trait loci have been mapped to Upland cotton (Gossypium hirsutum L.) chromosomes 11 and 14 that govern the highly resistant phenotype in response to infection by root-knot nematode (RKN; Meloidogyne incognita); however, nearly nothing is known regarding the underlying molecular determinants of this RKN-resistant phenotype. Multiple lines of circumstantial evidence have strongly suggested that the MIC (Meloidogyne Induced Cotton) gene family plays an integral role in mediating cotton resistance to RKN. In this report, we demonstrate that overexpression of MIC-3 in the RKN-susceptible genetic background Coker 312 reduces RKN egg production by ca. 60-75 % compared to non-transgenic controls and transgene-null sibling lines. MIC-3 transcript and protein overexpression were confirmed in root tissues of multiple independent transgenic lines with each line showing a similar level of increased resistance to RKN. In contrast to RKN fecundity, transgenic lines showed RKN-induced root galling similar to the susceptible controls. In addition, we determined that this effect of MIC-3 overexpression was specific to RKN as no effect was observed on reniform nematode (Rotylenchulus reniformis) reproduction. Transgenic lines did not show obvious alterations in growth, morphology, flowering, or fiber quality traits. Gene expression analyses showed that MIC-3 transcript levels in uninfected transgenic roots exceeded levels observed in RKN-infected roots of naturally resistant plants and that overexpression did not alter the regulation of native MIC genes in the genome. These results are the first report describing a direct role for a specific gene family in mediating cotton resistance to a plant-parasitic nematode.
McGarry, Roisin C; Prewitt, Sarah F; Culpepper, Samantha; Eshed, Yuval; Lifschitz, Eliezer; Ayre, Brian G
2016-10-01
Domestication of upland cotton (Gossypium hirsutum) converted it from a lanky photoperiodic perennial to a day-neutral annual row-crop. Residual perennial traits, however, complicate irrigation and crop management, and more determinate architectures are desired. Cotton simultaneously maintains robust monopodial indeterminate shoots and sympodial determinate shoots. We questioned if and how the FLOWERING LOCUS T/SINGLE FLOWER TRUSS (SFT)-like and TERMINAL FLOWER1/SELF-PRUNING (SP)-like genes control the balance of monopodial and sympodial growth in a woody perennial with complex growth habit. Virus-based manipulation of GhSP and GhSFT expression enabled unprecedented functional analysis of cotton development. GhSP maintains growth in all apices; in its absence, both monopodial and sympodial branch systems terminate precociously. GhSFT encodes a florigenic signal stimulating rapid onset of sympodial branching and flowering in side shoots of wild photoperiodic and modern day-neutral accessions. High florigen concentrations did not alter monopodial apices, implying that once a cotton apex is SP-determined, it cannot be reset by florigen. GhSP is also essential to establish and maintain cambial activity. Dynamic changes in GhSFT and GhSP levels navigate meristems between monopodial and sympodial programs in a single plant. SFT and SP influenced cotton domestication and are ideal targets for further agricultural optimization. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Molecular confirmation of Gossypium hirsutum chromosome substitution lines
USDA-ARS?s Scientific Manuscript database
The primary gene pool for tetraploid cotton species includes G. hirsutum L., as well as the other four 2n=52 species of Gossypium (G. barbadense, G. mustellinum, G. tomentosum and G. darwinii). To help overcome barriers to effective introgression, we have developed a number of alien chromosome subst...
Evaluation of Sentinel-2A satellite imagery for mapping cotton root rot
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) is an economically important crop that is highly susceptible to cotton root rot. Remote sensing technology provides a useful and effective means for detecting and mapping cotton root rot infestations in cotton fields. This research assessed the potential of 10-m Sentin...
Liu, Zhao; Ge, Xiaoyang; Yang, Zuoren; Zhang, Chaojun; Zhao, Ge; Chen, Eryong; Liu, Ji; Zhang, Xueyan; Li, Fuguang
2017-06-12
Sucrose non-fermenting-1-related protein kinase 2 (SnRK2) is a plant-specific serine/threonine kinase family involved in the abscisic acid (ABA) signaling pathway and responds to osmotic stress. A genome-wide analysis of this protein family has been conducted previously in some plant species, but little is known about SnRK2 genes in upland cotton (Gossypium hirsutum L.). The recent release of the G. hirsutum genome sequence provides an opportunity to identify and characterize the SnRK2 kinase family in upland cotton. We identified 20 putative SnRK2 sequences in the G. hirsutum genome, designated as GhSnRK2.1 to GhSnRK2.20. All of the sequences encoded hydrophilic proteins. Phylogenetic analysis showed that the GhSnRK2 genes were classifiable into three groups. The chromosomal location and phylogenetic analysis of the cotton SnRK2 genes indicated that segmental duplication likely contributed to the diversification and evolution of the genes. The gene structure and motif composition of the cotton SnRK2 genes were analyzed. Nine exons were conserved in length among all members of the GhSnRK2 family. Although the C-terminus was divergent, seven conserved motifs were present. All GhSnRK2s genes showed expression patterns under abiotic stress based on transcriptome data. The expression profiles of five selected genes were verified in various tissues by quantitative real-time RT-PCR (qRT-PCR). Transcript levels of some family members were up-regulated in response to drought, salinity or ABA treatments, consistent with potential roles in response to abiotic stress. This study is the first comprehensive analysis of SnRK2 genes in upland cotton. Our results provide the fundamental information for the functional dissection of GhSnRK2s and vital availability for the improvement of plant stress tolerance using GhSnRK2s.
Wu, Ying; Liu, Fang; Yang, Dai-Gang; Li, Wei; Zhou, Xiao-Jian; Pei, Xiao-Yu; Liu, Yan-Gai; He, Kun-Lun; Zhang, Wen-Sheng; Ren, Zhong-Ying; Zhou, Ke-Hai; Ma, Xiong-Feng; Li, Zhong-Hu
2018-01-01
Cotton is one of the most economically important fiber crop plants worldwide. The genus Gossypium contains a single allotetraploid group (AD) and eight diploid genome groups (A–G and K). However, the evolution of repeat sequences in the chloroplast genomes and the phylogenetic relationships of Gossypium species are unclear. Thus, we determined the variations in the repeat sequences and the evolutionary relationships of 40 cotton chloroplast genomes, which represented the most diverse in the genus, including five newly sequenced diploid species, i.e., G. nandewarense (C1-n), G. armourianum (D2-1), G. lobatum (D7), G. trilobum (D8), and G. schwendimanii (D11), and an important semi-wild race of upland cotton, G. hirsutum race latifolium (AD1). The genome structure, gene order, and GC content of cotton species were similar to those of other higher plant plastid genomes. In total, 2860 long sequence repeats (>10 bp in length) were identified, where the F-genome species had the largest number of repeats (G. longicalyx F1: 108) and E-genome species had the lowest (G. stocksii E1: 53). Large-scale repeat sequences possibly enrich the genetic information and maintain genome stability in cotton species. We also identified 10 divergence hotspot regions, i.e., rpl33-rps18, psbZ-trnG (GCC), rps4-trnT (UGU), trnL (UAG)-rpl32, trnE (UUC)-trnT (GGU), atpE, ndhI, rps2, ycf1, and ndhF, which could be useful molecular genetic markers for future population genetics and phylogenetic studies. Site-specific selection analysis showed that some of the coding sites of 10 chloroplast genes (atpB, atpE, rps2, rps3, petB, petD, ccsA, cemA, ycf1, and rbcL) were under protein sequence evolution. Phylogenetic analysis based on the whole plastomes suggested that the Gossypium species grouped into six previously identified genetic clades. Interestingly, all 13 D-genome species clustered into a strong monophyletic clade. Unexpectedly, the cotton species with C, G, and K-genomes were admixed and
Osmotic Adjustment in Cotton (Gossypium hirsutum L.) Leaves and Roots in Response to Water Stress 1
Oosterhuis, Derrick M.; Wullschleger, Stan D.
1987-01-01
The relative magnitude of adjustment in osmotic potential (ψs) of water-stressed cotton (Gossypium hirsutum L.) leaves and roots was studied using plants raised in pots of sand and grown in a growth chamber. One and three water-stress preconditioning cycles were imposed by withholding water, and the subsequent adjustment in solute potential upon relief of the stress and complete rehydration was monitored with thermocouple psychrometers. Both leaves and roots exhibited a substantial adjustment in ψs in response to water stress with the former exhibiting the larger absolute adjustment. The osmotic adjustment of leaves was 0.41 megapascal compared to 0.19 megapascal in the roots. The roots, however, exhibited much larger percentage osmotic adjustments of 46 and 63% in the one and three stress cycles, respectively, compared to 22 and 40% in the leaves in similar stress cycles. The osmotically adjusted condition of leaves and roots decreased after relief of the single cycle stress to about half the initial value within 3 days, and to the well-watered control level within 6 days. In contrast, increasing the number of water-stress preconditioning cycles resulted in significant percentage osmotic adjustment still being present after 6 days in roots but not in the leaves. The decrease in ψs of leaves persisted longer in field-grown cotton plants compared to plants of the same age grown in the growth chamber. The advantage of decreased ψs in leaves and roots of water-stressed cotton plants was associated with the maintenance of turgor during periods of decreasing water potentials. PMID:16665577
Analyses of Fusarium wilt race 3 resistance in Upland cotton (Gossypium hirsutum L.).
Abdullaev, Alisher A; Salakhutdinov, Ilkhom B; Egamberdiev, Sharof Sh; Kuryazov, Zarif; Glukhova, Ludmila A; Adilova, Azoda T; Rizaeva, Sofiya M; Ulloa, Mauricio; Abdurakhmonov, Ibrokhim Y
2015-06-01
Fusarium wilt [Fusarium oxysporum f.sp. vasinfectum (FOV) Atk. Sny & Hans] represents a serious threat to cotton (Gossypium spp.) production. For the last few decades, the FOV pathogen has become a significant problem in Uzbekistan causing severe wilt disease and yield losses of G. hirsutum L. cultivars. We present the first genetic analyses of FOV race 3 resistance on Uzbek Cotton Germplasm with a series of field and greenhouse artificial inoculation-evaluations and inheritance studies. The field experiments were conducted in two different sites: the experimental station in Zangiota region-Environment (Env) 1 and the Institute of Cotton Breeding (Env-2, Tashkent province). The Env-1 was known to be free of FOV while the Env-2 was known to be a heavily FOV infested soil. In both (Env-1 and Env-2) of these sites, field soil was inoculated with FOV race 3. F2 and an F3 Upland populations ("Mebane B1" × "11970") were observed with a large phenotypic variance for plant survival and FOV disease severity within populations and among control or check Upland accessions. Wilt symptoms among studied F2 individuals and F3 families significantly differed depending on test type and evaluation site. Distribution of Mendelian rations of susceptible (S) and resistant (R) phenotypes were 1S:1R field Env-1 and 3S:1R field Env-2 in the F2 population, and 1S:3R greenhouse site in the F3 population. The different segregation distribution of the Uzbek populations may be explained by differences in FOV inoculum level and environmental conditions during assays. However, genetic analysis indicated a recessive single gene action under high inoculum levels or disease pressure for FOV race 3 resistance. Uzbek germplasm may be more susceptible than expected to FOV race 3, and sources of resistance to FOV may be limited under the FOV inoculum levels present in highly-infested fields making the breeding process more complex.
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Cai, Darun; Liu, Hui; Sang, Na; Huang, Xianzhong
2017-01-01
The CONSTANS/FLOWERING LOCUS T (CO/FT) regulon plays a central role in the control of flowering time in photoperiod-sensitive plants. Flowering time in wild cotton (Gossypium spp.) has strict photoperiod sensitivity, but domesticated cotton is day-neutral. Information on the molecular characterization of the CO and CO-like (COL) genes in cotton is very limited. In this study, we identified 42 COL homologs (GhCOLs) in the G. hirsutum genome, and many of them were previously unreported. We studied their chromosome distribution, phylogenetic relationships, and structures of genes and proteins. Our results showed that GhCOLs were classified into three groups, and 14 COLs in group I showed conserved structure when compared with other plants. Two homoeologous pairs, GhCOL1-A and GhCOL1-D in Group I, showed the highest sequence similarity to Arabidopsis thaliana CO and rice CO homologous gene Heading date1 (Hd1). Tissue-specific expression showed that 42 GhCOL genes may function as tissue-specific regulators in different cells or organs. We cloned and sequenced the 14 GhCOL genes in Group I related to flowering induction to study their diurnal expression pattern, and found that their expression showed distinct circadian regulation. Most of them peaked at dawn and decreased rapidly to their minima at dusk, then started to accumulate until following dawn under long- or short-day conditions. Transgenic study in the Arabidopsis co-2 mutant demonstrated that GhCOL1-A and GhCOL1-D fully rescued the late-flowering phenotype, whereas GhCOL3-A, GhCOL3-D, GhCOL7-A, and GhCOL7-D partially rescued the late-flowering phenotype, and the other five homoeologous pairs in Group I did not promote flowering. These results indicate that GhCOL1-A and GhCOL1-D were potential flowering inducers, and are candidate genes for research in flowering regulation in cotton.
Coppens d'Eeckenbrugge, Geo; Lacape, Jean-Marc
2014-01-01
Perennial forms of Gossypium hirsutum are classified under seven races. Five Mesoamerican races would have been derived from the wild race ‘yucatanense’ from northern Yucatán. ‘Marie-Galante’, the main race in the Caribbean, would have developed from introgression with G. barbadense. The racial status of coastal populations from the Caribbean has not been clearly defined. We combined Ecological Niche Modeling with an analysis of SSR marker diversity, to elucidate the relationships among cultivated, feral and wild populations of perennial cottons. Out of 954 records of occurrence in Mesoamerica and the Caribbean, 630 were classified into four categories cultivated, feral (disturbed and secondary habitats), wild/feral (protected habitats), and truly wild cotton (TWC) populations. The widely distributed three first categories cannot be differentiated on ecological grounds, indicating they mostly belong to the domesticated pool. In contrast, TWC are restricted to the driest and hottest littoral habitats, in northern Yucatán and in the Caribbean (from Venezuela to Florida), as confirmed by their climatic envelope in the factorial analysis. Extrapolating this TWC climatic model to South America and the Pacific Ocean points towards places where other wild representatives of tetraploid Gossypium species have been encountered. The genetic analysis sample comprised 42 TWC accessions from 12 sites and 68 feral accessions from 18 sites; at nine sites, wild and feral accessions were collected in close vicinity. Principal coordinate analysis, neighbor joining, and STRUCTURE consistently showed a primary divergence between TWC and feral cottons, and a secondary divergence separating ‘Marie-Galante’ from all other feral accessions. This strong genetic structure contrasts strikingly with the absence of geographic differentiation. Our results show that TWC populations of Mesoamerica and the Caribbean constitute a homogenous gene pool. Furthermore, the relatively low
Regulation of auxin on secondary cell wall cellulose biosynthesis in developing cotton fibers
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) fibers are unicellular trichomes that differentiate from epidermal cells of developing cotton ovules. Mature fibers exhibit thickened secondary walls composed of nearly pure cellulose. Cotton fiber development is divided into four overlapping phases, 1) initiation sta...
Developing Accurate Spatial Maps of Cotton Fiber Quality Parameters
USDA-ARS?s Scientific Manuscript database
Awareness of the importance of cotton fiber quality (Gossypium, L. sps.) has increased as advances in spinning technology require better quality cotton fiber. Recent advances in geospatial information sciences allow an improved ability to study the extent and causes of spatial variability in fiber p...
Shah, Syed Tariq; Pang, Chaoyou; Fan, Shuli; Song, Meizhen; Arain, Saima; Yu, Shuxun
2013-12-01
NAC (NAM, ATAF, and CUC) is a plant-specific transcription factor family with diverse roles in plant development and stress regulation. In this report, stress-responsive NAC genes (GhNAC8-GhNAC17) isolated from cotton (Gossypium hirsutum L.) were characterised in the context of leaf senescence and stress tolerance. The characterisation of NAC genes during leaf senescence has not yet been reported for cotton. Based on the sequence characterisation, these GhNACs could be classified into three groups belonging to three known NAC sub-families. Their predicted amino acid sequences exhibited similarities to NAC genes from other plant species. Senescent leaves were the sites of maximum expression for all GhNAC genes except GhNAC10 and GhNAC13, which showed maximum expression in fibres, collected from 25 days post anthesis (DPA) plants. The ten GhNAC genes displayed differential expression patterns and levels during natural and induced leaf senescence. Quantitative RT-PCR and promoter analyses suggest that these genes are induced by ABA, ethylene, drought, salinity, cold, heat, and other hormonal treatments. These results support a role for cotton GhNAC genes in transcriptional regulation of leaf senescence, stress tolerance and other developmental stages of cotton. © 2013.
The draft genome of a diploid cotton Gossypium raimondii
USDA-ARS?s Scientific Manuscript database
We have sequenced and assembled the draft genome of Gossypium raimondii, whose progenitor is considered the contributor of the D-subgenome to the economically important natural textile fiber producer, G. hirsutum. Next-generation Illumina pair-end (PE) sequencing strategies were employed to obtain ...
Ding, Mingquan; Ye, Wuwei; Lin, Lifeng; He, Shae; Du, Xiongming; Chen, Aiqun; Cao, Yuefen; Qin, Yuan; Yang, Fen; Jiang, Yurong; Zhang, Hua; Wang, Xiyin; Paterson, Andrew H.; Rong, Junkang
2015-01-01
Cotton (Gossypium) stem trichomes are mostly single cells that arise from stem epidermal cells. In this study, a homeodomain-leucine zipper gene (HD1) was found to cosegregate with the dominant trichome locus previously designated as T1 and mapped to chromosome 6. Characterization of HD1 orthologs revealed that the absence of stem trichomes in modern Gossypium barbadense varieties is linked to a large retrotransposon insertion in the ninth exon, 2565 bp downstream from the initial codon in the At subgenome HD1 gene (At-GbHD1). In both the At and Dt subgenomes, reduced transcription of GbHD1 genes is caused by this insertion. The disruption of At-HD1 further affects the expression of downstream GbMYB25 and GbHOX3 genes. Analyses of primitive cultivated accessions identified another retrotransposon insertion event in the sixth exon of At-GbHD1 that might predate the previously identified retrotransposon in modern varieties. Although both retrotransposon insertions results in similar phenotypic changes, the timing of these two retrotransposon insertion events fits well with our current understanding of the history of cotton speciation and dispersal. Taken together, the results of genetics mapping, gene expression and association analyses suggest that GbHD1 is an important component that controls stem trichome development and is a promising candidate gene for the T1 locus. The interspecific phenotypic difference in stem trichome traits also may be attributable to HD1 inactivation associated with retrotransposon insertion. PMID:26133897
Effects of nitrogen and planting seed size on cotton growth, development, and yield
USDA-ARS?s Scientific Manuscript database
A standardized experiment was conducted during 2009 and 2010 at 20 location-years across U.S. cotton (Gossypium hirsutum L.)-producing states to compare the N use requirement of contemporary cotton cultivars based on their planting seed size. Treatments consisted of three cotton varieties with plant...
Zhou, Ying; Zhang, Ze-Ting; Li, Mo; Wei, Xin-Zheng; Li, Xiao-Jie; Li, Bing-Ying; Li, Xue-Bao
2015-02-01
Cotton (Gossypium hirsutum) fibre is an important natural raw material for textile industry in the world. Understanding the molecular mechanism of fibre development is important for the development of future cotton varieties with superior fibre quality. In this study, overexpression of Gh14-3-3L in cotton promoted fibre elongation, leading to an increase in mature fibre length. In contrast, suppression of expression of Gh14-3-3L, Gh14-3-3e and Gh14-3-3h in cotton slowed down fibre initiation and elongation. As a result, the mature fibres of the Gh14-3-3 RNAi transgenic plants were significantly shorter than those of wild type. This 'short fibre' phenotype of the 14-3-3 RNAi cotton could be partially rescued by application of 2,4-epibrassinolide (BL). Expression levels of the BR-related and fibre-related genes were altered in the Gh14-3-3 transgenic fibres. Furthermore, we identified Gh14-3-3 interacting proteins (including GhBZR1) in cotton. Site mutation assay revealed that Ser163 in GhBZR1 and Lys51/56/53 in Gh14-3-3L/e/h were required for Gh14-3-3-GhBZR1 interaction. Nuclear localization of GhBZR1 protein was induced by BR, and phosphorylation of GhBZR1 by GhBIN2 kinase was helpful for its binding to Gh14-3-3 proteins. Additionally, 14-3-3-regulated GhBZR1 protein may directly bind to GhXTH1 and GhEXP promoters to regulate gene expression for responding rapid fibre elongation. These results suggested that Gh14-3-3 proteins may be involved in regulating fibre initiation and elongation through their interacting with GhBZR1 to modulate BR signalling. Thus, our study provides the candidate intrinsic genes for improving fibre yield and quality by genetic manipulation. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Wang, Li; Mu, Chun; Du, Mingwei; Chen, Yin; Tian, Xiaoli; Zhang, Mingcai; Li, Zhaohu
2014-08-01
The growth regulator mepiquat chloride (MC) is globally used in cotton (Gossypium hirsutum L.) canopy manipulation to avoid excess growth and yield loss. However, little information is available as to whether the modification of plant architecture by MC is related to alterations in gibberellic acid (GA) metabolism and signaling. Here, the role of GA metabolism and signaling was investigated in cotton seedlings treated with MC. The MC significantly decreased endogenous GA3 and GA4 levels in the elongating internode, which inhibited cell elongation by downregulating GhEXP and GhXTH2, and then reducing plant height. Biosynthetic and metabolic genes of GA were markedly suppressed within 2-10d of MC treatment, which also downregulated the expression of DELLA-like genes. A remarkable feedback regulation was observed at the early stage of MC treatment when GA biosynthetic and metabolic genes expression was evidently upregulated. Mepiquat chloride action was controlled by temporal translocation and spatial accumulation which regulated GA biosynthesis and signal expression for maintaining GA homeostasis. The results suggested that MC application could reduce endogenous GA levels in cotton through controlled GA biosynthetic and metabolic genes expression, which might inhibit cell elongation, thereby shortening the internode and reducing plant height. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Seed germination is a crucial phase of the plant life cycle that affects its establishment and productivity. However, information on salt tolerance at this phase is limited. Pima cotton (Gossypium barbadense L.) may be more salt tolerant during germination than Upland cotton (G. hirsutum L.) based o...
He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui
2017-07-03
Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.
USDA-ARS?s Scientific Manuscript database
Reniform nematode (Rotylenchulus reniformis) resistance is being transferred to Upland cotton (Gossypium hirsutum) from its distant relatives. Anecdotal observations of fluometuron damage to LONREN lines with resistance from G. longicalyx raised concerns about introducing herbicide sensitivity from ...
Hulse-Kemp, Amanda M.; Lemm, Jana; Plieske, Joerg; Ashrafi, Hamid; Buyyarapu, Ramesh; Fang, David D.; Frelichowski, James; Giband, Marc; Hague, Steve; Hinze, Lori L.; Kochan, Kelli J.; Riggs, Penny K.; Scheffler, Jodi A.; Udall, Joshua A.; Ulloa, Mauricio; Wang, Shirley S.; Zhu, Qian-Hao; Bag, Sumit K.; Bhardwaj, Archana; Burke, John J.; Byers, Robert L.; Claverie, Michel; Gore, Michael A.; Harker, David B.; Islam, Md S.; Jenkins, Johnie N.; Jones, Don C.; Lacape, Jean-Marc; Llewellyn, Danny J.; Percy, Richard G.; Pepper, Alan E.; Poland, Jesse A.; Mohan Rai, Krishan; Sawant, Samir V.; Singh, Sunil Kumar; Spriggs, Andrew; Taylor, Jen M.; Wang, Fei; Yourstone, Scott M.; Zheng, Xiuting; Lawley, Cindy T.; Ganal, Martin W.; Van Deynze, Allen; Wilson, Iain W.; Stelly, David M.
2015-01-01
High-throughput genotyping arrays provide a standardized resource for plant breeding communities that are useful for a breadth of applications including high-density genetic mapping, genome-wide association studies (GWAS), genomic selection (GS), complex trait dissection, and studying patterns of genomic diversity among cultivars and wild accessions. We have developed the CottonSNP63K, an Illumina Infinium array containing assays for 45,104 putative intraspecific single nucleotide polymorphism (SNP) markers for use within the cultivated cotton species Gossypium hirsutum L. and 17,954 putative interspecific SNP markers for use with crosses of other cotton species with G. hirsutum. The SNPs on the array were developed from 13 different discovery sets that represent a diverse range of G. hirsutum germplasm and five other species: G. barbadense L., G. tomentosum Nuttal × Seemann, G. mustelinum Miers × Watt, G. armourianum Kearny, and G. longicalyx J.B. Hutchinson and Lee. The array was validated with 1,156 samples to generate cluster positions to facilitate automated analysis of 38,822 polymorphic markers. Two high-density genetic maps containing a total of 22,829 SNPs were generated for two F2 mapping populations, one intraspecific and one interspecific, and 3,533 SNP markers were co-occurring in both maps. The produced intraspecific genetic map is the first saturated map that associates into 26 linkage groups corresponding to the number of cotton chromosomes for a cross between two G. hirsutum lines. The linkage maps were shown to have high levels of collinearity to the JGI G. raimondii Ulbrich reference genome sequence. The CottonSNP63K array, cluster file and associated marker sequences constitute a major new resource for the global cotton research community. PMID:25908569
Ma, Yina; Wang, Youhua; Liu, Jingran; Lv, Fengjuan; Chen, Ji; Zhou, Zhiguo
2014-01-01
Cotton (Gossypium hirsutum L.) boll positions on a fruiting branch vary in their contribution to yield and fiber quality. Fiber properties are dependent on deposition of cellulose in the fiber cell wall, but information about the enzymatic differences in sucrose metabolism between these fruiting positions is lacking. Therefore, two cotton cultivars with different sensitivities to low temperature were tested in 2010 and 2011 to quantify the effect of fruit positions (FPs) on fiber quality in relation to sucrose content, enzymatic activities and sucrose metabolism. The indices including sucrose content, sucrose transformation rate, cellulose content, and the activities of the key enzymes, sucrose phosphate synthase (SPS), acid invertase (AI) and sucrose synthase (SuSy) which inhibit cellulose synthesis and eventually affect fiber quality traits in cotton fiber, were determined. Results showed that as compared with those of FP1, cellulose content, sucrose content, and sucrose transformation rate of FP3 were all decreased, and the variations of cellulose content and sucrose transformation rate caused by FPs in Sumian 15 were larger than those in Kemian 1. Under FP effect, activities of SPS and AI in sucrose regulation were decreased, while SuSy activity in sucrose degradation was increased. The changes in activities of SuSy and SPS in response to FP effect displayed different and large change ranges between the two cultivars. These results indicate that restrained cellulose synthesis and sucrose metabolism in distal FPs are mainly attributed to the changes in the activities of these enzymes. The difference in fiber quality, cellulose synthesis and sucrose metabolism in response to FPs in fiber cells for the two cotton cultivars was mainly determined by the activities of both SuSy and SPS.
Satya, Pratik; Paswan, Pramod Kumar; Ghosh, Swagata; Majumdar, Snehalata; Ali, Nasim
2016-06-01
Cross-species transferability is a quick and economic method to enrich SSR database, particularly for minor crops where little genomic information is available. However, transferability of SSR markers varies greatly between species, genera and families of plant species. We assessed confamiliar transferability of SSR markers from cotton (Gossypium hirsutum) and jute (Corchorus olitorius) to 22 species distributed in different taxonomic groups of Malvaceae. All the species selected were potential industrial crop species having little or no genomic resources or SSR database. Of the 14 cotton SSR loci tested, 13 (92.86 %) amplified in G. arboreum and 71.43 % exhibited cross-genera transferability. Nine out of 11 jute SSRs (81.81 %) showed cross-transferability across genera. SSRs from both the species exhibited high polymorphism and resolving power in other species. The correlation between transferability of cotton and jute SSRs were highly significant (r = 0.813). The difference in transferability among species was also significant for both the marker groups. High transferability was observed at genus, tribe and subfamily level. At tribe level, transferability of jute SSRs (41.04 %) was higher than that of cotton SSRs (33.74 %). The tribe Byttnerieae exhibited highest SSR transferability (48.7 %). The high level of cross-genera transferability (>50 %) in ten species of Malvaceae, where no SSR resource is available, calls for large scale transferability testing from the enriched SSR databases of cotton and jute.
Asanuma, Yoko; Gondo, Takahiro; Ishigaki, Genki; Inoue, Koichi; Zaita, Norihiro; Muguerza, Melody; Akashi, Ryo
2017-01-01
ABSTRACT Japan imports cottonseed mainly from Australia and the USA where more than 96% of all cotton varieties grown are genetically modified (GM). GM crops undergo an environmental risk assessment (ERA) under the Law Concerning the Conservation and Sustainable Use of Biological Diversity before import into Japan. Potential adverse effects on biodiversity are comprehensively assessed based on competitiveness, production of harmful substances and outcrossing ability. Even though imported cottonseed is intended for food and feed uses and not for cultivation, the potential risks from seed spillage during transport must be evaluated. In most cases, the ERA requires data collected from in-country field trials to demonstrate how the GM crop behaves in Japan's environment. Confined field trials in Japan were conducted for the ERA of Lepidoptera-resistant and glufosinate-tolerant GM cotton (Gossypium hirsutum L.) lines GHB119 and T304-40. These lines were compared with conventional varieties for growth habit, morphological characteristics, seed dormancy, and allelopathic activity associated with competitiveness and production of harmful substances. Outcrossing ability was not a concern due to the absence of sexually compatible wild relatives in Japan. Although slight statistical differences were observed between the GM line and its conventional comparator for some morphological characteristics, transgenes or transformation were not considered to be responsible for these differences. The trial demonstrated that competitiveness and production of harmful substances by these GM cotton lines were equivalent to conventional cotton varieties that have a long history of safe use, and no potential adverse effects to biosafety in Japan were observed. PMID:28510512
Asanuma, Yoko; Gondo, Takahiro; Ishigaki, Genki; Inoue, Koichi; Zaita, Norihiro; Muguerza, Melody; Akashi, Ryo
2017-04-03
Japan imports cottonseed mainly from Australia and the USA where more than 96% of all cotton varieties grown are genetically modified (GM). GM crops undergo an environmental risk assessment (ERA) under the Law Concerning the Conservation and Sustainable Use of Biological Diversity before import into Japan. Potential adverse effects on biodiversity are comprehensively assessed based on competitiveness, production of harmful substances and outcrossing ability. Even though imported cottonseed is intended for food and feed uses and not for cultivation, the potential risks from seed spillage during transport must be evaluated. In most cases, the ERA requires data collected from in-country field trials to demonstrate how the GM crop behaves in Japan's environment. Confined field trials in Japan were conducted for the ERA of Lepidoptera-resistant and glufosinate-tolerant GM cotton (Gossypium hirsutum L.) lines GHB119 and T304-40. These lines were compared with conventional varieties for growth habit, morphological characteristics, seed dormancy, and allelopathic activity associated with competitiveness and production of harmful substances. Outcrossing ability was not a concern due to the absence of sexually compatible wild relatives in Japan. Although slight statistical differences were observed between the GM line and its conventional comparator for some morphological characteristics, transgenes or transformation were not considered to be responsible for these differences. The trial demonstrated that competitiveness and production of harmful substances by these GM cotton lines were equivalent to conventional cotton varieties that have a long history of safe use, and no potential adverse effects to biosafety in Japan were observed.
Guo, Rui; Shi, LianXuan; Yang, ChunWu; Yan, ChangRong; Zhong, XiuLi; Liu, Qi; Xia, Xu; Li, HaoRu
2016-01-01
Soil salinization is an important agriculture-related environmental problem. Alkali stress and salt stress strongly influence the metabolic balance in plants. Salt and alkali stresses exert varied effects on old and young tissues, which display different adaptive strategies. In this study, we used cotton (Gossypium hirsutum L.) plants as experimental material to investigate whether alkali stress induces ionic and metabolism changes in old and young leaves of cotton plants exposed to alkali stress. Results showed that alkali stress exerted a considerably stronger growth inhibition on old leaves than on young leaves. Under alkali stress, young leaves can maintain low Na and high K contents and retain relatively stable tricarboxylic acid cycle, resulting in greater accumulation of photosynthetic metabolites. In terms of metabolic response, the young and old leaves clearly displayed different mechanisms of osmotic regulation. The amounts of inositol and mannose significantly increased in both old and young leaves of cotton exposed to alkali stress, and the extent of increase was higher in young leaves than in old leaves. In old leaves, synthesis of amino acids, such as GABA, valine, and serine, was dramatically enhanced, and this phenomenon is favorable for osmotic adjustment and membrane stability. Organs at different developmental stages possibly display different mechanisms of metabolic regulation under stress condition. Thus, we propose that future investigations on alkali stress should use more organs obtained at different developmental stages. PMID:27933088
Yu, Jiwen; Zhang, Ke; Li, Shuaiyang; Yu, Shuxun; Zhai, Honghong; Wu, Man; Li, Xingli; Fan, Shuli; Song, Meizhen; Yang, Daigang; Li, Yunhai; Zhang, Jinfa
2013-01-01
Identification of stable quantitative trait loci (QTLs) across different environments and mapping populations is a prerequisite for marker-assisted selection (MAS) for cotton yield and fiber quality. To construct a genetic linkage map and to identify QTLs for fiber quality and yield traits, a backcross inbred line (BIL) population of 146 lines was developed from a cross between Upland cotton (Gossypium hirsutum) and Egyptian cotton (Gossypium barbadense) through two generations of backcrossing using Upland cotton as the recurrent parent followed by four generations of self pollination. The BIL population together with its two parents was tested in five environments representing three major cotton production regions in China. The genetic map spanned a total genetic distance of 2,895 cM and contained 392 polymorphic SSR loci with an average genetic distance of 7.4 cM per marker. A total of 67 QTLs including 28 for fiber quality and 39 for yield and its components were detected on 23 chromosomes, each of which explained 6.65-25.27% of the phenotypic variation. Twenty-nine QTLs were located on the At subgenome originated from a cultivated diploid cotton, while 38 were on the Dt subgenome from an ancestor that does not produce spinnable fibers. Of the eight common QTLs (12%) detected in more than two environments, two were for fiber quality traits including one for fiber strength and one for uniformity, and six for yield and its components including three for lint yield, one for seedcotton yield, one for lint percentage and one for boll weight. QTL clusters for the same traits or different traits were also identified. This research represents one of the first reports using a permanent advanced backcross inbred population of an interspecific hybrid population to identify QTLs for fiber quality and yield traits in cotton across diverse environments. It provides useful information for transferring desirable genes from G. barbadense to G. hirsutum using MAS.
Economic Cotton Production over Irrigation Rates in the Southeast United States
USDA-ARS?s Scientific Manuscript database
Regardless of location, water availability affects Cotton (Gossypium hirsutum L.) yield potential and economic stability. Irrigation is used in the Southeast U.S. to supplement rainfall on nearly 50% of cotton acres in Georgia. Rainfall often interferes with the efficiency of irrigation, adding to...
Economic cotton production over irrigation rates in the southeast United States
USDA-ARS?s Scientific Manuscript database
Regardless of location, water availability affects Cotton (Gossypium hirsutum L.) yield potential and economic stability. Irrigation is used in the Southeast U.S. to supplement rainfall on nearly 50% of cotton acres in Georgia. Rainfall often interferes with the efficiency of irrigation, adding to...
Hande, Atul S; Katageri, Ishwarappa S; Jadhav, Mangesh P; Adiger, Sateesh; Gamanagatti, Savita; Padmalatha, Kethireddy Venkata; Dhandapani, Gurusamy; Kanakachari, Mogilicherla; Kumar, Polumetla Ananda; Reddy, Vanga Siva
2017-08-31
Cotton fibre is a single cell and it is one of the best platforms for unraveling the genes express during various stages of fibre development. There are reports devoted to comparative transcriptome study on fiber cell initiation and elongation in tetraploid cultivated cotton. However, in the present investigation, comparative transcriptome study was made in diploid cultivated cotton using isogenic fuzzy-lintless (Fl) and normal fuzzy linted (FL) lines belong to Gossypium arboreum, diploid species at two stages, 0 and 10 dpa (days post anthesis), using Affymetrix cotton GeneChip genome array. Scanning electron microscopy (SEM) analysis uncovered the occurrence of few fibre cell initials in the Fl line as compared to many in Normal FL at -2 and 0 dpa. However, at 10 dpa there were no fibre cells found elongated in Fl but many elongated cells were found in FL line. Up-regulation of transcription factors, AP2-EREBP, C2H2, C3H, HB and WRKY was observed at 0 dpa whereas in 10 dpa transcription factors, AP2-EREBP, AUX/IAA, bHLH, C2H2, C3H, HB, MYB, NAC, Orphans, PLATZ and WRKY were found down regulated in Fl line. These transcription factors were mainly involved in metabolic pathways such as phytohormone signaling, energy metabolism of cell, fatty acid metabolism, secondary metabolism and other signaling pathways and are related directly or indirectly in fiber development. Quantitative real-time PCR was performed to check fold up or down-regulation of these genes and transcription factors (TFs) down regulated in mutants as compared to normal at 0 and 10 dpa. This study elucidates that the up-regulation of transcription factors like AP2-EREBP, C2H2, C3H, HB, WRKY and phytohormone signaling genes at 0 dpa and their down-regulation at the 10 dpa might have constrain the fibre elongation in fuzzy-lintless line. Along with this the down-regulation of genes involved in synthesis of VLCFA chain, transcripts necessary for energy and cell wall metabolism, EXPANSINs
Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan
2015-01-01
Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.
Extra long staple upland cotton for the production of superior yarn
USDA-ARS?s Scientific Manuscript database
Cotton, Gossypium spp., fibers are produced primarily by two species, G. hirsutum L., upland, and G. barbadense L., pima, which also is referred to as Extra Long Staple (ELS). The Cotton Improvement Laboratory, Texas AgriLife Research, has developed ELS upland lines through intraspecific crosses and...
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) yield losses by southern root-knot nematode [Meloidogyne incognita (Kofoid & White) Chitwood] (RKN) are usually estimated after significant damage has been caused. However, estimation of potential yield reduction before planting is possible by using crop simulation mod...
Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species.
Chen, Zhiwen; Feng, Kun; Grover, Corrinne E; Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F; Wang, Kunbo; Hua, Jinping
2016-01-01
The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium.
Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species
Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo
2016-01-01
The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527
Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A
2017-12-10
Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected
Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.
Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei
2015-02-01
WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.
USDA-ARS?s Scientific Manuscript database
The tetraploid Gossypium species G. barbadense, G. tomentosum, and G. mustelinum (2n=52) are useful sources of important genes for pest and disease resistance, and for improved agronomic and fiber traits in Upland cotton (G. hirsutum). Cytological analyses of hybrids and comparative linkage mapping...
Thyssen, Gregory N; Fang, David D; Turley, Rickie B; Florane, Christopher; Li, Ping; Naoumkina, Marina
2015-09-01
Mapping-by-sequencing and SNP marker analysis were used to fine map the Ligon-lintless-1 ( Li 1 ) short fiber mutation in tetraploid cotton to a 255-kb region that contains 16 annotated proteins. The Ligon-lintless-1 (Li 1 ) mutant of cotton (Gossypium hirsutum L.) has been studied as a model for cotton fiber development since its identification in 1929; however, the causative mutation has not been identified yet. Here we report the fine genetic mapping of the mutation to a 255-kb region that contains only 16 annotated genes in the reference Gossypium raimondii genome. We took advantage of the incompletely dominant dwarf vegetative phenotype to identify 100 mutants (Li 1 /Li 1 ) and 100 wild-type (li 1 /li 1 ) homozygotes from a mapping population of 2567 F2 plants, which we bulked and deep sequenced. Since only homozygotes were sequenced, we were able to use a high stringency in SNP calling to rapidly narrow down the region harboring the Li 1 locus, and designed subgenome-specific SNP markers to test the population. We characterized the expression of all sixteen genes in the region by RNA sequencing of elongating fibers and by RT-qPCR at seven time points spanning fiber development. One of the most highly expressed genes found in this interval in wild-type fiber cells is 40-fold under-expressed at the day of anthesis (DOA) in the mutant fiber cells. This gene is a major facilitator superfamily protein, part of the large family of proteins that includes auxin and sugar transporters. Interestingly, nearly all genes in this region were most highly expressed at DOA and showed a high degree of co-expression. Further characterization is required to determine if transport of hormones or carbohydrates is involved in both the dwarf and lintless phenotypes of Li 1 plants.
Somatic embryogenesis in wild relatives of cotton (Gossypium Spp.)
Rao, Abdul Qayyum; Hussain, S. Sarfraz; Shahzad, M. Saqib; Bokhari, S. Yassir Abbas; Raza, M. Hashim; Rakha, Allah; Majeed, A.; Shahid, A. Ali; Saleem, Zafar; Husnain, Tayyab; Riazuddin, S.
2006-01-01
Wild cotton species can contribute a valuable gene pool for agronomically desirable cultivated tetraploid cultivars. In order to exploit diploid cotton a regeneration system is required to achieve transformation based goals. The present studies aimed at optimizing the conditions for regeneration of local varieties as well as wild species of cotton. Different callus induction media were tested with varying concentrations of hormones in which sucrose was used as nutritional source. Different explants (hypocotyls, cotyledon, root) were used to check the regeneration of both local cotton plants and wild relatives using T & G medium, BAP medium, CIM medium, EMMS medium, and cell suspension medium. Different stages of embryogenicity such as early torpedo stage, late torpedo stage, heart stage, globular stage and cotyledonary stage were observed in wild relatives of cotton. The results of this study pave the way for establishing future transformation methods. PMID:16532531
Polyploidization altered gene functions in cotton (Gossypium spp.)
USDA-ARS?s Scientific Manuscript database
Cotton fibers are seed trichomes derived from individual cells of the epidermal layer of the seed coat. It has been known for a long time that a large set of genes determine the development of cotton fiber, and more recently it has been determined that these genes are distributed across the At and ...
Responses of reniform nematode and browntop millet to tillage, cover crop, and herbicides in cotton
USDA-ARS?s Scientific Manuscript database
Cropping practices that reduce competition from reniform nematode (Rotylenchulus reniformis) and browntop millet (Urochlora ramosum) may help minimize losses in cotton (Gossypium hirsutum). The impacts of tillage, rye cover crop, and preemergence and postemergence herbicides on cotton yields, renifo...
