ArcS, the cognate sensor kinase in an atypical Arc system of Shewanella oneidensis MR-1.

PubMed

Lassak, Jürgen; Henche, Anna-Lena; Binnenkade, Lucas; Thormann, Kai M

2010-05-01

The availability of oxygen is a major environmental factor for many microbes, in particular for bacteria such as Shewanella species, which thrive in redox-stratified environments. One of the best-studied systems involved in mediating the response to changes in environmental oxygen levels is the Arc two-component system of Escherichia coli, consisting of the sensor kinase ArcB and the cognate response regulator ArcA. An ArcA ortholog was previously identified in Shewanella, and as in Escherichia coli, Shewanella ArcA is involved in regulating the response to shifts in oxygen levels. Here, we identified the hybrid sensor kinase SO_0577, now designated ArcS, as the previously elusive cognate sensor kinase of the Arc system in Shewanella oneidensis MR-1. Phenotypic mutant characterization, transcriptomic analysis, protein-protein interaction, and phosphotransfer studies revealed that the Shewanella Arc system consists of the sensor kinase ArcS, the single phosphotransfer domain protein HptA, and the response regulator ArcA. Phylogenetic analyses suggest that HptA might be a relict of ArcB. Conversely, ArcS is substantially different with respect to overall sequence homologies and domain organizations. Thus, we speculate that ArcS might have adopted the role of ArcB after a loss of the original sensor kinase, perhaps as a consequence of regulatory adaptation to a redox-stratified environment.

Whole genome sequence to decipher the resistome of Shewanella algae, a multidrug-resistant bacterium responsible for pneumonia, Marseille, France.

PubMed

Cimmino, Teresa; Olaitan, Abiola Olumuyiwa; Rolain, Jean-Marc

2016-01-01

We characterize and decipher the resistome and the virulence factors of Shewanella algae MARS 14, a multidrug-resistant clinical strain using the whole genome sequencing (WGS) strategy. The bacteria were isolated from the bronchoalveolar lavage of a hospitalized patient in the Timone Hospital in Marseille, France who developed pneumonia after plunging into the Mediterranean Sea. The genome size of S. algae MARS 14 was 5,005,710 bp with 52.8% guanine cytosine content. The resistome includes members of class C and D beta-lactamases and numerous multidrug-efflux pumps. We also found the presence of several hemolysins genes, a complete flagellum system gene cluster and genes responsible for biofilm formation. Moreover, we reported for the first time in a clinical strain of Shewanella spp. the presence of a bacteriocin (marinocin). The WGS analysis of this pathogen provides insight into its virulence factors and resistance to antibiotics.

Identification of Shewanella baltica as the most important H2S-producing species during iced storage of Danish marine fish.

PubMed

Fonnesbech Vogel, Birte; Venkateswaran, Kasthuri; Satomi, Masataka; Gram, Lone

2005-11-01

Shewanella putrefaciens has been considered the main spoilage bacteria of low-temperature stored marine seafood. However, psychrotropic Shewanella have been reclassified during recent years, and the purpose of the present study was to determine whether any of the new Shewanella species are important in fish spoilage. More than 500 H2S-producing strains were isolated from iced stored marine fish (cod, plaice, and flounder) caught in the Baltic Sea during winter or summer time. All strains were identified as Shewanella species by phenotypic tests. Different Shewanella species were present on newly caught fish. During the warm summer months the mesophilic human pathogenic S. algae dominated the H2S-producing bacterial population. After iced storage, a shift in the Shewanella species was found, and most of the H2S-producing strains were identified as S. baltica. The 16S rRNA gene sequence analysis confirmed the identification of these two major groups. Several isolates could only be identified to the genus Shewanella level and were separated into two subgroups with low (44%) and high (47%) G+C mol%. The low G+C% group was isolated during winter months, whereas the high G+C% group was isolated on fish caught during summer and only during the first few days of iced storage. Phenotypically, these strains were different from the type strains of S. putrefaciens, S. oneidensis, S. colwelliana, and S. affinis, but the high G+C% group clustered close to S. colwelliana by 16S rRNA gene sequence comparison. The low G+C% group may constitute a new species. S. baltica, and the low G+C% group of Shewanella spp. strains grew well in cod juice at 0 degrees C, but three high G+C Shewanella spp. were unable to grow at 0 degrees C. In conclusion, the spoilage reactions of iced Danish marine fish remain unchanged (i.e., trimethylamine-N-oxide reduction and H2S production); however, the main H2S-producing organism was identified as S. baltica.

Genome Sequences of Shewanella baltica and Shewanella morhuae Strains Isolated from the Gastrointestinal Tract of Freshwater Fish.

PubMed

Castillo, Daniel; Gram, Lone; Dailey, Frank E

2018-06-21

We present here the genome sequences of Shewanella baltica strain CW2 and Shewanella morhuae strain CW7, isolated from the gastrointestinal tract of Salvelinus namaycush (lean lake trout) and Coregonus clupeaformis (whitefish), respectively. These genome sequences provide insights into the niche adaptation of these specific species in freshwater systems. Copyright © 2018 Castillo et al.

Stress induction in the bacteria Shewanella oneidensis and Deinococcus radiodurans in response to below-background ionizing radiation.

PubMed

Castillo, Hugo; Schoderbek, Donald; Dulal, Santosh; Escobar, Gabriela; Wood, Jeffrey; Nelson, Roger; Smith, Geoffrey

2015-01-01

The 'Linear no-threshold' (LNT) model predicts that any amount of radiation increases the risk of organisms to accumulate negative effects. Several studies at below background radiation levels (4.5-11.4 nGy h(-1)) show decreased growth rates and an increased susceptibility to oxidative stress. The purpose of our study is to obtain molecular evidence of a stress response in Shewanella oneidensis and Deinococcus radiodurans grown at a gamma dose rate of 0.16 nGy h(-1), about 400 times less than normal background radiation. Bacteria cultures were grown at a dose rate of 0.16 or 71.3 nGy h(-1) gamma irradiation. Total RNA was extracted from samples at early-exponential and stationary phases for the rt-PCR relative quantification (radiation-deprived treatment/background radiation control) of the stress-related genes katB (catalase), recA (recombinase), oxyR (oxidative stress transcriptional regulator), lexA (SOS regulon transcriptional repressor), dnaK (heat shock protein 70) and SOA0154 (putative heavy metal efflux pump). Deprivation of normal levels of radiation caused a reduction in growth of both bacterial species, accompanied by the upregulation of katB, recA, SOA0154 genes in S. oneidensis and the upregulation of dnaK in D. radiodurans. When cells were returned to background radiation levels, growth rates recovered and the stress response dissipated. Our results indicate that below-background levels of radiation inhibited growth and elicited a stress response in two species of bacteria, contrary to the LNT model prediction.

Comparative Genomics Analysis and Phenotypic Characterization of Shewanella putrefaciens W3-18-1: Anaerobic Respiration, Bacterial Microcompartments, and Lateral Flagella

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, D.; Tu, Q.; He, Zhili

2010-05-17

Respiratory versatility and psychrophily are the hallmarks of Shewanella. The ability to utilize a wide range of electron acceptors for respiration is due to the large number of c-type cytochrome genes present in the genome of Shewanella strains. More recently the dissimilatory metal reduction of Shewanella species has been extensively and intensively studied for potential applications in the bioremediation of radioactive wastes of groundwater and subsurface environments. Multiple Shewanella genome sequences are now available in the public databases (Fredrickson et al., 2008). Most of the sequenced Shewanella strains were isolated from marine environments and this genus was believed to bemore » of marine origin (Hau and Gralnick, 2007). However, the well-characterized model strain, S. oneidensis MR-1, was isolated from the freshwater lake sediment of Lake Oneida, New York (Myers and Nealson, 1988) and similar bacteria have also been isolated from other freshwater environments (Venkateswaran et al., 1999). Here we comparatively analyzed the genome sequence and physiological characteristics of S. putrefaciens W3-18-1 and S. oneidensis MR-1, isolated from the marine and freshwater lake sediments, respectively. The anaerobic respirations, carbon source utilization, and cell motility have been experimentally investigated. Large scale horizontal gene transfers have been revealed and the genetic divergence between these two strains was considered to be critical to the bacterial adaptation to specific habitats, freshwater or marine sediments.« less

Shewregdb: Database and visualization environment for experimental and predicted regulatory information in Shewanella oneidensis mr-1

PubMed Central

Syed, Mustafa H; Karpinets, Tatiana V; Leuze, Michael R; Kora, Guruprasad H; Romine, Margaret R; Uberbacher, Edward C

2009-01-01

Shewanella oneidensis MR-1 is an important model organism for environmental research as it has an exceptional metabolic and respiratory versatility regulated by a complex regulatory network. We have developed a database to collect experimental and computational data relating to regulation of gene and protein expression, and, a visualization environment that enables integration of these data types. The regulatory information in the database includes predictions of DNA regulator binding sites, sigma factor binding sites, transcription units, operons, promoters, and RNA regulators including non-coding RNAs, riboswitches, and different types of terminators. Availability http://shewanella-knowledgebase.org:8080/Shewanella/gbrowserLanding.jsp PMID:20198195

Genome analysis of a clinical isolate of Shewanella sp. uncovered an active hybrid integrative and conjugative element carrying an integron platform inserted in a novel genomic locus.

PubMed

Parmeciano Di Noto, Gisela; Jara, Eugenio; Iriarte, Andrés; Centrón, Daniela; Quiroga, Cecilia

2016-08-01

Shewanella spp. are currently considered to be emerging pathogens that can code for a blaOXA carbapenemase in their chromosome. Complete genome analysis of the clinical isolate Shewanella sp. Sh95 revealed that this strain is a novel species, which shares a lineage with marine isolates. Characterization of its resistome showed that it codes for genes drfA15, qacH and blaOXA-48. We propose that Shewanella sp. Sh95 acts as reservoir of blaOXA-48. Moreover, analysis of mobilome showed that it contains a novel integrative and conjugative element (ICE), named ICESh95. Comparative analysis between the close relatives ICESpuPO1 from Shewanella sp. W3-18-1 and ICE SXTMO10 from Vibrio cholerae showed that ICESh95 encompassed two new regions, a type III restriction modification system and a multidrug resistance integron. The integron platform contained a novel arrangement formed by gene cassettes drfA15 and qacH, and a class C-attC group II intron. Furthermore, insertion of ICESh95 occurred at a unique target site, which correlated with the presence of a different xis/int module. Mobility of ICESh95 was assessed and demonstrated its ability to self-transfer with high efficiency to different species of bacteria. Our results show that ICESh95 is a self-transmissible, mobile element, which can contribute to the dissemination of antimicrobial resistance; this is clearly a threat when natural bacteria from water ecosystems, such as Shewanella, act as vectors in its propagation.

In Situ Analysis of a Silver Nanoparticle-Precipitating Shewanella Biofilm by Surface Enhanced Confocal Raman Microscopy

PubMed Central

Schkolnik, Gal; Schmidt, Matthias; Mazza, Marco G.; Harnisch, Falk; Musat, Niculina

2015-01-01

Shewanella oneidensis MR-1 is an electroactive bacterium, capable of reducing extracellular insoluble electron acceptors, making it important for both nutrient cycling in nature and microbial electrochemical technologies, such as microbial fuel cells and microbial electrosynthesis. When allowed to anaerobically colonize an Ag/AgCl solid interface, S. oneidensis has precipitated silver nanoparticles (AgNp), thus providing the means for a surface enhanced confocal Raman microscopy (SECRaM) investigation of its biofilm. The result is the in-situ chemical mapping of the biofilm as it developed over time, where the distribution of cytochromes, reduced and oxidized flavins, polysaccharides and phosphate in the undisturbed biofilm is monitored. Utilizing AgNp bio-produced by the bacteria colonizing the Ag/AgCl interface, we could perform SECRaM while avoiding the use of a patterned or roughened support or the introduction of noble metal salts and reducing agents. This new method will allow a spatially and temporally resolved chemical investigation not only of Shewanella biofilms at an insoluble electron acceptor, but also of other noble metal nanoparticle-precipitating bacteria in laboratory cultures or in complex microbial communities in their natural habitats. PMID:26709923

Metabolically engineered glucose-utilizing Shewanella strains under anaerobic conditions.

PubMed

Choi, Donggeon; Lee, Sae Bom; Kim, Sohyun; Min, Byoungnam; Choi, In-Geol; Chang, In Seop

2014-02-01

Comparative genome analysis of Shewanella strains predicted that the strains metabolize preferably two- and three-carbon carbohydrates as carbon/electron source because many Shewanella genomes are deficient of the key enzymes in glycolysis (e.g., glucokinase). In addition, all Shewanella genomes are known to have only one set of genes associated with the phosphotransferase system required to uptake sugars. To engineer Shewanella strains that can utilize five- and six-carbon carbohydrates, we constructed glucose-utilizing Shewanella oneidensis MR-1 by introducing the glucose facilitator (glf; ZMO0366) and glucokinase (glk; ZMO0369) genes of Zymomonas mobilis. The engineered MR-1 strain was able to grow on glucose as a sole carbon/electron source under anaerobic conditions. The glucose affinity (Ks) and glucokinase activity in the engineered MR-1 strain were 299.46 mM and 0.259 ± 0.034 U/g proteins. The engineered strain was successfully applied to a microbial fuel cell system and exhibited current generation using glucose as the electron source. Copyright © 2013 Elsevier Ltd. All rights reserved.

Differentiation of Shewanella putrefaciens and Shewanella alga on the basis of whole-cell protein profiles, ribotyping, phenotypic characterization, and 16S rRNA gene sequence analysis.

PubMed Central

Vogel, B F; Jørgensen, K; Christensen, H; Olsen, J E; Gram, L

1997-01-01

Seventy-six presumed Shewanella putrefaciens isolates from fish, oil drillings, and clinical specimens, the type strain of Shewanella putrefaciens (ATCC 8071), the type strain of Shewanella alga (IAM 14159), and the type strain of Shewanella hanedai (ATCC 33224) were compared by several typing methods. Numerical analysis of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell protein and ribotyping patterns showed that the strains were separated into two distinct clusters with 56% +/- 10% and 40% +/- 14% similarity for whole-cell protein profiling and ribotyping, respectively. One cluster consisted of 26 isolates with 52 to 55 mol% G + C and included 15 human isolates, mostly clinical specimens, 8 isolates from marine waters, and the type strain of S. alga. This homogeneous cluster of mesophilic, halotolerant strains was by all analyses identical to the recently defined species S. alga (U. Simidu et al., Int. J. Syst. Bacteriol, 40:331-336, 1990). Fifty-two typically psychrotolerant strains formed the other, more heterogeneous major cluster, with 43 to 47 mol% G + C. The type strain of S. putrefaciens was included in this group. The two groups were confirmed by 16S rRNA gene sequence analysis. It is concluded that the isolates must be considered two different species, S. alga and S. putrefaciens, and that most mesophilic isolates formerly identified as S. putrefaciens belong to S. alga. The ecological role and potential pathogenicity of S. alga can be evaluated only if the organism is correctly identified. PMID:9172338

Growth of the facultative anaerobe Shewanella putrefaciens by elemental sulfur reduction

NASA Technical Reports Server (NTRS)

Moser, D. P.; Nealson, K. H.

1996-01-01

The growth of bacteria by dissimilatory elemental sulfur reduction is generally associated with obligate anaerobes and thermophiles in particular. Here we describe the sulfur-dependent growth of the facultatively anaerobic mesophile Shewanella putrefaciens. Six of nine representative S. putrefaciens isolates from a variety of environments proved able to grow by sulfur reduction, and strain MR-1 was chosen for further study. Growth was monitored in a minimal medium (usually with 0.05% Casamino Acids added as a growth stimulant) containing 30 mM lactate and limiting concentrations of elemental sulfur. When mechanisms were provided for the removal of the metabolic end product, H2S, measurable growth was obtained at sulfur concentrations of from 2 to 30 mM. Initial doubling times were ca. 1.5 h and substrate independent over the range of sulfur concentrations tested. In the cultures with the highest sulfur concentrations, cell numbers increased by greater than 400-fold after 48 h, reaching a maximum density of 6.8 x 10(8) cells ml-1. Yields were determined as total cell carbon and ranged from 1.7 to 5.9 g of C mol of S(0) consumed-1 in the presence of the amino acid supplement and from 0.9 to 3.4 g of C mol of S(0-1) in its absence. Several lines of evidence indicate that cell-to-sulfur contact is not required for growth. Approaches for the culture of sulfur-metabolizing bacteria and potential ecological implications of sulfur reduction in Shewanella-like heterotrophs are discussed.

Shewanella putrefaciens Adhesion and Biofilm Formation on Food Processing Surfaces

PubMed Central

Bagge, Dorthe; Hjelm, Mette; Johansen, Charlotte; Huber, Ingrid; Gram, Lone

2001-01-01

Laboratory model systems were developed for studying Shewanella putrefaciens adhesion and biofilm formation under batch and flow conditions. S. putrefaciens plays a major role in food spoilage and may cause microbially induced corrosion on steel surfaces. S. putrefaciens bacteria suspended in buffer adhered readily to stainless steel surfaces. Maximum numbers of adherent bacteria per square centimeter were reached in 8 h at 25°C and reflected the cell density in suspension. Numbers of adhering bacteria from a suspension containing 108 CFU/ml were much lower in a laminar flow system (modified Robbins device) (reaching 102 CFU/cm2) than in a batch system (reaching 107 CFU/cm2), and maximum numbers were reached after 24 h. When nutrients were supplied, S. putrefaciens grew in biofilms with layers of bacteria. The rate of biofilm formation and the thickness of the film were not dependent on the availability of carbohydrate (lactate or glucose) or on iron starvation. The number of S. putrefaciens bacteria on the surface was partly influenced by the presence of other bacteria (Pseudomonas fluorescens) which reduced the numbers of S. putrefaciens bacteria in the biofilm. Numbers of bacteria on the surface must be quantified to evaluate the influence of environmental factors on adhesion and biofilm formation. We used a combination of fluorescence microscopy (4′,6′-diamidino-2-phenylindole staining and in situ hybridization, for mixed-culture studies), ultrasonic removal of bacteria from surfaces, and indirect conductometry and found this combination sufficient to quantify bacteria on surfaces. PMID:11319118

Contamination of salmon fillets and processing plants with spoilage bacteria.

PubMed

Møretrø, Trond; Moen, Birgitte; Heir, Even; Hansen, Anlaug Å; Langsrud, Solveig

2016-11-21

The processing environment of salmon processing plants represents a potential major source of bacteria causing spoilage of fresh salmon. In this study, we have identified major contamination routes of important spoilage associated species within the genera Pseudomonas, Shewanella and Photobacterium in pre-rigor processing of salmon. Bacterial counts and culture-independent 16S rRNA gene analysis on salmon fillet from seven processing plants showed higher levels of Pseudomonas spp. and Shewanella spp. in industrially processed fillets compared to salmon processed under strict hygienic conditions. Higher levels of Pseudomonas spp. and Shewanella spp. were found on fillets produced early on the production day compared to later processed fillets. The levels of Photobacterium spp. were not dependent on the processing method or time of processing. In follow-up studies of two plants, bacterial isolates (n=2101) from the in-plant processing environments (sanitized equipment/machines and seawater) and from salmon collected at different sites in the production were identified by partial 16S rRNA gene sequencing. Pseudomonas spp. dominated in equipment/machines after sanitation with 72 and 91% of samples from the two plants being Pseudomonas-positive. The phylogenetic analyses, based on partial 16S rRNA gene sequencing, showed 48 unique sequence profiles of Pseudomonas of which two were dominant. Only six profiles were found on both machines and in fillets in both plants. Shewanella spp. were found on machines after sanitation in the slaughter department while Photobacterium spp. were not detected after sanitation in any parts of the plants. Shewanella spp. and Photobacterium spp. were found on salmon in the slaughter departments. Shewanella was frequently present in seawater tanks used for bleeding/short term storage. In conclusion, this study provides new knowledge on the processing environment as a source of contamination of salmon fillets with Pseudomonas spp. and

Shewanella oneidensis MR-1 nanowires are outer membrane and periplasmic extensions of the extracellular electron transport components

PubMed Central

Pirbadian, Sahand; Barchinger, Sarah E.; Leung, Kar Man; Byun, Hye Suk; Jangir, Yamini; Bouhenni, Rachida A.; Reed, Samantha B.; Romine, Margaret F.; Saffarini, Daad A.; Shi, Liang; Gorby, Yuri A.; Golbeck, John H.; El-Naggar, Mohamed Y.

2014-01-01

Bacterial nanowires offer an extracellular electron transport (EET) pathway for linking the respiratory chain of bacteria to external surfaces, including oxidized metals in the environment and engineered electrodes in renewable energy devices. Despite the global, environmental, and technological consequences of this biotic–abiotic interaction, the composition, physiological relevance, and electron transport mechanisms of bacterial nanowires remain unclear. We report, to our knowledge, the first in vivo observations of the formation and respiratory impact of nanowires in the model metal-reducing microbe Shewanella oneidensis MR-1. Live fluorescence measurements, immunolabeling, and quantitative gene expression analysis point to S. oneidensis MR-1 nanowires as extensions of the outer membrane and periplasm that include the multiheme cytochromes responsible for EET, rather than pilin-based structures as previously thought. These membrane extensions are associated with outer membrane vesicles, structures ubiquitous in Gram-negative bacteria, and are consistent with bacterial nanowires that mediate long-range EET by the previously proposed multistep redox hopping mechanism. Redox-functionalized membrane and vesicular extensions may represent a general microbial strategy for electron transport and energy distribution. PMID:25143589

Shewanella oneidensis MR-1 nanowires are outer membrane and periplasmic extensions of the extracellular electron transport components.

PubMed

Pirbadian, Sahand; Barchinger, Sarah E; Leung, Kar Man; Byun, Hye Suk; Jangir, Yamini; Bouhenni, Rachida A; Reed, Samantha B; Romine, Margaret F; Saffarini, Daad A; Shi, Liang; Gorby, Yuri A; Golbeck, John H; El-Naggar, Mohamed Y

2014-09-02

Bacterial nanowires offer an extracellular electron transport (EET) pathway for linking the respiratory chain of bacteria to external surfaces, including oxidized metals in the environment and engineered electrodes in renewable energy devices. Despite the global, environmental, and technological consequences of this biotic-abiotic interaction, the composition, physiological relevance, and electron transport mechanisms of bacterial nanowires remain unclear. We report, to our knowledge, the first in vivo observations of the formation and respiratory impact of nanowires in the model metal-reducing microbe Shewanella oneidensis MR-1. Live fluorescence measurements, immunolabeling, and quantitative gene expression analysis point to S. oneidensis MR-1 nanowires as extensions of the outer membrane and periplasm that include the multiheme cytochromes responsible for EET, rather than pilin-based structures as previously thought. These membrane extensions are associated with outer membrane vesicles, structures ubiquitous in Gram-negative bacteria, and are consistent with bacterial nanowires that mediate long-range EET by the previously proposed multistep redox hopping mechanism. Redox-functionalized membrane and vesicular extensions may represent a general microbial strategy for electron transport and energy distribution.

Isolation and Physiological Characterization of Psychrophilic Denitrifying Bacteria from Permanently Cold Arctic Fjord Sediments (Svalbard, Norway)

NASA Technical Reports Server (NTRS)

Canion, Andy; Prakash, Om; Green, Stefan J.; Jahnke, Linda; Kuypers, Marcel M. M.; Kostka, Joel E.

2013-01-01

A large proportion of reactive nitrogen loss from polar sediments is mediated by denitrification, but microorganisms mediating denitrification in polar environments remain poorly characterized. A combined approach of most-probable-number (MPN) enumeration, cultivation and physiological characterization was used to describe psychrophilic denitrifying bacterial communities in sediments of three Arctic fjords in Svalbard (Norway). A MPN assay showed the presence of 10(sup 3)-10(sup 6) cells of psychrophilic nitrate-respiring bacteria g(sup -1) of sediment. Fifteen strains within the Proteobacteria were isolated using a systematic enrichment approach with organic acids as electron donors and nitrate as an electron acceptor. Isolates belonged to five genera, including Shewanella, Pseudomonas, Psychromonas (Gammaproteobacteria), Arcobacter (Epsilonproteobacteria) and Herminiimonas (Betaproteobacteria). All isolates were denitrifiers, except Shewanella, which exhibited the capacity for dissimilatory nitrate reduction to ammonium (DNRA). Growth from 0 to 40 degC demonstrated that all genera except Shewanella were psychrophiles with optimal growth below 15 degC, and adaptation to low temperature was demonstrated as a shift from primarily C16:0 saturated fatty acids to C16:1 monounsaturated fatty acids at lower temperatures. This study provides the first targeted enrichment and characterization of psychrophilic denitrifying bacteria from polar sediments, and two genera, Arcobacter and Herminiimonas, are isolated for the first time from permanently cold marine sediments.

Structures, Compositions, and Activities of Live Shewanella Biofilms Formed on Graphite Electrodes in Electrochemical Flow Cells

PubMed Central

Kitayama, Miho; Koga, Ryota; Kasai, Takuya; Kouzuma, Atsushi

2017-01-01

ABSTRACT An electrochemical flow cell equipped with a graphite working electrode (WE) at the bottom was inoculated with Shewanella oneidensis MR-1 expressing an anaerobic fluorescent protein, and biofilm formation on the WE was observed over time during current generation at WE potentials of +0.4 and 0 V (versus standard hydrogen electrodes), under electrolyte-flow conditions. Electrochemical analyses suggested the presence of unique electron-transfer mechanisms in the +0.4-V biofilm. Microscopic analyses revealed that, in contrast to aerobic biofilms, current-generating biofilm (at +0.4 V) was thin and flat (∼10 μm in thickness), and cells were evenly and densely distributed in the biofilm. In contrast, cells were unevenly distributed in biofilm formed at 0 V. In situ fluorescence staining and biofilm recovery experiments showed that the amounts of extracellular polysaccharides (EPSs) in the +0.4-V biofilm were much smaller than those in the aerobic and 0-V biofilms, suggesting that Shewanella cells suppress the production of EPSs at +0.4 V under flow conditions. We suggest that Shewanella cells perceive electrode potentials and modulate the structure and composition of biofilms to efficiently transfer electrons to electrodes. IMPORTANCE A promising application of microbial fuel cells (MFCs) is to save energy in wastewater treatment. Since current is generated in these MFCs by biofilm microbes under horizontal flows of wastewater, it is important to understand the mechanisms for biofilm formation and current generation under water-flow conditions. Although massive work has been done to analyze the molecular mechanisms for current generation by model exoelectrogenic bacteria, such as Shewanella oneidensis, limited information is available regarding the formation of current-generating biofilms over time under water-flow conditions. The present study developed electrochemical flow cells and used them to examine the electrochemical and structural features of

Structures, Compositions, and Activities of Live Shewanella Biofilms Formed on Graphite Electrodes in Electrochemical Flow Cells.

PubMed

Kitayama, Miho; Koga, Ryota; Kasai, Takuya; Kouzuma, Atsushi; Watanabe, Kazuya

2017-09-01

An electrochemical flow cell equipped with a graphite working electrode (WE) at the bottom was inoculated with Shewanella oneidensis MR-1 expressing an anaerobic fluorescent protein, and biofilm formation on the WE was observed over time during current generation at WE potentials of +0.4 and 0 V (versus standard hydrogen electrodes), under electrolyte-flow conditions. Electrochemical analyses suggested the presence of unique electron-transfer mechanisms in the +0.4-V biofilm. Microscopic analyses revealed that, in contrast to aerobic biofilms, current-generating biofilm (at +0.4 V) was thin and flat (∼10 μm in thickness), and cells were evenly and densely distributed in the biofilm. In contrast, cells were unevenly distributed in biofilm formed at 0 V. In situ fluorescence staining and biofilm recovery experiments showed that the amounts of extracellular polysaccharides (EPSs) in the +0.4-V biofilm were much smaller than those in the aerobic and 0-V biofilms, suggesting that Shewanella cells suppress the production of EPSs at +0.4 V under flow conditions. We suggest that Shewanella cells perceive electrode potentials and modulate the structure and composition of biofilms to efficiently transfer electrons to electrodes. IMPORTANCE A promising application of microbial fuel cells (MFCs) is to save energy in wastewater treatment. Since current is generated in these MFCs by biofilm microbes under horizontal flows of wastewater, it is important to understand the mechanisms for biofilm formation and current generation under water-flow conditions. Although massive work has been done to analyze the molecular mechanisms for current generation by model exoelectrogenic bacteria, such as Shewanella oneidensis , limited information is available regarding the formation of current-generating biofilms over time under water-flow conditions. The present study developed electrochemical flow cells and used them to examine the electrochemical and structural features of current

Formate Metabolism in Shewanella oneidensis Generates Proton Motive Force and Prevents Growth without an Electron Acceptor.

PubMed

Kane, Aunica L; Brutinel, Evan D; Joo, Heena; Maysonet, Rebecca; VanDrisse, Chelsey M; Kotloski, Nicholas J; Gralnick, Jeffrey A

2016-04-01

Shewanella oneidensis strain MR-1 is a facultative anaerobe that thrives in redox-stratified environments due to its ability to utilize a wide array of terminal electron acceptors. Conversely, the electron donors utilized by S. oneidensis are more limited and include products of primary fermentation such as lactate, pyruvate, formate, and hydrogen. Lactate, pyruvate, and hydrogen metabolisms inS. oneidensis have been described previously, but little is known about the role of formate oxidation in the ecophysiology of these bacteria. Formate is produced by S. oneidensis through pyruvate formate lyase during anaerobic growth on carbon sources that enter metabolism at or above the level of pyruvate, and the genome contains three gene clusters predicted to encode three complete formate dehydrogenase complexes. To determine the contribution of each complex to formate metabolism, strains lacking one, two, or all three annotated formate dehydrogenase gene clusters were generated and examined for growth rates and yields on a variety of carbon sources. Here, we report that formate oxidation contributes to both the growth rate and yield of S. oneidensis through the generation of proton motive force. Exogenous formate also greatly accelerated growth on N-acetylglucosamine, a carbon source normally utilized very slowly by S. oneidensis under anaerobic conditions. Surprisingly, deletion of all three formate dehydrogenase gene clusters enabled growth of S. oneidensis using pyruvate in the absence of a terminal electron acceptor, a mode of growth never before observed in these bacteria. Our results demonstrate that formate oxidation is a fundamental strategy under anaerobic conditions for energy conservation inS. oneidensis. Shewanella species have garnered interest in biotechnology applications for their ability to respire extracellular terminal electron acceptors, such as insoluble iron oxides and electrodes. While much effort has gone into studying the proteins for

Formate Metabolism in Shewanella oneidensis Generates Proton Motive Force and Prevents Growth without an Electron Acceptor

PubMed Central

Kane, Aunica L.; Brutinel, Evan D.; Joo, Heena; Maysonet, Rebecca; VanDrisse, Chelsey M.; Kotloski, Nicholas J.

2016-01-01

ABSTRACT Shewanella oneidensis strain MR-1 is a facultative anaerobe that thrives in redox-stratified environments due to its ability to utilize a wide array of terminal electron acceptors. Conversely, the electron donors utilized by S. oneidensis are more limited and include products of primary fermentation such as lactate, pyruvate, formate, and hydrogen. Lactate, pyruvate, and hydrogen metabolisms in S. oneidensis have been described previously, but little is known about the role of formate oxidation in the ecophysiology of these bacteria. Formate is produced by S. oneidensis through pyruvate formate lyase during anaerobic growth on carbon sources that enter metabolism at or above the level of pyruvate, and the genome contains three gene clusters predicted to encode three complete formate dehydrogenase complexes. To determine the contribution of each complex to formate metabolism, strains lacking one, two, or all three annotated formate dehydrogenase gene clusters were generated and examined for growth rates and yields on a variety of carbon sources. Here, we report that formate oxidation contributes to both the growth rate and yield of S. oneidensis through the generation of proton motive force. Exogenous formate also greatly accelerated growth on N-acetylglucosamine, a carbon source normally utilized very slowly by S. oneidensis under anaerobic conditions. Surprisingly, deletion of all three formate dehydrogenase gene clusters enabled growth of S. oneidensis using pyruvate in the absence of a terminal electron acceptor, a mode of growth never before observed in these bacteria. Our results demonstrate that formate oxidation is a fundamental strategy under anaerobic conditions for energy conservation in S. oneidensis. IMPORTANCE Shewanella species have garnered interest in biotechnology applications for their ability to respire extracellular terminal electron acceptors, such as insoluble iron oxides and electrodes. While much effort has gone into studying the

Antioxidant and Antimicrobial Potential of the Bifurcaria bifurcata Epiphytic Bacteria

PubMed Central

Horta, André; Pinteus, Susete; Alves, Celso; Fino, Nádia; Silva, Joana; Fernandez, Sara; Rodrigues, Américo; Pedrosa, Rui

2014-01-01

Surface-associated marine bacteria are an interesting source of new secondary metabolites. The aim of this study was the isolation and identification of epiphytic bacteria from the marine brown alga, Bifurcaria bifurcata, and the evaluation of the antioxidant and antimicrobial activity of bacteria extracts. The identification of epiphytic bacteria was determined by 16S rRNA gene sequencing. Bacteria extracts were obtained with methanol and dichloromethane (1:1) extraction. The antioxidant activity of extracts was performed by quantification of total phenolic content (TPC), 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity and oxygen radical absorbance capacity (ORAC). Antimicrobial activities were evaluated against Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, Salmonella enteritidis, Staphylococcus aureus, Saccharomyces cerevisiae and Candida albicans. A total of 39 Bifurcaria bifurcata-associated bacteria were isolated and 33 were identified as Vibrio sp. (48.72%), Alteromonas sp. (12.82%), Shewanella sp. (12.26%), Serratia sp. (2.56%), Citricoccus sp. (2.56%), Cellulophaga sp. (2.56%), Ruegeria sp. (2.56%) and Staphylococcus sp. (2.56%). Six (15.38%) of the 39 bacteria Bifurcaria bifurcata-associated bacteria presented less than a 90% Basic Local Alignment Search Tool (BLAST) match, and some of those could be new. The highest antioxidant activity and antimicrobial activity (against B. subtilis) was exhibited by strain 16 (Shewanella sp.). Several strains also presented high antimicrobial activity against S. aureus, mainly belonging to Alteromonas sp. and Vibrio sp. There were no positive results against fungi and Gram-negative bacteria. Bifurcaria bifurcata epiphytic bacteria were revealed to be excellent sources of natural antioxidant and antimicrobial compounds. PMID:24663118

Antioxidant and antimicrobial potential of the Bifurcaria bifurcata epiphytic bacteria.

PubMed

Horta, André; Pinteus, Susete; Alves, Celso; Fino, Nádia; Silva, Joana; Fernandez, Sara; Rodrigues, Américo; Pedrosa, Rui

2014-03-24

Surface-associated marine bacteria are an interesting source of new secondary metabolites. The aim of this study was the isolation and identification of epiphytic bacteria from the marine brown alga, Bifurcaria bifurcata, and the evaluation of the antioxidant and antimicrobial activity of bacteria extracts. The identification of epiphytic bacteria was determined by 16S rRNA gene sequencing. Bacteria extracts were obtained with methanol and dichloromethane (1:1) extraction. The antioxidant activity of extracts was performed by quantification of total phenolic content (TPC), 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity and oxygen radical absorbance capacity (ORAC). Antimicrobial activities were evaluated against Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, Salmonella enteritidis, Staphylococcus aureus, Saccharomyces cerevisiae and Candida albicans. A total of 39 Bifurcaria bifurcata-associated bacteria were isolated and 33 were identified as Vibrio sp. (48.72%), Alteromonas sp. (12.82%), Shewanella sp. (12.26%), Serratia sp. (2.56%), Citricoccus sp. (2.56%), Cellulophaga sp. (2.56%), Ruegeria sp. (2.56%) and Staphylococcus sp. (2.56%). Six (15.38%) of the 39 bacteria Bifurcaria bifurcata-associated bacteria presented less than a 90% Basic Local Alignment Search Tool (BLAST) match, and some of those could be new. The highest antioxidant activity and antimicrobial activity (against B. subtilis) was exhibited by strain 16 (Shewanella sp.). Several strains also presented high antimicrobial activity against S. aureus, mainly belonging to Alteromonas sp. and Vibrio sp. There were no positive results against fungi and Gram-negative bacteria. Bifurcaria bifurcata epiphytic bacteria were revealed to be excellent sources of natural antioxidant and antimicrobial compounds.

Plants as sources of airborne bacteria, including ice nucleation-active bacteria.

PubMed

Lindemann, J; Constantinidou, H A; Barchet, W R; Upper, C D

1982-11-01

Vertical wind shear and concentration gradients of viable, airborne bacteria were used to calculate the upward flux of viable cells above bare soil and canopies of several crops. Concentrations at soil or canopy height varied from 46 colony-forming units per m over young corn and wet soil to 663 colony-forming units per m over dry soil and 6,500 colony-forming units per m over a closed wheat canopy. In simultaneous samples, concentrations of viable bacteria in the air 10 m inside an alfalfa field were fourfold higher than those over a field with dry, bare soil immediately upwind. The upward flux of viable bacteria over alfalfa was three- to fourfold greater than over dry soil. Concentrations of ice nucleation-active bacteria were higher over plants than over soil. Thus, plant canopies may constitute a major source of bacteria, including ice nucleation-active bacteria, in the air.

Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

PubMed Central

Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

2003-01-01

The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

Silver nanocrystallites: Facile biofabrication using Shewanella oneidensis, and an evaluation of their comparative toxicity on Gram-negative and Gram-positive bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suresh, Anil K; Wang, Wei; Pelletier, Dale A

Microorganisms have long been known to develop resistance to metal ions either by sequestering metals inside the cell or by effluxing them into the extracellular media. Here we report the biosynthesis of extracellular silver based single nanocrystallites of well-defined composition and homogeneous morphology utilizing the -proteobacterium, Shewanella oneidensis strain MR-1, upon incubation with an aqueous solution of silver nitrate. Further characterization of these particles revealed that the crystals consist of small, reasonably monodispersed spheres in the size range 2 11 nm (with an average of 4 1.5 nm). The bactericidal effect of these biologically synthesized silver nanoparticles (biogenic-Ag) are comparedmore » to similar chemically synthesized nanoparticles (colloidal silver [colloidal-Ag] and oleate capped silver [oleate-Ag]). The determination of the bactericidal effect of these different silver nanoparticles was assessed using both Gram-negative (E. coli) and Gram-positive (B. subtilis) bacteria and based on the diameter of the inhibition zone in disc diffusion tests, minimum inhibitory concentrations, Live/Dead staining assays, and atomic force microscopy. From a toxicity perspective, a clear synthesis procedure, and a surface coat- and strain-dependent inhibition were observed for silver nanoparticles. Biogenic-Ag was found to be of higher toxicity when compared to colloidal-Ag for both E. coli and B. subtilis. E. coli was found to be more resistant to either of these nanoparticles than B. subtilis. In contrast, Oleate-Ag was not toxic to either of the bacteria. These findings have important implications for the potential uses of Ag nanomaterials and for their fate in biological and environmental systems.« less

Shewanella gelidii sp. nov., isolated from the red algae Gelidium amansii, and emended description of Shewanella waksmanii.

PubMed

Wang, Yan; Chen, Hongli; Liu, Zhenhua; Ming, Hong; Zhou, Chenyan; Zhu, Xinshu; Zhang, Peng; Jing, Changqin; Feng, Huigen

2016-08-01

A novel Gram-stain-negative, straight or slightly curved rod-shaped, non-spore-forming, facultatively anaerobic bacterium with a single polar flagellum, designated RZB5-4T, was isolated from a sample of the red algae Gelidium amansii collected from the coastal region of Rizhao, PR China (119.625° E 35.517° N). The organism grew optimally between 24 and 28 °C, at pH 7.0 and in the presence of 2-3 % (w/v) NaCl. The strain required seawater or artificial seawater for growth, and NaCl alone did not support growth. Strain RZB5-4T contained C16 : 1ω7c and/or C16 : 1ω6c, C16 : 0 and iso-C15 : 0 as the dominant fatty acids. The respiratory quinones detected in strain RZB5-4T were ubiquinone 7, ubiquinone 8, menaquinone 7 and methylmenaquinone 7. The polar lipids of strain RZB5-4T comprised phosphatidylethanolamine, phosphatidylglycerol, phosphatidylmonomethylethanolamine, one unidentified glycolipid, one unidentified phospholipid and one unknown lipid. The DNA G+C content of strain RZB5-4T was 47 mol %. Phylogenetic analysis based on 16S rRNA and gyrase B (gyrB) gene sequences showed that strain RZB5-4T belonged to the genus Shewanella, clustering with Shewanella waksmanii ATCC BAA-643T. Strain RZB5-4T exhibited the highest 16S rRNA gene sequence similarity value (96.6 %) and the highest gyrB gene sequence similarity value (80.7 %), respectively, to S. waksmanii ATCC BAA-643T. On the basis of polyphasic analyses, strain RZB5-4T represents a novel species of the genus Shewanella, for which the name Shewanella gelidii sp. nov. is proposed. The type strain is RZB5-4T (=JCM 30804T=KCTC 42663T=MCCC 1K00697T).

Investigating different mechanisms for biogenic selenite transformations: Geobacter sulfurreducens, Shewanella oneidensis and Veillonella atypica

USGS Publications Warehouse

Pearce, C.I.; Pattrick, R.A.D.; Law, N.; Charnock, J.M.; Coker, V.S.; Fellowes, J.W.; Oremland, R.S.; Lloyd, J.R.

2009-01-01

The metal-reducing bacteria Geobacter sulfurreducens, Shewanella oneidensis and Veillonella atypica, use different mechanisms to transform toxic, bioavailable sodium selenite to less toxic, non-mobile elemental selenium and then to selenide in anaerobic environments, offering the potential for in situ and ex situ bioremediation of contaminated soils, sediments, industrial effluents, and agricultural drainage waters. The products of these reductive transformations depend on both the organism involved and the reduction conditions employed, in terms of electron donor and exogenous extracellular redox mediator. The intermediary phase involves the precipitation of elemental selenium nanospheres and the potential role of proteins in the formation of these structures is discussed. The bionanomineral phases produced during these transformations, including both elemental selenium nanospheres and metal selenide nanoparticles, have catalytic, semiconducting and light-emitting properties, which may have unique applications in the realm of nanophotonics. This research offers the potential to combine remediation of contaminants with the development of environmentally friendly manufacturing pathways for novel bionanominerals. ?? 2009 Taylor & Francis.

Reduction of jarosite by Shewanella oneidensis MR-1 and secondary mineralization

NASA Astrophysics Data System (ADS)

Bingjie, Ouyang; Xiancai, Lu; Huan, Liu; Juan, Li; Tingting, Zhu; Xiangyu, Zhu; Jianjun, Lu; Rucheng, Wang

2014-01-01

Jarosite is a common mineral in a variety of environments formed by the oxidation of iron sulfide normally accompanying with the generation of acid mine drainage (AMD) in mining areas or acid rock drainages (ARD) in many localities. Decomposition of jarosite by dissimilatory iron reducing bacteria (DIRB) influences the mobility of many heavy metals generally accommodated in natural jarosite. This study examined the anaerobic reduction of synthesized jarosite by Shewanella oneidensis strain MR-1, a typical facultative bacteria. The release of ferrous and ferric ion, as well as sulfate and potassium, in the inoculated experimental group lasting 80 days is much higher than that in abiotic control groups. The detection of bicarbonate and acetate in experimental solution further confirms the mechanism of microbial reduction of jarosite, in which lactate acts as the electron donor. The produced ferrous iron stimulates the subsequent secondary mineralization, leading to precipitation and transformation of various iron-containing minerals. Green rust and goethite are the intermediate minerals of the microbial reduction process under anoxic conditions, and the end products include magnetite and siderite. In aerobic environments, goethite, magnetite and siderite were also detected, but the contents were relatively lower. While in abiotic experiments, only goethite has been detected as a product. Thus, the microbial reduction and subsequent mineral transformation can remarkably influence the geochemical cycling of iron and sulfur in supergene environments, as well as the mobility of heavy metals commonly accommodated in jarosite.

Rapid Quantification of Mutant Fitness in Diverse Bacteria by Sequencing Randomly Bar-Coded Transposons

PubMed Central

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth

2015-01-01

ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644

An extracytoplasmic function sigma factor-dependent periplasmic glutathione peroxidase is involved in oxidative stress response of Shewanella oneidensis

DOE PAGES

Dai, Jingcheng; Wei, Hehong; Tian, Chunyuan; ...

2015-01-01

Background: Bacteria use alternative sigma factors (σs) to regulate condition-specific gene expression for survival and Shewanella harbors multiple ECF (extracytoplasmic function) σ genes and cognate anti-sigma factor genes. Here we comparatively analyzed two of the rpoE-like operons in the strain MR-1: rpoE-rseA-rseB-rseC and rpoE2-chrR. Results: RpoE was important for bacterial growth at low and high temperatures, in the minimal medium, and high salinity. The degP/htrA orthologue, required for growth of Escherichia coli and Pseudomonas aeruginosa at high temperature, is absent in Shewanella, while the degQ gene is RpoE-regulated and is required for bacterial growth at high temperature. RpoE2 was essentialmore » for the optimal growth in oxidative stress conditions because the rpoE2 mutant was sensitive to hydrogen peroxide and paraquat. The operon encoding a ferrochelatase paralogue (HemH2) and a periplasmic glutathione peroxidase (PgpD) was identified as RpoE2-dependent. PgpD exhibited higher activities and played a more important role in the oxidative stress responses than the cytoplasmic glutathione peroxidase CgpD under tested conditions. The rpoE2-chrR operon and the identified regulon genes, including pgpD and hemH2, are coincidently absent in several psychrophilic and/or deep-sea Shewanella strains. Conclusion: In S. oneidensis MR-1, the RpoE-dependent degQ gene is required for optimal growth under high temperature. The rpoE2 and RpoE2-dependent pgpD gene encoding a periplasmic glutathione peroxidase are involved in oxidative stress responses. But rpoE2 is not required for bacterial growth at low temperature and it even affected bacterial growth under salt stress, indicating that there is a tradeoff between the salt resistance and RpoE2-mediated oxidative stress responses.« less

An extracytoplasmic function sigma factor-dependent periplasmic glutathione peroxidase is involved in oxidative stress response of Shewanella oneidensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Jingcheng; Wei, Hehong; Tian, Chunyuan

Background: Bacteria use alternative sigma factors (σs) to regulate condition-specific gene expression for survival and Shewanella harbors multiple ECF (extracytoplasmic function) σ genes and cognate anti-sigma factor genes. Here we comparatively analyzed two of the rpoE-like operons in the strain MR-1: rpoE-rseA-rseB-rseC and rpoE2-chrR. Results: RpoE was important for bacterial growth at low and high temperatures, in the minimal medium, and high salinity. The degP/htrA orthologue, required for growth of Escherichia coli and Pseudomonas aeruginosa at high temperature, is absent in Shewanella, while the degQ gene is RpoE-regulated and is required for bacterial growth at high temperature. RpoE2 was essentialmore » for the optimal growth in oxidative stress conditions because the rpoE2 mutant was sensitive to hydrogen peroxide and paraquat. The operon encoding a ferrochelatase paralogue (HemH2) and a periplasmic glutathione peroxidase (PgpD) was identified as RpoE2-dependent. PgpD exhibited higher activities and played a more important role in the oxidative stress responses than the cytoplasmic glutathione peroxidase CgpD under tested conditions. The rpoE2-chrR operon and the identified regulon genes, including pgpD and hemH2, are coincidently absent in several psychrophilic and/or deep-sea Shewanella strains. Conclusion: In S. oneidensis MR-1, the RpoE-dependent degQ gene is required for optimal growth under high temperature. The rpoE2 and RpoE2-dependent pgpD gene encoding a periplasmic glutathione peroxidase are involved in oxidative stress responses. But rpoE2 is not required for bacterial growth at low temperature and it even affected bacterial growth under salt stress, indicating that there is a tradeoff between the salt resistance and RpoE2-mediated oxidative stress responses.« less

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

PubMed

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Effect of Thiols, Zinc, and Redox Conditions on Hg Uptake in Shewanella oneidensis

DOE PAGES

Szczuka, Aleksandra; Morel, Francois M. M.; Schaefer, Jeffra K.

2015-05-18

Mercury uptake in bacteria represents a key first step in the production and accumulation Of methylmercury in biota. Previous experiments with mercury methylating bacteria have shown that Hg uptake is enhanced by some thiols, in particular cysteine, and that it is an energy-dependent process through heavy Metal TA transporters. In this study, we examine Hg uptake in the nonmethylating facultative aerobe, Shewanella oneidensis, under both anaerobic and aerobic conditions. Our results demonstrate similar characteristics of the Hg uptake system to those of the Hg methylating strains: uptake is enhanced in the presence of some thiols but not others; uptake ismore » energy dependent as evidenced by inhibition by a protonophore; and uptake is inhibited by high Zn(II) concentrations. Initial cellular uptake rates in S. oneidensis were remarkably similar under aerobic and fumarate-reducing conditions. In conclusion, these data support a similar Hg(II) uptake mechanism within the proteobacteria of accidental Hg(II) transport through heavy metal transporters with similar rates of uptake but differences in the ability to take up Hg bound to different thiols.« less

The surface properties of Shewanella putrefaciens 200 and S. oneidensis MR-1: the effect of pH and terminal electron acceptors.

PubMed

Furukawa, Yoko; Dale, Jason R

2013-04-08

We investigated the surface characteristics of two strains of Shewanella sp., S. oneidensis MR-1 and S. putrefaciens 200, that were grown under aerobic conditions as well as under anaerobic conditions with trimethylamine oxide (TMAO) as the electron acceptor. The investigation focused on the experimental determination of electrophoretic mobility (EPM) under a range of pH and ionic strength, as well as by subsequent modeling in which Shewanella cells were considered to be soft particles with water- and ion-permeable outermost layers. The soft layer of p200 is significantly more highly charged (i.e., more negative) than that of MR-1. The effect of electron acceptor on the soft particle characteristics of Shewanella sp. is complex. The fixed charge density, which is a measure of the deionized and deprotonated functional groups in the soft layer polymers, is slightly greater (i.e., more negative) for aerobically grown p200 than for p200 grown with TMAO. On the other hand, the fixed charge density of aerobically grown MR1 is slightly less than that of p200 grown with TMAO. The effect of pH on the soft particle characteristics is also complex, and does not exhibit a clear pH-dependent trend. The Shewanella surface characteristics were attributed to the nature of the outermost soft layer, the extracellular polymeric substances (EPS) in case of p200 and lypopolysaccharides (LPS) in case of MR1 which generally lacks EPS. The growth conditions (i.e., aerobic vs. anaerobic TMAO) have an influence on the soft layer characteristics of Shewanella sp. cells. Meanwhile, the clear pH dependency of the mechanical and morphological characteristics of EPS and LPS layers, observed in previous studies through atomic force microscopy, adhesion tests and spectroscopies, cannot be corroborated by the electrohydrodynamics-based soft particle characteristics which does not exhibited a clear pH dependency in this study. While the electrohydrodynamics-based soft-particle model is a useful tool

Oxygen exposure promotes fuel diversity for Shewanella oneidensis microbial fuel cells.

PubMed

Biffinger, Justin C; Byrd, Jacqueline N; Dudley, Breanna L; Ringeisen, Bradley R

2008-01-18

Miniature microbial fuel cells (mini-MFCs) were used to monitor the current generated by Shewanella oneidensis DSP10 under both anaerobic and aerobic conditions when exposed to glucose as a potential electron donor. In addition to glucose, other carbon fuels including fructose, sucrose, acetate, and ascorbic acid were also tested. When the anolyte containing S. oneidensis was grown in the presence of oxygen, power densities of 270+/-10, 350+/-20, and 120+/-10 W/m(3) were recorded from the mini-MFC for glucose, fructose, and ascorbic acid electron donors, respectively, while sucrose and acetate produced no response. The power produced from glucose decreased considerably (bacteria when grown under oxygen-rich or anoxic conditions. The power densities generated from the mini-MFC exposed to oxygen led to significant changes in current production over time with repeated feedings of these carbon nutrients. This work expands the breadth of potential electron donors for S. oneidensis MFCs and demonstrates the importance of studying microbial anolytes under diverse environmental conditions.

Shewanella species as the origin of blaOXA-48 genes: insights into gene diversity, associated phenotypes and possible transfer mechanisms.

PubMed

Tacão, Marta; Araújo, Susana; Vendas, Maria; Alves, Artur; Henriques, Isabel

2018-03-01

Chromosome-encoded beta-lactamases of Shewanella spp. have been indicated as probable progenitors of bla OXA-48 -like genes. However, these have been detected in few Shewanella spp. and dissemination mechanisms are unclear. Thus, our main objective was to confirm the role of Shewanella species as progenitors of bla OXA-48 -like genes. In silico analysis of Shewanella genomes was performed to detect bla OXA-48 -like genes and context, and 43 environmental Shewanella spp. were characterised. Clonal relatedness was determined by BOX-PCR. Phylogenetic affiliation was assessed by 16S rDNA and gyrB sequencing. Antibiotic susceptibility phenotypes were determined. The bla OXA-48 -like genes and genetic context were inspected by PCR, hybridisation and sequence analysis. Gene variants were cloned in Escherichia coli and MICs were determined. Shewanella isolates were screened for integrons, plasmids and insertion sequences. Analysis of Shewanella spp. genomes showed that putative bla OXA-48 -like is present in the majority and in an identical context. Isolates presenting unique BOX profiles affiliated with 11 Shewanella spp. bla OXA-48 -like genes were detected in 22 isolates from 6 species. Genes encoded enzymes identical to OXA-48, OXA-204, OXA-181, and 7 new variants differing from OXA-48 from 2 to 82 amino acids. IS1999 was detected in 24 isolates, although not in the vicinity of bla OXA-48 genes. Recombinant E. coli strains presented altered MICs. The presence/absence of bla OXA-48 -like genes was species-related. Gene variants encoded enzymes with hydrolytic spectra similar to OXA-48-like from non-shewanellae. From the mobile elements previously described in association with bla OXA-48 -like genes, only the IS1999 was found in Shewanella, which indicates its relevance in bla OXA-48 -like genes transfer to other hosts. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Shewanella amazonensis sp. nov., a novel metal-reducing facultative anaerobe from Amazonian shelf muds

NASA Technical Reports Server (NTRS)

Venkateswaran, K.; Dollhopf, M. E.; Aller, R.; Stackebrandt, E.; Nealson, K. H.

1998-01-01

A new bacterial species belonging to the genus Shewanella is described on the basis of phenotypic characterization and sequence analysis of its 16S rRNA-encoding and gyrase B (gyrB) genes. This organism, isolated from shallow-water marine sediments derived from the Amazon River delta, is a Gram-negative, motile, polarly flagellated, facultatively anaerobic, rod-shaped eubacterium and has a G&C content of 51.7 mol%. Strain SB2BT is exceptionally active in the anaerobic reduction of iron, manganese and sulfur compounds. SB2BT grows optimally at 35 degrees C, with 1-3% NaCl and over a pH range of 7-8. Analysis of the 16S rDNA sequence revealed a clear affiliation between strain SB2BT and members of the gamma subclass of the class Proteobacteria. High similarity values were found with certain members of the genus Shewanella, especially with Shewanella putrefaciens, and this was supported by cellular fatty acid profiles and phenotypic characterization. DNA-DNA hybridization between strain SB2BT and its phylogenetically closest relatives revealed low similarity values (24.6-42.7%) which indicated species status for strain SB2BT. That SB2BT represents a distinct bacterial species within the genus Shewanella is also supported by gyrB sequence analysis. Considering the source of the isolate, the name Shewanella amazonensis sp. nov. is proposed and strain SB2BT (= ATCC 700329T) is designated as the type strain.

Biological accumulation of tellurium nanorod structures via reduction of tellurite by Shewanella oneidensis MR-1.

PubMed

Kim, Dong-Hun; Kanaly, Robert A; Hur, Hor-Gil

2012-12-01

The dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, reduced tellurite (Te(IV), TeO(3)(2-)) to elemental tellurium under anaerobic conditions resulting in the intracellular accumulation of needle shaped crystalline Te(0) nanorods. Fatty acid analyses showed that toxic Te(IV) increased the unsaturated fatty acid composition of the lipid components of the cell membrane, implying a deconstruction of the integrity of the cellular membrane structure. The current results suggest that dissimilatory metal reducing bacteria such as S. oneidensis MR-1 may play an important role in recycling toxic tellurium elements, and may be applied as a novel selective biological filter via the accumulation of industry-applicable rare materials, Te(0) nanorods, in the cell. Copyright © 2012 Elsevier Ltd. All rights reserved.

Shewanella frigidimarina microbial fuel cells and the influence of divalent cations on current output.

PubMed

Fitzgerald, Lisa A; Petersen, Emily R; Leary, Dagmar H; Nadeau, Lloyd J; Soto, Carissa M; Ray, Richard I; Little, Brenda J; Ringeisen, Bradley R; Johnson, Glenn R; Vora, Gary J; Biffinger, Justin C

2013-02-15

The genes involved in the proposed pathway for Shewanella extracellular electron transfer (EET) are highly conserved. While extensive studies involving EET from a fresh water Shewanella microbe (S. oneidensis MR-1) to soluble and insoluble electron acceptors have been published, only a few reports have examined EET from marine strains of Shewanella. Thus, Shewanella frigidimarina (an isolate from Antarctic Sea ice) was used within miniature microbial fuel cells (mini-MFC) to evaluate potential power output. During the course of this study several distinct differences were observed between S. oneidensis MR-1 and S. frigidimarina under comparable conditions. The maximum power density with S. frigidimarina was observed when the anolyte was half-strength marine broth (1/2 MB) (0.28 μW/cm(2)) compared to Luria-Bertani (LB) (0.07 μW/cm(2)) or a defined growth minimal medium (MM) (0.02 μW/cm(2)). The systematic modification of S. frigidimarina cultured in 1/2 MB and LB with divalent cations shows that a maximum current output can be generated independent of internal ionic ohmic losses and the presence of external mediators. Published by Elsevier B.V.

Methods of producing protoporphyrin IX and bacterial mutants therefor

DOEpatents

Zhou, Jizhong; Qiu, Dongru; He, Zhili; Xie, Ming

2016-03-01

The presently disclosed inventive concepts are directed in certain embodiments to a method of producing protoporphyrin IX by (1) cultivating a strain of Shewanella bacteria in a culture medium under conditions suitable for growth thereof, and (2) recovering the protoporphyrin IX from the culture medium. The strain of Shewanella bacteria comprises at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX. In certain embodiments of the method, the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or of shew_1140. In other embodiments, the presently disclosed inventive concepts are directed to mutant strains of Shewanella bacteria having at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX during cultivation of the bacteria. In certain embodiments the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or shew_1140.

Spoilage bacteria of fresh broiler chicken carcasses.

PubMed

Russell, S M; Fletcher, D L; Cox, N A

1995-12-01

Studies were conducted to identify the bacteria responsible for spoilage of fresh broiler chicken carcasses and to characterize the off-odors these bacteria produce. Broiler carcasses were collected from processing plants in the northeast Georgia area, the southeastern U.S., Arkansas, California, and North Carolina. The carcasses were allowed to spoil under controlled conditions at 3 C and spoilage bacteria were isolated. Each spoilage bacterium was separately inoculated into a sterile chicken skin medium, incubated at 25 C for 48 h, and subjectively evaluated for odor. The bacteria isolated from spoiled carcasses that consistently produced off-odors in the chicken skin medium, regardless of the geographical location from which the chickens were obtained, were Shewanella putrefaciens A, B, and D, Pseudomonas fluorescens A, B, and D, and Pseudomonas fragi. These bacteria produced off-odors that resembled "sulfur", "dishrag", "ammonia", "wet dog", "skunk", "dirty socks", "rancid fish", "unspecified bad odor", or a sweet smell resembling "canned corn". Odors produced by the spoilage bacteria were varied; however, odors most associated with spoiled poultry, such as "dishraggy" odors, were produced by the bacteria that were most consistently isolated, such as S. putrefaciens and the pseudomonads.

Reduction of Fe(III) colloids by Shewanella putrefaciens: A kinetic model

NASA Astrophysics Data System (ADS)

Bonneville, Steeve; Behrends, Thilo; van Cappellen, Philippe; Hyacinthe, Christelle; Röling, Wilfred F. M.

2006-12-01

A kinetic model for the microbial reduction of Fe(III) oxyhydroxide colloids in the presence of excess electron donor is presented. The model assumes a two-step mechanism: (1) attachment of Fe(III) colloids to the cell surface and (2) reduction of Fe(III) centers at the surface of attached colloids. The validity of the model is tested using Shewanella putrefaciens and nanohematite as model dissimilatory iron reducing bacteria and Fe(III) colloidal particles, respectively. Attachment of nanohematite to the bacteria is formally described by a Langmuir isotherm. Initial iron reduction rates are shown to correlate linearly with the relative coverage of the cell surface by nanohematite particles, hence supporting a direct electron transfer from membrane-bound reductases to mineral particles attached to the cells. Using internally consistent parameter values for the maximum attachment capacity of Fe(III) colloids to the cells, Mmax, the attachment constant, KP, and the first-order Fe(III) reduction rate constant, k, the model reproduces the initial reduction rates of a variety of fine-grained Fe(III) oxyhydroxides by S. putrefaciens. The model explains the observed dependency of the apparent Fe(III) half-saturation constant, Km∗, on the solid to cell ratio, and it predicts that initial iron reduction rates exhibit saturation with respect to both the cell density and the abundance of the Fe(III) oxyhydroxide substrate.

Enhanced Shewanella biofilm promotes bioelectricity generation.

PubMed

Liu, Ting; Yu, Yang-Yang; Deng, Xiao-Peng; Ng, Chun Kiat; Cao, Bin; Wang, Jing-Yuan; Rice, Scott A; Kjelleberg, Staffan; Song, Hao

2015-10-01

Electroactive biofilms play essential roles in determining the power output of microbial fuel cells (MFCs). To engineer the electroactive biofilm formation of Shewanella oneidensis MR-1, a model exoelectrogen, we herein heterologously overexpressed a c-di-GMP biosynthesis gene ydeH in S. oneidensis MR-1, constructing a mutant strain in which the expression of ydeH is under the control of IPTG-inducible promoter, and a strain in which ydeH is under the control of a constitutive promoter. Such engineered Shewanella strains had significantly enhanced biofilm formation and bioelectricity generation. The MFCs inoculated with these engineered strains accomplished a maximum power density of 167.6 ± 3.6 mW/m(2) , which was ∼ 2.8 times of that achieved by the wild-type MR-1 (61.0 ± 1.9 mW/m(2) ). In addition, the engineered strains in the bioelectrochemical system at poised potential of 0.2 V vs. saturated calomel electrode (SCE) generated a stable current density of 1100 mA/m(2) , ∼ 3.4 times of that by wild-type MR-1 (320 mA/m(2) ). © 2015 Wiley Periodicals, Inc.

Enrichment and isolation of crude oil degrading bacteria from some mussels collected from the Persian Gulf.

PubMed

Bayat, Zeynab; Hassanshahian, Mehdi; Hesni, Majid Askari

2015-12-15

To date, little is known about existing relationships between mussels and bacteria in hydrocarbon-contaminated marine environments. The aim of this study is to find crude oil degrading bacteria in some mussels at the Persian Gulf. Twenty eight crude oil degrading bacteria were isolated from three mussels species collected from oil contaminated area at Persian Gulf. According to high growth and degradation of crude oil four strains were selected between 28 isolated strains for more study. Determination the nucleotide sequence of the gene encoding for 16S rRNA show that these isolated strains belong to: Shewanella algae isolate BHA1, Micrococcus luteus isolate BHA7, Pseudoalteromonas sp. isolate BHA8 and Shewanella haliotis isolate BHA35. The residual crude oil in culture medium was analysis by Gas Chromatography (GC). The results confirmed that these strains can degrade: 47.24%, 66.08%, 27.13% and 69.17% of crude oil respectively. These strains had high emulsification activity and biosurfactant production. Also, the effects of some factors on crude oil degradation by isolated strains were studied. The results show that the optimum concentration of crude oil was 2.5% and the best degradation take place at 12% of salinity. This research is the first reports on characterization of crude oil degrading bacteria from mussels at Persian Gulf and by using of these bacteria in the field the effect of oil pollution can be reduce on this marine environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Biological characteristics and pathogenicity of a highly pathogenic Shewanella marisflavi infected sea cucumber (Apostichopus uaponicus)

USDA-ARS?s Scientific Manuscript database

Shewanella marisflavi isolate AP629 was characterized as a novel pathogen of sea cucumber. The LD50 values (14 days) in sea cucumber and swordtail fish were 3.89 × 106 and 4.85 × 104 CFU g-1 body weight, respectively. Studies on S. marisflavi had been conducted, including morphology, physiological a...

Extracellular Polymeric Substances from Shewanella sp. HRCR-1 Biofilms: Characterization by Infrared Spectroscopy and Proteomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao, Bin; Shi, Liang; Brown, Roslyn N.

This study characterizes the composition of extracellular polymeric substances (EPS) from Shewanella sp. HRCR-1 biofilms to provide insight into potential interactions of EPS with redox-active metals and radionuclides. Both bound and loosely associated EPS were extracted from Shewanella sp. HRCR-1 biofilms prepared using a hollow-fiber membrane biofilm reactor (HfMBR). FTIR spectra revealed the presence of proteins, polysaccharides, nucleic acids, membrane lipids, and fatty acids in both bound and loosely associated EPS. Using a global proteomic approach, a total of 58 extracellular and outer membrane proteins were identified in the EPS. These included homologues of multiple S. oneidensis MR-1 proteins thatmore » potentially contribute to key physiological biofilm processes, such as biofilm-promoting protein BpfA, surface-associated serine protease, nucleotidases (CpdB and UshA), an extracellular lipase, and oligopeptidases (PtrB and a M13 family oligopeptidase lipoprotein). In addition, 20 redox proteins were found in extracted EPS. Among the detected redox proteins were the homologues of two S. oneidensis MR-1 c-type cytochromes, MtrC and OmcA, which have been implicated in extracellular electron transfer. Given their detection in the EPS of Shewanella sp. HRCR 1 biofilms, c-type cytochromes may contribute to the possible redox activity of the biofilm matrix and play important roles in extracellular electron transfer reactions.« less

Microbial Reduction and Precipitation of Vanadium by Shewanella oneidensis

PubMed Central

Carpentier, W.; Sandra, K.; De Smet, I.; Brigé, A.; De Smet, L.; Van Beeumen, J.

2003-01-01

Shewanella oneidensis couples anaerobic oxidation of lactate, formate, and pyruvate to the reduction of vanadium pentoxide (VV). The bacterium reduces VV (vanadate ion) to VIV (vanadyl ion) in an anaerobic atmosphere. The resulting vanadyl ion precipitates as a VIV-containing solid. PMID:12788772

PBP1a/LpoA but Not PBP1b/LpoB Are Involved in Regulation of the Major β-Lactamase Gene blaA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Sun, Yiyang; Mao, Yinting; Jin, Miao

2015-01-01

β-Lactamase production is one of the most important strategies for Gram-negative bacteria to combat β-lactam antibiotics. Studies of the regulation of β-lactamase expression have largely been focused on the class C β-lactamase AmpC, whose induction by β-lactams requires LysR-type regulator AmpR and permease AmpG-dependent peptidoglycan recycling intermediates. In Shewanella, which is ubiquitous in aquatic environments and is a reservoir for antibiotic resistance, production of the class D β-lactamase BlaA confers bacteria with natural resistance to many β-lactams. Expression of the blaA gene in the genus representative Shewanella oneidensis is distinct from the AmpC paradigm because of the lack of an AmpR homologue and the presence of an additional AmpG-independent regulatory pathway. In this study, using transposon mutagenesis, we identify proteins that are involved in blaA regulation. Inactivation of mrcA and lpoA, which encode penicillin binding protein 1a (PBP1a) and its lipoprotein cofactor, LpoA, respectively, drastically enhances blaA expression in the absence of β-lactams. Although PBP1b and its cognate, LpoB, also exist in S. oneidensis, their roles in blaA induction are dispensable. We further show that the mrcA-mediated blaA expression is independent of AmpG. PMID:25824223

Occurrence and role of lactic acid bacteria in seafood products.

PubMed

Françoise, Leroi

2010-09-01

Lactic acid bacteria (LAB) in fish flesh has long been disregarded because the high post-mortem pH, the low percentage of sugars, the high content of low molecular weight nitrogenous molecules and the low temperature of temperate waters favor the rapid growth of pH-sensitive psychrotolerant marine Gram-negative bacteria like Pseudomonas, Shewanella and Photobacterium. In seafood packed in both vacuum (VP) and modified atmosphere (MAP) packaging commonly CO(2) enriched, the growth of the Gram-negative aerobic bacteria group (predominantly pseudomonads) is effectively inhibited and the number reached by LAB during storage is higher than that achieved in air but always several log units lower than the trimethylamine oxide (TMA-O) reducing and CO(2)-resistant organisms (Shewanella putrefaciens and Photobacterium phosphoreum). Accordingly, LAB are not of much concern in seafood neither aerobically stored nor VP and MAP. However, they may acquire great relevance in lightly preserved fish products (LPFP), including those VP or MAP. Fresh fish presents a very high water activity (aw) value (0.99). However, aw is reduced to about 0.96 when salt (typically 6% WP) is added to the product. As a result, aerobic Gram-negative bacteria are inhibited, which allows the growth of other organisms more resistant to reduced aw, i.e. LAB, and then they may acquire a central role in the microbial events occurring in the product. Changes in consumers' habits have led to an increase of convenient LPFP with a relative long shelf-life (at least 3 weeks) which, on the other hand, may constitute a serious problem from a safety perspective since Listeria monocytogenes and sometimes Clostridium botulinum (mainly type E) may able to grow. In any case the LAB function in marine products is complex, depending on species, strains, interaction with other bacteria and the food matrix. They may have no particular effect or they may be responsible for spoilage and, in certain cases, they may even exert

Cold adaptation of the mononuclear molybdoenzyme periplasmic nitrate reductase from the Antarctic bacterium Shewanella gelidimarina

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simpson, Philippa J.L.; Codd, Rachel, E-mail: rachel.codd@sydney.edu.au; School of Medical Sciences

2011-11-04

Highlights: Black-Right-Pointing-Pointer Cold-adapted phenotype of NapA from the Antarctic bacterium Shewanella gelidimarina. Black-Right-Pointing-Pointer Protein homology model of NapA from S. gelidimarina and mesophilic homologue. Black-Right-Pointing-Pointer Six amino acid residues identified as lead candidates governing NapA cold adaptation. Black-Right-Pointing-Pointer Molecular-level understanding of designing cool-temperature in situ oxyanion sensors. -- Abstract: The reduction of nitrate to nitrite is catalysed in bacteria by periplasmic nitrate reductase (Nap) which describes a system of variable protein subunits encoded by the nap operon. Nitrate reduction occurs in the NapA subunit, which contains a bis-molybdopterin guanine dinucleotide (Mo-MGD) cofactor and one [4Fe-4S] iron-sulfur cluster. The activity ofmore » periplasmic nitrate reductase (Nap) isolated as native protein from the cold-adapted (psychrophilic) Antarctic bacterium Shewanella gelidimarina (Nap{sub Sgel}) and middle-temperature adapted (mesophilic) Shewanella putrefaciens (Nap{sub Sput}) was examined at varied temperature. Irreversible deactivation of Nap{sub Sgel} and Nap{sub Sput} occurred at 54.5 and 65 Degree-Sign C, respectively. When Nap{sub Sgel} was preincubated at 21-70 Degree-Sign C for 30 min, the room-temperature nitrate reductase activity was maximal and invariant between 21 and 54 Degree-Sign C, which suggested that Nap{sub Sgel} was poised for optimal catalysis at modest temperatures and, unlike Nap{sub Sput}, did not benefit from thermally-induced refolding. At 20 Degree-Sign C, Nap{sub Sgel} reduced selenate at 16% of the rate of nitrate reduction. Nap{sub Sput} did not reduce selenate. Sequence alignment showed 46 amino acid residue substitutions in Nap{sub Sgel} that were conserved in NapA from mesophilic Shewanella, Rhodobacter and Escherichia species and could be associated with the Nap{sub Sgel} cold-adapted phenotype. Protein homology modeling of Nap{sub Sgel

High Performance Heteroatoms Quaternary-doped Carbon Catalysts Derived from Shewanella Bacteria for Oxygen Reduction.

PubMed

Guo, Zhaoyan; Ren, Guangyuan; Jiang, Congcong; Lu, Xianyong; Zhu, Ying; Jiang, Lei; Dai, Liming

2015-11-25

A novel heteroatoms (N, P, S and Fe) quaternary-doped carbon (HQDC-X, X refers to the pyrolysis temperature) can be fabricated by directly pyrolyzing a gram-negative bacteria, S. oneidensis MR-1 as precursors at 800 °C, 900 °C and 1000 °C under argon atmosphere. These HQDC-X catalysts maintain the cylindrical shape of bacteria after pyrolysis under high temperatures, while heteroatoms including N, P, S and Fe distribute homogeneously on the carbon frameworks. As a result, HQDC-X catalysts exhibit excellent electrocatalytic activity for ORR via a dominant four-electron oxygen reduction pathway in alkaline medium, which is comparable with that of commercial Pt/C. More importantly, HQDC-X catalysts show better tolerance for methanol crossover and CO poisoning effects, long-term durability than commercial Pt/C, which could be promising alternatives to costly Pt-based electrocatalysts for ORR. The method may provide a promising avenue to develop cheap ORR catalysts from inexpensive, scalable and biological recursors.

Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens

NASA Technical Reports Server (NTRS)

Nealson, K. H.; Moser, D. P.; Saffarini, D. A.

1995-01-01

Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.

Riboflavin-mediated RDX transformation in the presence of Shewanella putrefaciens CN32 and lepidocrocite.

PubMed

Bae, Sungjun; Lee, Yoonhwa; Kwon, Man Jae; Lee, Woojin

2014-06-15

The potential of riboflavin for the reductive degradation of a cyclic nitramine, hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), was investigated in the presence of lepidocrocite and/or Shewanella putrefaciens CN32. RDX reduction by CN32 alone or CN32 with lepidocrocite was insignificant, while 110 μM RDX was completely reduced by CN32 with riboflavin in 78 h. The transformation products identified included nitroso metabolites, formaldehyde, and ammonium, indicating the ring cleavage of RDX. UV and visible light analysis revealed that riboflavin was microbially reduced by CN32, and that the reduced riboflavin was linked to the complete degradation of RDX. In the presence of both CN32 and lepidocrocite (γ-FeOOH), 100 μM-riboflavin increased the rate and extent of Fe(II) production as well as RDX reduction. An abiotic study also showed that Fe(II)-riboflavin complex, and Fe(II) adsorbed on lepidocrocite, reduced RDX by 48% and 21%, respectively. The findings in this study suggest that riboflavin-mediated RDX degradation pathways in subsurface environments are diverse and complex. However, riboflavin, either from bacteria or exogenous sources, can significantly increase RDX degradation. This will provide a sustainable clean-up option for explosive-contaminated subsurface environments. Copyright © 2014 Elsevier B.V. All rights reserved.

Structural dissection of Shewanella oneidensis old yellow enzyme 4 bound to a Meisenheimer complex and (nitro)phenolic ligands.

PubMed

Elegheert, Jonathan; Brigé, Ann; Van Beeumen, Jozef; Savvides, Savvas N

2017-10-01

Shewanella oneidensis, a Gram-negative γ-proteobacterium with an extensive redox capacity, possesses four old yellow enzyme (OYE) homologs. Of these, Shewanella yellow enzyme 4 (SYE4) is implicated in resistance to oxidative stress. Here, we present a series of high-resolution crystal structures for SYE4 in the oxidized and reduced states, and in complex with phenolic ligands and the nitro-aromatic explosive picric acid. The structures unmask new features, including the identification of a binding platform for long-chain hydrophobic molecules. Furthermore, we present the first structural observation of a hydride-Meisenheimer complex of picric acid with a flavoenzyme. Overall, our study exposes the binding promiscuity of SYE4 toward a variety of electrophilic substrates and is consistent with a general detoxification function for SYE4. © 2017 Federation of European Biochemical Societies.

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE PAGES

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...

2015-05-12

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are

Tolerance of anaerobic bacteria to chlorinated solvents.

PubMed

Koenig, Joanna C; Groissmeier, Kathrin D; Manefield, Mike J

2014-01-01

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation.

A method adapting microarray technology for signature tagged mutagenesis of Dusulfovibrio dusulfuricans G20 and Shewanella oneidensis MR-1 in anaerobic sediment survival experiments

USGS Publications Warehouse

Groh, Jennifer L.; Luo, Qingwei; Ballard , Jimmy D.; Krumholz, Lee R.

2005-01-01

Signature-tagged mutagenesis (STM) is a powerful technique that can be used to identify genes expressed by bacteria during exposure to conditions in their natural environments. To date, there have been no reports of studies in which this approach was used to study organisms of environmental, rather than pathogenic, significance. We used a mini-Tn10 transposon-bearing plasmid, pBSL180, that efficiently and randomly mutagenized Desulfovibrio desulfuricans G20 in addition to Shewanella oneidensis MR-1. Using these organisms as model sediment-dwelling anaerobic bacteria, we developed a new screening system, modified from former STM procedures, to identify genes that are critical for sediment survival. The screening system uses microarray technology to visualize tags from input and output pools, allowing us to identify those lost during sediment incubations. While the majority of data on survival genes identified will be presented in future papers, we report here on chemotaxis-related genes identified by our STM method in both bacteria in order to validate our method. This system may be applicable to the study of numerous environmental bacteria, allowing us to identify functions and roles of survival genes in various habitats.

Production and Dietary Uptake of PUFA by Piezophilic Bacteria, Implications for Marine Biogeochemistry

NASA Astrophysics Data System (ADS)

Fang, J.; Chan, O.; Agarkar, N.; Kato, C.; Sato, T.

2003-12-01

Polyunsaturated fatty acids (PUFAs) have been used extensively as proxies for determining the source and preservation of organic matter in marine sediments. However, the origin of polyunsaturated fatty acids in deep-sea sediments is not well understood; the ultimate source of PUFAs is only partially constrained. At issue is whether PUFAs in deep-sea sediments are derived from the primary production of the photic zone or from the in situ piezophilic bacterial production in the deep-sea, or both. In this study, we tested three deep-sea piezophilic strains, Shewanella violacea DSS12, Shewanella benthica DB21MT-2, Moritella yayanosii DB21MT-5, in biosynthesis and dietary uptake of PUFAs. These piezophilic bacteria were characterized by high abundance of unsaturated fatty acids (62-73% of total fatty acids). In particularly, polyunsaturated fatty acids (PUFA) were detected in all piezophiles examined, ranging from 8 to 27% of total fatty acids. M. japonica DSK1 produced 22:6n-3 (cis-4,7,10,13,16,19-docosahexaenoic acid, DHA), whereas the three Shewanella strains produced 20:5n-3 (cis-5,8,11,14,17-eicosapentaenoic acid, EPA) with trace amounts of DHA. The total concentrations of PLFA were higher in strains grown at low pressure (DSK1, 10 Megapascal or MPa, 26,983μ g/g dry wt cells; DSS12, 50 MPa, 23,986 μ g/g), and lower in strains grown at high pressure (DB6705, 85 MPa, 1,901μ g/g; DB21MT-2, 100 MPa, 3,014 μ g/g). When growth media were supplemented with arachidonic acid (AA; C20:4n-6), there was active uptake and cellular incorporation of AA in the hyperpiezophilic bacteria DB21MT-2 (14.7%) and DB21MT-5 (1.4%). No uptake was observed in DSS12. When cells were treated with antibiotic cerulenin, all three strains incorporated AA into cell membranes (13 to 19%). These results suggest that piezophilic bacteria can be an important contributor in producing and reworking of PUFAs in the deep sea, and that that caution must be exercised in using PUFAs in deducing sources

Biochemical and pathogenic properties of the natural isolate of Shewanella algae from Peter the great bay, sea of Japan.

PubMed

Beleneva, Irina A; Magarlamov, T Yu; Eliseikina, Marina G; Zhukova, Natalia V

2009-11-01

Pathogenic properties of the natural isolate of Shewanella algae from the coelomic fluid of the sea cucumber Apostichopus japonicus (Peter the Great Bay, Sea of Japan) were investigated. The isolate had oxydative metabolism, was positive for ornithine decarboxylase, cytochrome oxidase, catalase, DNase and gelatinase, hemolytically active, did not produce acid from carbohydrates, and did not hydrolyze urea and esculin. The strain was resistant to penicillin, amoxicillin, and ampicillin and susceptible to tetracycline and carbenicillin. Among cellular fatty acids, 13:0-i, 15:0-i, 16:0, 16:1(n-7), 17:0-i, and 17:0-ai dominated. These biochemical properties made it possible to attribute the isolated bacteria to the genus Shewanella and identified as S. algae. The cells of this bacterium were introduced into the coelomic cavity of another echinoderm, the sea urchin Strongylocentrotus nudus. As a result, in about 24h the animals became slow and 3-8days after the inoculation died. Dividing bacteria were being found during the experiment in the coelomic fluid as well as in the phagosomes of amoebocytes, i.e. cells acting as phagocytes in the coelomic fluid. The studies of the invasive properties of strain 156 showed that bacterial cells entered the subcuticular space of S. nudus and A. japonicus through the cuticle and stayed there for a long time without penetrating epithelium and exerting toxic effect upon the organisms of the laboratory animals. Pathogenic effect of S. algae can be manifested only if the cutaneous epithelium is destroyed permitting it to penetrate the lower tissue layers. The toxicity of S. algae is confirmed by in vitro experiments. The inoculation of the embryonic cells of S. nudus with samples of this bacterium caused the death of 10% of cells within an hour and 100% of cells within 12h after inoculation. The results of the investigations demonstrate that S. algae could produce opportunistic infection in the sea cucumber A. japonicus and the sea

Survival of Shewanella Oneidensis MR-1 to GPa pressures

NASA Astrophysics Data System (ADS)

Hazael, Rachael; Foglia, Fabrizia; Leighs, James; Appleby-Thomas, Gareth; Daniel, Isabelle; Eakins, Daniel; Meersman, Filip; McMillian, Paul

2013-06-01

Most life on Earth is thought to occupy near-surface environments under relatively mild conditions of temperature, pressure, pH, salinity etc. That view is changing following discovery of extremophile organisms that prefer environments based on high or low T, extreme chemistries, or very high pressures. Over the past three decades, geomicrobiologists have discovered an extensive subsurface biosphere, that may account for between 1/10 to 1/3 of Earth's living biomass. We subjected samples of Shewanella oneidensis to several pressure cycles to examine its survival to static high pressures to above 1.5 GPa. Shewanella forms part of a genus that contains several piezophile species like S. violacea and S. benthica. We have obtained growth curves for populations recovered from high P conditions and cultured in the laboratory, before being subjected to even higher pressures. We have also carried out dynamic shock experiments using a specially designed cell to maintain high-P, low-T conditions during shock-recovery experiments and observe colony formation among the survivors. Colony counts, shape and growth curves allow us to compare the static vs dynamic pressure resistance of wild type vs pressure-adapted strains. Leverhulme

Sorption and precipitation of Mn2+ by viable and autoclaved Shewanella putrefaciens: Effect of contact time

NASA Astrophysics Data System (ADS)

Chubar, Natalia; Visser, Tom; Avramut, Cristina; de Waard, Helen

2013-01-01

The sorption of Mn(II) by viable and inactivated cells of Shewanella putrefaciens, a non-pathogenic, facultative anaerobic, gram-negative bacterium characterised as a Mn(IV) and Fe(III) reducer, was studied under aerobic conditions, as a function of pH, bacterial density and metal loading. During a short contact time (3-24 h), the adsorptive behaviour of live and dead bacteria toward Mn(II) was sufficiently similar, an observation that was reflected in the studies on adsorption kinetics at various metal loadings, effects of pH, bacteria density, isotherms and drifting of pH during adsorption. Continuing the experiment for an additional 2-30 days demonstrated that the Mn(II) sorption by suspensions of viable and autoclaved cells differed significantly from one another. The sorption to dead cells was characterised by a rapid equilibration and was described by an isotherm. In contrast, the sorption (uptake) to live bacteria exhibited a complex time-dependent uptake. This uptake began as adsorption and ion exchange processes followed by bioprecipitation, and it was accompanied by the formation of polymeric sugars (EPS) and the release of dissolved organic substances. FTIR, EXAFS/XANES and XPS demonstrated that manganese(II) phosphate was the main precipitate formed in 125 ml batches, which is the first evidence of the ability of microbes to synthesise manganese phosphates. XPS and XANES spectra did not detect Mn(II) oxidation. Although the release of protein-like compounds by the viable bacteria increased in the presence of Mn2+ (and, by contrast, the release of carbohydrates did not change), electrochemical analyses did not indicate any aqueous complexation of Mn(II) by the organic ligands.

A comparative analysis of tellurite detoxification by members of the genus Shewanella.

PubMed

Valdivia-González, M A; Díaz-Vásquez, W A; Ruiz-León, D; Becerra, A A; Aguayo, D R; Pérez-Donoso, J M; Vásquez, C C

2018-03-01

The increasing industrial utilization of tellurium has resulted in an important environmental pollution with the soluble, extremely toxic oxyanion tellurite. In this context, the use of microorganisms for detoxifying tellurite or tellurium biorecovery has gained great interest. The ability of different Shewanella strains to reduce tellurite to elemental tellurium was assessed; the results showed that the reduction process is dependent on electron transport and the ∆pH gradient. While S. baltica OS155 showed the highest tellurite resistance, S. putrefaciens was the most efficient in reducing tellurite. Moreover, pH-dependent tellurite transformation was associated with tellurium precipitation as tellurium dioxide. In summary, this work highlights the high tellurite reduction/detoxification ability exhibited by a number of Shewanella species, which could represent the starting point to develop friendly methods for the recovery of elemental tellurium (or tellurium dioxide).

Whole-genome sequencing reveals that Shewanella haliotis Kim et al. 2007 can be considered a later heterotypic synonym of Shewanella algae Simidu et al. 1990.

PubMed

Szeinbaum, Nadia; Kellum, Cailin E; Glass, Jennifer B; Janda, J Michael; DiChristina, Thomas J

2018-04-01

Previously, experimental DNA-DNA hybridization (DDH) between Shewanellahaliotis JCM 14758 T and Shewanellaalgae JCM 21037 T had suggested that the two strains could be considered different species, despite minimal phenotypic differences. The recent isolation of Shewanella sp. MN-01, with 99 % 16S rRNA gene identity to S. algae and S. haliotis, revealed a potential taxonomic problem between these two species. In this study, we reassessed the nomenclature of S. haliotis and S. algae using available whole-genome sequences. The whole-genome sequence of S. haliotis JCM 14758 T and ten S. algae strains showed ≥97.7 % average nucleotide identity and >78.9 % digital DDH, clearly above the recommended species thresholds. According to the rules of priority and in view of the results obtained, S. haliotis is to be considered a later heterotypic synonym of S. algae. Because the whole-genome sequence of Shewanella sp. strain MN-01 shares >99 % ANI with S. algae JCM 14758 T , it can be confidently identified as S. algae.

Tolerance of Anaerobic Bacteria to Chlorinated Solvents

PubMed Central

Koenig, Joanna C.; Groissmeier, Kathrin D.; Manefield, Mike J.

2014-01-01

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

Reduced Heme Levels Underlie the Exponential Growth Defect of the Shewanella oneidensis hfq Mutant

PubMed Central

Mezoian, Taylor; Hunt, Taylor M.; Keane, Meaghan L.; Leonard, Jessica N.; Scola, Shelby E.; Beer, Emma N.; Perdue, Sarah; Pellock, Brett J.

2014-01-01

The RNA chaperone Hfq fulfills important roles in small regulatory RNA (sRNA) function in many bacteria. Loss of Hfq in the dissimilatory metal reducing bacterium Shewanella oneidensis strain MR-1 results in slow exponential phase growth and a reduced terminal cell density at stationary phase. We have found that the exponential phase growth defect of the hfq mutant in LB is the result of reduced heme levels. Both heme levels and exponential phase growth of the hfq mutant can be completely restored by supplementing LB medium with 5-aminolevulinic acid (5-ALA), the first committed intermediate synthesized during heme synthesis. Increasing expression of gtrA, which encodes the enzyme that catalyzes the first step in heme biosynthesis, also restores heme levels and exponential phase growth of the hfq mutant. Taken together, our data indicate that reduced heme levels are responsible for the exponential growth defect of the S. oneidensis hfq mutant in LB medium and suggest that the S. oneidensis hfq mutant is deficient in heme production at the 5-ALA synthesis step. PMID:25356668

Cr isotope fractionation factors for Cr(VI) reduction by a metabolically diverse group of bacteria

NASA Astrophysics Data System (ADS)

Basu, Anirban; Johnson, Thomas M.; Sanford, Robert A.

2014-10-01

Reduction of Cr(VI) is an important process that determines the geochemical behavior, mobility and bioavailability of Cr in both terrestrial and marine environments. Many metabolically diverse microorganisms possess Cr(VI) reduction capacity. Cr(VI) reduction fractionates Cr isotopes and thus 53Cr/52Cr ratios can be used to monitor Cr(VI) reduction and redox conditions. The magnitude of isotopic fractionation (ε) for a variety of microbial reduction mechanisms must be known for accurate interpretation of observed shifts in 53Cr/52Cr ratios. We determined isotopic fractionation factors for Cr(VI) reduction by metal reducers Geobacter sulfurreducens and Shewanella sp. strain NR, a denitrifying soil bacterium Pseudomonas stutzeri DCP-Ps1, and a sulfate reducer Desulfovibrio vulgaris. All bacteria investigated in this study produced significant Cr isotope fractionation. The fractionation (ε) for G. sulfurreducens, Shewanella sp. (NR), P. stutzeri DCP-Ps1, and D. vulgaris were -3.03‰ ± 0.12‰, -2.17‰ ± 0.22‰, -3.14‰ ± 0.13‰, and -3.01‰ ± 0.11‰, respectively. Despite differences in microbial strains in this study, the ε did not vary significantly except for Shewanella sp. (NR). Our results suggest that strong isotopic fractionation is induced during Cr(VI) reduction under electron donor poor (∼300 μM) conditions.