Airborne multispectral detection of regrowth cotton fields
USDA-ARS?s Scientific Manuscript database
Regrowth of cotton, Gossypium hirsutum L., can provide boll weevils, Anthonomus grandis Boheman, with an extended opportunity to feed and reproduce beyond the production season. Effective methods for timely areawide detection of these potential host plants are critically needed to achieve eradicati...
USDA-ARS?s Scientific Manuscript database
This study investigated the abiotic stress tolerance of mature cotton [Gossypium hirsutum (L.)] pollen and identified genetic variability among the six cotton lines studied. Genetic diversity in pollen viability was observed following a 6.5 h exposure to 25% relative humidity (RH). NM67, DP565, and...
Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W
2017-06-29
Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.
Wide-cross whole-genome radiation hybrid mapping of cotton (Gossypium hirsutum L.).
Gao, Wenxiang; Chen, Z Jeffrey; Yu, John Z; Raska, Dwaine; Kohel, Russell J; Womack, James E; Stelly, David M
2004-01-01
We report the development and characterization of a "wide-cross whole-genome radiation hybrid" (WWRH) panel from cotton (Gossypium hirsutum L.). Chromosomes were segmented by gamma-irradiation of G. hirsutum (n = 26) pollen, and segmented chromosomes were rescued after in vivo fertilization of G. barbadense egg cells (n = 26). A 5-krad gamma-ray WWRH mapping panel (N = 93) was constructed and genotyped at 102 SSR loci. SSR marker retention frequencies were higher than those for animal systems and marker retention patterns were informative. Using the program RHMAP, 52 of 102 SSR markers were mapped into 16 syntenic groups. Linkage group 9 (LG 9) SSR markers BNL0625 and BNL2805 had been colocalized by linkage analysis, but their order was resolved by differential retention among WWRH plants. Two linkage groups, LG 13 and LG 9, were combined into one syntenic group, and the chromosome 1 linkage group marker BNL4053 was reassigned to chromosome 9. Analyses of cytogenetic stocks supported synteny of LG 9 and LG 13 and localized them to the short arm of chromosome 17. They also supported reassignment of marker BNL4053 to the long arm of chromosome 9. A WWRH map of the syntenic group composed of linkage groups 9 and 13 was constructed by maximum-likelihood analysis under the general retention model. The results demonstrate not only the feasibility of WWRH panel construction and mapping, but also complementarity to traditional linkage mapping and cytogenetic methods. PMID:15280245
Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu
2016-04-11
Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) provides a major source of oil for food and feed industries, but little was known about the oil biosynthesis pathway in cottonseed. Towards understanding the biochemical pathway of oil accumulation in cottonseed, this study focused on phosphatidic acid phosphatase (PAP...
Increase of cold tolerance in cotton plant (Gossypium hirsutum L.) by mepiquat chloride
NASA Technical Reports Server (NTRS)
Gausman, H. W.; Escobar, D. E.; Rodriguez, R. R. (Principal Investigator); Huang, S. Y.; Rittig, F. R.
1982-01-01
Three mepiquat chloride (MC) concentrations - 40, 70, and 100 g a.i./ha - were used to spray cotton (Gossypium hirsutum L., cultival McNair 220) plants to determine whether or not MC would increase their cold tolerance. Seven to ten days after the spray, the plants were exposed to three different cold treatments. No important difference in cold damage was noticed between the control and the MC-treated plants when they were exposed repeatedly to 4.5 C. No plants died when exposed to 0.5 C for 12 h; however, 90% of the 1st and 2nd leaves of the control plants were damaged. This was three times more damage than those leaves of plants treated with 70 and 100 g a.i./ha MC concentrations; 60% f the control and 10-20% of the MC-treated plants died when the plants were subjected to a cold hardening process with 15.5 C day (12 h) and 1.7 C night (12 h) for 10 days, and then, held at -2.2 C for 24 hours. The electrolyte leakage and reflectance measurement data showed that the cell membranes of the MC-treated plants sustained much less damage than those of the control. Freezing injury was easily assessed by reflectance measurements at the 1.65 micrometer wavelength.
Wang, Baohua; Zhuang, Zhimin; Zhang, Zhengsheng; Draye, Xavier; Shuang, Lan-Shuan; Shehzad, Tariq; Lubbers, Edward L; Jones, Don; May, O Lloyd; Paterson, Andrew H; Chee, Peng W
2017-01-01
The molecular genetic basis of cotton fiber strength and fineness in crosses between Gossypium mustelinum and Gossypium hirsutum (Upland cotton) was dissected using 21 BC 3 F 2 and 12 corresponding BC 3 F 2:3 and BC 3 F 2:4 families. The BC 3 F 2 families were genotyped with simple sequence repeat markers from a G. hirsutum by G. mustelinum linkage map, and the three generations of BC 3 -derived families were phenotyped for fiber strength (STR) and fineness (Micronaire, MIC). A total of 42 quantitative trait loci (QTLs) were identified through one-way analysis of variance, including 15 QTLs for STR and 27 for MIC, with the percentage of variance explained by individual loci averaging 13.86 and 14.06%, respectively. Eighteen of the 42 QTLs were detected at least twice near the same markers in different generations/families or near linked markers in the same family, and 28 of the 42 QTLs were identified in both mixed model-based composite interval mapping and one-way variance analyses. Alleles from G. mustelinum increased STR for eight of 15 and reduced MIC for 15 of 27 QTLs. Significant among-family genotypic effects ( P < 0.001) were detected in 13 and 10 loci for STR and MIC respectively, and five loci showed significant ( P < 0.001) genotype × family interaction for MIC. These results support the hypothesis that fiber quality improvement for Upland cotton could be realized by introgressing G. mustelinum alleles although complexities due to the different effects of genetic background on introgressed chromatin might be faced. Building on prior work with G. barbadense, G. tomentosum , and G. darwinii , QTL mapping involving introgression of G. mustelinum alleles offers new allelic variation to Upland cotton germplasm.
Assessing the breeding potential of extra-long staple germplasm in an upland cotton breeding program
USDA-ARS?s Scientific Manuscript database
Fiber quality improvement of upland cotton (Gossypium hirsutum L.) is essential to increase the value and competitiveness of cotton fiber. The closely related allotetraploid species G. barbadense has long been targeted as a source of beneficial fiber quality alleles. Although interspecific hybridiza...
Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong
2015-01-01
Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a “relay race”-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus. PMID:26634818
USDA-ARS?s Scientific Manuscript database
Lygus lineolaris is a key pest affecting cotton, Gossypium spp. The pest is widely distributed in the U.S., especially in eastern and mid-southern states. Nearly 53% of U.S. cotton acreage was infested by Lygus spp. in 2002. An individual lygus bug is capable of destroying up to 23,400 cotton square...
USDA-ARS?s Scientific Manuscript database
The standard sampling technique used to quantify cotton fleahopper, Pseudatomoscelis seriatus (Reuter), abundance in cotton, Gossypium hirsutum L., involves direct counts of adults and nymphs on plants. This method, however, becomes increasingly laborious and time consuming as plants increase in si...
High resistance to thermal decomposition in brown cotton is linked to tannis and sodium content
USDA-ARS?s Scientific Manuscript database
Brown cotton (Gossypium hirsutum L.) fibers (SA-1 and MC-BL) studied were inferior to white cotton fiber Sure-Grow 747 (SG747) in fiber quality, i.e., shorter length, fewer twists, and lower crystallinity, but exhibited superior thermal properties in thermogravimetry (TG), differential thermogravime...
TAL effector driven induction of a SWEET gene confers susceptibility to bacterial blight of cotton
USDA-ARS?s Scientific Manuscript database
Bacterial blight of cotton (BBC), caused by Xanthomonas citri subsp. malvacearum (Xcm), is among the most destructive diseases in cotton (Gossypium spp.). Transcription activator-like (TAL) effectors from Xcm are essential for BBC disease progression. Here, we carried out whole-genome PacBio-seque...
Meloidogyne incognita emigration from cotton roots may be induced by the resistance QTL qMi-C11
USDA-ARS?s Scientific Manuscript database
Upland cotton (Gossypium hirsutum) is one of the most widely grown crops in the southern US, and Meloidogyne incognita is the most significant pathogen of cotton in the US. Two QTLs, qMi-C11 and qMi-C14, conferring resistance to M. incognita have been identified in cotton. Previous research docume...
Detecting cotton boll rot with an electronic nose
USDA-ARS?s Scientific Manuscript database
South Carolina Boll Rot is an emerging disease of cotton, Gossypium hirsutum L., caused by the opportunistic bacteria, Pantoea agglomerans (Ewing and Fife). Unlike typical fungal diseases, bolls infected with P. agglomerans continue to appear normal externally, complicating early and rapid detectio...
USDA-ARS?s Scientific Manuscript database
Cotton, Gossypium hirsutum (L.), plants expressing insecticidal crystal (Cry) proteins of Bacillus thuringiensis (Bt) Berliner are planted on significant acreage across the Southern region of the United States. Fall armyworm, Spodoptera frugiperda (J. E. Smith), can be a significant cotton pest in ...
Effects of 1,1-Dimethylpiperidinium Chloride on the Pests and Allelochemicals of Cotton and Pecan.
P. A. Hedin; J. N. Jenkins; J. C. McCarty; J. E. Mulrooney; W. L. Parrott; A. Borazjani; C. H. Graves; T. H. Filer
1984-01-01
The growth regulator, PIX (mepiquat chloride - 1,1-dimethyl-piperdinium chloride), when applied to cotton (Gossypium hirsutum L.) and pecan (Carya illinoensis Koch), caused internode shortening. PIX did not elicit an increase in resistance in cotton to the tobacco budworm (Heliothis virescens (Fab.)], or in pecan...
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) production in the Southeast United States can be limited by periodic drought. Irrigation and furrow diking tillage may improve economic yield and water use efficiency of cotton. Timing of rainfall may interfere with the efficiency of irrigation. Field studies were c...
USDA-ARS?s Scientific Manuscript database
The cotton fleahopper (CFH), Pseudatomoscelis seriatus (Reuter, 1876) (Hemiptera: Miridae), is a pest of commercial cotton (Gossypium hirsutum L.) with over 100 known host plants across its range. Both adults and nymphs attack small, developing squares, leading to abscission of the square. A new t...
USDA-ARS?s Scientific Manuscript database
Upland cotton, Gossypium hirsutum L. is planted on most of the hectareage of cultivated cotton in the United States and the world. The cultivated tetraploid species G. barbadense L. produces extra long, strong, and fine fibers. Breeders would like to move fiber quality alleles from this species in...
Evaluating cotton seed gland initiation by microscopy
USDA-ARS?s Scientific Manuscript database
Gossypol is a terpenoid aldehyde found in cotton (Gossypium hirsutum L.) glands and helps protect the seed from pests and pathogens. However, gossypol is toxic to many animals, so the seed is used mainly in cattle feed, as ruminants are tolerant to the effects of gossypol. In order to develop strat...
Population Dynamics of Belonolaimus longicaudatusin a Cotton Production System
Crow, W. T.; Weingartner, D. P.; McSorley, R.; Dickson, D. W.
2000-01-01
Belonolaimus longicaudatus is a recognized pathogen of cotton (Gossypium hirsutum), but insufficient information is available on the population dynamics and economic thresholds of B. longicaudatus in cotton production. In this study, data collected from a field in Florida were used to develop models predicting population increases of B. longicaudatus on cotton and population declines under clean fallow. Population densities of B. longicaudatus increased on cotton, reaching a carrying capacity of 139 nematodes/130 cm³ of soil, but decreased exponentially during periods of bare fallow. The model indicated that population densities should decrease each year of monocropped cotton, if an alternate host is not present between sequential cotton crops. Economic thresholds derived from published damage functions and current prices for cotton and nematicides varied from 2 to 5 B. longicaudatus/130 cm³ of soil, depending on the nematicide used. PMID:19270968
Ganesan, M; Jayabalan, N
2004-10-01
Somatic embryogenesis in cotton (Gossypium hirsutum L.) is accelerated when the plant regeneration medium is supplemented with haemoglobin (erythrogen). In cotton SVPR 2 lines, a higher frequency of embryoid formation was observed when the medium contained 400 mg/l haemoglobin. Fresh weight of the callus, rate of embryoid induction, number of embryoids formed and the percentage of plant regeneration from somatic embryos were increased. Among the two different cultivars tested, MCU 11 showed no response to the presence of haemoglobin when compared to SVPR 2, and embryogenic callus formation was completely absent in the former. Medium containing MS salts, 100 mg/l myo-inositol , 0.3 mg/l thiamine-HCL, 0.3 mg/l Picloram (PIC), 0.1 mg/l kinetin and 400 mg/l haemoglobin effected a better response with respect to embryogenic callus induction. After 8 weeks of culture, a high frequency of embryoid induction was observed on medium containing MS basal salts, 100 mg/l myo-inositol, 0.3 mg/l PIC , 0.1 mg/l isopentenyl adenine, 1.0 g/l NH4NO3 and 400 mg/l haemoglobin. Plant regeneration was observed in 75.8% of the mature somatic embryos, and whole plant regeneration was achieved within 6-7 months of culture. The regenerated plantlets were fertile and similar to in vivo-grown, seed-derived plants except that they were phenotypically smaller. A positive influence of haemoglobin was observed at concentrations up to 400 mg/l at all stages of somatic embryogenesis. The increase in the levels of antioxidant enzyme activities, for example superoxide dismutase and peroxidase, indicated the presence of excess oxygen uptake and the stressed condition of the plant tissues that arose from haemoglobin supplementation. This increased oxygen uptake and haemoglobin-mediated stress appeared to accelerate somatic embryogenesis in cotton.
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) germplasm line BARBREN-713 (Reg. No. ___, PI _____) was developed and released by the USDA-ARS, Mississippi Agricultural and Forest Experiment Station, Texas A&M AgriLife Research, and Cotton Incorporated in 2012. The objective of the release was to provide public and...
Tang, Kai; Dong, Chun-Juan; Liu, Jin-Yuan
2016-01-01
In this study, 40 phospholipase D (PLD) genes were identified from allotetraploid cotton Gossypium hirsutum, and 20 PLD genes were examined in diploid cotton Gossypium raimondii. Combining with 19 previously identified Gossypium arboreum PLD genes, a comparative analysis was performed among the PLD gene families among allotetraploid and two diploid cottons. Based on the orthologous relationships, we found that almost each G. hirsutum PLD had a corresponding homolog in the G. arboreum and G. raimondii genomes, except for GhPLDβ3A, whose homolog GaPLDβ3 may have been lost during the evolution of G. arboreum after the interspecific hybridization. Phylogenetic analysis showed that all of the cotton PLDs were unevenly classified into six numbered subgroups: α, β/γ, δ, ε, ζ and φ. An N-terminal C2 domain was found in the α, β/γ, δ and ε subgroups, while phox homology (PX) and pleckstrin homology (PH) domains were identified in the ζ subgroup. The subgroup φ possessed a single peptide instead of a functional domain. In each phylogenetic subgroup, the PLDs showed high conservation in gene structure and amino acid sequences in functional domains. The expansion of GhPLD and GrPLD gene families were mainly attributed to segmental duplication and partly attributed to tandem duplication. Furthermore, purifying selection played a critical role in the evolution of PLD genes in cotton. Quantitative RT-PCR documented that allotetraploid cotton PLD genes were broadly expressed and each had a unique spatial and developmental expression pattern, indicating their functional diversification in cotton growth and development. Further analysis of cis-regulatory elements elucidated transcriptional regulations and potential functions. Our comparative analysis provided valuable information for understanding the putative functions of the PLD genes in cotton fiber. PMID:27213891
Abney, Mark R; Ruberson, John R; Herzog, Gary A; Kring, Timothy J; Steinkraus, Donald C; Roberts, Phillip M
2008-02-01
The impact of natural enemies on cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae), populations in cotton, Gossypium hirsutum L., production systems in the southeastern United States was evaluated over 3 yr in irrigated commercial cotton fields. Fungal epizootics caused by the entomopathogen Neozygites fresenii (Nowakowski) Batko reduced aphid numbers to subthreshold levels in 1999, 2000, and 2001 and occurred consistently in early to mid-July in all 3 yr. Scymnus spp. were the most abundant aphidophagous predators, although other coccinellid species and generalist predators such as spiders, fire ants, heteropterans, and neuropterans also were present. Studies using arthropod exclusion cages demonstrated little impact of predators or parasitoids on aphid populations before fungal epizootics. Arthropod natural enemies were most abundant after epizootics and may have suppressed aphid populations late in the season. Seed cotton yield, and lint quality were not affected by aphicide applications in any year of the study. Implications of these findings for aphid management in the southeastern United States are discussed.
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) germplasm lines LONREN-1 (Reg. No. GP-977, PI 669509) and LONREN-2 (Reg. No. GP978, PI 669510) were developed and released by the USDA-ARS, Texas Agricultural Experiment Station and Cotton Incorporated in 2007 to provide breeders with desirable germplasm resistant to t...
Cultivar variation in cotton photosynthetic performance under different temperature regimes
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) yields are impacted by overall photosynthetic production. Factors that influence crop photosynthesis are the plants genetic makeup and the environmental conditions. This study investigated cultivar variation in photosynthesis when plants were grown in the field under...
Zhang, Gaofeng; Lu, Tingting; Miao, Wenwen; Sun, Lirong; Tian, Mi; Wang, Ji; Hao, Fushun
2017-01-01
Abscisic acid (ABA) receptor pyrabactin resistance1/PYR1-like/regulatory components of ABA receptor (PYR1/PYL/RCAR) (named PYLs for simplicity) are core regulators of ABA signaling, and have been well studied in Arabidopsis and rice. However, knowledge is limited about the PYL family regarding genome organization, gene structure, phylogenesis, gene expression and protein interaction with downstream targets in Gossypium . A comprehensive analysis of the Gossypium PYL family was carried out, and 21, 20, 40 and 39 PYL genes were identified in the genomes from the diploid progenitor G. arboretum , G. raimondii and the tetraploid G. hirsutum and G. barbadense , respectively. Characterization of the physical properties, chromosomal locations, structures and phylogeny of these family members revealed that Gossypium PYLs were quite conservative among the surveyed cotton species. Segmental duplication might be the main force promoting the expansion of PYLs , and the majority of the PYLs underwent evolution under purifying selection in Gossypium . Additionally, the expression profiles of GhPYL genes were specific in tissues. Transcriptions of many GhPYL genes were inhibited by ABA treatments and induced by osmotic stress. A number of GhPYLs can interact with GhABI1A or GhABID in the presence and/or absence of ABA by the yeast-two hybrid method in cotton.
Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J
2017-03-01
An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.
Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin
2016-06-01
Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. Copyright © 2016 Thyssen et al.
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) producers in Alabama and across the Cotton Belt are faced with a rapidly expanding problem that decreases yields and increases production costs: herbicide-resistant weeds. Producers are increasingly relying on production methods that raise production costs, such as add...
Spectral discrimination of two pigweeds from cotton with different leaf colors
USDA-ARS?s Scientific Manuscript database
To implement strategies to control Palmer amaranth (Amaranthus palmeri S. Wats.) and redroot pigweed (Amaranthus retroflexus L.) infestations in cotton (Gossypium hirsutum L.) production systems, managers need effective techniques to identify the weeds. Leaf light reflectance measurements have shown...
Xu, Jun; Xu, Xiaoyang; Tian, Liangliang; Wang, Guilin; Zhang, Xueying; Wang, Xinyu; Guo, Wangzhen
2016-01-01
Verticillium dahliae, a destructive and soil-borne fungal pathogen, causes massive losses in cotton yields. However, the resistance mechanism to V. dahilae in cotton is still poorly understood. Accumulating evidence indicates that chitinases are crucial hydrolytic enzymes, which attack fungal pathogens by catalyzing the fungal cell wall degradation. As a large gene family, to date, the chitinase genes (Chis) have not been systematically analyzed and effectively utilized in cotton. Here, we identified 47, 49, 92, and 116 Chis from four sequenced cotton species, diploid Gossypium raimondii (D5), G. arboreum (A2), tetraploid G. hirsutum acc. TM-1 (AD1), and G. barbadense acc. 3–79 (AD2), respectively. The orthologous genes were not one-to-one correspondence in the diploid and tetraploid cotton species, implying changes in the number of Chis in different cotton species during the evolution of Gossypium. Phylogenetic classification indicated that these Chis could be classified into six groups, with distinguishable structural characteristics. The expression patterns of Chis indicated their various expressions in different organs and tissues, and in the V. dahliae response. Silencing of Chi23, Chi32, or Chi47 in cotton significantly impaired the resistance to V. dahliae, suggesting these genes might act as positive regulators in disease resistance to V. dahliae. PMID:27354165
Gilbert, Matthew K; Turley, Rickie B; Kim, Hee Jin; Li, Ping; Thyssen, Gregory; Tang, Yuhong; Delhom, Christopher D; Naoumkina, Marina; Fang, David D
2013-06-17
Cotton fiber length is very important to the quality of textiles. Understanding the genetics and physiology of cotton fiber elongation can provide valuable tools to the cotton industry by targeting genes or other molecules responsible for fiber elongation. Ligon Lintless-1 (Li1) is a monogenic mutant in Upland cotton (Gossypium hirsutum) which exhibits an early cessation of fiber elongation resulting in very short fibers (< 6 mm) at maturity. This presents an excellent model system for studying the underlying molecular and cellular processes involved with cotton fiber elongation. Previous reports have characterized Li1 at early cell wall elongation and during later secondary cell wall synthesis, however there has been very limited analysis of the transition period between these developmental time points. Physical and morphological measurements of the Li1 mutant fibers were conducted, including measurement of the cellulose content during development. Affymetrix microarrays were used to analyze transcript profiles at the critical developmental time points of 3 days post anthesis (DPA), the late elongation stage of 12 DPA and the early secondary cell wall synthesis stage of 16 DPA. The results indicated severe disruption to key hormonal and other pathways related to fiber development, especially pertaining to the transition stage from elongation to secondary cell wall synthesis. Gene Ontology enrichment analysis identified several key pathways at the transition stage that exhibited altered regulation. Genes involved in ethylene biosynthesis and primary cell wall rearrangement were affected, and a primary cell wall-related cellulose synthase was transcriptionally repressed. Linkage mapping using a population of 2,553 F2 individuals identified SSR markers associated with the Li1 genetic locus on chromosome 22. Linkage mapping in combination with utilizing the diploid G. raimondii genome sequences permitted additional analysis of the region containing the Li1 gene. The
Chandnani, Rahul; Wang, Baohua; Draye, Xavier; Rainville, Lisa K; Auckland, Susan; Zhuang, Zhimin; Lubbers, Edward L; May, O Lloyd; Chee, Peng W; Paterson, Andrew H
2017-10-01
This study reports transmission genetics of chromosomal segments into Gossypium hirsutum from its most distant euploid relative, Gossypium mustelinum . Mutilocus interactions and structural rearrangements affect introgression and segregation of donor chromatin. Wild allotetraploid relatives of cotton are a rich source of genetic diversity that can be used in genetic improvement, but linkage drag and non-Mendelian transmission genetics are prevalent in interspecific crosses. These problems necessitate knowledge of transmission patterns of chromatin from wild donor species in cultivated recipient species. From an interspecific cross, Gossypium hirsutum × Gossypium mustelinum, we studied G. mustelinum (the most distant tetraploid relative of Upland cotton) allele retention in 35 BC 3 F 1 plants and segregation patterns in BC 3 F 2 populations totaling 3202 individuals, using 216 DNA marker loci. The average retention of donor alleles across BC 3 F 1 plants was higher than expected and the average frequency of G. mustelinum alleles in BC 3 F 2 segregating families was less than expected. Despite surprisingly high retention of G. mustelinum alleles in BC 3 F 1 , 46 genomic regions showed no introgression. Regions on chromosomes 3 and 15 lacking introgression were closely associated with possible small inversions previously reported. Nonlinear two-locus interactions are abundant among loci with single-locus segregation distortion, and among loci originating from one of the two subgenomes. Comparison of the present results with those of prior studies indicates different permeability of Upland cotton for donor chromatin from different allotetraploid relatives. Different contributions of subgenomes to two-locus interactions suggest different fates of subgenomes in the evolution of allotetraploid cottons. Transmission genetics of G. hirsutum × G. mustelinum crosses reveals allelic interactions, constraints on fixation and selection of donor alleles, and challenges with
Reproduction and pathogenicity of endemic populations of Rotylenchulus reniformis on cotton
USDA-ARS?s Scientific Manuscript database
The reniform nematode (Rotylenchulus reniformis) is the predominant parasitic nematode of upland cotton (Gossypium hirsutum) in the southern United States. Little is known about variability in geographic isolates of reniform nematode. In order to evaluate the comparative reproduction and pathogenici...
Identification of resistance to Aspergillus flavus infection in cotton germplasm
USDA-ARS?s Scientific Manuscript database
Natural resistance of in cottonseed to Aspergillus flavus infection has not been explored to date. A green fluorescent protein (GFP) expressing -70 strain was used to assess the resistance of seed from thirty five35 cotton varieties including representatives from Gossypium arboreum, G. barbadense, a...
Naoumkina, Marina; Hinchliffe, Doug J; Fang, David D; Florane, Christopher B; Thyssen, Gregory N
2017-08-30
Xyloglucan is a matrix polysaccharide found in the cell walls of all land plants. In growing cells, xyloglucan is thought to connect cellulose microfibrils and regulate their separation during wall extension. Ligon lintless-2 (Li 2 ) is a monogenic dominant cotton fiber mutation that causes extreme reduction in lint fiber length with no pleiotropic effects on vegetative growth. Li 2 represents an excellent model system to study fiber elongation. To understand the role of xyloglucan in cotton fiber elongation we used the short fiber mutant Li 2 and its near isogenic wild type for analysis of xyloglucan content and expression of xyloglucan-related genes in developing fibers. Accumulation of xyloglucan was significantly higher in Li 2 developing fibers than in wild type. Genes encoding enzymes for nine family members of xyloglucan biosynthesis were identified in the draft Gossypium hirsutum genome. RNAseq analysis revealed that most differentially expressed xyloglucan-related genes were down-regulated in Li 2 fiber cells. RT-qPCR analysis revealed that the peak of expression for the majority of xyloglucan-related genes in wild type developing fibers was 5-16days post anthesis (DPA) compared to 1-3 DPA in Li 2 fibers. Thus, our results suggest that early activation of xyloglucan-related genes and down regulation of xyloglucan degradation genes during the elongation phase lead to elevated accumulation of xyloglucan that restricts elongation of fiber cells in Li 2 . Copyright © 2017. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Preuss, Mary L.; Delmar, Deborah P.; Liu, Bo
Microtubules in interphase plant cells form a cortical array, which is critical for plant cell morphogenesis. Genetic studies imply that the minus end-directed microtubule motor kinesin-like calmodulin-binding protein (KCBP) plays a role in trichome morphogenesis in Arabidopsis. However, it was not clear whether this motor interacted with interphase microtubules. In cotton (Gossypium hirsutum) fibers, cortical microtubules undergo dramatic reorganization during fiber development. In this study, cDNA clones of the cotton KCBP homolog GhKCBP were isolated from a cotton fiber-specific cDNA library. During cotton fiber development from 10 to 21 DPA, the GhKCBP protein level gradually decreases. By immunofluorescence, GhKCBP wasmore » detected as puncta along cortical microtubules in fiber cells of different developmental stages. Thus the results provide evidence that GhKCBP plays a role in interphase cell growth likely by interacting with cortical microtubules. In contrast to fibers, in dividing cells of cotton, GhKCBP localized to the nucleus, the microtubule preprophase band, mitotic spindle, and the phragmoplast. Therefore KCBP likely exerts multiple roles in cell division and cell growth in flowering plants.« less
Miao, Wenwen; Sun, Lirong; Tian, Mi; Wang, Ji
2017-01-01
Abscisic acid (ABA) receptor pyrabactin resistance1/PYR1-like/regulatory components of ABA receptor (PYR1/PYL/RCAR) (named PYLs for simplicity) are core regulators of ABA signaling, and have been well studied in Arabidopsis and rice. However, knowledge is limited about the PYL family regarding genome organization, gene structure, phylogenesis, gene expression and protein interaction with downstream targets in Gossypium. A comprehensive analysis of the Gossypium PYL family was carried out, and 21, 20, 40 and 39 PYL genes were identified in the genomes from the diploid progenitor G. arboretum, G. raimondii and the tetraploid G. hirsutum and G. barbadense, respectively. Characterization of the physical properties, chromosomal locations, structures and phylogeny of these family members revealed that Gossypium PYLs were quite conservative among the surveyed cotton species. Segmental duplication might be the main force promoting the expansion of PYLs, and the majority of the PYLs underwent evolution under purifying selection in Gossypium. Additionally, the expression profiles of GhPYL genes were specific in tissues. Transcriptions of many GhPYL genes were inhibited by ABA treatments and induced by osmotic stress. A number of GhPYLs can interact with GhABI1A or GhABID in the presence and/or absence of ABA by the yeast-two hybrid method in cotton. PMID:29230363
Ulloa, Mauricio; Hulse-Kemp, Amanda M; De Santiago, Luis M; Stelly, David M; Burke, John J
2017-01-01
High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement, especially in paleopolyploids with exceptionally complex genomes, eg, upland cotton ( Gossypium hirsutum L., "2n = 52"). Three independently developed intraspecific upland mapping populations were analyzed to generate 3 high-density genetic linkage single-nucleotide polymorphism (SNP) maps and a consensus map using the CottonSNP63K array. The populations consisted of a previously reported F 2 , a recombinant inbred line (RIL), and reciprocal RIL population, from "Phytogen 72" and "Stoneville 474" cultivars. The cluster file provided 7417 genotyped SNP markers, resulting in 26 linkage groups corresponding to the 26 chromosomes (c) of the allotetraploid upland cotton (AD) 1 arisen from the merging of 2 genomes ("A" Old World and "D" New World). Patterns of chromosome-specific recombination were largely consistent across mapping populations. The high-density genetic consensus map included 7244 SNP markers that spanned 3538 cM and comprised 3824 SNP bins, of which 1783 and 2041 were in the A t and D t subgenomes with 1825 and 1713 cM map lengths, respectively. Subgenome average distances were nearly identical, indicating that subgenomic differences in bin number arose due to the high numbers of SNPs on the D t subgenome. Examination of expected recombination frequency or crossovers (COs) on the chromosomes within each population of the 2 subgenomes revealed that COs were also not affected by the SNPs or SNP bin number in these subgenomes. Comparative alignment analyses identified historical ancestral A t -subgenomic translocations of c02 and c03, as well as of c04 and c05. The consensus map SNP sequences aligned with high congruency to the NBI assembly of Gossypium hirsutum . However, the genomic comparisons revealed evidence of additional
USDA-ARS?s Scientific Manuscript database
Chromosome substitution lines (CSL) have been developed for selected chromosomes from two tetraploid species of Gossypium and have been shown to be effective ways to target introgression of useful alleles from exotic tetraploid species into Upland cotton, G. hirsutum L. Genetic effects of chromosome...
Liu, Guoyuan; Li, Xue; Guo, Liping; Zhang, Xuexian; Qi, Tingxiang; Wang, Hailin; Tang, Huini; Qiao, Xiuqin; Zhang, Jinfa; Xing, Chaozhu; Wu, Jianyong
2017-01-01
The RNA editing occurring in plant organellar genomes mainly involves the change of cytidine to uridine. This process involves a deamination reaction, with cytidine deaminase as the catalyst. Pentatricopeptide repeat (PPR) proteins with a C-terminal DYW domain are reportedly associated with cytidine deamination, similar to members of the deaminase superfamily. PPR genes are involved in many cellular functions and biological processes including fertility restoration to cytoplasmic male sterility (CMS) in plants. In this study, we identified 227 and 211 DYW deaminase-coding PPR genes for the cultivated tetraploid cotton species G. hirsutum and G. barbadense (2n = 4x = 52), respectively, as well as 126 and 97 DYW deaminase-coding PPR genes in the ancestral diploid species G. raimondii and G. arboreum (2n = 26), respectively. The 227 G. hirsutum PPR genes were predicted to encode 52–2016 amino acids, 203 of which were mapped onto 26 chromosomes. Most DYW deaminase genes lacked introns, and their proteins were predicted to target the mitochondria or chloroplasts. Additionally, the DYW domain differed from the complete DYW deaminase domain, which contained part of the E domain and the entire E+ domain. The types and number of DYW tripeptides may have been influenced by evolutionary processes, with some tripeptides being lost. Furthermore, a gene ontology analysis revealed that DYW deaminase functions were mainly related to binding as well as hydrolase and transferase activities. The G. hirsutum DYW deaminase expression profiles varied among different cotton tissues and developmental stages, and no differentially expressed DYW deaminase-coding PPRs were directly associated with the male sterility and restoration in the CMS-D2 system. Our current study provides an important piece of information regarding the structural and evolutionary characteristics of Gossypium DYW-containing PPR genes coding for deaminases and will be useful for characterizing the DYW deaminase gene
Registration of cotton germplasm line md 10-5
USDA-ARS?s Scientific Manuscript database
MD 10-5 (Reg. No. ______, PI 675077) is a noncommercial breeding line of cotton (Gossypium hirsutum L.) released by the USDA-ARS at Stoneville, MS in 2015. MD 10-5 was selected in F4 progenies from a cross between MD 15 (PI 642769) and JJ 1145ne. MD 10-5 has a desirable combination between lint yi...
Registration of a tufted-naked seed upland cotton germplasm
USDA-ARS?s Scientific Manuscript database
A tufted-naked cotton (Gossypium hirsutum L.) mutant, 9023n4t (Reg. No. GP-971, PI 667553) was developed from the cultivar SC 9023 (9023) (PI 590933) through chemical mutagenesis. Germplasm line 9023n4t was developed by the Department of Plant and Soil Science, Texas Tech University, and released in...
USDA-ARS?s Scientific Manuscript database
The ability to monitor verde plant bug, Creontiades signatus Distant (Hemiptera: Miridae), and the progression of cotton, Gossypium hirsutum L., boll responses to feeding and associated cotton boll rot development provided opportunity to assess if a single in-season measurement had value in evaluati...
Profitability of cover crops for single and twin row cotton
USDA-ARS?s Scientific Manuscript database
With the increased interest in cover crops, the impact of adoption on profitability of cash crops is a common question from producers. The objective of this study was to evaluate the profitability of cover crops for single and twin row cotton (Gossypium hirsutum L.) in Alabama. This experiment inclu...
USDA-ARS?s Scientific Manuscript database
While the boll weevil, Anthonomus grandis, has been identified as one of the most devastating pests in U.S. history, its origin and activity in Mexico, both on wild and cultivated cotton hosts (genus Gossypium), is poorly understood. Three forms (geographical or host-associated races) of A. grandis ...
Genetic and DNA Methylation Changes in Cotton (Gossypium) Genotypes and Tissues
Osabe, Kenji; Clement, Jenny D.; Bedon, Frank; Pettolino, Filomena A.; Ziolkowski, Lisa; Llewellyn, Danny J.; Finnegan, E. Jean; Wilson, Iain W.
2014-01-01
In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP. PMID:24465864
Genetic and DNA methylation changes in cotton (Gossypium) genotypes and tissues.
Osabe, Kenji; Clement, Jenny D; Bedon, Frank; Pettolino, Filomena A; Ziolkowski, Lisa; Llewellyn, Danny J; Finnegan, E Jean; Wilson, Iain W
2014-01-01
In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.
Islam, Md S; Zeng, Linghe; Thyssen, Gregory N; Delhom, Christopher D; Kim, Hee Jin; Li, Ping; Fang, David D
2016-06-01
Three QTL regions controlling three fiber quality traits were validated and further fine-mapped with 27 new single nucleotide polymorphism (SNP) markers. Transcriptome analysis suggests that receptor-like kinases found within the validated QTLs are potential candidate genes responsible for superior fiber strength in cotton line MD52ne. Fiber strength, length, maturity and fineness determine the market value of cotton fibers and the quality of spun yarn. Cotton fiber strength has been recognized as a critical quality attribute in the modern textile industry. Fine mapping along with quantitative trait loci (QTL) validation and candidate gene prediction can uncover the genetic and molecular basis of fiber quality traits. Four previously-identified QTLs (qFBS-c3, qSFI-c14, qUHML-c14 and qUHML-c24) related to fiber bundle strength, short fiber index and fiber length, respectively, were validated using an F3 population that originated from a cross of MD90ne × MD52ne. A group of 27 new SNP markers generated from mapping-by-sequencing (MBS) were placed in QTL regions to improve and validate earlier maps. Our refined QTL regions spanned 4.4, 1.8 and 3.7 Mb of physical distance in the Gossypium raimondii reference genome. We performed RNA sequencing (RNA-seq) of 15 and 20 days post-anthesis fiber cells from MD52ne and MD90ne and aligned reads to the G. raimondii genome. The QTL regions contained 21 significantly differentially expressed genes (DEGs) between the two near-isogenic parental lines. SNPs that result in non-synonymous substitutions to amino acid sequences of annotated genes were identified within these DEGs, and mapped. Taken together, transcriptome and amino acid mutation analysis indicate that receptor-like kinase pathway genes are likely candidates for superior fiber strength and length in MD52ne. MBS along with RNA-seq demonstrated a powerful strategy to elucidate candidate genes for the QTLs that control complex traits in a complex genome like tetraploid
Structural analysis of Gossypium hirsutum fibers grown under greenhouse and hydroponic conditions.
Natalio, Filipe; Tahir, Muhammad Nawaz; Friedrich, Norman; Köck, Margret; Fritz-Popovski, Gerhard; Paris, Oskar; Paschke, Reinhard
2016-06-01
Cotton is the one of the world's most important crops. Like any other crop, cotton growth/development and fiber quality is highly dependent on environmental factors. Increasing global weather instability has been negatively impacting its economy. Cotton is a crop that exerts an intensive pressure over natural resources (land and water) and demands an overuse of pesticides. Thus, the search for alternative cotton culture methods that are pesticide-free (biocotton) and enable customized standard fiber quality should be encouraged. Here we describe a culture of Gossypium hirsutum ("Upland" Cotton) utilizing a greenhouse and hydroponics in which the fibers are morphological similar to conventional cultures and structurally fit into the classical two-phase cellulose I model with 4.19nm crystalline domains surrounded by amorphous regions. These fibers exhibit a single crystalline form of cellulose I-Iß, monoclinic unit cell. Fiber quality bulk analysis shows an improved length, strength, whiteness when compared with soil-based cultures. Finally, we show that our fibers can be spun, used for production of non-woven fabrics and indigo-vat stained demonstrating its potential in industrial and commercial applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Employing broadband spectra and cluster analysis to assess thermal defoliation of cotton
USDA-ARS?s Scientific Manuscript database
Growers and field scouts need assistance in surveying cotton (Gossypium hirsutum L.) fields subjected to thermal defoliation to reap the benefits provided by this nonchemical defoliation method. A study was conducted to evaluate broadband spectral data and unsupervised classification as tools for s...
USDA-ARS?s Scientific Manuscript database
Cotton is an economically important crop affected by a number of abiotic and biotic stresses. Cotton leaf curl disease (CLCuD) is caused by virus in the genus Begomovirus (family Geminiviridae), collectively called cotton leaf curl viruses (CLCuVs). It is one of the most devastating virual diseases ...
USDA-ARS?s Scientific Manuscript database
Irrigated cotton (Gossypium Hirsutum L.) production is a central part of west Texas agriculture that depends on the essentially non-renewable water resource of the Ogallala aquifer. Web-based decision support tools that estimate the profit effects of irrigation for cotton under varying lint price, p...
Development of New Candidate Gene and EST-Based Molecular Markers for Gossypium Species
Buyyarapu, Ramesh; Kantety, Ramesh V.; Yu, John Z.; Saha, Sukumar; Sharma, Govind C.
2011-01-01
New source of molecular markers accelerate the efforts in improving cotton fiber traits and aid in developing high-density integrated genetic maps. We developed new markers based on candidate genes and G. arboreum EST sequences that were used for polymorphism detection followed by genetic and physical mapping. Nineteen gene-based markers were surveyed for polymorphism detection in 26 Gossypium species. Cluster analysis generated a phylogenetic tree with four major sub-clusters for 23 species while three species branched out individually. CAP method enhanced the rate of polymorphism of candidate gene-based markers between G. hirsutum and G. barbadense. Two hundred A-genome based SSR markers were designed after datamining of G. arboreum EST sequences (Mississippi Gossypium arboreum EST-SSR: MGAES). Over 70% of MGAES markers successfully produced amplicons while 65 of them demonstrated polymorphism between the parents of G. hirsutum and G. barbadense RIL population and formed 14 linkage groups. Chromosomal localization of both candidate gene-based and MGAES markers was assisted by euploid and hypoaneuploid CS-B analysis. Gene-based and MGAES markers were highly informative as they were designed from candidate genes and fiber transcriptome with a potential to be integrated into the existing cotton genetic and physical maps. PMID:22315588
Pang, Chaoyou; Fan, Shuli; Song, Meizhen; Yu, Shuxun
2013-01-01
Background Cotton (Gossypium hirsutum L.) is one of the world’s most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. Methodology/Principal Findings In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR), which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. Conclusions/Significance These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence assembly and annotation
Riaz, M; Farooq, J; Sakhawat, G; Mahmood, A; Sadiq, M A; Yaseen, M
2013-02-27
Research pertaining to genetic variability parameters, heritability, and genotypic, phenotypic, simple, and environmental correlations for various seedling traits in five elite advanced cotton (Gossypium hirsutum L.) lines (FH-113, FH-114, FH-941, FH-942, and FH-2015) and one check (CIM-496) was carried out during October and November 2010 under greenhouse conditions at the Cotton Research Institute (Faisalabad, Pakistan). Material was raised in plastic tubes with a randomized complete block design replicated three times. Three drought shocks were applied by withholding water from the tube-sown plants for 8-, 10-, and 12-day intervals. After 60 days of sowing, data on root/shoot traits like root length (cm), shoot length (cm), root weight (g), shoot fresh weight (g), lateral root number, root dry weight (g) shoot dry weight (g), and total plant weight (g) were recorded. Considerable genotypic variations existed between genotypes for all seedling characters. Higher broad-sense heritability estimates were found for all traits studied. Maximum broad-sense heritability coupled with high genetic advance in root length (0.99, 17.34), lateral root number (0.91, 2.89), and shoot length (0.90, 4.35) suggested a potential for genetic improvement through breeding and selection. The correlation coefficients among root length, shoot length, root dry weight, fresh shoot weight, and total plant weight were positively and significantly correlated; thus, they can be selected simultaneously as drought tolerance selection indexes owing to the absence of undesired relationships. Genotypes FH-942 and FH-113 had the lowest excised leaf water loss during the first 4 h and also for the next 4 h. Therefore, these two advanced lines (FH-942 and FH-113) with high initial water content and lower excised leaf water loss had better adaptation to water stress.