Culturable diversity of halophilic bacteria in foreshore soils

PubMed Central

Irshad, Aarzoo; Ahmad, Irshad; Kim, Seung Bum

2014-01-01

Halophilic bacteria are commonly found in natural environments containing significant concentration of NaCl such as inland salt lakes and evaporated sea-shore pools, as well as environments such as curing brines, salted food products and saline soils. Dependence on salt is an important phenotypic characteristic of halophilic bacteria, which can be used in the polyphasic characterization of newly discovered microorganisms. In this study the diversity of halophilic bacteria in foreshore soils of Daecheon, Chungnam, and Saemangeum, Jeonbuk, was investigated. Two types of media, namely NA and R2A supplemented with 3%, 5%, 9%, 15%, 20% and 30% NaCl were used. More than 200 halophilic bacteria were isolated and BOX-PCR fingerprinting analysis was done for the typing of the isolates. The BLAST identification results showed that isolated strains were composed of 4 phyla, Firmicutes (60%), Proteobacteria (31%), Bacteriodetes (5%) and Actinobacteria (4%). Isolates were affiliated with 16 genera and 36 species. Bacillus was the dominant genus in the phylum Firmicutes, comprising 24% of the total isolates. Halomonas (12%) and Shewanella (12%) were also found as the main genera. These findings show that the foreshore soil of Daecheon Beach and Saemangeum Sea of Korea represents an untapped source of bacterial biodiversity. PMID:25242943

Culturable diversity of halophilic bacteria in foreshore soils.

PubMed

Irshad, Aarzoo; Ahmad, Irshad; Kim, Seung Bum

2014-01-01

Halophilic bacteria are commonly found in natural environments containing significant concentration of NaCl such as inland salt lakes and evaporated sea-shore pools, as well as environments such as curing brines, salted food products and saline soils. Dependence on salt is an important phenotypic characteristic of halophilic bacteria, which can be used in the polyphasic characterization of newly discovered microorganisms. In this study the diversity of halophilic bacteria in foreshore soils of Daecheon, Chungnam, and Saemangeum, Jeonbuk, was investigated. Two types of media, namely NA and R2A supplemented with 3%, 5%, 9%, 15%, 20% and 30% NaCl were used. More than 200 halophilic bacteria were isolated and BOX-PCR fingerprinting analysis was done for the typing of the isolates. The BLAST identification results showed that isolated strains were composed of 4 phyla, Firmicutes (60%), Proteobacteria (31%), Bacteriodetes (5%) and Actinobacteria (4%). Isolates were affiliated with 16 genera and 36 species. Bacillus was the dominant genus in the phylum Firmicutes, comprising 24% of the total isolates. Halomonas (12%) and Shewanella (12%) were also found as the main genera. These findings show that the foreshore soil of Daecheon Beach and Saemangeum Sea of Korea represents an untapped source of bacterial biodiversity.

Ferrihydrite-associated organic matter (OM) stimulates reduction by Shewanella oneidensis MR-1 and a complex microbial consortia

NASA Astrophysics Data System (ADS)

Cooper, Rebecca Elizabeth; Eusterhues, Karin; Wegner, Carl-Eric; Totsche, Kai Uwe; Küsel, Kirsten

2017-11-01

The formation of Fe(III) oxides in natural environments occurs in the presence of natural organic matter (OM), resulting in the formation of OM-mineral complexes that form through adsorption or coprecipitation processes. Thus, microbial Fe(III) reduction in natural environments most often occurs in the presence of OM-mineral complexes rather than pure Fe(III) minerals. This study investigated to what extent does the content of adsorbed or coprecipitated OM on ferrihydrite influence the rate of Fe(III) reduction by Shewanella oneidensis MR-1, a model Fe(III)-reducing microorganism, in comparison to a microbial consortium extracted from the acidic, Fe-rich Schlöppnerbrunnen fen. We found that increased OM content led to increased rates of microbial Fe(III) reduction by S. oneidensis MR-1 in contrast to earlier findings with the model organism Geobacter bremensis. Ferrihydrite-OM coprecipitates were reduced slightly faster than ferrihydrites with adsorbed OM. Surprisingly, the complex microbial consortia stimulated by a mixture of electrons donors (lactate, acetate, and glucose) mimics S. oneidensis under the same experimental Fe(III)-reducing conditions suggesting similar mechanisms of electron transfer whether or not the OM is adsorbed or coprecipitated to the mineral surfaces. We also followed potential shifts of the microbial community during the incubation via 16S rRNA gene sequence analyses to determine variations due to the presence of adsorbed or coprecipitated OM-ferrihydrite complexes in contrast to pure ferrihydrite. Community profile analyses showed no enrichment of typical model Fe(III)-reducing bacteria, such as Shewanella or Geobacter sp., but an enrichment of fermenters (e.g., Enterobacteria) during pure ferrihydrite incubations which are known to use Fe(III) as an electron sink. Instead, OM-mineral complexes favored the enrichment of microbes including Desulfobacteria and Pelosinus sp., both of which can utilize lactate and acetate as an electron

The Phantom Menace for Patients with Hepatobiliary Diseases: Shewanella haliotis, Often Misidentified as Shewanella algae in Biochemical Tests and MALDI-TOF Analysis.

PubMed

Byun, Jung-Hyun; Park, Hyunwoong; Kim, Sunjoo

2017-03-24

Although Shewanella algae has been known to have weak pathogenicity, case reports on infections with this species have been steadily increasing. S. algae and S. haliotis are difficult to distinguish from each other with conventional phenotypic methods. We reviewed the microbiological and clinical features of S. algae and S. haliotis infections at our institute. Bacterial culture and identification reports from patient samples from 2010 to 2014 were reviewed to screen the cases of Shewanella infections. In addition to conventional biochemical tests, 16S rRNA gene sequence analysis and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry were performed for 19 stored bacterial isolates. Medical records were reviewed for clinical characteristics and laboratory findings. All isolates were identified as S. algae by using VITEK 2. MALDI-TOF also identified all isolates as S. algae with a 99.9 confidence value. In contrast, 16S rRNA analysis identified 10 isolates as S. algae and 9 isolates as S. haliotis. Both S. algae (60%) and S. haliotis (77%) infections were strongly associated with diseases of the hepatobiliary tract and pancreas. To distinguish between S. algae and S. haliotis, 16S rRNA gene sequence analysis seems more accurate than biochemical tests or MALDI-TOF. Patients with underlying diseases in the hepatobiliary tract and pancreas seem to be susceptible to these marine pathogens.

Photoreduction of Shewanella oneidensis Extracellular Cytochromes by Organic Chromophores and Dye‐Sensitized TiO2

PubMed Central

Ainsworth, Emma V.; Lockwood, Colin W. J.; White, Gaye F.; Hwang, Ee Taek; Sakai, Tsubasa; Gross, Manuela A.; Richardson, David J.; Clarke, Thomas A.

2016-01-01

Abstract The transfer of photoenergized electrons from extracellular photosensitizers across a bacterial cell envelope to drive intracellular chemical transformations represents an attractive way to harness nature's catalytic machinery for solar‐assisted chemical synthesis. In Shewanella oneidensis MR‐1 (MR‐1), trans‐outer‐membrane electron transfer is performed by the extracellular cytochromes MtrC and OmcA acting together with the outer‐membrane‐spanning porin⋅cytochrome complex (MtrAB). Here we demonstrate photoreduction of solutions of MtrC, OmcA, and the MtrCAB complex by soluble photosensitizers: namely, eosin Y, fluorescein, proflavine, flavin, and adenine dinucleotide, as well as by riboflavin and flavin mononucleotide, two compounds secreted by MR‐1. We show photoreduction of MtrC and OmcA adsorbed on RuII‐dye‐sensitized TiO2 nanoparticles and that these protein‐coated particles perform photocatalytic reduction of solutions of MtrC, OmcA, and MtrCAB. These findings provide a framework for informed development of strategies for using the outer‐membrane‐associated cytochromes of MR‐1 for solar‐driven microbial synthesis in natural and engineered bacteria. PMID:27685371

In Situ Characterization of Shewanella oneidensis MR1 Biofilms by SALVI and ToF-SIMS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komorek, Rachel; Wei, Wenchao; Yu, Xiaofei

Bacterial biofilms are surface-associated communities that are vastly studied to understand their self-produced extracellular polymeric substances (EPS) and their roles in environmental microbiology. This study outlines a method to cultivate biofilm attachment to the System for Analysis at the Liquid Vacuum Interface (SALVI) and achieve in situ chemical mapping of a living biofilm by time-of-flight secondary ion mass spectrometry (ToF-SIMS). This is done through the culturing of bacteria both outside and within the SALVI channel with our specialized setup, as well as through optical imaging techniques to detect the biofilm presence and thickness before ToF-SIMS analysis. Our results show themore » characteristic peaks of the Shewanella biofilm in its natural hydrated state, highlighting upon its localized water cluster environment, as well as EPS fragments, which are drastically different from the same biofilm’s dehydrated state. These results demonstrate the breakthrough capability of SALVI that allows for in situ biofilm imaging with a vacuum-based chemical imaging instrument.« less

Aerated Shewanella oneidensis in Continuously-fed Bioelectrochemical Systems for Power and Hydrogen Production

USDA-ARS?s Scientific Manuscript database

We studied the effects of aeration of Shewanella oneidensis on potentiostatic current production, iron(III) reduction, hydrogen production in a microbial electrolysis cell, and electric power generation in a microbial fuel cell. The potentiostatic performance of aerated S. oneidensis was considerab...

Effect of electrode sub-micron surface feature size on current generation of Shewanella oneidensis in microbial fuel cells

NASA Astrophysics Data System (ADS)

Ye, Zhou; Ellis, Michael W.; Nain, Amrinder S.; Behkam, Bahareh

2017-04-01

Microbial fuel cells (MFCs) are envisioned to serve as compact and sustainable sources of energy; however, low current and power density have hindered their widespread use. Introduction of 3D micro/nanostructures on the MFC anode is known to improve its performance by increasing the surface area available for bacteria attachment; however, the role of the feature size remains poorly understood. To delineate the role of feature size from the ensuing surface area increase, nanostructures with feature heights of 115 nm and 300 nm, both at a height to width aspect ratio of 0.3, are fabricated in a grid pattern on glassy carbon electrodes (GCEs). Areal current densities and bacteria attachment densities of the patterned and unpatterned GCEs are compared using Shewanella oneidensis Δbfe in a three-electrode bioreactor. The 115 nm features elicit a remarkable 40% increase in current density and a 78% increase in bacterial attachment density, whereas the GCE with 300 nm pattern does not exhibit significant change in current density or bacterial attachment density. The current density dependency on feature size is maintained over the entire 160 h experiment. Thus, optimally sized surface features have a substantial effect on current production that is independent of their effect on surface area.

Effect of anode polarization on biofilm formation and electron transfer in Shewanella oneidensis/graphite felt microbial fuel cells.

PubMed

Pinto, David; Coradin, Thibaud; Laberty-Robert, Christel

2018-04-01

In microbial fuel cells, electricity generation is assumed by bacterial degradation of low-grade organics generating electrons that are transferred to an electrode. The nature and efficiency of the electron transfer from the bacteria to the electrodes are determined by several chemical, physical and biological parameters. Specifically, the application of a specific potential at the bioanode has been shown to stimulate the formation of an electro-active biofilm, but the underlying mechanisms remain poorly understood. In this study, we have investigated the effect of an applied potential on the formation and electroactivity of biofilms established by Shewanella oneidensis bacteria on graphite felt electrodes in single- and double-chamber reactor configurations in oxic conditions. Using amperometry, cyclic voltammetry, and OCP/Power/Polarization curves techniques, we showed that a potential ranging between -0.3V and +0.5V (vs. Ag/AgCl/KCl sat.) and its converse application to a couple of electrodes leads to different electrochemical behaviors, anodic currents and biofilm architectures. For example, when the bacteria were confined in the anodic compartment of a double-chamber cell, a negative applied potential (-0.3V) at the bioanode favors a mediated electron transfer correlated with the progressive formation of a biofilm that fills the felt porosity and bridges the graphite fibers. In contrast, a positive applied potential (+0.3V) at the bioanode stimulates a direct electron transfer resulting in the fast-bacterial colonization of the fibers only. These results provide significant insight for the understanding of the complex bacteria-electrode interactions in microbial fuel cells. Copyright © 2017 Elsevier B.V. All rights reserved.

[A rare cause of pneumonia: Shewanella putrefaciens].

PubMed

Durdu, Bülent; Durdu, Yasemin; Güleç, Nuray; Islim, Filiz; Biçer, Mualla

2012-01-01

Shewanella putrefaciens is a gram-negative, non-fermentative, oxidase positive, motile bacillus that produces hydrogen sulphide. It is found widely in the nature especially in marine environments. Although it is accepted as saprophytic, different clinical syndromes, most commonly skin or soft tissue infections, have been associated with S.putrefaciens, mainly in immunocompromised cases and patients with underlying diseases. However, pneumonia cases due to S.putrefaciens are quite limited in the literature. In this report, a case of pneumonia caused by S.putrefaciens was presented. A 43-year-old female patient was admitted to our hospital with the complaints of fever, cough, sputum and weakness. The patient has had brochiectasis since childhood and has used periodical antibiotic therapies due to pneumoniae episodes. She was diagnosed to have pneumonia based on the clinical, radiological and laboratory findings, and empirical antibiotic treatment with ciprofloxacin and ceftazidime combination was initiated. Gram-stained smear of sputum yielded abundant leucocytes and gram-negative bacteria, and the isolate grown in the sputum culture was identified as S.putrefaciens by conventional methods and API 20 NE (BioMerieux, France) system. The isolate was found susceptible to ceftriaxone, ceftazidime, cefepime, ciprofloxacin, piperacillin-tazobactam, cephoperazon-sulbactam, imipenem, amikacin, gentamicin and trimethoprime-sulphametoxazole; whereas resistant to ampicillin, amoxycillin-clavulanate, cefazolin and cefuroxime, by Kirby-Bauer disk diffusion method. According to the antibiogram results, the therapy was changed to ceftriaxone (1 x 2 g, intravenous). The patient was discharged with complete cure after 14 days of therapy. In conclusion, S.putrefaciens should be considered in patients with predisposing factors as an unusual cause of pneumonia and the characteristics such as H2S production and sensitivity to third generation cephalosporins and penicillins should be used

Antimicrobial effects of a new therapeutic liquid dentifrice formulation on oral bacteria including odorigenic species.

PubMed

Sreenivasan, P K; Furgang, D; Zhang, Y; DeVizio, W; Fine, D H

2005-03-01

The control of oral malodor is well-recognized in efforts to improve oral health. Antimicrobial formulations can mitigate oral malodor, however, procedures to assess effects on oral bacteria including those implicated in halitosis are unavailable. This investigation examined the antimicrobial effects of a new liquid triclosan/copolymer dentifrice (test) formulation that demonstrated significant inhibition of oral malodor in previous organoleptic clinical studies. Procedures compared antimicrobial effects of the test and control formulations on a range of oral micro-organisms including members implicated in halitosis, substantive antimicrobial effects of formulations with hydroxyapatite as a surrogate for human teeth and ex vivo effects on oral bacteria from human volunteers. With Actinomyces viscosus, as a model system, the test formulation demonstrated a dose-dependent effect. At these concentrations the test formulation provided significant antimicrobial effects on 13 strains of oral bacteria including those implicated in bad breath at selected posttreatment time points. Treatment of hydroxyapatite by the test dentifrice resulted in a significant and substantive antimicrobial effect vs. controls. Oral bacteria from subjects treated ex vivo with the test dentifrice resulted in significant reductions in cultivable oral bacteria and odorigenic bacteria producing hydrogen sulfide. In summary, microbiological methods adapted to study odorigenic bacteria demonstrate the significant antimicrobial effects of the test (triclosan/copolymer) dentifrice with laboratory and clinical strains of oral bacteria implicated in bad breath.

Evidence-Based Annotation of Gene Function in Shewanella oneidensis MR-1 Using Genome-Wide Fitness Profiling across 121 Conditions

PubMed Central

Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.; Shao, Wenjun; Baumohl, Jason K.; Xu, Zhuchen; Nguyen, Michelle; Tamse, Raquel; Davis, Ronald W.; Arkin, Adam P.

2011-01-01

Most genes in bacteria are experimentally uncharacterized and cannot be annotated with a specific function. Given the great diversity of bacteria and the ease of genome sequencing, high-throughput approaches to identify gene function experimentally are needed. Here, we use pools of tagged transposon mutants in the metal-reducing bacterium Shewanella oneidensis MR-1 to probe the mutant fitness of 3,355 genes in 121 diverse conditions including different growth substrates, alternative electron acceptors, stresses, and motility. We find that 2,350 genes have a pattern of fitness that is significantly different from random and 1,230 of these genes (37% of our total assayed genes) have enough signal to show strong biological correlations. We find that genes in all functional categories have phenotypes, including hundreds of hypotheticals, and that potentially redundant genes (over 50% amino acid identity to another gene in the genome) are also likely to have distinct phenotypes. Using fitness patterns, we were able to propose specific molecular functions for 40 genes or operons that lacked specific annotations or had incomplete annotations. In one example, we demonstrate that the previously hypothetical gene SO_3749 encodes a functional acetylornithine deacetylase, thus filling a missing step in S. oneidensis metabolism. Additionally, we demonstrate that the orphan histidine kinase SO_2742 and orphan response regulator SO_2648 form a signal transduction pathway that activates expression of acetyl-CoA synthase and is required for S. oneidensis to grow on acetate as a carbon source. Lastly, we demonstrate that gene expression and mutant fitness are poorly correlated and that mutant fitness generates more confident predictions of gene function than does gene expression. The approach described here can be applied generally to create large-scale gene-phenotype maps for evidence-based annotation of gene function in prokaryotes. PMID:22125499

Structural and Biochemical Characterization of a Bifunctional Ketoisomerase/N-acetyltransferase from Shewanella denitrificans¶

PubMed Central

Chantigian, Daniel P.; Thoden, James B.; Holden, Hazel M.

2014-01-01

Unusual N-acetylated sugars have been observed on the O-antigens of some Gram-negative bacteria and on the S-layers of both Gram-positive and Gram-negative bacteria. One such sugar is 3-acetamido-3,6-dideoxy-α-d-galactose or Fuc3NAc. The pathway for its production requires five enzymes with the first step involving the attachment of dTMP to glucose-1-phosphate. Here we report a structural and biochemical characterization of a bifunctional enzyme from Shewanella denitificans thought to be involved in the biosynthesis of dTDP-Fuc3NAc. On the basis of a bioinformatics analysis, the enzyme, hereafter referred to as FdtD, has been postulated to catalyze the third and fifth steps in the pathway, namely a 3,4-keto isomerization and an N-acetyltransferase reaction. For the X-ray analysis reported here, the enzyme was crystallized in the presence of dTDP and CoA. The crystal structure shows that FdtD adopts a hexameric quaternary structure with 322 symmetry. Each subunit of the hexamer folds into two distinct domains connected by a flexible loop. The N-terminal domain adopts a left-handed β-helix motif and is responsible for the N-acetylation reaction. The C-terminal domain folds into an antiparallel flattened β-barrel that harbors the active site responsible for the isomerization reaction. Biochemical assays verify the two proposed catalytic activities of the enzyme and reveal that the 3,4-keto isomerization event leads to inversion of configuration about the hexose C-4' carbon. PMID:24128043

Multi-heme Cytochromes in Shewanella oneidensis MR-1: Structures, functions and opportunities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen

Multi-heme cytochromes are employed by a range of microorganisms to transport electrons over distances of up to tens of nanometers. Perhaps the most spectacular utilization of these proteins is in the reduction of extracellular solid substrates, including electrodes and insoluble mineral oxides of Fe(III) and Mn(III/IV), by species of Shewanella and Geobacter. However, multi-heme cytochromes are found in numerous and phylogenetically diverse prokaryotes where they participate in electron transfer and redox catalysis that contributes to biogeochemical cycling of N, S and Fe on the global scale. These properties of multi-heme cytochromes have attracted much interest and contributed to advances inmore » bioenergy applications and bioremediation of contaminated soils. Looking forward there are opportunities to engage multi-heme cytochromes for biological photovoltaic cells, microbial electrosynthesis and developing bespoke molecular devices. As a consequence it is timely to review our present understanding of these proteins and we do this here with a focus on the multitude of functionally diverse multi-heme cytochromes in Shewanella oneidensis MR-1. We draw on findings from experimental and computational approaches which ideally complement each other in the study of these systems: computational methods can interpret experimentally determined properties in terms of molecular structure to cast light on the relation between structure and function. We show how this synergy has contributed to our understanding of multi-heme cytochromes and can be expected to continue to do so for greater insight into natural processes and their informed exploitation in biotechnologies.« less

Multi-haem cytochromes in Shewanella oneidensis MR-1: structures, functions and opportunities

PubMed Central

Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen; Butt, Julea N.

2015-01-01

Multi-haem cytochromes are employed by a range of microorganisms to transport electrons over distances of up to tens of nanometres. Perhaps the most spectacular utilization of these proteins is in the reduction of extracellular solid substrates, including electrodes and insoluble mineral oxides of Fe(III) and Mn(III/IV), by species of Shewanella and Geobacter. However, multi-haem cytochromes are found in numerous and phylogenetically diverse prokaryotes where they participate in electron transfer and redox catalysis that contributes to biogeochemical cycling of N, S and Fe on the global scale. These properties of multi-haem cytochromes have attracted much interest and contributed to advances in bioenergy applications and bioremediation of contaminated soils. Looking forward, there are opportunities to engage multi-haem cytochromes for biological photovoltaic cells, microbial electrosynthesis and developing bespoke molecular devices. As a consequence, it is timely to review our present understanding of these proteins and we do this here with a focus on the multitude of functionally diverse multi-haem cytochromes in Shewanella oneidensis MR-1. We draw on findings from experimental and computational approaches which ideally complement each other in the study of these systems: computational methods can interpret experimentally determined properties in terms of molecular structure to cast light on the relation between structure and function. We show how this synergy has contributed to our understanding of multi-haem cytochromes and can be expected to continue to do so for greater insight into natural processes and their informed exploitation in biotechnologies. PMID:25411412

Synthetic and Evolutionary Construction of a Chlorate-Reducing Shewanella oneidensis MR-1

PubMed Central

Clark, Iain C.; Melnyk, Ryan A.; Youngblut, Matthew D.; Carlson, Hans K.; Iavarone, Anthony T.

2015-01-01

ABSTRACT Despite evidence for the prevalence of horizontal gene transfer of respiratory genes, little is known about how pathways functionally integrate within new hosts. One example of a mobile respiratory metabolism is bacterial chlorate reduction, which is frequently encoded on composite transposons. This implies that the essential components of the metabolism are encoded on these mobile elements. To test this, we heterologously expressed genes for chlorate reduction from Shewanella algae ACDC in the non-chlorate-reducing Shewanella oneidensis MR-1. The construct that ultimately endowed robust growth on chlorate included cld, a cytochrome c gene, clrABDC, and two genes of unknown function. Although strain MR-1 was unable to grow on chlorate after initial insertion of these genes into the chromosome, 11 derived strains capable of chlorate respiration were obtained through adaptive evolution. Genome resequencing indicated that all of the evolved chlorate-reducing strains replicated a large genomic region containing chlorate reduction genes. Contraction in copy number and loss of the ability to reduce chlorate were also observed, indicating that this phenomenon was extremely dynamic. Although most strains contained more than six copies of the replicated region, a single strain with less duplication also grew rapidly. This strain contained three additional mutations that we hypothesized compensated for the low copy number. We remade the mutations combinatorially in the unevolved strain and determined that a single nucleotide polymorphism (SNP) upstream of cld enabled growth on chlorate and was epistatic to a second base pair change in the NarP binding sequence between narQP and nrfA that enhanced growth. PMID:25991681

Contribution of Extracellular Polymeric Substances from Shewanella sp. HRCR-1 Biofilms to U(VI) Immobilization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao, Bin; Ahmed, B.; Kennedy, David W.

2011-06-05

The goal of this study was to quantify the contribution of extracellular polymeric substances (EPS) in U(VI) immobilization by Shewanella sp. HRCR-1. Through comparison of U(VI) immobilization using cells with bound EPS (bEPS) and cells without EPS, we showed that i) bEPS from Shewanella sp. HRCR-1 biofilms contributed significantly to U(VI) immobilization, especially at low initial U(VI) concentrations, through both sorption and reduction; ii) bEPS could be considered as a functional extension of the cells for U(VI) immobilization and they likely play more important roles at initial U(VI) concentrations; and iii) U(VI) reduction efficiency was found to be dependent uponmore » initial U(VI) concentration and the efficiency decreased at lower concentrations. To quantify relative contribution of sorption and reduction in U(VI) immobilization by EPS fractions, we isolated loosely associated EPS (laEPS) and bEPS from Shewanella sp. HRCR-1 biofilms grown in a hollow fiber membrane biofilm reactor and tested their reactivity with U(V). We found that, when in reduced form, the isolated cell-free EPS fractions could reduce U(VI). Polysaccharides in the EPS likely contributed to U(VI) sorption and dominated reactivity of laEPS while redox active components (e.g., outer membrane c-type cytochromes), especially in bEPS, might facilitate U(VI) reduction.« less

Contribution of extracellular polymeric substances from Shewanella sp. HRCR-1 biofilms to U(VI) immobilization.

PubMed

Cao, Bin; Ahmed, Bulbul; Kennedy, David W; Wang, Zheming; Shi, Liang; Marshall, Matthew J; Fredrickson, Jim K; Isern, Nancy G; Majors, Paul D; Beyenal, Haluk

2011-07-01

The goal of this study was to quantify the contribution of extracellular polymeric substances (EPS) to U(VI) immobilization by Shewanella sp. HRCR-1. Through comparison of U(VI) immobilization using cells with bound EPS (bEPS) and cells with minimal EPS, we show that (i) bEPS from Shewanella sp. HRCR-1 biofilms contribute significantly to U(VI) immobilization, especially at low initial U(VI) concentrations, through both sorption and reduction; (ii) bEPS can be considered a functional extension of the cells for U(VI) immobilization and they likely play more important roles at lower initial U(VI) concentrations; and (iii) the U(VI) reduction efficiency is dependent upon the initial U(VI) concentration and decreases at lower concentrations. To quantify the relative contributions of sorption and reduction to U(VI) immobilization by EPS fractions, we isolated loosely associated EPS (laEPS) and bEPS from Shewanella sp. HRCR-1 biofilms grown in a hollow fiber membrane biofilm reactor and tested their reactivity with U(VI). We found that, when reduced, the isolated cell-free EPS fractions could reduce U(VI). Polysaccharides in the EPS likely contributed to U(VI) sorption and dominated the reactivity of laEPS, while redox active components (e.g., outer membrane c-type cytochromes), especially in bEPS, possibly facilitated U(VI) reduction.

Biogenic formation of photoactive arsenic-sulfide nanotubes by Shewanella sp. strain HN-41

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ji-Hoon; Kim, Min-Gyu; Yoo, Bongyoung

2007-12-18

Microorganisms facilitate the formation of a wide range of minerals that have unique physical and chemical properties as well as morphologies that are not produced by abiotic processes. Here, we report the production of an extensive extracellular network of filamentous, arsenic-sulfide (As-S) nanotubes (20–100 nm in diameter by 30 µm in length) by the dissimilatory metal-reducing bacterium Shewanella sp. HN-41. The As-S nanotubes, formed via the reduction of As(V) and S2O, were initially amorphous As2S3 but evolved with increasing incubation time toward polycrystalline phases of the chalcogenide minerals realgar (AsS) and duranusite (As4S). Upon maturation, the As-S nanotubes behaved asmore » metals and semiconductors in terms of their electrical and photoconductive properties, respectively. The As-S nanotubes produced by Shewanella may provide useful materials for novel nano- and opto-electronic devices.« less

Enhanced eicosapentaenoic acid production by a new deep-sea marine bacterium Shewanella electrodiphila MAR441T.

PubMed

Zhang, Jinwei; Burgess, J Grant

2017-01-01

Omega-3 fatty acids are products of secondary metabolism, essential for growth and important for human health. Although there are numerous reports of bacterial production of omega-3 fatty acids, less information is available on the biotechnological production of these compounds from bacteria. The production of eicosapentaenoic acid (EPA, 20:5ω3) by a new species of marine bacteria Shewanella electrodiphila MAR441T was investigated under different fermentation conditions. This strain produced a high percentage (up to 26%) of total fatty acids and high yields (mg / g of biomass) of EPA at or below the optimal growth temperature. At higher growth temperatures these values decreased greatly. The amount of EPA produced was affected by the carbon source, which also influenced fatty acid composition. This strain required Na+ for growth and EPA synthesis and cells harvested at late exponential or early stationary phase had a higher EPA content. Both the highest amounts (20 mg g-1) and highest percent EPA content (18%) occurred with growth on L-proline and (NH4)2SO4. The addition of cerulenin further enhanced EPA production to 30 mg g-1. Chemical mutagenesis using NTG allowed the isolation of mutants with improved levels of EPA content (from 9.7 to 15.8 mg g-1) when grown at 15°C. Thus, the yields of EPA could be substantially enhanced without the need for recombinant DNA technology, often a commercial requirement for food supplement manufacture.

Enhanced eicosapentaenoic acid production by a new deep-sea marine bacterium Shewanella electrodiphila MAR441T

PubMed Central

Burgess, J. Grant

2017-01-01

Omega-3 fatty acids are products of secondary metabolism, essential for growth and important for human health. Although there are numerous reports of bacterial production of omega-3 fatty acids, less information is available on the biotechnological production of these compounds from bacteria. The production of eicosapentaenoic acid (EPA, 20:5ω3) by a new species of marine bacteria Shewanella electrodiphila MAR441T was investigated under different fermentation conditions. This strain produced a high percentage (up to 26%) of total fatty acids and high yields (mg / g of biomass) of EPA at or below the optimal growth temperature. At higher growth temperatures these values decreased greatly. The amount of EPA produced was affected by the carbon source, which also influenced fatty acid composition. This strain required Na+ for growth and EPA synthesis and cells harvested at late exponential or early stationary phase had a higher EPA content. Both the highest amounts (20 mg g-1) and highest percent EPA content (18%) occurred with growth on L-proline and (NH4)2SO4. The addition of cerulenin further enhanced EPA production to 30 mg g-1. Chemical mutagenesis using NTG allowed the isolation of mutants with improved levels of EPA content (from 9.7 to 15.8 mg g-1) when grown at 15°C. Thus, the yields of EPA could be substantially enhanced without the need for recombinant DNA technology, often a commercial requirement for food supplement manufacture. PMID:29176835

Electron acceptor redox potential globally regulates transcriptomic profiling in Shewanella decolorationis S12

NASA Astrophysics Data System (ADS)

Lian, Yingli; Yang, Yonggang; Guo, Jun; Wang, Yan; Li, Xiaojing; Fang, Yun; Gan, Lixia; Xu, Meiying

2016-08-01

Electron acceptor redox potential (EARP) was presumed to be a determining factor for microbial metabolism in many natural and engineered processes. However, little is known about the potentially global effects of EARP on bacteria. In this study, we compared the physiological and transcriptomic properties of Shewanella decolorationis S12 respiring with different EARPs in microbial electrochemical systems to avoid the effects caused by the other physicochemical properties of real electron acceptor. Results showed that the metabolic activities of strain S12 were nonlinear responses to EARP. The tricarboxylic acid cycle for central carbon metabolism was down-regulated while glyoxylate shunt was up-regulated at 0.8 V compared to 0.2 and -0.2 V, which suggested that EARP is an important but not the only determinant for metabolic pathways of strain S12. Moreover, few cytochrome c genes were differentially expressed at different EARPs. The energy intensive flagella assembly and assimilatory sulfur metabolism pathways were significantly enriched at 0.8 V, which suggested strain S12 had stronger electrokinesis behavior and oxidative stress-response at high EARP. This study provides the first global information of EARP regulations on microbial metabolism, which will be helpful for understanding microorganism respiration.

Efficiencies of Bio-electrocatalytic Production of Hydrogen from Lactate Using Shewanella oneidensis MR-1

USDA-ARS?s Scientific Manuscript database

Shewanella oneidensis MR-1 was grown in a chemostatic, continuously-fed bioelectrochemical cell under slightly aerated conditions. The start-up phase was controlled potentiostatically (0.4 V vs. SHE). When a stable performance was achieved, the reactor was switched to bio-electrocatalytic producti...

Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy

Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less

Water Dynamics in Shewanella oneidensis at Ambient and High Pressure using Quasi-Elastic Neutron Scattering.

PubMed

Foglia, Fabrizia; Hazael, Rachael; Simeoni, Giovanna G; Appavou, Marie-Sousai; Moulin, Martine; Haertlein, Michael; Trevor Forsyth, V; Seydel, Tilo; Daniel, Isabelle; Meersman, Filip; McMillan, Paul F

2016-01-07

Quasielastic neutron scattering (QENS) is an ideal technique for studying water transport and relaxation dynamics at pico- to nanosecond timescales and at length scales relevant to cellular dimensions. Studies of high pressure dynamic effects in live organisms are needed to understand Earth's deep biosphere and biotechnology applications. Here we applied QENS to study water transport in Shewanella oneidensis at ambient (0.1 MPa) and high (200 MPa) pressure using H/D isotopic contrast experiments for normal and perdeuterated bacteria and buffer solutions to distinguish intracellular and transmembrane processes. The results indicate that intracellular water dynamics are comparable with bulk diffusion rates in aqueous fluids at ambient conditions but a significant reduction occurs in high pressure mobility. We interpret this as due to enhanced interactions with macromolecules in the nanoconfined environment. Overall diffusion rates across the cell envelope also occur at similar rates but unexpected narrowing of the QENS signal appears between momentum transfer values Q = 0.7-1.1 Å(-1) corresponding to real space dimensions of 6-9 Å. The relaxation time increase can be explained by correlated dynamics of molecules passing through Aquaporin water transport complexes located within the inner or outer membrane structures.

Flavins secreted by bacterial cells of Shewanella catalyze cathodic oxygen reduction.

PubMed

Liu, Huan; Matsuda, Shoichi; Hashimoto, Kazuhito; Nakanishi, Shuji

2012-06-01

On Her Majesty's Secrete Service: Oxygen reduction is an important process for microbial fuel cells (MFCs) and microbiologically-influenced corrosion (MIC). We demonstrate that flavins secreted by anode-respiring Shewanella cells can catalyze cathodic oxygen reduction via adsorption on the cathode. The findings will provide new insight for developing methods to improve MFC performance and to prevent MIC. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Methods for imaging Shewanella oneidensis MR-1 nanofilaments.

PubMed

Ray, R; Lizewski, S; Fitzgerald, L A; Little, B; Ringeisen, B R

2010-08-01

Nanofilament production by Shewanella oneidensis MR-1 was evaluated as a function of lifestyle (planktonic vs. sessile) under aerobic and anaerobic conditions using different sample preparation techniques prior to imaging with scanning electron microscopy. Nanofilaments could be imaged on MR-1 cells grown in biofilms or planktonically under both aerobic and anaerobic batch culture conditions after fixation, critical point drying and coating with a conductive metal. Critical point drying was a requirement for imaging nanofilaments attached to planktonically grown MR-1 cells, but not for cells grown in a biofilm. Techniques described in this paper cannot be used to differentiate nanowires from pili or flagella.

Polyunsaturated fatty acids in marine bacteria and strategies to enhance their production.

PubMed

Moi, Ibrahim Musa; Leow, Adam Thean Chor; Ali, Mohd Shukuri Mohamad; Rahman, Raja Noor Zaliha Raja Abd; Salleh, Abu Bakar; Sabri, Suriana

2018-05-10

Polyunsaturated fatty acids (PUFAs) play an important role in human diet. Despite the wide-ranging importance and benefits from heart health to brain functions, humans and mammals cannot synthesize PUFAs de novo. The primary sources of PUFA are fish and plants. Due to the increasing concerns associated with food security as well as issues of environmental contaminants in fish oil, there has been considerable interest in the production of polyunsaturated fatty acids from alternative resources which are more sustainable, safer, and economical. For instance, marine bacteria, particularly the genus of Shewanella, Photobacterium, Colwellia, Moritella, Psychromonas, Vibrio, and Alteromonas, are found to be one among the major microbial producers of polyunsaturated fatty acids. Recent developments in the area with a focus on the production of polyunsaturated fatty acids from marine bacteria as well as the metabolic engineering strategies for the improvement of PUFA production are discussed.

Differential Regulation of the Two Ferrochelatase Paralogues in Shewanella loihica PV-4 in Response to Environmental Stresses

DOE PAGES

Qiu, Dongru; Xie, Ming; Dai, Jingcheng; ...

2016-06-10

biosynthesis of heme and cytochromes is poorly understood. In conclusion, our study has demonstrated that two ferrochelatase genes involved in heme biosynthesis are differentially regulated in response to environmental stresses, including light and reactive oxygen species. This is an excellent example showing how bacteria have evolved to maintain cellular heme homeostasis. More interestingly, the high yields of extracellular protoporphyrin IX by theShewanella loihicaPV-4 mutants could be utilized for commercial production of this valuable chemical via bacterial fermentation.« less

Differential Regulation of the Two Ferrochelatase Paralogues in Shewanella loihica PV-4 in Response to Environmental Stresses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, Dongru; Xie, Ming; Dai, Jingcheng

biosynthesis of heme and cytochromes is poorly understood. In conclusion, our study has demonstrated that two ferrochelatase genes involved in heme biosynthesis are differentially regulated in response to environmental stresses, including light and reactive oxygen species. This is an excellent example showing how bacteria have evolved to maintain cellular heme homeostasis. More interestingly, the high yields of extracellular protoporphyrin IX by theShewanella loihicaPV-4 mutants could be utilized for commercial production of this valuable chemical via bacterial fermentation.« less

Species-dependent hydrodynamics of flagellum-tethered bacteria in early biofilm development.

PubMed

Bennett, Rachel R; Lee, Calvin K; De Anda, Jaime; Nealson, Kenneth H; Yildiz, Fitnat H; O'Toole, George A; Wong, Gerard C L; Golestanian, Ramin

2016-02-01

Monotrichous bacteria on surfaces exhibit complex spinning movements. Such spinning motility is often a part of the surface detachment launch sequence of these cells. To understand the impact of spinning motility on bacterial surface interactions, we develop a hydrodynamic model of a surface-bound bacterium, which reproduces behaviours that we observe in Pseudomonas aeruginosa, Shewanella oneidensis and Vibrio cholerae, and provides a detailed dictionary for connecting observed spinning behaviour to bacteria-surface interactions. Our findings indicate that the fraction of the flagellar filament adhered to the surface, the rotation torque of this appendage, the flexibility of the flagellar hook and the shape of the bacterial cell dictate the likelihood that a microbe will detach and the optimum orientation that it should have during detachment. These findings are important for understanding species-specific reversible attachment, the key transition event between the planktonic and biofilm lifestyle for motile, rod-shaped organisms. © 2016 The Author(s).

Synthetic and Evolutionary Construction of a Chlorate-Reducing Shewanella oneidensis MR-1.

PubMed

Clark, Iain C; Melnyk, Ryan A; Youngblut, Matthew D; Carlson, Hans K; Iavarone, Anthony T; Coates, John D

2015-05-19

Despite evidence for the prevalence of horizontal gene transfer of respiratory genes, little is known about how pathways functionally integrate within new hosts. One example of a mobile respiratory metabolism is bacterial chlorate reduction, which is frequently encoded on composite transposons. This implies that the essential components of the metabolism are encoded on these mobile elements. To test this, we heterologously expressed genes for chlorate reduction from Shewanella algae ACDC in the non-chlorate-reducing Shewanella oneidensis MR-1. The construct that ultimately endowed robust growth on chlorate included cld, a cytochrome c gene, clrABDC, and two genes of unknown function. Although strain MR-1 was unable to grow on chlorate after initial insertion of these genes into the chromosome, 11 derived strains capable of chlorate respiration were obtained through adaptive evolution. Genome resequencing indicated that all of the evolved chlorate-reducing strains replicated a large genomic region containing chlorate reduction genes. Contraction in copy number and loss of the ability to reduce chlorate were also observed, indicating that this phenomenon was extremely dynamic. Although most strains contained more than six copies of the replicated region, a single strain with less duplication also grew rapidly. This strain contained three additional mutations that we hypothesized compensated for the low copy number. We remade the mutations combinatorially in the unevolved strain and determined that a single nucleotide polymorphism (SNP) upstream of cld enabled growth on chlorate and was epistatic to a second base pair change in the NarP binding sequence between narQP and nrfA that enhanced growth. The ability of chlorate reduction composite transposons to form functional metabolisms after transfer to a new host is an important part of their propagation. To study this phenomenon, we engineered Shewanella oneidensis MR-1 into a chlorate reducer. We defined a set of

Enhance wastewater biological treatment through the bacteria induced graphene oxide hydrogel.

PubMed

Shen, Liang; Jin, Ziheng; Wang, Dian; Wang, Yuanpeng; Lu, Yinghua

2018-01-01

The interaction between bacteria and graphene-family materials like pristine graphene, graphene oxide (GO) and reduced graphene oxide (rGO) is such an elusive issue that its implication in environmental biotechnology is unclear. Herein, two kinds of self-assembled bio-rGO-hydrogels (BGHs) were prepared by cultivating specific Shewanella sp. strains with GO solution for the first time. The microscopic examination by SEM, TEM and CLSM indicated a porous 3D structure of BGHs, in which live bacteria firmly anchored and extracellular polymeric substances (EPS) abundantly distributed. Spectra of XRD, FTIR, XPS and Raman further proved that GO was reduced to rGO by bacteria along with the gelation process, which suggests a potential green technique to produce graphene. Based on the characterization results, four mechanisms for the BGH formation were proposed, i.e., stacking, bridging, rolling and cross-linking of rGO sheets, through the synergistic effect of activities and EPS from special bacteria. More importantly, the BGHs obtained in this study were found able to achieve unique cleanup performance that the counterpart free bacteria could not fulfill, as exemplified in Congo red decolorization and Cr(VI) bioreduction. These findings therefore enlighten a prospective application of graphene materials for the biological treatment of wastewaters in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mechanism(s) of Electricity Production by Shewanella and Other Microbes: Understanding and Optimization

DTIC Science & Technology

2012-01-01

Kan, J. B. Flood, J.P. McCrow, J.S. Kim, L. Tan , and K.H. Nealson. 2011. A rapid fingerprinting approach to distinguish between closely related...strains of Shewanella. J. Microbiol. Methods. 86: 62-68. 33. Kan, J. Wang, Y., A. Obraztsova, G. Rosen, J. Leather , K.G. Scheckel, K.H. Nealson, and Y.M

Transcriptome Analysis of Shewanella oneidensis MR-1 in Response to Elevated Salt Conditions

PubMed Central

Liu, Yongqing; Gao, Weimin; Wang, Yue; Wu, Liyou; Liu, Xueduan; Yan, Tinfeng; Alm, Eric; Arkin, Adam; Thompson, Dorothea K.; Fields, Matthew W.; Zhou, Jizhong

2005-01-01

Whole-genomic expression patterns were examined in Shewanella oneidensis cells exposed to elevated sodium chloride. Genes involved in Na+ extrusion and glutamate biosynthesis were significantly up-regulated, and the majority of chemotaxis/motility-related genes were significantly down-regulated. The data also suggested an important role for metabolic adjustment in salt stress adaptation in S. oneidensis. PMID:15774893

Respiratory Nitrate Ammonification by Shewanella oneidensis MR-1▿

PubMed Central

Cruz-García, Claribel; Murray, Alison E.; Klappenbach, Joel A.; Stewart, Valley; Tiedje, James M.

2007-01-01

Anaerobic cultures of Shewanella oneidensis MR-1 grown with nitrate as the sole electron acceptor exhibited sequential reduction of nitrate to nitrite and then to ammonium. Little dinitrogen and nitrous oxide were detected, and no growth occurred on nitrous oxide. A mutant with the napA gene encoding periplasmic nitrate reductase deleted could not respire or assimilate nitrate and did not express nitrate reductase activity, confirming that the NapA enzyme is the sole nitrate reductase. Hence, S. oneidensis MR-1 conducts respiratory nitrate ammonification, also termed dissimilatory nitrate reduction to ammonium, but not respiratory denitrification. PMID:17098906

Functional Specificity of Extracellular Nucleases of Shewanella oneidensis MR-1

PubMed Central

Heun, Magnus; Binnenkade, Lucas; Kreienbaum, Maximilian

2012-01-01

Bacterial species such as Shewanella oneidensis MR-1 require extracellular nucleolytic activity for the utilization of extracellular DNA (eDNA) as a source of nutrients and for the turnover of eDNA as a structural matrix component during biofilm formation. We have previously characterized two extracellular nucleases of S. oneidensis MR-1, ExeM and ExeS. Although both are involved in biofilm formation, they are not specifically required for the utilization of eDNA as a nutrient. Here we identified and characterized EndA, a third extracellular nuclease of Shewanella. The heterologously overproduced and purified protein was highly active and rapidly degraded linear and supercoiled DNAs of various origins. Divalent metal ions (Mg2+ or Mn2+) were required for function. endA is cotranscribed with phoA, an extracellular phosphatase, and is not upregulated upon phosphostarvation. Deletion of endA abolished both extracellular degradation of DNA by S. oneidensis MR-1 and the ability to use eDNA as a sole source of phosphorus. PhoA is not strictly required for the exploitation of eDNA as a nutrient. The activity of EndA prevents the formation of large cell aggregates during planktonic growth. However, in contrast to the findings for ExeM, endA deletion had only minor effects on biofilm formation. The findings strongly suggest that the extracellular nucleases of S. oneidensis exert specific functions required under different conditions. PMID:22492434

Growth Trade-Offs Accompany the Emergence of Glycolytic Metabolism in Shewanella oneidensis MR-1

DOE PAGES

Chubiz, Lon M.; Marx, Christopher J.