USDA-ARS?s Scientific Manuscript database
Irrigated cotton (Gossypium Hirsutum L.) production is a central part of west Texas agriculture that depends on the essentially non-renewable water resource of the Ogallala aquifer. Web-based decision support tools that estimate the profit effects of irrigation for cotton under varying lint price, p...
Molecular evolution of the plastid genome during diversification of the cotton genus.
Chen, Zhiwen; Grover, Corrinne E; Li, Pengbo; Wang, Yumei; Nie, Hushuai; Zhao, Yanpeng; Wang, Meiyan; Liu, Fang; Zhou, Zhongli; Wang, Xingxing; Cai, Xiaoyan; Wang, Kunbo; Wendel, Jonathan F; Hua, Jinping
2017-07-01
Cotton (Gossypium spp.) is commonly grouped into eight diploid genomic groups, designated A-G and K, and one tetraploid genomic group, namely AD. To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome duringdiversification, chloroplast genomes (cpDNA) from 6 D-genome and 2 G-genome species of Gossypium (G. armourianum D 2-1 , G. harknessii D 2-2 , G. davidsonii D 3-d , G. klotzschianum D 3-k , G. aridum D 4 , G. trilobum D 8 , and G. australe G 2 , G. nelsonii G 3 ) were newly reported here. In combination with the 26 previously released cpDNA sequences, we performed comparative phylogenetic analyses of 34 Gossypium chloroplast genomes that collectively represent most of the diversity in the genus. Gossypium chloroplasts span a small range in size that is mostly attributable to indels that occur in the large single copy (LSC) region of the genome. Phylogenetic analysis using a concatenation of all genes provides robust support for six major Gossypium clades, largely supporting earlier inferences but also revealing new information on intrageneric relationships. Using Theobroma cacao as an outgroup, diversification of the genus was dated, yielding results that are in accord with previous estimates of divergence times, but also offering new perspectives on the basal, early radiation of all major clades within the genus as well as gaps in the record indicative of extinctions. Like most higher-plant chloroplast genomes, all cotton species exhibit a conserved quadripartite structure, i.e., two large inverted repeats (IR) containing most of the ribosomal RNA genes, and two unique regions, LSC (large single sequence) and SSC (small single sequence). Within Gossypium, the IR-single copy region junctions are both variable and homoplasious among species. Two genes, accD and psaJ, exhibited greater rates of synonymous and non-synonymous substitutions than did other genes. Most genes exhibited Ka/Ks ratios suggestive of neutral
USDA-ARS?s Scientific Manuscript database
Genetic diversity in reproductive abiotic stress tolerance has been reported for cotton [Gossypium hirsutum (L.)] based upon the percentage of anther dehiscence of mature pollen in adverse environments. This study investigated the abiotic stress tolerance of mature pollen and identified genetic vari...
Effects of tillage and N fertilizer on cotton growth, yield, and fiber quality
USDA-ARS?s Scientific Manuscript database
Increasing restrictions on ammonium nitrate have spurred interest in alternative sources of N fertilizer, including urea-ammonium sulfate (UAS). However, UAS has not been widely tested, particularly in row crop agriculture. A cotton (Gossypium hirsutum L.) field study was conducted in Central Alabam...
Stability of spatial distributions of stink bugs, boll injury, and NDVI in cotton
USDA-ARS?s Scientific Manuscript database
A two-year study was conducted to determine the degree of aggregation of thrips, stink bugs, and aphids in cotton, Gossypium hirsutum L., and their spatial association with soil apparent electrical conductivity (ECa), a multispectral vegetation index (Normalized Difference Vegetation Index [NDVI]), ...
[The inheritance of an ultra-dwarf plant mutant from upland cotton].
Chen, Xu-Sheng; DI, Jia-Chun; Xu, Nai-Yin; Xiao, Song-Hua; Liu, Jian-Guang
2007-04-01
The inheritance of an ultra-dwarf plant mutant from upland cotton (Gossypium hirsutum L.) was studied, which showed that the mutant was controlled by single recessive quality gene. This gene was denominated as du tentatively. No similar mutant has been found in upland cotton. The mutation could not normally flower and produce bolls under natural conditions, and its mature height was only 10.5 cm. When treated with exogenous GA3, it could normally flower and boll, and plant height could reach 57.8 cm finally.
Manure-derived biochars for use as a phosphorus fertilizer in cotton production
USDA-ARS?s Scientific Manuscript database
Biochars made from animal manure feedstocks appear to be a potential P fertilizer source. Our objective was to assess five different manure-derived biochars, pyrolyzed at two different temperatures (350 and 700 °C), for their potential as a Phosphorus (P) fertilizer for cotton (Gossypium hirsutum L....
Participation of chitin-binding peroxidase isoforms in the wilt pathogenesis of cotton
USDA-ARS?s Scientific Manuscript database
Specific chitin-binding isozymes of peroxidase (POX) play an important role in pathogenesis of plant diseases caused with fungi. We studied the dynamics of peroxidase activity in two varieties of cotton (Gossypium hirsutum L.); one was a susceptible and the other resistant to the plant pathogen Vert...
Su, Aiguo; Geng, Jianing; Grover, Corrinne E.; Hu, Songnian; Hua, Jinping
2013-01-01
Background Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. Methodology/Principal Findings We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. Conclusion The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species. PMID:23940520
Lee, Seung-Bum; Kaittanis, Charalambos; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-01-01
Background Cotton (Gossypium hirsutum) is the most important fiber crop grown in 90 countries. In 2004–2005, US farmers planted 79% of the 5.7-million hectares of nuclear transgenic cotton. Unfortunately, genetically modified cotton has the potential to hybridize with other cultivated and wild relatives, resulting in geographical restrictions to cultivation. However, chloroplast genetic engineering offers the possibility of containment because of maternal inheritance of transgenes. The complete chloroplast genome of cotton provides essential information required for genetic engineering. In addition, the sequence data were used to assess phylogenetic relationships among the major clades of rosids using cotton and 25 other completely sequenced angiosperm chloroplast genomes. Results The complete cotton chloroplast genome is 160,301 bp in length, with 112 unique genes and 19 duplicated genes within the IR, containing a total of 131 genes. There are four ribosomal RNAs, 30 distinct tRNA genes and 17 intron-containing genes. The gene order in cotton is identical to that of tobacco but lacks rpl22 and infA. There are 30 direct and 24 inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Most of the direct repeats are within intergenic spacer regions, introns and a 72 bp-long direct repeat is within the psaA and psaB genes. Comparison of protein coding sequences with expressed sequence tags (ESTs) revealed nucleotide substitutions resulting in amino acid changes in ndhC, rpl23, rpl20, rps3 and clpP. Phylogenetic analysis of a data set including 61 protein-coding genes using both maximum likelihood and maximum parsimony were performed for 28 taxa, including cotton and five other angiosperm chloroplast genomes that were not included in any previous phylogenies. Conclusion Cotton chloroplast genome lacks rpl22 and infA and contains a number of dispersed direct and inverted repeats. RNA editing resulted in amino acid changes with significant impact on their
Performance of transform against selected cotton insects in laboratory and field studies
USDA-ARS?s Scientific Manuscript database
The tarnished plant bug, Lygus lineolaris (Palisot de Beauvois), has become a major pest of cotton, Gossypium hirsutum (L.), within the Mid-Southern United States over the last several years. Tarnished plant bug has become the target of more insecticide applications than any other insect pest of c...
CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).
Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S
2017-07-01
The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.
Development of a plant based threshold for tarnished plant bug (Hemiptera: miridae) in cotton
USDA-ARS?s Scientific Manuscript database
The tarnished plant bug, Lygus lineolaris (Palisot de Beauvois), is the most important insect pest of cotton, Gossypium hirsutum L., in the midsouthern United States. It is almost exclusively controlled with foliar insecticide applications, and sampling methods and thresholds need to be revisited. ...
Captures of boll weevils (Coleoptera: Curculionidae) in relation to trap distance from cotton fields
USDA-ARS?s Scientific Manuscript database
Once populations of the boll weevil (Anthonomus grandis grandis Boheman) are suppressed, eradication programs rely on pheromone trap-based monitoring for timely detection of weevil populations in cotton (Gossypium spp.). Delayed detection may increase the costs of remedial treatments, and permit rep...
Planting geometry and growing season effects on the growth and yield of dryland cotton
USDA-ARS?s Scientific Manuscript database
The declining Ogallala Aquifer beneath the Southern High Plains may necessitate dryland crop production and cotton (Gossypium hirsutum L.) is a well-adapted and potentially profitable alternative crop. The limited growing season duration of the Texas Panhandle and southwestern Kansas, however, impos...
Patil, Chandrashekhar D; Borase, Hemant P; Salunkhe, Rahul B; Suryawanshi, Rahul K; Narkhade, Chandrakant P; Salunke, Bipinchandra K; Patil, Satish V
2014-01-01
Background: We aimed to extract the ingredients from leaves of Gossypium hirsutum (Bt cotton) using different solvents and evaluate for potential use to control different larval stages of mosquito species, Aedes aegypti and Anopheles stephensi. Methods: Qualitative and quantitative estimation of ingredients from Go. hirsutum (Bt) plant extract was carried out and their inhibitory action against mosquito larvae was determined using mosquito larvicidal assay. Results: LC50 values of water, ethanol, ethyl acetate and hexane extracts for Ae. aegypti were 211.73±21.49, 241.64±19.92, 358.07±32.43, 401.03±36.19 and 232.56±26.00, 298.54±21.78, 366.50±30.59, 387.19±31.82 for 4th instar of An. stephensi, respectively. The water extract displayed lowest LC50 value followed by ethanol, ethyl acetate and hexane. Owing to the comparatively better activity of water extract, its efficacy was further evaluated for mosquito larvicidal activity, which exhibited LC50 values of 133.95±12.79, 167.65±11.34 against 2nd and 3rd instars of Ae. aegypti and 145.48±11.76, 188.10±12.92 against 2nd and 3rd instars of An. stephensi, respectively. Crude protein from the water extract was precipitated using acetone and tested against 2nd, 3rd and 4th instars of Ae. aegypti and An. stephensi. It revealed further decrease in LC50 values as 105.72±25.84, 138.23±23.18, 126.19±25.65, 134.04±04 and 137.88±17.59, 154.25±16.98 for 2nd, 3rd and 4th instars of Ae. aegypti and An. stephensi, respectively. Conclusion: Leaves extracts of Go. hirsutum (Bt) is potential mosquito larvicide and can be used as a potent alternative to chemical insecticides in integrated pest management. PMID:25629069
Genome sequence of the cultivated cotton Gossypium arboreum
USDA-ARS?s Scientific Manuscript database
Cotton is one of the most economically important natural fiber crops in the world, and the complex tetraploid nature of its genome (AADD, 2n = 52) makes genetic, genomic and functional analyses extremely challenging. Here we sequenced and assembled 98.3% of the 1.7-gigabase G. arboreum (AA, 2n = 26...
Water, sediment, and metolachlor transport between wide- and narrow row cotton production systems
USDA-ARS?s Scientific Manuscript database
Planting cotton [Gossypium hirsutum (L.)] in narrow rather than wide rows could reduce erosion and off-site agrochemical transport, but this hypothesis needs to be evaluated under Mid-South cropping conditions. Field studies were conducted near Stoneville, MS on a Dundee silty clay loam from 2006 t...
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Alleles conferring improved fiber quality from EMS mutagenesis of elite cotton genotypes
USDA-ARS?s Scientific Manuscript database
The elite gene pool of cotton (Gossypium spp.) has less diversity than those of most other major crops, making identification of novel alleles important to ongoing crop improvement. A total of 3,164 M5 lines resulting from ethyl methanesulfonate mutagenesis of two G. hirsutum breeding lines, TAM 94L...
Reflectance measurements of cotton leaf senescence altered by mepiquat chloride
NASA Technical Reports Server (NTRS)
Gausman, H. W.; Escobar, D. E.; Rodriguez, R. R. (Principal Investigator)
1982-01-01
Spectrophotometric reflectance measurements were made on plant-attached leaves to evaluate growth chamber-grown cotton leaf (Gossypium hirsutum L.) senescence (chlorophyll degradation as criterion) that was delayed by mepiquat chloride (1,1-dimethylpiperidinium chloride) rates of 0, 10, 40, 70, and 100 g a.i./ha. Mepiquat chloride (MC increased both chlorophyll and leaf water contents as compared with that of untreated leaves. Reflectance was inversely and linearly correlated (r = -0.873**) with eater content at the 1.65 micrometer wavelength and was inversely correlated (r = -0.812**) with chlorophyll concentration at the 0.55 micrometer wavelength but best fit a quadratic equation. Either wavelength measurement might be useful to remotely detect cotton leaf senescence or fields of MC-treated cotton plants.
USDA-ARS?s Scientific Manuscript database
Drought and salt tolerances are complex traits and controlled by multiple genes, environmental factors and their interactions. Drought and salt stresses can result in more than 50% yield loss in Upland cotton (Gossypium hirsutum L.). G. barbadense L. (the source of Pima cotton) carries desirable tra...
2013-01-01
Background Cotton (Gossypium hirsutum L.) is a major fiber crop that is grown worldwide; it faces extensive damage from sap-sucking insects, including aphids and whiteflies. Genome-wide transcriptome analysis was performed to understand the molecular details of interaction between Gossypium hirsutum L. and sap-sucking pests, namely Aphis gossypii (Aphid) and Bemisia tabacci (Whiteflies). Roche’s GS-Titanium was used to sequence transcriptomes of cotton infested with aphids and whiteflies for 2 h and 24 h. Results A total of 100935 contigs were produced with an average length of 529 bp after an assembly in all five selected conditions. The Blastn of the non-redundant (nr) cotton EST database resulted in the identification of 580 novel contigs in the cotton plant. It should be noted that in spite of minimal physical damage caused by the sap-sucking insects, they can change the gene expression of plants in 2 h of infestation; further change in gene expression due to whiteflies is quicker than due to aphids. The impact of the whitefly 24 h after infestation was more or less similar to that of the aphid 2 h after infestation. Aphids and whiteflies affect many genes that are regulated by various phytohormones and in response to microbial infection, indicating the involvement of complex crosstalk between these pathways. The KOBAS analysis of differentially regulated transcripts in response to aphids and whiteflies indicated that both the insects induce the metabolism of amino acids biosynthesis specially in case of whiteflies infestation at later phase. Further we also observed that expression of transcript related to photosynthesis specially carbon fixation were significantly influenced by infestation of Aphids and Whiteflies. Conclusions A comparison of different transcriptomes leads to the identification of differentially and temporally regulated transcripts in response to infestation by aphids and whiteflies. Most of these differentially expressed contigs were
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) lint yield losses associated with southern root-knot nematode [Meloidogyne incognita] (RKN) parasitism have increased during the last 20 years. The hypothesis that variable rate application of nematicides can reduce yield losses and reduce the risk for under- and over-...
Chen, Z; Nie, H; Grover, C E; Wang, Y; Li, P; Wang, M; Pei, H; Zhao, Y; Li, S; Wendel, J F; Hua, J
2017-05-01
Cotton (Gossypium spp.) is commonly grouped into eight diploid genomic groups, designated A-G and K, and an allotetraploid genomic group, AD. Gossypium raimondii (D 5 ) and G. arboreum (A 2 ) are the putative contributors to the progenitor of G. hirsutum (AD 1 ), the economically important fibre-producing cotton species. Mitochondrial DNA from week-old etiolated seedlings was extracted from isolated organelles using discontinuous sucrose density gradient method. Mitochondrial genomes were sequenced, assembled, annotated and analysed in orderly. Gossypium raimondii (D 5 ) and G. arboreum (A 2 ) mitochondrial genomes were provided in this study. The mitochondrial genomes of two diploid species harboured circular genome of 643,914 bp (D 5 ) and 687,482 bp (A 2 ), respectively. They differ in size and number of repeat sequences, both contain illuminating triplicate sequences with 7317 and 10,246 bp, respectively, demonstrating dynamic difference and rearranged genome organisations. Comparing the D 5 and A 2 mitogenomes with mitogenomes of tetraploid Gossypium species (AD 1 , G. hirsutum; AD 2 , G. barbadense), a shared 11 kbp fragment loss was detected in allotetraploid species, three regions shared by G. arboreum (A 2 ), G. hirsutum (AD 1 ) and G. barbadense (AD 2 ), while eight regions were specific to G. raimondii (D 5 ). The presence/absence variations and gene-based phylogeny supported that A-genome is a cytoplasmic donor to the progenitor of allotetraploid species G. hirsutum and G. barbadense. The results present structure variations and phylogeny of Gossypium mitochondrial genome evolution. © 2017 The Authors. Plant Biology published by John Wiley & Sons Ltd on behalf of German Botanical Society, Royal Dutch Botanical Society.
USDA-ARS?s Scientific Manuscript database
Petroleum prices impacts cotton (Gossypium hirsutum L.) N fertilization cost. A 3-year field study was conducted on a Dundee silt loam to assess the interactions of leguminous cover crops [none, Austrian winter field pea (Pisum sativum L.) or hairy vetch (Vicia villosa Roth] and N fertilization rate...
Nitrogen fertilizer sources and tillage effects on cotton growth, yield, and fiber quality
USDA-ARS?s Scientific Manuscript database
Interest in urea-ammonium sulfate (UAS) as a N fertilizer is increasing due, in part, to increased restriction on ammonium nitrate. This has resulted in UAS being marketed as an alternative fertilizer source; however, UAS has not been widely tested. A cotton (Gossypium hirsutum L.) field study was c...
Feng, Hongjie; Li, Yanjun; Wang, Shaofang; Zhang, Liangliang; Liu, Yongchuang; Xue, Fei; Sun, Yuqiang; Wang, Yongmei; Sun, Jie
2014-11-01
The structural characteristics and component differences of proanthocyanidins in brown and white cotton fibres were identified by nuclear magnetic resonance (NMR) and matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) analyses. Proanthocyanidins in brown and white cotton fibres were found to contain mainly procyanidin (PC) and prodelphidin (PD) units with 2, 3-cis form (epigallocatechin and epicatechin). However, part of the proanthocyanidins in the white cotton fibres were modified by acylation and were constitutively different from the proanthocyanidins in brown cotton fibres. The relative amount of PD was similar to that of PC in white cotton fibres, while proanthocyanidins in brown cotton fibres consisted mainly of PD units with a relative ratio of 9:1. In brown cotton fibres, the proanthocyanidin monomeric composition was consistent with the expression profiles of proanthocyanidin synthase genes, suggesting that anthocyanidin reductase represented the major flow of the proanthocyanidin biosynthesis pathway. In addition, the structural characteristics and component differences of proanthocanidins in brown and white cotton fibres suggested that quinones, the oxidation products of proanthocyanidins, were the direct contributors to colour development in brown cotton fibre. This was demonstrated by vanillin-HCl staining and Borntrager's test. Collectively, these data demonstrated that the biosynthesis of proanthocyanidins is a crucial pigmentation process in brown cotton fibre, and that quinones may represent the main pigments contributing to formation of the the brown colour. This study revealed the molecular basis of pigmentation in brown cotton fibres, and provided important insights for genetic manipulation of pigment production in cotton fibres. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Ulloa, M; Wang, C; Saha, S; Hutmacher, R B; Stelly, D M; Jenkins, J N; Burke, J; Roberts, P A
2016-04-01
Chromosome substitution (CS) lines in plants are a powerful genetic resource for analyzing the contribution of chromosome segments to phenotypic variance. In this study, a series of interspecific cotton (Gossypium spp.) CS lines were used to identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode or fungal disease resistance traits. The CS lines were developed in the G. hirsutum L. TM-1 background with chromosome or chromosome segment substitutions from G. barbadense L. Pima 3-79 or G. tomentosum. Root-knot nematode (Meloidogyne incognita) and fusarium wilt (Fusarium oxysporum f. sp. vasinfectum) (races 1 and 4) resistance alleles and quantitative trait loci (QTL) previously placed on cotton chromosomes using SSR markers in two interspecific recombinant inbred line populations were chosen for testing. Phenotypic responses of increased resistance or susceptibility in controlled inoculation and infested field assays confirmed the resistance QTLs, based on substitution with the positive or negative allele for resistance. Lines CS-B22Lo, CS-B04, and CS-B18 showed high resistance to nematode root-galling, confirming QTLs on chromosomes 4 and 22 (long arm) with resistance alleles from Pima 3-79. Line CS-B16 had less fusarium race 1-induced vascular root staining and higher percent survival than the TM-1 parent, confirming a major resistance QTL on chromosome 16. Lines CS-B(17-11) and CS-B17 had high fusarium race 4 vascular symptoms and low survival due to susceptible alleles introgressed from Pima 3-79, confirming the localization on chromosome 17 of an identified QTL with resistance alleles from TM1 and other resistant lines. Analyses validated regions on chromosomes 11, 16, and 17 harboring nematode and fusarium wilt resistance genes and demonstrated the value of CS lines as both a germplasm resource for breeding programs and as a powerful genetic analysis tool for determining QTL effects for disease
USDA-ARS?s Scientific Manuscript database
Pantoea ananatis (Serano) representatives are known to have a broad host range including both humans and plants. The cotton fleahopper (Pseudatomoscelis seriatus, Reuter) is a significant pest that causes cotton bud damage that may result in significant yield losses. In this study, cotton fleahopp...
USDA-ARS?s Scientific Manuscript database
Timely reflectance data from cotton (Gossypium hirsutum L.) production fields provide a useful tool for crop health assessment and site-specific crop management decisions. This field study investigated the relationships among site-specific normalized difference vegetation index (NDVI), soil physical...
USDA-ARS?s Scientific Manuscript database
Background: Cotton fiber maturity refers the degree of fiber cell wall development and is an important factor for determining commercial value of cotton. The molecular mechanism regulating the fiber cell wall development has not been well characterized. Microscopic image analysis of the cross-sect...
Efect of tri-species chromosome shuffling on agronomic and fiber traits in Upland cotton
USDA-ARS?s Scientific Manuscript database
Gossypium barbadense (L.), G. tomentosum (Seem.), G. mustelinum (Watt.) and G. darwinii (Watt.) are in the primary gene pool of Upland cotton (G. hirsutum). They share a common chromosome number (2n=52), similar AD-genome architecture, and form reasonably fertile F1 hybrids. However, reduced transm...
Recurrent selection performance for FOV race 4 resistance in selected cotton germplasm and progeny
USDA-ARS?s Scientific Manuscript database
Recurrent selection is being used to improve Fusarium oxysporum f. sp. vasinfectum race 4 (FOV4) resistance in Upland (Gossypium hirsutum L.) and Pima (G. barbadense L.) cotton using naturally infested fields and artificially inoculum-greenhouse sites. One of our target objectives is to introduce a ...
Effect of foliar-applied salicylic acid on cotton flowering, boll retention, and yield
J.J. Heitholt; J.H. Schmidt; Joseph E. Mulrooney
2001-01-01
Salicylic acid (2-hydroxybenzoic acid) may help regulate several plant functions, including systemic acquired resistance to pathogens and the formation of flowers. The objective of this study was to characterize the effects of foliar-applied salicylic acid on cotton (Gossypium hirsutum L.) flowering, boll retention, and yield. Field experiments were...
USDA-ARS?s Scientific Manuscript database
Recent studies have suggested that cottonseed (Gossypium spp.) has the potential to contribute to the effort against world hunger, particularly by providing a high quality protein source. This report analyzed the diversity in protein content and other seed quality factors in the US National Cotton ...
USDA-ARS?s Scientific Manuscript database
To mitigate the effects of heat and drought stress, an understanding of the genetic control of physiological responses to these environmental conditions is needed. To this end, we evaluated an upland cotton (Gossypium hirsutum L.) mapping population under water-limited and well-watered conditions in...
Carter, William W.
1981-01-01
Gossypium arboreum 'Nanking CB 1402' possessed a high level of resistance to Rotylenchulus reniformis. Within 16 h, the nematode penetrated roots of resistant and susceptible cottons equally. After 36 h, significantly fewer nematodes were found in resistant roots. Larvae fed in either an endodermal or pericyclic cell and had no specificity for root tissue of a particular age. In roots of resistant G. arboreum '1402,' wall breakdown of pericyclic cells was evident after 3 d, endodermal and cortical cells collapsed, and the hypertrophied pericyclic cells disintegrated within 12 d. Cell walls immediately adjacent to the nematode's head were thickened and more safranin positive in resistant than in susceptible cotton cultivars. Several other cultivars of G. arboreum were also resistant to R. reniformis, based on nematode fecundity and percent egg reduction. PMID:19300777
Venkatachalam, P; Priyanka, N; Manikandan, K; Ganeshbabu, I; Indiraarulselvi, P; Geetha, N; Muralikrishna, K; Bhattacharya, R C; Tiwari, M; Sharma, N; Sahi, S V
2017-01-01
This report focuses on application of zinc oxide nanoparticles (ZnONPs) carrying phycomolecule ligands as a novel plant growth promoter aimed at increasing the crop productivity. The present investigation examined the effect of ZnONPs on plant growth characteristics, and associated biochemical changes in cotton (Gossypium hirsutum L.) following growth in a range of concentrations (25-200 mg L -l ZnONPs) in combination with 100 mM P in a hydroponic system. Treated plants registered an increase in growth and total biomass by 130.6% and 131%, respectively, over control. Results demonstrated a significant increase in the level of chlorophyll a (141.6%), b (134.7%), carotenoids (138.6%), and total soluble protein contents (179.4%); at the same time, a significant reduction (68%) in the level of malondialdehyde (MDA) in leaves with respect to control. Interestingly, a significant increase in superoxide dismutase (SOD, 264.2%), and peroxidase (POX, 182.8%) enzyme activities followed by a decrease in the catalase (CAT) activity, in response to above treatments. These results suggest that bioengineered ZnONPs interact with meristematic cells triggering biochemical pathways conducive to an accumulation of biomass. Further investigations will map out the mode of action involved in growth promotion. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Palmer amaranth (Amaranthus palmeri S. Wats.) invasion negatively impacts cotton (Gossypium hirsutum L.) production systems throughout the United States. The objective of this study was to evaluate canopy hyperspectral narrowband data as input into the random forest machine learning algorithm to dis...
Linkage Map Construction and QTL Analysis of Agronomic and Fiber Quality Traits in Cotton.
USDA-ARS?s Scientific Manuscript database
The superior fiber properties of Gossypium barbadense L. serve as a source of novel variation for improving fiber quality in Upland cotton (G. hirsutum L.), but introgression from G. barbadense has been largely unsuccessful due to hybrid breakdown and a lack of genetic and genomic resources. In an e...
Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects
Malik, Waqas; Iqbal, Muhammad Zaffar; Ali Khan, Asif; Qayyum, Abdul; Ali Abid, Muhammad; Noor, Etrat; Qadir Ahmad, Muhammad; Hasan Abbasi, Ghulam
2014-01-01
Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L.) is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS) technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS) are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i) comparative analysis of low- and high-throughput marker technologies available in cotton, (ii) genetic diversity in the available wild and improved gene pools of cotton, (iii) identification of the genomic regions within cotton genome underlying economic traits, and (iv) marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands. PMID:25401149
USDA-ARS?s Scientific Manuscript database
A chromosome specific recombinant inbred line (CS-B05shRIL) population was created from a cross of TM-1, the genetic standard line of Gossypium hirsutum L. and CS-B05sh, a previously released interspecific chromosome substitution line in which all of the chromosome pairs are genetically similar to T...
Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang
2015-01-01
Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660
Huang, Yu; Wei, Xiaoyang; Zhou, Shiguang; Liu, Mingyong; Tu, Yuanyuan; Li, Ao; Chen, Peng; Wang, Yanting; Zhang, Xuewen; Tai, Hongzhong; Peng, Liangcai; Xia, Tao
2015-04-01
In this study, steam explosion pretreatment was performed in cotton stalks, leading to 5-6 folds enhancements on biomass enzymatic saccharification distinctive in Gossypium barbadense and Gossypium hirsutum species. Sequential 1% H2SO4 pretreatment could further increase biomass digestibility of the steam-exploded stalks, and also cause the highest sugar-ethanol conversion rates probably by releasing less inhibitor to yeast fermentation. By comparison, extremely high concentration alkali (16% NaOH) pretreatment with raw stalks resulted in the highest hexoses yields, but it had the lowest sugar-ethanol conversion rates. Characterization of wall polymer features indicated that biomass saccharification was enhanced with steam explosion by largely reducing cellulose DP and extracting hemicelluloses. It also showed that cellulose crystallinity and arabinose substitution degree of xylans were the major factors on biomass digestibility in cotton stalks. Hence, this study has provided the insights into cell wall modification and biomass process technology in cotton stalks and beyond. Copyright © 2015 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Recent studies have suggested that cottonseed (Gossypium spp.) has the potential to contribute to the effort against world hunger, particularly by providing a high-quality protein source. This report analyzed the diversity in protein content and other seed quality factors in the U.S. National Cotton...
Planting Cotton in a Crop Residue in a Semiarid Climate: Water Balance and Lint Yield
USDA-ARS?s Scientific Manuscript database
Cotton (Gossypium hirsutum L.) is planted on more land area than any other crop on the Texas High Plains. Much of this area is considered highly erodible and requires a conservation compliance program to participate in government farm programs. Because this region is semiarid and because irrigation ...
Modelling the structural response of cotton plants to mepiquat chloride and population density
Gu, Shenghao; Evers, Jochem B.; Zhang, Lizhen; Mao, Lili; Zhang, Siping; Zhao, Xinhua; Liu, Shaodong; van der Werf, Wopke; Li, Zhaohu
2014-01-01
Background and Aims Cotton (Gossypium hirsutum) has indeterminate growth. The growth regulator mepiquat chloride (MC) is used worldwide to restrict vegetative growth and promote boll formation and yield. The effects of MC are modulated by complex interactions with growing conditions (nutrients, weather) and plant population density, and as a result the effects on plant form are not fully understood and are difficult to predict. The use of MC is thus hard to optimize. Methods To explore crop responses to plant density and MC, a functional–structural plant model (FSPM) for cotton (named CottonXL) was designed. The model was calibrated using 1 year's field data, and validated by using two additional years of detailed experimental data on the effects of MC and plant density in stands of pure cotton and in intercrops of cotton with wheat. CottonXL simulates development of leaf and fruits (square, flower and boll), plant height and branching. Crop development is driven by thermal time, population density, MC application, and topping of the main stem and branches. Key Results Validation of the model showed good correspondence between simulated and observed values for leaf area index with an overall root-mean-square error of 0·50 m2 m−2, and with an overall prediction error of less than 10 % for number of bolls, plant height, number of fruit branches and number of phytomers. Canopy structure became more compact with the decrease of leaf area index and internode length due to the application of MC. Moreover, MC did not have a substantial effect on boll density but increased lint yield at higher densities. Conclusions The model satisfactorily represents the effects of agronomic measures on cotton plant structure. It can be used to identify optimal agronomic management of cotton to achieve optimal plant structure for maximum yield under varying environmental conditions. PMID:24489020
Ma, Xiaoyan; Wu, Hanwen; Jiang, Weili; Ma, Yajie; Ma, Yan
2015-01-01
Redroot pigweed is one of the injurious agricultural weeds on a worldwide basis. Understanding of its interference impact in crop field will provide useful information for weed control programs. The effects of redroot pigweed on cotton at densities of 0, 0.125, 0.25, 0.5, 1, 2, 4, and 8 plants m(-1) of row were evaluated in field experiments conducted in 2013 and 2014 at Institute of Cotton Research, CAAS in China. Redroot pigweed remained taller and thicker than cotton and heavily shaded cotton throughout the growing season. Both cotton height and stem diameter reduced with increasing redroot pigweed density. Moreover, the interference of redroot pigweed resulted in a delay in cotton maturity especially at the densities of 1 to 8 weed plants m(-1) of row, and cotton boll weight and seed numbers per boll were reduced. The relationship between redroot pigweed density and seed cotton yield was described by the hyperbolic decay regression model, which estimated that a density of 0.20-0.33 weed plant m(-1) of row would result in a 50% seed cotton yield loss from the maximum yield. Redroot pigweed seed production per plant or per square meter was indicated by logarithmic response. At a density of 1 plant m(-1) of cotton row, redroot pigweed produced about 626,000 seeds m(-2). Intraspecific competition resulted in density-dependent effects on weed biomass per plant, a range of 430-2,250 g dry weight by harvest. Redroot pigweed biomass ha(-1) tended to increase with increasing weed density as indicated by a logarithmic response. Fiber quality was not significantly influenced by weed density when analyzed over two years; however, the fiber length uniformity and micronaire were adversely affected at density of 1 weed plant m(-1) of row in 2014. The adverse impact of redroot pigweed on cotton growth and development identified in this study has indicated the need of effective redroot pigweed management.
Ma, Xiaoyan; Wu, Hanwen; Jiang, Weili; Ma, Yajie; Ma, Yan
2015-01-01
Redroot pigweed is one of the injurious agricultural weeds on a worldwide basis. Understanding of its interference impact in crop field will provide useful information for weed control programs. The effects of redroot pigweed on cotton at densities of 0, 0.125, 0.25, 0.5, 1, 2, 4, and 8 plants m-1 of row were evaluated in field experiments conducted in 2013 and 2014 at Institute of Cotton Research, CAAS in China. Redroot pigweed remained taller and thicker than cotton and heavily shaded cotton throughout the growing season. Both cotton height and stem diameter reduced with increasing redroot pigweed density. Moreover, the interference of redroot pigweed resulted in a delay in cotton maturity especially at the densities of 1 to 8 weed plants m-1 of row, and cotton boll weight and seed numbers per boll were reduced. The relationship between redroot pigweed density and seed cotton yield was described by the hyperbolic decay regression model, which estimated that a density of 0.20–0.33 weed plant m-1 of row would result in a 50% seed cotton yield loss from the maximum yield. Redroot pigweed seed production per plant or per square meter was indicated by logarithmic response. At a density of 1 plant m-1 of cotton row, redroot pigweed produced about 626,000 seeds m-2. Intraspecific competition resulted in density-dependent effects on weed biomass per plant, a range of 430–2,250 g dry weight by harvest. Redroot pigweed biomass ha-1 tended to increase with increasing weed density as indicated by a logarithmic response. Fiber quality was not significantly influenced by weed density when analyzed over two years; however, the fiber length uniformity and micronaire were adversely affected at density of 1 weed plant m-1 of row in 2014. The adverse impact of redroot pigweed on cotton growth and development identified in this study has indicated the need of effective redroot pigweed management. PMID:26057386
USDA-ARS?s Scientific Manuscript database
Uniqueness, content, localization, and defense-related features of the root-knot nematode resistance-associated MIC-3 multigene cluster in the genus Gossypium are all of interest for molecular evolutionary studies of duplicate genes in allopolyploids. Here we report molecular evolutionary rates of t...
USDA-ARS?s Scientific Manuscript database
Nitrogen fertilizer use efficiency (NUE) is low in surface-irrigated cotton (Gossypium hirsutum L.), especially when adding N to irrigation water. A NO3 soil-test algorithm was compared with canopy reflectance-based N management with surface- overhead sprinkler-irrigation in Central AZ. The surfac...
USDA-ARS?s Scientific Manuscript database
Locally severe outbreaks of Fusarium wilt of cotton (Gossypium spp.) in South Georgia raised concerns about the genotypes of the causal pathogen, Fusarium oxysporum f. sp. vasinfectum. Vegetative complementation tests and DNA sequence analysis were used to determine genetic diversity among 492 F. ox...
USDA-ARS?s Scientific Manuscript database
Background: Individual fiber strength is an important quality attribute that greatly influences the strength of the yarn spun from cotton fibers. Fiber strength is usually measured from bundles of fibers due to the difficulty of reliably measuring strength from individual cotton fibers. However, bun...
USDA-ARS?s Scientific Manuscript database
The semiarid Texas High Plains produces ~30% of U.S. cotton (Gossypium hirsutum L.). Agricultural production, however, is experiencing a transition from irrigated to dryland crop production due to reductions in water availability from the Ogallala aquifer. Additional challenges are imposed by extrem...
Tan, Jiafu; Tu, Lili; Deng, Fenglin; Hu, Haiyan; Nie, Yichun; Zhang, Xianlong
2013-01-01
The cotton (Gossypium spp.) fiber is a unique elongated cell that is useful for investigating cell differentiation. Previous studies have demonstrated the importance of factors such as sugar metabolism, the cytoskeleton, and hormones, which are commonly known to be involved in plant cell development, while the secondary metabolites have been less regarded. By mining public data and comparing analyses of fiber from two cotton species (Gossypium hirsutum and Gossypium barbadense), we found that the flavonoid metabolism is active in early fiber cell development. Different flavonoids exhibited distinct effects on fiber development during ovule culture; among them, naringenin (NAR) could significantly retard fiber development. NAR is a substrate of flavanone 3-hydroxylase (F3H), and silencing the F3H gene significantly increased the NAR content of fiber cells. Fiber development was suppressed following F3H silencing, but the overexpression of F3H caused no obvious effects. Significant retardation of fiber growth was observed after the introduction of the F3H-RNA interference segment into the high-flavonoid brown fiber G. hirsutum T586 line by cross. A greater accumulation of NAR as well as much shorter fibers were also observed in the BC1 generation plants. These results suggest that NAR is negatively associated with fiber development and that the metabolism mediated by F3H is important in fiber development, thus highlighting that flavonoid metabolism represents a novel pathway with the potential for cotton fiber improvement. PMID:23535943
Hinchliffe, Doug J.; Condon, Brian D.; Thyssen, Gregory; Naoumkina, Marina; Madison, Crista A.; Reynolds, Michael; Delhom, Christopher D.; Fang, David D.; Li, Ping; McCarty, Jack
2016-01-01
Some naturally coloured brown cotton fibres from accessions of Gossypium hirsutum L. can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the mechanism of lint fibre FR is not yet fully understood. In this study, we show that both the brown colour and enhanced FR of the Lc1 lint colour locus are linked to a 1.4Mb inversion on chromosome A07 that is immediately upstream of a gene with similarity to Arabidopsis TRANSPARENT TESTA 2 (TT2). As a result of the alternative upstream sequence, the transcription factor GhTT2_A07 is highly up-regulated in developing fibres. In turn, genes in the phenylpropanoid metabolic pathway are activated, leading to biosynthesis of proanthocyanidins and accumulation of inorganic elements. We show that enhanced FR and anthocyanin precursors appear in developing brown fibres well before the brown colour is detectible, demonstrating for the first time that the polymerized proanthocyanidins that constitute the brown colour are not the source of enhanced FR. Identifying the particular colourless metabolite that provides Lc1 cotton with enhanced FR could help minimize the use of synthetic chemical flame retardant additives in textiles. PMID:27567364
Hinchliffe, Doug J; Condon, Brian D; Thyssen, Gregory; Naoumkina, Marina; Madison, Crista A; Reynolds, Michael; Delhom, Christopher D; Fang, David D; Li, Ping; McCarty, Jack
2016-10-01
Some naturally coloured brown cotton fibres from accessions of Gossypium hirsutum L. can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the mechanism of lint fibre FR is not yet fully understood. In this study, we show that both the brown colour and enhanced FR of the Lc1 lint colour locus are linked to a 1.4Mb inversion on chromosome A07 that is immediately upstream of a gene with similarity to Arabidopsis TRANSPARENT TESTA 2 (TT2). As a result of the alternative upstream sequence, the transcription factor GhTT2_A07 is highly up-regulated in developing fibres. In turn, genes in the phenylpropanoid metabolic pathway are activated, leading to biosynthesis of proanthocyanidins and accumulation of inorganic elements. We show that enhanced FR and anthocyanin precursors appear in developing brown fibres well before the brown colour is detectible, demonstrating for the first time that the polymerized proanthocyanidins that constitute the brown colour are not the source of enhanced FR. Identifying the particular colourless metabolite that provides Lc1 cotton with enhanced FR could help minimize the use of synthetic chemical flame retardant additives in textiles. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Global gene expression in cotton (Gossypium hirsutum L.) leaves to waterlogging stress.
Zhang, Yanjun; Kong, Xiangqiang; Dai, Jianlong; Luo, Zhen; Li, Zhenhuai; Lu, Hequan; Xu, Shizhen; Tang, Wei; Zhang, Dongmei; Li, Weijiang; Xin, Chengsong; Dong, Hezhong
2017-01-01
Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control)-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH), but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress.
Global gene expression in cotton (Gossypium hirsutum L.) leaves to waterlogging stress
Zhang, Yanjun; Kong, Xiangqiang; Dai, Jianlong; Luo, Zhen; Li, Zhenhuai; Lu, Hequan; Xu, Shizhen; Tang, Wei; Zhang, Dongmei; Li, Weijiang; Xin, Chengsong
2017-01-01
Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control)-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH), but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress. PMID:28953908
Wang, Ning; Qiao, Wenqing; Liu, Xiaohong; Shi, Jianbin; Xu, Qinghua; Zhou, Hong; Yan, Gentu; Huang, Qun
2017-10-01
In this study, the role of specific components of different coping strategies to salt load were identified. A pot experiment was conducted with four cotton (Gossypium hirsutum L.) cultivars (differing in salt-sensitivity) under salinity stress. Based on observed responses in growth performance and physiological characteristics, CZ91 was the most tolerant of the four cultivars, followed by cultivars CCRI44 and CCRI49, with Z571 being much more sensitive to salt stress. To perform this tolerant response, they implement different adaptative mechanisms to cope with salt-stress. The superior salt tolerance of CZ91 was conferred by at least three complementary physiological mechanisms: its ability to regulate K + and Na + transport more effectively, its higher photochemical efficiency and better antioxidant defense capacity. However, only one or a few specific components of these defense systems play crucial roles in moderately salt tolerant CCRI44 and CCRI49. Lower ROS load in CCRI44 may be attributed to simultaneous induction of antioxidant defenses by maintaining an unusually high level of SOD, and higher activities of CAT, APX, and POD during salt stress. CCRI49 could reduce the excess generation of ROS not only by maintaining a higher selective absorption of K + over Na + in roots across the membranes through SOS1, AKT1, and HAK5, but also by displaying higher excess-energy dissipation (e.g., higher ETR, P R and qN) during salt stress. Overall, our data provide a mechanistic explanation for differential salt stress tolerance among these cultivars and shed light on the different strategies employed by cotton cultivars to minimize the ill effects of stress. Copyright © 2017. Published by Elsevier Masson SAS.