2017-03-13

Bacteria increase their metabolic capacity via the acquisition of genetic material or by the mutation of genes already present in the genome. Here, we explore the mechanisms and trade-offs involved whenShewanella oneidensis, a bacterium that typically consumes small organic and amino acids, rapidly evolves to expand its metabolic capacity to catabolize glucose after a short period of adaptation to a glucose-rich environment. Using whole-genome sequencing and genetic approaches, we discovered that deletions in a region including the transcriptional repressor (nagR) that regulates the expression of genes associated with catabolism ofN-acetylglucosamine are the common basis for evolved glucose metabolism across populations.more » The loss ofnagRresults in the constitutive expression of genes for anN-acetylglucosamine permease (nagP) and kinase (nagK). We demonstrate that promiscuous activities of both NagP and NagK toward glucose allow for the transport and phosphorylation of glucose to glucose-6-phosphate, the initial events of glycolysis otherwise thought to be absent inS. oneidensis. 13C-based metabolic flux analysis uncovered that subsequent utilization was mediated by the Entner-Doudoroff pathway. This is an example whereby gene loss and preexisting enzymatic promiscuity, and not gain-of-function mutations, were the drivers of increased metabolic capacity. However, we observed a significant decrease in the growth rate on lactate after adaptation to glucose catabolism, suggesting that trade-offs may explain why glycolytic function may not be readily observed inS. oneidensisin natural environments despite it being readily accessible through just a single mutational event.Gains in metabolic capacity are frequently associated with the acquisition of novel genetic material via natural or engineered horizontal gene transfer events. Here, we explored how a bacterium that typically consumes small organic acids and amino acids expands its metabolic capacity to include

Growth Trade-Offs Accompany the Emergence of Glycolytic Metabolism in Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chubiz, Lon M.; Marx, Christopher J.

Bacteria increase their metabolic capacity via the acquisition of genetic material or by the mutation of genes already present in the genome. Here, we explore the mechanisms and trade-offs involved whenShewanella oneidensis, a bacterium that typically consumes small organic and amino acids, rapidly evolves to expand its metabolic capacity to catabolize glucose after a short period of adaptation to a glucose-rich environment. Using whole-genome sequencing and genetic approaches, we discovered that deletions in a region including the transcriptional repressor (nagR) that regulates the expression of genes associated with catabolism ofN-acetylglucosamine are the common basis for evolved glucose metabolism across populations.more » The loss ofnagRresults in the constitutive expression of genes for anN-acetylglucosamine permease (nagP) and kinase (nagK). We demonstrate that promiscuous activities of both NagP and NagK toward glucose allow for the transport and phosphorylation of glucose to glucose-6-phosphate, the initial events of glycolysis otherwise thought to be absent inS. oneidensis. 13C-based metabolic flux analysis uncovered that subsequent utilization was mediated by the Entner-Doudoroff pathway. This is an example whereby gene loss and preexisting enzymatic promiscuity, and not gain-of-function mutations, were the drivers of increased metabolic capacity. However, we observed a significant decrease in the growth rate on lactate after adaptation to glucose catabolism, suggesting that trade-offs may explain why glycolytic function may not be readily observed inS. oneidensisin natural environments despite it being readily accessible through just a single mutational event.Gains in metabolic capacity are frequently associated with the acquisition of novel genetic material via natural or engineered horizontal gene transfer events. Here, we explored how a bacterium that typically consumes small organic acids and amino acids expands its metabolic capacity to include

Development of species-specific hybridization probes for marine luminous bacteria by using in vitro DNA amplification.

PubMed Central

Wimpee, C F; Nadeau, T L; Nealson, K H

1991-01-01

By using two highly conserved region of the luxA gene as primers, polymerase chain reaction amplification methods were used to prepare species-specific probes against the luciferase gene from four major groups of marine luminous bacteria. Laboratory studies with test strains indicated that three of the four probes cross-reacted with themselves and with one or more of the other species at low stringencies but were specific for members of their own species at high stringencies. The fourth probe, generated from Vibrio harveyi DNA, cross-reacted with DNAs from two closely related species, V. orientalis and V. vulnificus. When nonluminous cultures were tested with the species-specific probes, no false-positive results were observed, even at low stringencies. Two field isolates were correctly identified as Photobacterium phosphoreum by using the species-specific hybridization probes at high stringency. A mixed probe (four different hybridization probes) used at low stringency gave positive results with all of the luminous bacteria tested, including the terrestrial species, Xenorhabdus luminescens, and the taxonomically distinct marine bacterial species Shewanella hanedai; minimal cross-hybridization with these species was seen at higher stringencies. Images PMID:1854194

Engineering Shewanella oneidensis enables xylose-fed microbial fuel cell.

PubMed

Li, Feng; Li, Yuanxiu; Sun, Liming; Li, Xiaofei; Yin, Changji; An, Xingjuan; Chen, Xiaoli; Tian, Yao; Song, Hao

2017-01-01

The microbial fuel cell (MFC) is a green and sustainable technology for electricity energy harvest from biomass, in which exoelectrogens use metabolism and extracellular electron transfer pathways for the conversion of chemical energy into electricity. However, Shewanella oneidensis MR-1, one of the most well-known exoelectrogens, could not use xylose (a key pentose derived from hydrolysis of lignocellulosic biomass) for cell growth and power generation, which limited greatly its practical applications. Herein, to enable S. oneidensis to directly utilize xylose as the sole carbon source for bioelectricity production in MFCs, we used synthetic biology strategies to successfully construct four genetically engineered S. oneidensis (namely XE, GE, XS, and GS) by assembling one of the xylose transporters (from Candida intermedia and Clostridium acetobutylicum ) with one of intracellular xylose metabolic pathways (the isomerase pathway from Escherichia coli and the oxidoreductase pathway from Scheffersomyces stipites ), respectively. We found that among these engineered S. oneidensis strains, the strain GS (i.e. harbouring Gxf1 gene encoding the xylose facilitator from C. intermedi , and XYL1 , XYL2 , and XKS1 genes encoding the xylose oxidoreductase pathway from S. stipites ) was able to generate the highest power density, enabling a maximum electricity power density of 2.1 ± 0.1 mW/m 2 . To the best of our knowledge, this was the first report on the rationally designed Shewanella that could use xylose as the sole carbon source and electron donor to produce electricity. The synthetic biology strategies developed in this study could be further extended to rationally engineer other exoelectrogens for lignocellulosic biomass utilization to generate electricity power.

Relative Frequency, Characteristics, and Antimicrobial Susceptibility Patterns of Vibrio spp., Aeromonas spp., Chromobacterium violaceum, and Shewanella spp. in the Northern Territory of Australia, 2000–2013

PubMed Central

McAuliffe, Gary N.; Hennessy, Jann; Baird, Robert W.

2015-01-01

Vibrio, Aeromonas, Chromobacterium violaceum, and Shewanella (VACS) are water-associated Gram-negative organisms that can cause a variety of infections. The frequency, patient characteristics, and antimicrobial susceptibilities for 468 isolates from 442 patients from the Northern Territory were reviewed. Aeromonas spp. (312 of 468; 67%) were most commonly isolated followed by Vibrio spp. (71 of 468; 15%), Shewanella spp. (61 of 468; 13%), and C. violaceum (24 of 468; 5%). A strong male predominance was found (male to female ratio of 2.3:1). Skin and soft tissue isolations (373 of 468; 80%) from lower limb infections (222 of 371; 60%) were the most common clinical manifestation. The episodes were usually polymicrobial (281 of 468; 60%). Coisolates included Staphylococcus aureus (137 of 468; 29%), β-hemolytic streptococci (74 of 468; 16%), enterobacteriaceae (111 of 468; 24%), non-fermentative Gram-negative bacilli (35 of 468; 7%), and other VACS organisms (37 of 468; 8%). Antimicrobial resistance of VACS organisms to ciprofloxacin (0–4%), cefepime (0–3%), and gentamicin (0–0.8%) and Vibrio spp., Aeromonas spp., and Shewanella to cotrimoxazole (0–3%) was rarely shown. For water-associated lower limb skin and soft tissue infections in the tropics, clinicians should consider empirical antimicrobial therapy with agents active against S. aureus and VACS organisms. PMID:25548380

Water Dynamics in Shewanella oneidensis at Ambient and High Pressure using Quasi-Elastic Neutron Scattering

NASA Astrophysics Data System (ADS)

Foglia, Fabrizia; Hazael, Rachael; Simeoni, Giovanna G.; Appavou, Marie-Sousai; Moulin, Martine; Haertlein, Michael; Trevor Forsyth, V.; Seydel, Tilo; Daniel, Isabelle; Meersman, Filip; McMillan, Paul F.

2016-01-01

Quasielastic neutron scattering (QENS) is an ideal technique for studying water transport and relaxation dynamics at pico- to nanosecond timescales and at length scales relevant to cellular dimensions. Studies of high pressure dynamic effects in live organisms are needed to understand Earth’s deep biosphere and biotechnology applications. Here we applied QENS to study water transport in Shewanella oneidensis at ambient (0.1 MPa) and high (200 MPa) pressure using H/D isotopic contrast experiments for normal and perdeuterated bacteria and buffer solutions to distinguish intracellular and transmembrane processes. The results indicate that intracellular water dynamics are comparable with bulk diffusion rates in aqueous fluids at ambient conditions but a significant reduction occurs in high pressure mobility. We interpret this as due to enhanced interactions with macromolecules in the nanoconfined environment. Overall diffusion rates across the cell envelope also occur at similar rates but unexpected narrowing of the QENS signal appears between momentum transfer values Q = 0.7-1.1 Å-1 corresponding to real space dimensions of 6-9 Å. The relaxation time increase can be explained by correlated dynamics of molecules passing through Aquaporin water transport complexes located within the inner or outer membrane structures.

Combined effect of loss of the caa3 oxidase and Crp regulation drives Shewanella to thrive in redox-stratified environments.

PubMed

Zhou, Guangqi; Yin, Jianhua; Chen, Haijiang; Hua, Yijie; Sun, Linlin; Gao, Haichun

2013-09-01

Shewanella species are a group of facultative Gram-negative microorganisms with remarkable respiration abilities that allow the use of a diverse array of terminal electron acceptors (EA). Like most bacteria, S. oneidensis possesses multiple terminal oxidases, including two heme-copper oxidases (caa3- and cbb3-type) and a bd-type quinol oxidase. As aerobic respiration is energetically favored, mechanisms underlying the fact that these microorganisms thrive in redox-stratified environments remain vastly unexplored. In this work, we discovered that the cbb3-type oxidase is the predominant system for respiration of oxygen (O2), especially when O2 is abundant. Under microaerobic conditions, the bd-type quinol oxidase has a significant role in addition to the cbb3-type oxidase. In contrast, multiple lines of evidence suggest that under test conditions the caa3-type oxidase, an analog to the mitochondrial enzyme, has no physiological significance, likely because of its extremely low expression. In addition, expression of both cbb3- and bd-type oxidases is under direct control of Crp (cAMP receptor protein) but not the well-established redox regulator Fnr (fumarate nitrate regulator) of canonical systems typified in Escherichia coli. These data, collectively, suggest that adaptation of S. oneidensis to redox-stratified environments is likely due to functional loss of the caa3-type oxidase and switch of the regulatory system for respiration.

Bioleaching of arsenic in contaminated soil using metal-reducing bacteria

NASA Astrophysics Data System (ADS)

Lee, So-Ra; Lee, Jong-Un; Chon, Hyo-Taek

2014-05-01

A study on the extraction of arsenic in the contaminated soil collected from an old smelting site in Korea was carried out using metal-reducing bacteria. Two types of batch-type experiments, biostimulation and bioaugmentation, were conducted for 28 days under anaerobic conditions. The biostimulation experiments were performed through activation of indigenous bacteria by supply with glucose or lactate as a carbon source. The contaminated, autoclaved soil was inoculated with metal-reducing bacteria, Shewanella oneidensis MR-1 and S. algae BrY, in the bioaugmentation experiments. The results indicated that the maximum concentration of the extracted As was 11.2 mg/L at 4 days from the onset of the experiment when 20 mM glucose was supplied and the extraction efficiency of As ranged 60~63% in the biostimulation experiments. In the case of bioaugmentation, the highest dissolved As concentration was 24.4 mg/L at 2 days, though it dramatically decreased over time through re-adsorption onto soil particles. After both treatments, mode of As occurrence in the soil appeared to be changed to readily extractable fractions. This novel technique of bioleaching may be practically applied for remediation of As-contaminated soil after determination of optimum operational conditions such as operation time and proper carbon source and its concentration.

Development and application of reverse transcription loop-mediated isothermal amplification for detecting live Shewanella putrefaciens in preserved fish sample.

PubMed

Li, Chenghua; Ying, Qi; Su, Xiurong; Li, Taiwu

2012-04-01

Given that live Shewanella putrefaciens is one of the major causes of spoilage for aquatic products even in chill storage, the rapid and accurate detection process is the first priority. In the present study, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) detecting assay was developed by targeting internal transcribed spacer (ITS) sequence between 16S and 23S rRNA. At the same time, a new procaryotic mRNA isolation strategy was also established by introducing a polyA tail to RNA during cDNA synthesis step. Under the optimal reaction time (60 min) and temperature (64.1 °C), S. putrefaciens could be specially identified from a variety of other tested bacteria by RT-LAMP. The sensitivity analysis showed that RT-LAMP could be identified as lower as 5.4 copies per reaction, which is over 200-fold higher than that of standard PCR (1.08 × 10³ copies per reaction). The method could be effectively identified S. putrefaciens in artificially contaminated or spoilaged fish samples with dose-dependent manners. To our knowledge, this is the first report using RT-LAMP assay to detect live S. putrefaciens in fish. The study provided a rapid and accurate detection method for live bacteria in aquatic food and established a new procaryotic mRNA isolation strategy at the same time, which will be useful for food preservation. © 2012 Institute of Food Technologists®

Shewanella oneidensis MR-1 chemotaxis proteins and electron-transport chain components essential for congregation near insoluble electron acceptors.

PubMed

Harris, H Wayne; El-Naggar, Mohamed Y; Nealson, Kenneth H

2012-12-01

Shewanella oneidensis MR-1 cells utilize a behaviour response called electrokinesis to increase their speed in the vicinity of IEAs (insoluble electron acceptors), including manganese oxides, iron oxides and poised electrodes [Harris, El-Naggar, Bretschger, Ward, Romine, Obraztsova and Nealson (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 326-331]. However, it is not currently understood how bacteria remain in the vicinity of the IEA and accumulate both on the surface and in the surrounding medium. In the present paper, we provide results indicating that cells that have contacted the IEAs swim faster than those that have not recently made contact. In addition, fast-swimming cells exhibit an enhancement of swimming reversals leading to rapid non-random accumulation of cells on, and adjacent to, mineral particles. We call the observed accumulation near IEAs 'congregation'. Congregation is eliminated by the loss of a critical gene involved with EET (extracellular electron transport) (cymA, SO_4591) and is altered or eliminated in several deletion mutants of homologues of genes that are involved with chemotaxis or energy taxis in Escherichia coli. These genes include chemotactic signal transduction protein (cheA-3, SO_3207), methyl-accepting chemotaxis proteins with the Cache domain (mcp_cache, SO_2240) or the PAS (Per/Arnt/Sim) domain (mcp_pas, SO_1385). In the present paper, we report studies of S. oneidensis MR-1 that lend some insight into how microbes in this group can 'sense' the presence of a solid substrate such as a mineral surface, and maintain themselves in the vicinity of the mineral (i.e. via congregation), which may ultimately lead to attachment and biofilm formation.

Differential biofilms characteristics of Shewanella decolorationis microbial fuel cells under open and closed circuit conditions.

PubMed

Yang, Yonggang; Sun, Guoping; Guo, Jun; Xu, Meiying

2011-07-01

Biofilms formation capacities of Shewanella species in microbial fuel cells (MFCs) and their roles in current generation have been documented to be species-dependent. Understandings of the biofilms growth and metabolism are essential to optimize the current generation of MFCs. Shewanella decolorationis S12 was used in both closed-circuit and open-circuit MFCs in this study. The anodic S. decolorationis S12 biofilms could generate fivefold more current than the planktonic cells, playing a dominant role in current generation. Anodic biofilms viability was sustained at 98 ± 1.2% in closed-circuit while biofilms viability in open-circuit decreased to 72 ± 7% within 96 h. The unviable domain in open-circuit MFCs biofilms majorly located at the inner layer of biofilm. The decreased biofilms viability in open-circuit MFCs could be recovered by switching into closed-circuit, indicating that the current-generating anode in MFCs could serve as a favorable electron acceptor and provide sufficient energy to support cell growth and metabolism inside biofilms. Copyright © 2011 Elsevier Ltd. All rights reserved.

A near-infrared light responsive c-di-GMP module-based AND logic gate in Shewanella oneidensis.

PubMed

Hu, Yidan; Wu, Yichao; Mukherjee, Manisha; Cao, Bin

2017-01-31

A novel, biofilm-based AND logic gate was constructed in Shewanella oneidensis through a near-infrared (NIR) light responsive c-di-GMP module. The logic gate was demonstrated in microbial fuel cells with isopropyl β-d-thiogalactoside (IPTG) and NIR light as the inputs and electrical signals as the output.

Antimicrobial peptide AMPNT-6 from Bacillus subtilis inhibits biofilm formation by Shewanella putrefaciens and disrupts its preformed biofilms on both abiotic and shrimp shell surfaces.

PubMed

Deng, Qi; Pu, Yuehua; Sun, Lijun; Wang, Yaling; Liu, Yang; Wang, Rundong; Liao, Jianmeng; Xu, Defeng; Liu, Ying; Ye, Riying; Fang, Zhijia; Gooneratne, Ravi

2017-12-01

Shewanella putrefaciens biofilm formation is of great concern for the shrimp industry because it adheres easily to food and food-contact surfaces and is a source of persistent and unseen contamination that causes shrimp spoilage and economic losses to the shrimp industry. Different concentrations of an antimicrobial lipopeptide, the fermentation product of Bacillus subtilis, AMPNT-6, were tested for the ability to reduce adhesion and disrupt S. putrefaciens preformed biofilms on two different contact surfaces (shrimp shell, stainless steel sheet). AMPNT-6 displayed a marked dose- and time-dependent anti-adhesive effect>biofilm removal. 3MIC AMPNT-6 was able both to remove biofilm and prevent bacteria from forming biofilm in a 96-well polystyrene microplate used as the model surface. 2MIC AMPNT-6 prevented bacteria from adhering to the microplate surface to form biofilm for 3h and removed already existing biofilm within 24h. Secretion of extracellular polymeric substances incubated in LB broth for 24h by S. putrefaciens was minimal at 3× MIC AMPNT-6. Scanning electron microscopy showed that damage to S. putrefaciens bacteria by AMPNT-6 possibly contributed to the non-adherence to the surfaces. Disruption of the mature biofilm structure by AMPNT-6 contributed to biofilm removal. It is concluded that AMPNT-6 can be used effectively to prevent attachment and also detach S. putrefaciens biofilms from shrimp shells, stainless steel sheets and polystyrene surfaces. Copyright © 2017 Elsevier Ltd. All rights reserved.

Time-course analysis of the Shewanella amazonensis SB2B proteome in response to sodium chloride shock.

PubMed

Parnell, J Jacob; Callister, Stephen J; Rompato, Giovanni; Nicora, Carrie D; Paša-Tolić, Ljiljana; Williamson, Ashley; Pfrender, Michael E

2011-01-01

Shewanellae are microbial models for environmental stress response; however, the sequential expression of mechanisms in response to stress is poorly understood. Here we experimentally determine the response mechanisms of Shewanella amazonensis SB2B during sodium chloride stress using a novel liquid chromatography and accurate mass-time tag mass spectrometry time-course proteomics approach. The response of SB2B involves an orchestrated sequence of events comprising increased signal transduction associated with motility and restricted growth. Following a metabolic shift to branched chain amino acid degradation, motility and cellular replication proteins return to pre-perturbed levels. Although sodium chloride stress is associated with a change in the membrane fatty acid composition in other organisms, this is not the case for SB2B as fatty acid degradation pathways are not expressed and no change in the fatty acid profile is observed. These findings suggest that shifts in membrane composition may be an indirect physiological response to high NaCl stress.

Roles of Two Shewanella oneidensis MR-1 Extracellular Endonucleases ▿ †

PubMed Central

Gödeke, Julia; Heun, Magnus; Bubendorfer, Sebastian; Paul, Kristina; Thormann, Kai M.

2011-01-01

The dissimilatory iron-reducing bacterium Shewanella oneidensis MR-1 is capable of using extracellular DNA (eDNA) as the sole source of carbon, phosphorus, and nitrogen. In addition, we recently demonstrated that S. oneidensis MR-1 requires eDNA as a structural component during all stages of biofilm formation. In this study, we characterize the roles of two Shewanella extracellular endonucleases, ExeS and ExeM. While ExeS is likely secreted into the medium, ExeM is predicted to remain associated with the cell envelope. Both exeM and exeS are highly expressed under phosphate-limited conditions. Mutants lacking exeS and/or exeM exhibit decreased eDNA degradation; however, the capability of S. oneidensis MR-1 to use DNA as the sole source of phosphorus is only affected in mutants lacking exeM. Neither of the two endonucleases alleviates toxic effects of increased eDNA concentrations. The deletion of exeM and/or exeS significantly affects biofilm formation of S. oneidensis MR-1 under static conditions, and expression of exeM and exeS drastically increases during static biofilm formation. Under hydrodynamic conditions, a deletion of exeM leads to altered biofilms that consist of densely packed structures which are covered by a thick layer of eDNA. Based on these results, we hypothesize that a major role of ExeS and, in particular, ExeM of S. oneidensis MR-1, is to degrade eDNA as a matrix component during biofilm formation to improve nutrient supply and to enable detachment. PMID:21705528

Fluorescence of bioaerosols: mathematical model including primary fluorescing and absorbing molecules in bacteria.

PubMed

Hill, Steven C; Pan, Yong-Le; Williamson, Chatt; Santarpia, Joshua L; Hill, Hanna H

2013-09-23

This paper describes a mathematical model of fluorescent biological particles composed of bacteria, viruses, or proteins. The fluorescent and/or light absorbing molecules included in the model are amino acids (tryptophan, etc.); nucleic acids (DNA, RNA, etc.); coenzymes (nicotinamide adenine dinucleotides, flavins, and vitamins B₆ and K and variants of these); and dipicolinates. The concentrations, absorptivities, and fluorescence quantum yields are estimated from the literature, often with large uncertainties. The bioparticles in the model are spherical and homogeneous. Calculated fluorescence cross sections for particles excited at 266, 280, and 355 nm are compared with measured values from the literature for several bacteria, bacterial spores and albumins. The calculated 266- and 280-nm excited fluorescence is within a factor of 3.2 of the measurements for the vegetative cells and proteins, but overestimates the fluorescence of spores by a factor of 10 or more. This is the first reported modeling of the fluorescence of bioaerosols in which the primary fluorophores and absorbing molecules are included.

Characterization and application of monoclonal antibodies against Shewanella marisflavi, a novel pathogen of Apostichopus japonicus

USDA-ARS?s Scientific Manuscript database

Shewanella marisflavi strain AP629 was certified as a novel pathogen of the sea cucumber Apostichopus japonicus. In this study, four monoclonal antibodies (MAbs) (3C1, 3D9, 2F2, 2A8) against strain AP629 were developed by immunizing Balb/C mice. 3C1 and 3D9 recognized S. marisflavi only, showing no ...

Diversity of protease-producing marine bacteria from sub-antarctic environments.

PubMed

Cristóbal, Héctor Antonio; López, Maria Alejandra; Kothe, Erika; Abate, Carlos Mauricio

2011-12-01

From seawater and the intestines of benthonic organisms collected from the Beagle Channel, Argentina, 230 marine bacteria were isolated. Cultivable bacteria were characterized and classified as psychrotolerant, whereas few isolates were psychrophiles. These isolates were capable of producing proteases at 4 and 15 °C under neutral (pH 7.0), alkaline (pH 10.0) and acidic (pH 4.5) conditions on different media, revealing 62, 33 and 22% producers at cold and 84, 47 and 33% producers at low temperatures, respectively. More protease-producing strains (67%) were detected when isolated from benthic invertebrates as compared to seawater (33%), with protease production under neutral conditions resulting in milk protein hydrolysis halos between 27 and 30 ± 2 mm in diameter. Using sterile 0.22 μm membrane filters, 29 isolates exhibiting extracellular protease activity were detected. These were grouped into six operational taxonomic units by restriction analysis and identified based on 16S rDNA as γ-proteobacteria of the genera Pseudoalteromonas, Pseudomonas, Shewanella, Alteromonas, Aeromonas, and Serratia. Plasmids were found to be harbored by eight strains, mainly within the isolates from benthonic organisms. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Iodate Reduction by Shewanella oneidensis Does Not Involve Nitrate Reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mok, Jung Kee; Toporek, Yael J.; Shin, Hyun-Dong

Microbial iodate (IO 3 -) reduction is a major component of the iodine biogeochemical reaction network and is the basis of alternative strategies for remediation of iodine-contaminated environments. The molecular mechanism of microbial IO 3 - reduction, however, is not well understood. In microorganisms displaying IO 3 - and nitrate (NO 3 -) reduction activities, NO 3 - reductase is postulated to reduce IO 3 - as alternate electron acceptor. In the present study, whole genome analyses of 25 NO 3 --reducing Shewanella strains identified various combinations of genes encoding one assimilatory (cytoplasmic Nas) and three dissimilatory (membrane-associated Nar andmore » periplasmic Napα and Napβ) NO 3 - reductases. S. oneidensis was the only Shewanella strain whose genome encoded a single NO 3 - reductase (Napβ). Terminal electron acceptor competition experiments in S. oneidensis batch cultures amended with both NO 3 - and IO 3 - demonstrated that neither NO 3 - nor IO 3 - reduction activities were competitively inhibited by the presence of the competing electron acceptor. The lack of involvement of S. oneidensis Napβ in IO 3 - reduction was confirmed via phenotypic analysis of an in-frame gene deletion mutant lacking napβΑ (encoding the NO 3 --reducing NapβA catalytic subunit). S. oneidensis ΔnapβA was unable to reduce NO 3 -, yet reduced IO 3 - at rates higher than the wild-type strain. Thus, NapβA is required for dissimilatory NO 3 - reduction by S. oneidensis, while neither the assimilatory (Nas) nor dissimilatory (Napα, Napβ, and Nar) NO 3 - reductases are required for IO 3 - reduction. These findings oppose the traditional view that NO 3 - reductase reduces IO 3 - as alternate electron acceptor and indicate that S. oneidensis reduces IO 3 - via an as yet undiscovered enzymatic mechanism.« less

Programming the quorum sensing-based AND gate in Shewanella oneidensis for logic gated-microbial fuel cells.

PubMed

Hu, Yidan; Yang, Yun; Katz, Evgeny; Song, Hao

2015-03-11

An AND logic gate based on a synthetic quorum-sensing (QS) module was constructed in a Shewanella oneidensis MR-1 mtrA knockout mutant. The presence of two input signals activated the expression of a periplasmic decaheme cytochrome MtrA to regenerate the extracellular electron transfer conduit, enabling the construction of AND-gated microbial fuel cells.

Enrichment and identification of naphthalene-degrading bacteria from the Persian Gulf.

PubMed

Hassanshahian, Mehdi; Boroujeni, Negar Amini

2016-06-15

Naphthalene is a ubiquitous pollutant of the marine environment, and naphthalene biodegradation has been receiving constant scientific consideration. For cleanup of aromatic contaminated sites, bioremediation methods are considered as economical and safe approaches for the marine environment. The aims of this research are isolation and characterization of naphthalene-degrading bacteria from some marine samples of the Persian Gulf. Fifty four naphthalene-degrading bacteria were isolated from marine samples (sediment and seawater) that are enriched in ONR7a medium with naphthalene as the only carbon source. Some screening tests such as growth at high concentration of naphthalene, bioemulsifier production and surface hydrophobicity were done to select the best and prevalent strains for naphthalene degradation. Determination of the nucleotide sequence of the gene encoding for 16S rRNA shows that these isolated strains belong to these genera: Shewanella, Salegentibacter, Halomonas, Marinobacter, Oceanicola, Idiomarina and Thalassospira. These strains can degrade half of the percentage of naphthalene in 10days of incubation. This research is the first report on isolation of these genera from the Persian Gulf as naphthalene-degrader. Copyright © 2016 Elsevier Ltd. All rights reserved.

Large-Scale Comparative Phenotypic and Genomic Analyses Reveal Ecological Preferences of Shewanella Species and Identify Metabolic Pathways Conserved at the Genus Level ▿ †

PubMed Central

Rodrigues, Jorge L. M.; Serres, Margrethe H.; Tiedje, James M.

2011-01-01

The use of comparative genomics for the study of different microbiological species has increased substantially as sequence technologies become more affordable. However, efforts to fully link a genotype to its phenotype remain limited to the development of one mutant at a time. In this study, we provided a high-throughput alternative to this limiting step by coupling comparative genomics to the use of phenotype arrays for five sequenced Shewanella strains. Positive phenotypes were obtained for 441 nutrients (C, N, P, and S sources), with N-based compounds being the most utilized for all strains. Many genes and pathways predicted by genome analyses were confirmed with the comparative phenotype assay, and three degradation pathways believed to be missing in Shewanella were confirmed as missing. A number of previously unknown gene products were predicted to be parts of pathways or to have a function, expanding the number of gene targets for future genetic analyses. Ecologically, the comparative high-throughput phenotype analysis provided insights into niche specialization among the five different strains. For example, Shewanella amazonensis strain SB2B, isolated from the Amazon River delta, was capable of utilizing 60 C compounds, whereas Shewanella sp. strain W3-18-1, isolated from deep marine sediment, utilized only 25 of them. In spite of the large number of nutrient sources yielding positive results, our study indicated that except for the N sources, they were not sufficiently informative to predict growth phenotypes from increasing evolutionary distances. Our results indicate the importance of phenotypic evaluation for confirming genome predictions. This strategy will accelerate the functional discovery of genes and provide an ecological framework for microbial genome sequencing projects. PMID:21642407

Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces.

PubMed

Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth

2013-01-01

This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daly, Michael J.

2006-05-01

Ionizing Radiation (IR) Resistance in Bacteria. Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR) and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny,more » where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR.« less

Impact of a static magnetic field on the electricity production of Shewanella-inoculated microbial fuel cells.

PubMed

Li, Wen-Wei; Sheng, Guo-Ping; Liu, Xian-Wei; Cai, Pei-Jie; Sun, Min; Xiao, Xiang; Wang, Yun-Kun; Tong, Zhong-Hua; Dong, Fang; Yu, Han-Qing

2011-06-15

The electricity production of Shewanella-inoculated microbial fuel cells (MFCs) under magnetic field (MF) exposure was investigated in different reactor systems. The persistency of the MF effect and the influences of MF intensity and direction on MFC performance were also studied. Application of a 100-mT static MF to the MFCs improved electricity production considerably, with an increase in the maximum voltage by 20-27% in both single- and two-chamber MFCs, while a more conspicuous improvement in the electricity generation was observed in a three-electrode cell. The MF effects were found to be immediate and reversible, and adverse effects seemed to occur when the MF was suddenly removed. The medium components analysis demonstrated that the application of MF led to an enhanced bioelectrochemical activity of Shewanella, and no significant promotion in mediator secretion was found. The improvement in the electricity production of MFCs under MF was mainly attributed to the enhanced bioelectrochemical activity, possibly through the oxidative stress mechanism. An accelerated cell growth under MF might also contribute to the enhanced substrate degradation and power generation. Copyright © 2010 Elsevier B.V. All rights reserved.

The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

2010-04-20

Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

Mercury capture into biogenic amorphous selenium nanospheres produced by mercury resistant Shewanella putrefaciens 200.

PubMed

Jiang, Shenghua; Ho, Cuong Tu; Lee, Ji-Hoon; Duong, Hieu Van; Han, Seunghee; Hur, Hor-Gil

2012-05-01

Shewanella putrefaciens 200, resistant to high concentration of Hg(II), was selected for co-removal of mercury and selenium from aqueous medium. Biogenic Hg(0) reduced from Hg(II) by S. putrefaciens 200 was captured into extracellular amorphous selenium nanospheres, resulting in the formation of stable HgSe nanoparticles. This bacterial reduction could be a new strategy for mercury removal from aquatic environments without secondary pollution of mercury methylation or Hg(0) volatilization. Copyright © 2012 Elsevier Ltd. All rights reserved.

Current Production and Metal Oxide Reduction by Shewanella oneidensis MR-1 Wild Type and Mutants▿ †

PubMed Central

Bretschger, Orianna; Obraztsova, Anna; Sturm, Carter A.; Chang, In Seop; Gorby, Yuri A.; Reed, Samantha B.; Culley, David E.; Reardon, Catherine L.; Barua, Soumitra; Romine, Margaret F.; Zhou, Jizhong; Beliaev, Alexander S.; Bouhenni, Rachida; Saffarini, Daad; Mansfeld, Florian; Kim, Byung-Hong; Fredrickson, James K.; Nealson, Kenneth H.

2007-01-01

Shewanella oneidensis MR-1 is a gram-negative facultative anaerobe capable of utilizing a broad range of electron acceptors, including several solid substrates. S. oneidensis MR-1 can reduce Mn(IV) and Fe(III) oxides and can produce current in microbial fuel cells. The mechanisms that are employed by S. oneidensis MR-1 to execute these processes have not yet been fully elucidated. Several different S. oneidensis MR-1 deletion mutants were generated and tested for current production and metal oxide reduction. The results showed that a few key cytochromes play a role in all of the processes but that their degrees of participation in each process are very different. Overall, these data suggest a very complex picture of electron transfer to solid and soluble substrates by S. oneidensis MR-1. PMID:17644630

Functional characterization of Gram-negative bacteria from different genera as multiplex cadmium biosensors.

PubMed

Bereza-Malcolm, Lara; Aracic, Sanja; Kannan, Ruban; Mann, Gülay; Franks, Ashley E

2017-08-15

Widespread presence of cadmium in soil and water systems is a consequence of industrial and agricultural processes. Subsequent accumulation of cadmium in food and drinking water can result in accidental consumption of dangerous concentrations. As such, cadmium environmental contamination poses a significant threat to human health. Development of microbial biosensors, as a novel alternative method for in situ cadmium detection, may reduce human exposure by complementing traditional analytical methods. In this study, a multiplex cadmium biosensing construct was assembled by cloning a single-output cadmium biosensor element, cadRgfp, and a constitutively expressed mrfp1 onto a broad-host range vector. Incorporation of the duplex fluorescent output [green and red fluorescence proteins] allowed measurement of biosensor functionality and viability. The biosensor construct was tested in several Gram-negative bacteria including Pseudomonas, Shewanella and Enterobacter. The multiplex cadmium biosensors were responsive to cadmium concentrations ranging from 0.01 to 10µgml -1 , as well as several other heavy metals, including arsenic, mercury and lead at similar concentrations. The biosensors were also responsive within 20-40min following exposure to 3µgml -1 cadmium. This study highlights the importance of testing biosensor constructs, developed using synthetic biology principles, in different bacterial genera. Copyright © 2017 Elsevier B.V. All rights reserved.

Respiration of metal (hydr)oxides by Shewanella and Geobacter: a key role for multihaem c-type cytochromes

PubMed Central

Shi, Liang; Squier, Thomas C; Zachara, John M; Fredrickson, James K

2007-01-01

Dissimilatory reduction of metal (e.g. Fe, Mn) (hydr)oxides represents a challenge for microorganisms, as their cell envelopes are impermeable to metal (hydr)oxides that are poorly soluble in water. To overcome this physical barrier, the Gram-negative bacteria Shewanella oneidensis MR-1 and Geobacter sulfurreducens have developed electron transfer (ET) strategies that require multihaem c-type cytochromes (c-Cyts). In S. oneidensis MR-1, multihaem c-Cyts CymA and MtrA are believed to transfer electrons from the inner membrane quinone/quinol pool through the periplasm to the outer membrane. The type II secretion system of S. oneidensis MR-1 has been implicated in the reduction of metal (hydr)oxides, most likely by translocating decahaem c-Cyts MtrC and OmcA across outer membrane to the surface of bacterial cells where they form a protein complex. The extracellular MtrC and OmcA can directly reduce solid metal (hydr)oxides. Likewise, outer membrane multihaem c-Cyts OmcE and OmcS of G. sulfurreducens are suggested to transfer electrons from outer membrane to type IV pili that are hypothesized to relay the electrons to solid metal (hydr)oxides. Thus, multihaem c-Cyts play critical roles in S. oneidensis MR-1- and G. sulfurreducens-mediated dissimilatory reduction of solid metal (hydr)oxides by facilitating ET across the bacterial cell envelope. PMID:17581116

Monitoring structural transformation of hydroxy-sulphate green rust in the presence of sulphate reducing bacteria

NASA Astrophysics Data System (ADS)

Abdelmoula, M.; Zegeye, A.; Jorand, F.; Carteret, C.

2006-01-01

The activities of bacterial consortia enable organisms to maximize their metabolic capabilities. This article assesses the synergetic relationship between iron reducing bacteria (IRB), Shewanella putrefaciens and sulphate reducing bacteria (SRB) Desulfovibrio alaskensis. Thus, the aim of this study was first to form a biogenic hydroxy-sulpahte green rust GR2( {text{SO}}_{{text{4}}} ^{{2 - }} ) through the bioreduction of lepidocrocite by S. putrefaciens and secondly to investigate if sulfate anions intercalated in the biogenic GR2( {text{SO}}_{{text{4}}} ^{{2 - }} ) could serve as final electron acceptor for a sulfate reducing bacterium, D. alaskensis. The results indicate that the IRB lead to the formation of GR2( {text{SO}}_{{text{4}}} ^{{2 - }} ) and this mineral serve as an electron acceptor for SRB. GR2( {text{SO}}_{{text{4}}} ^{{2 - }} ) precipitation and its transformation was demonstrated by using X-ray diffraction (DRX), Mössbauer spectroscopy (TMS) and transmission electron spectroscopy (TEM). These observations point out the possible acceleration of steel corrosion in marine environment in presence of IRB/SRB consortia.

Biogeochemical modification of Nontronite by Shewanella oneidensis MR-1: Evidence of Microbially induced Smectite-to-Illite reaction

NASA Astrophysics Data System (ADS)

Koo, T. H.; Kogure, T.; Kim, J. W.

2017-12-01

The biogeochemical modification of chemistry/structure of smectite associated with microbial Fe(III) respiration is a major process of promoting smectite-to-illite reaction (S-I reaction). Direct evidence of illitization including K-fixation and changes in Al/Si, formation of K-nontronite/illite-like structure has not been suggested systematically. Nontronite (NAu-1) was inoculated with Fe-reducing bacteria (FeRB), Shewanella oneidensis MR-1 at 30 ° with pH buffered (7.0 and 8.0) M1 medium in the anaerobic chamber, and the evidence of illitization was suggested by microscopic/spectroscopic measurements as well as aqueous chemistry in the supernatant with various incubation time. A progressive morphological change in bio-reduced notnronite (altered nontronite → K-nontronite → illite) corresponded to chemical modification in solid phase (Al/Si 0.16 to 0.28). Fe and Al contents in the supernatant increased continuously up to 70 days of incubation (3.4 to 20 and 1.7 to 13 20 mmol/mg of NAu-1, respectively) then decreased in 120 days of incubation (20 to 8 and 13 to 3 mmol/mg of NAu-1, respectively) indicating new mineral phase precipitated. Si contents showed slightly decreased in 7 days (133 to 100 mmol/mg of NAu-1) then showed fluctuated pattern (increased to 183 mmol/mg of NAu-1 in 70 days, then decreased to 102 mmol/mg of NAu-1 in 120 days of incubation). Formation of biotic silica globule within 120-day incubation supported the dissolution of bio-reduced notnronite. Indeed, modification in structure (appearance of 10-Å shoulder in X-ray diffraction profile) and formation of discrete illite-like packet (d001=1.0 nm) in the wavy bio-reduced nontronite matrix (d001=1.2-1.3 nm) strongly suggest that bio-reduced nontronite underwent the reductive dissolution and precipitated the newly formed illite

Transcriptional analysis of Shewanella oneidensis MR-1 with an electrode compared to Fe(III)citrate or oxygen as terminal electron acceptor

USDA-ARS?s Scientific Manuscript database

Background. Shewanella oneidensis is a target of extensive research efforts in the fields of bioelectrochemical systems and bioremediation because of its versatile metabolic capabilities, especially in regards to the respiration with extracellular electron acceptors. Here, we took a global approach ...

The effects of a new therapeutic triclosan/copolymer/sodium-fluoride dentifrice on oral bacteria, including odorigenic species.

PubMed

Furgang, David; Sreenivasan, Prem K; Zhang, Yun Po; Fine, Daniel H; Cummins, Diane

2003-09-01

This investigation examined the in vitro and ex vivo antimicrobial effects of a new dentifrice, Colgate Total Advanced Fresh, formulated with triclosan/copolymer/sodium fluoride, on oral bacteria, including those odorigenic bacteria implicated in bad breath. The effects of Colgate Total Advanced Fresh were compared to commercially available fluoride dentifrices that served as controls. Three experimental approaches were undertaken for these studies. In the first approach, the dentifrice formulations were tested in vitro against 13 species of oral bacteria implicated in bad breath. The second approach examined the antimicrobial activity derived from dentifrice that was adsorbed to and released from hydroxyapatite disks. In this approach, dentifrice-treated hydroxyapatite disks were immersed in a suspension of bacteria, and reduction in bacterial viability from the release of bioactive agents from hydroxyapatite was determined. The third approach examined the effect of treating bacteria immediately after their removal from the oral cavity of 11 adult human volunteers. This ex vivo study examined the viability of cultivable oral bacteria after dentifrice treatment for 2 minutes. Antimicrobial effects were determined by plating Colgate Total Advanced Fresh and control-dentifrice-treated samples on enriched media (for all cultivable oral bacteria) and indicator media (for hydrogen-sulfide-producing organisms), respectively. Results indicated that the antimicrobial effects of Colgate Total Advanced Fresh were significantly greater than either of the other dentifrices for all 13 oral odorigenic bacterial strains tested in vitro (P < or = 0.05). In the second approach, Colgate Total Advanced Fresh-treated hydroxyapatite disks were significantly more active in reducing bacterial growth than the other dentifrices tested (P < or = 0.05). Finally, ex vivo treatment of oral bacteria with Colgate Total Advanced Fresh demonstrated a 90.9% reduction of all oral cultivable bacteria

Draft genome sequence of carbapenem-resistant Shewanella algae strain AC isolated from small abalone (Haliotis diversicolor).

PubMed

Huang, Yao-Ting; Cheng, Jan-Fang; Chen, Shi-Yu; Hong, Yu-Kai; Wu, Zong-Yen; Liu, Po-Yu

2018-06-19

Shewanella algae is an environmental marine bacteria and an emerging opportunistic human pathogen. Moreover, there are increasing reports of strains showing multi-drug resistance, particularly carbapenem-resistant isolates. Although S. algae have been found in bivalve shellfish aquaculture, there is very little genome-wide data on resistant determinants in S. algae from shellfish. In the study, we aimed to determine the whole genome sequence of carbapenem-resistant S. algae strain AC isolated from small abalone in Taiwan. Genome DNA was sequenced using an Illumina MiSeq platform using 250bp paired-end reads. De novo genome assembly was performed using Velvet v1.2.07. The whole genome was annotated and several candidate genes for antimicrobial resistance were identified. The genome size was calculated at 4,751,156bp, with a mean G＋C content of 53.09%. A total of 4,164 protein-coding sequences, 7 rRNAs, 85 tRNAs, and 5 non-coding RNAs were identified. The genome contains genes associated with resistance to β-lactams, trimethoprim, tetracycline, colistin, and quinolone resistance. Multiple efflux pump genes were also detected. Small abalone is a potential source of foodborne drug resistant S. algae. The genome sequence of a carbapenem-resistant S. algae strain AC isolated from small abalone will provide valuable information for further study of the dissemination of resistance genes at the human-animal interface. Copyright © 2018. Published by Elsevier Ltd.

Network-Based Methods for Identifying Key Active Proteins in the Extracellular Electron Transfer Process in Shewanella oneidensis MR-1.

PubMed

Ding, Dewu; Sun, Xiao

2018-01-16

Shewanella oneidensis MR-1 can transfer electrons from the intracellular environment to the extracellular space of the cells to reduce the extracellular insoluble electron acceptors (Extracellular Electron Transfer, EET). Benefiting from this EET capability, Shewanella has been widely used in different areas, such as energy production, wastewater treatment, and bioremediation. Genome-wide proteomics data was used to determine the active proteins involved in activating the EET process. We identified 1012 proteins with decreased expression and 811 proteins with increased expression when the EET process changed from inactivation to activation. We then networked these proteins to construct the active protein networks, and identified the top 20 key active proteins by network centralization analysis, including metabolism- and energy-related proteins, signal and transcriptional regulatory proteins, translation-related proteins, and the EET-related proteins. We also constructed the integrated protein interaction and transcriptional regulatory networks for the active proteins, then found three exclusive active network motifs involved in activating the EET process-Bi-feedforward Loop, Regulatory Cascade with a Feedback, and Feedback with a Protein-Protein Interaction (PPI)-and identified the active proteins involved in these motifs. Both enrichment analysis and comparative analysis to the whole-genome data implicated the multiheme c -type cytochromes and multiple signal processing proteins involved in the process. Furthermore, the interactions of these motif-guided active proteins and the involved functional modules were discussed. Collectively, by using network-based methods, this work reported a proteome-wide search for the key active proteins that potentially activate the EET process.

Comparative c-type cytochrome expression analysis in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C grown with soluble and insoluble oxidised metal electron acceptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nissen, Silke; Liu, Xiaoxin; Chourey, Karuna

2012-01-01

The genomes of Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C encode 40 and 69 putative c-type cytochrome genes, respectively. Deletion mutant and biochemical studies have assigned specific functions to a few c-type cytochromes involved in electron transfer to oxidised metals in Shewanella oneidensis strain MR-1. Although promising, the genetic approach is limited to gene deletions that produce a distinct phenotype, and organism for which a genetic system is available. To more comprehensively investigate and compare c-type cytochrome expression in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C, proteomic measurements were used to characterise lysates of cells grownmore » with soluble Fe(III) (as ferric citrate) and insoluble Mn(IV) (as MnO2) as electron acceptors. Strain MR-1 expressed 19 and 20, and strain 2CP-C expressed 27 and 25 c-type cytochromes when grown with Fe(III) and Mn(IV), respectively. The majority of c-type cytochromes (77% for strain MR-1 and 63% for strain 2CP-C) were expressed under both growth conditions; however, the analysis also revealed unique c-type cytochromes that were specifically expressed in cells grown with soluble Fe(III) or insoluble Mn(IV). Proteomic characterisation proved to be a promising approach for determining the c-type cytochrome complement expressed under different growth conditions, and will help elucidating the specific functions of more c-type cytochromes that are the basis for Shewanella and Anaeromyxobacter respiratory versatility.« less

Characterisation of volatile compounds produced by bacteria isolated from the spoilage flora of cold-smoked salmon.

PubMed

Joffraud, J J; Leroi, F; Roy, C; Berdagué, J L

2001-06-15

This study investigated the volatile compounds produced by bacteria belonging to nine different bacterial groups: Lactobacillus sake, L. farciminis, L. alimentarius, Carnobacterium piscicola, Aeromonas sp., Shewanella putrefaciens, Brochothrix thermosphacta, Photobacterium phosphoreum and Enterobacteriaceae isolated from cold-smoked salmon. Each bacterial group was represented by several strains. In addition, combinations of the groups were examined as well. Sterile blocks of cold-smoked salmon were inoculated, vacuum-packed and stored at 6 degrees C. After 40 days of storage at 6 degrees C, aerobic viable count and pH were recorded, the volatile fraction of the samples was analysed by gas chromatography-mass spectrometry (GC-MS), and spoilage was assessed by sensory evaluation. Among the 81 volatile compounds identified by GC-MS, 30 appeared to be released as a result of bacterial metabolism. Some of the effects of inoculated bacterial strains on the composition of the volatile fraction seemed to be characteristic of certain bacterial species. Sensory analysis showed relationships between bacteria, the composition of the volatile fraction and the organoleptic quality of smoked salmon.

Transcriptome Profiling of Shewanella oneidensis Gene Expression following Exposure to Acidic and Alkaline pH†

PubMed Central

Leaphart, Adam B.; Thompson, Dorothea K.; Huang, Katherine; Alm, Eric; Wan, Xiu-Feng; Arkin, Adam; Brown, Steven D.; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Wickham, Gene S.; Zhou, Jizhong

2006-01-01

The molecular response of Shewanella oneidensis MR-1 to variations in extracellular pH was investigated based on genomewide gene expression profiling. Microarray analysis revealed that cells elicited both general and specific transcriptome responses when challenged with environmental acid (pH 4) or base (pH 10) conditions over a 60-min period. Global responses included the differential expression of genes functionally linked to amino acid metabolism, transcriptional regulation and signal transduction, transport, cell membrane structure, and oxidative stress protection. Response to acid stress included the elevated expression of genes encoding glycogen biosynthetic enzymes, phosphate transporters, and the RNA polymerase sigma-38 factor (rpoS), whereas the molecular response to alkaline pH was characterized by upregulation of nhaA and nhaR, which are predicted to encode an Na+/H+ antiporter and transcriptional activator, respectively, as well as sulfate transport and sulfur metabolism genes. Collectively, these results suggest that S. oneidensis modulates multiple transporters, cell envelope components, and pathways of amino acid consumption and central intermediary metabolism as part of its transcriptome response to changing external pH conditions. PMID:16452448

Sponge-Associated Bacteria Produce Non-cytotoxic Melanin Which Protects Animal Cells from Photo-Toxicity.

PubMed

Vijayan, Vijitha; Jasmin, Chekidhenkuzhiyil; Anas, Abdulaziz; Parakkaparambil Kuttan, Sreelakshmi; Vinothkumar, Saradavey; Perunninakulath Subrayan, Parameswaran; Nair, Shanta

2017-09-01

Melanin is a photo-protective polymer found in many organisms. Our research shows that the bacteria associated with darkly pigmented sponges (Haliclona pigmentifera, Sigmadocia pumila, Fasciospongia cavernosa, Spongia officinalis, and Callyspongia diffusa) secrete non-cytotoxic melanin, with antioxidant activity that protects animal cells from photo-toxicity. Out of 156 bacterial strains screened, 22 produced melanin and these melanin-producing bacteria (MPB) were identified as Vibrio spp., Providencia sp., Bacillus sp., Shewanella sp., Staphylococcus sp., Planococcus sp., Salinococcus sp., and Glutamicibacter sp. Maximum melanin production was exhibited by Vibrio alginolyticus Marine Microbial Reference Facility (MMRF) 534 (50 mg ml -1 ), followed by two isolates of Vibrio harveyi MMRF 535 (40 mg ml -1 ) and MMRF 546 (30 mg ml -1 ). Using pathway inhibition assay and FT-IR spectral analysis, we identified the melanin secreted into the culture medium of MPB as 1,8-dihydroxynaphthalene-melanin. The bacterial melanin was non-cytotoxic to mouse fibroblast L929 cells and brine shrimps up to a concentration of 200 and 500 ppm, respectively. Bacterial melanin showed antioxidant activity at very low concentration (IC 50 -9.0 ppm) and at 50 ppm, melanin protected L929 cells from UV-induced intracellular reactive oxygen stress. Our study proposes sponge-associated bacteria as a potential source of non-cytotoxic melanin with antioxidant potentials.

Biofilms and antibiotic susceptibility of multidrug-resistant bacteria from wild animals.

PubMed

Dias, Carla; Borges, Anabela; Oliveira, Diana; Martinez-Murcia, Antonio; Saavedra, Maria José; Simões, Manuel

2018-01-01

The "One Health" concept recognizes that human health and animal health are interdependent and bound to the health of the ecosystem in which they (co)exist. This interconnection favors the transmission of bacteria and other infectious agents as well as the flow of genetic elements containing antibiotic resistance genes. This problem is worsened when pathogenic bacteria have the ability to establish as biofilms. Therefore, it is important to understand the characteristics and behaviour of microorganisms in both planktonic and biofilms states from the most diverse environmental niches to mitigate the emergence and dissemination of resistance. The purpose of this work was to assess the antibiotic susceptibility of four bacteria ( Acinetobacter spp., Klebsiella pneumoniae , Pseudomonas fluorescens and Shewanella putrefaciens ) isolated from wild animals and their ability to form biofilms. The effect of two antibiotics, imipenem (IPM) and ciprofloxacin (CIP), on biofilm removal was also assessed. Screening of resistance genetic determinants was performed by PCR. Biofilm tests were performed by a modified microtiter plate method. Bacterial surface hydrophobicity was determined by sessile drop contact angles. The susceptibility profile classified the bacteria as multidrug-resistant. Three genes coding for β-lactamases were detected in K. pneumoniae (TEM, SHV, OXA-aer) and one in P. fluorescens (OXA-aer). K. pneumoniae was the microorganism that carried more β-lactamase genes and it was the most proficient biofilm producer, while P. fluorescens demonstrated the highest adhesion ability. Antibiotics at their MIC, 5 × MIC and 10 × MIC were ineffective in total biofilm removal. The highest biomass reductions were found with IPM (54% at 10 × MIC) against K. pneumoniae biofilms and with CIP (40% at 10 × MIC) against P. fluorescens biofilms. The results highlight wildlife as important host reservoirs and vectors for the spread of multidrug-resistant bacteria and genetic

Biofilms and antibiotic susceptibility of multidrug-resistant bacteria from wild animals

PubMed Central

Dias, Carla; Borges, Anabela; Oliveira, Diana; Martinez-Murcia, Antonio; Saavedra, Maria José

2018-01-01

Background The “One Health” concept recognizes that human health and animal health are interdependent and bound to the health of the ecosystem in which they (co)exist. This interconnection favors the transmission of bacteria and other infectious agents as well as the flow of genetic elements containing antibiotic resistance genes. This problem is worsened when pathogenic bacteria have the ability to establish as biofilms. Therefore, it is important to understand the characteristics and behaviour of microorganisms in both planktonic and biofilms states from the most diverse environmental niches to mitigate the emergence and dissemination of resistance. Methods The purpose of this work was to assess the antibiotic susceptibility of four bacteria (Acinetobacter spp., Klebsiella pneumoniae, Pseudomonas fluorescens and Shewanella putrefaciens) isolated from wild animals and their ability to form biofilms. The effect of two antibiotics, imipenem (IPM) and ciprofloxacin (CIP), on biofilm removal was also assessed. Screening of resistance genetic determinants was performed by PCR. Biofilm tests were performed by a modified microtiter plate method. Bacterial surface hydrophobicity was determined by sessile drop contact angles. Results The susceptibility profile classified the bacteria as multidrug-resistant. Three genes coding for β-lactamases were detected in K. pneumoniae (TEM, SHV, OXA-aer) and one in P. fluorescens (OXA-aer). K. pneumoniae was the microorganism that carried more β-lactamase genes and it was the most proficient biofilm producer, while P. fluorescens demonstrated the highest adhesion ability. Antibiotics at their MIC, 5 × MIC and 10 × MIC were ineffective in total biofilm removal. The highest biomass reductions were found with IPM (54% at 10 × MIC) against K. pneumoniae biofilms and with CIP (40% at 10 × MIC) against P. fluorescens biofilms. Discussion The results highlight wildlife as important host reservoirs and vectors for the spread of

Comparative systems biology across an evolutionary gradient within the Shewanella genus.

PubMed

Konstantinidis, Konstantinos T; Serres, Margrethe H; Romine, Margaret F; Rodrigues, Jorge L M; Auchtung, Jennifer; McCue, Lee-Ann; Lipton, Mary S; Obraztsova, Anna; Giometti, Carol S; Nealson, Kenneth H; Fredrickson, James K; Tiedje, James M

2009-09-15

To what extent genotypic differences translate to phenotypic variation remains a poorly understood issue of paramount importance for several cornerstone concepts of microbiology including the species definition. Here, we take advantage of the completed genomic sequences, expressed proteomic profiles, and physiological studies of 10 closely related Shewanella strains and species to provide quantitative insights into this issue. Our analyses revealed that, despite extensive horizontal gene transfer within these genomes, the genotypic and phenotypic similarities among the organisms were generally predictable from their evolutionary relatedness. The power of the predictions depended on the degree of ecological specialization of the organisms evaluated. Using the gradient of evolutionary relatedness formed by these genomes, we were able to partly isolate the effect of ecology from that of evolutionary divergence and to rank the different cellular functions in terms of their rates of evolution. Our ranking also revealed that whole-cell protein expression differences among these organisms, when the organisms were grown under identical conditions, were relatively larger than differences at the genome level, suggesting that similarity in gene regulation and expression should constitute another important parameter for (new) species description. Collectively, our results provide important new information toward beginning a systems-level understanding of bacterial species and genera.

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A survey of culturable aerobic and anaerobic marine bacteria in de novo biofilm formation on natural substrates in St. Andrews Bay, Scotland.

PubMed

Finnegan, Lucy; Garcia-Melgares, Manuel; Gmerek, Tomasz; Huddleston, W Ryan; Palmer, Alexander; Robertson, Andrew; Shapiro, Sarah; Unkles, Shiela E

2011-10-01

This study reports a novel study of marine biofilm formation comprising aerobic and anaerobic bacteria. Samples of quartz and feldspar, minerals commonly found on the earth, were suspended 5 m deep in the North Sea off the east coast of St. Andrews, Scotland for 5 weeks. The assemblage of organisms attached to these stones was cultivated under aerobic and anaerobic conditions in the laboratory. Bacteria isolated on Marine Agar 2216 were all Gram-negative and identified to genus level by sequencing the gene encoding 16S rRNA. Colwellia, Maribacter, Pseudoaltermonas and Shewanella were observed in aerobically-grown cultures while Vibrio was found to be present in both aerobic and anaerobic cultures. The obligate anaerobic bacterium Psychrilyobacter atlanticus, a recently defined genus, was identified as a close relative of isolates grown anaerobically. The results provide valuable information as to the main players that attach and form de novo biofilms on common minerals in sea water.

Enhancing Bidirectional Electron Transfer of Shewanella oneidensis by a Synthetic Flavin Pathway.

PubMed

Yang, Yun; Ding, Yuanzhao; Hu, Yidan; Cao, Bin; Rice, Scott A; Kjelleberg, Staffan; Song, Hao

2015-07-17

Flavins regulate the rate and direction of extracellular electron transfer (EET) in Shewanella oneidensis. However, low concentration of endogenously secreted flavins by the wild-type S. oneidensis MR-1 limits its EET efficiency in bioelectrochemical systems (BES). Herein, a synthetic flavin biosynthesis pathway from Bacillus subtilis was heterologously expressed in S. oneidensis MR-1, resulting in ∼25.7 times' increase in secreted flavin concentration. This synthetic flavin module enabled enhanced bidirectional EET rate of MR-1, in which its maximum power output in microbial fuel cells increased ∼13.2 times (from 16.4 to 233.0 mW/m(2)), and the inward current increased ∼15.5 times (from 15.5 to 255.3 μA/cm(2)).

Cell density related H2 consumption in relation to anoxic Fe(0) corrosion and precipitation of corrosion products by Shewanella oneidensis MR-1.

PubMed

De Windt, Wim; Boon, Nico; Siciliano, Steven D; Verstraete, Willy

2003-11-01

In the absence of oxygen, a protective H2 film is formed around an Fe(0) surface, inhibiting the electron flow from this surface. Our study of anoxic corrosion of Fe(0) beads revealed that, in the presence of Shewanella oneidensis MR-1, H2 removal and precipitation of Fe mineral particles on the cell surface are determining processes for corrosion. These two biologically mediated processes were governed by cell density. H2 removal by Shewanella oneidensis was detected at cell concentrations of 1.0 x 10(6) live cells ml-1 and higher and H2 was electron donor for denitrification of NO3-. The removal of the protective H2 layer from Fe(0) beads by Shewanella oneidensis, resulted in an increase of Fe release out of the Fe(0) beads from 153 +/- 25 mg l(-1) to 196 +/- 7 mg l-1 after 20 h. When the cell concentration exceeded 1.0 x 10(8) live cells ml-1, precipitation of iron minerals on the cell surface was characteristic for the greatest percentage of MR-1 cells, whereas micrometre-scale iron precipitates not associated with culturable cell biomass significantly decreased in number. Addition of supernatant of a corrosion assay with high cell concentration induced metabolic activity in a corrosion assay with low cell concentration, resulting in increased H2 consumption and Fe release from Fe(0) beads. Homoserine lactone-like molecules were detected in the supernatant by a bio-assay, suggesting the involvement of a quorum-sensing regulatory mechanism.

Identifying the role of cytochromes upon the attachment, growth and detachment of Shewanella oneidensis MR-1 on hematite during dissimilatory iron reduction under natural- flow conditions

NASA Astrophysics Data System (ADS)

Mitchell, A. C.; Geesey, G. G.

2006-12-01

Current understanding of bacterial respiration by dissimilatory iron (Fe) reduction is based primarily on studies of closed systems using soluble Fe(III). However, natural environments likely to support Fe reduction are typically open systems and contain Fe(III) primarily in the form of crystalline (hydr)oxides. Mechanisms by which electrons are transported between bacteria and mineral terminal electron acceptors (TEAs) under open system conditions are still poorly understood. However, a number of cytochromes have been identified as potentially playing a critical role in the electron transport system of some Fe reducing bacteria. Experiments were performed using (i) omcA, (ii) mtrC, or (iii) omcA and mtrC cytochrome deficient mutants of the Fe-reducing bacteria, Shewanella oneidensis MR-1, in transparent-window flow- reactors containing hematite as the only TEA. These were operated under defined hydrodynamic and anaerobic conditions. Cells expressed green fluorescent protein (gfp), allowing real time measurement of cells at the mineral surface by epifluorescence microscopy. Cytochromes which play a critical role in the anaerobic growth of S. Oneidensis by Fe reduction under open system natural-flow conditions could then be identified. Differences in the accumulation, maximum density, detachment and total production of surface-associated cells growing on hematite surfaces were apparent between the mutants, and between the mutants and the wild-type. Mutants deficient in cytochromes grew to a lower max density by up to 2 orders of magnitude than the wild-type, and exhibited no reduced Fe in the reactor effluent or at the surface of the hematite at the conclusion of the experiment, as revealed by X-Ray photoelectron spectroscopy (XPS). Therefore omcA and / or mtrC cytochromes appear critical for electron shuttling and anaerobic growth of S. Oneidensis on hematite under natural-flow conditions.

A new methodology to assess antimicrobial resistance of bacteria in coastal waters; pilot study in a Mediterranean hydrosystem

NASA Astrophysics Data System (ADS)

Almakki, Ayad; Estèves, Kevin; Vanhove, Audrey S.; Mosser, Thomas; Aujoulat, Fabien; Marchandin, Hélène; Toubiana, Mylène; Monfort, Patrick; Jumas-Bilak, Estelle; Licznar-Fajardo, Patricia

2017-10-01

The global resistome of coastal waters has been less studied than that of other waters, including marine ones. Here we develop an original method for characterizing the antimicrobial resistance of bacterial communities in coastal waters. The method combines the determination of a new parameter, the community Inhibitory Concentration (c-IC) of antibiotics (ATBs), and the description of the taxonomic richness of the resistant bacteria. We test the method in a Mediterranean hydrosystem, in the Montpellier region, France. Three types of waters are analyzed: near coastal river waters (Lez), lagoon brackish waters (Mauguio), and lake freshwaters (Salagou). Bacterial communities are grown in vitro in various conditions of temperature, salinity, and ATB concentrations. From these experiments, we determine the concentrations of ATB that decrease the bacterial community abundance by 50% (c-IC50) and by 90% (c-IC90). In parallel, we determine the taxonomic repertory of the resistant growing bacteria communities (repertory of Operational Taxonomic Units [OTU]). Temperature and salinity influence the abundance of the cultivable bacteria in presence of ATBs and hence the c-ICs. Very low ATB concentrations can decrease the bacterial abundance significantly. Beside a few ubiquitous genera (Bacillus, Pseudomonas, Shewanella, Vibrio), most resistant OTUs are specific of a type of water. In brackish water, resistant OTUs are more diverse and their community structure less vulnerable to ATBs than those in freshwater. We anticipate that c-IC measurement combined with taxonomic description can be applied to any littoral region to characterize the resistant bacterial communities in the coastal waters. This would help us to evaluate the vulnerability of aquatic ecosystems to antimicrobial pressure.

Discrimination of Four Marine Biofilm-Forming Bacteria by LC-MS Metabolomics and Influence of Culture Parameters.

PubMed

Favre, Laurie; Ortalo-Magné, Annick; Greff, Stéphane; Pérez, Thierry; Thomas, Olivier P; Martin, Jean-Charles; Culioli, Gérald

2017-05-05

Most marine bacteria can form biofilms, and they are the main components of biofilms observed on marine surfaces. Biofilms constitute a widespread life strategy, as growing in such structures offers many important biological benefits. The molecular compounds expressed in biofilms and, more generally, the metabolomes of marine bacteria remain poorly studied. In this context, a nontargeted LC-MS metabolomics approach of marine biofilm-forming bacterial strains was developed. Four marine bacteria, Persicivirga (Nonlabens) mediterranea TC4 and TC7, Pseudoalteromonas lipolytica TC8, and Shewanella sp. TC11, were used as model organisms. The main objective was to search for some strain-specific bacterial metabolites and to determine how culture parameters (culture medium, growth phase, and mode of culture) may affect the cellular metabolism of each strain and thus the global interstrain metabolic discrimination. LC-MS profiling and statistical partial least-squares discriminant analyses showed that the four strains could be differentiated at the species level whatever the medium, the growth phase, or the mode of culture (planktonic vs biofilm). A MS/MS molecular network was subsequently built and allowed the identification of putative bacterial biomarkers. TC8 was discriminated by a series of ornithine lipids, while the P. mediterranea strains produced hydroxylated ornithine and glycine lipids. Among the P. mediterranea strains, TC7 extracts were distinguished by the occurrence of diamine derivatives, such as putrescine amides.

Characterization of a New M13 Metallopeptidase from Deep-Sea Shewanella sp. E525-6 and Mechanistic Insight into Its Catalysis

PubMed Central

Yang, Jin-Yu; Wang, Peng; Li, Chun-Yang; Dong, Sheng; Song, Xiao-Yan; Zhang, Xi-Ying; Xie, Bin-Bin; Zhou, Bai-Cheng; Zhang, Yu-Zhong; Chen, Xiu-Lan

2016-01-01

Bacterial extracellular peptidases are important for bacterial nutrition and organic nitrogen degradation in the ocean. While many peptidases of the M13 family from terrestrial animals and bacteria are studied, there has been no report on M13 peptidases from marine bacteria. Here, we characterized an M13 peptidase, PepS, from the deep-sea sedimentary strain Shewanella sp. E525-6, and investigated its substrate specificity and catalytic mechanism. The gene pepS cloned from strain E525-6 contains 2085 bp and encodes an M13 metallopeptidase. PepS was expressed in Escherichia coli and purified. Among the characterized M13 peptidases, PepS shares the highest sequence identity (47%) with Zmp1 from Mycobacterium tuberculosis, indicating that PepS is a new member of the M13 family. PepS had the highest activity at 30°C and pH 8.0. It retained 15% activity at 0°C. Its half life at 40°C was only 4 min. These properties indicate that PepS is a cold-adapted enzyme. The smallest substrate for PepS is pentapeptide, and it is probably unable to cleave peptides of more than 30 residues. PepS prefers to hydrolyze peptide bonds with P1′ hydrophobic residues. Structural and mutational analyses suggested that His531, His535 and Glu592 coordinate the catalytic zinc ion in PepS, Glu532 acts as a nucleophile, and His654 is probably involved in the transition state stabilization. Asp538 and Asp596 can stablize the orientations of His531 and His535, and Arg660 can stablize the orientation of Asp596. These results help in understanding marine bacterial peptidases and organic nitrogen degradation. PMID:26779153

Characterization of a New M13 Metallopeptidase from Deep-Sea Shewanella sp. E525-6 and Mechanistic Insight into Its Catalysis.

PubMed

Yang, Jin-Yu; Wang, Peng; Li, Chun-Yang; Dong, Sheng; Song, Xiao-Yan; Zhang, Xi-Ying; Xie, Bin-Bin; Zhou, Bai-Cheng; Zhang, Yu-Zhong; Chen, Xiu-Lan

2015-01-01

Bacterial extracellular peptidases are important for bacterial nutrition and organic nitrogen degradation in the ocean. While many peptidases of the M13 family from terrestrial animals and bacteria are studied, there has been no report on M13 peptidases from marine bacteria. Here, we characterized an M13 peptidase, PepS, from the deep-sea sedimentary strain Shewanella sp. E525-6, and investigated its substrate specificity and catalytic mechanism. The gene pepS cloned from strain E525-6 contains 2085 bp and encodes an M13 metallopeptidase. PepS was expressed in Escherichia coli and purified. Among the characterized M13 peptidases, PepS shares the highest sequence identity (47%) with Zmp1 from Mycobacterium tuberculosis, indicating that PepS is a new member of the M13 family. PepS had the highest activity at 30°C and pH 8.0. It retained 15% activity at 0°C. Its half life at 40°C was only 4 min. These properties indicate that PepS is a cold-adapted enzyme. The smallest substrate for PepS is pentapeptide, and it is probably unable to cleave peptides of more than 30 residues. PepS prefers to hydrolyze peptide bonds with P1' hydrophobic residues. Structural and mutational analyses suggested that His531, His535 and Glu592 coordinate the catalytic zinc ion in PepS, Glu532 acts as a nucleophile, and His654 is probably involved in the transition state stabilization. Asp538 and Asp596 can stablize the orientations of His531 and His535, and Arg660 can stablize the orientation of Asp596. These results help in understanding marine bacterial peptidases and organic nitrogen degradation.

Vanadium(V) Reduction by Shewanella oneidensis MR-1 Requires Menaquinone and Cytochromes from the Cytoplasmic and Outer Membranes

PubMed Central

Myers, Judith M.; Antholine, William E.; Myers, Charles R.

2004-01-01

The metal-reducing bacterium Shewanella oneidensis MR-1 displays remarkable anaerobic respiratory plasticity, which is reflected in the extensive number of electron transport components encoded in its genome. In these studies, several cell components required for the reduction of vanadium(V) were determined. V(V) reduction is mediated by an electron transport chain which includes cytoplasmic membrane components (menaquinone and the tetraheme cytochrome CymA) and the outer membrane (OM) cytochrome OmcB. A partial role for the OM cytochrome OmcA was evident. Electron spin resonance spectroscopy demonstrated that V(V) was reduced to V(IV). V(V) reduction did not support anaerobic growth. This is the first report delineating specific electron transport components that are required for V(V) reduction and of a role for OM cytochromes in the reduction of a soluble metal species. PMID:15006760

Effects of disinfectant and biofilm on the corrosion of cast iron pipes in a reclaimed water distribution system.

PubMed

Wang, Haibo; Hu, Chun; Hu, Xuexiang; Yang, Min; Qu, Jiuhui

2012-03-15

The effects of disinfection and biofilm on the corrosion of cast iron pipe in a model reclaimed water distribution system were studied using annular reactors (ARs). The corrosion scales formed under different conditions were characterized by X-ray diffraction (XRD), energy dispersive spectroscopy (EDS), and scanning electron microscopy (SEM), while the bacterial characteristics of biofilm on the surface were determined using several molecular methods. The corrosion scales from the ARs with chlorine included predominantly α-FeOOH and Fe2O3, while CaPO3(OH)·2H2O and α-FeOOH were the predominant phases after chloramines replaced chlorine. Studies of the consumption of chlorine and iron release indicated that the formation of dense oxide layers and biofilm inhibited iron corrosion, causing stable lower chlorine decay. It was verified that iron-oxidizing bacteria (IOB) such as Sediminibacterium sp., and iron-reducing bacteria (IRB) such as Shewanella sp., synergistically interacted with the corrosion product to prevent further corrosion. For the ARs without disinfection, α-FeOOH was the predominant phase at the primary stage, while CaCO3 and α-FeOOH were predominant with increasing time. The mixed corrosion-inducing bacteria, including the IRB Shewanella sp., the IOB Sediminibacterium sp., and the sulfur-oxidizing bacteria (SOB) Limnobacter thioxidans strain, promoted iron corrosion by synergistic interactions in the primary period, while anaerobic IRB became the predominant corrosion bacteria, preventing further corrosion via the formation of protective layers. Copyright © 2011 Elsevier Ltd. All rights reserved.

High-and low-affinity binding sites for Cd on the bacterial cell walls of Bacillus subtilis and Shewanella oneidensis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, B.; Boyanov, M.; Bunker, B. A.

2010-08-01

Bulk Cd adsorption isotherm experiments, thermodynamic equilibrium modeling, and Cd K edge EXAFS were used to constrain the mechanisms of proton and Cd adsorption to bacterial cells of the commonly occurring Gram-positive and Gram-negative bacteria, Bacillus subtilis and Shewanella oneidensis, respectively. Potentiometric titrations were used to characterize the functional group reactivity of the S. oneidensis cells, and we model the titration data using the same type of non-electrostatic surface complexation approach as was applied to titrations of B. subtilis suspensions by Fein et al. (2005). Similar to the results for B. subtilis, the S. oneidensis cells exhibit buffering behavior frommore » approximately pH 3-9 that requires the presence of four distinct sites, with pK{sub a} values of 3.3 {+-} 0.2, 4.8 {+-} 0.2, 6.7 {+-} 0.4, and 9.4 {+-} 0.5, and site concentrations of 8.9({+-}2.6) x 10{sup -5}, 1.3({+-}0.2) x 10{sup -4}, 5.9({+-}3.3) x 10{sup -5}, and 1.1({+-}0.6) x 10{sup -4} moles/g bacteria (wet mass), respectively. The bulk Cd isotherm adsorption data for both species, conducted at pH 5.9 as a function of Cd concentration at a fixed biomass concentration, were best modeled by reactions with a Cd:site stoichiometry of 1:1. EXAFS data were collected for both bacterial species as a function of Cd concentration at pH 5.9 and 10 g/L bacteria. The EXAFS results show that the same types of binding sites are responsible for Cd sorption to both bacterial species at all Cd loadings tested (1-200 ppm). Carboxyl sites are responsible for the binding at intermediate Cd loadings. Phosphoryl ligands are more important than carboxyl ligands for Cd binding at high Cd loadings. For the lowest Cd loadings studied here, a sulfhydryl site was found to dominate the bound Cd budgets for both species, in addition to the carboxyl and phosphoryl sites that dominate the higher loadings. The EXAFS results suggest that both Gram-positive and Gram-negative bacterial cell walls

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

Effect of media composition, including gelling agents, on isolation of previously uncultured rumen bacteria.

PubMed

Nyonyo, T; Shinkai, T; Tajima, A; Mitsumori, M

2013-01-01

The aim of this study was to develop novel anaerobic media using gellan gum for the isolation of previously uncultured rumen bacteria. Four anaerobic media, a basal liquid medium (BM) with agar (A-BM), a modified BM (MBM) with agar (A-MBM), an MBM with phytagel (P-MBM) and an MBM with gelrite (G-MBM) were used for the isolation of rumen bacteria and evaluated for the growth of previously uncultured rumen bacteria. Of the 214 isolates composed of 144 OTUs, 103 isolates (83 OTUs) were previously uncultured rumen bacteria. Most of the previously uncultured strains were obtained from A-MBM, G-MBM and P-MBM, but the predominant cultural members, isolated from each medium, differed. A-MBM and G-MBM showed significantly higher numbers of different OTUs derived from isolates than A-BM (P < 0·05). The Shannon index indicated that the isolates of A-MBM showed the highest diversity (H' = 3·89) compared with those of G-MBM, P-MBM and A-BM (H' = 3·59, 3·23 and 3·39, respectively). Although previously uncultured rumen bacteria were isolated from all media used, the ratio of previously uncultured bacteria to total isolates was increased in A-MBM, P-MBM and G-MBM. © 2012 The Society for Applied Microbiology.

Effects of Fab' fragments of specific egg yolk antibody (IgY-Fab') against Shewanella putrefaciens on the preservation of refrigerated turbot.

PubMed

Zhang, Qian; Lin, Hong; Sui, Jianxin; Wang, Jingxue; Cao, Limin

2015-01-01

In our previous studies the specific egg yolk antibody (IgY) against Shewanella putrefaciens (one of the specific spoilage organisms for marine products during aerobic chilling storage) demonstrated significant activity to prolong the shelf life of refrigerated fish. The exploitation of the antigen-binding fragment plus the hinge region (IgY-Fab') is now considered a promising method for improving the efficiency of such natural antimicrobial agents. The antimicrobial activity of IgY-Fab' against S. putrefaciens was investigated using refrigerated turbot as samples. By microbial, chemical and sensory tests, it was shown to be able to effectively inhibit bacterial growth and prolong the shelf life of samples, with an efficiency evaluated significantly higher than that of whole IgY with the same molarity. The interaction between IgY agents and S. putrefaciens cells was also investigated, and the IgY-Fab' showed a much greater ability to damage cell membranes than the whole IgY. Compared to whole IgY with the same molarity, IgY-Fab' demonstrated higher and more durable antimicrobial efficiency. Such a result was assumed to be closely related to its structural properties (such as the much lower molecular weight), which may enhance its ability to influence physiological activities of antigen bacteria, especially the property or/and structure of cell membranes. © 2014 Society of Chemical Industry.

Synthetic Klebsiella pneumoniae-Shewanella oneidensis Consortium Enables Glycerol-Fed High-Performance Microbial Fuel Cells.

PubMed

Li, Feng; Yin, Changji; Sun, Liming; Li, Yuanxiu; Guo, Xuewu; Song, Hao

2018-05-01

Microbial fuel cell (MFC) is an eco-friendly bio-electrochemical sys-tem that uses microorganism as biocatalyst to convert biomass into electricity. Glycerol, as a waste in the biodiesel refinery processes, is an appealing substrate for MFC. Nevertheless, glycerol cannot be utilized as carbon source by well-known exoelectrogens such as Shewanella oneidensis. Herein, to generate electricity by rapidly harnessing glycerol, the authors rationally constructed a Klebsiella pneumoniae-Shewanella oneidensis microbial consortium to efficiently harvest electricity from glyc-erol, in which K. pneumoniae converted glycerol into lactate, fed to S. oneidensis as carbon source and electron donor. To improve electricity output, the authors systematically engineered the consortium in terms of carbon flux distribution and efficiency of extracellular electron transfer (EET). To direct more carbon flux to lactate biosynthesis in K. pneumoniae, the authors eliminated the ethanol pathway by knocking out the alcohol dehydrogenase gene (adhE), and enhanced lactate biosynthesis by heterologously expressing a lactate dehydrogen-ase gene (ldhD) from Lactobacillus bulgaricus and a lactate transporter gene (lldP) from Escherichia coli. To facilitate EET between S. oneidensis and anode surfaces, a biosynthetic flavins pathway from Bacillus subtilis is introduced into S. oneidensis. The author further optimized the glycerol concentration, thus S. oneidensis could be continuously fed with lactate synthesized from K. pneumoniae at a constant rate. Our glycerol-fed MFC generated a maximum power density of 19.9 mW/m 2 , significantly higher than that of the wild-type consor-tium. This work suggested that engineering microbial consortia is an effi-cient strategy to expand the spectrum of usable carbon sources and promote electricity power production in MFCs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

THE ROLE OF 4-HYDROXYPHENYLPYRUVATE DIOXYGENASE IN ENHANCEMENT OF SOLID-PHASE ELECTRON TRANSFER BY SHEWANELLA ONEIDENSIS MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Turick, C; Amy Ekechukwu, A

2007-06-01

While mechanistic details of dissimilatory metal reduction are far from being understood, it is postulated that the electron transfer to solid metal oxides is mediated by outer membrane-associated c-type cytochromes and redox active electron shuttling compounds. This study focuses on the production of homogensitate in Shewanella oneidensis MR-1, an intermediate of tyrosine degradation pathway, which is a precursor of a redox cycling metabolite, pyomelanin. In this study, we determined that two enzymes involved in this pathway, 4-hydroxyphenylpyruvate dioxygenase (4HPPD) and homogentisate 1,2-dioxygenase are responsible for homogentisate production and oxidation, respectively. Inhibition of 4-HPPD activity with the specific inhibitor sulcotrione (2-(2-chloro-4-methanemore » sulfonylbenzoyl)-1,3-cyclohexanedione), and deletion of melA, a gene encoding 4-HPPD, resulted in no pyomelanin production by S. oneidensis MR-1. Conversely, deletion of hmgA which encodes the putative homogentisate 1,2-dioxygenase, resulted in pyomelanin overproduction. The efficiency and rates, with which MR-1 reduces hydrous ferric oxide, were directly linked to the ability of mutant strains to produce pyomelanin. Electrochemical studies with whole cells demonstrated that pyomelanin substantially increases the formal potential (E{sup o}{prime}) of S. oneidensis MR-1. Based on this work, environmental production of pyomelanin likely contributes to an increased solid-phase metal reduction capacity in Shewanella oneidensis.« less

Identities of epilithic hydrocarbon-utilizing diazotrophic bacteria from the Arabian Gulf Coasts, and their potential for oil bioremediation without nitrogen supplementation.

PubMed

Radwan, Samir; Mahmoud, Huda; Khanafer, Majida; Al-Habib, Aamar; Al-Hasan, Redha

2010-08-01

Gravel particles from four sites along the Arabian Gulf coast in autumn, winter, and spring were naturally colonized with microbial consortia containing between 7 and 400 × 10(2) cm(-2) of cultivable oil-utilizing bacteria. The 16S rRNA gene sequences of 70 representatives of oil-utilizing bacteria revealed that they were predominantly affiliated with the Gammaproteobacteria and the Actinobacteria. The Gammaproteobacteria comprised among others, the genera Pseudomonas, Pseudoalteromonas, Shewanella, Marinobacter, Psychrobacter, Idiomarina, Alcanivorax, Cobetia, and others. Actinobacteria comprised the genera Dietzia, Kocuria, Isoptericola, Rhodococcus, Microbacterium, and others. In autumn, Firmicutes members were isolated from bay and nonbay stations while Alphaproteobacteria were detected only during winter from Anjefa bay station. Fingerprinting by denaturing gradient gel electrophoresis of amplified 16S rRNA genes of whole microbial consortia confirmed the culture-based bacterial diversities in the various epilithons in various sites and seasons. Most of the representative oil-utilizing bacteria isolated from the epilithons were diazotrophic and could attenuate oil also in nitrogen-rich (7.9-62%) and nitrogen-free (4-54%) cultures, which, makes the microbial consortia suitable for oil bioremediation in situ, without need for nitrogen supplementation. This was confirmed in bench-scale experiments in which unfertilized oily seawater was bioremediated by epilithon-coated gravel particles.

Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bendall, Matthew L.; Luong, Khai; Wetmore, Kelly M.

2013-08-30

We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns.more » However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.« less

Evolution of Cell Size Homeostasis and Growth Rate Diversity during Initial Surface Colonization of Shewanella oneidensis.

PubMed

Lee, Calvin K; Kim, Alexander J; Santos, Giancarlo S; Lai, Peter Y; Lee, Stella Y; Qiao, David F; Anda, Jaime De; Young, Thomas D; Chen, Yujie; Rowe, Annette R; Nealson, Kenneth H; Weiss, Paul S; Wong, Gerard C L

2016-09-06

Cell size control and homeostasis are fundamental features of bacterial metabolism. Recent work suggests that cells add a constant size between birth and division ("adder" model). However, it is not known how cell size homeostasis is influenced by the existence of heterogeneous microenvironments, such as those during biofilm formation. Shewanella oneidensis MR-1 can use diverse energy sources on a range of surfaces via extracellular electron transport (EET), which can impact growth, metabolism, and size diversity. Here, we track bacterial surface communities at single-cell resolution to show that not only do bacterial motility appendages influence the transition from two- to three-dimensional biofilm growth and control postdivisional cell fates, they strongly impact cell size homeostasis. For every generation, we find that the average growth rate for cells that stay on the surface and continue to divide (nondetaching population) and that for cells that detach before their next division (detaching population) are roughly constant. However, the growth rate distribution is narrow for the nondetaching population, but broad for the detaching population in each generation. Interestingly, the appendage deletion mutants (ΔpilA, ΔmshA-D, Δflg) have significantly broader growth rate distributions than that of the wild type for both detaching and nondetaching populations, which suggests that Shewanella appendages are important for sensing and integrating environmental inputs that contribute to size homeostasis. Moreover, our results suggest multiplexing of appendages for sensing and motility functions contributes to cell size dysregulation. These results can potentially provide a framework for generating metabolic diversity in S. oneidensis populations to optimize EET in heterogeneous environments.

Potent antimicrobial and antibiofilm activities of bacteriogenically synthesized gold-silver nanoparticles against pathogenic bacteria and their physiochemical characterizations.

PubMed

Ramasamy, Mohankandhasamy; Lee, Jin-Hyung; Lee, Jintae

2016-09-01

The objective of this study was to develop a bimetallic nanoparticle with enhanced antibacterial activity that would improve the therapeutic efficacy against bacterial biofilms. Bimetallic gold-silver nanoparticles were bacteriogenically synthesized using γ-proteobacterium, Shewanella oneidensis MR-1. The antibacterial activities of gold-silver nanoparticles were assessed on the planktonic and biofilm phases of individual and mixed multi-cultures of pathogenic Gram negative (Escherichia coli and Pseudomonas aeruginosa) and Gram positive bacteria (Enterococcus faecalis and Staphylococcus aureus), respectively. The minimum inhibitory concentration of gold-silver nanoparticles was 30-50 µM than that of other nanoparticles (>100 µM) for the tested bacteria. Interestingly, gold-silver nanoparticles were more effective in inhibiting bacterial biofilm formation at 10 µM concentration. Both scanning and transmission electron microscopy results further accounted the impact of gold-silver nanoparticles on biocompatibility and bactericidal effect that the small size and bio-organic materials covering on gold-silver nanoparticles improves the internalization and thus caused bacterial inactivation. Thus, bacteriogenically synthesized gold-silver nanoparticles appear to be a promising nanoantibiotic for overcoming the bacterial resistance in the established bacterial biofilms. © The Author(s) 2016.

Facilitated extracellular electron transfer of Shewanella loihica PV-4 by antimony-doped tin oxide nanoparticles as active microelectrodes.

PubMed

Zhang, Xiaojian; Liu, Huan; Wang, Jinrong; Ren, Guangyuan; Xie, Beizhen; Liu, Hong; Zhu, Ying; Jiang, Lei

2015-11-28

Dissimilatory metal reducing bacteria are capable of extracellular electron transfer (EET) to insoluble metal oxides as external electron acceptors for their anaerobic respiration, which is recognized as an important energy-conversion process in natural and engineered environments, such as in mineral cycling, bioremediation, and microbial fuel/electrolysis cells. However, the low EET efficiency remains one of the major bottlenecks for its practical application. We report firstly that the microbial current generated by Shewanella loihica PV-4 (S. loihica PV-4) could be greatly improved that is up to ca. 115 fold, by adding antimony-doped tin oxide (ATO) nanoparticles in the electrochemical reactor. The results demonstrate that the biocompatible, electrically conductive ATO nanoparticles acted as active microelectrodes could facilitate the formation of a cells/ATO composite biofilm and the reduction of the outer membrane c-type cytochromes (OM c-Cyts) that are beneficial for the electron transfer from cells to electrode. Meanwhile, a synergistic effect between the participation of OM c-Cyts and the accelerated EET mediated by cell-secreted flavins may play an important role for the enhanced current generation in the presence of ATO nanoparticles. Moreover, it is worth noting that the TCA cycle in S. loihica PV-4 cells is activated by adding ATO nanoparticles, even if the potential is poised at +0.2 V, thereby also improving the EET process. The results presented here may provide a simple and effective strategy to boost the EET of S. loihica PV-4 cells, which is conducive to providing potential applications in bioelectrochemical systems.

Phylogenentic and enzymatic characterization of psychrophilic and psychrotolerant marine bacteria belong to γ-Proteobacteria group isolated from the sub-Antarctic Beagle Channel, Argentina.

PubMed

Cristóbal, Héctor A; Benito, Juliana; Lovrich, Gustavo A; Abate, Carlos M

2015-05-01

The phylogenetic and physiological characteristics of cultivable-dependent approaches were determined to establish the diversity of marine bacteria associated with the intestines of benthonic organisms and seawater samples from the Argentina's Beagle Channel. A total of 737 isolates were classified as psychrophlic and psychrotolerant culturable marine bacteria. These cold-adapted microorganisms are capable of producing cold-active glycosyl hydrolases, such as β-glucosidases, celulases, β-galactosidases, xylanases, chitinases, and proteases. These enzymes could have potential biotechnological applications for use in low-temperature manufacturing processes. According to polymerase chain reaction-restriction fragment length polymorphism analysis of part of genes encoding 16S ribosomal DNA (ARDRA) and DNA gyrase subunit B (gyrB-RFLP), 11 operational taxonomic units (OTU) were identified and clustered in known genera using InfoStat software. The 50 isolates selected were sequenced based on near full sequence analysis of 16S rDNA and gyrB sequences and identified by their nearest neighbors ranging between 96 and 99 % of identities. Phylogenetic analyses using both genes allowed relationships between members of the cultured marine bacteria belonging to the γ-Proteobacteria group (Aeromonas, Halteromonas, Pseudomonas, Pseudoalteromonas, Shewanella, Serratia, Colwellia, Glacielocola, and Psychrobacter) to be evaluated. Our research reveals a high diversity of hydrolytic bacteria, and their products actuality has an industrial use in several bioprocesses at low-temperature manufacturing.

Polymicrobial bacteremia caused by Escherichia coli, Edwardsiella tarda, and Shewanella putrefaciens.