USDA-ARS?s Scientific Manuscript database
The declining saturated thickness of the Ogallala Aquifer combined with the unpredictability of precipitation during the growing season in the Southern High Plains has resulted in elevated production risks associated with short-term crop water deficits. Cotton (Gossypium spp.) cultivars that can use...
USDA-ARS?s Scientific Manuscript database
Irrigation water availability is decreasing in the Southern Great Plains due to continued pumping from the Ogallala aquifer. Cotton (Gossypium hirsutum L.) is a profitable alternative crop suited to sustainable dryland production. However, the growing season of the Texas Panhandle and southwestern...
USDA-ARS?s Scientific Manuscript database
The BNL3279 primers give unique DNA markers that are closely linked with resistance to reniform nematodes in Gossypium longicalx, Gossypium barbadense GB713, and Gossypium aridum. Plants that had been selected and advanced based on reniform nematode bioassays for each of five or six generations of ...
Lacape, Jean-Marc; Llewellyn, Danny; Jacobs, John; Arioli, Tony; Becker, David; Calhoun, Steve; Al-Ghazi, Yves; Liu, Shiming; Palaï, Oumarou; Georges, Sophie; Giband, Marc; de Assunção, Henrique; Barroso, Paulo Augusto Vianna; Claverie, Michel; Gawryziak, Gérard; Jean, Janine; Vialle, Michèle; Viot, Christopher
2010-06-28
Cotton fibers (produced by Gossypium species) are the premier natural fibers for textile production. The two tetraploid species, G. barbadense (Gb) and G. hirsutum (Gh), differ significantly in their fiber properties, the former having much longer, finer and stronger fibers that are highly prized. A better understanding of the genetics and underlying biological causes of these differences will aid further improvement of cotton quality through breeding and biotechnology. We evaluated an inter-specific Gh x Gb recombinant inbred line (RIL) population for fiber characteristics in 11 independent experiments under field and glasshouse conditions. Sites were located on 4 continents and 5 countries and some locations were analyzed over multiple years. The RIL population displayed a large variability for all major fiber traits. QTL analyses were performed on a per-site basis by composite interval mapping. Among the 651 putative QTLs (LOD > 2), 167 had a LOD exceeding permutation based thresholds. Coincidence in QTL location across data sets was assessed for the fiber trait categories strength, elongation, length, length uniformity, fineness/maturity, and color. A meta-analysis of more than a thousand putative QTLs was conducted with MetaQTL software to integrate QTL data from the RIL and 3 backcross populations (from the same parents) and to compare them with the literature. Although the global level of congruence across experiments and populations was generally moderate, the QTL clustering was possible for 30 trait x chromosome combinations (5 traits in 19 different chromosomes) where an effective co-localization of unidirectional (similar sign of additivity) QTLs from at least 5 different data sets was observed. Most consistent meta-clusters were identified for fiber color on chromosomes c6, c8 and c25, fineness on c15, and fiber length on c3. Meta-analysis provided a reliable means of integrating phenotypic and genetic mapping data across multiple populations and
Zhao, Yunlei; Wang, Hongmei; Chen, Wei; Li, Yunhai
2014-01-01
Understanding the population structure and linkage disequilibrium in an association panel can effectively avoid spurious associations and improve the accuracy in association mapping. In this study, one hundred and fifty eight elite cotton (Gossypium hirsutum L.) germplasm from all over the world, which were genotyped with 212 whole genome-wide marker loci and phenotyped with an disease nursery and greenhouse screening method, were assayed for population structure, linkage disequilibrium, and association mapping of Verticillium wilt resistance. A total of 480 alleles ranging from 2 to 4 per locus were identified from all collections. Model-based analysis identified two groups (G1 and G2) and seven subgroups (G1a–c, G2a–d), and differentiation analysis showed that subgroup having a single origin or pedigree was apt to differentiate with those having a mixed origin. Only 8.12% linked marker pairs showed significant LD (P<0.001) in this association panel. The LD level for linked markers is significantly higher than that for unlinked markers, suggesting that physical linkage strongly influences LD in this panel, and LD level was elevated when the panel was classified into groups and subgroups. The LD decay analysis for several chromosomes showed that different chromosomes showed a notable change in LD decay distances for the same gene pool. Based on the disease nursery and greenhouse environment, 42 marker loci associated with Verticillium wilt resistance were identified through association mapping, which widely were distributed among 15 chromosomes. Among which 10 marker loci were found to be consistent with previously identified QTLs and 32 were new unreported marker loci, and QTL clusters for Verticillium wilt resistanc on Chr.16 were also proved in our study, which was consistent with the strong linkage in this chromosome. Our results would contribute to association mapping and supply the marker candidates for marker-assisted selection of Verticillium wilt
USDA-ARS?s Scientific Manuscript database
Use of furrow irrigation in row crop production is a common practice through much of the Midsouth US and yet, nutrients can be transported off-site through surface runoff. A field study with cotton (Gossypium hirsutum, L.) was conducted to understand the impact of furrow tillage practices and nitrog...
USDA-ARS?s Scientific Manuscript database
In this study, we characterized small RNA (sRNA) or microRNA (miRNA) profiles during Fusarium oxysporum f.sp. vasinfectum (FOV) race 3 pathogenesis in cotton (Gossypium hirsutum L.) seedlings. sRNAs or miRNA are known to play important roles in gene expression, including stress responses, influencin...
Efe, Lale; Killi, Fatih; Mustafayev, Sefer A
2009-10-15
In the study carried out in 2002-2003 in the East Mediterranean region of Turkey (in Kahramanmaras Province), four different naturally coloured cotton (Gossypium hirsutum L.) (dark brown, light brown, cream and green) lines from Azerbaijan and two white linted cotton varieties (Maras-92 and Sayar-314 (G. hirsutum L.)) of the region were used as material. The aim of this study was to determine seed cotton yield and yield components and major lint quality traits of investigated coloured cotton lines comprising white linted local standard cotton varieties. Field trials were established in randomized block design with four blocks. According to two year's results, it was determined that naturally coloured cottons were found similar to both white linted standard cotton varieties for sympodia number and seed cotton yield. For boll number per plant, except green cotton line all coloured cotton lines were similar to standard varieties or even some of them were better than standards. For ginning outturn, dark brown, cream and green cotton lines were found statistically similar to standard Maras-92. But all naturally coloured cotton lines had lower seed cotton weight per boll and generally lower fiber quality than white linted standard varieties. For fiber length and fiber strength cream cotton line was the best coloured cotton. And for fiber fineness only green cotton line was better than both standards. It can be said that naturally coloured cotton lines need to be improved especially for fiber quality characters in the East Mediterranean region of Turkey.
Shi, Yuzhen; Zhang, Baocai; Liu, Aiying; Li, Wentan; Li, Junwen; Lu, Quanwei; Zhang, Zhen; Li, Shaoqi; Gong, Wankui; Shang, Haihong; Gong, Juwu; Chen, Tingting; Ge, Qun; Wang, Tao; Zhu, Heqin; Liu, Zhi; Yuan, Youlu
2016-11-05
Verticillium wilt (VW) caused by Verticillium dahliae (Kleb) is one of the most destructive diseases of cotton. The identification of highly resistant QTLs or genes in the whole cotton genome is quite important for developing a VW-resistant variety and for further molecular design breeding. In the present study, BC 1 F 1 , BC 1 S 1 , and BC 2 F 1 populations derived from an interspecific backcross between the highly resistant line Hai1 (Gossypium barbadense L.) and the susceptible variety CCRI36 (G. hirsutum L.) as the recurrent parent were constructed. Quantitative trait loci (QTL) related to VW resistance were detected in the whole cotton genome using a high-density simple sequence repeat (SSR) genetic linkage map from the BC 1 F 1 population, with 2292 loci covering 5115.16 centiMorgan (cM) of the cotton (AD) genome, and the data concerning VW resistance that were obtained from four dates of BC 2 F 1 in the artificial disease nursery and one date of BC 1 S 1 and BC 2 F 1 in the field. A total of 48 QTLs for VW resistance were identified, and 37 of these QTLs had positive additive effects, which indicated that the G. barbadense alleles increased resistance to VW and decreased the disease index (DI) by about 2.2-10.7. These QTLs were located on 19 chromosomes, in which 33 in the A subgenome and 15 QTLs in the D subgenome. The 6 QTLs were found to be stable. The 6 QTLs were consistent with those identified previously, and another 42 were new, unreported QTLs, of which 31 QTLs were from G. barbadense. By meta-analysis, 17 QTL hotspot regions were identified and 10 of them were new, unreported hotspot regions. 29 QTLs in this paper were in 12 hotspot regions and were all from G. barbadense. These stable or consensus QTL regions warrant further investigation to better understand the genetics and molecular mechanisms underlying VW resistance. This study provides useful information for further comparative analysis and marker-assisted selection in the breeding of disease
Diversity analysis of cotton (Gossypium hirsutum L.) germplasm using the CottonSNP63K Array
USDA-ARS?s Scientific Manuscript database
Cotton germplasm resources contain beneficial alleles that can be exploited to develop germplasm adapting to emerging environmental and climate conditions, and this germplasm has commonly been characterized based on phenotypes. However, phenotypic profiles are limited by what can be observed and me...
USDA-ARS?s Scientific Manuscript database
Root-knot nematode (RKN, Meloidogyne incognita) resistance in Gossypium hirsutum ‘Acala NemX’ cotton is conferred by the recessive gene rkn1 (locus Mi2h-C11) on chromosome 11. The concentration of RKN, reniform nematode and other disease resistance determinants on chromosome 11 indicates that much c...
Effect of seed size on ginning Efficiency in Upland Cotton (Gossypium hirsutum L.)
USDA-ARS?s Scientific Manuscript database
Not much information is available in the literature on the effect of seed size on ginning efficiency in upland cotton. In 2015 and 2016 nine diverse upland cotton cultivars and germplasm lines were planted at two locations in Stoneville, MS to test the above relationship. Two of the cultivars (Ark 9...
Linkage and association mapping reveals the genetic basis of brown fibre (Gossypium hirsutum).
Wen, Tianwang; Wu, Mi; Shen, Chao; Gao, Bin; Zhu, De; Zhang, Xianlong; You, Chunyuan; Lin, Zhongxu
2018-02-24
Brown fibre cotton is an environmental-friendly resource that plays a key role in the textile industry. However, the fibre quality and yield of natural brown cotton are poor, and fundamental research on brown cotton is relatively scarce. To understand the genetic basis of brown fibre cotton, we constructed linkage and association populations to systematically examine brown fibre accessions. We fine-mapped the brown fibre region, Lc 1 , and dissected it into 2 loci, qBF-A07-1 and qBF-A07-2. The qBF-A07-1 locus mediates the initiation of brown fibre production, whereas the shade of the brown fibre is affected by the interaction between qBF-A07-1 and qBF-A07-2. Gh_A07G2341 and Gh_A07G0100 were identified as candidate genes for qBF-A07-1 and qBF-A07-2, respectively. Haploid analysis of the signals significantly associated with these two loci showed that most tetraploid modern brown cotton accessions exhibit the introgression signature of Gossypium barbadense. We identified 10 quantitative trait loci (QTLs) for fibre yield and 19 QTLs for fibre quality through a genome-wide association study (GWAS) and found that qBF-A07-2 negatively affects fibre yield and quality through an epistatic interaction with qBF-A07-1. This study sheds light on the genetics of fibre colour and lint-related traits in brown fibre cotton, which will guide the elite cultivars breeding of brown fibre cotton. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Sajjad, Aamer; Anjum, Shakeel Ahmad; Ahmad, Riaz; Waraich, Ejaz Ahmad
2018-01-01
Delayed sowing of wheat (Triticum aestivum L.) in cotton-based system reduces the productivity and profitability of the cotton-wheat cropping system. In this scenario, relay cropping of wheat in standing cotton might be a viable option to ensure the timely wheat sowing with simultaneous improvement in wheat yields and system profitability. This 2-year study (2012-2013 and 2013-2014) aimed to evaluate the influence of sowing dates and relay cropping combined with different management techniques of cotton sticks on the wheat yield, soil physical properties, and the profitability of the cotton-wheat system. The experiment consisted of five treatments viz. (S1) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, (S2) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator, (S3) sowing of wheat at the 7th of November as relay crop in standing cotton with broadcast method, (S4) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, and (S5) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator. The highest seed cotton yield was observed in the S5 treatment which was statistically similar with the S3 and S4 treatments; seed cotton yield in the S1 and S2 treatments has been the lowest in both years of experimentation. However, the S2 treatment produced substantially higher root length, biological yield, and grain yield of wheat than the other treatments. The lower soil bulk density at 0-10-cm depth was recorded in the S2 treatment which was statistically similar with the S5 treatment during both years of experimentation. The volumetric water contents, net
USDA-ARS?s Scientific Manuscript database
Fiber properties measured by high volume instrument (HVI) and advanced fiber information system (AFIS) are currently being used in Upland cotton (Gossypium hirsutum L.) breeding. It would be interesting to know if selections for parameters measured by the two instrumental systems are equally effici...
NASA Astrophysics Data System (ADS)
Roy, K.; Zwieniecki, M.
2017-12-01
Cotton (Gossypium hirsutum L.) is relatively drought resistant and thus is planted widely in many semi-arid and arid parts of the world, many of which are usually deprived of modern water management technologies. Since the productivity of cotton plants depends on water availability, we carried out the present research aiming at testing two different low cost and arid-environment friendly water efficient techniques: application of particle film technology on leaves to reduce the transpiration rate (kaolin dust), and use of organic material to improve the soil water holding capacity (cotton wool). In details, kaolin (3% and 5%; weight:volume) mixed in water was sprayed on the upper surface of the leaves of young plants, and small amounts of cotton wool (0.1%, 0.3% and 0.5%; weight:weight) were mixed into the soils. The study showed that kaolin spray was useful as a transpiration reducing agent only if plants have adequate water in the soil (well irrigated) but not under water stress conditions. In addition, mixing a small amount of cotton wool into the soil can significantly increase the amount of water available to the plants, and extend the benefit of kaolin application on plants.
Wang, Baohua; Liu, Limei; Zhang, Dong; Zhuang, Zhimin; Guo, Hui; Qiao, Xin; Wei, Lijuan; Rong, Junkang; May, O. Lloyd; Paterson, Andrew H.; Chee, Peng W.
2016-01-01
Among the seven tetraploid cotton species, little is known about transmission genetics and genome organization in Gossypium mustelinum, the species most distant from the source of most cultivated cotton, G. hirsutum. In this research, an F2 population was developed from an interspecific cross between G. hirsutum and G. mustelinum (HM). A genetic linkage map was constructed mainly using simple sequence repeat (SSRs) and restriction fragment length polymorphism (RFLP) DNA markers. The arrangements of most genetic loci along the HM chromosomes were identical to those of other tetraploid cotton species. However, both major and minor structural rearrangements were also observed, for which we propose a parsimony-based model for structural divergence of tetraploid cottons from common ancestors. Sequences of mapped markers were used for alignment with the 26 scaffolds of the G. hirsutum draft genome, and showed high consistency. Quantitative trait locus (QTL) mapping of fiber elongation in advanced backcross populations derived from the same parents demonstrated the value of the HM map. The HM map will serve as a valuable resource for QTL mapping and introgression of G. mustelinum alleles into G. hirsutum, and help clarify evolutionary relationships between the tetraploid cotton genomes. PMID:27172208
Wang, Haimiao; Chen, Yinglong; Hu, Wei; Wang, Shanshan; Snider, John L; Zhou, Zhiguo
2017-11-01
Short-term waterlogging and chronic elevated temperature occur concomitantly in the cotton (Gossypium hirsutum) growing season. While previous research about co-occurring waterlogging and elevated temperature has focused primarily on cotton fiber, no studies have investigated carbohydrate metabolism of the subtending leaf (a major source leaf for boll development) cross-acclimation to aforementioned stressors. To address this, plants were exposed to ambient (31.6/26.5°C) and elevated (34.1/29.0°C) temperatures during the whole flowering and boll formation stage, and waterlogging (0, 3, 6 days) beginning on the day of anthesis. Both waterlogging and high temperature limited boll biomass (reduced by 1.19-32.14%), but effects of different durations of waterlogging coupled with elevated temperature on carbohydrate metabolism in the subtending leaf were quite different. The 6-day waterlogging combined with elevated temperature had the most negative impact on net photosynthetic rate (Pn) and carbohydrate metabolism of any treatment, leading to upregulated GhSusA and GhSusC expression and enhanced sucrose synthase (SuSy, EC 2.4.1.13) activity for sucrose degradation. A prior exposure to waterlogging for 3 days improved subtending leaf performance under elevated temperature. Pn, sucrose concentrations, Rubisco (EC 4.1.1.39) activity, and cytosolic fructose-1,6-bisphosphatase (cy-FBPase, EC 3.1.3.11) activity in the subtending leaf significantly increased, while SuSy activity decreased under 3 days waterlogging and elevated temperature combined relative to elevated temperature alone. Thus, we concluded that previous exposure to a brief (3 days) waterlogging stress improved sucrose composition and accumulation cross-acclimation to high temperature later in development not only by promoting leaf photosynthesis but also inhibiting sucrose degradation. © 2017 Scandinavian Plant Physiology Society.
Hu, Wei; Zhao, Wenqing; Yang, Jiashuo; Oosterhuis, Derrick M; Loka, Dimitra A; Zhou, Zhiguo
2016-04-01
The nitrogen (N) metabolism of the leaf subtending the cotton boll (LSCB) was studied with two cotton (Gossypium hirsutum L.) cultivars (Simian 3, low-K tolerant; Siza 3, low-K sensitive) under three levels of potassium (K) fertilization (K0: 0 g K2O plant(-1), K1: 4.5 K2O plant(-1) and K2: 9.0 g K2O plant(-1)). The results showed that total dry matter increased by 13.1-27.4% and 11.2-18.5% under K supply for Simian 3 and Siza 3. Boll biomass and boll weight also increased significantly in K1 and K2 treatments. Leaf K content, leaf N content and nitrate (NO3(-)) content increased with increasing K rates, and leaf N content or NO3(-) content had a significant positive correlation with leaf K content. Free amino acid content increased in the K0 treatment for both cultivars, due to increased protein degradation caused by higher protease and peptidase activities, resulting in lower protein content in the K0 treatment. The critical leaf K content for free amino acid and soluble protein content were 14 mg g(-1) and 15 mg g(-1) in Simian 3, and 17 mg g(-1) and 18 mg g(-1) in Siza 3, respectively. Nitrate reductase (NR), glutamic-oxaloace transaminase (GOT) and glutamic-pyruvic transaminase (GPT) activities increased in the K1 and K2 treatments for both cultivars, while glutamine synthetase (GS) and glutamate synthase (GOGAT) activities increased under K supply treatments only for Siza 3, and were not affected in Simian 3, indicating that this was the primary difference in nitrogen-metabolizing enzymes activities for the two cultivars with different sensitivity to low-K. Copyright © 2016. Published by Elsevier Masson SAS.
USDA-ARS?s Scientific Manuscript database
The resistant line Auburn 623RNR and a number of elite breeding lines derived from it remain the most important source of root-knot nematode (RKN) resistance because they exhibit the highest level of resistance to RKN known to date in Upland cotton (Gossypium hirsutum L). Prior genetic mapping analy...
USDA-ARS?s Scientific Manuscript database
Genotype × environment interactions and trait correlations significantly impact efforts to develop high yield, high quality, and environmentally stable Upland cotton (Gossypium hirsutum L.) cultivars. Knowledge of both can and should be used to design optimal breeding programs and effective selectio...
Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S
2012-11-01
Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.
The Elusive Search for Reniform Nematode Resistance in Cotton.
Khanal, Churamani; McGawley, Edward C; Overstreet, Charles; Stetina, Salliana R
2018-05-01
The reniform nematode (Rotylenchulus reniformis Linford and Oliveira) has emerged as the most important plant-parasitic nematode of cotton in the United States cotton belt. Success in the development of reniform nematode-resistant upland cotton cultivars (Gossypium hirsutum L.) has not been realized despite over three decades of breeding efforts. Research approaches ranging from conventional breeding to triple species hybrids to marker-assisted selection have been employed to introgress reniform nematode resistance from other species of cotton into upland cultivars. Reniform nematode-resistant breeding lines derived from G. longicalyx were developed in 2007. However, these breeding lines displayed stunting symptoms and a hypersensitive response to reniform nematode infection. Subsequent breeding efforts focused on G. barbadense, G. aridum, G. armoreanum, and other species that have a high level of resistance to reniform nematode. Marker-assisted selection has greatly improved screening of reniform nematode-resistant lines. The use of advanced molecular techniques such as CRISPER-Cas9 systems and alternative ways such as delivery of suitable "cry" proteins and specific double-stranded RNA to nematodes will assist in developing resistant cultivars of cotton. In spite of the efforts of cotton breeders and nematologists, successes are limited only to the development of reniform nematode-resistant breeding lines. In this article, we provide an overview of the approaches employed to develop reniform nematode-resistant upland cotton cultivars in the past, progress to date, major obstacles, and some promising future research activity.
Ma, Jun; Wang, Qinglian; Sun, Runrun; Xie, Fuliang; Jones, Don C; Zhang, Baohong
2014-10-16
Plant-specific TEOSINTE-BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors play versatile functions in multiple aspects of plant growth and development. However, no systematical study has been performed in cotton. In this study, we performed for the first time the genome-wide identification and expression analysis of the TCP transcription factor family in Gossypium raimondii. A total of 38 non-redundant cotton TCP encoding genes were identified. The TCP transcription factors were divided into eleven subgroups based on phylogenetic analysis. Most TCP genes within the same subfamily demonstrated similar exon and intron organization and the motif structures were highly conserved among the subfamilies. Additionally, the chromosomal distribution pattern revealed that TCP genes were unevenly distributed across 11 out of the 13 chromosomes; segmental duplication is a predominant duplication event for TCP genes and the major contributor to the expansion of TCP gene family in G. raimondii. Moreover, the expression profiles of TCP genes shed light on their functional divergence.
Ma, Jun; Wang, Qinglian; Sun, Runrun; Xie, Fuliang; Jones, Don C.; Zhang, Baohong
2014-01-01
Plant-specific TEOSINTE-BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors play versatile functions in multiple aspects of plant growth and development. However, no systematical study has been performed in cotton. In this study, we performed for the first time the genome-wide identification and expression analysis of the TCP transcription factor family in Gossypium raimondii. A total of 38 non-redundant cotton TCP encoding genes were identified. The TCP transcription factors were divided into eleven subgroups based on phylogenetic analysis. Most TCP genes within the same subfamily demonstrated similar exon and intron organization and the motif structures were highly conserved among the subfamilies. Additionally, the chromosomal distribution pattern revealed that TCP genes were unevenly distributed across 11 out of the 13 chromosomes; segmental duplication is a predominant duplication event for TCP genes and the major contributor to the expansion of TCP gene family in G. raimondii. Moreover, the expression profiles of TCP genes shed light on their functional divergence. PMID:25322260
Farooq, Muhammad; Mansoor, Shahid; Guo, Hui; Amin, Imran; Chee, Peng W.; Azim, M. Kamran; Paterson, Andrew H.
2017-01-01
MicroRNAs (miRNAs) are small 20–24nt molecules that have been well studied over the past decade due to their important regulatory roles in different cellular processes. The mature sequences are more conserved across vast phylogenetic scales than their precursors and some are conserved within entire kingdoms, hence, their loci and function can be predicted by homology searches. Different studies have been performed to elucidate miRNAs using de novo prediction methods but due to complex regulatory mechanisms or false positive in silico predictions, not all of them express in reality and sometimes computationally predicted mature transcripts differ from the actual expressed ones. With the availability of a complete genome sequence of Gossypium arboreum, it is important to annotate the genome for both coding and non-coding regions using high confidence transcript evidence, for this cotton species that is highly resistant to various biotic and abiotic stresses. Here we have analyzed the small RNA transcriptome of G. arboreum leaves and provided genome annotation of miRNAs with evidence from miRNA/miRNA∗ transcripts. A total of 446 miRNAs clustered into 224 miRNA families were found, among which 48 families are conserved in other plants and 176 are novel. Four short RNA libraries were used to shortlist best predictions based on high reads per million. The size, origin, copy numbers and transcript depth of all miRNAs along with their isoforms and targets has been reported. The highest gene copy number was observed for gar-miR7504 followed by gar-miR166, gar-miR8771, gar-miR156, and gar-miR7484. Altogether, 1274 target genes were found in G. arboreum that are enriched for 216 KEGG pathways. The resultant genomic annotations are provided in UCSC, BED format. PMID:28663752
USDA-ARS?s Scientific Manuscript database
Cotton fibers represent the largest single cell in the plant kingdom, and they have been used as a model to study cell function, differentiation, maturation, and cell death. The cotton fiber transcriptome can be clustered into two genomic regions: conserved and recombination hotspots. Genetic link...
USDA-ARS?s Scientific Manuscript database
Silencing phytochrome A1 gene (PHYA1) by RNA interference in Upland cotton (Gossypium hirsutum L. cv. Coker 312) had generated PHYA1 RNAi lines with simultaneously improved fiber quality (longer, stronger and finer fiber) and other key agronomic traits. Comparative analyses of altered molecular proc...
Yan, Qian; Liu, Hou-Sheng; Yao, Dan; Li, Xin; Chen, Han; Dou, Yang; Wang, Yi; Pei, Yan; Xiao, Yue-Hua
2015-01-01
Basic/helix-loop-helix (bHLH) proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum), a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors) maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062) showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus. PMID:25992947
Yan, Qian; Liu, Hou-Sheng; Yao, Dan; Li, Xin; Chen, Han; Dou, Yang; Wang, Yi; Pei, Yan; Xiao, Yue-Hua
2015-01-01
Basic/helix-loop-helix (bHLH) proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum), a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors) maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062) showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilkins, T.A.
1993-06-01
This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.
USDA-ARS?s Scientific Manuscript database
Mutant germplasm lines MD 15-Mut 13 (Reg. No. GP-1025, PI 681706), MD 15-Mut 31 (Reg. No. GP-1026, PI 681707), MD 15-Mut 61 (Reg. No. GP-1027, PI 681708), MD 15-Mut 89 (Reg. No. GP-1028, PI 681709), and MD 15-Mut 138 (Reg. No. GP-1029, PI 681710) are unique genotypes of upland cotton (Gossypium hirs...
USDA-ARS?s Scientific Manuscript database
Cotton fiber length is a key determinant of fiber quality for the textile industry. Improving cotton fiber length without reducing yield is one of the major goals for cotton breeding. However, genetic improvement of cotton fiber length by breeding has been a challenge due to narrow genetic diversit...
USDA-ARS?s Scientific Manuscript database
We determined the effect of exogenous indole-3-acetic acid, a-naphthylene-3-acetic acid and gibberellic acid (GA3) on the enzymatic activity of glucansynthase, peroxidase and cellulase in ovule development of naked L-70 and linted AN-Bayaut-2 cotton (Gossypium hirsutum L.) seeds. We isolated a prote...
USDA-ARS?s Scientific Manuscript database
Fusarium wilt, caused by the soil-borne fungal pathogen Fusarium oxysporum f. sp. vasinfectum (FOV), is a vascular disease of cotton (Gossypium spp.). FOV race 1 (FOV1) causes major plant injury and yield loss in G. hirsutum cultivars with co-infection with root-knot nematode (Meloidogyne incognita)...
USDA-ARS?s Scientific Manuscript database
Glandled cotton plants, Gossypium hirsutum L., have long been known to be more resistant to insect pests compared to their glandless counterparts. This resistance has been mainly attributed to the presence of terpenoid aldehydes such as gossypol, hemigossypolone, and heliocides in the glands. We p...
Singh, Ruchi; Pandey, Neha; Naskar, Jishnu; Shirke, Pramod A
2015-03-01
Cotton is mostly cultivated under rain-fed conditions in India, thus faces frequent drought conditions during its life cycle. Drought being a major stress factor responsible for yield penalty, there has always been a high priority to generate knowledge on adaptation and tolerance of cotton. In the present study, four cotton varieties, JKC-770 and KC-2 (Gossypium hirsutum), and JKC-717 and RAHS-187(Gossypium herbaceum), were imposed to drought. Under drought condition, differential changes in physiological characters like net photosynthesis, transpiration, stomatal conductance, chlorophyll fluorescence, relative water content (RWC), and predawn water potential (ψ 0) showed a change. While proline, malondialdehyde (MDA), and glutathione-S-transferase (GST) content increased along with a concomitant change in the expression of their associated genes. Under moderate stress, tolerant varieties maintain lower ψ 0 probably due to higher proline content as compared to sensitive varieties. Cyclic electron flow (CEF) also plays an important role in tolerance under mild water stress in G. hirsutum varieties. CEF not only activates at high light but also initiates at a very low light intensity. Expression analysis of genes reveals that drought-tolerant varieties showed enhanced detoxifying mechanism by up-regulation of asparagine synthase (AS), glutathione-S-transferase (GST), and methyl glyoxalase (GlyI) genes under drought stress. Up-regulation of Δ(1)-pyrroline-5-carboxylase synthase (Δ(1)P5CS) enhanced accumulation of proline, an osmolyte, under drought in tolerant varieties. While the drought-sensitive varieties showed up-regulation of ethylene responsive factor (ERF) and down-regulation of WRKY70 responsible for senescence of the leaf which correlated well with the high rate of leaf fall in sensitive varieties under water stress.
Control of plant trichome development by a cotton fiber MYB gene.
Wang, Shui; Wang, Jia-Wei; Yu, Nan; Li, Chun-Hong; Luo, Bin; Gou, Jin-Ying; Wang, Ling-Jian; Chen, Xiao-Ya
2004-09-01
Cotton (Gossypium spp) plants produce seed trichomes (cotton fibers) that are an important commodity worldwide; however, genes controlling cotton fiber development have not been characterized. In Arabidopsis thaliana the MYB gene GLABRA1 (GL1) is a central regulator of trichome development. Here, we show that promoter of a cotton fiber gene, RD22-like1 (RDL1), contains a homeodomain binding L1 box and a MYB binding motif that confer trichome-specific expression in Arabidopsis. A cotton MYB protein GaMYB2/Fiber Factor 1 transactivated the RDL1 promoter both in yeast and in planta. Real-time PCR and in situ analysis showed that GaMYB2 is predominantly expressed early in developing cotton fibers. After transferring into Arabidopsis, GL1::GaMYB2 rescued trichome formation of a gl1 mutant, and interestingly, 35S::GaMYB2 induced seed-trichome production. We further demonstrate that the first intron of both GL1 and GaMYB2 plays a role in patterning trichomes: it acts as an enhancer in trichome and a repressor in nontrichome cells, generating a trichome-specific pattern of MYB gene expression. Disruption of a MYB motif conserved in intron 1 of GL1, WEREWOLF, and GaMYB2 genes affected trichome production. These results suggest that cotton and Arabidopsis use similar transcription factors for regulating trichomes and that GaMYB2 may be a key regulator of cotton fiber development.
USDA-ARS?s Scientific Manuscript database
Six Upland cotton, Gossypium hirsutum L., germplasm lines, M Rk-Rn 1, M Rk-Rn 2, M Rk-Rn 3, M Rk-Rn 4, M Rk-Rn 5, and M Rk-Rn 6, with resistance to root-knot nematode, Meloidogyne incognita (Kofoid and White) Chitwood, and reniform nematode, Rotylenchulus reniformis Linford and Oliveria, were jointl...
Blenda, Anna; Fang, David D.; Rami, Jean-François; Garsmeur, Olivier; Luo, Feng; Lacape, Jean-Marc
2012-01-01
A consensus genetic map of tetraploid cotton was constructed using six high-density maps and after the integration of a sequence-based marker redundancy check. Public cotton SSR libraries (17,343 markers) were curated for sequence redundancy using 90% as a similarity cutoff. As a result, 20% of the markers (3,410) could be considered as redundant with some other markers. The marker redundancy information had been a crucial part of the map integration process, in which the six most informative interspecific Gossypium hirsutum×G. barbadense genetic maps were used for assembling a high density consensus (HDC) map for tetraploid cotton. With redundant markers being removed, the HDC map could be constructed thanks to the sufficient number of collinear non-redundant markers in common between the component maps. The HDC map consists of 8,254 loci, originating from 6,669 markers, and spans 4,070 cM, with an average of 2 loci per cM. The HDC map presents a high rate of locus duplications, as 1,292 markers among the 6,669 were mapped in more than one locus. Two thirds of the duplications are bridging homoeologous AT and DT chromosomes constitutive of allopolyploid cotton genome, with an average of 64 duplications per AT/DT chromosome pair. Sequences of 4,744 mapped markers were used for a mutual blast alignment (BBMH) with the 13 major scaffolds of the recently released Gossypium raimondii genome indicating high level of homology between the diploid D genome and the tetraploid cotton genetic map, with only a few minor possible structural rearrangements. Overall, the HDC map will serve as a valuable resource for trait QTL comparative mapping, map-based cloning of important genes, and better understanding of the genome structure and evolution of tetraploid cotton. PMID:23029214
USDA-ARS?s Scientific Manuscript database
Glandled cotton plants, Gossypium hirsutum L., have long been known to be more resistant to insect pests compared to their glandless counterparts. This resistance has been mainly attributed to the presence of terpenoid aldehydes such as gossypol, hemigossypolone, and heliocides in the glands. We p...
USDA-ARS?s Scientific Manuscript database
A DArT marker platform is developed for the cotton genome to evaluate the use of DArT markers compared to AFLPs in mapping, and transferability across the mapping populations. We used a reference genetic map of tetraploid Gossypium that already contained ~5000 loci which coalesced into 26 chromosom...
Chen, Yu; Wang, Yingying; Zhao, Ting; Yang, Jianwei; Feng, Shouli; Nazeer, Wajad; Zhang, Tianzhen; Zhou, Baoliang
2015-01-01
Gossypium arboreum, a cultivated cotton species (2n = 26, AA) native to Asia, possesses invaluable characteristics unavailable in the tetraploid cultivated cotton gene pool, such as resistance to pests and diseases and tolerance to abiotic stresses. However, it is quite difficult to transfer favorable traits into Upland cotton through conventional methods due to the cross-incompatibility of G. hirsutum (2n = 52, AADD) and G. arboreum. Here, we improved an embryo rescue technique to overcome the cross-incompatibility between these two parents for transferring favorable genes from G. arboreum into G. hirsutum. Our results indicate that MSB2K supplemented with 0.5 mgl-1 kinetin and 250 mg-1 casein hydrolysate is an efficient initial medium for rescuing early (3 d after pollination) hybrid embryos. Eight putative hybrids were successfully obtained, which were further verified and characterized by cytology, molecular markers and morphological analysis. The putative hybrids were subsequently treated with different concentrations of colchicine solution to double their chromosomes. The results demonstrate that four putative hybrid plants were successfully chromosome-doubled by treatment with 0.1% colchicine for 24 h and become amphiploid, which were confirmed by cytological observation, self-fertilization and backcrossing. Preliminary assessments of resistance at seedling stage indicate that the synthetic amphiploid showed highly resistant to Verticillium and drought. The synthetic amphiploid between G. hirsutum × G. arboreum would lay the foundation for developing G. arboreum-introgressed lines with the uniform genetic background of G. hirsutum acc TM-1, which would greatly enhance and simplify the mining, isolation, characterization, cloning and use of G. arboreum-specific desirable genes in future cotton breeding programs. PMID:26061996
Gene copy number evolution during tetraploid cotton radiation.
Rong, J; Feltus, F A; Liu, L; Lin, L; Paterson, A H
2010-11-01
After polyploid formation, retention or loss of duplicated genes is not random. Genes with some functional domains are convergently restored to 'singleton' state after many independent genome duplications, and have been referred to as 'duplication-resistant' (DR) genes. To further explore the timeframe for their restoration to the singleton state, 27 cotton homologs of genes found to be 'DR' in Arabidopsis were selected based on diagnostic Pfam domains. Their copy numbers were studied using southern hybridization and sequence analysis in five tetraploid species and their ancestral A and D genome diploids. DR genes had significantly lower copy number than gene families hybridizing to randomly selected cotton ESTs. Three DR genes showed complete loss of D genome-derived homoeologs in some or all tetraploid species. Prior analysis has shown gene loss in polyploid cotton to be rare, and herein only one randomly selected gene showed loss of a homoeolog in only one of the five tetraploid species (Gossypium mustelinum). BAC sequencing confirmed two cases of gene loss in tetraploid cotton. Divergence among 5' sequences of DR genes amplified from G. arboreum, G. raimondii, and Gossypioides kirkii was correlated with gene copy number. These results show that genes containing Pfam domains associated with duplication resistance in Arabidopsis have also been preferentially restored to low copy number after a more recent polyploidization event in cotton. In tetraploid cotton, genes from the progenitor D genome seem to experience more gene copy number divergence than genes from the A genome. Together with D subgenome-biased alterations in gene expression, perhaps gene loss may contribute to the relatively larger portion of quantitative trait variation attributable to D than A subgenome chromosomes of tetraploid cotton.
Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping
2016-07-20
Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways. Copyright © 2016 Elsevier B.V. All rights reserved.
Transcriptome analysis of nitric oxide-responsive genes in upland cotton (Gossypium hirsutum).
Huang, Juan; Wei, Hengling; Li, Libei; Yu, Shuxun
2018-01-01
Nitric oxide (NO) is an important signaling molecule with diverse physiological functions in plants. It is therefore important to characterize the downstream genes and signal transduction networks modulated by NO. Here, we identified 1,932 differentially expressed genes (DEGs) responding to NO in upland cotton using high throughput tag sequencing. The results of quantitative real-time polymerase chain reaction (qRT-PCR) analysis of 25 DEGs showed good consistency. Gene Ontology (GO) and KEGG pathway were analyzed to gain a better understanding of these DEGs. We identified 157 DEGs belonging to 36 transcription factor (TF) families and 72 DEGs related to eight plant hormones, among which several TF families and hormones were involved in stress responses. Hydrogen peroxide and malondialdehyde (MDA) contents were increased, as well related genes after treatment with sodium nitroprusside (SNP) (an NO donor), suggesting a role for NO in the plant stress response. Finally, we compared of the current and previous data indicating a massive number of NO-responsive genes at the large-scale transcriptome level. This study evaluated the landscape of NO-responsive genes in cotton and identified the involvement of NO in the stress response. Some of the identified DEGs represent good candidates for further functional analysis in cotton.
The Mating System of the Wild-to-Domesticated Complex of Gossypium hirsutum L. Is Mixed
Velázquez-López, Rebeca; Wegier, Ana; Alavez, Valeria; Pérez-López, Javier; Vázquez-Barrios, Valeria; Arroyo-Lambaer, Denise; Ponce-Mendoza, Alejandro; Kunin, William E.
2018-01-01
The domestication syndrome of many plants includes changes in their mating systems. The evolution of the latter is shaped by ecological and genetic factors that are particular to an area. Thus, the reproductive biology of wild relatives must be studied in their natural distribution to understand the mating system of a crop species as a whole. Gossypium hirsutum (upland cotton) includes both domesticated varieties and wild populations of the same species. Most studies on mating systems describe cultivated cotton as self-pollinated, while studies on pollen dispersal report outcrossing; however, the mating system of upland cotton has not been described as mixed and little is known about its wild relatives. In this study we selected two wild metapopulations for comparison with domesticated plants and one metapopulation with evidence of recent gene flow between wild relatives and the crop to evaluate the mating system of cotton’s wild-to-domesticated complex. Using classic reproductive biology methods, our data demonstrate that upland cotton presents a mixed mating system throughout the complex. Given cotton’s capacity for outcrossing, differences caused by the domestication process in cultivated individuals can have consequences for its wild relatives. This characterization of the diversity of the wild relatives in their natural distribution, as well as their interactions with the crop, will be useful to design and implement adequate strategies for conservation and biosecurity. PMID:29868048
Gao, Zhenrui; Liu, Chuanliang; Zhang, Yanzhao; Li, Ying; Yi, Keke; Zhao, Xinhua; Cui, Min-Long
2013-01-01
The red leaf coloration of Empire Red Leaf Cotton (ERLC) (Gossypium hirsutum L.), resulted from anthocyanin accumulation in light, is a well known dominant agricultural trait. However, the underpin molecular mechanism remains elusive. To explore this, we compared the molecular biological basis of anthocyanin accumulation in both ERLC and the green leaf cotton variety CCRI 24 (Gossypium hirsutum L.). Introduction of R2R3-MYB transcription factor Rosea1, the master regulator anthocyanin biosynthesis in Antirrhinum majus, into CCRI 24 induced anthocyanin accumulation, indicating structural genes for anthocyanin biosynthesis are not defected and the leaf coloration might be caused by variation of regulatory genes expression. Expression analysis found that a transcription factor RLC1 (Red Leaf Cotton 1) which encodes the ortholog of PAP1/Rosea1 was highly expressed in leaves of ERLC but barely expressed in CCRI 24 in light. Ectopic expression of RLC1 from ERLC and CCRI 24 in hairy roots of Antirrhinum majus and CCRI 24 significantly enhanced anthocyanin accumulation. Comparison of RLC1 promoter sequences between ERLC and CCRI 24 revealed two 228-bp tandem repeats presented in ERLC with only one repeat in CCRI 24. Transient assays in cotton leave tissue evidenced that the tandem repeats in ERLC is responsible for light-induced RLC1 expression and therefore anthocyanin accumulation. Taken together, our results in this article strongly support an important step toward understanding the role of R2R3-MYB transcription factors in the regulatory menchanisms of anthocyanin accumulation in red leaf cotton under light.