PubMed

Wang, I-Kuan; Lee, Ming-Hsun; Chen, Yu-Ming; Huang, Chiu-Ching

2004-09-01

Edwardsiella tarda, a member of Enterobacteriaceae, is found in freshwater and marine environments and in animals living in these environments. This bacterium is primarily associated with gastrointestinal diseases, and has been isolated from stool specimens obtained from persons with or without clinical infectious diseases. Shewanella putrefaciens, a saprophytic gram-negative rod, is rarely responsible for clinical syndromes in humans. Debilitated status and exposure to aquatic environments are the major predisposing factors for E. tarda or S. putrefaciens infection. A 61-year-old woman was febrile with diarrhea 8 hours after ingesting shark meat, and two sets of blood cultures grew Escherichia coli, E. tarda and S. putrefaciens at the same time. She was successfully treated with antibiotics. We present this rare case of polymicrobial bacteremia caused by E. coli, E. tarda and S. putrefaciens without underlying disease, which is the first found in Taiwan. This rare case of febrile diarrhea with consequent polymicrobial bacteremia emphasizes that attention should always be extended to these unusual pathogens.

Bacteria exploit a polymorphic instability of the flagellar filament to escape from traps.

PubMed

Kühn, Marco J; Schmidt, Felix K; Eckhardt, Bruno; Thormann, Kai M

2017-06-13

Many bacterial species swim by rotating single polar helical flagella. Depending on the direction of rotation, they can swim forward or backward and change directions to move along chemical gradients but also to navigate their obstructed natural environment in soils, sediments, or mucus. When they get stuck, they naturally try to back out, but they can also resort to a radically different flagellar mode, which we discovered here. Using high-speed microscopy, we monitored the swimming behavior of the monopolarly flagellated species Shewanella putrefaciens with fluorescently labeled flagellar filaments at an agarose-glass interface. We show that, when a cell gets stuck, the polar flagellar filament executes a polymorphic change into a spiral-like form that wraps around the cell body in a spiral-like fashion and enables the cell to escape by a screw-like backward motion. Microscopy and modeling suggest that this propagation mode is triggered by an instability of the flagellum under reversal of the rotation and the applied torque. The switch is reversible and bacteria that have escaped the trap can return to their normal swimming mode by another reversal of motor direction. The screw-type flagellar arrangement enables a unique mode of propagation and, given the large number of polarly flagellated bacteria, we expect it to be a common and widespread escape or motility mode in complex and structured environments.

Expression of a tetraheme protein, Desulfovibrio vulgaris Miyazaki F cytochrome c(3), in Shewanella oneidensis MR-1

NASA Technical Reports Server (NTRS)

Ozawa, K.; Tsapin, A. I.; Nealson, K. H.; Cusanovich, M. A.; Akutsu, H.

2000-01-01

Cytochrome c(3) from Desulfovibrio vulgaris Miyazaki F was successfully expressed in the facultative aerobe Shewanella oneidensis MR-1 under anaerobic, microaerophilic, and aerobic conditions, with yields of 0.3 to 0.5 mg of cytochrome/g of cells. A derivative of the broad-host-range plasmid pRK415 containing the cytochrome c(3) gene from D. vulgaris Miyazaki F was used for transformation of S. oneidensis MR-1, resulting in the production of protein product that was indistinguishable from that produced by D. vulgaris Miyazaki F, except for the presence of one extra alanine residue at the N terminus.

Culturable bacterial communities associated to Brazilian Oscarella species (Porifera: Homoscleromorpha) and their antagonistic interactions.

PubMed

Laport, Marinella Silva; Bauwens, Mathieu; de Oliveira Nunes, Suzanne; Willenz, Philippe; George, Isabelle; Muricy, Guilherme

2017-04-01

Sponges offer an excellent model to investigate invertebrate-microorganism interactions. Furthermore, bacteria associated with marine sponges represent a rich source of bioactive metabolites. The aim of this study was to characterize the bacteria inhabiting a genus of sponges, Oscarella, and their potentiality for antimicrobial production. Bacterial isolates were recovered from different Oscarella specimens, among which 337 were phylogenetically identified. The culturable community was dominated by Proteobacteria and Firmicutes, and Vibrio was the most frequently isolated genus, followed by Shewanella. When tested for antimicrobial production, bacteria of the 12 genera isolated were capable of producing antimicrobial substances. The majority of strains were involved in antagonistic interactions and inhibitory activities were also observed against bacteria of medical importance. It was more pronounced in some isolated genera (Acinetobacter, Bacillus, Photobacterium, Shewanella and Vibrio). These findings suggest that chemical antagonism could play a significant role in shaping bacterial communities within Oscarella, a genus classified as low-microbial abundance sponge. Moreover, the identified strains may contribute to the search for new sources of antimicrobial substances, an important strategy for developing therapies to treat infections caused by multidrug-resistant bacteria. This study was the first to investigate the diversity and antagonistic activity of bacteria isolated from Oscarella spp. It highlights the biotechnological potential of sponge-associated bacteria.

Physiological and hydrological controls on mineral redox cycling by long-range electron transport by bacteria in anaerobic sediments

NASA Astrophysics Data System (ADS)

Michelson, K.; Werth, C. J.; Sanford, R. A.; Valocchi, A. J.

2016-12-01

The cycling of iron and manganese oxides plays a critical role in the bioavailability of trace elements and macronutrients, the flux of carbon across terrestrial and atmospheric ecosystems, and the remediation of groundwater contaminated by toxic metals and radionuclides. Bacteria control one half of the redox cycle as the primary drivers of iron and manganese reduction in anaerobic soils and sediments. However, Fe(III) and Mn(IV) are almost exclusively present under anaerobic conditions as insoluble oxides, the reduction of which are facilitated by extracellular electron transport via conductive `nanowires', electron shuttling, and direct contact with outer membrane cytochromes. Our research focus is on the relative contribution of nanowires and electron shuttles under different physiological and hydrological conditions, which remains unexplored. We present a novel microfluidic platform that allows us to directly observe these phenomena under a controlled environment representative of groundwater conditions, monitor the metabolic activity and redox state of bacteria, and determine the presence of reduced products in-situ using Raman spectroscopy. Using Geobacter sulfurreducens and Shewanella oneidensis as model metal-reducing bacteria, and insoluble manganese dioxide (i.e. birnessite) as an electron acceptor, we show that 1) electron shuttling is more effective under static conditions 2) the presence of exogenous shuttles allows efficient electron transport under all flow regimes 3) redox potential of the bulk medium exerts significant control over reduction by both nanowires and electron shuttles 4) shuttling is amplified by orders of magnitude in nanopores.

Outer membrane cytochromes/flavin interactions in Shewanella spp.—A molecular perspective

DOE PAGES

Babanova, Sofia; Matanovic, Ivana; Cornejo, Jose; ...

2017-05-31

Extracellular electron transfer (EET) is intrinsically associated with the core phenomena of energy harvesting/energy conversion in natural ecosystems and biotechnology applications. But, the mechanisms associated with EET are complex and involve molecular interactions that take place at the “bionano interface” where biotic/abiotic interactions are usually explored. Our work provides molecular perspective on the electron transfer mechanism(s) employed by Shewanella oneidensis MR-1. Molecular docking simulations were used to explain the interfacial relationships between two outer-membrane cytochromes (OMC) OmcA and MtrC and riboflavin (RF) and flavin mononucleotide (FMN), respectively. OMC-flavin interactions were analyzed by studying the electrostatic potential, the hydrophilic/hydrophobic surface properties,more » and the van der Waals surface of the OMC proteins. As a result, it was proposed that the interactions between flavins and OMCs are based on geometrical recognition event. The possible docking positions of RF and FMN to OmcA and MtrC were also shown.« less

Changes in Microbial Communities, Including both Uncultured and Culturable Bacteria, with Mid-Ocean Ballast-Water Exchange during a Voyage from Japan to Australia

PubMed Central

Tomaru, Akiko; Kawachi, Masanobu; Demura, Mikihide; Fukuyo, Yasuwo

2014-01-01

We assessed changes in the microbial communities in ballast water during a trans-Pacific voyage from Japan to Australia that included a mid-ocean ballast-water exchange. Uncultured (i.e., total) and culturable bacteria were counted and were characterized by using denaturing gradient gel electrophoresis (DGGE). There was a clear decrease over time in numbers of uncultured microorganisms, except for heterotrophic nanoflagellates, whereas the abundance of culturable bacteria initially decreased after the ballast-water exchange but then increased. The increase, however, was only up to 5.34% of the total number of uncultured bacteria. Cluster analysis showed that the DGGE profiles of uncultured bacteria clearly changed after the exchange. In contrast, there was no clear change in the DGGE profiles of culturable bacteria after the exchange. Multidimensional scaling analysis showed changes in microbial communities over the course of the voyage. Although indicator microbes as defined by the International Convention for the Control and Management of Ships' Ballast Water and Sediments were occasionally detected, no coliform bacteria were detected after the exchange. PMID:24817212

Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens

PubMed Central

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-01-01

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210

Characterization of the microbial community composition and the distribution of Fe-metabolizing bacteria in a creek contaminated by acid mine drainage.

PubMed

Sun, Weimin; Xiao, Enzong; Krumins, Valdis; Dong, Yiran; Xiao, Tangfu; Ning, Zengping; Chen, Haiyan; Xiao, Qingxiang

2016-10-01

A small watershed heavily contaminated by long-term acid mine drainage (AMD) from an upstream abandoned coal mine was selected to study the microbial community developed in such extreme system. The watershed consists of AMD-contaminated creek, adjacent contaminated soils, and a small cascade aeration unit constructed downstream, which provide an excellent contaminated site to study the microbial response in diverse extreme AMD-polluted environments. The results showed that the innate microbial communities were dominated by acidophilic bacteria, especially acidophilic Fe-metabolizing bacteria, suggesting that Fe and pH are the primary environmental factors in governing the indigenous microbial communities. The distribution of Fe-metabolizing bacteria showed distinct site-specific patterns. A pronounced shift from diverse communities in the upstream to Proteobacteria-dominated communities in the downstream was observed in the ecosystem. This location-specific trend was more apparent at genus level. In the upstream samples (sampling sites just below the coal mining adit), a number of Fe(II)-oxidizing bacteria such as Alicyclobacillus spp., Metallibacterium spp., and Acidithrix spp. were dominant, while Halomonas spp. were the major Fe(II)-oxidizing bacteria observed in downstream samples. Additionally, Acidiphilium, an Fe(III)-reducing bacterium, was enriched in the upstream samples, while Shewanella spp. were the dominant Fe(III)-reducing bacteria in downstream samples. Further investigation using linear discriminant analysis (LDA) effect size (LEfSe), principal coordinate analysis (PCoA), and unweighted pair group method with arithmetic mean (UPGMA) clustering confirmed the difference of microbial communities between upstream and downstream samples. Canonical correspondence analysis (CCA) and Spearman's rank correlation indicate that total organic carbon (TOC) content is the primary environmental parameter in structuring the indigenous microbial communities

Quantification of the Genetic Expression of bgl-A, bgl, and CspA and Enzymatic Characterization of β-Glucosidases from Shewanella sp. G5.

PubMed

Cristóbal, Héctor Antonio; Poma, Hugo Ramiro; Abate, Carlos Mauricio; Rajal, Verónica Beatriz

2016-06-01

Shewanella sp. G5, a psychrotolerant marine bacterium, has a cold-shock protein (CspA) and three β-glucosidases, two of which were classified in the glycosyl hydrolase families 1 and 3 and are encoded by bgl-A and bgl genes, respectively. Shewanella sp. G5 was cultured on Luria-Bertani (LB) and Mineral Medium Brunner (MMB) media with glucose and cellobiose at various temperatures and pH 6 and 8. Relative quantification of the expression levels of all three genes was studied by real-time PCR with the comparative Ct method (2(-ΔΔCt)) using the gyrB housekeeping gene as a normalizer. Results showed that the genes had remarkably different genetic expression levels under the conditions evaluated, with increased expression of all genes obtained on MMB with cellobiose at 30 °C. Specific growth rate and specific β-glucosidase activity were also determined for all the culture conditions. Shewanella sp. G5 was able to grow on both media at 4 °C, showing the maximum specific growth rate on LB with cellobiose at 37 °C. The specific β-glucosidase activity obtained on MMB with cellobiose at 30 °C was 25 to 50 % higher than for all other conditions. At pH 8, relative activity was 34, 60, and 63 % higher at 30 °C than at 10 °C, with three peaks at 10, 25, and 37 °C on both media. Enzyme activity increased by 61 and 47 % in the presence of Ca(2+) and by 24 and 31 % in the presence of Mg(2+) on LB and MMB at 30 °C, respectively, but it was totally inhibited by Hg(2+), Cu(2+), and EDTA. Moreover, this activity was slightly decreased by SDS, Zn(2+), and DTT, all at 5 mM. Ethanol (14 % v/v) and glucose (100 mM) also reduced the activity by 63 and 60 %, respectively.

Iron Reduction and Carbonate Precipitation by Shewanella oneidensis

NASA Astrophysics Data System (ADS)

Zeng, Z.; Tice, M. M.

2011-12-01

This study is to contribute to better understanding of how Archean microbes induced carbonate diagenesis in mats and stromatolites. Previous studies showed sulfate reduction, a common promoter of carbonate precipitation in modern mats[1], is likely to have been less effective in Archean mats in marine fluids lower in sulfate[2]. Alternatively, iron reduction produces far more alkalinity per unit carbon respired than sulfate reduction. Therefore, we hypothesize iron reduction can promote much more carbonate precipitation than sulfate reduction. Our study might also have some relevance to banded iron formation on which microbial iron reduction played a potential role[3]. To test our hypothesis, Shewanella oneidensis MR-1, a dissimilatory iron reducing bacterium will be cultured anaerobically (79%N2, 20%CO2 and 1%H2) in basal medium to trigger iron reduction. Lactate will be used as electron donor, and the electron acceptor will be fresh ferrihydrite. Culture medium will be added with various metal ions, such as Ca2+ and Mg2+, to obtain potential carbonate precipitate. Escherichia coli (with fumarate added as an electron acceptor) will be used to provide a comparison to live but non-iron- reduction cells. After 20 days incubation, precipitate will be collected, washed and identified by X-ray diffraction (XRD). Besides, iron reduction rate (ferrozine assay)[4], PH and amount of precipitate (carbonate and oxidize fractions)[5] will be measured over time to well understand how S. oneidensis drives carbonate precipitation.

Role of outer membrane c-type cytochromes MtrC and OmcA in Shewanella oneidensis MR-1 cell production, accumulation and detachment during respiration on hematite

USDA-ARS?s Scientific Manuscript database

The iron-reducing bacterium Shewanella oneidensis MR-1 has the capacity to contribute to iron cycling over the long term by respiring on crystalline iron oxides such as hematite when poorly crystalline phases are depleted. The ability of outer membrane cytochromes OmcA and MtrC of MR-1 to bind to an...

Plant Carbohydrate Scavenging through TonB-Dependent Receptors: A Feature Shared by Phytopathogenic and Aquatic Bacteria

PubMed Central

Boulanger, Alice; Lautier, Martine; Guynet, Catherine; Denancé, Nicolas; Vasse, Jacques

2007-01-01

TonB-dependent receptors (TBDRs) are outer membrane proteins mainly known for the active transport of iron siderophore complexes in Gram-negative bacteria. Analysis of the genome of the phytopathogenic bacterium Xanthomonas campestris pv. campestris (Xcc), predicts 72 TBDRs. Such an overrepresentation is common in Xanthomonas species but is limited to only a small number of bacteria. Here, we show that one Xcc TBDR transports sucrose with a very high affinity, suggesting that it might be a sucrose scavenger. This TBDR acts with an inner membrane transporter, an amylosucrase and a regulator to utilize sucrose, thus defining a new type of carbohydrate utilization locus, named CUT locus, involving a TBDR for the transport of substrate across the outer membrane. This sucrose CUT locus is required for full pathogenicity on Arabidopsis, showing its importance for the adaptation to host plants. A systematic analysis of Xcc TBDR genes and a genome context survey suggested that several Xcc TBDRs belong to other CUT loci involved in the utilization of various plant carbohydrates. Interestingly, several Xcc TBDRs and CUT loci are conserved in aquatic bacteria such as Caulobacter crescentus, Colwellia psychrerythraea, Saccharophagus degradans, Shewanella spp., Sphingomonas spp. or Pseudoalteromonas spp., which share the ability to degrade a wide variety of complex carbohydrates and display TBDR overrepresentation. We therefore propose that TBDR overrepresentation and the presence of CUT loci designate the ability to scavenge carbohydrates. Thus CUT loci, which seem to participate to the adaptation of phytopathogenic bacteria to their host plants, might also play a very important role in the biogeochemical cycling of plant-derived nutrients in marine environments. Moreover, the TBDRs and CUT loci identified in this study are clearly different from those characterized in the human gut symbiont Bacteroides thetaiotaomicron, which allow glycan foraging, suggesting a convergent

Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fredrickson, Jim K.; Daly, Michael J.

2006-06-01

Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR), desiccation, and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and verymore » low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR (http://cfyn.ifas.ufl.edu/radiation.pdf).« less

Development of a real-time PCR assay with an internal amplification control for detection of Gram-negative histamine-producing bacteria in fish.

PubMed

Bjornsdottir-Butler, Kristin; Jones, Jessica L; Benner, Ronald; Burkhardt, William

2011-05-01

Prompt detection of bacteria that contribute to scombrotoxin (histamine) fish poisoning can aid in the detection of potentially toxic fish products and prevent the occurrence of illness. We report development of the first real-time PCR method for rapid detection of Gram-negative histamine-producing bacteria (HPB) in fish. The real-time PCR assay was 100% inclusive for detecting high-histamine producing isolates and did not detect any of the low- or non-histamine producing isolates. The efficiency of the assay with/without internal amplification control ranged from 96-104% and in the presence of background flora and inhibitory matrices was 92/100% and 73-96%, respectively. This assay was used to detect HPB from naturally contaminated yellowfin tuna, bluefish, and false albacore samples. Photobacterium damselae (8), Plesiomonas shigelloides (2), Shewanella sp. (1), and Morganella morganii (1) were subsequently isolated from the real-time PCR positive fish samples. These results indicate that the real-time PCR assay developed in this study is a rapid and sensitive method for detecting high-HPB. The assay may be adapted for quantification of HPB, either directly or with an MPN-PCR method. Copyright © 2010. Published by Elsevier Ltd.

Effect of quorum sensing signals produced by seaweed-associated bacteria on carpospore liberation from Gracilaria dura

PubMed Central

Singh, Ravindra Pal; Baghel, Ravi S.; Reddy, C. R. K.; Jha, Bhavanath

2015-01-01

Epiphytic and endophytic bacteria associated with green macroalgae Ulva (U. fasciata and U. lactuca) and red macroalgae Gracilaria (G. corticata and G. dura) have been identified from three different seasons to evaluate the effect of quorum sensing (QS) molecules on carpospores liberation from Gracilaria dura. The bacterial isolates belonging to the orders Bacillales, Pseudomonadales, Alteromonadales, and Vibrionales were present in all seasons, whereas Actinomycetales and Enterobacteriales were confined to pre-monsoon and post-monsoon seasons, respectively. Among all the Gram-negative bacteria, seven isolates were found to produce different types of N-acyl homoserine lactones (AHLs). Interestingly, Shewanella algae produced five types of AHL: C4-HSL, HC4-HSL, C6-HSL, 3-oxo-C6-HSL, and 3-oxo-C12-HSL. Subsequently, the AHLs producing bacterial isolates were screened for carpospore liberation from G. dura and these isolates were found to positively induce carpospore liberation over the control. Also, observed that carpospore liberation increased significantly in C4- and C6-HSL treated cystocarps. Sodium dodecyl sulfate and native polyacrylamide gel electrophoresis of the total protein of the C4- and C6-HSL treated cystocarps showed two specific peptide bands of different molecular weights (50 kDa and 60 kDa) as compared to the control, confirming their indirect effect on carpospore liberation. PMID:25788899

The effect of metal loading on Cd adsorption onto Shewanella oneidensis bacterial cell envelopes: The role of sulfhydryl sites

NASA Astrophysics Data System (ADS)

Yu, Qiang; Fein, Jeremy B.

2015-10-01

The adsorption and desorption of Cd onto Shewanella oneidensis bacterial cells with and without blocking of sulfhydryl sites was measured in order to determine the effect of metal loading and to understand the role of sulfhydryl sites in the adsorption reactions. The observed adsorption/desorption behaviors display strong dependence on metal loading. Under a high loading of 40 μmol Cd/g bacterial cells, blocking the sulfhydryl sites within the cell envelope by exposure of the biomass to monobromo(trimethylammonio)bimane bromide (qBBr) does not significantly affect the extent of Cd adsorption, and we observed fully reversible adsorption under this condition. In contrast, under a low metal loading of 1.3 μmol Cd/g bacterial cells, the extent of Cd adsorption onto sulfhydryl-blocked S. oneidensis cells was significantly lower than that onto untreated cells, and only approximately 50-60% of the adsorbed Cd desorbed from the cells upon acidification. In conjunction with previous EXAFS results, our findings demonstrate that Cd adsorption onto S. oneidensis under low metal loading conditions is dominated by sulfhydryl binding, and thus is controlled by a distinct adsorption mechanism from the non-sulfhydryl site binding which controls Cd adsorption under high metal loading conditions. We use the data to develop a surface complexation model that constrains the values of the stability constants for individual Cd-sulfhydryl and Cd-non-sulfhydryl bacterial complexes, and we use this approach to account for the Cd adsorption behavior as a function of both pH and metal loading. This approach is crucial in order to predict metal adsorption onto bacteria under environmentally relevant metal loading conditions where sulfhydryl binding sites can dominate the adsorption reaction.

c-Type Cytochrome-Dependent Formation of U(IV) Nanoparticles by Shewanella oneidensis

PubMed Central

Marshall, Matthew J; Dohnalkova, Alice C; Kennedy, David W; Shi, Liang; Wang, Zheming; Boyanov, Maxim I; Lai, Barry; Kemner, Kenneth M; McLean, Jeffrey S; Reed, Samantha B; Culley, David E; Bailey, Vanessa L; Simonson, Cody J; Saffarini, Daad A; Romine, Margaret F; Zachara, John M

2006-01-01

Modern approaches for bioremediation of radionuclide contaminated environments are based on the ability of microorganisms to effectively catalyze changes in the oxidation states of metals that in turn influence their solubility. Although microbial metal reduction has been identified as an effective means for immobilizing highly-soluble uranium(VI) complexes in situ, the biomolecular mechanisms of U(VI) reduction are not well understood. Here, we show that c-type cytochromes of a dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, are essential for the reduction of U(VI) and formation of extracelluar UO 2 nanoparticles. In particular, the outer membrane (OM) decaheme cytochrome MtrC (metal reduction), previously implicated in Mn(IV) and Fe(III) reduction, directly transferred electrons to U(VI). Additionally, deletions of mtrC and/or omcA significantly affected the in vivo U(VI) reduction rate relative to wild-type MR-1. Similar to the wild-type, the mutants accumulated UO 2 nanoparticles extracellularly to high densities in association with an extracellular polymeric substance (EPS). In wild-type cells, this UO 2-EPS matrix exhibited glycocalyx-like properties and contained multiple elements of the OM, polysaccharide, and heme-containing proteins. Using a novel combination of methods including synchrotron-based X-ray fluorescence microscopy and high-resolution immune-electron microscopy, we demonstrate a close association of the extracellular UO 2 nanoparticles with MtrC and OmcA (outer membrane cytochrome). This is the first study to our knowledge to directly localize the OM-associated cytochromes with EPS, which contains biogenic UO 2 nanoparticles. In the environment, such association of UO 2 nanoparticles with biopolymers may exert a strong influence on subsequent behavior including susceptibility to oxidation by O 2 or transport in soils and sediments. PMID:16875436

Dissolution of Arsenic Minerals Mediated by Dissimilatory Arsenate Reducing Bacteria: Estimation of the Physiological Potential for Arsenic Mobilization

PubMed Central

Lukasz, Drewniak; Liwia, Rajpert; Aleksandra, Mantur; Aleksandra, Sklodowska

2014-01-01

The aim of this study was characterization of the isolated dissimilatory arsenate reducing bacteria in the context of their potential for arsenic removal from primary arsenic minerals through reductive dissolution. Four strains, Shewanella sp. OM1, Pseudomonas sp. OM2, Aeromonas sp. OM4, and Serratia sp. OM17, capable of anaerobic growth with As (V) reduction, were isolated from microbial mats from an ancient gold mine. All of the isolated strains: (i) produced siderophores that promote dissolution of minerals, (ii) were resistant to dissolved arsenic compounds, (iii) were able to use the dissolved arsenates as the terminal electron acceptor, and (iii) were able to use copper minerals containing arsenic minerals (e.g., enargite) as a respiratory substrate. Based on the results obtained in this study, we postulate that arsenic can be released from some As-bearing polymetallic minerals (such as copper ore concentrates or middlings) under reductive conditions by dissimilatory arsenate reducers in indirect processes. PMID:24724102

Dissolution of arsenic minerals mediated by dissimilatory arsenate reducing bacteria: estimation of the physiological potential for arsenic mobilization.

PubMed

Lukasz, Drewniak; Liwia, Rajpert; Aleksandra, Mantur; Aleksandra, Sklodowska

2014-01-01

The aim of this study was characterization of the isolated dissimilatory arsenate reducing bacteria in the context of their potential for arsenic removal from primary arsenic minerals through reductive dissolution. Four strains, Shewanella sp. OM1, Pseudomonas sp. OM2, Aeromonas sp. OM4, and Serratia sp. OM17, capable of anaerobic growth with As (V) reduction, were isolated from microbial mats from an ancient gold mine. All of the isolated strains: (i) produced siderophores that promote dissolution of minerals, (ii) were resistant to dissolved arsenic compounds, (iii) were able to use the dissolved arsenates as the terminal electron acceptor, and (iii) were able to use copper minerals containing arsenic minerals (e.g., enargite) as a respiratory substrate. Based on the results obtained in this study, we postulate that arsenic can be released from some As-bearing polymetallic minerals (such as copper ore concentrates or middlings) under reductive conditions by dissimilatory arsenate reducers in indirect processes.

Impact of Sodium Tungstate and Tungsten Alloys on the Growth of Selected Microorganisms with Environmental Significance

DTIC Science & Technology

2010-07-30

TUNGSTEN ALLOYS ON THE GROWTH OF SELECTED MICROORGANISMS WITH ENVIROMENTAL SIGNIFICANCE 5a. Contract Number: 5b. Grant Number: 5c. Program Element...lower tolerances. Interestingly, bacteria cultivated from the environment displayed only minor delays and reduction in growth relative to pure...settings where nutrients may be limited. 15. SUBJECT TERMS Tungsten, sodium tungstate, microbial growth , environmental microbiology, bacteria , Shewanella

The role of riboflavin in decolourisation of Congo red and bioelectricity production using Shewanella oneidensis-MR1 under MFC and non-MFC conditions.

PubMed

Gomaa, Ola M; Fapetu, Segun; Kyazze, Godfrey; Keshavarz, Tajalli

2017-03-01

Dissimilatory metal reducing bacteria can exchange electrons extracellularly and hold great promise for their use in simultaneous wastewater treatment and electricity production. This study investigated the role of riboflavin, an electron carrier, in the decolourisation of Congo red in microbial fuel cells (MFCs) using Shewanella oneidensis MR-1 as a model organism. The contribution of the membrane-bound protein MtrC to the decolourisation process was also investigated. Within the range of riboflavin concentrations tested, 20 µM was found to be the best with >95% of the dye (initial concentration 200 mg/L) decolourised in MFCs within 50 h compared to 90% in the case where no riboflavin was added. The corresponding maximum power density was 45 mW/m 2 . There was no significant difference in the overall decolourisation efficiencies of Shewanela oneidensis MR-1 ΔMtrC mutants compared to the wild type. However, in terms of power production the mutant produced more power (P max 76 mW/m 2 ) compared to the wild type (P max 46 mW/m 2 ) which was attributed to higher levels of riboflavin secreted in solution. Decolourisation efficiencies in non-MFC systems (anaerobic bottles) were similar to those under MFC systems indicating that electricity generation in MFCs does not impair dye decolourisation efficiencies. The results suggest that riboflavin enhances both decolourisation of dyes and simultaneous electricity production in MFCs.

A freshwater bacterial strain, Shewanella sp. Lzh-2, isolated from Lake Taihu and its two algicidal active substances, hexahydropyrrolo[1,2-a]pyrazine-1,4-dione and 2, 3-indolinedione.

PubMed

Li, Zhenghua; Lin, Shengqin; Liu, Xianglong; Tan, Jing; Pan, Jianliang; Yang, Hong

2014-05-01

Cyanobacterial blooms have become a serious problem in Lake Taihu during the last 20 years, and Microcystis aeruginosa and Synechococcus sp. are the two dominant species in cyanobacterial blooms of Lake Taihu. A freshwater bacterial strain, Shewanella sp. Lzh-2, with strong algicidal properties against harmful cyanobacteria was isolated from Lake Taihu. Two substances with algicidal activity secreted extracellularly by Shewanella sp. Lzh-2, S-2A and S-2B, were purified from the bacterial culture of strain Lzh-2 using ethyl acetate extraction, column chromatography, and high performance liquid chromatography (HPLC) in turn. The substances S-2A and S-2B were identified as hexahydropyrrolo[1,2-a]pyrazine-1,4-dione and 2, 3-indolinedione (isatin), respectively, based on liquid chromatography-mass spectrometry (LC-MS), gas chromatography-mass spectrometry (GC-MS), and hydrogen-nuclear magnetic resonance (H-NMR) analyses, making this the first report of their algicidal activity toward cyanobacteria. S-2A (hexahydropyrrolo[1,2-a]pyrazine-1,4-dione) had no algicidal effects against Synechococcus sp. BN60, but had a high level of algicidal activity against M. aeruginosa 9110. The LD50 value of S-2A against M. aeruginosa 9110 was 5.7 μg/ml. S-2B (2, 3-indolinedione) showed a potent algicidal effect against both M. aeruginosa 9110 and Synechococcus sp. BN60, and the LD50 value of S-2B against M. aeruginosa 9110 and Synechococcus sp. BN60 was 12.5 and 34.2 μg/ml, respectively. Obvious morphological changes in M. aeruginosa 9110 and Synechococcus sp. BN60 were observed after they were exposed to S-2A (or S-2B) for 24 h. Approximately, the algicidal activity, the concentration of S-2A and S-2B, and the cell density of Lzh-2 were positively related to each other during the cocultivation process. Overall, these findings increase our knowledge about algicidal substances secreted by algicidal bacteria and indicate that strain Lzh-2 and its two algicidal substances have the

Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.

PubMed

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-10-15

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Metal Cycling by Bacteria: Moving Electrons Around

ScienceCinema

Nealson, Ken

2017-12-09

About 20 years ago, Shewanella oneidensis MR-1 was isolated from a manganese-rich lack in upstate New York, and subsequently shown to utilize solid forms of oxidized manganese or iron as an electron acceptor. Recent studies of metal-reducing bacterial have unveiled a number of unexpected properties of microbes that have enlarged our view of microbes and their role(s) in natural ecosystems. For example, the processes of metal reduction themselves are fundamental to the carbon cycle in many lakes and sediments, where iron and manganese account for the major portion of organic carbon oxidation in many sediments. On more modest spatial scales, iron and manganese reduction can be linked to the oxidation of a wide variety of carbon compounds, many of them recalcitrant and/or toxic. One remarkable property of metal reducers is their ability to reduce solid, often highly crystalline substrates such as iron and manganese oxides and oxyhydroxides. It is now clear that this is done via the utilization of enzymes located on the outer wall of the bacteria - enzymes that apparently interact directly with these solid substrates. Molecular and genomic studies combined have revealed the genes and protoeins responsible for these activities, and many facets of the regulation. This talk focuses on the general features and properties of these remarkable organisms that seem to communicate via electron transfer across a wide variety of soluable, insoluable, and even "inert" substrates, and the way that these processes may be mechanistically linked.

Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1

PubMed Central

Gödeke, Julia; Paul, Kristina; Lassak, Jürgen; Thormann, Kai M

2011-01-01

Shewanella oneidensis MR-1 is capable of forming highly structured surface-attached communities. By DNase I treatment, we demonstrated that extracellular DNA (eDNA) serves as a structural component in all stages of biofilm formation under static and hydrodynamic conditions. We determined whether eDNA is released through cell lysis mediated by the three prophages LambdaSo, MuSo1 and MuSo2 that are harbored in the genome of S. oneidensis MR-1. Mutant analyses and infection studies revealed that all three prophages may individually lead to cell lysis. However, only LambdaSo and MuSo2 form infectious phage particles. Phage release and cell lysis already occur during early stages of static incubation. A mutant devoid of the prophages was significantly less prone to lysis in pure culture. In addition, the phage-less mutant was severely impaired in biofilm formation through all stages of development, and three-dimensional growth occurred independently of eDNA as a structural component. Thus, we suggest that in S. oneidensis MR-1 prophage-mediated lysis results in the release of crucial biofilm-promoting factors, in particular eDNA. PMID:20962878

The acid-tolerant L-arabinose isomerase from the mesophilic Shewanella sp. ANA-3 is highly active at low temperatures

PubMed Central

2011-01-01

Background L-arabinose isomerases catalyse the isomerization of L-arabinose into L-ribulose at insight biological systems. At industrial scale of this enzyme is used for the bioconversion of D-galactose into D-tagatose which has many applications in pharmaceutical and agro-food industries. The isomerization reaction is thermodynamically equilibrated, and therefore the bioconversion rates is shifted towards tagatose when the temperature is increased. Moreover, to prevent secondary reactions it will be of interest to operate at low pH. The profitability of this D-tagatose production process is mainly related to the use of lactose as cheaper raw material. In many dairy products it will be interesting to produce D-tagatose during storage. This requires an efficient L-arabinose isomerase acting at low temperature and pH values. Results The gene encoding the L-arabinose isomerase from Shewanella sp. ANA-3 was cloned and overexpressed in Escherichia coli. The purified protein has a tetrameric arrangement composed by four identical 55 kDa subunits. The biochemical characterization of this enzyme showed that it was distinguishable by its maximal activity at low temperatures comprised between 15-35°C. Interestingly, this biocatalyst preserves more than 85% of its activity in a broad range of temperatures from 4.0 to 45°C. Shewanella sp. ANA-3 L-arabinose isomerase was also optimally active at pH 5.5-6.5 and maintained over 80% of its activity at large pH values from 4.0 to 8.5. Furthermore, this enzyme exhibited a weak requirement for metallic ions for its activity evaluated at 0.6 mM Mn2+. Stability studies showed that this protein is highly stable mainly at low temperature and pH values. Remarkably, T268K mutation clearly enhances the enzyme stability at low pH values. Use of this L-arabinose isomerase for D-tagatose production allows the achievement of attractive bioconversion rates of 16% at 4°C and 34% at 35°C. Conclusions Here we reported the purification and the

Plutonium Oxidation State Distribution under Aerobic and Anaerobic Subsurface Conditions for Metal-Reducing Bacteria

NASA Astrophysics Data System (ADS)

Reed, D. T.; Swanson, J.; Khaing, H.; Deo, R.; Rittmann, B.

2009-12-01

The fate and potential mobility of plutonium in the subsurface is receiving increased attention as the DOE looks to cleanup the many legacy nuclear waste sites and associated subsurface contamination. Plutonium is the near-surface contaminant of concern at several DOE sites and continues to be the contaminant of concern for the permanent disposal of nuclear waste. The mobility of plutonium is highly dependent on its redox distribution at its contamination source and along its potential migration pathways. This redox distribution is often controlled, especially in the near-surface where organic/inorganic contaminants often coexist, by the direct and indirect effects of microbial activity. The redox distribution of plutonium in the presence of facultative metal reducing bacteria (specifically Shewanella and Geobacter species) was established in a concurrent experimental and modeling study under aerobic and anaerobic conditions. Pu(VI), although relatively soluble under oxidizing conditions at near-neutral pH, does not persist under a wide range of the oxic and anoxic conditions investigated in microbiologically active systems. Pu(V) complexes, which exhibit high chemical toxicity towards microorganisms, are relatively stable under oxic conditions but are reduced by metal reducing bacteria under anaerobic conditions. These facultative metal-reducing bacteria led to the rapid reduction of higher valent plutonium to form Pu(III/IV) species depending on nature of the starting plutonium species and chelating agents present in solution. Redox cycling of these lower oxidation states is likely a critical step in the formation of pseudo colloids that may lead to long-range subsurface transport. The CCBATCH biogeochemical model is used to explain the redox mechanisms and final speciation of the plutonium oxidation state distributions observed. These results for microbiologically active systems are interpreted in the context of their importance in defining the overall migration

Physiology and enzymology involved in denitrification by Shewanella putrefaciens

NASA Technical Reports Server (NTRS)

Krause, B.; Nealson, K. H.

1997-01-01

Nitrate reduction to N2O was investigated in batch cultures of Shewanella putrefaciens MR-1, MR-4, and MR-7. All three strains reduced nitrate to nitrite to N2O, and this reduction was coupled to growth, whereas ammonium accumulation was very low (0 to 1 micromol liter-1). All S. putrefaciens isolates were also capable of reducing nitrate aerobically; under anaerobic conditions, nitrite levels were three- to sixfold higher than those found under oxic conditions. Nitrate reductase activities (31 to 60 micromol of nitrite min-1 mg of protein-1) detected in intact cells of S. putrefaciens were equal to or higher than those seen in Escherichia coli LE 392. Km values for nitrate reduction ranged from 12 mM for MR-1 to 1.3 mM for MR-4 with benzyl viologen as an artifical electron donor. Nitrate and nitrite reductase activities in cell-free preparations were demonstrated in native gels by using reduced benzyl viologen. Detergent treatment of crude and membrane extracts suggested that the nitrate reductases of MR-1 and MR-4 are membrane bound. When the nitrate reductase in MR-1 was partially purified, three subunits (90, 70, and 55 kDa) were detected in denaturing gels. The nitrite reductase of MR-1 is also membrane bound and appeared as a 60-kDa band in sodium dodecyl sulfate-polyacrylamide gels after partial purification.

Comparative analysis of microbial community between different cathode systems of microbial fuel cells for denitrification.

PubMed

Li, Chao; Xu, Ming; Lu, Yi; Fang, Fang; Cao, Jiashun

2016-01-01

Two types of cathodic biofilm in microbial fuel cells (MFC) were established for comparison on their performance and microbial communities. Complete autotrophic simultaneous nitrification and denitrification (SND) without organics addition was achieved in nitrifying-MFC (N-MFC) with a total nitrogen (TN) removal rate of 0.35 mg/(L·h), which was even higher than that in denitrifying-MFC (D-MFC) at same TN level. Integrated denaturing gradient gel electrophoresis analysis based on both 16S rRNA and nirK genes showed that Alpha-, Gammaproteobacteria were the main denitrifier communities. Some potential autotrophic denitrifying bacteria which can use electrons and reducing power from cathodes, such as Shewanella oneidensis, Shewanella loihica, Pseudomonas aeruginosa, Starkeya novella and Rhodopseudomonas palustris were identified and selectively enriched on cathode biofilms. Further, relative abundance of denitrifying bacteria characterized by nirK/16S ratios was much higher in biofilm than suspended sludge according to real-time polymerase chain reaction. The highest enrichment efficiency for denitrifiers was obtained in N-MFC cathode biofilms, which confirmed autotrophic denitrifying bacteria enrichment is the key factor for a D-MFC system.

Microbial-enzymatic-hybrid biological fuel cell with optimized growth conditions for Shewanella oneidensis DSP-10.

PubMed

Roy, Jared N; Luckarift, Heather R; Sizemore, Susan R; Farrington, Karen E; Lau, Carolin; Johnson, Glenn R; Atanassov, Plamen

2013-07-10

In this work we present a biological fuel cell fabricated by combining a Shewanella oneidensis microbial anode and a laccase-modified air-breathing cathode. This concept is devised as an extension to traditional biochemical methods by incorporating diverse biological catalysts with the aim of powering small devices. In preparing the biological fuel cell anode, novel hierarchical-structured architectures and biofilm configurations were investigated. A method for creating an artificial biofilm based on encapsulating microorganisms in a porous, thin film of silica was compared with S. oneidensis biofilms that were allowed to colonize naturally. Results indicate comparable current and power densities for artificial and natural biofilm formations, based on growth characteristics. As a result, this work describes methods for creating controllable and reproducible bio-anodes and demonstrates the versatility of hybrid biological fuel cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Targeted Protein Degradation of Outer Membrane Decaheme Cytochrome MtrC Metal Reductase in Shewanella oneidensis MR-1 Measured Using Biarsenical Probe CrAsH-EDT2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiong, Yijia; Chen, Baowei; Shi, Liang

2011-10-14

Development of efficient microbial biofuel cells requires an ability to exploit interfacial electron transfer reactions to external electron acceptors, such as metal oxides; such reactions occur in the facultative anaerobic gram-negative bacterium Shewanella oneidensis MR-1 through the catalytic activity of the outer membrane decaheme c-type cytochrome MtrC. Central to the utility of this pathway to synthetic biology is an understanding of cellular mechanisms that maintain optimal MtrC function, cellular localization, and renewal by degradation and resynthesis. In order to monitor trafficking to the outer membrane, and the environmental sensitivity of MtrC, we have engineered a tetracysteine tag (i.e., CCPGCC) atmore » its C-terminus that permits labeling by the cell impermeable biarsenical fluorophore, carboxy-FlAsH (CrAsH) of MtrC at the surface of living Shewanella oneidensis MR-1 cells. In comparison, the cell permeable reagent FlAsH permits labeling of the entire population of MtrC, including proteolytic fragments resulting from incorrect maturation. We demonstrate specific labeling by CrAsH of engineered MtrC which is dependent on the presence of a functional type-2 secretion system (T2S), as evidenced by T2S system gspD or gspG deletion mutants which are incapable of CrAsH labeling. Under these latter conditions, MtrC undergoes proteolytic degradation to form a large 35-38 kDa fragment; this degradation product is also resolved during normal turnover of the CrAsH-labeled MtrC protein. No MtrC protein is released into the medium during turnover, suggesting the presence of cellular turnover systems involving MtrC reuptake and degradation. The mature MtrC localized on the outer membrane is a long-lived protein, with a turnover rate of 0.043 hr-1 that is insensitive to O2 concentration. Maturation of MtrC is relatively inefficient, with substantial rates of turnover of the immature protein prior to export to the outer membrane (i.e., 0.028 hr-1) that are

DOE Office of Scientific and Technical Information (OSTI.GOV)

NEALSON, KENNETH H.

This project had as its goals the understanding of the ecophysiology of the genus Shewanella using various genomics approaches. As opposed to other programs involving Shewanella, this one branched out into the various areas in which Shewanella cells are active, and included both basic and applied studies. All of the work was, to some extent, related to the ability of the bacteria to accomplish electron exchange between the cell and solid state electron acceptors and/or electron donors, a process we call Extracellular Electron Transport, or EET. The major accomplishments related to several different areas: Basic Science Studies: 1. Genetics andmore » genomics of nitrate reduction, resulting in elucidation of atypical nitrate reduction systems in Shewanella oneidensis (MR-1)[2]. 2. Influence of bacterial strain and growth conditions on iron reduction, showing that rates of reduction, extents of reduction, and the formation of secondary minerals were different for different strains of Shewanella [3,4,9]. 3. Comparative genomics as a tool for comparing metabolic capacities of different Shewanella strains, and for predicting growth and metabolism [6,10,15]. In these studies, collaboration with ORNL, PNNL, and 4. Basic studies of electron transport in strain MR-1, both to poised electrodes, and via conductive nanowires [12,13]. This included the first accurate measurements of electrical energy generation by a single cell during electrode growth [12], and the demonstration of electrical conductivity along the length of bacterial nanowires [13]. 5. Impact of surface charge and electron flow on cell movement, cell attachment, cell growth, and biofilm formation [7.18]. The demonstration that interaction with solid state electron acceptors resulted in increased motility [7] led to the description of a phenomenon called electrokinesis. The importance of this for biofilm formation and for electron flow was hypothesized by Nealson & Finkel [18], and is now under study in

Cellular Response of Shewanella oneidensis to Strontium Stress†

PubMed Central

Brown, Steven D.; Martin, Madhavi; Deshpande, Sameer; Seal, Sudipta; Huang, Katherine; Alm, Eric; Yang, Yunfeng; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Arkin, Adam; Chourey, Karuna; Zhou, Jizhong; Thompson, Dorothea K.