Control of Plant Trichome Development by a Cotton Fiber MYB GeneW⃞
Wang, Shui; Wang, Jia-Wei; Yu, Nan; Li, Chun-Hong; Luo, Bin; Gou, Jin-Ying; Wang, Ling-Jian; Chen, Xiao-Ya
2004-01-01
Cotton (Gossypium spp) plants produce seed trichomes (cotton fibers) that are an important commodity worldwide; however, genes controlling cotton fiber development have not been characterized. In Arabidopsis thaliana the MYB gene GLABRA1 (GL1) is a central regulator of trichome development. Here, we show that promoter of a cotton fiber gene, RD22-like1 (RDL1), contains a homeodomain binding L1 box and a MYB binding motif that confer trichome-specific expression in Arabidopsis. A cotton MYB protein GaMYB2/Fiber Factor 1 transactivated the RDL1 promoter both in yeast and in planta. Real-time PCR and in situ analysis showed that GaMYB2 is predominantly expressed early in developing cotton fibers. After transferring into Arabidopsis, GL1∷GaMYB2 rescued trichome formation of a gl1 mutant, and interestingly, 35S∷GaMYB2 induced seed-trichome production. We further demonstrate that the first intron of both GL1 and GaMYB2 plays a role in patterning trichomes: it acts as an enhancer in trichome and a repressor in nontrichome cells, generating a trichome-specific pattern of MYB gene expression. Disruption of a MYB motif conserved in intron 1 of GL1, WEREWOLF, and GaMYB2 genes affected trichome production. These results suggest that cotton and Arabidopsis use similar transcription factors for regulating trichomes and that GaMYB2 may be a key regulator of cotton fiber development. PMID:15316114
Chromosomal assignment of ALFP markers in upland cotton (Gossypium hirsutum L.)
USDA-ARS?s Scientific Manuscript database
In this research, we used two sets of cotton aneuploid (G. hirsutum × G. tomentosum and G. hirsutum × G. barbadense) plants to locate AFLP markers to chromosome using deletion analysis method. Thirty-eight primer combinations were used to generate 608 polymorphic AFLP markers. Ninety-eight AFLP mark...
Zhang, Wenxiang; Fan, Shuli; Pang, Chaoyou; Wei, Hengling; Ma, Jianhui; Song, Meizhen; Yu, Shuxun
2013-07-01
The MADS-box genes encode a large family of transcription factors having diverse roles in plant development. The SQUAMOSA (SQUA)/APETALA1 (AP1)/FRUITFULL (FUL) subfamily genes are essential regulators of floral transition and floral organ identity. Here we cloned two MADS-box genes, GhMADS22 and GhMADS23, belonging to the SQUA/AP1/FUL subgroup from Gossypium hirsutum L. Phylogenetic analysis and sequence alignment showed that GhMADS22 and GhMADS23 belonged to the euFUL and euAP1 subclades, respectively. The two genes both had eight exons and seven introns from the start codon to the stop codon according to the alignment between the obtained cDNA sequence and the Gossypium raimondii L. genome sequence. Expression profile analysis showed that GhMADS22 and GhMADS23 were highly expressed in developing shoot apices, bracts, and sepals. Gibberellic acid promoted GhMADS22 and GhMADS23 expression in the shoot apex. Transgenic Arabidopsis lines overexpressing 35S::GhMADS22 had abnormal flowers and bolted earlier than wild type under long-day conditions (16 h light/8 h dark). Moreover, GhMADS22 overexpression delayed floral organ senescence and abscission and it could also respond to abscisic acid. In summary, GhMADS22 may have functions in promoting flowering, improving resistance and delaying senescence for cotton and thus it may be a candidate target for promoting early-maturation in cotton breeding. © 2013 Institute of Botany, Chinese Academy of Sciences.
Genetic and epigenetic status of triple exotic consanguinity cotton introgression lines.
He, S P; Sun, J L; Du, X M
2011-10-03
Introgression lines are some of the most important germplasm for breeding applications and other research conducted on cotton crops. The DNA methylation level among 10 introgression lines of cotton (Gossypium hirsutum) and three exotic parental species (G. arboreum, G. thurberi and G. barbadense) were assessed by methylation-sensitive amplified polymorphism (MSAP) technology. The methylation level in the introgression lines ranged from 33.3 to 51.5%. However, the lines PD0111 and PD0113 had the lowest methylation level (34.6 and 33.3%, respectively) due to demethylation of most non-coding sequences. Amplified fragment length polymorphism (AFLP) was used to evaluate the genetic polymorphism in the cotton introgression lines. A high degree of polymorphism was observed in all introgression lines (mean 47.2%) based on AFLP and MSAP analyses. This confirmed the effects of genetic improvement on cotton introgression lines. The low methylation varieties, PD0111 and PD0113 (introgression lines), clustered outside of the introgression lines based on MSAP data, which was incongruent with an AFLP-based dendrogram. This phenomenon could be caused by environmental changes or introgression of exotic DNA fragments.
USDA-ARS?s Scientific Manuscript database
Cotton cultivars with reduced fiber-seed attachment force have the potential to be ginned faster with less energy. The objective of this study was to identify quantitative trait loci (QTL) for net ginning energy (NGE) requirement, and its relationship with other fiber quality traits in upland cotton...
Bajwa, Kamran S.; Shahid, Ahmad A.; Rao, Abdul Q.; Bashir, Aftab; Aftab, Asia; Husnain, Tayyab
2015-01-01
Cotton fiber is multigenic trait controlled by number of genes. Previous studies suggest that one of these genes may be responsible for switching cotton fiber growth on and off to influence the fiber quality produced from a cotton seed. In the present study, the Gossypium hirsutum GhEXPA8 fiber expansin gene was introduced into local cotton variety NIAB 846 by using an Agrobacterium-mediated gene transformation. The neomycin phosphotransferase (NPTII) gene was used as a selection marker for screening of putative transgenic cotton plants. Integration and expression of the fiber expansin gene in cotton plants was confirmed with molecular techniques including Southern blot analyses, real-time PCR. Cellulose assay was used for measurement of cellulose contents of transgenic cotton fiber. The data collected from 3 years of field performance of the transgenic cotton plants expressing GhEXPA8 showed that significant improvement has been made in fiber lengths and micronaire values as compared to control G. hirsutum variety NIAB 846 cotton plants. Statistical techniques were also used for analysis of fiber and agronomic characteristics. The results of this study support improvement of cotton fiber through genetic modification. PMID:26583018
Wang, Le; Zhu, Yue; Wang, Peng; Fan, Qiang; Wu, Yao; Peng, Qing-Zhong; Xia, Gui-Xian; Wu, Jia-He
2016-01-26
Dihydroflavanol 4-reductase (DFR) is a key later enzyme involved in two polyphenols' (anthocyanins and proanthocyanidins (PAs)) biosynthesis, however it is not characterized in cotton yet. In present reports, a DFR cDNA homolog (designated as GhDFR1) was cloned from developing fibers of upland cotton. Silencing GhDFR1 in cotton by virus-induced gene silencing led to significant decrease in accumulation of anthocyanins and PAs. More interestingly, based on LC-MS analysis, two PA monomers, (-)-epicatachin and (-)-epigallocatachin, remarkably decreased in content in fibers of GhDFR1-silenced plants, but two new monomers, (-)-catachin and (-)-gallocatachin were present compared to the control plants infected with empty vector. The ectopic expression of GhDFR1 in an Arabidopsis TT3 mutant allowed for reconstruction of PAs biosynthesis pathway and led to accumulation of PAs in seed coat. Taken together, these data demonstrate that GhDFR1 contributes to the biosynthesis of anthocyanins and PAs in cotton.
USDA-ARS?s Scientific Manuscript database
Upland cotton germplasm USDA MD 16-1 (Reg. No. __ and PI ___ ), and USDA MD 16-2 (Reg. No. ___ and PI___) (Gossypium hirsutum L.), have enhanced yield and good fiber quality. These germplasm lines were developed by the USDA-ARS, Stoneville, MS and released in 2017. Two crosses, MD 25-51 X MD 10-9-1 ...
Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping
2013-01-01
Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.
Fang, Lei; Wang, Qiong; Hu, Yan; Jia, Yinhua; Chen, Jiedan; Liu, Bingliang; Zhang, Zhiyuan; Guan, Xueying; Chen, Shuqi; Zhou, Baoliang; Mei, Gaofu; Sun, Junling; Pan, Zhaoe; He, Shoupu; Xiao, Songhua; Shi, Weijun; Gong, Wenfang; Liu, Jianguang; Ma, Jun; Cai, Caiping; Zhu, Xiefei; Guo, Wangzhen; Du, Xiongming; Zhang, Tianzhen
2017-07-01
Upland cotton (Gossypium hirsutum) is the most important natural fiber crop in the world. The overall genetic diversity among cultivated species of cotton and the genetic changes that occurred during their improvement are poorly understood. Here we report a comprehensive genomic assessment of modern improved upland cotton based on the genome-wide resequencing of 318 landraces and modern improved cultivars or lines. We detected more associated loci for lint yield than for fiber quality, which suggests that lint yield has stronger selection signatures than other traits. We found that two ethylene-pathway-related genes were associated with increased lint yield in improved cultivars. We evaluated the population frequency of each elite allele in historically released cultivar groups and found that 54.8% of the elite genome-wide association study (GWAS) alleles detected were transferred from three founder landraces: Deltapine 15, Stoneville 2B and Uganda Mian. Our results provide a genomic basis for improving cotton cultivars and for further evolutionary analysis of polyploid crops.
Li, Ruijuan; Erpelding, John E
2016-10-01
The diploid cotton species Gossypium arboreum possesses many favorable agronomic traits such as drought tolerance and disease resistance, which can be utilized in the development of improved upland cotton cultivars. The USDA National Plant Germplasm System maintains more than 1600 G. arboreum accessions. Little information is available on the genetic diversity of the collection thereby limiting the utilization of this cotton species. The genetic diversity and population structure of the G. arboreum germplasm collection were assessed by genotyping-by-sequencing of 375 accessions. Using genome-wide single nucleotide polymorphism sequence data, two major clusters were inferred with 302 accessions in Cluster 1, 64 accessions in Cluster 2, and nine accessions unassigned due to their nearly equal membership to each cluster. These two clusters were further evaluated independently resulting in the identification of two sub-clusters for the 302 Cluster 1 accessions and three sub-clusters for the 64 Cluster 2 accessions. Low to moderate genetic diversity between clusters and sub-clusters were observed indicating a narrow genetic base. Cluster 2 accessions were more genetically diverse and the majority of the accessions in this cluster were landraces. In contrast, Cluster 1 is composed of varieties or breeding lines more recently added to the collection. The majority of the accessions had kinship values ranging from 0.6 to 0.8. Eight pairs of accessions were identified as potential redundancies due to their high kinship relatedness. The genetic diversity and genotype data from this study are essential to enhance germplasm utilization to identify genetically diverse accessions for the detection of quantitative trait loci associated with important traits that would benefit upland cotton improvement.
Effects of nematicides on cotton root mycobiota.
Baird, R E; Carling, D E; Watson, C E; Scruggs, M L; Hightower, P
2004-02-01
Baseline information on the diversity and population densities of fungi collected from soil debris and cotton (Gossypium hirsutum L.) roots was determined. Samples were collected from Tifton, GA, and Starkville, MS containing cotton field soil treated with the nematicides 1,3-dichloroproprene (fumigant) and aldicarb (granules). A total of 10,550 and 13,450 fungal isolates were collected from these two study sites, respectively. Of this total, 34 genera of plant pathogenic or saprophytic species were identified. Pathogenic root fungi included Fusarium spp. (40% of all isolations), Macrophomina, Pythium, Rhizoctonia, and Sclerotium. Fusarium and Rhizoctonia were the most common fungal species identified and included F. oxysporum, F. verticillioides and F. solani, the three Fusarium species pathogenic on cotton plants. Population densities of Fusarium were not significantly different among locations or tissue types sampled. Macrophomina was isolated at greater numbers near the end of the growing seasons. Anastomosis groups of R. solani isolated from roots and soil debris included AG-3, -4, -7, 2-2, and -13 and anastomosis groups of binucleate Rhizoctonia included CAG-2, -3, and -5. Occurrences and frequency of isolations among sampling dates were not consistent. Fluctuations in the frequency of isolation of Rhizoctonia did not correspond with changes in frequency of isolation of the biological control fungus, Trichoderma. When individual or pooled frequencies of the mycobiota were compared to nematicide treatments, no specific trends occurred between treatments, application methods or rates. Results from this study show that use of 1,3-D and aldicarb in cotton fields does not significantly impact plant pathogenic fungi or saprophytic fungal populations. Thus cotton producers need not adjust seedling disease control measures when these two nematicides are used.
Functional Genomic Analysis of Cotton Genes with Agrobacterium-Mediated Virus-Induced Gene Silencing
Gao, Xiquan; Shan, Libo
2015-01-01
Cotton (Gossypium spp.) is one of the most agronomically important crops worldwide for its unique textile fiber production and serving as food and feed stock. Molecular breeding and genetic engineering of useful genes into cotton have emerged as advanced approaches to improve cotton yield, fiber quality, and resistance to various stresses. However, the understanding of gene functions and regulations in cotton is largely hindered by the limited molecular and biochemical tools. Here, we describe the method of an Agrobacterium infiltration-based virus-induced gene silencing (VIGS) assay to transiently silence endogenous genes in cotton at 2-week-old seedling stage. The genes of interest could be readily silenced with a consistently high efficiency. To monitor gene silencing efficiency, we have cloned cotton GrCla1 from G. raimondii, a homolog gene of Arabidopsis Cloroplastos alterados 1 (AtCla1) involved in chloroplast development, and inserted into a tobacco rattle virus (TRV) binary vector pYL156. Silencing of GrCla1 results in albino phenotype on the newly emerging leaves, serving as a visual marker for silencing efficiency. To further explore the possibility of using VIGS assay to reveal the essential genes mediating disease resistance to Verticillium dahliae, a fungal pathogen causing severe Verticillium wilt in cotton, we developed a seedling infection assay to inoculate cotton seedlings when the genes of interest are silenced by VIGS. The method we describe here could be further explored for functional genomic analysis of cotton genes involved in development and various biotic and abiotic stresses. PMID:23386302
Gao, Xiquan; Shan, Libo
2013-01-01
Cotton (Gossypium spp.) is one of the most agronomically important crops worldwide for its unique textile fiber production and serving as food and feed stock. Molecular breeding and genetic engineering of useful genes into cotton have emerged as advanced approaches to improve cotton yield, fiber quality, and resistance to various stresses. However, the understanding of gene functions and regulations in cotton is largely hindered by the limited molecular and biochemical tools. Here, we describe the method of an Agrobacterium infiltration-based virus-induced gene silencing (VIGS) assay to transiently silence endogenous genes in cotton at 2-week-old seedling stage. The genes of interest could be readily silenced with a consistently high efficiency. To monitor gene silencing efficiency, we have cloned cotton GrCla1 from G. raimondii, a homolog gene of Arabidopsis Cloroplastos alterados 1 (AtCla1) involved in chloroplast development, and inserted into a tobacco rattle virus (TRV) binary vector pYL156. Silencing of GrCla1 results in albino phenotype on the newly emerging leaves, serving as a visual marker for silencing efficiency. To further explore the possibility of using VIGS assay to reveal the essential genes mediating disease resistance to Verticillium dahliae, a fungal pathogen causing severe Verticillium wilt in cotton, we developed a seedling infection assay to inoculate cotton seedlings when the genes of interest are silenced by VIGS. The method we describe here could be further explored for functional genomic analysis of cotton genes involved in development and various biotic and abiotic stresses.
Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen
2015-01-01
COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066
Santos, Karen B Dos; Meneguim, Ana M; Santos, Walter J Dos; Neves, Pedro M O J; Santos, Rachel B Dos
2010-01-01
The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud; leaf and boll; flower bud or boll; and leaf, flower bud and boll. The survival of S. cosmioides and S. eridania was greater than 80% and 70% for larvae fed on cotton plant parts offered separately or together, respectively. One larva of S. eridania damaged 1.7 flower buds, but did not damage bolls, while one larva of S. cosmioides damaged 5.2 flower buds and 3.0 cotton bolls. Spodoptera eridania and S. cosmioides can be considered species with potential to cause economic damage to cotton plants because they can occur throughout cotton developmental stages causing defoliation and losses of reproductive structures. Therefore, the results validate field observations that these two species of Spodoptera are potential pests for cotton.
Crop juxtaposition affects cotton fiber quality in Georgia farmscapes.
Toews, Michael D; Shurley, W Donald
2009-08-01
Phytophagous stink bugs (Hemiptera: Pentatomidae), including green stink bug [Acrosternum hilare (Say)], southern green stink bug [Nezara viridula (L.)], and brown stink bug [Euschistus servus (Say)], have become a serious production issue for southeastern U.S. cotton, Gossypium hirsutum L., growers. To investigate how different agronomic crops may affect stink bug damage and fiber quality in neighboring cotton fields, replicated 1.6-2.0-ha trials were planted with corn (Zea mays L.), peanut (Arachis hypogaea L.), and soybean [Glycine max (L.) Merr.] bordering a centrally located cotton plot (each of the four crops composed of approximately 0.4-0.5 ha per trial). Three trials were conducted in 2007 and three additional trials were conducted in 2008. Stink bug damage in the cotton plot was sampled weekly during weeks 3 through 6 of bloom at distances of 0.5, 5.3, 9.6, and 18.7 m from the adjacent crop. At the end of the year, representative lint samples at distances of 0.5, 9.6, 18.7, and 31.8 m from each adjacent crop were mechanically harvested, ginned, and classed. Results show that boll damage, seedcotton yield, gin turnout, fiber color, and lint value were negatively affected when the cotton was located adjacent to peanut and soybean. Regardless of the adjacent crop, there were no differences among yield and fiber quality parameters comparing seedcotton obtained 18.7 m from the plot edge and samples obtained from the middle of the cotton plot (approximately 31.8 m from an adjacent crop). These data suggest that integrated pest management programs for the stink bug complex in cotton may include farmscape level planning and targeted interventions as opposed to a crop specific management approach.
Genomics-enabled analysis of the emergent disease cotton bacterial blight
Phillips, Anne Z.; Burke, Jillian; Bunn, J. Imani; Allen, Tom W.; Wheeler, Terry
2017-01-01
Cotton bacterial blight (CBB), an important disease of (Gossypium hirsutum) in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm) strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars. PMID:28910288
Sun, Zhengwen; Wang, Xingfen; Liu, Zhengwen; Gu, Qishen; Zhang, Yan; Li, Zhikun; Ke, Huifeng; Yang, Jun; Wu, Jinhua; Wu, Liqiang; Zhang, Guiyin; Zhang, Caiying; Ma, Zhiying
2017-08-01
Genetic improvement of fibre quality is one of the main breeding goals for the upland cotton, Gossypium hirsutum, but there are difficulties with precise selection of traits. Therefore, it is important to improve the understanding of the genetic basis of phenotypic variation. In this study, we conducted phenotyping and genetic variation analyses of 719 diverse accessions of upland cotton based on multiple environment tests and a recently developed Cotton 63K Illumina Infinium SNP array and performed a genome-wide association study (GWAS) of fibre quality traits. A total of 10 511 polymorphic SNPs distributed in 26 chromosomes were screened across the cotton germplasms, and forty-six significant SNPs associated with five fibre quality traits were detected. These significant SNPs were scattered over 15 chromosomes and were involved in 612 unique candidate genes, many related to polysaccharide biosynthesis, signal transduction and protein translocation. Two major haplotypes for fibre length and strength were identified on chromosomes Dt11 and At07. Furthermore, by combining GWAS and transcriptome analysis, we identified 163 and 120 fibre developmental genes related to length and strength, respectively, of which a number of novel genes and 19 promising genes were screened. These results provide new insight into the genetic basis of fibre quality in G. hirsutum and provide candidate SNPs and genes to accelerate the improvement of upland cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
USDA-ARS?s Scientific Manuscript database
• Actin polymerizes to form the cytoskeleton and organize polar growth in all eukaryotic cells. Species with numerous actin genes are especially useful for the dissection of actin molecular function due to redundancy and neofunctionalization. Here, we investigated the role of a cotton (Gossypium hi...
Eisenring, Michael; Meissle, Michael; Hagenbucher, Steffen; Naranjo, Steven E; Wettstein, Felix; Romeis, Jörg
2017-01-01
In its defense against herbivores, cotton ( Gossypium sp.) relies in part on the production of a set of inducible, non-volatile terpenoids. Under uniform damage levels, in planta allocation of induced cotton terpenoids has been found to be highest in youngest leaves, supporting assumptions of the optimal defense theory (ODT) which predicts that plants allocate defense compounds to tissues depending on their value and the likelihood of herbivore attack. However, our knowledge is limited on how varying, and thus more realistic, damage levels might affect cotton defense organization. We hypothesized that the allocation of terpenoids and densities of terpenoid-storing glands in leaves aligns with assumptions of the ODT, even when plants are subjected to temporally, spatially and quantitatively varying caterpillar ( Heliothis virescens ) damage. As expected, cotton plants allocated most of their defenses to their youngest leaves regardless of damage location. However, defense induction in older leaves varied with damage location. For at least 14 days after damage treatments ended, plants reallocated defense resources from previously young leaves to newly developed leaves. Furthermore, we observed a positive hyperbolic relationship between leaf damage area and both terpenoid concentrations and gland densities, indicating that cotton plants can fine-tune defense allocation. Although it appears that factors like vascular constraints and chemical properties of individual defense compounds can affect defense levels, our results overall demonstrate that induced defense organization of cotton subjected to varying damage treatments is in alignment with key assumptions of the ODT.
Eisenring, Michael; Meissle, Michael; Hagenbucher, Steffen; Naranjo, Steven E.; Wettstein, Felix; Romeis, Jörg
2017-01-01
In its defense against herbivores, cotton (Gossypium sp.) relies in part on the production of a set of inducible, non-volatile terpenoids. Under uniform damage levels, in planta allocation of induced cotton terpenoids has been found to be highest in youngest leaves, supporting assumptions of the optimal defense theory (ODT) which predicts that plants allocate defense compounds to tissues depending on their value and the likelihood of herbivore attack. However, our knowledge is limited on how varying, and thus more realistic, damage levels might affect cotton defense organization. We hypothesized that the allocation of terpenoids and densities of terpenoid-storing glands in leaves aligns with assumptions of the ODT, even when plants are subjected to temporally, spatially and quantitatively varying caterpillar (Heliothis virescens) damage. As expected, cotton plants allocated most of their defenses to their youngest leaves regardless of damage location. However, defense induction in older leaves varied with damage location. For at least 14 days after damage treatments ended, plants reallocated defense resources from previously young leaves to newly developed leaves. Furthermore, we observed a positive hyperbolic relationship between leaf damage area and both terpenoid concentrations and gland densities, indicating that cotton plants can fine-tune defense allocation. Although it appears that factors like vascular constraints and chemical properties of individual defense compounds can affect defense levels, our results overall demonstrate that induced defense organization of cotton subjected to varying damage treatments is in alignment with key assumptions of the ODT. PMID:28270830
Wang, Xiyin; Guo, Hui; Wang, Jinpeng; Lei, Tianyu; Liu, Tao; Wang, Zhenyi; Li, Yuxian; Lee, Tae-Ho; Li, Jingping; Tang, Haibao; Jin, Dianchuan; Paterson, Andrew H
2016-02-01
The 'apparently' simple genomes of many angiosperms mask complex evolutionary histories. The reference genome sequence for cotton (Gossypium spp.) revealed a ploidy change of a complexity unprecedented to date, indeed that could not be distinguished as to its exact dosage. Herein, by developing several comparative, computational and statistical approaches, we revealed a 5× multiplication in the cotton lineage of an ancestral genome common to cotton and cacao, and proposed evolutionary models to show how such a decaploid ancestor formed. The c. 70% gene loss necessary to bring the ancestral decaploid to its current gene count appears to fit an approximate geometrical model; that is, although many genes may be lost by single-gene deletion events, some may be lost in groups of consecutive genes. Gene loss following cotton decaploidy has largely just reduced gene copy numbers of some homologous groups. We designed a novel approach to deconvolute layers of chromosome homology, providing definitive information on gene orthology and paralogy across broad evolutionary distances, both of fundamental value and serving as an important platform to support further studies in and beyond cotton and genomics communities. No claim to original US government works. New Phytologist © 2015 New Phytologist Trust.
Chawla, Suchi; Gor, Hetal N; Patel, Hemlatta K; Parmar, Kaushik D; Patel, Anil R; Shukla, Varsha; Ilyas, Mohammad; Parsai, Satish K; Somashekar; Meena, Roop Singh; Shah, Paresh G
2018-05-04
Cotton crop is highly susceptible to attack by sucking pests. Being an important oilseed and feed crop, it is essential to monitor the pesticides and ensure health protection at consumer level. Therefore, a method was validated to estimate fipronil and flonicamid in various cotton samples and risk assessment was performed. Contamination of oil in the extracts from the various oil seeds and cake samples is a major problem as this oil contaminates the column and interferes with the detection of pesticides. The present manuscript for the first time describes successful analysis of the pesticides from various cotton samples including cotton oil, seed, and cake. Quick, easy, cheap, effective, rugged, and safe (QuEChERS)-based methods were validated for estimation of fipronil and flonicamid in cotton samples and in soil by LC-MS/MS. Recoveries were within the acceptable range of 70-120% with relative standard deviation ≤ 20% and HorRat values < 0.3-1.3. R 2 was > 0.99. Matrix effects of 150 and 13.5% were observed for fipronil and flonicamid, respectively, in cotton leaves. Limits of quantitation (LOQs) were in the range of 0.0004 to 0.004 mg kg -1 for fipronil and flonicamid. Cotton samples collected from a field study at different locations were analyzed. Half-life ranged from 2.2 to 5.8 for fipronil and 4.6 to 7.0 days for flonicamid. A pre-harvest interval of 33 days is suggested. The risk assessment studies at maximum residue level values showed HQ < 1 at pre-harvest interval (PHI). The methods being short and easy can be extended to estimate more types of pesticides in different oilseeds. Following a PHI of 33 days, fipronil and flonicamid can be used on cotton at standard dose. As the levels of fipronil and flonicamid were below determination limit in all the soils, the environmental risk is negligible.
Balasubramanian, Vimal Kumar; Rai, Krishan Mohan; Thu, Sandi Win; Hii, Mei Mei; Mendu, Venugopal
2016-01-01
The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality. PMID:27679939
de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F
2016-01-01
Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.
de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.
2016-01-01
Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081
Chen, Zhifan; Zhao, Ye; Fan, Lidong; Xing, Liteng; Yang, Yujie
2015-12-01
Phytoremediation using economically valuable, large biomass, non-edible plants is a promising method for metal-contaminated soils. This study investigated cotton's tolerance for Cd and remediation potential through analyzing Cd bioaccumulation and localization in plant organs under different soil Cd levels. Results showed cotton presents good tolerance when soil Cd concentration ≤20.26 mg kg(-1). Cotton had good Cd accumulation ability under low soil Cd levels (<1.26 mg kg(-1)), with a TF value (the ratio of Cd concentration in stem to root) above 1. Energy dispersive X-ray microanalysis indicated cotton leaf transpiration played a key role in extracting soil Cd, while roots and stems were the main compartments of Cd storage. Cd complexation to other organic constituents in root and stem cell sap could be a primary detoxifying strategy. Therefore, cotton is a potential candidate for phytoremediation of Cd-contaminated soils.
Zhao, Jingqing; Li, Sha; Jiang, Tengfei; Liu, Zhi; Zhang, Wenwei; Jian, Guiliang; Qi, Fangjun
2012-01-01
Leaf senescence plays a vital role in nutrient recycling and overall capacity to assimilate carbon dioxide. Cotton premature leaf senescence, often accompanied with unexpected short-term low temperature, has been occurring with an increasing frequency in many cotton-growing areas and causes serious reduction in yield and quality of cotton. The key factors for causing and promoting cotton premature leaf senescence are still unclear. In this case, the relationship between the pre-chilling stress and Alternaria alternata infection for causing cotton leaf senescence was investigated under precisely controlled laboratory conditions with four to five leaves stage cotton plants. The results showed short-term chilling stress could cause a certain degree of physiological impairment to cotton leaves, which could be recovered to normal levels in 2–4 days when the chilling stresses were removed. When these chilling stress injured leaves were further inoculated with A. alternata, the pronounced appearance and development of leaf spot disease, and eventually the pronounced symptoms of leaf senescence, occurred on these cotton leaves. The onset of cotton leaf senescence at this condition was also reflected in various physiological indexes such as irreversible increase in malondialdehyde (MDA) content and electrolyte leakage, irreversible decrease in soluble protein content and chlorophyll content, and irreversible damage in leaves' photosynthesis ability. The presented results demonstrated that chilling stress acted as the key predisposing factor for causing A. alternata infection and leading to cotton leaf senescence. It could be expected that the understanding of the key factors causing and promoting cotton leaf senescence would be helpful for taking appropriate management steps to prevent cotton premature leaf senescence. PMID:22558354
Soil microbial biomass and root growth in Bt and non-Bt cotton
NASA Astrophysics Data System (ADS)
Tan, D. K. Y.; Broughton, K.; Knox, O. G.; Hulugalle, N. R.
2012-04-01
The introduction of transgenic Bacillus thuringiensis (Bt) cotton (Gossypium hirsutum L.) has had a substantial impact on pest management in the cotton industry. While there has been substantial research done on the impact of Bt on the above-ground parts of the cotton plant, less is known about the effect of Bt genes on below ground growth of cotton and soil microbial biomass. The aim of this research was to test the hypothesis that Bt [Sicot 80 BRF (Bollgard II Roundup Ready Flex®)] and non-Bt [Sicot 80 RRF (Roundup Ready Flex®)] transgenic cotton varieties differ in root growth and root turnover, carbon indices and microbial biomass. A field experiment was conducted in Narrabri, north-western NSW. The experimental layout was a randomised block design and used minirhizotron and core break and root washing methods to measure cotton root growth and turnover during the 2008/09 season. Root growth in the surface 0-0.1 m of the soil was measured using the core break and root washing methods, and that in the 0.1 to 1 m depth was measured with a minirhizotron and an I-CAP image capture system. These measurements were used to calculate root length per unit area, root carbon added to the soil through intra-seasonal root death, carbon in roots remaining at the end of the season and root carbon potentially added to the soil. Microbial biomass was also measured using the ninhydrin reactive N method. Root length densities and length per unit area of non-Bt cotton were greater than Bt cotton. There were no differences in root turnover between Bt and non-Bt cotton at 0-1 m soil depth, indicating that soil organic carbon stocks may not be affected by cotton variety. Cotton variety did not have an effect on soil microbial biomass. The results indicate that while there are differences in root morphology between Bt and non-Bt cotton, these do not change the carbon turnover dynamics in the soil.
Cell synchrony and chromosomal protocols for somatic cells of cotton gossypium hirsutum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van`t Hof, J.; Lamm, S.S.
1994-10-10
The intent of this pamphlet is to share information with others who are interested in useful protocols for cotton cytogenetics and cytology. The protocols described are a beginning effort and they are expected to be improved. All methods, results and data given pertain to cultivar MD 51ne. We are not satisfied with our results of in situ hybridization.
Han, Yingchun; Li, Yabing; Wang, Guoping; Feng, Lu; Yang, Beifang; Fan, Zhengyi; Lei, Yaping; Du, Wenli; Mao, Shuchun
2017-01-01
In this study, transplanting cotton seedlings grown in artificial substrate is considered due to recent increased interest in cotton planting labor saving approaches. The nursery methods used for growing cotton seedlings affect root growth. However, the underlying functional responses of root growth to variations in cotton seedling transplanting methods are poorly understood. We assessed the responses of cotton (Gossypium hirsutum L.) roots to different planting methods by conducting cotton field experiments in 2012 and 2013. A one-factor random block design was used with three replications and three different cotton planting patterns (substrate seedling transplanted cotton (SSTC), soil-cube seedling transplanted cotton (ScSTC) and directly sown cotton (DSC). The distributions and variances of the root area density (RAD) and root length density (RLD) at different cotton growing stages and several yield components were determined. Overall, the following results were observed: 1) The RAD and RLD were greatest near the plants (a horizontal distance of 0 cm) but were lower at W20 and W40 cm in the absence of film mulching than at E20 and E40 cm with film mulching. 2) The roots were confined to shallow depths (20–40 cm), and the root depths of SSTC and DSC were greater than the root depths of ScSTC. 3) Strong root growth was observed in the SSTC at the cotton flowering and boll setting stages. In addition, early onset root growth occurred in the ScSTC, and vigorous root growth occurred throughout all cotton growth stages in DSC. 4) The SSTC plants had more lateral roots with higher root biomass (RB) than the ScSTC, which resulted in higher cotton yields. However, the early onset root growth in the ScSTC resulted in greater pre-frost seed cotton (PFSC) yields. These results can be used to infer how cotton roots are distributed in soils and capture nutrients. PMID:29272298
Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.
Ke, Liping; Liu, RuiE; Chu, Bijue; Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang
2012-01-01
Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.
Liu, Xia; Zhao, Bo; Zheng, Hua-Jun; Hu, Yan; Lu, Gang; Yang, Chang-Qing; Chen, Jie-Dan; Chen, Jun-Jian; Chen, Dian-Yang; Zhang, Liang; Zhou, Yan; Wang, Ling-Jian; Guo, Wang-Zhen; Bai, Yu-Lin; Ruan, Ju-Xin; Shangguan, Xiao-Xia; Mao, Ying-Bo; Shan, Chun-Min; Jiang, Jian-Ping; Zhu, Yong-Qiang; Jin, Lei; Kang, Hui; Chen, Shu-Ting; He, Xu-Lin; Wang, Rui; Wang, Yue-Zhu; Chen, Jie; Wang, Li-Jun; Yu, Shu-Ting; Wang, Bi-Yun; Wei, Jia; Song, Si-Chao; Lu, Xin-Yan; Gao, Zheng-Chao; Gu, Wen-Yi; Deng, Xiao; Ma, Dan; Wang, Sen; Liang, Wen-Hua; Fang, Lei; Cai, Cai-Ping; Zhu, Xie-Fei; Zhou, Bao-Liang; Jeffrey Chen, Z; Xu, Shu-Hua; Zhang, Yu-Gao; Wang, Sheng-Yue; Zhang, Tian-Zhen; Zhao, Guo-Ping; Chen, Xiao-Ya
2015-09-30
Of the two cultivated species of allopolyploid cotton, Gossypium barbadense produces extra-long fibers for the production of superior textiles. We sequenced its genome (AD)2 and performed a comparative analysis. We identified three bursts of retrotransposons from 20 million years ago (Mya) and a genome-wide uneven pseudogenization peak at 11-20 Mya, which likely contributed to genomic divergences. Among the 2,483 genes preferentially expressed in fiber, a cell elongation regulator, PRE1, is strikingly At biased and fiber specific, echoing the A-genome origin of spinnable fiber. The expansion of the PRE members implies a genetic factor that underlies fiber elongation. Mature cotton fiber consists of nearly pure cellulose. G. barbadense and G. hirsutum contain 29 and 30 cellulose synthase (CesA) genes, respectively; whereas most of these genes (>25) are expressed in fiber, genes for secondary cell wall biosynthesis exhibited a delayed and higher degree of up-regulation in G. barbadense compared with G. hirsutum, conferring an extended elongation stage and highly active secondary wall deposition during extra-long fiber development. The rapid diversification of sesquiterpene synthase genes in the gossypol pathway exemplifies the chemical diversity of lineage-specific secondary metabolites. The G. barbadense genome advances our understanding of allopolyploidy, which will help improve cotton fiber quality.
Romero-Perdomo, Felipe; Abril, Jorge; Camelo, Mauricio; Moreno-Galván, Andrés; Pastrana, Iván; Rojas-Tapias, Daniel; Bonilla, Ruth
The aim of this research was to evaluate whether the application of two plant growth-promoting (rhizo)bacteria might reduce nitrogen fertilization doses in cotton. We used strains Azotobacter chroococcum AC1 and AC10 for their proven ability to promote seed germination and cotton growth. These microorganisms were characterized by their plant growth-promoting activities. Then, we conducted a glasshouse study to evaluate the plant growth promoting ability of these strains with reduced doses of urea fertilization in cotton. Results revealed that both strains are capable of fixing nitrogen, solubilizing phosphorus, synthesizing indole compounds and producing hydrolytic enzymes. After 12 weeks, the glasshouse experiment showed that cotton growth was positively influenced due to bacterial inoculation with respect to chemical fertilization. Notably, we observed that microbial inoculation further influenced plant biomass (p<0.05) than nitrogen content. Co-inoculation, interestingly, exhibited a greater beneficial effect on plant growth parameters compared to single inoculation. Moreover, similar results without significant statistical differences were observed among bacterial co-inoculation plus 50% urea and 100% fertilization. These findings suggest that co-inoculation of A. chroococcum strains allow to reduce nitrogen fertilization doses up to 50% on cotton growth. Our results showed that inoculation with AC1 and AC10 represents a viable alternative to improve cotton growth while decreasing the N fertilizer dose and allows to alleviate the environmental deterioration related to N pollution. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The plasma membrane intrinsic proteins (PIP) are one of the five aquaporin protein subfamilies. Aquaporin proteins are known to facilitate water transport through biological membranes. In order to identify NIP aquaporin gene candidates in cotton (Gossypium hirsutum L.), in silico and molecular clon...
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
Modeling cotton (Gossypium spp) leaves and canopy using computer aided geometric design (CAGD)
USDA-ARS?s Scientific Manuscript database
The goal of this research is to develop a geometrically accurate model of cotton crop canopies for exploring changes in canopy microenvironment and physiological function with leaf structure. We develop an accurate representation of the leaves, including changes in three-dimensional folding and orie...
Zhou, Zhaolu; Cao, Chong; Cao, Lidong; Zheng, Li; Xu, Jun; Li, Fengmin; Huang, Qiliang
2018-04-05
The evaporation kinetics of pesticide droplets deposited on a leaf surface can affect their application efficiency. Evaporation of droplets on the hydrophobic leaves has received considerable attention, but little is known about hydrophilic leaf surfaces. In this study, the effect of surfactant concentration on the evaporation of droplets deposited on cotton leaves was investigated. The evaporation time is roughly decreased for concentrations ranging from 0% to 0.01% and increased from 0.01% to 0.10%. Contrary to the widely held belief that pesticide retention on target crops can rapidly be formed only with surfactant concentrations exceeding the CMC (critical micelle concentration), this study demonstrates that, on hydrophilic cotton leaves, fast evaporation of the droplet at surfactant concentrations of 0.01% (CMC) can reduce the volume quickly, lower the loss point and enhance pesticide retention. In addition, the evolution of droplet volume, height and contact angle on the cotton leaf surface were measured to confirm this conclusion. The result presented herein can be used to guide the use of surfactants and pesticides in agriculture. Copyright © 2018 Elsevier B.V. All rights reserved.
Arick, Mark A; Conover, Justin L; Thrash, Adam; Sanders, William S; Hsu, Chuan-Yu; Naqvi, Rubab Zahra; Farooq, Muhammad; Li, Xiaochong; Gong, Lei; Mudge, Joann; Ramaraj, Thiruvarangan; Udall, Joshua A; Peterson, Daniel G
2017-01-01
Abstract Long-distance insular dispersal is associated with divergence and speciation because of founder effects and strong genetic drift. The cotton tribe (Gossypieae) has experienced multiple transoceanic dispersals, generating an aggregate geographic range that encompasses much of the tropics and subtropics worldwide. Two genera in the Gossypieae, Kokia and Gossypioides, exhibit a remarkable geographic disjunction, being restricted to the Hawaiian Islands and Madagascar/East Africa, respectively. We assembled and use de novo genome sequences to address questions regarding the divergence of these two genera from each other and from their sister-group, Gossypium. In addition, we explore processes underlying the genome downsizing that characterizes Kokia and Gossypioides relative to other genera in the tribe. Using 13,000 gene orthologs and synonymous substitution rates, we show that the two disjuncts last shared a common ancestor ∼5 Ma, or half as long ago as their divergence from Gossypium. We report relative stasis in the transposable element fraction. In comparison to Gossypium, there is loss of ∼30% of the gene content in the two disjunct genera and a history of genome-wide accumulation of deletions. In both genera, there is a genome-wide bias toward deletions over insertions, and the number of gene losses exceeds the number of gains by ∼2- to 4-fold. The genomic analyses presented here elucidate genomic consequences of the demographic and biogeographic history of these closest relatives of Gossypium, and enhance their value as phylogenetic outgroups. PMID:29194487
Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo
2013-01-01
We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G . incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G . raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377
Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo
2013-01-01
We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.
Molecular Mapping of Restriction-Site Associated DNA Markers In Allotetraploid Upland Cotton.
Wang, Yangkun; Ning, Zhiyuan; Hu, Yan; Chen, Jiedan; Zhao, Rui; Chen, Hong; Ai, Nijiang; Guo, Wangzhen; Zhang, Tianzhen
2015-01-01
Upland cotton (Gossypium hirsutum L., 2n = 52, AADD) is an allotetraploid, therefore the discovery of single nucleotide polymorphism (SNP) markers is difficult. The recent emergence of genome complexity reduction technologies based on the next-generation sequencing (NGS) platform has greatly expedited SNP discovery in crops with highly repetitive and complex genomes. Here we applied restriction-site associated DNA (RAD) sequencing technology for de novo SNP discovery in allotetraploid cotton. We identified 21,109 SNPs between the two parents and used these for genotyping of 161 recombinant inbred lines (RILs). Finally, a high dense linkage map comprising 4,153 loci over 3500-cM was developed based on the previous result. Using this map quantitative trait locus (QTLs) conferring fiber strength and Verticillium Wilt (VW) resistance were mapped to a more accurate region in comparison to the 1576-cM interval determined using the simple sequence repeat (SSR) genetic map. This suggests that the newly constructed map has more power and resolution than the previous SSR map. It will pave the way for the rapid identification of the marker-assisted selection in cotton breeding and cloning of QTL of interest traits.
Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.
The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species ( G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes ( FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes ( FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family
Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium
Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; ...
2014-11-18
The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species ( G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes ( FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes ( FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family
USDA-ARS?s Scientific Manuscript database
A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...