2006-01-01

The physiology and transcriptome dynamics of the metal ion-reducing bacterium Shewanella oneidensis strain MR-1 in response to nonradioactive strontium (Sr) exposure were investigated. Studies indicated that MR-1 was able to grow aerobically in complex medium in the presence of 180 mM SrCl2 but showed severe growth inhibition at levels above that concentration. Temporal gene expression profiles were generated from aerobically grown, mid-exponential-phase MR-1 cells shocked with 180 mM SrCl2 and analyzed for significant differences in mRNA abundance with reference to data for nonstressed MR-1 cells. Genes with annotated functions in siderophore biosynthesis and iron transport were among the most highly induced (>100-fold [P < 0.05]) open reading frames in response to acute Sr stress, and a mutant (SO3032::pKNOCK) defective in siderophore production was found to be hypersensitive to SrCl2 exposure, compared to parental and wild-type strains. Transcripts encoding multidrug and heavy metal efflux pumps, proteins involved in osmotic adaptation, sulfate ABC transporters, and assimilative sulfur metabolism enzymes also were differentially expressed following Sr exposure but at levels that were several orders of magnitude lower than those for iron transport genes. Precipitate formation was observed during aerobic growth of MR-1 in broth cultures amended with 50, 100, or 150 mM SrCl2 but not in cultures of the SO3032::pKNOCK mutant or in the abiotic control. Chemical analysis of this precipitate using laser-induced breakdown spectroscopy and static secondary ion mass spectrometry indicated extracellular solid-phase sequestration of Sr, with at least a portion of the heavy metal associated with carbonate phases. PMID:16391131

One Enzyme, Three Metabolites: Shewanella algae Controls Siderophore Production via the Cellular Substrate Pool.

PubMed

Rütschlin, Sina; Gunesch, Sandra; Böttcher, Thomas

2017-05-18

Shewanella algae B516 produces avaroferrin, an asymmetric hydroxamate siderophore, which has been shown to inhibit swarming motility of Vibrio alginolyticus. We aimed to elucidate the biosynthesis of this siderophore and to investigate how S. algae coordinates the production of avaroferrin and its two symmetric counterparts. We reconstituted the reaction in vitro with the main enzyme AvbD and the putative biosynthetic precursors, and demonstrate that multispecificity of this enzyme results in the production of all three cyclic hydroxamate siderophores that were previously isolated as natural products from S. algae. Surprisingly, purified AvbD exhibited a clear preference for the larger cadaverine-derived substrate. In live cells, however, siderophore ratios are maximized toward avaroferrin production, and we demonstrate that these siderophore ratios are the result of a regulation on substrate pool level, which may allow rapid evolutionary adaptation to environmental changes. Our results thereby give insights into a unique evolutionary strategy toward metabolite diversity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Biofabrication of morphology improved cadmium sulfide nanoparticles using Shewanella oneidensis bacterial cells and ionic liquid: For toxicity against brain cancer cell lines.

PubMed

Wang, Li; Chen, Siyuan; Ding, Yiming; Zhu, Qiang; Zhang, Nijia; Yu, Shuqing

2018-01-01

The present work determines the anticancer activity of bio-mediated synthesized cadmium sulfide nanoparticles using the ionic liquid and bacterial cells (Shewanella oneidensis). Bacterial cells have been exposed to be important resources that hold huge potential as ecofriendly, cost-effective, evading toxic of dangerous chemicals and the alternative of conventional physiochemical synthesis. The Shewanella oneidensis is an important kind of metal reducing bacterium, known as its special anaerobic respiratory and sulfate reducing capacity. The crystalline nature, phase purity and surface morphology of biosynthesized cadmium sulfide nanoparticles were analyzed by Fourier transform infrared spectroscopy, X-ray diffraction, Field emission scanning electron microscopy, Energy dispersive spectroscopy and Transmission electron microscopy. The use of imidazolium based ionic liquids as soft templating agent for controlling self-assembly and crystal growth direction of metal sulfide nanoparticles has also advanced as an important method. The microscopic techniques showed that the nanoparticles are designed on the nano form and have an excellent spherical morphology, due to the self-assembled mechanism of ionic liquid assistance. The antitumor efficiency of the cadmium sulfide nanoparticles was investigated against brain cancer cell lines using rat glioma cell lines. The effectively improved nano-crystalline and morphological structure of CdS nanoparticles in the presence of IL exhibit excellent cytotoxicity and dispersion ability on the cell shape is completely spread out showing a nice toxic environment against cancer cells. The cytotoxicity effect of cadmium sulfide nanoparticles was discussed with a diagrammatic representation. Copyright © 2017. Published by Elsevier B.V.

Use of an Electrochemical Split Cell Technique to Evaluate the Influence of Shewanella oneidensis Activities on Corrosion of Carbon Steel

PubMed Central

Miller, Robert Bertram; Sadek, Anwar; Rodriguez, Alvaro; Iannuzzi, Mariano; Giai, Carla; Senko, John M.; Monty, Chelsea N.

2016-01-01

Microbially induced corrosion (MIC) is a complex problem that affects various industries. Several techniques have been developed to monitor corrosion and elucidate corrosion mechanisms, including microbiological processes that induce metal deterioration. We used zero resistance ammetry (ZRA) in a split chamber configuration to evaluate the effects of the facultatively anaerobic Fe(III) reducing bacterium Shewanella oneidensis MR-1 on the corrosion of UNS G10180 carbon steel. We show that activities of S. oneidensis inhibit corrosion of steel with which that organism has direct contact. However, when a carbon steel coupon in contact with S. oneidensis was electrically connected to a second coupon that was free of biofilm (in separate chambers of the split chamber assembly), ZRA-based measurements indicated that current moved from the S. oneidensis-containing chamber to the cell-free chamber. This electron transfer enhanced the O2 reduction reaction on the coupon deployed in the cell free chamber, and consequently, enhanced oxidation and corrosion of that electrode. Our results illustrate a novel mechanism for MIC in cases where metal surfaces are heterogeneously covered by biofilms. PMID:26824529

Use of an Electrochemical Split Cell Technique to Evaluate the Influence of Shewanella oneidensis Activities on Corrosion of Carbon Steel.

PubMed

Miller, Robert Bertram; Sadek, Anwar; Rodriguez, Alvaro; Iannuzzi, Mariano; Giai, Carla; Senko, John M; Monty, Chelsea N

2016-01-01

Microbially induced corrosion (MIC) is a complex problem that affects various industries. Several techniques have been developed to monitor corrosion and elucidate corrosion mechanisms, including microbiological processes that induce metal deterioration. We used zero resistance ammetry (ZRA) in a split chamber configuration to evaluate the effects of the facultatively anaerobic Fe(III) reducing bacterium Shewanella oneidensis MR-1 on the corrosion of UNS G10180 carbon steel. We show that activities of S. oneidensis inhibit corrosion of steel with which that organism has direct contact. However, when a carbon steel coupon in contact with S. oneidensis was electrically connected to a second coupon that was free of biofilm (in separate chambers of the split chamber assembly), ZRA-based measurements indicated that current moved from the S. oneidensis-containing chamber to the cell-free chamber. This electron transfer enhanced the O2 reduction reaction on the coupon deployed in the cell free chamber, and consequently, enhanced oxidation and corrosion of that electrode. Our results illustrate a novel mechanism for MIC in cases where metal surfaces are heterogeneously covered by biofilms.

Beverages obtained from soda fountain machines in the U.S. contain microorganisms, including coliform bacteria.

PubMed

White, Amy S; Godard, Renee D; Belling, Carolyn; Kasza, Victoria; Beach, Rebecca L

2010-01-31

Ninety beverages of three types (sugar sodas, diet sodas and water) were obtained from 20 self-service and 10 personnel-dispensed soda fountains, analyzed for microbial contamination, and evaluated with respect to U.S. drinking water regulations. A follow-up study compared the concentration and composition of microbial populations in 27 beverages collected from 9 soda fountain machines in the morning as well as in the afternoon. Ice dispensed from these machines was also examined for microbial contamination. While none of the ice samples exceeded U.S. drinking water standards, coliform bacteria was detected in 48% of the beverages and 20% had a heterotrophic plate count greater than 500cfu/ml. Statistical analyses revealed no difference in levels of microbial contamination between beverage types or between those dispensed from self-service and personnel-dispensed soda fountains. More than 11% of the beverages analyzed contained Escherichia coli and over 17% contained Chryseobacterium meningosepticum. Other opportunistic pathogenic microorganisms isolated from the beverages included species of Klebsiella, Staphylococcus, Stenotrophomonas, Candida, and Serratia. Most of the identified bacteria showed resistance to one or more of the 11 antibiotics tested. These findings suggest that soda fountain machines may harbor persistent communities of potentially pathogenic microorganisms which may contribute to episodic gastric distress in the general population and could pose a more significant health risk to immunocompromised individuals. These findings have important public health implications and signal the need for regulations enforcing hygienic practices associated with these beverage dispensers. Copyright 2009 Elsevier B.V. All rights reserved.

Oxygen Consumption Rates of Bacteria under Nutrient-Limited Conditions

PubMed Central

Riedel, Timothy E.; Nealson, Kenneth H.; Finkel, Steven E.

2013-01-01

Many environments on Earth experience nutrient limitation and as a result have nongrowing or very slowly growing bacterial populations. To better understand bacterial respiration under environmentally relevant conditions, the effect of nutrient limitation on respiration rates of heterotrophic bacteria was measured. The oxygen consumption and population density of batch cultures of Escherichia coli K-12, Shewanella oneidensis MR-1, and Marinobacter aquaeolei VT8 were tracked for up to 200 days. The oxygen consumption per CFU (QO2) declined by more than 2 orders of magnitude for all three strains as they transitioned from nutrient-abundant log-phase growth to the nutrient-limited early stationary phase. The large reduction in QO2 from growth to stationary phase suggests that nutrient availability is an important factor in considering environmental respiration rates. Following the death phase, during the long-term stationary phase (LTSP), QO2 values of the surviving population increased with time and more cells were respiring than formed colonies. Within the respiring population, a subpopulation of highly respiring cells increased in abundance with time. Apparently, as cells enter LTSP, there is a viable but not culturable population whose bulk community and per cell respiration rates are dynamic. This result has a bearing on how minimal energy requirements are met, especially in nutrient-limited environments. The minimal QO2 rates support the extension of Kleiber's law to the mass of a bacterium (100-fg range). PMID:23770901

Rapid construction of a whole-genome transposon insertion collection for Shewanella oneidensis by Knockout Sudoku.

PubMed

Baym, Michael; Shaket, Lev; Anzai, Isao A; Adesina, Oluwakemi; Barstow, Buz

2016-11-10

Whole-genome knockout collections are invaluable for connecting gene sequence to function, yet traditionally, their construction has required an extraordinary technical effort. Here we report a method for the construction and purification of a curated whole-genome collection of single-gene transposon disruption mutants termed Knockout Sudoku. Using simple combinatorial pooling, a highly oversampled collection of mutants is condensed into a next-generation sequencing library in a single day, a 30- to 100-fold improvement over prior methods. The identities of the mutants in the collection are then solved by a probabilistic algorithm that uses internal self-consistency within the sequencing data set, followed by rapid algorithmically guided condensation to a minimal representative set of mutants, validation, and curation. Starting from a progenitor collection of 39,918 mutants, we compile a quality-controlled knockout collection of the electroactive microbe Shewanella oneidensis MR-1 containing representatives for 3,667 genes that is functionally validated by high-throughput kinetic measurements of quinone reduction.

Method of Detecting Coliform Bacteria and Escherichia Coli Bacteria from Reflected Light

NASA Technical Reports Server (NTRS)

Vincent, Robert (Inventor)

2013-01-01

The present invention relates to a method of detecting coliform bacteria in water from reflected light and a method of detecting Eschericha Coli bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

Bacteria-surface interactions.

PubMed

Tuson, Hannah H; Weibel, Douglas B

2013-05-14

The interaction of bacteria with surfaces has important implications in a range of areas, including bioenergy, biofouling, biofilm formation, and the infection of plants and animals. Many of the interactions of bacteria with surfaces produce changes in the expression of genes that influence cell morphology and behavior, including genes essential for motility and surface attachment. Despite the attention that these phenotypes have garnered, the bacterial systems used for sensing and responding to surfaces are still not well understood. An understanding of these mechanisms will guide the development of new classes of materials that inhibit and promote cell growth, and complement studies of the physiology of bacteria in contact with surfaces. Recent studies from a range of fields in science and engineering are poised to guide future investigations in this area. This review summarizes recent studies on bacteria-surface interactions, discusses mechanisms of surface sensing and consequences of cell attachment, provides an overview of surfaces that have been used in bacterial studies, and highlights unanswered questions in this field.

Particle size effect and the mechanism of hematite reduction by the outer membrane cytochrome OmcA of Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Juan; Pearce, Carolyn I.; Shi, Liang

The cycling of iron at the Earth’s near surface is profoundly influenced by dissimilatory metal reducing microorganisms, and many studies have focused on unraveling electron transfer mechanisms between these bacteria and Fe(III)-(oxyhydr)oxides. However, these efforts have been complicated by the fact that these minerals often occur in the micro- to nanosize regime, and in relevant natural environments as well as in the laboratory are subject to aggregation. The nature of the physical interface between the cellular envelope, the outer-membrane cytochromes responsible for facilitating the interfacial electron transfer step, and these complex mineral particulates is thus difficult to probe. Previous studiesmore » using whole cells have reported reduction rates that do not correlate with particle size. In the present study we isolate the interaction between the decaheme outer-membrane cytochrome OmcA of Shewanella oneidensis and nanoparticulate hematite, examining the reduction rate as a function of particle size and reaction products through detailed characterization of the electron balance and the structure and valence of iron at particle surfaces. By comparison with abiotic reduction via the smaller molecule ascorbic acid, we show that the reduction rate is systematically controlled by the sterically accessible interfacial contact area between OmcA and hematite in particle aggregates; rates increase once pore throat sizes in aggregates become as large as OmcA. Simultaneous measure of OmcA oxidation against Fe(II) release shows a ratio of 1:10, consistent with a cascade OmcA oxidation mechanism heme by heme. X-ray absorption spectroscopies reveal incipient magnetite on the reacted surfaces of the hematite nanoparticles after reaction. The collective findings establish the importance of accessibility of physical contact between the terminal reductases and iron oxide surfaces, and through apparent consistency of observations help reconcile behavior reported at the

Particle size effect and the mechanism of hematite reduction by the outer membrane cytochrome OmcA of Shewanella oneidensis MR-1

NASA Astrophysics Data System (ADS)

Liu, Juan; Pearce, Carolyn I.; Shi, Liang; Wang, Zheming; Shi, Zhi; Arenholz, Elke; Rosso, Kevin M.

2016-11-01

The cycling of iron at the Earth's near surface is profoundly influenced by dissimilatory metal reducing microorganisms, and many studies have focused on unraveling electron transfer mechanisms between these bacteria and Fe(III)-(oxyhydr)oxides. However, these efforts have been complicated by the fact that these minerals often occur in the micro- to nanosize regime, and in relevant natural environments as well as in the laboratory are subject to aggregation. The nature of the physical interface between the cellular envelope, the outer-membrane cytochromes responsible for facilitating the interfacial electron transfer step, and these complex mineral particulates is thus difficult to probe. Previous studies using whole cells have reported reduction rates that do not correlate with particle size. In the present study we isolate the interaction between the decaheme outer-membrane cytochrome OmcA of Shewanella oneidensis and nanoparticulate hematite, examining the reduction rate as a function of particle size and reaction products through detailed characterization of the electron balance and the structure and valence of iron at particle surfaces. By comparison with abiotic reduction via the smaller molecule ascorbic acid, we show that the reduction rate is systematically controlled by the sterically accessible interfacial contact area between OmcA and hematite in particle aggregates; rates increase once pore throat sizes in aggregates become as large as OmcA. Simultaneous measure of OmcA oxidation against Fe(II) release shows a ratio of 1:10, consistent with a cascade OmcA oxidation mechanism heme by heme. X-ray absorption spectroscopies reveal incipient magnetite on the reacted surfaces of the hematite nanoparticles after reaction. The collective findings establish the importance of accessibility of physical contact between the terminal reductases and iron oxide surfaces, and through apparent consistency of observations help reconcile behavior reported at the larger

Simultaneous microbial reduction of vanadium (V) and chromium (VI) by Shewanella loihica PV-4.

PubMed

Wang, Guangyu; Zhang, Baogang; Li, Shuang; Yang, Meng; Yin, Changcheng

2017-03-01

Toxic vanadium (V) and chromium (VI) often co-exist in wastewater from vanadium ore smelting and their reductions by bacterial strain Shewanella loihica PV-4 is realized simultaneously. After 27-d operation, 71.3% of V(V) and 91.2% of Cr(VI) were removed respectively, with citrate as organic carbon source. Enhancement of Cr(VI) bioreduction was observed with the suppressed V(V) reduction. V(IV) and Cr(III), the main reduction products, precipitated inside the organisms and attached on cell surfaces. Both membrane components containing cytochrome c and cytoplasmic fractions containing soluble proteins as well as NADH may contribute to these microbial reductions. Most Cr(VI) were reduced extracellularly and V(V) tended to be reduced through intracellular process, as revealed by mapping the microbial surface and a line scan across the cell, performed by scanning transmission electron microscopy. This study provides an efficient alternative for controlling combined pollution caused by these two metals based on microbial technology. Copyright © 2016 Elsevier Ltd. All rights reserved.

Respiration-linked proton translocation coupled to anaerobic reduction of manganese(IV) and iron(III) in Shewanella putrefaciens MR-1.

PubMed Central

Myers, C R; Nealson, K H

1990-01-01

An oxidant pulse technique, with lactate as the electron donor, was used to study respiration-linked proton translocation in the manganese- and iron-reducing bacterium Shewanella putrefaciens MR-1. Cells grown anaerobically with fumarate or nitrate as the electron acceptor translocated protons in response to manganese (IV), fumarate, or oxygen. Cells grown anaerobically with fumarate also translocated protons in response to iron(III) and thiosulfate, whereas those grown with nitrate did not. Aerobically grown cells translocated protons only in response to oxygen. Proton translocation with all electron acceptors was abolished in the presence of the protonophore carbonyl cyanide m-chlorophenylhydrazone (20 microM) and was partially to completely inhibited by the electron transport inhibitor 2-n-heptyl-4-hydroxyquinoline N-oxide (50 microM). PMID:2172208

Systematic screening of carbon-based anode materials for microbial fuel cells with Shewanella oneidensis MR-1.

PubMed

Kipf, Elena; Koch, Julia; Geiger, Bettina; Erben, Johannes; Richter, Katrin; Gescher, Johannes; Zengerle, Roland; Kerzenmacher, Sven

2013-10-01

We present a systematic screening of carbon-based anode materials for microbial fuel cells with Shewanella oneidensis MR-1. Under anoxic conditions nanoporous activated carbon cloth is a superior anode material in terms of current density normalized to the projected anode area and anode volume (24.0±0.3 μA cm(-2) and 482±7 μA cm(-3) at -0.2 vs. SCE, respectively). The good performance can be attributed to the high specific surface area of the material, which is available for mediated electron transfer through self-secreted flavins. Under aerated conditions no influence of the specific surface area is observed, which we attribute to a shift from primary indirect electron transfer by mediators to direct electron transfer via adherent cells. Furthermore, we show that an aerated initial growth phase enhances the current density under subsequent anoxic conditions fivefold when compared to a similar experiment that was conducted under permanently anoxic conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Determination of Spoilage Microbiota of Pacific White Shrimp During Ambient and Cold Storage Using Next-Generation Sequencing and Culture-Dependent Method.

PubMed

Yang, Sheng-Ping; Xie, Jing; Qian, Yun-Fang

2017-05-01

This study was conducted to determine the initial and spoilage microbiota of Pacific white shrimp during ambient and cold storage using next-generation sequencing (NGS) and a culture-dependent method. The quality changes were also evaluated by sensory analysis and total volatile basic nitrogen (TVB-N) values. After 1 d of storage, the psychrotrophic bacteria were only 5.97 log CFU/g, accounting for 1.1% of the mesophilic bacteria counts (7.94 log CFU/g). The psychrotrophic bacteria counts exceeded the counts of mesophilic bacteria for shrimp stored at 4 °C after 6 d of storage, indicating that psychrotrophic bacteria became predominant. The NGS was used to identify the bacterial species in samples stored at 25 and 4 °C. The results showed that the dominant microorganisms were Vibrio at 25 °C, and Acinetobacter, Psychrobacter, and Shewanella at 4 °C. By the culture-dependent method based on 16S rRNA gene and VITEK®2 CompactA system, it showed that the dominant microorganisms were Proteus spp. at 25 °C, and Shewanella putrefaciens, Acinetobacter johnsonii, and Aeromonas sobria at 4 °C. In conclusion, differences in results of microbiota analyzed by culture dependent and independent approaches were observed. The combination of both methodologies may provide more comprehensive information about the dominant spoilage microbiota in Pacific white shrimp during ambient and cold storage. © 2017 Institute of Food Technologists®.

CRISPRi-sRNA: Transcriptional-Translational Regulation of Extracellular Electron Transfer in Shewanella oneidensis.

PubMed

Cao, Yingxiu; Li, Xiaofei; Li, Feng; Song, Hao

2017-09-15

Extracellular electron transfer (EET) in Shewanella oneidensis MR-1, which is one of the most well-studied exoelectrogens, underlies many microbial electrocatalysis processes, including microbial fuel cells, microbial electrolysis cells, and microbial electrosynthesis. However, regulating the efficiency of EET remains challenging due to the lack of efficient genome regulation tools that regulate gene expression levels in S. oneidensis. Here, we systematically established a transcriptional regulation technology, i.e., clustered regularly interspaced short palindromic repeats interference (CRISPRi), in S. oneidensis MR-1 using green fluorescent protein (GFP) as a reporter. We used this CRISPRi technology to repress the expression levels of target genes, individually and in combination, in the EET pathways (e.g., the MtrCAB pathway and genes affecting the formation of electroactive biofilms in S. oneidensis), which in turn enabled the efficient regulation of EET efficiency. We then established a translational regulation technology, i.e., Hfq-dependent small regulatory RNA (sRNA), in S. oneidensis by repressing the GFP reporter and mtrA, which is a critical gene in the EET pathways in S. oneidensis. To achieve coordinated transcriptional and translational regulation at the genomic level, the CRISPRi and Hfq-dependent sRNA systems were incorporated into a single plasmid harbored in a recombinant S. oneidensis strain, which enabled an even higher efficiency of mtrA gene repression in the EET pathways than that achieved by the CRISPRi and Hfq-dependent sRNA system alone, as exhibited by the reduced electricity output. Overall, we developed a combined CRISPRi-sRNA method that enabled the synergistic transcriptional and translational regulation of target genes in S. oneidensis. This technology involving CRISPRi-sRNA transcriptional-translational regulation of gene expression at the genomic level could be applied to other microorganisms.

Isolation and Characterization of a Shewanella Phage–Host System from the Gut of the Tunicate, Ciona intestinalis

PubMed Central

Leigh, Brittany; Karrer, Charlotte; Cannon, John P.; Breitbart, Mya; Dishaw, Larry J.

2017-01-01

Outnumbering all other biological entities on earth, bacteriophages (phages) play critical roles in structuring microbial communities through bacterial infection and subsequent lysis, as well as through horizontal gene transfer. While numerous studies have examined the effects of phages on free-living bacterial cells, much less is known regarding the role of phage infection in host-associated biofilms, which help to stabilize adherent microbial communities. Here we report the cultivation and characterization of a novel strain of Shewanella fidelis from the gut of the marine tunicate Ciona intestinalis, inducible prophages from the S. fidelis genome, and a strain-specific lytic phage recovered from surrounding seawater. In vitro biofilm assays demonstrated that lytic phage infection affects biofilm formation in a process likely influenced by the accumulation and integration of the extracellular DNA released during cell lysis, similar to the mechanism that has been previously shown for prophage induction. PMID:28327522

Endogenous generation of hydrogen sulfide and its regulation in Shewanella oneidensis

PubMed Central

Wu, Genfu; Li, Ning; Mao, Yinting; Zhou, Guangqi; Gao, Haichun

2015-01-01

Hydrogen sulfide (H2S) has been recognized as a physiological mediator with a variety of functions across all domains of life. In this study, mechanisms of endogenous H2S generation in Shewanella oneidensis were investigated. As a research model with highly diverse anaerobic respiratory pathways, the microorganism is able to produce H2S by respiring on a variety of sulfur-containing compounds with SirACD and PsrABC enzymatic complexes, as well as through cysteine degradation with three enzymes, MdeA, SO_1095, and SseA. We showed that the SirACD and PsrABC complexes, which are predominantly, if not exclusively, responsible for H2S generation via respiration of sulfur species, do not interplay with each other. Strikingly, a screen for regulators controlling endogenous H2S generation by transposon mutagenesis identified global regulator Crp to be essential to all H2S-generating processes. In contrast, Fnr and Arc, two other global regulators that have a role in respiration, are dispensable in regulating H2S generation via respiration of sulfur species. Interestingly, Arc is involved in the H2S generation through cysteine degradation by repressing expression of the mdeA gene. We further showed that expression of the sirA and psrABC operons is subjected to direct regulation of Crp, but the mechanisms underlying the requirement of Crp for H2S generation through cysteine degradation remain elusive. PMID:25972854

Transformation of gram positive bacteria by sonoporation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Yunfeng; Li, Yongchao

The present invention provides a sonoporation-based method that can be universally applied for delivery of compounds into Gram positive bacteria. Gram positive bacteria which can be transformed by sonoporation include, for example, Bacillus, Streptococcus, Acetobacterium, and Clostridium. Compounds which can be delivered into Gram positive bacteria via sonoporation include nucleic acids (DNA or RNA), proteins, lipids, carbohydrates, viruses, small organic and inorganic molecules, and nano-particles.

Methanotrophic bacteria.

PubMed Central

Hanson, R S; Hanson, T E

1996-01-01

Methane-utilizing bacteria (methanotrophs) are a diverse group of gram-negative bacteria that are related to other members of the Proteobacteria. These bacteria are classified into three groups based on the pathways used for assimilation of formaldehyde, the major source of cell carbon, and other physiological and morphological features. The type I and type X methanotrophs are found within the gamma subdivision of the Proteobacteria and employ the ribulose monophosphate pathway for formaldehyde assimilation, whereas type II methanotrophs, which employ the serine pathway for formaldehyde assimilation, form a coherent cluster within the beta subdivision of the Proteobacteria. Methanotrophic bacteria are ubiquitous. The growth of type II bacteria appears to be favored in environments that contain relatively high levels of methane, low levels of dissolved oxygen, and limiting concentrations of combined nitrogen and/or copper. Type I methanotrophs appear to be dominant in environments in which methane is limiting and combined nitrogen and copper levels are relatively high. These bacteria serve as biofilters for the oxidation of methane produced in anaerobic environments, and when oxygen is present in soils, atmospheric methane is oxidized. Their activities in nature are greatly influenced by agricultural practices and other human activities. Recent evidence indicates that naturally occurring, uncultured methanotrophs represent new genera. Methanotrophs that are capable of oxidizing methane at atmospheric levels exhibit methane oxidation kinetics different from those of methanotrophs available in pure cultures. A limited number of methanotrophs have the genetic capacity to synthesize a soluble methane monooxygenase which catalyzes the rapid oxidation of environmental pollutants including trichloroethylene. PMID:8801441

Removal of methylmercury and tributyltin (TBT) using marine microorganisms.

PubMed

Lee, Seong Eon; Chung, Jin Wook; Won, Ho Shik; Lee, Dong Sup; Lee, Yong-Woo

2012-02-01

Two marine species of bacteria were isolated that are capable of degrading organometallic contaminants: Pseudomonas balearica, which decomposes methylmercury; and Shewanella putrefaciens, which decomposes tributyltin. P. balearica decomposed 97% of methylmercury (20.0 μg/L) into inorganic mercury after 3 h, while S. putrefaciens decomposed 88% of tributyltin (55.3 μg Sn/L) in real wastewater after 36 h. These data indicate that the two bacteria efficiently decomposed the targeted substances and may be applied to real wastewater.

Deep-Sea Bacterium Shewanella piezotolerans WP3 Has Two Dimethyl Sulfoxide Reductases in Distinct Subcellular Locations

PubMed Central

Xiong, Lei; Jian, Huahua

2017-01-01

ABSTRACT Dimethyl sulfoxide (DMSO) acts as a substantial sink for dimethyl sulfide (DMS) in deep waters and is therefore considered a potential electron acceptor supporting abyssal ecosystems. Shewanella piezotolerans WP3 was isolated from west Pacific deep-sea sediments, and two functional DMSO respiratory subsystems are essential for maximum growth of WP3 under in situ conditions (4°C/20 MPa). However, the relationship between these two subsystems and the electron transport pathway underlying DMSO reduction by WP3 remain unknown. In this study, both DMSO reductases (type I and type VI) in WP3 were found to be functionally independent despite their close evolutionary relationship. Moreover, immunogold labeling of DMSO reductase subunits revealed that the type I DMSO reductase was localized on the outer leaflet of the outer membrane, whereas the type VI DMSO reductase was located within the periplasmic space. CymA, a cytoplasmic membrane-bound tetraheme c-type cytochrome, served as a preferential electron transport protein for the type I and type VI DMSO reductases, in which type VI accepted electrons from CymA in a DmsE- and DmsF-independent manner. Based on these results, we proposed a core electron transport model of DMSO reduction in the deep-sea bacterium S. piezotolerans WP3. These results collectively suggest that the possession of two sets of DMSO reductases with distinct subcellular localizations may be an adaptive strategy for WP3 to achieve maximum DMSO utilization in deep-sea environments. IMPORTANCE As the dominant methylated sulfur compound in deep oceanic water, dimethyl sulfoxide (DMSO) has been suggested to play an important role in the marine biogeochemical cycle of the volatile anti-greenhouse gas dimethyl sulfide (DMS). Two sets of DMSO respiratory systems in the deep-sea bacterium Shewanella piezotolerans WP3 have previously been identified to mediate DMSO reduction under in situ conditions (4°C/20 MPa). Here, we report that the two DMSO

Anaerobic Decolorization and Detoxification of Cationic Red X-GRL by Shewanella oneidensis MR-1.

PubMed

Li, Qian; Feng, Xiao-Li; Li, Ting-Ting; Lu, Xue-Rong; Liu, Qiu-Yue; Han, Xue; Feng, Yu-Jie; Liu, Zhao-Ying; Zhang, Xi-Jia; Xiao, Xiang

2017-07-14

The ability of a electrochemically active bacterium, Shewanella oneidensis MR-1, to decolorize azo dye cationic red X-GRL (X-GRL) was investigated. S. oneidensis MR-1 showed a high decolorization capability for X-GRL under anaerobic conditions. The Mtr respiratory pathway was proved to be involved in the extracellular decolorization of X-GRL. The decolorization efficiency of S. oneidensis MR-1 was significantly inhibited when initial X-GRL concentration was over 200 mg L -1 . Increasing the inoculum volume of S. oneidensis MR-1 could obviously promote the X-GRL decolorization. The 100 mg L -1 X-GRL and 6% (v/v) inoculum volume were chosen as the optimal parameter. Under such a condition, almost all of X-GRL (100 mg L -1 ) could be completely reduced after 12-h incubation at the pH range of 5.5∼8.0 and temperature range of 30∼40 °C. Salinity in the medium also affected X-GRL decolorization. Lactate and citric acid were found to be the suitable electron donors for X-GRL decolorization. Although the genotoxicity increased slightly, the phytotoxicity of X-GRL in the decolorization process was significantly reduced by S. oneidensis MR-1.

BioNLP Shared Task--The Bacteria Track.

PubMed

Bossy, Robert; Jourde, Julien; Manine, Alain-Pierre; Veber, Philippe; Alphonse, Erick; van de Guchte, Maarten; Bessières, Philippe; Nédellec, Claire

2012-06-26

We present the BioNLP 2011 Shared Task Bacteria Track, the first Information Extraction challenge entirely dedicated to bacteria. It includes three tasks that cover different levels of biological knowledge. The Bacteria Gene Renaming supporting task is aimed at extracting gene renaming and gene name synonymy in PubMed abstracts. The Bacteria Gene Interaction is a gene/protein interaction extraction task from individual sentences. The interactions have been categorized into ten different sub-types, thus giving a detailed account of genetic regulations at the molecular level. Finally, the Bacteria Biotopes task focuses on the localization and environment of bacteria mentioned in textbook articles. We describe the process of creation for the three corpora, including document acquisition and manual annotation, as well as the metrics used to evaluate the participants' submissions. Three teams submitted to the Bacteria Gene Renaming task; the best team achieved an F-score of 87%. For the Bacteria Gene Interaction task, the only participant's score had reached a global F-score of 77%, although the system efficiency varies significantly from one sub-type to another. Three teams submitted to the Bacteria Biotopes task with very different approaches; the best team achieved an F-score of 45%. However, the detailed study of the participating systems efficiency reveals the strengths and weaknesses of each participating system. The three tasks of the Bacteria Track offer participants a chance to address a wide range of issues in Information Extraction, including entity recognition, semantic typing and coreference resolution. We found common trends in the most efficient systems: the systematic use of syntactic dependencies and machine learning. Nevertheless, the originality of the Bacteria Biotopes task encouraged the use of interesting novel methods and techniques, such as term compositionality, scopes wider than the sentence.

Diversity of the Sediment Microbial Community in the Aha Watershed (Southwest China) in Response to Acid Mine Drainage Pollution Gradients

PubMed Central

Sun, Weimin; Sun, Min; Dong, Yiran; Ning, Zengping; Xiao, Enzong; Tang, Song; Li, Jiwei

2015-01-01

Located in southwest China, the Aha watershed is continually contaminated by acid mine drainage (AMD) produced from upstream abandoned coal mines. The watershed is fed by creeks with elevated concentrations of aqueous Fe (total Fe > 1 g/liter) and SO42− (>6 g/liter). AMD contamination gradually decreases throughout downstream rivers and reservoirs, creating an AMD pollution gradient which has led to a suite of biogeochemical processes along the watershed. In this study, sediment samples were collected along the AMD pollution sites for geochemical and microbial community analyses. High-throughput sequencing found various bacteria associated with microbial Fe and S cycling within the watershed and AMD-impacted creek. A large proportion of Fe- and S-metabolizing bacteria were detected in this watershed. The dominant Fe- and S-metabolizing bacteria were identified as microorganisms belonging to the genera Metallibacterium, Aciditerrimonas, Halomonas, Shewanella, Ferrovum, Alicyclobacillus, and Syntrophobacter. Among them, Halomonas, Aciditerrimonas, Metallibacterium, and Shewanella have previously only rarely been detected in AMD-contaminated environments. In addition, the microbial community structures changed along the watershed with different magnitudes of AMD pollution. Moreover, the canonical correspondence analysis suggested that temperature, pH, total Fe, sulfate, and redox potentials (Eh) were significant factors that structured the microbial community compositions along the Aha watershed. PMID:25979900

The nature of electron acceptor (MnIV/NO3) triggers differential expression of genes associated with stress and ammonium limitation responses in Shewanella algae C6G3.

PubMed

Aigle, Axel; Bonin, Patricia; -Nunez, Nicolas Fernandez; Loriod, Béatrice; Guasco, Sophie; Bergon, Aurélie; Armougom, Fabrice; Iobbi-Nivol, Chantal; Imbert, Jean; Michotey, Valérie

2018-03-16

Shewanella algae C6G3 can reduce dissimilatively nitrate into ammonium and manganese-oxide (MnIV) into MnII. It has the unusual ability to produce anaerobically nitrite from ammonium in the presence of MnIV. To gain insight into their metabolic capabilities, global mRNA expression patterns were investigated by RNA-seq and qRT-PCR in cells growing with lactate and ammonium as carbon and nitrogen sources and with either MnIV or nitrate as electron acceptors. Gene exhibiting higher expression levels in the presence of MnIV belonged to functional categories of carbohydrate, coenzyme, lipid metabolisms and inorganic ion transport. Comparative transcriptomic pattern between MnIV and NO3 revealed that the strain presented an ammonium limitation status with MnIV, despite the presence of non-limiting concentration of ammonium under both culture conditions. In addition, in presence of MnIV, ntrB/nrtC regulators, ammonium channel, nitrogen regulatory protein P-II, glutamine synthetase and asparagine synthetase glutamine dependent genes were over-represented. Under nitrate condition, the expression of genes involved in the synthesis of several amino acids was increased. Finally, expression level of genes associated with the general stress response was also amplified and among them, katE, a putative catalase/peroxidase present on several Shewanella genomes, was highly expressed with a relative median value higher in MnIV condition.

Microbial profiles of commercial, vacuum-packaged, fresh pork of normal or short storage life.

PubMed

Holley, Richard A; Peirson, Michael D; Lam, Jocelyn; Tan, Kit Bee

2004-12-01

The microbial ecology of fresh vacuum-packed pork cuts during storage at -1.5 degrees C for up to 45 days was examined to characterize rates of microbial growth and pH changes in commercially prepared products of normal storage quality. Pork loins in commercial distribution with odour defects were also studied to determine a possible cause of the defects and avoid future problems. In addition, microbial profiles of pork cuts from two plants were compared, after storage for 25 days at -1.5 degrees C, to identify possible reasons for differences in the storage life of product from the plants. The effects of a change in sanitation procedures on the microbial populations of products stored for 25 days were also studied. With normal product, microbial growth in different packages progressed at different rates, reflecting differences in initial levels of bacterial contamination. All samples in the study reached 8 weeks without apparent organoleptic change and samples carried 5.8+/-1.2 log bacteria cm(-2) (mean+/-S.D.). The flora of loins with the odour defect were predominately lactic acid bacteria (LAB) and carnobacteria, but they contained large fractions of Enterobacteriaceae <35 days after packaging. Aeromonas spp. and Shewanella spp. were likely responsible for the sulfide-putrid smell of these spoiled products, but species of Enterobacteriaceae and lactic acid bacteria could have contributed to spoilage. Comparison of microbial groups present in 16 other cuts, half from each of two commercial plants, which were stored for 25 days at -1.5 degrees C, showed that larger fractions of Enterobacteriaceae were present in samples from the plant having difficulty achieving the desired storage life. Additional bacterial samples from 12 cuts supplied by the latter plant obtained after adoption of an acid sanitizer step in the plant cleaning regimen, and also stored for 25 days at -1.5 degrees C, yielded few Enterobacteriaceae, Aeromonas or Shewanella. Use of an acid sanitizer

Culturable Aerobic and Facultative Anaerobic Intestinal Bacterial Flora of Black Cobra (Naja naja karachiensis) in Southern Pakistan

PubMed Central

Iqbal, Junaid; Sagheer, Mehwish; Tabassum, Nazneen; Siddiqui, Ruqaiyyah; Khan, Naveed Ahmed

2014-01-01

Using morphological analysis and biochemical testing, here for the first time, we determined the culturable gut bacterial flora (aerobes and facultative anaerobes) in the venomous Black Cobra (Naja naja karachiensis) from South Asia. The findings revealed that these snakes inhabit potentially pathogenic bacteria including Serratia marcescens, Pseudomonas aeruginosa, Shewanella putrefaciens, Aeromonas hydrophila, Salmonella sp., Moraxella sp., Bacillus sp., Ochrobactrum anthropi, and Providencia rettgeri. These findings are of concern, as injury from snake bite can result in wound infections and tissue necrosis leading to sepsis/necrotizing fasciitis and/or expose consumers of snake meat/medicine in the community to infections. PMID:25002979

DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria.

PubMed

Peng, Yun-Feng; Chen, Wen-Chao; Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

2016-01-01

The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of four pfaE genes from bacteria producing arachidonic acid (ARA, 20:4ω6), eicosapentaenoic acid (EPA, 20:5ω3) or DHA, respectively. Substitution of the pfaE gene from different strain source in E. coli did not influence the function of the PKS pathway producing DHA, although they led to different DHA yields and fatty acid profiles. This result suggested that the pfaE gene could be switchable between these strains for the production of DHA. The DHA production by expressing the reconstituted PKS pathway was also investigated in different E. coli strains, at different temperatures, or with the treatment of cerulenin. The highest DHA production, 2.2 mg of DHA per gram of dry cell weight or 4.1% of total fatty acids, was obtained by co-expressing pfaE(EPA) from the EPA-producing strain Shewanella baltica with pfaABCD in DH5α. Incubation at low temperature (10-15°C) resulted in higher accumulation of DHA compared to higher temperatures. The addition of cerulenin to the medium increased the proportion of DHA and saturated fatty acids, including C12:0, C14:0 and C16:0, at the expense of monounsaturated fatty acids, including C16:1 and C18:1. Supplementation with 1 mg/L cerulenin resulted in the highest DHA yield of 2.4 mg/L upon co-expression of pfaE(DHA) from C. psychrerythraea.

Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*

PubMed Central

Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.

2009-01-01

Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057

Contribution of direct electron transfer mechanisms to overall electron transfer in microbial fuel cells utilising Shewanella oneidensis as biocatalyst.

PubMed

Fapetu, Segun; Keshavarz, Taj; Clements, Mark; Kyazze, Godfrey

2016-09-01

To investigate the contribution of direct electron transfer mechanisms to electricity production in microbial fuel cells by physically retaining Shewanella oneidensis cells close to or away from the anode electrode. A maximum power output of 114 ± 6 mWm(-2) was obtained when cells were retained close to the anode using a dialysis membrane. This was 3.5 times more than when the cells were separated away from the anode. Without the membrane the maximum power output was 129 ± 6 mWm(-2). The direct mechanisms of electron transfer contributed significantly to overall electron transfer from S. oneidensis to electrodes, a result that was corroborated by another experiment where S. oneidensis cells were entrapped in alginate gels. S. oneidensis transfers electrons primarily by direct electron transfer as opposed to mediated electron transfer.

Expression of Shewanella oneidensis MR-1 [FeFe]-Hydrogenase Genes in Anabaena sp. Strain PCC 7120

PubMed Central

Gärtner, Katrin; Lechno-Yossef, Sigal; Cornish, Adam J.; Wolk, C. Peter

2012-01-01

H2 generated from renewable resources holds promise as an environmentally innocuous fuel that releases only energy and water when consumed. In biotechnology, photoautotrophic oxygenic diazotrophs could produce H2 from water and sunlight using the cells' endogenous nitrogenases. However, nitrogenases have low turnover numbers and require large amounts of ATP. [FeFe]-hydrogenases found in other organisms can have 1,000-fold higher turnover numbers and no specific requirement for ATP but are very O2 sensitive. Certain filamentous cyanobacteria protect nitrogenase from O2 by sequestering the enzyme within internally micro-oxic, differentiated cells called heterocysts. We heterologously expressed the [FeFe]-hydrogenase operon from Shewanella oneidensis MR-1 in Anabaena sp. strain PCC 7120 using the heterocyst-specific promoter PhetN. Active [FeFe]-hydrogenase was detected in and could be purified from aerobically grown Anabaena sp. strain PCC 7120, but only when the organism was grown under nitrate-depleted conditions that elicited heterocyst formation. These results suggest that the heterocysts protected the [FeFe]-hydrogenase against inactivation by O2. PMID:23023750

Distinct Osmoadaptation Strategies in the Strict Halophilic and Halotolerant Bacteria Isolated from Lunsu Salt Water Body of North West Himalayas.

PubMed

Vaidya, Shivani; Dev, Kamal; Sourirajan, Anuradha

2018-07-01

Two strict halophilic bacterial strains, Halobacillus trueperi SS1, and Halobacillus trueperi SS3, and three halotolerant bacterial strains, Shewanella algae SS2, Halomonas venusta SS5, and Marinomonas sp. SS8 of Lunsu salt water body, Himachal Pradesh, India, were selected to study the mechanism of salt tolerance and the role of osmolytes therein. A combination of flame photometry, chromatographic and colorimetric assays was used to study the mechanism of salt tolerance in the selected strict halophilic and halotolerant bacterial strains. The strict halophiles and, one of the halotolerants, Marinomonas sp. SS8 were found to utilize both "salt-in strategy" and "accumulation of compatible solutes strategy" for osmoregulation in hypersaline conditions. On the contrary, the remaining two halotolerants used "accumulation of compatible solutes strategy" under saline stress and not the "salt-in strategy". The present study suggests towards distinct mechanisms of salt tolerance in the two classes, wherein strict halophiles accumulate compatible solutes as well as adopt salt-in strategy, while the halotolerant bacteria accumulate a range of compatible solutes, except Marinomonas sp. SS8, which utilizes both the strategies to combat salt stress.

[Effects of iron on azoreduction by Shewanella decolorationis S12].

PubMed

Chen, Xing-Juan; Xu, Mei-Ying; Sun, Guo-Ping

2010-01-01

The effects of soluble and insoluble Fe(III) on anaerobic azoreduction by Shewanella decolorationis S12 were examined in a series of experiments. Results showed that the effects of iron on anaerobic azoreduction depended on the solubility and concentration of the compounds. Azoreduction was inhibited by insoluble Fe(III) and 0.05-2 mmol/L Fe2 O3 all decelerated the azoreduction activity of 0.2 mmol/L amaranth, but the increase in the concentrations of Fe2O3 did not cause an increasing inhibition. Soluble Fe(III) of which concentration less than 0.4 mmol/L enhanced azoreduction activity of 0.2 mmol/L amaranth but there was no linear relationship between the concentration of soluble Fe(III) and azoreduction activity. Soluble Fe(III) of which concentration more than 1 mmol/L inhibited azoreduction activity of 0.2 mmol/L amaranth and an increasing concentration resulted in an increased inhibition. The inhibition was strengthened under the conditions of limited electron donor. On the other hand, soluble Fe(III) and Fe(II) could relieve the inhibition of azoreduction by dicumarol which blocked quinone cycle. It suggests that in addition to quinone cycle, there is a Fe(III) <--> Fe(II) cycle shuttling electrons in cytoplasmic and periplasmic environment. That is the reason why low concentration of soluble Fe(III) or Fe (II) can enhance azoreduction of S. decolorationis S12. It also indicates that insoluble Fe(III) and high concentration of soluble Fe(III) do compete with azo dye for electrons once it acts as electron acceptor. Thus, when iron and azo dye coexisted, iron could serve as an electron transfer agent or electron competitive inhibitor for anaerobic azoreduction under different conditions. High efficiency of azoreduction can be achieved through controlling the solubility and concentration of irons.