Liang, Chengzhen; Meng, Zhaohong; Meng, Zhigang; Malik, Waqas; Yan, Rong; Lwin, Khin Myat; Lin, Fazhuang; Wang, Yuan; Sun, Guoqing; Zhou, Tao; Zhu, Tao; Li, Jianying; Jin, Shuangxia; Guo, Sandui; Zhang, Rui
2016-10-07
The bZIP transcription factor (TF) act as an important regulator for the abscisic acid (ABA) mediated abiotic stresses signaling pathways in plants. Here, we reported the cloning and characterization of GhABF2, encoding for typical cotton bZIP TF. Overexpression of GhABF2 significantly improved drought and salt stress tolerance both in Arabidopsis and cotton. However, silencing of GhABF2 made transgenic cotton sensitive to PEG osmotic and salt stress. Expression of GhABF2 was induced by drought and ABA treatments but repressed by high salinity. Transcriptome analysis indicated that GhABF2 increases drought and salt tolerance by regulating genes related to ABA, drought and salt response. The proline contents, activity of superoxide dismutase (SOD) and catalase (CAT) were also significantly increased in GhABF2-overexpression cottons in comparison to wild type after drought and salt treatment. Further, an increase in fiber yield under drought and saline-alkali wetland exhibited the important role of GhABF2 in enhancing the drought and salt tolerance in transgenic lines. In conclusion, manipulation of GhABF2 by biotechnological tools could be a sustainable strategy to deploy drought and salt tolerance in cotton.
Fan, Xinqi; Guo, Qi; Xu, Peng; Gong, YuanYong; Shu, Hongmei; Yang, Yang; Ni, Wanchao; Zhang, Xianggui; Shen, Xinlian
2015-01-01
WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs) in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III), as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.
Irizarry, I; White, J F
2017-04-01
Cotton seeds are frequently treated with acid to remove fibres and reduce seed-transmitted diseases. This process also eliminates beneficial bacteria on the seed surface. The goal of this research was to seek and apply beneficial bacteria to acid delinted cotton seeds to evaluate their growth-promoting and salt stress alleviating effects in seedlings. Bacteria were isolated from non-cultivated plants in the Malvaceae. Seeds were collected from Portia tree (Thespesia populnea) and wild cotton (Gossypium hirsutum) from coastal and arid areas of Puerto Rico. Bacillus amyloliquefaciens, Curtobacterium oceanosedimentum and Pseudomonas oryzihabitans were inoculated onto acid delinted cotton seeds. Bacteria increased cotton seed germination and length of emerging seedling radicles. Cotton seeds were inoculated with B. amyloliquefaciens to evaluate growth and root architecture of non-stressed and salt stressed seedlings. Inoculating cotton seeds with B. amyloliquefaciens led to a greater percentage of seedlings with expanded cotyledons after 8 days, enhanced primary and lateral root growth, and altered root architecture. Similar results were obtained when okra seeds were inoculated with B. amyloliquefaciens. The data supported the hypothesis that non-cultivated plants in the Malvaceae growing in stressful environments possess bacteria that promote growth, alter root architecture and alleviate salt stress of cotton and okra seedlings. This study demonstrated the effects of applying beneficial bacteria on acid delinted cotton seeds. Inoculating seeds with salt stress alleviating bacteria could improve the growth of crop seedlings that are vulnerable to soil salinization. © 2017 The Society for Applied Microbiology.
Cell Suspension Culture-Mediated Incorporation of the Rice Bel Gene into Transgenic Cotton
Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang
2012-01-01
Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops. PMID:22768325
2013-01-01
Background Cotton (Gossypium spp.) is widely cultivated due to the important economic value of its fiber. However, extreme environmental degradation impedes cotton growth and production. Receptor-like kinase (RLK) proteins play important roles in signal transduction and participate in a diverse range of processes in response to plant hormones and environmental cues. Here, we introduced an RLK gene (GbRLK) from cotton into Arabidopsis and investigated its role in imparting abiotic stress tolerance. Results GbRLK transcription was induced by exogenously supplied abscisic acid (ABA), salicylic acid, methyl jasmonate, mock drought conditions and high salinity. We cloned the promoter sequence of this gene via self-formed adaptor PCR. Sequence analysis revealed that the promoter region contains many cis-acting stress-responsive elements such as ABRE, W-Box, MYB-core, W-Box core, TCA-element and others. We constructed a vector containing a 1,890-bp sequence in the 5′ region upstream of the initiation codon of this promoter and transformed it into Arabidopsis thaliana. GUS histochemical staining analysis showed that GbRLK was expressed mainly in leaf veins, petioles and roots of transgenic Arabidopsis, but not in the cotyledons or root hairs. GbRLK promoter activity was induced by ABA, PEG, NaCl and Verticillium dahliae. Transgenic Arabidopsis with constitutive overexpression of GbRLK exhibited a reduced rate of water loss in leaves in vitro, along with improved salinity and drought tolerance and increased sensitivity to ABA compared with non-transgenic Col-0 Arabidopsis. Expression analysis of stress-responsive genes in GbRLK Arabidopsis revealed that there was increased expression of genes involved in the ABA-dependent signaling pathway (AtRD20, AtRD22 and AtRD26) and antioxidant genes (AtCAT1, AtCCS, AtCSD2 and AtCSD1) but not ion transporter genes (AtNHX1, AtSOS1). Conclusions GbRLK is involved in the drought and high salinity stresses pathway by activating or
USDA-ARS?s Scientific Manuscript database
A bacterial artificial chromosome (BAC) library and BAC-end sequences for Gossypium hirsutum L. have recently been developed. Here we report on genomic-based genome-wide SNP mining utilizing re-sequencing data with a BAC-end sequence reference for twelve G. hirsutum L. lines, one G. barbadense L. li...
Yang, Yuwen; Chen, Tianzi; Ling, Xitie; Ma, Zhengqiang
2018-01-01
Verticillium wilt is a soil-borne disease that can cause devastating losses in cotton production. Because there is no effective chemical means to combat the disease, the only effective way to control Verticillium wilt is through genetic improvement. Therefore, the identification of additional disease-resistance genes will benefit efforts toward the genetic improvement of cotton resistance to Verticillium wilt. Based on screening of a BAC library with a partial Ve homologous fragment and expression analysis, a V. dahliae-induced gene, Gbvdr6, was isolated and cloned from the Verticillium wilt-resistant cotton G. barbadense cultivar Hai7124. The gene was located in the gene cluster containing Gbve1 and Gbvdr5 and adjacent to the Verticillium wilt-resistance QTL hotspot. Gbvdr6 was induced by Verticillium dahliae Kleb and by the plant hormones salicylic acid (SA), methyl jasmonate (MeJA) and ethephon (ETH) but not by abscisic acid (ABA). Gbvdr6 was localized to the plasma membrane. Overexpression of Gbvdr6 in Arabidopsis and cotton enhanced resistance to V. dahliae. Moreover, the JA/ET signaling pathway-related genes PR3, PDF 1.2, ERF1 and the SA-related genes PR1 and PR2 were constitutively expressed in transgenic plants. Gbvdr6-overexpressing Arabidopsis was less sensitive than the wild-type plant to MeJA. Furthermore, the accumulation of reactive oxygen species and callose was triggered at early time points after V. dahliae infection. These results suggest that Gbvdr6 confers resistance to V. dahliae through regulation of the JA/ET and SA signaling pathways. PMID:29387078
Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming
2013-10-01
Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.
Spatial Mapping of Lipids at Cellular Resolution in Embryos of Cotton[W][OA
Horn, Patrick J.; Korte, Andrew R.; Neogi, Purnima B.; Love, Ebony; Fuchs, Johannes; Strupat, Kerstin; Borisjuk, Ljudmilla; Shulaev, Vladimir; Lee, Young-Jin; Chapman, Kent D.
2012-01-01
Advances in mass spectrometry (MS) have made comprehensive lipidomics analysis of complex tissues relatively commonplace. These compositional analyses, although able to resolve hundreds of molecular species of lipids in single extracts, lose the original cellular context from which these lipids are derived. Recently, high-resolution MS of individual lipid droplets from seed tissues indicated organelle-to-organelle variation in lipid composition, suggesting that heterogeneity of lipid distributions at the cellular level may be prevalent. Here, we employed matrix-assisted laser desorption/ionization–MS imaging (MALDI-MSI) approaches to visualize lipid species directly in seed tissues of upland cotton (Gossypium hirsutum). MS imaging of cryosections of mature cotton embryos revealed a distinct, heterogeneous distribution of molecular species of triacylglycerols and phosphatidylcholines, the major storage and membrane lipid classes in cotton embryos. Other lipids were imaged, including phosphatidylethanolamines, phosphatidic acids, sterols, and gossypol, indicating the broad range of metabolites and applications for this chemical visualization approach. We conclude that comprehensive lipidomics images generated by MALDI-MSI report accurate, relative amounts of lipid species in plant tissues and reveal previously unseen differences in spatial distributions providing for a new level of understanding in cellular biochemistry. PMID:22337917
Huang, Cong; Nie, Xinhui; Shen, Chao; You, Chunyuan; Li, Wu; Zhao, Wenxia; Zhang, Xianlong; Lin, Zhongxu
2017-11-01
Gossypium hirsutum L. represents the largest source of textile fibre, and China is one of the largest cotton-producing and cotton-consuming countries in the world. To investigate the genetic architecture of the agronomic traits of upland cotton in China, a diverse and nationwide population containing 503 G. hirsutum accessions was collected for a genome-wide association study (GWAS) on 16 agronomic traits. The accessions were planted in four places from 2012 to 2013 for phenotyping. The CottonSNP63K array and a published high-density map based on this array were used for genotyping. The 503 G. hirsutum accessions were divided into three subpopulations based on 11 975 quantified polymorphic single-nucleotide polymorphisms (SNPs). By comparing the genetic structure and phenotypic variation among three genetic subpopulations, seven geographic distributions and four breeding periods, we found that geographic distribution and breeding period were not the determinants of genetic structure. In addition, no obvious phenotypic differentiations were found among the three subpopulations, even though they had different genetic backgrounds. A total of 324 SNPs and 160 candidate quantitative trait loci (QTL) regions were identified as significantly associated with the 16 agronomic traits. A network was established for multieffects in QTLs and interassociations among traits. Thirty-eight associated regions had pleiotropic effects controlling more than one trait. One candidate gene, Gh_D08G2376, was speculated to control the lint percentage (LP). This GWAS is the first report using high-resolution SNPs in upland cotton in China to comprehensively investigate agronomic traits, and it provides a fundamental resource for cotton genetic research and breeding. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
A new fuzzless seed locus in an upland cotton (Gossypium hirsutum L.) mutant
USDA-ARS?s Scientific Manuscript database
Various fiber mutants of cotton have been reported since 1920. Two of the best characterized mutants are the naked seed loci, N1N1 and n2n2. Recently, a naked-tufted mutant called 9023n4t was developed from the cultivar SC 9023 through chemical mutagenesis. The objective of this research was to dete...
Liu, Qinxiang; Talbot, Mark; Llewellyn, Danny J.
2013-01-01
Pectin, a major component of the primary cell walls of dicot plants, is synthesized in Golgi, secreted into the wall as methylesters and subsequently de-esterified by pectin methylesterase (PME). Pectin remodelling by PMEs is known to be important in regulating cell expansion in plants, but has been poorly studied in cotton. In this study, genome-wide analysis showed that PMEs are a large multi-gene family (81 genes) in diploid cotton (Gossypium raimondii), an expansion over the 66 in Arabidopsis and suggests the evolution of new functions in cotton. Relatively few PME genes are expressed highly in fibres based on EST abundance and the five most abundant in fibres were cloned and sequenced from two cotton species. Their significant sequence differences and their stage-specific expression in fibres within a species suggest sub-specialisation during fibre development. We determined the transcript abundance of the five fibre PMEs, total PME enzyme activity, pectin content and extent of de-methylesterification of the pectin in fibre walls of the two cotton species over the first 25–30 days of fibre growth. There was a higher transcript abundance of fibre-PMEs and a higher total PME enzyme activity in G. barbadense (Gb) than in G. hirsutum (Gh) fibres, particularly during late fibre elongation. Total pectin was high, but de-esterified pectin was low during fibre elongation (5–12 dpa) in both Gh and Gb. De-esterified pectin levels rose thereafter when total PME activity increased and this occurred earlier in Gb fibres resulting in a lower degree of esterification in Gb fibres between 17 and 22 dpa. Gb fibres are finer and longer than those of Gh, so differences in pectin remodelling during the transition to wall thickening may be an important factor in influencing final fibre diameter and length, two key quality attributes of cotton fibres. PMID:23755181
Bao, Wei-Fang; Yang, Fan; Xu, Bin; Yang, Yi-Zhong
2017-01-01
The polyphagous mirid bug Apolygus lucorum (Heteroptera: Miridae) has more than 200 species of host plants and is an insect pest of important agricultural crops, including cotton (Gossypium hirsutum) and mungbean (Vigna radiata). Previous field trials have shown that A. lucorum adults prefer mungbean to cotton plants, indicating the considerable potential of mungbean as a trap crop in cotton fields. However, direct evidence supporting the migration of A. lucorum adults from cotton to mungbean is lacking. We developed a DNA-based polymerase chain reaction (PCR) approach to reveal the movement of A. lucorum between neighboring mungbean and cotton fields. Two pairs of PCR primers specific to cotton or mungbean were designed to target the trnL-trnF region of chloroplast DNA. Significant differences in the detectability half-life (DS50) were observed between these two host plants, and the mean for cotton (8.26 h) was approximately two times longer than that of mungbean (4.38 h), requiring weighted mean calculations to compare the detectability of plant DNA in the guts of field-collected bugs. In field trials, cotton DNA was detected in the guts of the adult A. lucorum individuals collected in mungbean plots, and the cotton DNA detection rate decreased successively from 5 to 15 m away from the mungbean-cotton midline. In addition to the specific detection of cotton- and mungbean-fed bugs, both cotton and mungbean DNA were simultaneously detected within the guts of single individuals caught from mungbean fields. This study successfully established a tool for molecular gut-content analyses and clearly demonstrated the movement of A. lucorum adults from cotton to neighboring mungbean fields, providing new insights into understanding the feeding characteristics and landscape-level ecology of A. lucorum under natural conditions. PMID:28586352
Li, Yan-Jun; Zhu, Shou-Hong; Zhang, Xin-Yu; Liu, Yong-Chang; Xue, Fei; Zhao, Lan-Jie; Sun, Jie
2017-06-12
Cotton fiber, a natural fiber widely used in the textile industry, is differentiated from single cell of ovule epidermis. A large number of genes are believed to be involved in fiber formation, but so far only a few fiber genes have been isolated and functionally characterized in this developmental process. The Kinesin13 subfamily was found to play key roles during cell division and cell elongation, and was considered to be involved in the regulation of cotton fiber development. The full length of coding sequence of GhKIS13A1 was cloned using cDNA from cotton fiber for functional characterization. Expression pattern analysis showed that GhKIS13A1 maintained a lower expression level during cotton fiber development. Biochemical assay showed that GhKIS13A1 has microtubule binding activity and basal ATPase activity that can be activated significantly by the presence of microtubules. Overexpression of GhKIS13A1 in Arabidopsis reduced leaf trichomes and the percentage of three-branch trichomes, and increased two-branch and shriveled trichomes compared to wild-type. Additionally, the expression of GhKIS13A1 in the Arabidopsis Kinesin-13a-1 mutant rescued the defective trichome branching pattern of the mutant, making its overall trichome branching pattern back to normal. Our results suggested that GhKIS13A1 is functionally compatible with AtKinesin-13A regarding their role in regulating the number and branching pattern of leaf trichomes. Given the developmental similarities between cotton fibers and Arabidopsis trichomes, it is speculated that GhKIS13A1 may also be involved in the regulation of cotton fiber development.
Hu, Hongtao; Rashotte, Aaron M; Singh, Narendra K; Weaver, David B; Goertzen, Leslie R; Singh, Shree R; Locy, Robert D
2015-01-01
MicroRNAs (miRNAs) and secondary small interfering RNAs (principally phased siRNAs or trans-acting siRNAs) are two distinct subfamilies of small RNAs (sRNAs) that are emerging as key regulators of posttranscriptional gene expression in plants. Both miRNAs and secondary-siRNAs (sec-siRNAs) are processed from longer RNA precursors by DICER-LIKE proteins (DCLs). Gossypium arboreum L., also known as tree cotton or Asian cotton, is a diploid, possibly ancestral relative of tetraploid Gossypium hirsutum L., the predominant type of commercially grown cotton worldwide known as upland cotton. To understand the biological significance of these gene regulators in G. arboreum, a bioinformatics analysis was performed on G. arboreum small RNAs produced from G. arboreum leaf, flower, and boll tissues. Consequently, 263 miRNAs derived from 353 precursors, including 155 conserved miRNAs (cs-miRNAs) and 108 novel lineage-specific miRNAs (ls-miRNAs). Along with miRNAs, 2,033 miRNA variants (isomiRNAs) were identified as well. Those isomiRNAs with variation at the 3'-miRNA end were expressed at the highest levels, compared to other types of variants. In addition, 755 pha-siRNAs derived 319 pha-siRNA gene transcripts (PGTs) were identified, and the potential pha-siRNA initiators were predicted. Also, 2,251 non-phased siRNAs were found as well, of which 1,088 appeared to be produced by so-called cis- or trans-cleavage of the PGTs observed at positions differing from pha-siRNAs. Of those sRNAs, 148 miRNAs/isomiRNAs and 274 phased/non-phased siRNAs were differentially expressed in one or more pairs of tissues examined. Target analysis revealed that target genes for both miRNAs and pha-siRNAs are involved a broad range of metabolic and enzymatic activities. We demonstrate that secondary siRNA production could result from initial cleavage of precursors by both miRNAs or isomiRNAs, and that subsequently produced phased and unphased siRNAs could result that also serve as triggers of a second
USDA-ARS?s Scientific Manuscript database
The merit of interspecific germplasm introgression has been well appreciated in many crop species, but it has not been exploited well in Upland cotton improvement. Wide-cross introgression typically requires considerable time and effort to circumvent and overcome biological, genetic, and cytogenetic...
Wang, Li Ke; Niu, Xiao Wei; Lv, Yan Hui; Zhang, Tian Zhen; Guo, Wang Zhen
2010-10-01
Annexins constitute a family of multifunction and structurally related proteins. These proteins are ubiquitous in the plant kingdom, and are important calcium-dependent membrane-binding proteins that participate in the polar development of different plant regions such as rhizoids, root caps, and pollen tube tips. In this study, a novel cotton annexin gene (designated as GhFAnnx) was isolated from a fiber cDNA library of cotton (Gossypium hirsutum). The full-length cDNA of GhFAnnx comprises an open reading frame of 945 bp that encodes a 314-amino acid protein with a calculated molecular mass of 35.7 kDa and an isoelectric point of 6.49. Genomic GhFAnnx sequences from different cotton species, TM-1, Hai7124 and two diploid progenitor cottons, G. herbaceum (A-genome) and G. raimondii (D-genome) showed that at least two copies of the GhFAnnx gene, each with six exons and five introns in the coding region, were identified in the allotetraploid cotton genome. The GhFAnnx gene cloned from the cDNA library in this study was mapped to the chromosome 10 of the A-subgenome of the tetraploid cotton. Sequence alignment revealed that GhFAnnx contained four repeats of 70 amino acids. Semi-quantitative reverse transcriptase-polymerase chain reaction revealed that GhFAnnx is preferentially expressed in different developmental fibers but its expression is low in roots, stems, and leaves. Subcellular localization of GhFAnnx in onion epidermal cells and cotton fibers suggests that this protein is ubiquitous in the epidermal cells of onion, but assembles at the edge and the inner side of the apex of the cotton fiber tips with brilliant spots. In summary, GhFAnnx influences fiber development and is associated with the polar expansion of the cotton fiber during elongation stages.
Genetic gains from selection for fiber traits in Gossypium hirsutum L.
de Faria, G M P; Sanchez, C F B; de Carvalho, L P; da Silva Oliveira, M; Cruz, C D
2016-11-21
Brazil is among the five largest producers of cotton in the world, cultivating the species Gossypium hirsutum L. r. latifolium Hutch. The cultivars should have good fiber quality as well as yield. Genetic improvement of fiber traits requires the study of the genetic structure of the populations under improvement, leading to the identification of promising parent plants. To this end, it is important to acquire some information, such as estimates of genetic variance components and heritability coefficients, which will support the appropriate choice of the breeding strategy to be employed as well as enable the estimation of gains from selection. This study aimed to evaluate some agronomic characteristics, such as fiber quality and yield, estimating genetic parameters for the purpose of predicting earnings. Twelve cultivars of cotton, including four male progenitors (CNPA 01-42, BRS Verde, Glandless, and Okra leaf) and eight female progenitors (Delta opal, CNPA 7H, Aroeira, Antares, Sucupira, Facual, Precoce 3, and CNPA 8H), were used in performing crosses according to design I, proposed by Comstock and Robinson (1948). The experimental design was a randomized block with four replications. We observed genetic variability among all traits as well as higher efficiency of selection for the gains related to traits. Our results showed that the combined selection presented the highest genetic gains for all traits. For fiber length, the female/male selection and the combined selection resulted in the highest genetic gain.
Toxicity to cotton boll weevil Anthonomus grandis of a trypsin inhibitor from chickpea seeds.
de P G Gomes, Angélica; Dias, Simoni C; Bloch, Carlos; Melo, Francislete R; Furtado, José R; Monnerat, Rose G; Grossi-de-Sá, Maria F; Franco, Octávio L
2005-02-01
Cotton (Gossypium hirsutum L.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil Anthonomus grandis. Adult A. grandis feed on fruits and leaf petioles, reducing drastically the crop production. The predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. The present study describes a novel proteinase inhibitor from chickpea seeds (Cicer arietinum L.) and its effects against A. grandis. This inhibitor, named CaTI, was purified by using affinity Red-Sepharose Cl-6B chromatography, followed by reversed-phase HPLC (Vydac C18-TP). SDS-PAGE and MALDI-TOF analyses, showed a unique monomeric protein with a mass of 12,877 Da. Purified CaTI showed significant inhibitory activity against larval cotton boll weevil serine proteinases (78%) and against bovine pancreatic trypsin (73%), when analyzed by fluorimetric assays. Although the molecular mass of CaTI corresponded to alpha-amylase/trypsin bifunctional inhibitors masses, no inhibitory activity against insect and mammalian alpha-amylases was observed. In order to observe CaTI in vivo effects, an inhibitor rich fraction was added to an artificial diet at different concentrations. At 1.5% (w/w), CaTI caused severe development delay, several deformities and a mortality rate of approximately 45%. These results suggested that CaTI could be useful in the production of transgenic cotton plants with enhanced resistance toward cotton boll weevil.
Growing Season Carbon Dioxide Exchange in Flooded Non-Mulching and Non-Flooded Mulching Cotton
Li, Zhi-guo; Zhang, Run-hua; Wang, Xiu-jun; Chen, Fang; Tian, Chang-yan
2012-01-01
There is much interest in the role that agricultural practices might play in sequestering carbon to help offset rising atmospheric CO2 concentrations. However, limited information exists regarding the potential for increased carbon sequestration of different management strategies. The objective of this study was to quantify and contrast carbon dioxide exchange in traditional non-mulching with flooding irrigation (TF) and plastic film mulching with drip irrigation (PM) cotton (Gossypium hirsutum L.) fields in northwest China. Net primary productivity (NPP), soil heterotrophic respiration (R h) and net ecosystem productivity (NEP) were measured during the growing seasons in 2009 and 2010. As compared with TF, PM significantly increased the aboveground and belowground biomass and the NPP (340 g C m−2 season−1) of cotton, and decreased the R h (89 g C m−2 season−1) (p<0.05). In a growing season, PM had a higher carbon sequestration in terms of NEP of ∼ 429 g C m−2 season−1 than the TF. These results demonstrate that conversion of this type of land use to mulching practices is an effective way to increase carbon sequestration in the short term in cotton systems of arid areas. PMID:23226376
Ding, Yuanhao; Ma, Yizan; Liu, Nian; Xu, Jiao; Hu, Qin; Li, Yaoyao; Wu, Yuanlong; Xie, Sai; Zhu, Longfu; Min, Ling; Zhang, Xianlong
2017-09-01
Male sterility caused by long-term high-temperature (HT) stress occurs widely in crops. MicroRNAs (miRNAs), a class of endogenous non-coding small RNAs, play an important role in the plant response to various abiotic stresses. To dissect the working principle of miRNAs in male sterility under HT stress in cotton, a total of 112 known miRNAs, 270 novel miRNAs and 347 target genes were identified from anthers of HT-insensitive (84021) and HT-sensitive (H05) cotton cultivars under normal-temperature and HT conditions through small RNA and degradome sequencing. Quantitative reverse transcriptase-polymerase chain reaction and 5'-RNA ligase-mediated rapid amplification of cDNA ends experiments were used to validate the sequencing data. The results show that miR156 was suppressed by HT stress in both 84021 and H05; miR160 was suppressed in 84021 but induced in H05. Correspondingly, SPLs (target genes of miR156) were induced both in 84021 and H05; ARF10 and ARF17 (target genes of miR160) were induced in 84021 but suppressed in H05. Overexpressing miR160 increased cotton sensitivity to HT stress seen as anther indehiscence, associated with the suppression of ARF10 and ARF17 expression, thereby activating the auxin response that leads to anther indehiscence. Supporting this role for auxin, exogenous Indole-3-acetic acid (IAA) leads to a stronger male sterility phenotype both in 84021 and H05 under HT stress. Cotton plants overexpressing miR157 suppressed the auxin signal, and also showed enhanced sensitivity to HT stress, with microspore abortion and anther indehiscence. Thus, we propose that the auxin signal, mediated by miRNAs, is essential for cotton anther fertility under HT stress. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Guo, Kai; Du, Xueqiong; Tu, Lili; Tang, Wenxin; Wang, Pengcheng; Wang, Maojun; Liu, Zhen; Zhang, Xianlong
2016-05-01
High-quality cotton fibre equates to a more comfortable textile. Fibre length is an important index of fibre quality. Hydrogen peroxide (H2O2) acts as a signalling molecule in the regulation of fibre elongation. Results from in vitro ovule culture suggest that the alteration of fibre cell H2O2 levels affects fibre development. Ascorbate peroxidase (APX) is an important reactive oxygen species (ROS) scavenging enzyme, and we found that GhAPX1AT/DT encoded one member of the previously unrealized group of cytosolic APXs (cAPXs) that were preferentially expressed during the fibre elongation stage. Transgenic cottons with up- and down-regulation of GhAPX1AT/DT were generated to control fibre endogenous levels of H2O2 Suppression of all cAPX (IAO) resulted in a 3.5-fold increase in H2O2 level in fibres and oxidative stress, which significantly suppressed fibre elongation. The fibre length of transgenic lines with over-expression or specific down-regulation of GhAPX1AT/DT did not show any obvious change. However, the fibres in the over-expression lines exhibited higher tolerance to oxidative stress. Differentially expressed genes (DEGs) in fibres at 10 days post-anthesis (DPA) of IAO lines identified by RNA-seq were related to redox homeostasis, signalling pathways, stress responses and cell wall synthesis, and the DEGs that were up-regulated in IAO lines were also up-regulated in the 10 DPA and 20 DPA fibres of wild cotton compared with domesticated cotton. These results suggest that optimal H2O2 levels and redox state regulated by cytosolic APX are key mechanisms regulating fibre elongation, and dysregulation of the increase in H2O2 induces oxidative stress and results in shorter fibres by initiating secondary cell wall-related gene expression. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Analysis of flavonoids and the flavonoid structural genes in brown fiber of upland cotton.
Feng, Hongjie; Tian, Xinhui; Liu, Yongchang; Li, Yanjun; Zhang, Xinyu; Jones, Brian Joseph; Sun, Yuqiang; Sun, Jie
2013-01-01
As a result of changing consumer preferences, cotton (Gossypium Hirsutum L.) from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3'H, and GhF3'5'H) were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL). The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin) were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers.
Analysis of Flavonoids and the Flavonoid Structural Genes in Brown Fiber of Upland Cotton
Liu, Yongchang; Li, Yanjun; Zhang, Xinyu; Jones, Brian Joseph; Sun, Yuqiang; Sun, Jie
2013-01-01
Backgroud As a result of changing consumer preferences, cotton (Gossypium Hirsutum L.) from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. Experimental Design Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3′H, and GhF3′5′H) were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. Result The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL). The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin) were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. Conclusions Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers. PMID:23527031
Tian, Xiaoli; Duan, Liusheng; Zhang, Mingcai; Tan, Weiming; Xu, Dongyong; Li, Zhaohu
2014-01-01
Defoliants can increase machine harvest efficiency of cotton (Gossypium hirusutum L.), prevent lodging and reduce the time from defoliation to harvest. Coronatine (COR) is a chlorosis-inducing non-host-specific phytotoxin that induces leaf and/or fruit abscission in some crops. The present study investigates how COR might induce cotton leaf abscission by modulating genes involved in cell wall hydrolases and ACC (ethylene precursor) in various cotton tissues. The effects of COR on cotton boll ripening, seedcotton yield, and seed development were also studied. After 14 d of treatment with COR, cells within the leaf abscission zone (AZ) showed marked differentiation. Elevated transcripts of GhCEL1, GhPG and GhACS were observed in the AZs treated with COR and Thidiazuron (TDZ). The relative expression of GhCEL1 and GhACS in TDZ treated plants was approximately twice that in plants treated with COR for 12 h. However, only GhACS expression increased in leaf blade and petiole. There was a continuous increase in the activity of hydrolytic enzymes such as cellulase (CEL) and polygalacturonase (PG), and ACC accumulation in AZs following COR and TDZ treatments, but there was greater increase in ACC activity of COR treated boll crust, indicating that COR had greater ripening effect than TDZ. Coronatine significantly enhanced boll opening without affecting boll weight, lint percentage and seed quality. Therefore, COR can be a potential cotton defoliant with different physiological mechanism of action from the currently used TDZ. PMID:24845465
Spurgeon, Dale W
2016-12-01
The boll weevil (Anthonomus grandis grandis Boheman) has been eradicated from much of the United States, but remains an important pest of cotton (Gossypium spp.) in other parts of the Americas. Where the weevil occurs, the pheromone trap is a key tool for population monitoring or detection. Traditional monitoring programs have placed traps in or near the outermost cotton rows where damage by farm equipment can cause loss of trapping data. Recently, some programs have adopted a trap placement adjacent to but outside monitored fields. The effects of these changes have not been previously reported. Captures of early-season boll weevils by traps near (≤1 m) or far (7-10 m) from the outermost cotton row were evaluated. In 2005, during renewed efforts to eradicate the boll weevil from the Lower Rio Grande Valley of Texas, far traps consistently captured more weevils than traps near cotton. Traps at both placements indicated similar patterns of early-season weevil captures, which were consistent with those previously reported. In 2006, no distinction between trap placements was detected. Early-season patterns of captures in 2006 were again similar for both trap placements, but captures were much lower and less regular compared with those observed in 2005. These results suggest magnitude and likelihood of weevil capture in traps placed away from cotton are at least as high as for traps adjacent to cotton. Therefore, relocation of traps away from the outer rows of cotton should not negatively impact ability to monitor or detect the boll weevil. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by a US Government employee and is in the public domain in the US.
He, Qiuling; Jones, Don C.; Li, Wei; Xie, Fuliang; Ma, Jun; Sun, Runrun; Wang, Qinglian; Zhu, Shuijin; Zhang, Baohong
2016-01-01
The R2R3-MYB is one of the largest families of transcription factors, which have been implicated in multiple biological processes. There is great diversity in the number of R2R3-MYB genes in different plants. However, there is no report on genome-wide characterization of this gene family in cotton. In the present study, a total of 205 putative R2R3-MYB genes were identified in cotton D genome (Gossypium raimondii), that are much larger than that found in other cash crops with fully sequenced genomes. These GrMYBs were classified into 13 groups with the R2R3-MYB genes from Arabidopsis and rice. The amino acid motifs and phylogenetic tree were predicted and analyzed. The sequences of GrMYBs were distributed across 13 chromosomes at various densities. The results showed that the expansion of the G. Raimondii R2R3-MYB family was mainly attributable to whole genome duplication and segmental duplication. Moreover, the expression pattern of 52 selected GrMYBs and 46 GaMYBs were tested in roots and leaves under different abiotic stress conditions. The results revealed that the MYB genes in cotton were differentially expressed under salt and drought stress treatment. Our results will be useful for determining the precise role of the MYB genes during stress responses with crop improvement. PMID:27009386
Wang, Le; Wu, Shu-Ming; Zhu, Yue; Fan, Qiang; Zhang, Zhen-Nan; Hu, Guang; Peng, Qing-Zhong; Wu, Jia-He
2017-03-01
The jasmonic acid (JA) signalling pathway plays roles in plant development and defence against biotic and abiotic stresses. We isolated a cotton NINJA (novel interactor of JA ZIM-domain) gene, designated GhNINJA, which contains a 1305 bp open read frame. The GhNINJA gene encodes a 434 amino acid peptide. According to quantitative real-time PCR analysis, GhNINJA is preferentially expressed in roots, and its expression level is greatly induced by Verticillium dahliae infection. Through a virus-induced gene silencing technique, we developed GhNINJA-silenced cotton plants, which had significantly decreased expression of the target gene with an average expression of 6% of the control. The regenerating lateral root growth of silenced plants was largely inhibited compared to the control. Analysis by microscopy demonstrated that the cell length of the root differentiation zone in GhNINJA-silenced plants is significantly shorter than those of the control. Moreover, the silenced plants exhibited higher tolerance to V. dahliae infection compared to the control, which was linked to the increased expression of the defence marker genes PDF1.2 and PR4. Together, these data indicated that knockdown of GhNINJA represses the root growth and enhances the tolerance to V. dahliae. Therefore, GhNINJA gene can be used as a candidate gene to breed the new cultivars for improving cotton yield and disease resistance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Molecular Identification of Thrips Species Infesting Cotton in the Southeastern United States.
Wang, Hehe; Kennedy, George G; Reay-Jones, Francis P F; Reisig, Dominic D; Toews, Michael D; Roberts, Phillip M; Herbert, D Ames; Taylor, Sally; Jacobson, Alana L; Greene, Jeremy K
2018-04-02
Traditional identification of thrips species based on morphology is difficult, laborious, and especially challenging for immature thrips. To support monitoring and management efforts of thrips as consistent and widespread pests of cotton (Gossypium hirsutum L.), a probe-based quantitative PCR (qPCR) assay with crude DNA extraction was developed to allow efficient and specific identification of the primary species of thrips infesting cotton. The assay was applied to identify over 5,000 specimens of thrips (including 3,366 immatures) collected on cotton seedlings from Alabama, Georgia, North Carolina, South Carolina, and Virginia in 2016. One half of all adult samples were examined by morphological identification, which provided a statistically equivalent species composition as the qPCR method. Frankliniella fusca (Hinds) (Thysanoptera: Thripidae) was the dominant species across all the locations (76.8-94.3% of adults and 81.6-98.0% of immatures), followed by Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae) in Georgia, North Carolina, and Virginia (4.6-19% of adults and 1.7-17.3% of immatures) or Frankliniella tritici (Fitch) (Thysanoptera: Thripidae) in South Carolina (10.8% of adults and 7.8% of immatures). Thrips tabaci (Lindeman) (Thysanoptera: Thripidae) and Neohydatothrips variabilis (Beach) (Thysanoptera: Thripidae) were occasionally found among adults but were rarely present among immature thrips. These five species of thrips represented 98.2-100% of samples collected across the Southeast. The qPCR assay was demonstrated to be a valuable tool for large-scale monitoring of species composition of thrips at different life stages in cotton. The tool will contribute to a better understanding of thrips population structure in cotton and could assist with development and application of improved management strategies.
Nitrogen nutrition in cotton and control strategies for greenhouse gas emissions: a review.
Khan, Aziz; Tan, Daniel Kean Yuen; Munsif, Fazal; Afridi, Muhammad Zahir; Shah, Farooq; Wei, Fan; Fahad, Shah; Zhou, Ruiyang
2017-10-01
Cotton (Gossypium hirustum L.) is grown globally as a major source of natural fiber. Nitrogen (N) management is cumbersome in cotton production systems; it has more impacts on yield, maturity, and lint quality of a cotton crop than other primary plant nutrient. Application and production of N fertilizers consume large amounts of energy, and excess application can cause environmental concerns, i.e., nitrate in ground water, and the production of nitrous oxide a highly potent greenhouse gas (GHG) to the atmosphere, which is a global concern. Therefore, improving nitrogen use efficiency (NUE) of cotton plant is critical in this context. Slow-release fertilizers (e.g., polymer-coated urea) have the potential to increase cotton yield and reduce environmental pollution due to more efficient use of nutrients. Limited literature is available on the mitigation of GHG emissions for cotton production. Therefore, this review focuses on the role of N fertilization, in cotton growth and GHG emission management strategies, and will assess, justify, and organize the researchable priorities. Nitrate and ammonium nitrogen are essential nutrients for successful crop production. Ammonia (NH 3 ) is a central intermediate in plant N metabolism. NH 3 is assimilated in cotton by the mediation of glutamine synthetase, glutamine (z-) oxoglutarate amino-transferase enzyme systems in two steps: the first step requires adenosine triphosphate (ATP) to add NH 3 to glutamate to form glutamine (Gln), and the second step transfers the NH 3 from glutamine (Gln) to α-ketoglutarate to form two glutamates. Once NH 3 has been incorporated into glutamate, it can be transferred to other carbon skeletons by various transaminases to form additional amino acids. The glutamate and glutamine formed can rapidly be used for the synthesis of low-molecular-weight organic N compounds (LMWONCs) such as amides, amino acids, ureides, amines, and peptides that are further synthesized into high-molecular-weight organic
Agrobacterium-mediated virus-induced gene silencing assay in cotton.
Gao, Xiquan; Britt, Robert C; Shan, Libo; He, Ping
2011-08-20
Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation(1). To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions. Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation(2,3). Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies(3,4). As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation. In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development(6), and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves(7), providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration
Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton
Gao, Xiquan; Britt Jr., Robert C.; Shan, Libo; He, Ping
2011-01-01
Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation1. To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions. Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation2,3. Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies3,4. As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation. In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development6, and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves7, providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration, the albino
Cheng, Xi; Wang, Yanan; Abdullah, Muhammad; Li, Manli; Li, Dahui; Gao, Junshan
2017-01-01
Plant type III polyketide synthase (PKS) can catalyse the formation of a series of secondary metabolites with different structures and different biological functions; the enzyme plays an important role in plant growth, development and resistance to stress. At present, the PKS gene has been identified and studied in a variety of plants. Here, we identified 11 PKS genes from upland cotton (Gossypium hirsutum) and compared them with 41 PKS genes in Populus tremula, Vitis vinifera, Malus domestica and Arabidopsis thaliana. According to the phylogenetic tree, a total of 52 PKS genes can be divided into four subfamilies (I–IV). The analysis of gene structures and conserved motifs revealed that most of the PKS genes were composed of two exons and one intron and there are two characteristic conserved domains (Chal_sti_synt_N and Chal_sti_synt_C) of the PKS gene family. In our study of the five species, gene duplication was found in addition to Arabidopsis thaliana and we determined that purifying selection has been of great significance in maintaining the function of PKS gene family. From qRT-PCR analysis and a combination of the role of the accumulation of proanthocyanidins (PAs) in brown cotton fibers, we concluded that five PKS genes are candidate genes involved in brown cotton fiber pigment synthesis. These results are important for the further study of brown cotton PKS genes. It not only reveals the relationship between PKS gene family and pigment in brown cotton, but also creates conditions for improving the quality of brown cotton fiber. PMID:29104824
Muthusamy, Annamalai; Jayabalan, Narayanasamy
2014-12-01
The purpose of the investigation was to induce somaclonal variations by gamma rays (GR), ethylmethane sulphonate (EMS) and sodium azide (SA) during in vitro organogenesis of cotton. The shoot tip explants were irradiated with 5-50 Gray (Gy) GR (Cobalt 60), 0.5-5.0 mM EMS and SA separately, and inoculated on Murashige and Skoog (MS) medium fortified with plant growth regulator (PGR) for organogenesis. The plantlets with well-developed root systems were acclimatized and transferred into the experimental field to screen the somaclonal variations during growth and development. The number of somaclonal variations was observed in growth of irradiated/treated shoot tips, multiplication, plantlet regeneration and growth in vitro and ex vitro. The lower doses/concentrations of mutagenic treatments showed significant enhancement in selected agronomical characters and they showed decreased trends with increasing doses/concentrations of mutagenic agents. The results of the present study revealed the influence of lower doses/concentrations of mutagenic treatments on in vitro and ex vitro growth of cotton plantlets and their significant improvement in agronomical characters which needs further imperative stability analysis. The present observations showed the platform to use lower doses/concentrations of mutagenic agents to induce variability for enhanced agronomical characters, resistant and tolerant cotton varieties.
Reddy, Umesh K.; Nimmakayala, Padma; Abburi, Venkata Lakshmi; Reddy, C. V. C. M.; Saminathan, Thangasamy; Percy, Richard G.; Yu, John Z.; Frelichowski, James; Udall, Joshua A.; Page, Justin T.; Zhang, Dong; Shehzad, Tariq; Paterson, Andrew H.
2017-01-01
Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using the SNPs distributed genome-wide, we examined genetic diversity, haplotype distribution and linkage disequilibrium patterns in the G. hirsutum and G. barbadense genomes to clarify population demographic history. Diversity and identity-by-state analyses have revealed little sharing of alleles between the two cultivated allotetraploid genomes, with a few exceptions that indicated sporadic gene flow. We found a high number of new alleles, representing increased nucleotide diversity, on chromosomes 1 and 2 in cultivated G. hirsutum as compared with low nucleotide diversity on these chromosomes in landrace G. hirsutum. In contrast, G. barbadense chromosomes showed negative Tajima’s D on several chromosomes for both cultivated and landrace types, which indicate that speciation of G. barbadense itself, might have occurred with relatively narrow genetic diversity. The presence of conserved linkage disequilibrium (LD) blocks and haplotypes between G. hirsutum and G. barbadense provides strong evidence for comparable patterns of evolution in their domestication processes. Our study illustrates the potential use of population genetic techniques to identify genomic regions for domestication. PMID:28128280
Multiattribute evaluation of regional cotton variety trials.
Basford, K E; Kroonenberg, P M; Delacy, I H; Lawrence, P K
1990-02-01
The Australian Cotton Cultivar Trials (ACCT) are designed to investigate various cotton [Gossypium hirsutum (L.)] lines in several locations in New South Wales and Queensland each year. If these lines are to be assessed by the simultaneous use of yield and lint quality data, then a multivariate technique applicable to three-way data is desirable. Two such techniques, the mixture maximum likelihood method of clustering and three-mode principal component analysis, are described and used to analyze these data. Applied together, the methods enhance each other's usefulness in interpreting the information on the line response patterns across the locations. The methods provide a good integration of the responses across environments of the entries for the different attributes in the trials. For instance, using yield as the sole criterion, the excellence of the namcala and coker group for quality is overlooked. The analyses point to a decision in favor of either high yields of moderate to good quality lint or moderate yield but superior lint quality. The decisions indicated by the methods confirmed the selections made by the plant breeders. The procedures provide a less subjective, relatively easy to apply and interpret analytical method of describing the patterns of performance and associations in complex multiattribute and multilocation trials. This should lead to more efficient selection among lines in such trials.
Parajulee, M N; Shrestha, R B; Leser, J F
2006-04-01
A 2-yr field study was conducted to examine the effectiveness of two sampling methods (visual and plant washing techniques) for western flower thrips, Frankliniella occidentalis (Pergande), and five sampling methods (visual, beat bucket, drop cloth, sweep net, and vacuum) for cotton fleahopper, Pseudatomoscelis seriatus (Reuter), in Texas cotton, Gossypium hirsutum (L.), and to develop sequential sampling plans for each pest. The plant washing technique gave similar results to the visual method in detecting adult thrips, but the washing technique detected significantly higher number of thrips larvae compared with the visual sampling. Visual sampling detected the highest number of fleahoppers followed by beat bucket, drop cloth, vacuum, and sweep net sampling, with no significant difference in catch efficiency between vacuum and sweep net methods. However, based on fixed precision cost reliability, the sweep net sampling was the most cost-effective method followed by vacuum, beat bucket, drop cloth, and visual sampling. Taylor's Power Law analysis revealed that the field dispersion patterns of both thrips and fleahoppers were aggregated throughout the crop growing season. For thrips management decision based on visual sampling (0.25 precision), 15 plants were estimated to be the minimum sample size when the estimated population density was one thrips per plant, whereas the minimum sample size was nine plants when thrips density approached 10 thrips per plant. The minimum visual sample size for cotton fleahoppers was 16 plants when the density was one fleahopper per plant, but the sample size decreased rapidly with an increase in fleahopper density, requiring only four plants to be sampled when the density was 10 fleahoppers per plant. Sequential sampling plans were developed and validated with independent data for both thrips and cotton fleahoppers.
Wang, Chunling; Lu, Guoqing; Hao, Yuqiong; Guo, Huiming; Guo, Yan; Zhao, Jun; Cheng, Hongmei
2017-09-01
ABP9 , encoding a bZIP transcription factor from maize, enhances tolerance to multiple stresses and may participate in the ABA signaling pathway in transgenic cotton by altering physiological and biochemical processes and stress-related gene expression. Abiotic stresses, such as soil salinity and drought, negatively affect growth, development, and yield in cotton. Gene ABP9, which encodes a bZIP transcription factor, binds to the abscisic acid (ABA)-responsive-element (ABRE2) motif of the maize catalase1 gene. Its expression significantly improves tolerance in Arabidopsis to multiple abiotic stresses, but little is known about its role in cotton. In the present study, the ABP9 gene was introduced into upland cotton (Gossypium hirsutum L.) cultivar R15 by Agrobacterium tumefaciens-mediated transformation, and 12 independent transgenic cotton lines were obtained. Cotton plants over-expressing ABP9 have enhanced tolerance to salt and osmotic stress. Under stress, they developed better root systems in a greenhouse and higher germination, reduced stomatal aperture, and stomatal density in a growth chamber. Under drought conditions, survival rate and relative water content (RWC) of transgenic cotton were higher than those of R15 plants. Under salt and osmotic stresses, chlorophyll, proline, and soluble sugar contents significantly increased in transgenic cotton leaves and the malondialdehyde (MDA) content was lower than in R15. Overexpression of ABP9 also enhanced oxidative stress tolerance, reduced cellular levels of reactive oxygen species (ROS) through increased activities of antioxidative enzymes, and alleviated oxidative damage to cell. Interestingly, ABP9 over-expressing cotton was more sensitive to exogenous ABA than R15 at seed germination, root growth, stomatal aperture, and stomatal density. Moreover, ABP9 overexpression upregulated significantly the transcription levels of stress-related genes such as GhDBP2, GhNCED2, GhZFP1, GhERF1, GhHB1, and GhSAP1 under
Divergence and evolution of cotton bHLH proteins from diploid to allotetraploid.
Liu, Bingliang; Guan, Xueying; Liang, Wenhua; Chen, Jiedan; Fang, Lei; Hu, Yan; Guo, Wangzhen; Rong, Junkang; Xu, Guohua; Zhang, Tianzhen
2018-02-23
Polyploidy is considered a major driving force in genome expansion, yielding duplicated genes whose expression may be conserved or divergence as a consequence of polyploidization. We compared the genome sequences of tetraploid cotton (Gossypium hirsutum) and its two diploid progenitors, G. arboreum and G. raimondii, and found that the bHLH genes were conserved over the polyploidization. Oppositely, the expression of the homeolgous gene pairs was diversified. The biased homeologous proportion for bHLH family is significantly higher (64.6%) than the genome wide homeologous expression bias (40%). Compared with cacao (T. cacao), orthologous genes only accounted for a small proportion (41.7%) of whole cotton bHLHs family. The further Ks analysis indicated that bHLH genes underwent at least two distinct episodes of whole genome duplication: a recent duplication (1.0-60.0 million years ago, MYA, 0.005 < Ks < 0.312) and an old duplication (> 60.0 MYA, 0.312 < Ks < 3.0). The old duplication event might have played a key role in the expansion of the bHLH family. Both recent and old duplicated pairs (68.8%) showed a divergent expression profile, indicating specialized functions. The expression diversification of the duplicated genes suggested it might be a universal feature of the long-term evolution of cotton. Overview of cotton bHLH proteins indicated a conserved and divergent evolution from diploids to allotetraploid. Our results provided an excellent example for studying the long-term evolution of polyploidy.
Tao, Chengcheng; Jin, Xiang; Zhu, Liping; Xie, Quanliang; Wang, Xuchu; Li, Hongbin
2018-06-01
Ascorbate peroxidase (APX) is a member of heme-containing peroxidases which catalyze the H 2 O 2 -dependent oxidation of a wide range of substrates in plants and animals. As is known, H 2 O 2 acts as a signaling molecule in the regulation of fiber development. Our previous work reported that ascorbate peroxidase 1 (GhAPX1) was important for cotton fiber elongation. However, knowledge about APX gene family members and their evolutionary and functional characteristics in cotton is limited. Here, we report 26 GhAPX genes by genome-wide investigation of tetraploid cotton Gossypium hirsutum. Phylogenetic and gene structure analyses classified these APX members into five clades and syntenic analysis suggested two duplication events. Expression profiling of the 26 APXs revealed that ten members are expressed in cotton fibers. Notably, GhAPX10A, GhAPX10D, GhAPX12A, and GhAPX12D showed high expression levels in 30-day fiber, while GhAPX1A/D, GhAPX3A/D, and GhAPX6A/D showed very low expression levels. The enzyme activity and H 2 O 2 content assays revealed that cotton fiber kept high enzyme activity and the lowest H 2 O 2 level in 30-day fibers, indicating that other than GhAPX1, the newly reported APX members are responsible for the reactive oxygen species homeostasis in the cotton fiber maturation stages. Expression profiling of ten fiber-expressed APXs after phytohormone treatments revealed their regulation patterns by different stimuli, suggesting that GhAPX1, GhAPX12A, and GhAPX12D are responsible to most phytohormone treatments. Our data provided evolutionary and functional information of GhAPX gene family members and revealed that different members are responsible to redox homeostasis during different cotton fiber development stages.
Code of Federal Regulations, 2014 CFR
2014-01-01
... cubic foot. Contamination (contaminate). Containing or bearing whole cottonseed or seed cotton or other....) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton; cottonseed; cotton... cotton, grains (including grain products), field seeds, agricultural roots, rhizomes, tubers, or other...
COTIP: Cotton TILLING Platform, a Resource for Plant Improvement and Reverse Genetic Studies
Aslam, Usman; Cheema, Hafiza M. N.; Ahmad, Sheraz; Khan, Iqrar A.; Malik, Waqas; Khan, Asif A.
2016-01-01
Cotton is cultivated worldwide for its white fiber, of which around 90% is tetraploid upland cotton (Gossypium hirsutum L.) carrying both A and D genome. Since centuries, yield increasing efforts for the cotton crop by conventional breeding approaches have caused an extensive erosion of natural genetic variability. Mutation based improvement strategies provide an effective way of creating new allelic variations. Targeting Induced Local Lesions IN Genomes (TILLING) provides a mutation based reverse genetic strategy to create and evaluate induced genetic variability at DNA level. Here, we report development and testing of TILLING populations of allotetraploid cotton (G. hirsutum) for functional genomic studies and mutation based enrichment of cotton genetic resources. Seed of two cotton cultivars “PB-899 and PB-900” were mutagenized with 0.3 and 0.2% (v/v) ethyl methanesulfonate, respectively. The phenotyping of M1 and M2 populations presented numerous mutants regarding the branching pattern, leaf morphology, disease resistance, photosynthetic lesions and flower sterility. Molecular screening for point mutations was performed by TILLING PCR aided CEL1 mismatch cleavage. To estimate the mutation frequency in the mutant genomes, five gene classes were TILLed in 8000 M2 plants of each var. “PB-899” and “PB-900.” These include actin (GhACT), Pectin Methyl Esterase (GhPME), sucrose synthase (GhSUS), resistance gene analog, and defense response gene (DRGs). The var. PB-899 was harboring 47% higher mutation induction rate than PB-900. The highest rate of mutation frequency was identified for NAC-TF5 (EU706348) of DRGs class, ranging from 1/58 kb in PB-899 to 1/105 kb in PB-900. The mutation screening assay revealed the presence of significant proportion of induced mutations in cotton TILLING populations such as 1/153 kb and 1/326 kb in var. “PB-899” and “PB-900,” respectively. The establishment of a cotton TILLING platform (COTIP) and data obtained from
A New SNP Haplotype associated with blue disease resistance gene in cotton (Gossypium hirsutum L.)
USDA-ARS?s Scientific Manuscript database
Resistance to cotton blue disease (CBD) was evaluated in 364 F2.3 families of 3 populations derived from resistant variety ‘Delta Opal’. The CBD resistance in ‘Delta Opal’ was controlled by one single dominant gene designated Cbd. Two simple sequence repeat (SSR) markers were identified as linked t...
Morphological and Physiological Responses of Cotton (Gossypium hirsutum L.) Plants to Salinity
Zhang, Lei; Ma, Huijuan; Chen, Tingting; Pen, Jun; Yu, Shuxun; Zhao, Xinhua
2014-01-01
Salinization usually plays a primary role in soil degradation, which consequently reduces agricultural productivity. In this study, the effects of salinity on growth parameters, ion, chlorophyll, and proline content, photosynthesis, antioxidant enzyme activities, and lipid peroxidation of two cotton cultivars, [CCRI-79 (salt tolerant) and Simian 3 (salt sensitive)], were evaluated. Salinity was investigated at 0 mM, 80 mM, 160 mM, and 240 mM NaCl for 7 days. Salinity induced morphological and physiological changes, including a reduction in the dry weight of leaves and roots, root length, root volume, average root diameter, chlorophyll and proline contents, net photosynthesis and stomatal conductance. In addition, salinity caused ion imbalance in plants as shown by higher Na+ and Cl− contents and lower K+, Ca2+, and Mg2+ concentrations. Ion imbalance was more pronounced in CCRI-79 than in Simian3. In the leaves and roots of the salt-tolerant cultivar CCRI-79, increasing levels of salinity increased the activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), and glutathione reductase (GR), but reduced catalase (CAT) activity. The activities of SOD, CAT, APX, and GR in the leaves and roots of CCRI-79 were higher than those in Simian 3. CAT and APX showed the greatest H2O2 scavenging activity in both leaves and roots. Moreover, CAT and APX activities in conjunction with SOD seem to play an essential protective role in the scavenging process. These results indicate that CCRI-79 has a more effective protection mechanism and mitigated oxidative stress and lipid peroxidation by maintaining higher antioxidant activities than those in Simian 3. Overall, the chlorophyll a, chlorophyll b, and Chl (a+b) contents, net photosynthetic rate and stomatal conductance, SOD, CAT, APX, and GR activities showed the most significant variation between the two cotton cultivars. PMID:25391141
2010-01-01
Background The soil-borne fungal pathogen Verticillium dahliae Kleb causes Verticillium wilt in a wide range of crops including cotton (Gossypium hirsutum). To date, most upland cotton varieties are susceptible to V. dahliae and the breeding for cotton varieties with the resistance to Verticillium wilt has not been successful. Results Hpa1Xoo is a harpin protein from Xanthomonas oryzae pv. oryzae which induces the hypersensitive cell death in plants. When hpa1Xoo was transformed into the susceptible cotton line Z35 through Agrobacterium-mediated transformation, the transgenic cotton line (T-34) with an improved resistance to Verticillium dahliae was obtained. Cells of the transgenic T-34, when mixed with the conidia suspension of V. dahliae, had a higher tolerance to V. dahliae compared to cells of untransformed Z35. Cells of T-34 were more viable 12 h after mixing with V. dahliae conidia suspension. Immunocytological analysis showed that Hpa1Xoo, expressed in T-34, accumulated as clustered particles along the cell walls of T-34. In response to the infection caused by V. dahliae, the microscopic cell death and the generation of reactive oxygen intermediates were observed in leaves of T-34 and these responses were absent in leaves of Z35 inoculated with V. dahliae. Quantitative RT-PCR analysis indicated that five defense-related genes, ghAOX1, hin1, npr1, ghdhg-OMT, and hsr203J, were up-regulated in T-34 inoculated with V. dahliae. The up-regulations of these defense-relate genes were not observed or in a less extent in leaves of Z-35 after the inoculation. Conclusions Hpa1Xoo accumulates along the cell walls of the transgenic T-34, where it triggers the generation of H2O2 as an endogenous elicitor. T-34 is thus in a primed state, ready to protect the host from the pathogen. The results of this study suggest that the transformation of cotton with hpa1Xoo could be an effective approach for the development of cotton varieties with the improved resistance against soil
Effects of climate change on phenological trends and seed cotton yields in oasis of arid regions.
Huang, Jian; Ji, Feng
2015-07-01
Understanding the effects of climatic change on phenological phases of cotton (Gossypium hirsutum L.) in oasis of arid regions may help optimize management schemes to increase productivity. This study assessed the impacts of climatic changes on the phenological phases and productivity of spring cotton. The results showed that climatic warming led the dates of sowing seed, seeding emergence, three-leaf, five-leaf, budding, anthesis, full bloom, cleft boll, boll-opening, boll-opening filling, and stop-growing become earlier by 24.42, 26.19, 24.75, 23.28, 22.62, 15.75, 14.58, 5.37, 2.85, 8.04, and 2.16 days during the period of 1981-2010, respectively. The growth period lengths from sowing seed to seeding emergence and from boll-opening to boll-opening filling were shortened by 1.76 and 5.19 days, respectively. The other growth period lengths were prolonged by 2-9.71 days. The whole growth period length was prolonged by 22.26 days. The stop-growing date was delayed by 2.49-3.46 days for every 1 °C rise in minimum, maximum, and mean temperatures; however, other development dates emerged earlier by 2.17-4.76 days. Rising temperatures during the stage from seeding emergence to three-leaf reduced seed cotton yields. However, rising temperatures increased seed cotton yields in the two stages from anthesis to cleft boll and from boll-opening filling to the stop-growing. Increasing accumulated temperatures (AT) had different impacts on different development stages. During the vegetative phase, rising AT led to reduced seed cotton yields, but rising AT during reproductive stage increased seed cotton yields. In conclusion, climatic warming helpfully obtained more seed cotton yields in oasis of arid regions in northwest China. Changing the sowing date is another way to enhance yields for climate change in the future.
Brévault, T; Carletto, J; Tribot, J; Vanlerberghe-Masutti, F
2011-08-01
Field populations of the cotton aphid, Aphis gossypii Glover, are structured into geographically widespread host races. In the cotton-producing regions of West and Central Africa (WCA), two genotypes have been repeatedly detected within the cotton host race, one of which (Burk1) is prevalent (>90%) and resistant to several insecticides, as opposed to the second one (Ivo). Here, we conducted whole plant and field cage experiments to test hypotheses for such low genetic diversity, including selection from insecticide treatments, interclonal competition and adaptation to host plant, or climatic conditions. To assess the genetic diversity of immigrant aphids, alatae were trapped and collected on cotton and relay host plants (okra and roselle) in the early cropping season. Individuals were genotyped at eight specific microsatellite loci and characterized by a multilocus genotype (MLG). When independently transferred from cotton (Gossypium hirustum L.) leaf discs to whole plants (G. hirsutum and G. arboreum, roselle and okra), Ivo and Burk1 performed equally well. When concurrently transferred from cotton leaf discs to the same plant species, Ivo performed better than Burk1, indicating that competition favoured Ivo. This was also the case on G. hirsutum growing outdoors. Conversely, Burk1 prevailed when cotton plants were sprayed with insecticides. In experiments where aphids were allowed to move to neighbouring plants, Burk1 was better represented than Ivo on low-populated plants, suggesting that dispersal may be a way to avoid competition on crowded plants. Most cotton aphids collected on cotton or relay host plants in the early cropping season were Burk1 (>90%), indicating high dispersal ability and, probably reflecting high frequency on host plants from which they dispersed. In the agricultural landscape of WCA, the use of broad-range insecticides on both cotton and relay host plants has led to the prevalence of one genotype of A. gossypii resistant to different
Han, Li-Bo; Li, Yuan-Bao; Wang, Hai-Yun; Wu, Xiao-Min; Li, Chun-Li; Luo, Ming; Wu, Shen-Jie; Kong, Zhao-Sheng; Pei, Yan; Jiao, Gai-Li; Xia, Gui-Xian
2013-01-01
LIN-11, Isl1 and MEC-3 (LIM)-domain proteins play pivotal roles in a variety of cellular processes in animals, but plant LIM functions remain largely unexplored. Here, we demonstrate dual roles of the WLIM1a gene in fiber development in upland cotton (Gossypium hirsutum). WLIM1a is preferentially expressed during the elongation and secondary wall synthesis stages in developing fibers. Overexpression of WLIM1a in cotton led to significant changes in fiber length and secondary wall structure. Compared with the wild type, fibers of WLIM1a-overexpressing plants grew longer and formed a thinner and more compact secondary cell wall, which contributed to improved fiber strength and fineness. Functional studies demonstrated that (1) WLIM1a acts as an actin bundler to facilitate elongation of fiber cells and (2) WLIM1a also functions as a transcription factor to activate expression of Phe ammonia lyase–box genes involved in phenylpropanoid biosynthesis to build up the secondary cell wall. WLIM1a localizes in the cytosol and nucleus and moves into the nucleus in response to hydrogen peroxide. Taken together, these results demonstrate that WLIM1a has dual roles in cotton fiber development, elongation, and secondary wall formation. Moreover, our study shows that lignin/lignin-like phenolics may substantially affect cotton fiber quality; this finding may guide cotton breeding for improved fiber traits. PMID:24220634
Li, Tinggang; Ma, Xuefeng; Li, Nanyang; Zhou, Lei; Liu, Zheng; Han, Huanyong; Gui, Yuejing; Bao, Yuming; Chen, Jieyin; Dai, Xiaofeng
2017-12-01
Verticillium wilt (VW), caused by infection by Verticillium dahliae, is considered one of the most yield-limiting diseases in cotton. To examine the genetic architecture of cotton VW resistance, we performed a genome-wide association study (GWAS) using a panel of 299 accessions and 85 630 single nucleotide polymorphisms (SNPs) detected using the specific-locus amplified fragment sequencing (SLAF-seq) approach. Trait-SNP association analysis detected a total of 17 significant SNPs at P < 1.17 × 10 -5 (P = 1/85 630, -log 10 P = 4.93); the peaks of SNPs associated with VW resistance on A10 were continuous and common in three environments (RDIG2015, RDIF2015 and RDIF2016). Haplotype block structure analysis predicted 22 candidate genes for VW resistance based on A10_99672586 with a minimum P-value (-log 10 P = 6.21). One of these genes (CG02) was near the significant SNP A10_99672586 (0.26 Mb), located in a 372-kb haplotype block, and its Arabidopsis AT3G25510 homologues contain TIR-NBS-LRR domains that may be involved in disease resistance response. Real-time quantitative PCR and virus-induced gene silencing (VIGS) analysis showed that CG02 was specific to up-regulation in the resistant (R) genotype Zhongzhimian2 (ZZM2) and that silenced plants were more susceptible to V. dahliae. These results indicate that CG02 is likely the candidate gene for resistance against V. dahliae in cotton. The identified locus or gene may serve as a promising target for genetic engineering and selection for improving resistance to VW in cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Influence of cover crops on insect pests and predators in conservation tillage cotton.
Tillman, Glynn; Schomberg, Harry; Phatak, Sharad; Mullinix, Benjamin; Lachnicht, Sharon; Timper, Patricia; Olson, Dawn
2004-08-01
In fall 2000, an on-farm sustainable agricultural research project was established for cotton, Gossypium hirsutum L., in Tift County, Georgia. The objective of our 2-yr research project was to determine the impact of several cover crops on pest and predator insects in cotton. The five cover crop treatments included 1) cereal rye, Secale cereale L., a standard grass cover crop; 2) crimson clover, Trifolium incarnatum L., a standard legume cover crop; 3) a legume mixture of balansa clover, Trifolium michelianum Savi; crimson clover; and hairy vetch, Vicia villosa Roth; 4) a legume mixture + rye combination; and 5) no cover crop in conventionally tilled fields. Three main groups or species of pests were collected in cover crops and cotton: 1) the heliothines Heliothis virescens (F.) and Helicoverpa zea (Boddie); 2) the tarnished plant bug, Lygus lineolaris (Palisot de Beauvois); and 3) stink bugs. The main stink bugs collected were the southern green stink bug, Nezara viridula (L.); the brown stink bug, Euschistus servus (Say); and the green stink bug, Acrosternum hilare (Say). Cotton aphids, Aphis gossypii Glover, were collected only on cotton. For both years of the study, the heliothines were the only pests that exceeded their economic threshold in cotton, and the number of times this threshold was exceeded in cotton was higher in control cotton than in crimson clover and rye cotton. Heliothine predators and aphidophagous lady beetles occurred in cover crops and cotton during both years of the experiment. Geocoris punctipes (Say), Orius insidiosus (Say), and red imported fire ant, Solenopsis invicta Buren were relatively the most abundant heliothine predators observed. Lady beetles included the convergent lady beetle, Hippodamia convergens Guérin-Méneville; the sevenspotted lady beetle, Coccinella septempunctata L.; spotted lady beetle, Coleomegilla maculata (DeGeer); and the multicolored Asian lady beetle, Harmonia axyridis (Pallas). Density of G. punctipes was
Inheritance of the ovule fuzzless trait for Gossypium arboreum germplasm line PI 529708
USDA-ARS?s Scientific Manuscript database
Background: Cotton is the most important fiber crop and understanding the genetic mechanisms controlling fiber production on cotton seeds can aid in the development of improved varieties with higher lint yields and improved fiber quality. Lint and fuzz are the two types of fiber produced on the cott...
Reproduction of Meloidogyne incognita on Winter Cover Crops Used in Cotton Production
Timper, Patricia; Davis, Richard F.; Tillman, P. Glynn
2006-01-01
Substantial reproduction of Meloidogyne incognita on winter cover crops may lead to damaging populations in a subsequent cotton (Gossypium hirsutum) crop. The amount of population increase during the winter depends on soil temperature and the host status of the cover crop. Our objectives were to quantify M. incognita race 3 reproduction on rye (Secale cereale) and several leguminous cover crops and to determine if these cover crops increase population densities of M. incognita and subsequent damage to cotton. The cover crops tested were ‘Bigbee’ berseem clover (Trifolium alexandrinum), ‘Paradana’ balansa clover (T. balansae), ‘AU Sunrise’ and ‘Dixie’ crimson clover (T. incarnatum), ‘Cherokee’ red clover (T. pratense), common and ‘AU Early Cover’ hairy vetch (Vicia villosa), ‘Cahaba White’ vetch (V. sativa), and ‘Wrens Abruzzi’ rye. In the greenhouse tests, egg production was greatest on berseem clover, Dixie crimson clover, AU Early Cover hairy vetch, and common hairy vetch; intermediate on Balansa clover and AU Sunrise crimson clover; and least on rye, Cahaba White vetch, and Cherokee red clover. In both 2002 and 2003 field tests, enough heat units were accumulated between 1 January and 20 May for the nematode to complete two generations. Both AU Early Cover and common hairy vetch led to greater root galling than fallow in the subsequent cotton crop; they also supported high reproduction of M. incognita in the greenhouse. Rye and Cahaba White vetch did not increase root galling on cotton and were relatively poor hosts for M. incognita. Only those legumes that increased populations of M. incognita reduced cotton yield. In the southern US, M. incognita can complete one to two generations on a susceptible winter cover crop, so cover crops that support high nematode reproduction may lead to damage and yield losses in the following cotton crop. Planting rye or Meloidogyne-resistant legumes as winter cover crops will lower the risk of
Reproduction of Meloidogyne incognita on Winter Cover Crops Used in Cotton Production.
Timper, Patricia; Davis, Richard F; Tillman, P Glynn
2006-03-01
Substantial reproduction of Meloidogyne incognita on winter cover crops may lead to damaging populations in a subsequent cotton (Gossypium hirsutum) crop. The amount of population increase during the winter depends on soil temperature and the host status of the cover crop. Our objectives were to quantify M. incognita race 3 reproduction on rye (Secale cereale) and several leguminous cover crops and to determine if these cover crops increase population densities of M. incognita and subsequent damage to cotton. The cover crops tested were 'Bigbee' berseem clover (Trifolium alexandrinum), 'Paradana' balansa clover (T. balansae), 'AU Sunrise' and 'Dixie' crimson clover (T. incarnatum), 'Cherokee' red clover (T. pratense), common and 'AU Early Cover' hairy vetch (Vicia villosa), 'Cahaba White' vetch (V. sativa), and 'Wrens Abruzzi' rye. In the greenhouse tests, egg production was greatest on berseem clover, Dixie crimson clover, AU Early Cover hairy vetch, and common hairy vetch; intermediate on Balansa clover and AU Sunrise crimson clover; and least on rye, Cahaba White vetch, and Cherokee red clover. In both 2002 and 2003 field tests, enough heat units were accumulated between 1 January and 20 May for the nematode to complete two generations. Both AU Early Cover and common hairy vetch led to greater root galling than fallow in the subsequent cotton crop; they also supported high reproduction of M. incognita in the greenhouse. Rye and Cahaba White vetch did not increase root galling on cotton and were relatively poor hosts for M. incognita. Only those legumes that increased populations of M. incognita reduced cotton yield. In the southern US, M. incognita can complete one to two generations on a susceptible winter cover crop, so cover crops that support high nematode reproduction may lead to damage and yield losses in the following cotton crop. Planting rye or Meloidogyne-resistant legumes as winter cover crops will lower the risk of increased nematode populations
Code of Federal Regulations, 2014 CFR
2014-01-01
...: (a) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton; cottonseed... containing cotton. (b) Seed cotton. The unginned lint and seed admixture, just as it is picked from the cotton boll. (c) Cottonseed. The seed of the cotton plant, either separated from the lint or as a...
Code of Federal Regulations, 2010 CFR
2010-01-01
...: (a) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton; cottonseed... containing cotton. (b) Seed cotton. The unginned lint and seed admixture, just as it is picked from the cotton boll. (c) Cottonseed. The seed of the cotton plant, either separated from the lint or as a...
Code of Federal Regulations, 2011 CFR
2011-01-01
...: (a) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton; cottonseed... containing cotton. (b) Seed cotton. The unginned lint and seed admixture, just as it is picked from the cotton boll. (c) Cottonseed. The seed of the cotton plant, either separated from the lint or as a...
Code of Federal Regulations, 2013 CFR
2013-01-01
...: (a) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton; cottonseed... containing cotton. (b) Seed cotton. The unginned lint and seed admixture, just as it is picked from the cotton boll. (c) Cottonseed. The seed of the cotton plant, either separated from the lint or as a...
Code of Federal Regulations, 2012 CFR
2012-01-01
...: (a) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton; cottonseed... containing cotton. (b) Seed cotton. The unginned lint and seed admixture, just as it is picked from the cotton boll. (c) Cottonseed. The seed of the cotton plant, either separated from the lint or as a...
Imran, M; Shakeel, A; Azhar, F M; Farooq, J; Saleem, M F; Saeed, A; Nazeer, W; Riaz, M; Naeem, M; Javaid, A
2012-08-24
Cotton is an important cash crop worldwide, accounting for a large percentage of world agricultural exports; however, yield per acre is still poor in many countries, including Pakistan. Diallel mating system was used to identify parents for improving within-boll yield and fiber quality parameters. Combining ability analysis was employed to obtain suitable parents for this purpose. The parental genotypes CP-15/2, NIAB Krishma, CIM-482, MS-39, and S-12 were crossed in complete diallel mating under green house conditions during 2009. The F₀ seed of 20 hybrids and five parents were planted in the field in randomized complete block design with three replications during 2010. There were highly significant differences among all F₁ hybrids and their parents. Specific combining ability (SCA) variance was greater than general combining ability (GCA) variance for bolls per plant (9.987), seeds per boll (0.635), seed density (5.672), lint per seed (4.174), boll size (3.69), seed cotton yield (0.315), and lint percentage (0.470), showing predominance of non-additive genes; while seed volume (3.84) was controlled by additive gene action based on maximum GCA variance. Cultivar MS-39 was found to be the best general combiner for seed volume (0.102), seeds per boll (0.448), and lint per seed (0.038) and its utilization produced valuable hybrids, including MS-39 x NIAB Krishma and MS-39 x S-12. The parental line CIM-482 had high GCA effects for boll size (0.33) and seeds per boll (0.90). It also showed good SCA with S-12 and NIAB Krishma for bolls per plant, with CP- 15/2 for boll size, and with MS-39 for seeds per boll. The hybrids, namely, CP-15/2 x NIAB Krishma, NIAB Krishma x S-12, NIAB Krishma x CIM-482, MS-39 x NIAB Krishma, MS-39 x CP-15/2, and S-12 x MS-39 showed promising results. Correlation analysis revealed that seed cotton yield showed significant positive correlation with bolls per plant, boll size and seeds per boll while it showed negative correlation with lint
Andres, Ryan J; Coneva, Viktoriya; Frank, Margaret H; Tuttle, John R; Samayoa, Luis Fernando; Han, Sang-Won; Kaur, Baljinder; Zhu, Linglong; Fang, Hui; Bowman, Daryl T; Rojas-Pierce, Marcela; Haigler, Candace H; Jones, Don C; Holland, James B; Chitwood, Daniel H; Kuraparthy, Vasu
2017-01-03
Leaf shape varies spectacularly among plants. Leaves are the primary source of photoassimilate in crop plants, and understanding the genetic basis of variation in leaf morphology is critical to improving agricultural productivity. Leaf shape played a unique role in cotton improvement, as breeders have selected for entire and lobed leaf morphs resulting from a single locus, okra (l-D 1 ), which is responsible for the major leaf shapes in cotton. The l-D 1 locus is not only of agricultural importance in cotton, but through pioneering chimeric and morphometric studies, it has contributed to fundamental knowledge about leaf development. Here we show that an HD-Zip transcription factor homologous to the LATE MERISTEM IDENTITY1 (LMI1) gene of Arabidopsis is the causal gene underlying the l-D 1 locus. The classical okra leaf shape allele has a 133-bp tandem duplication in the promoter, correlated with elevated expression, whereas an 8-bp deletion in the third exon of the presumed wild-type normal allele causes a frame-shifted and truncated coding sequence. Our results indicate that subokra is the ancestral leaf shape of tetraploid cotton that gave rise to the okra allele and that normal is a derived mutant allele that came to predominate and define the leaf shape of cultivated cotton. Virus-induced gene silencing (VIGS) of the LMI1-like gene in an okra variety was sufficient to induce normal leaf formation. The developmental changes in leaves conferred by this gene are associated with a photosynthetic transcriptomic signature, substantiating its use by breeders to produce a superior cotton ideotype.
Shang, Xiaoguang; Cheng, Chaoze; Ding, Jian; Guo, Wangzhen
2017-02-01
Cotton is an economically important crop grown for natural fiber and seed oil production. Cottonseed oil ranks third after soybean oil and colza oil in terms of edible oilseed tonnage worldwide. The fatty acid composition of cottonseed oil determines its industrial application and nutritional values. However, little progress has been made in understanding cottonseed oil biogenesis. Stearoyl-acyl carrier protein desaturase (SAD), the only known enzyme to convert saturated fatty acids into unsaturated fatty acids in plants, plays key roles in determining the fatty acid composition of cottonseed oil. In this study, we identified 9, 9, 18 and 19 SAD genes in the genomes of four sequenced cotton species: diploid Gossypium raimondii (D 5 ), G. arboreum (A 2 ), tetraploid G. hirsutum acc. TM-1 (AD 1 ) and G. barbadense cv. Xinhai21 (AD 2 ), respectively. Bioinformatic and phylogenetic analyses revealed that cotton SADs can be classified into two classes. Expression patterns showed developmental and spatial regulation of SADs in cotton. GhSAD2 and GhSAD4 were preferentially expressed in developing ovules 20-35 days post-anthesis, and significantly different expression patterns were found between high-oil and low-oil cotton cultivars, implying these two genes could be involved in cottonseed oil biogenesis. Association analysis further confirmed that GhSAD4-At expression was closely related to the oleic acid (O) content, linoleic acid (L) content and O/L value in cottonseed, implying GhSAD4 plays an important role in cottonseed oil composition. This study brings new perspectives for integrated genome-wide identification of SADs in cotton and provides references for the genetic improvement of cottonseed oil.
USDA-ARS?s Scientific Manuscript database
Cotton is an important crop in the world and is a major source of oil for human consumption and cotton meal for livestock. Cottonseed composition constituents (protein, oil, and minerals) determine the quality of seeds. Therefore, maintaining optimum levels of cottonseed constituents is critical. Ph...
Small RNA-mediated responses to low- and high-temperature stresses in cotton
Wang, Qiongshan; Liu, Nian; Yang, Xiyan; Tu, Lili; Zhang, Xianlong
2016-01-01
MicroRNAs (miRNAs) are one class of endogenous non-coding RNAs modulating the expression of target genes involved in plant development and stress tolerance, by degrading mRNA or repressing translation. In this study, small RNA and mRNA degradome sequencing were used to identify low- and high-temperature stress-responsive miRNAs and their targets in cotton (Gossypium hirsutum). Cotton seedlings were treated under different temperature conditions (4, 12, 25, 35, and 42 °C) and then the effects were investigated. In total, 319 known miRNAs and 800 novel miRNAs were identified, and 168 miRNAs were differentially expressed between different treatments. The targets of these miRNAs were further analysed by degradome sequencing. Based on studies from Gene Ontology and Kyoto Encyclopedia of Genes and Genomes, the majority of the miRNAs are from genes that are likely involved in response to hormone stimulus, oxidation-reduction reaction, photosynthesis, plant–pathogen interaction and plant hormone signal transduction pathways. This study provides new insight into the molecular mechanisms of plant response to extreme temperature stresses, and especially the roles of miRNAs under extreme temperatures. PMID:27752116
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
USDA-ARS?s Scientific Manuscript database
The length of cotton fiber is an important agronomic trait characteristic that directly affects the quality of yarn and fabric. Cotton fiber mutants have been useful tools to study the molecular processes of fiber development. In this work we describe a chemically-induced short fiber mutant Ligon-li...
Singh, Bir; Avci, Utku; Eichler Inwood, Sarah E; Grimson, Mark J; Landgraf, Jeff; Mohnen, Debra; Sørensen, Iben; Wilkerson, Curtis G; Willats, William G T; Haigler, Candace H
2009-06-01
Cotton (Gossypium hirsutum) provides the world's dominant renewable textile fiber, and cotton fiber is valued as a research model because of its extensive elongation and secondary wall thickening. Previously, it was assumed that fibers elongated as individual cells. In contrast, observation by cryo-field emission-scanning electron microscopy of cotton fibers developing in situ within the boll demonstrated that fibers elongate within tissue-like bundles. These bundles were entrained by twisting fiber tips and consolidated by adhesion of a cotton fiber middle lamella (CFML). The fiber bundles consolidated via the CFML ultimately formed a packet of fiber around each seed, which helps explain how thousands of cotton fibers achieve their great length within a confined space. The cell wall nature of the CFML was characterized using transmission electron microscopy, including polymer epitope labeling. Toward the end of elongation, up-regulation occurred in gene expression and enzyme activities related to cell wall hydrolysis, and targeted breakdown of the CFML restored fiber individuality. At the same time, losses occurred in certain cell wall polymer epitopes (as revealed by comprehensive microarray polymer profiling) and sugars within noncellulosic matrix components (as revealed by gas chromatography-mass spectrometry analysis of derivatized neutral and acidic glycosyl residues). Broadly, these data show that adhesion modulated by an outer layer of the primary wall can coordinate the extensive growth of a large group of cells and illustrate dynamic changes in primary wall structure and composition occurring during the differentiation of one cell type that spends only part of its life as a tissue.
2011-01-01
Background Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Results Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. Conclusions uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues. PMID:22115195
Andres, Ryan J.; Coneva, Viktoriya; Frank, Margaret H.; Tuttle, John R.; Samayoa, Luis Fernando; Han, Sang-Won; Kaur, Baljinder; Zhu, Linglong; Fang, Hui; Bowman, Daryl T.; Rojas-Pierce, Marcela; Haigler, Candace H.; Jones, Don C.; Holland, James B.; Chitwood, Daniel H.; Kuraparthy, Vasu
2017-01-01
Leaf shape varies spectacularly among plants. Leaves are the primary source of photoassimilate in crop plants, and understanding the genetic basis of variation in leaf morphology is critical to improving agricultural productivity. Leaf shape played a unique role in cotton improvement, as breeders have selected for entire and lobed leaf morphs resulting from a single locus, okra (l-D1), which is responsible for the major leaf shapes in cotton. The l-D1 locus is not only of agricultural importance in cotton, but through pioneering chimeric and morphometric studies, it has contributed to fundamental knowledge about leaf development. Here we show that an HD-Zip transcription factor homologous to the LATE MERISTEM IDENTITY1 (LMI1) gene of Arabidopsis is the causal gene underlying the l-D1 locus. The classical okra leaf shape allele has a 133-bp tandem duplication in the promoter, correlated with elevated expression, whereas an 8-bp deletion in the third exon of the presumed wild-type normal allele causes a frame-shifted and truncated coding sequence. Our results indicate that subokra is the ancestral leaf shape of tetraploid cotton that gave rise to the okra allele and that normal is a derived mutant allele that came to predominate and define the leaf shape of cultivated cotton. Virus-induced gene silencing (VIGS) of the LMI1-like gene in an okra variety was sufficient to induce normal leaf formation. The developmental changes in leaves conferred by this gene are associated with a photosynthetic transcriptomic signature, substantiating its use by breeders to produce a superior cotton ideotype. PMID:27999177
Zhang, Jingxia; Wang, Furong; Zhang, Chuanyun; Zhang, Junhao; Chen, Yu; Liu, Guodong; Zhao, Yanxiu; Hao, Fushun; Zhang, Jun
2018-06-04
A VIGS method by agroinoculation of cotton seeds was developed for gene silencing in young seedlings and roots, and applied in functional analysis of GhBI-1 in response to salt stress. Virus-induced gene silencing (VIGS) has been widely used to investigate the functions of genes expressed in mature leaves, but not yet in young seedlings or roots of cotton (Gossypium hirsutum L.). Here, we developed a simple and effective VIGS method for silencing genes in young cotton seedlings and roots by soaking naked seeds in Agrobacterium cultures carrying tobacco rattle virus (TRV)-VIGS vectors. When the naked seeds were soaked in Agrobacterium cultures with an OD600 of 1.5 for 90 min, it was optimal for silencing genes effectively in young seedlings as clear photo-bleaching phenotype in the newly emerging leaves of pTRV:GhCLA1 seedlings were observed at 12-14 days post inoculation. Silencing of GhPGF (cotton pigment gland formation) by this method resulted in a 90% decrease in transcript abundances of the gene in roots at the early development stage. We further used the tool to investigate function of GhBI-1 (cotton Bax inhibitor-1) gene in response to salt stress and demonstrated that GhBI-1 might play a protective role under salt stress by suppressing stress-induced cell death in cotton. Our results showed that the newly established VIGS method is a powerful tool for elucidating functions of genes in cotton, especially the genes expressed in young seedlings and roots.
Cotton Production Practices Change Soil Properties
NASA Astrophysics Data System (ADS)
Blaise, D.; Singh, J. V.
2012-04-01
Historically, indigenous Asiatic cottons (Gossypium arboreum) were cultivated with minimal inputs in India. The introduction of the Upland cottons (G. hirsutum) and later the hybrid (H-4) triggered a whole set of intensified agronomic management with reliance on high doses of fertilisers and pesticide usage. In 2002, the transgenic Bt cotton hybrids were introduced and released for commercial cultivation. Presently, more than 95% of the nearly 12.2 million hectares of cotton area is under the Bt transgenic hybrids. These hybrids are not only high yielding but have reduced the dependence on pesticide because of an effective control of the lepidopteran pests. Thus, a change in the management practices is evident over the years. In this paper, we discuss the impact of two major agronomic management practices namely, nutrient management and tillage besides organic cotton cultivation in the rainfed cotton growing regions of central India characterized by sub-humid to semi-arid climate and dominated by Vertisols. Long-term studies at Nagpur, Maharashtra indicated the importance of integrated nutrient management (INM) wherein a part of the nutrient needs through fertiliser was substituted with organic manures such as farmyard manure (FYM). With the application of mineral fertilisers alone, soils became deficient in micronutrients. This was not observed with the FYM amended plots. Further, the manure amended plots had a better soil physical properties and the water holding capacity of the soil improved due to improvements in soil organic matter (SOM). Similarly, in a separate experiment, an improvement in SOM was observed in the organically managed fields because of continuous addition of organic residues. Further, it resulted in greater biological activity compared to the conventionally managed fields. Conservation tillage systems such as reduced tillage (RT) are a means to improve soil health and crop productivity. Long-term studies on tillage practices such as
Phosphorus use efficiency by cotton measured through 32P isotope technique
NASA Astrophysics Data System (ADS)
Marcante, N. C.; Muraoka, T.; Camacho, M. A.; César, F. R. C. F.; Bruno, I. P.
2012-04-01
Deficiency of phosphorus (P) is the major limitation to agricultural production in the Brazilian Savannah (Cerrado), which is naturally poor in this nutrient. Most of the P applied by fertilizer in Cerrado soils are converted into low solubility forms and can not be easily absorbed by plants. This occurs for characteristics of adsorption, conditioned by the predominance of low pH and aluminum and iron oxides in the clay fraction. The development of genotypes and cultivars with greater capacity to grow up in soils with low P availability ('phosphorus efficiency') is interesting to improve the agriculture in these areas in a sustainable way. Cotton (Gossypium spp.) is the main product for the fibers used nationally and globally in the textile chain. This study aim was to evaluate the efficiency of absorption and utilization of P by cotton cultivars/genotypes grown in Cerrado soil by the isotopic dilution technique. The soil classified as Ultisols, was labeled with the radioisotope 32P.The experiment was conducted in a greenhouse in a completely randomized design factorial 2 x 17. Factors were considered two levels of P (insufficient = 20 mg kg-1 and sufficient = 120 mg kg-1) and 17 genetic materials of cotton recommended for Cerrado region. Phosphorus levels influenced significantly the shoots dry matter production, the P content and accumulation, the 32P specific activity, the L value and L value less seed cotton P by cultivars and genotypes. The hierarchical clustering analysis used to verify the similarities between the cultivars and genotypes of cotton, classified them into internally homogeneous groups and heterogeneous between different groups. Cultivars FMT 523, FM 910 and CNPA GO 2043 were the most responsive to phosphate fertilizer in sufficient level of P, while the genotype Barbadense 01 and cultivars FM 966LL, IPR Jataí, BRS Aroeira and BRS Buriti were most efficient absorbing P in soils with insufficient level.
2. Long distance view from the SW of former Cotton ...
2. Long distance view from the SW of former Cotton Yards (now used as a parking lot); Cotton Yard Gates at far right, Red Building and Produce Freight Warehouse in background. - Central of Georgia Railway, Cotton Yard Gates, West Broad Street, Savannah, Chatham County, GA
Structure of cellulose microfibrils in mature cotton fibres.
Martínez-Sanz, Marta; Pettolino, Filomena; Flanagan, Bernadine; Gidley, Michael J; Gilbert, Elliot P
2017-11-01
The structure of cellulose microfibrils in mature cotton fibres from three varieties - Gossypium hirsutum, G. barbadense and G. arboreum - has been investigated by a multi-technique approach combining small angle scattering techniques with spectroscopy and diffraction. Cellulose microfibrils present a Iβ-rich crystalline structure with limited surface disorder. Small angle scattering (SAXS and SANS) data have been successfully fitted using a core-shell model and the results obtained indicate that the cellulose microfibrils, formed by the association of 2-3 elementary fibrils, are composed of a ca. 2nm impermeable crystalline core, surrounded by a partially hydrated paracrystalline shell, with overall cross-sections of ca. 3.6-4.7nm. Different low levels of cell wall matrix components have a strong impact on the microfibril architecture and enable moisture penetration upon hydration. Furthermore, the higher amounts of non-cellulosic components in G. barbadense result in a less dense packing of cellulose microfibrils and increased solvent accessibility. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhou, Li; Wang, Na-Na; Gong, Si-Ying; Lu, Rui; Li, Yang; Li, Xue-Bao
2015-11-01
Soil salinity is one of the most serious threats in world agriculture, and often influences cotton growth and development, resulting in a significant loss in cotton crop yield. WRKY transcription factors are involved in plant response to high salinity stress, but little is known about the role of WRKY transcription factors in cotton so far. In this study, a member (GhWRKY34) of cotton WRKY family was functionally characterized. This protein containing a WRKY domain and a zinc-finger motif belongs to group III of cotton WRKY family. Subcellular localization assay indicated that GhWRKY34 is localized to the cell nucleus. Overexpression of GhWRKY34 in Arabidopsis enhanced the transgenic plant tolerance to salt stress. Several parameters (such as seed germination, green cotyledons, root length and chlorophyll content) in the GhWRKY34 transgenic lines were significantly higher than those in wild type under NaCl treatment. On the contrary, the GhWRKY34 transgenic plants exhibited a substantially lower ratio of Na(+)/K(+) in leaves and roots dealing with salt stress, compared with wild type. Growth status of the GhWRKY34 transgenic plants was much better than that of wild type under salt stress. Expressions of the stress-related genes were remarkably up-regulated in the transgenic plants under salt stress, compared with those in wild type. Based on the data presented in this study, we hypothesize that GhWRKY34 as a positive transcription regulator may function in plant response to high salinity stress through maintaining the Na(+)/K(+) homeostasis as well as activating the salt stress-related genes in cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
7 CFR 318.47 - Notice of quarantine.
Code of Federal Regulations, 2011 CFR
2011-01-01
... aforementioned insect pests. (c) All parts and products of plants of the genus Gossypium, such as seeds including seed cotton; cottonseed; cotton lint, linters, and other forms of cotton fiber; cottonseed hulls, cake, meal, and other cottonseed products, except oil; cotton waste; and all other unmanufactured parts of...
7 CFR 318.47 - Notice of quarantine.
Code of Federal Regulations, 2010 CFR
2010-01-01
... aforementioned insect pests. (c) All parts and products of plants of the genus Gossypium, such as seeds including seed cotton; cottonseed; cotton lint, linters, and other forms of cotton fiber; cottonseed hulls, cake, meal, and other cottonseed products, except oil; cotton waste; and all other unmanufactured parts of...
USDA-ARS?s Scientific Manuscript database
Fiber strength, length, maturity and fineness determine the market value of cotton fibers and the quality of spun yarn. Cotton fiber strength has been recognized as a critical quality attribute in the modern textile industry. Fine mapping along with quantitative trait loci (QTL) validation and candi...
Sub-soil microbial activity under rotational cotton crops in Australia
NASA Astrophysics Data System (ADS)
Polain, Katherine; Knox, Oliver; Wilson, Brian; Pereg, Lily
2016-04-01
Soil microbial communities contribute significantly to soil organic matter formation, stabilisation and destabilisation, through nutrient cycling and biodegradation. The majority of soil microbial research examines the processes occurring in the top 0 cm to 30 cm of the soil, where organic nutrients are easily accessible. In soils such as Vertosols, the high clay content causes swelling and cracking. When soil cracking is coupled with rain or an irrigation event, a flush of organic nutrients can move down the soil profile, becoming available for subsoil microbial community use and potentially making a significant contribution to nutrient cycling and biodegradation in soils. At present, the mechanisms and rates of soil nutrient turnover (such as carbon and nitrogen) at depth under cotton rotations are mostly speculative and the process-response relationships remain unclear, although they are undoubtedly underpinned by microbial activity. Our research aims to determine the contribution and role of soil microbiota to the accumulation, cycling and mineralisation of carbon and nitrogen through the whole root profile under continuous cotton (Gossypium hirsutum) and cotton-maize rotations in regional New South Wales, Australia. Through seasonal work, we have established both baseline and potential microbial activity rates from 0 cm to 100 cm down the Vertosol profile, using respiration and colourimetric methods. Further whole soil profile analyses will include determination of microbial biomass and isotopic carbon signatures using phospholipid fatty acid (PLFA) methodology, identification of microbial communities (sequencing) and novel experiments to investigate potential rates of nitrogen mineralisation and quantification of associated genes. Our preliminary observations and the hypotheses tested in this three-year study will be presented.
Li, Xiaogang; Ding, Changfeng; Wang, Xingxiang; Liu, Biao
2015-03-04
The introduction of transgenic insect-resistant cotton into agricultural ecosystems has raised concerns regarding its ecological effects. Many studies have been conducted to compare the differences in characteristics between transgenic cotton and conventional counterparts. However, few studies have focused on the different responses of transgenic cotton to stress conditions, especially to the challenges of pathogens. The aim of this work is to determine the extent of variation in physiological characteristics between transgenic insect-resistant cotton and the conventional counterpart infected by cotton soil-borne pathogens. The results showed that the difference in genetic backgrounds is the main factor responsible for the effects on biochemical characteristics of transgenic cotton when incubating with cotton Fusarium oxysporum. However, genetic modification had a significantly greater influence on the stomatal structure of transgenic cotton than the effects of cotton genotypes. Our results highlight that the differences in genetic background and/or genetic modifications may introduce variations in physiological characteristics and should be considered to explore the potential unexpected ecological effects of transgenic cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... more pounds per cubic foot. Contamination (contaminate). Containing or bearing whole cottonseed or seed... construed accordingly.) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton... cotton, grains (including grain products), field seeds, agricultural roots, rhizomes, tubers, or other...
Code of Federal Regulations, 2012 CFR
2012-01-01
... more pounds per cubic foot. Contamination (contaminate). Containing or bearing whole cottonseed or seed... construed accordingly.) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton... cotton, grains (including grain products), field seeds, agricultural roots, rhizomes, tubers, or other...
Code of Federal Regulations, 2010 CFR
2010-01-01
... more pounds per cubic foot. Contamination (contaminate). Containing or bearing whole cottonseed or seed... construed accordingly.) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton... cotton, grains (including grain products), field seeds, agricultural roots, rhizomes, tubers, or other...
Code of Federal Regulations, 2013 CFR
2013-01-01
... more pounds per cubic foot. Contamination (contaminate). Containing or bearing whole cottonseed or seed... construed accordingly.) Cotton. Parts and products of plants of the genus Gossypium, including seed cotton... cotton, grains (including grain products), field seeds, agricultural roots, rhizomes, tubers, or other...
Optimal Cotton Insecticide Application Termination Timing: A Meta-Analysis.
Griffin, T W; Zapata, S D
2016-08-01
The concept of insecticide termination timing is generally accepted among cotton (Gossypium hirsutum) researchers; however, exact timings are often disputed. Specifically, there is uncertainty regarding the last economic insecticide application to control fruit-feeding pests including tarnished plant bug (Lygus lineolaris (Palisot de Beauvois)), boll weevil (Anthonomus grandis), bollworm (Helicoverpa zea), tobacco budworm (Heliothis virescens), and cotton fleahopper (Pseudatomoscelis seriatus). A systematic review of prior studies was conducted within a meta-analytic framework. Nine publicly available articles were amalgamated to develop an optimal timing principle. These prior studies reported 53 independent multiple means comparison field experiments for a total of 247 trial observations. Stochastic plateau theory integrated with econometric meta-analysis methodology was applied to the meta-database to determine the shape of the functional form of both the agronomic optimal insecticide termination timing and corresponding yield potential. Results indicated that current university insecticide termination timing recommendations are later than overall estimated timing suggested. The estimated 159 heat units (HU) after the fifth position above white flower (NAWF5) was found to be statistically different than the 194 HU termination used as the status quo recommended termination timing. Insecticides applied after 159 HU may have been applied in excess, resulting in unnecessary economic and environmental costs. Empirical results also suggested that extending the insecticide termination time by one unit resulted in a cotton lint yield increase of 0.27 kilograms per hectare up to the timing where the plateau began. Based on economic analyses, profit-maximizing producers may cease application as soon as 124 HU after NAWF5. These results provided insights useful to improve production systems by applying inputs only when benefits were expected to be in excess of the
Guo, Danli; Li, Chao; Dong, Rui; Li, Xiaobo; Xiao, Xiangwen; Huang, Xianzhong
2015-06-01
FLOWERING LOCUS T (FT) encodes a member of the phosphatidylethanolamine-binding protein (PEBP) family that functions as the mobile floral signal, playing an important role in regulating the floral transition in angiosperms. We isolated an FT-homolog (GhFT1) from Gossypium hirsutum L. cultivar, Xinluzao 33 GhFT1 was predominantly expressed in stamens and sepals, and had a relatively higher expression level during the initiation stage of fiber development. GhFT1 mRNA displayed diurnal oscillations in both long-day and short-day condition, suggesting that the expression of this gene may be under the control of the circadian clock. Subcellular analysis revealed that GhFT1 protein located in the cytoplasm and nucleus. Ectopic expression of GhFT1 in transgenic arabidopsis plants resulted in early flowering compared with wild-type plants. In addition, ectopic expression of GhFT1 in arabidopsis ft-10 mutants partially rescued the extremely late flowering phenotype. Finally, several flowering related genes functioning downstream of AtFT were highly upregulated in the 35S::GhFT1 transgenic arabidopsis plants. In summary, GhFT1 is an FT-homologous gene in cotton that regulates flower transition similar to its orthologs in other plant species and thus it may be a candidate target for promoting early maturation in cotton breeding. © 2014 Institute of Botany, Chinese Academy of Sciences.
USDA-ARS?s Scientific Manuscript database
In 1999 crop consultants scouting for stink bugs (several Hemiptera spp.) in South Carolina discovered a formerly unobserved seed rot of cotton that caused yield losses ranging from 10 to 15% in certain fields. The same symptoms were subsequently reported in fields throughout the southeastern Cotto...
Gene-specific changes in alpha-tubulin transcript accumulation in developing cotton fibers.
Whittaker, D J; Triplett, B A
1999-09-01
The fibers of cotton (Gossypium hirsutum) are single-cell trichomes that undergo rapid and synchronous elongation. Cortical microtubules provide spatial information necessary for the alignment of cellulose microfibrils that confine and regulate cell elongation. We used gene-specific probes to investigate alpha-tubulin transcript levels in elongating cotton fibers. Two discrete patterns of transcript accumulation were observed. Whereas transcripts of alpha-tubulin genes GhTua2/3 and GhTua4 increased in abundance from 10 to 20 d post anthesis (DPA), GhTua1 and GhTua5 transcripts were abundant only through to 14 DPA, and dropped significantly at 16 DPA with the onset of secondary wall synthesis. This is the first report, to our knowledge, of gene-specific changes in tubulin transcript levels during the development of a terminally differentiated plant cell. The decrease in abundance of GhTua1 and GhTua5 transcripts was correlated with pronounced changes in cell wall structure, suggesting that alpha-tubulin isoforms may be functionally distinct in elongating fiber cells. Although total alpha-tubulin transcript levels were much higher in fiber than several other tissues, including the hypocotyl and pollen, none of the alpha-tubulins was specific to fiber cells.
de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio
2017-03-01
Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum
Castillo Lopez, Diana; Zhu-Salzman, Keyan; Ek-Ramos, Maria Julissa; Sword, Gregory A.
2014-01-01
The effects of two entomopathogenic fungal endophytes, Beauveria bassiana and Purpureocillium lilacinum (formerly Paecilomyces lilacinus), were assessed on the reproduction of cotton aphid, Aphis gossypii Glover (Homoptera:Aphididae), through in planta feeding trials. In replicate greenhouse and field trials, cotton plants (Gossypium hirsutum) were inoculated as seed treatments with two concentrations of B. bassiana or P. lilacinum conidia. Positive colonization of cotton by the endophytes was confirmed through potato dextrose agar (PDA) media plating and PCR analysis. Inoculation and colonization of cotton by either B. bassiana or P. lilacinum negatively affected aphid reproduction over periods of seven and 14 days in a series of greenhouse trials. Field trials were conducted in the summers of 2012 and 2013 in which cotton plants inoculated as seed treatments with B. bassiana and P. lilacinum were exposed to cotton aphids for 14 days. There was a significant overall effect of endophyte treatment on the number of cotton aphids per plant. Plants inoculated with B. bassiana had significantly lower numbers of aphids across both years. The number of aphids on plants inoculated with P. lilacinum exhibited a similar, but non-significant, reduction in numbers relative to control plants. We also tested the pathogenicity of both P. lilacinum and B. bassiana strains used in the experiments against cotton aphids in a survival experiment where 60% and 57% of treated aphids, respectively, died from infection over seven days versus 10% mortality among control insects. Our results demonstrate (i) the successful establishment of P. lilacinum and B. bassiana as endophytes in cotton via seed inoculation, (ii) subsequent negative effects of the presence of both target endophytes on cotton aphid reproduction using whole plant assays, and (iii) that the P. lilacinum strain used is both endophytic and pathogenic to cotton aphids. Our results illustrate the potential of using these
Castillo Lopez, Diana; Zhu-Salzman, Keyan; Ek-Ramos, Maria Julissa; Sword, Gregory A
2014-01-01
The effects of two entomopathogenic fungal endophytes, Beauveria bassiana and Purpureocillium lilacinum (formerly Paecilomyces lilacinus), were assessed on the reproduction of cotton aphid, Aphis gossypii Glover (Homoptera:Aphididae), through in planta feeding trials. In replicate greenhouse and field trials, cotton plants (Gossypium hirsutum) were inoculated as seed treatments with two concentrations of B. bassiana or P. lilacinum conidia. Positive colonization of cotton by the endophytes was confirmed through potato dextrose agar (PDA) media plating and PCR analysis. Inoculation and colonization of cotton by either B. bassiana or P. lilacinum negatively affected aphid reproduction over periods of seven and 14 days in a series of greenhouse trials. Field trials were conducted in the summers of 2012 and 2013 in which cotton plants inoculated as seed treatments with B. bassiana and P. lilacinum were exposed to cotton aphids for 14 days. There was a significant overall effect of endophyte treatment on the number of cotton aphids per plant. Plants inoculated with B. bassiana had significantly lower numbers of aphids across both years. The number of aphids on plants inoculated with P. lilacinum exhibited a similar, but non-significant, reduction in numbers relative to control plants. We also tested the pathogenicity of both P. lilacinum and B. bassiana strains used in the experiments against cotton aphids in a survival experiment where 60% and 57% of treated aphids, respectively, died from infection over seven days versus 10% mortality among control insects. Our results demonstrate (i) the successful establishment of P. lilacinum and B. bassiana as endophytes in cotton via seed inoculation, (ii) subsequent negative effects of the presence of both target endophytes on cotton aphid reproduction using whole plant assays, and (iii) that the P. lilacinum strain used is both endophytic and pathogenic to cotton aphids. Our results illustrate the potential of using these
USDA-ARS?s Scientific Manuscript database
An ontogenetic study of a commercial cotton cultivar (FiberMax 1320), grown dryland, revealed that the dry weight (DW) of leaves reached a maximum at the 1st flower stage, and then declined as bolls opened. However, % pentane soluble hydrocarbon (HC) yield continued to increase throughout the growi...
Armstrong, J Scott; Brewer, Michael J; Parker, Roy D; Adamczyk, J J
2013-02-01
The verde plant bug, Creontiades signatus (Distant), has been present in south Texas for several years but has more recently been documented as an economic threat to cultivated cotton, (Gossypium hirsutum L. Our studies over 2 yr (2009 and 2010) and two locations (Weslaco and Corpus Christi, TX) investigated feeding-injury of the verde plant bug to a range of cotton boll age classes defined by boll diameter and accumulated degree-days (anthesis to the time of infesting) for first-position cotton bolls infested with the plant bugs. The most detrimental damage to younger cotton holls from verde plant bug feeding was boll abscission. Cotton bolls <04 accumulating daily degree-days (ACDD), or a boll diameter of 1.3 cm were subject to 60-70% higher boll abscission when compared with the noninfested controls. Significantly higher boll abscission occurred from verde plant bug injured bolls compared with the controls up to 162 ACDD or a mean boll diameter 2.0 cm. Cotton seed weights were significantly reduced up to 179 ACDD or a boll diameter of 2.0 cm at Weslaco in 2009, and up to 317 ACDD or boll diameter 2.6 cm for Weslaco in 2010 when compared with the noninfested controls. Lint weight per cotton boll for infested and noninfested bolls was significantly reduced up to 262 ACDD or boll diameter 2.5 for Corpus Christi in 2010 and up to 288 ACCD or boll diameter 2.6 cm for Weslaco, TX, in 2010. Damage ratings (dependant variable) regressed against infested and noninfested seed-cotton weights showed that in every instance, the infested cotton bolls had a strong and significant relationship with damage ratings for all age classes of bolls. Damage ratings for the infested cotton bolls that did not abscise by harvest showed visual signs of verde plant bug feeding injury and the subsequent development ofboll rot; however, these two forms of injury causing lint and seed mass loss are hard to differentiate from open or boll-locked cotton bolls. Based on the results of both lint
Chen, Zongkui; Tao, Xianping; Khan, Aziz; Tan, Daniel K. Y.; Luo, Honghai
2018-01-01
Limitations of soil water and nitrogen (N) are factors which cause a substantial reduction in cotton (Gossypium hirsutum L.) yield, especially in an arid environment. Suitable management decisions like irrigation method and nitrogen fertilization are the key yield improvement technologies in cotton production systems. Therefore, we hypothesized that optimal water-N supply can increase cotton plant biomass accumulation by maintaining leaf photosynthetic capacity and improving root growth. An outdoor polyvinyl chloride (PVC) tube study was conducted to investigate the effects of two water-N application depths, i.e., 20 cm (H20) or 40 cm (H40) from soil surface and four water-N combinations [deficit irrigation (W55) and no N (N0) (W55N0), W55 and moderate N (N1) (W55N1), moderate irrigation (W75) and N0 (W75N0), W75N1] on the roots growth, leaf photosynthetic traits and dry mass accumulation of cotton crops. H20W55N1 combination increased total dry mass production by 29–82% and reproductive organs biomass by 47–101% compared with other counterparts. Root protective enzyme and nitrate reductase (NR) activity, potential quantum yield of photosystem (PS) II (Fv/Fm), PSII quantum yield in the light [Y(II)] and electron transport rate of PSII were significantly higher in H20W55N1 prior to 82 days after emergence. Root NR activity and protective enzyme were significantly correlated with chlorophyll, Fv/Fm, Y(II) and stomatal conductance. Hence, shallow irrigation (20 cm) with moderate irrigation and N-fertilization application could increase cotton root NR activity and protective enzyme leading to enhance light capture and photochemical energy conversion of PSII before the full flowering stage. This enhanced photoassimilate to reproductive organs. PMID:29497435
USDA-ARS?s Scientific Manuscript database
The yellowstriped armyworm (YSAW), Spodoptera ornithogalli (Guenée), has a broad host range and can be an economic threat to cotton in southern growing regions of the United States by consuming leaves and damaging fruiting forms. Field grown cotton varieties containing the endotoxins from Bacillus t...
Causarano, H J; Franzluebbers, A J; Reeves, D W; Shaw, J N
2006-01-01
Past agricultural management practices have contributed to the loss of soil organic carbon (SOC) and emission of greenhouse gases (e.g., carbon dioxide and nitrous oxide). Fortunately, however, conservation-oriented agricultural management systems can be, and have been, developed to sequester SOC, improve soil quality, and increase crop productivity. Our objectives were to (i) review literature related to SOC sequestration in cotton (Gossypium hirsutum L.) production systems, (ii) recommend best management practices to sequester SOC, and (iii) outline the current political scenario and future probabilities for cotton producers to benefit from SOC sequestration. From a review of 20 studies in the region, SOC increased with no tillage compared with conventional tillage by 0.48 +/- 0.56 Mg C ha(-1) yr(-1) (H(0): no change, p < 0.001). More diverse rotations of cotton with high-residue-producing crops such as corn (Zea mays L.) and small grains would sequester greater quantities of SOC than continuous cotton. No-tillage cropping with a cover crop sequestered 0.67 +/- 0.63 Mg C ha(-1) yr(-1), while that of no-tillage cropping without a cover crop sequestered 0.34 +/- 47 Mg C ha(-1) yr(-1) (mean comparison, p = 0.04). Current government incentive programs recommend agricultural practices that would contribute to SOC sequestration. Participation in the Conservation Security Program could lead to government payments of up to Dollars 20 ha(-1). Current open-market trading of C credits would appear to yield less than Dollars 3 ha(-1), although prices would greatly increase should a government policy to limit greenhouse gas emissions be mandated.
Khan, Zainul A; Abdin, Malik Z; Khan, Jawaid A
2015-01-01
Cotton leaf curl Burewala virus (CLCuBuV), belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP) genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV) were fused with β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi) leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum) plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.
Diversity and genetic structure among subpopulations of Gossypium mustelinum (Malvaceae).
Alves, M F; Barroso, P A V; Ciampi, A Y; Hoffmann, L V; Azevedo, V C R; Cavalcante, U
2013-02-27
Gossypium mustelinum is the only cotton species native to Brazil; it is endemic to the semi-arid region of the northeast. The populations are found near perennial and semi-perennial sources of water, such as ponds or pools in intermittent streams. Problems with in situ conservation derive from human interference in its habitat, mainly because of excessive cattle grazing and deforestation. Establishing efficient strategies for in situ conservation requires knowledge of the genetic structure of the populations. We evaluated the structure and genetic variability of populations of G. mustelinum in the Tocó and Capivara Rivers (State of Bahia). Two hundred and eighteen mature G. mustelinum plants were genotyped with SSR markers. The molecular data were used to estimate the allelic frequencies, the heterozygosity, the F statistics, and the genetic distance among the populations and among individuals. We found high genetic diversity among the populations. The FST indexes for each population were also high and strongly correlated with physical distance. The high estimated level of endogamy and the low observed heterozygosity are indicative that the populations reproduce mainly by self-fertilization and crosses between related individuals. Consequently, strategies for in situ preservation should include at least three occurrence sites of G. mustelinum from each population. For ex situ conservation, the collections should include as many sites as possible.
de Menezes, I P P; Hoffmann, L V; de Lima, T H; da Silva, A R; Lucena, V S; Barroso, P A V
2017-09-27
Mocó cotton belong to the same species as the cultivated species, Gossypium hirsutum, and cultivated forms were mainly landraces but also developed as cultivars, bearing good fiber quality and drought tolerant when cropped as a perennial species. The northeast Brazil crop system based on this cotton type is finished, with a few small area planted in the three main States, where it was previously cultivated (Ceará, Paraíba, and Rio Grande do Norte), but in others, maintenance is accomplished by single dooryard plants. Plants were found in all visited Northeast Brazil municipalities, sometimes in the North of the country, and were collected for ex situ preservation and evaluation. Most of seeds had no fuzz (62.2%) and 94.6% of the genotypes presented spot in flowers. Seventy-one alleles were revealed in 12 loci. The genetic structure of the population evaluated by microsatellite markers shows two main groups, one comprising the Seridó region where landraces were originated and other comprising the state of Ceará, where a specific breeding program was developed. Genotypes collected in North Brazil States as well as those collected in Bahia, Alagoas, and Sergipe grouped with those collected in Ceará. The Mantel correlogram indicates a significant (P < 0.05) correlation between genetic and geographical distances up to 77 km. The ex situ maintenance and agronomical evaluation are the main concerns for mocó, as the use of the agricultural interesting traits, possibly introgressed to other genotypes, is predicted. The in situ preservation is still of interest since there is more diversity there than in the collected plants and some should be continued due to use as medicinal plant.
Guo, Yulong; Zhu, Qinlong; Zheng, Shangyong; Li, Mingyang
2007-06-01
A MADS box gene (GhMADS3) was cloned from cotton (Gossypium hirsutum L.) based on EST sequences. The predicted protein sequence of GhMADS3 showed 85%, 73%, and 62% identity with Theobroma cacao TcAG, Antirrhinum majus FAR, and Arabidopsis thaliana AG, respectively, and was grouped with AG homologues when the full length sequences excluding N-extensions were compared. GhMADS3 expressed in the wild type cotton flower primarily in stamens and carpels, which was comparable to AG in Arabidopsis. However, it was not expressed in floral buds of a homeotic cotton variant chv1. Ectopic expression of GhMADS3 in tobacco (Nicotiana tabacum L.) resulted in flowers with sepal-to-carpel and petal-to-stamen transformation. The carpelloid first whorl organs, with stigmatic tissue on their upper edges, had a white appearance when compared with the dark green color of the wild type sepals. At times, long filaments were observed at the fusion site of the first carpelloid oranges. The second whorl organs in staminoid were usually smaller than the wild type and the color was changed from pink to white. These results suggest that GhMADS3 has a homeotic role in flower development.
Naoumkina, Marina; Bechere, Efrem; Fang, David D; Thyssen, Gregory N; Florane, Christopher B
2017-07-01
In this work we describe a chemically-induced short fiber mutant cotton line, Ligon-lintless-y (li y ), which is controlled by a single recessive locus and affects multiple traits, including height of the plant, and length and maturity of fiber. An RNAseq analysis was used to evaluate global transcriptional changes during cotton fiber development at 3, 8 and 16days post anthesis. We found that 613, 2629 and 3397 genes were significantly down-regulated, while 2700, 477 and 3260 were significantly up-regulated in li y at 3, 8 and 16 DPA. Gene set enrichment analysis revealed that many metabolic pathways, including carbohydrate, cell wall, hormone metabolism and transport were substantially altered in li y developing fibers. We discuss perturbed expression of genes involved in signal transduction and biosynthesis of phytohormones, such as auxin, abscisic acid, gibberellin and ethylene. The results of this study provide new insights into transcriptional regulation of cotton fiber development. Published by Elsevier Inc.
Tang, Kai; Liu, Jin-Yuan
2017-01-01
Phospholipase D (PLD) hydrolyzes phospholipids to generate a free polar head group (e.g., choline) and a second messenger phosphatidic acid and plays diverse roles in plant growth and development, including seed germination, leaf senescence, root hair growth, and hypocotyl elongation. However, the function of PLD in cotton remains largely unexplored. Here, the comprehensive molecular characterization of GhPLDα1 was explored with its role in upland cotton (Gossypium hirsutum) fiber development. The GhPLDα1 gene was cloned successfully, and a sequence alignment showed that GhPLDα1 contains one C2 domain and two HKD (HxKxxxxD) domains. Quantitative reverse transcriptase-polymerase chain reaction measured the expression of GhPLDα1 in various cotton tissues with the highest level in fibers at 20 days post anthesis (d.p.a.). Fluorescent microscopy and immunoblotting in tobacco epidermis showed the GhPLDα1 distribution in both cell membranes and the cytoplasm. An activity assay indicated changes in PLDα enzyme activity in developing fiber cells with a peak level at 20 d.p.a., coinciding with the onset of cellulose accumulation and the increased H 2 O 2 content during fiber development. Furthermore, the inhibition of PLDα activity obviously decreased the cellulose and H 2 O 2 contents of in vitro-cultured cotton fibers. These results provide important evidence explaining the relationship of GhPLDα1 with secondary cell wall thickening in cotton fibers in that GhPLDα1 may correlate with the increased H 2 O 2 content at the onset of secondary cell wall thickening, ultimately promoting cellulose biosynthesis. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Brill, Elizabeth; van Thournout, Michel; White, Rosemary G.; Llewellyn, Danny; Campbell, Peter M.; Engelen, Steven; Ruan, Yong-Ling; Arioli, Tony; Furbank, Robert T.
2011-01-01
Sucrose (Suc) synthase (Sus) is the major enzyme of Suc breakdown for cellulose biosynthesis in cotton (Gossypium hirsutum) fiber, an important source of fiber for the textile industry. This study examines the tissue-specific expression, relative abundance, and temporal expression of various Sus transcripts and proteins present in cotton. A novel isoform of Sus (SusC) is identified that is expressed at high levels during secondary cell wall synthesis in fiber and is present in the cell wall fraction. The phylogenetic relationships of the deduced amino acid sequences indicate two ancestral groups of Sus proteins predating the divergence of monocots and dicots and that SusC sequences form a distinct branch in the phylogeny within the dicot-specific clade. The subcellular location of the Sus isoforms is determined, and it is proposed that cell wall-localized SusC may provide UDP-glucose for cellulose and callose synthesis from extracellular sugars. PMID:21757635
Kim, Hee Jin; Hinchliffe, Doug J.; Triplett, Barbara A.; Chen, Z. Jeffrey; Stelly, David M.; Yeater, Kathleen M.; Moon, Hong S.; Gilbert, Matthew K.; Thyssen, Gregory N.; Turley, Rickie B.; Fang, David D.
2015-01-01
The number of cotton (Gossypium sp.) ovule epidermal cells differentiating into fiber initials is an important factor affecting cotton yield and fiber quality. Despite extensive efforts in determining the molecular mechanisms regulating fiber initial differentiation, only a few genes responsible for fiber initial differentiation have been discovered. To identify putative genes directly involved in the fiber initiation process, we used a cotton ovule culture technique that controls the timing of fiber initial differentiation by exogenous phytohormone application in combination with comparative expression analyses between wild type and three fiberless mutants. The addition of exogenous auxin and gibberellins to pre-anthesis wild type ovules that did not have visible fiber initials increased the expression of genes affecting auxin, ethylene, ABA and jasmonic acid signaling pathways within 1 h after treatment. Most transcripts expressed differentially by the phytohormone treatment in vitro were also differentially expressed in the ovules of wild type and fiberless mutants that were grown in planta. In addition to MYB25-like, a gene that was previously shown to be associated with the differentiation of fiber initials, several other differentially expressed genes, including auxin/indole-3-acetic acid (AUX/IAA) involved in auxin signaling, ACC oxidase involved in ethylene biosynthesis, and abscisic acid (ABA) 8'-hydroxylase an enzyme that controls the rate of ABA catabolism, were co-regulated in the pre-anthesis ovules of both wild type and fiberless mutants. These results support the hypothesis that phytohormonal signaling networks regulate the temporal expression of genes responsible for differentiation of cotton fiber initials in vitro and in planta. PMID:25927364
Zahoor, Rizwan; Zhao, Wenqing; Abid, Muhammad; Dong, Haoran; Zhou, Zhiguo
2017-08-01
To evaluate the role of potassium (K) in maintaining nitrogen metabolism and osmotic adjustment development of cotton functional leaves to sustain growth under soil drought and rewatering conditions, the plants of two cotton cultivars Siza 3 (low-K sensitive) and Simian 3 (low-K tolerant), were grown under three different K rates (K0, K1, and K2; 0, 150, and 300kgK 2 Oha -1 , respectively) and exposed to drought stress with 40±5% soil relative water content (SRWC). The drought stress was applied at flowering stage by withholding water for eight days followed by rewatering to a well-watered level (75±5% SRWC). The results showed that drought-stressed plants of both cultivars showed a decrease in leaf relative water content (RWC) and osmotic potential in the functional leaves and developed osmotic adjustment with an increase in the contents of free amino acids, soluble sugars, inorganic K, and nitrate as compared to well-watered plants. In drought-stressed plants, nitrogen-metabolizing enzyme activities of nitrogen reductase (NR), glutamine synthetase (GS), and glutamate synthase (GOGAT) were diminished significantly (P≤0.05) along with decreased chlorophyll content and soluble proteins. However, drought-stressed plants under K application not only exhibited higher osmotic adjustment with greater accumulation of osmolytes but also regulated nitrogen metabolism by maintaining higher enzyme activities, soluble proteins, and chlorophyll content in functional leaves as compared to the plants without K application. Siza 3 showed better stability in enzyme activities and resulted in 89% higher seed cotton yield under K2 as compared to K0 in drought-stressed plants, whereas this increase was 53% in the case of Simian 3. The results of the study suggested that K application enhances cotton plants' potential for sustaining high nitrogen-metabolizing enzyme activities and related components to supplement osmotic adjustment under soil drought conditions. Copyright © 2017
Ruan, Y. L.; Chourey, P. S.; Delmer, D. P.; Perez-Grau, L.
1997-01-01
Developing cotton (Gossypium hirsutum L.) seed exhibits complex patterns of carbon allocation in which incoming sucrose (Suc) is partitioned to three major sinks: the fibers, seed coat, and cotyledons, which synthesize cellulose, starch, and storage proteins or oils, respectively. In this study we investigated the role of Suc synthase (SuSy) in the mobilization of Suc into such sinks. Assessments of SuSy gene expression at various levels led to the surprising conclusion that, in contrast to that found for other plants, SuSy does not appear to play a role in starch synthesis in the cotton seed. However, our demonstration of functional symplastic connections between the phloem-unloading area and the fiber cells, as well as the SuSy expression pattern in fibers, indicates a major role of SuSy in partitioning carbon to fiber cellulose synthesis. SuSy expression is also high in transfer cells of the seed coat facing the cotyledons. Such high levels of SuSy could contribute to the synthesis of the thickened cell walls and to the energy generation for Suc efflux to the seed apoplast. The expression of SuSy in cotyledons also suggests a role in protein and lipid synthesis. In summary, the developing cotton seed provides an excellent example of the diverse roles played by SuSy in carbon metabolism. PMID:12223814
Kuai, Jie; Chen, Yinglong; Wang, Youhua; Meng, Yali; Chen, Binglin; Zhao, Wenqing; Zhou, Zhiguo
2016-01-01
Transient waterlogging occurs frequently in the Yangtze River and adversely affects cotton fiber quality. However, the carbohydrate metabolic mechanism that affects fiber quality after waterlogging remains undescribed. Here, the effects of five waterlogging levels (0, 3, 6, 9, and 12 days) were assessed during flowering and boll formation to characterize the carbohydrates, enzymes and genes that affect the fiber quality of cotton after waterlogging. The cellulose and sucrose contents of cotton fibers were significantly decreased after waterlogging for 6 (WL6), 9 (WL9), and 12 d (WL12), although these properties were unaffected after 3 (WL3) and 6 days at the fruiting branch 14–15 (FB14–15). Sucrose phosphate synthase (SPS) was the most sensitive to waterlogging among the enzymes tested. SPS activity was decreased by waterlogging at FB6–7, whereas it was significantly enhanced under WL3–6 at FB10–15. Waterlogging down-regulated the expression of fiber invertase at 10 days post anthesis (DPA), whereas that of expansin, β-1,4-glucanase and endoxyloglucan transferase (XET) was up-regulated with increasing waterlogging time. Increased mRNA levels and activities of fiber SuSy at each fruiting branch indicated that SuSy was the main enzyme responsible for sucrose degradation because it was markedly induced by waterlogging and was active even when waterlogging was discontinued. We therefore concluded that the reduction in fiber sucrose and down-regulation of invertase at 10 DPA led to a markedly shorter fiber length under conditions WL6–12. Significantly decreased fiber strength at FB6–11 for WL6–12 was the result of the inhibition of cellulose synthesis and the up-regulation of expansin, β-1,4-glucanase and XET, whereas fiber strength increased under WL3–6 at FB14–15 due to the increased cellulose content of the fibers. Most of the indictors tested revealed that WL6 resulted in the best compensatory performance, whereas exposure to waterlogged
NASA Astrophysics Data System (ADS)
Walke, N.; Obi Reddy, G. P.; Maji, A. K.; Thayalan, S.
2012-04-01
In this study an attempt was made to characterize the soils of the Ringanbodi watershed, Nagpur district, Maharashtra, Central India, for soil-suitability evaluation for cotton using geographic information system (GIS)-based multicriteria overlay analysis techniques. The study shows that 8 soil series and 16 soil series associations in the study area and soils were classified into three orders, i.e., Entisol, Inceptisol, and Vertisol. The analysis reveals that the soil associations E-F, F-G, G-H, and H-G are "moderately suitable" (S2), D-E are "marginally to moderately suitable," and C-D are marginally (S3) suitable. However, soils B-C are "not suitable" to "marginally suitable" (N2-S3) and A-B are "unsuitable" (N2) for cultivation of cotton. The area analysis shows that for a cotton crop an area about 966.7 ha (49.1%) of TGA is moderately suitable and classified as S2. An area about 469.9 ha (23.8%) of TGA is marginal to moderately suitable (S3-S2). The marginally suitable soils for cotton are classified as S3 and cover an area about 35.2 ha (1.8%) of TGA. However, a 172.3 ha (8.7%) area is not suitable (N2) to marginally suitable (S3) and a 326.9 (16.6%) area is not suitable (N2) for cotton because of uncorrectable factors like soil depth, slope, etc. The study demonstrated that GIS-based multicriteria overlay analysis of soil thematic parameters will be of immense help in soil-suitability evaluation for cotton.
Pang, Jinhuan; Zhu, Yue; Li, Qing; Liu, Jinzhi; Tian, Yingchuan; Liu, Yule; Wu, Jiahe
2013-01-01
Gossypium barbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species). These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G . barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G . barbadense . In this study, we had successfully introduced a virus-induced gene silencing (VIGS) system into three cultivars of G . barbadense by inserting marker genes into the tobacco rattle virus (TRV) vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G . barbadense . The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G . barbadense , and help to contribute desirable traits for breeding of G . barbadense and G. hirsutum. PMID:24023833
Cotton fiber tips have diverse morphologies and show evidence of apical cell wall synthesis
Stiff , Michael R.; Haigler, Candace H.
2016-01-01
Cotton fibers arise through highly anisotropic expansion of a single seed epidermal cell. We obtained evidence that apical cell wall synthesis occurs through examining the tips of young elongating Gossypium hirsutum (Gh) and G. barbadense (Gb) fibers. We characterized two tip types in Gh fiber (hemisphere and tapered), each with distinct apical diameter, central vacuole location, and distribution of cell wall components. The apex of Gh hemisphere tips was enriched in homogalacturonan epitopes, including a relatively high methyl-esterified form associated with cell wall pliability. Other wall components increased behind the apex including cellulose and the α-Fuc-(1,2)-β-Gal epitope predominantly found in xyloglucan. Gb fibers had only one narrow tip type featuring characters found in each Gh tip type. Pulse-labeling of cell wall glucans indicated wall synthesis at the apex of both Gh tip types and in distal zones. Living Gh hemisphere and Gb tips ruptured preferentially at the apex upon treatment with wall degrading enzymes, consistent with newly synthesized wall at the apex. Gh tapered tips ruptured either at the apex or distantly. Overall, the results reveal diverse cotton fiber tip morphologies and support primary wall synthesis occurring at the apex and discrete distal regions of the tip. PMID:27301434