Antibacterial and antibiotic resistance modifying activity of the extracts from Allanblackia gabonensis, Combretum molle and Gladiolus quartinianus against Gram-negative bacteria including multi-drug resistant phenotypes.

PubMed

Fankam, Aimé G; Kuiate, Jules R; Kuete, Victor

2015-06-30

Bacterial resistance to antibiotics is becoming a serious problem worldwide. The discovery of new and effective antimicrobials and/or resistance modulators is necessary to tackle the spread of resistance or to reverse the multi-drug resistance. We investigated the antibacterial and antibiotic-resistance modifying activities of the methanol extracts from Allanblackia gabonensis, Gladiolus quartinianus and Combretum molle against 29 Gram-negative bacteria including multi-drug resistant (MDR) phenotypes. The broth microdilution method was used to determine the minimal inhibitory concentrations (MIC) and minimal bactericidal concentrations (MBC) of the samples meanwhile the standard phytochemical methods were used for the preliminary phytochemical screening of the plant extracts. Phytochemical analysis showed the presence of alkaloids, flavonoids, phenols and tannins in all studied extracts. Other chemical classes of secondary metabolites were selectively presents. Extracts from A. gabonensis and C. molle displayed a broad spectrum of activity with MICs varying from 16 to 1024 μg/mL against about 72.41% of the tested bacteria. The extract from the fruits of A. gabonensis had the best activity, with MIC values below 100 μg/mL on 37.9% of tested bacteria. Percentages of antibiotic-modulating effects ranging from 67 to 100% were observed against tested MDR bacteria when combining the leaves extract from C. molle (at MIC/2 and MIC/4) with chloramphenicol, kanamycin, streptomycin and tetracycline. The overall results of the present study provide information for the possible use of the studied plant, especially Allanblackia gabonensis and Combretum molle in the control of Gram-negative bacterial infections including MDR species as antibacterials as well as resistance modulators.

Involvement of Shewanella oneidensis MR-1 LuxS in Biofilm Development and Sulfur Metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Learman, Deric R.; Yi, Haakrho; Brown, Steven D.

2009-01-05

The role of LuxS in Shewanella oneidensis MR-1 has been examined by transcriptomic profiling, biochemical, and physiological experiments. The results indicate that a mutation in luxS alters biofilm development, not by altering quorum-sensing abilities but by disrupting the activated methyl cycle (AMC). The S. oneidensis wild type can produce a luminescence response in the AI-2 reporter strain Vibrio harveyi MM32. This luminescence response is abolished upon the deletion of luxS. The deletion of luxS also alters biofilm formations in static and flowthrough conditions. Genetic complementation restores the mutant biofilm defect, but the addition of synthetic AI-2 has no effect. Thesemore » results suggest that AI-2 is not used as a quorum-sensing signal to regulate biofilm development in S. oneidensis. Growth on various sulfur sources was examined because of the involvement of LuxS in the AMC. A mutation in luxS produced a reduced ability to grow with methionine as the sole sulfur source. Methionine is a key metabolite used in the AMC to produce a methyl source in the cell and to recycle homocysteine. These data suggest that LuxS is important to metabolizing methionine and the AMC in S. oneidensis.« less

Promotion of Iron Oxide Reduction and Extracellular Electron Transfer in Shewanella oneidensis by DMSO

PubMed Central

Cheng, Yuan-Yuan; Li, Bing-Bing; Li, Dao-Bo; Chen, Jie-Jie; Li, Wen-Wei; Tong, Zhong-Hua; Wu, Chao; Yu, Han-Qing

2013-01-01

The dissimilatory metal reducing bacterium Shewanella oneidensis MR-1, known for its capacity of reducing iron and manganese oxides, has great environmental impacts. The iron oxides reducing process is affected by the coexistence of alternative electron acceptors in the environment, while investigation into it is limited so far. In this work, the impact of dimethyl sulphoxide (DMSO), a ubiquitous chemical in marine environment, on the reduction of hydrous ferric oxide (HFO) by S. oneidensis MR-1 was investigated. Results show that DMSO promoted HFO reduction by both wild type and ΔdmsE, but had no effect on the HFO reduction by ΔdmsB, indicating that such a promotion was dependent on the DMSO respiration. With the DMSO dosing, the levels of extracellular flavins and omcA expression were significantly increased in WT and further increased in ΔdmsE. Bioelectrochemical analysis show that DMSO also promoted the extracellular electron transfer of WT and ΔdmsE. These results demonstrate that DMSO could stimulate the HFO reduction through metabolic and genetic regulation in S. oneidensis MR-1, rather than compete for electrons with HFO. This may provide a potential respiratory pathway to enhance the microbial electron flows for environmental and engineering applications. PMID:24244312

Review on SERS of Bacteria

PubMed Central

Mosier-Boss, Pamela A.

2017-01-01

Surface enhanced Raman spectroscopy (SERS) has been widely used for chemical detection. Moreover, the inherent richness of the spectral data has made SERS attractive for use in detecting biological materials, including bacteria. This review discusses methods that have been used to obtain SERS spectra of bacteria. The kinds of SERS substrates employed to obtain SERS spectra are discussed as well as how bacteria interact with silver and gold nanoparticles. The roll of capping agents on Ag/Au NPs in obtaining SERS spectra is examined as well as the interpretation of the spectral data. PMID:29137201

Direct determination of oxidation state of gold deposits in metal-reducing bacterium Shewanella algae using X-ray absorption near-edge structure spectroscopy (XANES).

PubMed

Konishi, Yasuhiro; Tsukiyama, Takeshi; Saitoh, Norizoh; Nomura, Toshiyuki; Nagamine, Shinsuke; Takahashi, Yoshio; Uruga, Tomoya

2007-06-01

X-ray absorption near-edge structure spectroscopy (XANES) was successfully employed to determine the gold valence in the metal-reducing bacterium Shewanella algae after exposure to a 1 mM aqueous HAuCl4 solution for 10-120 min. XANES spectra revealed the oxidation state of gold in the bacterial cells to be Au(0) without any contribution from Au(III), demonstrating that S. algae cells can reduce AuCl4- ions to elemental gold. Transmission electron microscopy (TEM) and energy dispersive X-ray (EDX) analysis confirmed that gold nanoparticles 5-15 nm in size were deposited in the periplasmic space of the bacterial cells; a preferable, cell surface location for the easy recovery of biogenic nanoparticles.

Increases of heat shock proteins and their mRNAs at high hydrostatic pressure in a deep-sea piezophilic bacterium, Shewanella violacea.

PubMed

Sato, Hiroshi; Nakasone, Kaoru; Yoshida, Takao; Kato, Chiaki; Maruyama, Tadashi

2015-07-01

When non-extremophiles encounter extreme environmental conditions, which are natural for the extremophiles, stress reactions, e.g., expression of heat shock proteins (HSPs), are thought to be induced for survival. To understand how the extremophiles live in such extreme environments, we studied the effects of high hydrostatic pressure on cellular contents of HSPs and their mRNAs during growth in a piezophilic bacterium, Shewanella violacea. HSPs increased at high hydrostatic pressures even when optimal for growth. The mRNAs and proteins of these HSPs significantly increased at higher hydrostatic pressure in S. violacea. In the non-piezophilic Escherichia coli, however, their mRNAs decreased, while their proteins did not change. Several transcriptional start sites (TSSs) for HSP genes were determined by the primer extension method and some of them showed hydrostatic pressure-dependent increase of the mRNAs. A major refolding target of one of the HSPs, chaperonin, at high hydrostatic pressure was shown to be RplB, a subunit of the 50S ribosome. These results suggested that in S. violacea, HSPs play essential roles, e.g., maintaining protein complex machinery including ribosomes, in the growth and viability at high hydrostatic pressure, and that, in their expression, the transcription is under the control of σ(32).

Methods for dispersing hydrocarbons using autoclaved bacteria

DOEpatents

Tyndall, Richard L.

1996-01-01

A method of dispersing a hydrocarbon includes the steps: providing a bacterium selected from the following group: ATCC 85527, ATCC 75529, and ATCC 55638, a mutant of any one of these bacteria possessing all the identifying characteristics of any one of these bacteria, and mixtures thereof; autoclaving the bacterium to derive a dispersant solution therefrom; and contacting the dispersant solution with a hydrocarbon to disperse the hydrocarbon. Moreover, a method for preparing a dispersant solution includes the following steps: providing a bacterium selected from the following group: ATCC 75527, ATCC 75529, and ATCC 55638, a mutant of any one of these bacteria possessing all the identifying characteristics of any one of these bacteria, and mixtures thereof; and autoclaving the bacterium to derive a dispersant solution therefrom.

Methods for dispersing hydrocarbons using autoclaved bacteria

DOEpatents

Tyndall, R.L.

1996-11-26

A method of dispersing a hydrocarbon includes the following steps: providing a bacterium selected from the following group: ATCC 85527, ATCC 75529, and ATCC 55638, a mutant of any one of these bacteria possessing all the identifying characteristics of any one of these bacteria, and mixtures; autoclaving the bacterium to derive a dispersant solution; and contacting the dispersant solution with a hydrocarbon to disperse the hydrocarbon. Moreover, a method for preparing a dispersant solution includes the following steps: providing a bacterium selected from the following group: ATCC 75527, ATCC 75529, and ATCC 55638, a mutant of any one of these bacteria possessing all the identifying characteristics of any one of these bacteria, and mixtures; and autoclaving the bacterium to derive a dispersant solution.

Bioremediation of nanomaterials

DOEpatents

Chen, Frank Fanqing; Keasling, Jay D; Tang, Yinjie J

2013-05-14

The present invention provides a method comprising the use of microorganisms for nanotoxicity study and bioremediation. In some embodiment, the microorganisms are bacterial organisms such as Gram negative bacteria, which are used as model organisms to study the nanotoxicity of the fullerene compounds: E. coli W3110, a human related enterobacterium and Shewanella oneidensis MR-1, an environmentally important bacterium with versatile metabolism.

Investigations of structure and metabolism within Shewanella oneidensis MR-1 biofilms.

PubMed

McLean, Jeffrey S; Majors, Paul D; Reardon, Catherine L; Bilskis, Christina L; Reed, Samantha B; Romine, Margaret F; Fredrickson, James K

2008-07-01

Biofilms possess spatially and temporally varying metabolite concentration profiles at the macroscopic and microscopic scales. This results in varying growth environments that may ultimately drive species diversity, determine biofilm structure and the spatial distribution of the community members. Using non-invasive nuclear magnetic resonance (NMR) microscopic imaging/spectroscopy and confocal imaging, we investigated the kinetics and stratification of anaerobic metabolism within live biofilms of the dissimilatory metal-reducing bacterium Shewanella oneidensis strain MR-1. Biofilms were pre-grown using a defined minimal medium in a constant-depth film bioreactor and subsequently transferred to an in-magnet sample chamber under laminar flow for NMR measurements. Biofilms generated in this manner were subjected to changing substrate/electron acceptor combinations (fumarate, dimethyl sulfoxide, and nitrate) and the metabolic responses measured. Localized NMR spectroscopy was used to non-invasively measure hydrogen-containing metabolites at high temporal resolution (4.5 min) under O(2)-limited conditions. Reduction of electron acceptor under anaerobic conditions was immediately observed upon switching feed solutions indicating that no gene induction (transcriptional response) was needed for MR-1 to switch metabolism from O(2) to fumarate, dimethyl sulfoxide or nitrate. In parallel experiments, confocal microscopy was used with constitutively expressed fluorescent reporters to independently investigate changes in population response to the availability of electron acceptor and to probe metabolic competition under O(2)-limited conditions. A clearer understanding of the metabolic diversity and plasticity of the biofilm mode of growth as well as how these factors relate to environmental fitness is made possible through the use of non-invasive and non-destructive techniques such as described herein.

Electron energy loss spectroscopy techniques for the study of microbial chromium(VI) reduction

NASA Technical Reports Server (NTRS)

Daulton, Tyrone L.; Little, Brenda J.; Lowe, Kristine; Jones-Meehan, Joanne

2002-01-01

Electron energy loss spectroscopy (EELS) techniques were used to determine oxidation state, at high spatial resolution, of chromium associated with the metal-reducing bacteria, Shewanella oneidensis, in anaerobic cultures containing Cr(VI)O4(2-). These techniques were applied to fixed cells examined in thin section by conventional transmission electron microscopy (TEM) as well as unfixed, hydrated bacteria examined by environmental cell (EC)-TEM. Two distinct populations of bacteria were observed by TEM: bacteria exhibiting low image contrast and bacteria exhibiting high contrast in their cell membrane (or boundary) structure which was often encrusted with high-contrast precipitates. Measurements by EELS demonstrated that cell boundaries became saturated with low concentrations of Cr and the precipitates encrusting bacterial cells contained a reduced form of Cr in oxidation state + 3 or lower.

Laser-Based Identification of Pathogenic Bacteria

NASA Astrophysics Data System (ADS)

Rehse, Steven J.

2009-03-01

Bacteria are ubiquitous in our world. From our homes, to our work environment, to our own bodies, bacteria are the omnipresent although often unobserved companions to human life. Physicists are typically untroubled professionally by the presence of these bacteria, as their study usually falls safely outside the realm of our typical domain. In the last 10 years, however, several events have occurred that demand the attention of the general populace — including the ranks of physicists among them.

Transcriptome and metabolome responses of Shewanella oneidensis MR-1 to methyl orange under microaerophilic and aerobic conditions.

PubMed

Cao, Xinhua; Qi, Yueling; Xu, Chen; Yang, Yuyi; Wang, Jun

2017-04-01

Shewanella oneidensis MR-1 degrades various azo dyes under microaerophilic and anaerobic conditions, but this process is inhibited under aerobic conditions. The mechanisms underlying azo dye biodegradation and inhibition remain unknown. Therefore, we investigated metabolic and transcriptional changes in strain MR-1, which was cultured under different conditions, to elucidate these mechanisms. At the transcriptional level, genes involved in certain metabolic processes, particularly the tricarboxylic acid (TCA) cycle, amino acid biodegradation, and the electron transfer system, were significantly altered (M ≧ 2, p > 0.8 ) in the presence of methyl orange (MO). Moreover, a high concentration of dissolved oxygen heavily impacted the expression levels of genes involved in fatty acid biodegradation. Metabolome analysis revealed significant alteration (p < 0.05) in the concentrations of nine metabolites when strain MR-1 was cultured under aerobic conditions; the majority of these metabolites were closely associated with amino acid metabolism and DNA replication. Accordingly, we propose a possible pathway for MO biodegradation and discuss the most likely causes of biodegradation inhibition due to dissolved oxygen.

Diversity of the Sediment Microbial Community in the Aha Watershed (Southwest China) in Response to Acid Mine Drainage Pollution Gradients.

PubMed

Sun, Weimin; Xiao, Tangfu; Sun, Min; Dong, Yiran; Ning, Zengping; Xiao, Enzong; Tang, Song; Li, Jiwei

2015-08-01

Located in southwest China, the Aha watershed is continually contaminated by acid mine drainage (AMD) produced from upstream abandoned coal mines. The watershed is fed by creeks with elevated concentrations of aqueous Fe (total Fe > 1 g/liter) and SO4 (2-) (>6 g/liter). AMD contamination gradually decreases throughout downstream rivers and reservoirs, creating an AMD pollution gradient which has led to a suite of biogeochemical processes along the watershed. In this study, sediment samples were collected along the AMD pollution sites for geochemical and microbial community analyses. High-throughput sequencing found various bacteria associated with microbial Fe and S cycling within the watershed and AMD-impacted creek. A large proportion of Fe- and S-metabolizing bacteria were detected in this watershed. The dominant Fe- and S-metabolizing bacteria were identified as microorganisms belonging to the genera Metallibacterium, Aciditerrimonas, Halomonas, Shewanella, Ferrovum, Alicyclobacillus, and Syntrophobacter. Among them, Halomonas, Aciditerrimonas, Metallibacterium, and Shewanella have previously only rarely been detected in AMD-contaminated environments. In addition, the microbial community structures changed along the watershed with different magnitudes of AMD pollution. Moreover, the canonical correspondence analysis suggested that temperature, pH, total Fe, sulfate, and redox potentials (Eh) were significant factors that structured the microbial community compositions along the Aha watershed. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Anaerobic bacteria

MedlinePlus

Anaerobic bacteria are bacteria that do not live or grow when oxygen is present. In humans, these bacteria ... Brook I. Diseases caused by non-spore-forming anaerobic bacteria. In: Goldman L, Schafer AI, eds. Goldman-Cecil ...

A synthetic microbial consortium of Shewanella and Bacillus for enhanced generation of bioelectricity.

PubMed

Liu, Ting; Yu, Yang-Yang; Chen, Tao; Chen, Wei Ning

2017-03-01

In this study, a synthetic microbial consortium containing exoelectrogen Shewanella oneidensis MR-1 and riboflavin-producing strain, Bacillus subtilis RH33, was rationally designed and successfully constructed, enabling a stable, multiple cycles of microbial fuel cells (MFCs) operation for more than 500 h. The maximum power density of MFCs with this synthetic microbial consortium was 277.4 mW/m 2 , which was 4.9 times of that with MR-1 (56.9 mW/m 2 ) and 40.2 times of RH33 (6.9 mW/m 2 ), separately. At the same time, the Coulombic efficiency of the synthetic microbial consortium (5.6%) was higher than MR-1 (4.1%) and RH33 (2.3%). Regardless the high concentration of riboflavin produced by RH33, the power density of RH33 was rather low. The low bioelectricity generation can be ascribed to the low efficiency of RH33 in utilizing riboflavin for extracellular electron transfer (EET). In the synthetic microbial consortium of MR-1 and RH33, it was found that both mediated and direct electron transfer efficiencies were enhanced. By exchanging the anolyte of MR-1 and RH33, it was confirmed that the improved MFC performance with the synthetic microbial consortium was because MR-1 could efficiently utilize the high concentration of riboflavin produced by RH33. Biotechnol. Bioeng. 2017;114: 526-532. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

[FATTY ACID COMPOSITION ALTEROMONAS-LIKE BACTERIA ISOLATED FROM THE BLACK SEA WATER].

PubMed

Klochko, V V; Avdeeva, L V

2015-01-01

Alteromonas macleodii strains isolated from the Black sea water were similar in their fatty acids composition with the type strain of this species. Analysis of lipid composition of 10 A. macleodii strains isolated from the deep and surface water layers in different World ocean regions including the Black sea water has shown that the deep and surface isolates of this species formed two groups different in their fatty acids profiles. The Black sea isolates of Pseudoalteromonas haloplanktis, P. citrea, P. flavipulchra conformed to these species type strains in their fatty acids composition. On the basis of the fatty acids spectra similarity of three Pseudoalteromonas species strains with Plipolytica described in 2010 has been established. Presence of three isomers C16:1ψ7, C 16:1ψ9 and C16:1ψ6--components of hexadecenic acid in the Black sea isolates of Shewanella baltica has been shown.

Biofouling of contaminated ground-water recovery wells: Characterization of microorganisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, S.W.; Lange, C.R.; Lesold, E.A.

1997-11-01

The taxonomy and physiology of microorganisms isolated from contaminated ground-water recovery wells prone to biofouling are characterized for an industrial site in Rochester, New York. Principal aquifer contaminants include acetone, cyclohexane, dichloroethane, dichloromethane, 1,4-dioxane, isopropanol, methanol, and toluene. These contaminants represent a significant fraction (up to 95%) of the total organic carbon in the ground water. Ground-water samples from 12 recovery wells were used to isolate, quantify, and identify aerobic and anaerobic bacterial populations. Samples from selected wells were also characterized geochemically to assess redox conditions and availability of essential and trace nutrients. Dominant bacteria, listed in order of descendingmore » numbers, including sulfate-reducers (Desulfovibrio desulfuricans), anaerobic heterotrophs (Actinomyces, Bacteriodes, Bacillus, Agrobacterium), aerobic heterotrophs (Pseudomonas, Flavobacterium, Nocardia, Citrobacter), iron-oxidizers (Gallionella ferruginea, Crenothrix polyspora), iron-reducers (Shewanella), and sulfur-oxidizers (Thiobacillus ferrooxidans). Fungi were also recovered in low numbers. Both aerobic and anaerobic heterotrophs were able to utilize all principal contaminants as sole carbon and energy sources except 1,4-dioxane. The prevalence of heterotrophic bacteria and their ability to use the available anthropogenic carbon suggests that aerobic and anaerobic heterotrophs contribute to the biofouling of wells at this site, in addition to the often cited fouling due to iron-oxidizing bacteria and sulfate-reducing bacteria.« less

Fatty acid and hydrocarbon composition in tropical marine Shewanella amazonensis strain SB2B(T).

PubMed

Motoigi, Taro; Okuyama, Hidetoshi

2011-10-01

Shewanella amazonensis strain SB2B(T) is an isolate from shallow-water marine sediments derived from the Amazon River delta. This bacterium contained a long-chain polyunsaturated hydrocarbon, all-cis -3,6,9,12,16,19,22,25,28 hentriacontanonaene (C31:9), constituting 1-2% of the total fatty acid methyl ester and hydrocarbon fraction, which was produced dependently of decreased growth temperature. Analysis of its cellular fatty acid composition demonstrated that isopentadecanoic acid was the major fatty acid component and that all the main monounsaturated fatty acids had straight chains with a cis configuration. However, monoenoic cyclopropyl fatty acids, which were previously reported to be present in this bacterium, were not detected by mass spectrometric analysis. The growth temperature affected the content of Δ9-cis -hexadecenoic [16:1(Δ9c)], palmitic, and heptadecanoic acids. These results suggest that C31:9, as well as 16:1(Δ9c) might be involved in adaptation to low temperature in S. amazonensis strain SB2B(T) . Our result suggests that polyunsaturated fatty acid synthase protein complex may be involved in synthesis of C31:9 but not in production of eicosapentaenoic acid. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

High power density from a miniature microbial fuel cell using Shewanella oneidensis DSP10.

PubMed

Ringeisen, Bradley R; Henderson, Emily; Wu, Peter K; Pietron, Jeremy; Ray, Ricky; Little, Brenda; Biffinger, Justin C; Jones-Meehan, Joanne M

2006-04-15

A miniature microbial fuel cell (mini-MFC) is described that demonstrates high output power per device cross-section (2.0 cm2) and volume (1.2 cm3). Shewanella oneidensis DSP10 in growth medium with lactate and buffered ferricyanide solutions were used as the anolyte and catholyte, respectively. Maximum power densities of 24 and 10 mW/m2 were measured using the true surface areas of reticulated vitreous carbon (RVC) and graphite felt (GF) electrodes without the addition of exogenous mediators in the anolyte. Current densities at maximum power were measured as 44 and 20 mA/m2 for RVC and GF, while short circuit current densities reached 32 mA/m2 for GF anodes and 100 mA/m2 for RVC. When the power density for GF was calculated using the cross sectional area of the device or the volume of the anode chamber, we found values (3 W/m2, 500 W/m3) similar to the maxima reported in the literature. The addition of electron mediators resulted in current and power increases of 30-100%. These power densities were surprisingly high considering a pure S. oneidensis culture was used. We found that the short diffusion lengths and high surface-area-to-chamber volume ratio utilized in the mini-MFC enhanced power density when compared to output from similar macroscopic MFCs.

Individual Patterns of Complexity in Cystic Fibrosis Lung Microbiota, Including Predator Bacteria, over a 1-Year Period

PubMed Central

de Dios Caballero, Juan; Vida, Rafael; Cobo, Marta; Máiz, Luis; Suárez, Lucrecia; Galeano, Javier; Baquero, Fernando; Cantón, Rafael

2017-01-01

ABSTRACT Cystic fibrosis (CF) lung microbiota composition has recently been redefined by the application of next-generation sequencing (NGS) tools, identifying, among others, previously undescribed anaerobic and uncultivable bacteria. In the present study, we monitored the fluctuations of this ecosystem in 15 CF patients during a 1-year follow-up period, describing for the first time, as far as we know, the presence of predator bacteria in the CF lung microbiome. In addition, a new computational model was developed to ascertain the hypothetical ecological repercussions of a prey-predator interaction in CF lung microbial communities. Fifteen adult CF patients, stratified according to their pulmonary function into mild (n = 5), moderate (n = 9), and severe (n = 1) disease, were recruited at the CF unit of the Ramón y Cajal University Hospital (Madrid, Spain). Each patient contributed three or four induced sputum samples during a 1-year follow-up period. Lung microbiota composition was determined by both cultivation and NGS techniques and was compared with the patients’ clinical variables. Results revealed a particular microbiota composition for each patient that was maintained during the study period, although some fluctuations were detected without any clinical correlation. For the first time, Bdellovibrio and Vampirovibrio predator bacteria were shown in CF lung microbiota and reduced-genome bacterial parasites of the phylum Parcubacteria were also consistently detected. The newly designed computational model allows us to hypothesize that inoculation of predators into the pulmonary microbiome might contribute to the control of chronic colonization by CF pathogens in early colonization stages. PMID:28951476

New Insights into the Changes of the Proteome and Microbiome of Shrimp ( Litopenaeus vannamei) Stored in Acidic Electrolyzed Water Ice.

PubMed

Zhao, Li; Zhang, Zhaohuan; Wang, Meng; Sun, Jiangping; Li, Huan; Malakar, Pradeep K; Liu, Haiquan; Pan, Yingjie; Zhao, Yong

2018-05-16

Acidic electrolyzed water (AEW) ice is a novel technique for prolonging the shelf life of foods, but there is limited knowledge of its preservation mechanism. A proteomics approach and 16S rRNA-based Illumina sequencing were employed to investigate the changes of key proteins and bacterial communities in shrimp stored in AEW ice and tap water ice (TW ice) for 7 days. Compared with TW ice, AEW ice markedly retards the degradation of myofibrillar proteins in shrimp, including myosin, actin, and tropomyosin. Moreover, sarcoplasmatic proteins that participate in the carbohydrate catabolic process and amino acid metabolism were also influenced. Furthermore, the growth of spoilage bacteria, which includes the genera Psychrobacter, Shewanella, and Flavobacterium, was significantly inhibited by AEW ice, and the inhibition rates at day 7 were 71.6, 47.8, and 100%, respectively ( p < 0.05). Further correlation analysis showed the links between spoilage bacteria and protein changes can be broken by AEW ice treatment. Collectively, our findings indicated AEW ice can improve the quality of shrimp via previously undescribed mechanisms, which retarded the degradation of myofibrillar proteins and inhibited the growth of spoilage bacteria.

Spectroscopic diagnostics for bacteria in biologic sample

DOEpatents

El-Sayed, Mostafa A.; El-Sayed, Ivan H.

2002-01-01

A method to analyze and diagnose specific bacteria in a biologic sample using spectroscopy is disclosed. The method includes obtaining the spectra of a biologic sample of a non-infected patient for use as a reference, subtracting the reference from the spectra of an infected sample, and comparing the fingerprint regions of the resulting differential spectrum with reference spectra of bacteria in saline. Using this diagnostic technique, specific bacteria can be identified sooner and without culturing, bacteria-specific antibiotics can be prescribed sooner, resulting in decreased likelihood of antibiotic resistance and an overall reduction of medical costs.

Methylotrophic bacteria in sustainable agriculture.

PubMed

Kumar, Manish; Tomar, Rajesh Singh; Lade, Harshad; Paul, Diby

2016-07-01

Excessive use of chemical fertilizers to increase production from available land has resulted in deterioration of soil quality. To prevent further soil deterioration, the use of methylotrophic bacteria that have the ability to colonize different habitats, including soil, sediment, water, and both epiphytes and endophytes as host plants, has been suggested for sustainable agriculture. Methylotrophic bacteria are known to play a significant role in the biogeochemical cycle in soil ecosystems, ultimately fortifying plants and sustaining agriculture. Methylotrophs also improve air quality by using volatile organic compounds such as dichloromethane, formaldehyde, methanol, and formic acid. Additionally, methylotrophs are involved in phosphorous, nitrogen, and carbon cycling and can help reduce global warming. In this review, different aspects of the interaction between methylotrophs and host plants are discussed, including the role of methylotrophs in phosphorus acquisition, nitrogen fixation, phytohormone production, iron chelation, and plant growth promotion, and co-inoculation of these bacteria as biofertilizers for viable agriculture practices.

40 CFR 165.63 - Scope of pesticide products included.

Code of Federal Regulations, 2011 CFR

2011-07-01

... caused by bacteria, viruses, fungi, protozoa, algae, or slime; and (B) In the intended use is subject to... bacteria, viruses, fungi, protozoa, algae, or slime. (ii) The labeling of the pesticide product includes...

40 CFR 165.63 - Scope of pesticide products included.

Code of Federal Regulations, 2014 CFR

2014-07-01

... caused by bacteria, viruses, fungi, protozoa, algae, or slime; and (B) In the intended use is subject to... bacteria, viruses, fungi, protozoa, algae, or slime. (ii) The labeling of the pesticide product includes...

40 CFR 165.63 - Scope of pesticide products included.

Code of Federal Regulations, 2013 CFR

2013-07-01

... caused by bacteria, viruses, fungi, protozoa, algae, or slime; and (B) In the intended use is subject to... bacteria, viruses, fungi, protozoa, algae, or slime. (ii) The labeling of the pesticide product includes...

40 CFR 165.63 - Scope of pesticide products included.

Code of Federal Regulations, 2012 CFR

2012-07-01

... caused by bacteria, viruses, fungi, protozoa, algae, or slime; and (B) In the intended use is subject to... bacteria, viruses, fungi, protozoa, algae, or slime. (ii) The labeling of the pesticide product includes...

Tracking Electron Uptake from a Cathode into Shewanella Cells: Implications for Energy Acquisition from Solid-Substrate Electron Donors

PubMed Central

Rajeev, Pournami; Jain, Abhiney; Pirbadian, Sahand; Okamoto, Akihiro; Gralnick, Jeffrey A.; El-Naggar, Mohamed Y.; Nealson, Kenneth H.

2018-01-01

ABSTRACT While typically investigated as a microorganism capable of extracellular electron transfer to minerals or anodes, Shewanella oneidensis MR-1 can also facilitate electron flow from a cathode to terminal electron acceptors, such as fumarate or oxygen, thereby providing a model system for a process that has significant environmental and technological implications. This work demonstrates that cathodic electrons enter the electron transport chain of S. oneidensis when oxygen is used as the terminal electron acceptor. The effect of electron transport chain inhibitors suggested that a proton gradient is generated during cathode oxidation, consistent with the higher cellular ATP levels measured in cathode-respiring cells than in controls. Cathode oxidation also correlated with an increase in the cellular redox (NADH/FMNH2) pool determined with a bioluminescence assay, a proton uncoupler, and a mutant of proton-pumping NADH oxidase complex I. This work suggested that the generation of NADH/FMNH2 under cathodic conditions was linked to reverse electron flow mediated by complex I. A decrease in cathodic electron uptake was observed in various mutant strains, including those lacking the extracellular electron transfer components necessary for anodic-current generation. While no cell growth was observed under these conditions, here we show that cathode oxidation is linked to cellular energy acquisition, resulting in a quantifiable reduction in the cellular decay rate. This work highlights a potential mechanism for cell survival and/or persistence on cathodes, which might extend to environments where growth and division are severely limited. PMID:29487241

Bacteria-Affinity 3D Macroporous Graphene/MWCNTs/Fe3O4 Foams for High-Performance Microbial Fuel Cells.

PubMed

Song, Rong-Bin; Zhao, Cui-E; Jiang, Li-Ping; Abdel-Halim, Essam Sayed; Zhang, Jian-Rong; Zhu, Jun-Jie

2016-06-29

Promoting the performance of microbial fuel cells (MFCs) relies heavily on the structure design and composition tailoring of electrode materials. In this work, three-dimensional (3D) macroporous graphene foams incorporated with intercalated spacer of multiwalled carbon nanotubes (MWCNTs) and bacterial anchor of Fe3O4 nanospheres (named as G/MWCNTs/Fe3O4 foams) were first synthesized and used as anodes for Shewanella-inoculated microbial fuel cells (MFCs). Thanks to the macroporous structure of 3D graphene foams, the expanded electrode surface by MWCNTs spacing, as well as the high affinity of Fe3O4 nanospheres toward Shewanella oneidensis MR-1, the anode exhibited high bacterial loading capability. In addition to spacing graphene nanosheets for accommodating bacterial cells, MWCNTs paved a smoother way for electron transport in the electrode substrate of MFCs. Meanwhile, the embedded bioaffinity Fe3O4 nanospheres capable of preserving the bacterial metabolic activity provided guarantee for the long-term durability of the MFCs. With these merits, the constructed MFC possessed significantly higher power output and stronger stability than that with conventional graphite rod anode.

Microbial Iron Respiration Can Protect Steel from Corrosion

PubMed Central

Dubiel, M.; Hsu, C. H.; Chien, C. C.; Mansfeld, F.; Newman, D. K.

2002-01-01

Microbiologically influenced corrosion (MC) of steel has been attributed to the activity of biofilms that include anaerobic microorganisms such as iron-respiring bacteria, yet the mechanisms by which these organisms influence corrosion have been unclear. To study this process, we generated mutants of the iron-respiring bacterium Shewanella oneidensis strain MR-1 that were defective in biofilm formation and/or iron reduction. Electrochemical impedance spectroscopy was used to determine changes in the corrosion rate and corrosion potential as a function of time for these mutants in comparison to the wild type. Counter to prevailing theories of MC, our results indicate that biofilms comprising iron-respiring bacteria may reduce rather than accelerate the corrosion rate of steel. Corrosion inhibition appears to be due to reduction of ferric ions to ferrous ions and increased consumption of oxygen, both of which are direct consequences of microbial respiration. PMID:11872499

Gastric spiral bacteria in small felids.

PubMed

Kinsel, M J; Kovarik, P; Murnane, R D

1998-06-01

Nine small cats, including one bobcat (Felis rufus), one Pallas cat (F. manul), one Canada lynx (F. lynx canadensis), two fishing cats (F. viverrina), two margays (F. wiedii), and two sand cats (F. margarita), necropsied between June 1995 and March 1997 had large numbers of gastric spiral bacteria, whereas five large cats, including one African lion (Panthera leo), two snow leopards (P. uncia), one Siberian tiger (P. tigris altaica), and one jaguar (P. onca), necropsied during the same period had none. All of the spiral organisms from the nine small cats were histologically and ultrastructurally similar. Histologically, the spiral bacteria were 5-14 microm long with five to nine coils per organism and were located both extracellularly within gastric glands and surface mucus, and intracellularly in parietal cells. Spiral bacteria in gastric mucosal scrapings from the Canada lynx, one fishing cat, and the two sand cats were gram negative and had corkscrewlike to tumbling motility when viewed with phase contrast microscopy. The bacteria were 0.5-0.7 microm wide, with a periodicity of 0.65-1.1 microm in all cats. Bipolar sheathed flagella were occasionally observed, and no periplasmic fibrils were seen. The bacteria were extracellular in parietal cell canaliculi and intracellular within parietal cells. Culture of mucosal scrapings from the Canada lynx and sand cats was unsuccessful. Based on morphology, motility, and cellular tropism, the bacteria were probably Helicobacter-like organisms. Although the two margays had moderate lymphoplasmacytic gastritis, the other cats lacked or had only mild gastric lymphoid infiltrates, suggesting that these organisms are either commensals or opportunistic pathogens.

Isolation of Novel Bacteria Including Rarely Cultivated Phyla, Acidobacteria and Verrucomicrobia, from the Roots of Emergent Plants by Simple Culturing Method

PubMed Central

Tanaka, Yasuhiro; Matsuzawa, Hiroaki; Tamaki, Hideyuki; Tagawa, Masahiro; Toyama, Tadashi; Kamagata, Yoichi; Mori, Kazuhiro

2017-01-01

A number of novel bacteria including members of rarely cultivated phyla, Acidobacteria and Verrucomicrobia, were successfully isolated from the roots of two emergent plants, Iris pseudacorus and Scirpus juncoides, by a simple culturing method. A total of 47.1% (66 strains) for I. pseudacorus and 42.1% (59 strains) for S. juncoides of all isolates (140 strains from each sample) were phylogenetically novel. Furthermore, Acidobacteria and Verrucomicrobia occupied 10.7% (15 strains) and 2.9% (4 strains) of I. pseudacorus isolates, and 2.1% (3 strains) and 3.6% (5 strains) of S. juncoides isolates, respectively, indicating that plant roots are attractive sources for isolating rarely cultivated microbes. PMID:28740039

Individual Patterns of Complexity in Cystic Fibrosis Lung Microbiota, Including Predator Bacteria, over a 1-Year Period.

PubMed

de Dios Caballero, Juan; Vida, Rafael; Cobo, Marta; Máiz, Luis; Suárez, Lucrecia; Galeano, Javier; Baquero, Fernando; Cantón, Rafael; Del Campo, Rosa

2017-09-26

Cystic fibrosis (CF) lung microbiota composition has recently been redefined by the application of next-generation sequencing (NGS) tools, identifying, among others, previously undescribed anaerobic and uncultivable bacteria. In the present study, we monitored the fluctuations of this ecosystem in 15 CF patients during a 1-year follow-up period, describing for the first time, as far as we know, the presence of predator bacteria in the CF lung microbiome. In addition, a new computational model was developed to ascertain the hypothetical ecological repercussions of a prey-predator interaction in CF lung microbial communities. Fifteen adult CF patients, stratified according to their pulmonary function into mild ( n = 5), moderate ( n = 9), and severe ( n = 1) disease, were recruited at the CF unit of the Ramón y Cajal University Hospital (Madrid, Spain). Each patient contributed three or four induced sputum samples during a 1-year follow-up period. Lung microbiota composition was determined by both cultivation and NGS techniques and was compared with the patients' clinical variables. Results revealed a particular microbiota composition for each patient that was maintained during the study period, although some fluctuations were detected without any clinical correlation. For the first time, Bdellovibrio and Vampirovibrio predator bacteria were shown in CF lung microbiota and reduced-genome bacterial parasites of the phylum Parcubacteria were also consistently detected. The newly designed computational model allows us to hypothesize that inoculation of predators into the pulmonary microbiome might contribute to the control of chronic colonization by CF pathogens in early colonization stages. IMPORTANCE The application of NGS to sequential samples of CF patients demonstrated the complexity of the organisms present in the lung (156 species) and the constancy of basic individual colonization patterns, although some differences between samples from the same patient were

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

PubMed Central

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin

2016-01-01

Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855

Larval settlement and metamorphosis of the mussel Mytilus coruscus in response to monospecific bacterial biofilms.

PubMed

Yang, Jin-Long; Shen, Pei-Jing; Liang, Xiao; Li, Yi-Feng; Bao, Wei-Yang; Li, Jia-Le

2013-01-01

The effects of bacterial biofilms (BFs) on larval settlement and metamorphosis of the mussel, Mytilus coruscus, were investigated in the laboratory. Of nine different isolates, Shewanella sp.1 BF induced the highest percentage of larval settlement and metamorphosis, whereas seven other isolates had a moderate inducing activity and one isolate, Pseudoalteromonas sp. 4, had a no inducing activity. The inducing activity of individual bacterial isolates was not correlated either with their phylogenetic relationship or with the surfaces from which they were isolated. Among the eight bacterial species that demonstrated inducing activity, bacterial density was significantly correlated with the inducing activity for each strain, with the exception of Vibrio sp. 1. The Shewanella sp. 1 BF cue that was responsible for inducing larval settlement and metamorphosis was further investigated. Treatment of the BFs with formalin, antibiotics, ultraviolet irradiation, heat, and ethanol resulted in a significant decrease in their inducing activities and cell survival. BF-conditioned water (CW) did not induce larval metamorphosis, but it triggered larval settlement behavior. A synergistic effect of CW with formalin-fixed Shewanella sp. 1 BF significantly promoted larval metamorphosis. Thus, a cocktail of chemical cues derived from bacteria may be necessary to stimulate larval settlement and metamorphosis in this species.

Deletion of degQ gene enhances outer membrane vesicle production of Shewanella oneidensis cells.

PubMed

Ojima, Yoshihiro; Mohanadas, Thivagaran; Kitamura, Kosei; Nunogami, Shota; Yajima, Reiki; Taya, Masahito

2017-04-01

Shewanella oneidensis is a Gram-negative facultative anaerobe that can use a wide variety of terminal electron acceptors for anaerobic respiration. In this study, S. oneidensis degQ gene, encoding a putative periplasmic serine protease, was cloned and expressed. The activity of purified DegQ was inhibited by diisopropyl fluorophosphate, a typical serine protease-specific inhibitor, indicating that DegQ is a serine protease. In-frame deletion and subsequent complementation of the degQ were carried out to examine the effect of envelope stress on the production of outer membrane vesicles (OMVs). Analysis of periplasmic proteins from the resulting S. oneidensis strain showed that deletion of degQ induced protein accumulation and resulted in a significant decrease in protease activity within the periplasmic space. OMVs from the wild-type and mutant strains were purified and observed by transmission electron microscopy. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the OMVs showed a prominent band at ~37 kDa. Nanoliquid chromatography-tandem mass spectrometry analysis identified three outer membrane porins (SO3896, SO1821, and SO3545) as dominant components of the band, suggesting that these proteins could be used as indices for comparing OMV production by S. oneidensis strains. Quantitative evaluation showed that degQ-deficient cells had a fivefold increase in OMV production compared with wild-type cells. Thus, the increased OMV production following the deletion of DegQ in S. oneidensis may be responsible for the increase in envelope stress.

Cell growth and protein expression of Shewanella oneidensis in biofilms and hydrogel-entrapped cultures.

PubMed

Zhang, Yingdan; Ng, Chun Kiat; Cohen, Yehuda; Cao, Bin

2014-05-01

The performance of biofilm-based bioprocesses is difficult to predict and control because of the intrinsic heterogeneous and dynamic properties of microbial biofilms. Biofilm mimics, such as microbial cells entrapped in polymeric scaffolds that are permeable for nutrients, have been proposed to replace real biofilms to achieve long-term robust performance in engineering applications. However, the physiological differences between cells that are physically entrapped in a synthetic polymeric matrix and biofilm cells that are encased in a self-produced polymeric matrix remain unknown. In this study, using Shewanella oneidensis as a model organism and alginate hydrogel as a model synthetic matrix, we compared the cell growth and protein expression in entrapped cultures and biofilms. The hydrogel-entrapped cultures were found to exhibit a growth rate comparable with biofilms. There was no substantial difference in cell viability, surface charge, as well as hydrophobicity between the cells grown in alginate hydrogel and those grown in biofilms. However, the gel-entrapped cultures were found to be physiologically different from biofilms. The gel-entrapped cultures had a higher demand for metabolic energy. The siderophore-mediated iron uptake was repressed in the gel-entrapped cells. The presence of the hydrogel matrix decreased the expression of proteins involved in biofilm formation, while inducing the production of extracellular DNA (eDNA) in the gel-entrapped cultures. These results advance the fundamental understanding of the physiology of hydrogel-entrapped cells, which can lead to more efficient biofilm mimic-based applications.

On the influence of the culture conditions in bacterial antifouling bioassays and biofilm properties: Shewanella algae, a case study

PubMed Central

2014-01-01

Background A variety of conditions (culture media, inocula, incubation temperatures) are employed in antifouling tests with marine bacteria. Shewanella algae was selected as model organism to evaluate the effect of these parameters on: bacterial growth, biofilm formation, the activity of model antifoulants, and the development and nanomechanical properties of the biofilms. The main objectives were: 1) To highlight and quantify the effect of these conditions on relevant parameters for antifouling studies: biofilm morphology, thickness, roughness, surface coverage, elasticity and adhesion forces. 2) To establish and characterise in detail a biofilm model with a relevant marine strain. Results Both the medium and the temperature significantly influenced the total cell densities and biofilm biomasses in 24-hour cultures. Likewise, the IC50 of three antifouling standards (TBTO, tralopyril and zinc pyrithione) was significantly affected by the medium and the initial cell density. Four media (Marine Broth, MB; 2% NaCl Mueller-Hinton Broth, MH2; Luria Marine Broth, LMB; and Supplemented Artificial Seawater, SASW) were selected to explore their effect on the morphological and nanomechanical properties of 24-h biofilms. Two biofilm growth patterns were observed: a clear trend to vertical development, with varying thickness and surface coverage in MB, LMB and SASW, and a horizontal, relatively thin film in MH2. The Atomic Force Microscopy analysis showed the lowest Young modulii for MB (0.16 ± 0.10 MPa), followed by SASW (0.19 ± 0.09 MPa), LMB (0.22 ± 0.13 MPa) and MH2 (0.34 ± 0.16 MPa). Adhesion forces followed an inverted trend, being higher in MB (1.33 ± 0.38 nN) and lower in MH2 (0.73 ± 0.29 nN). Conclusions All the parameters significantly affected the ability of S. algae to grow and form biofilms, as well as the activity of antifouling molecules. A detailed study has been carried out in order to establish a biofilm model for further assays. The morphology and

Bacteria isolated from amoebae/bacteria consortium

DOEpatents

Tyndall, R.L.

1995-05-30

New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

Bacteria isolated from amoebae/bacteria consortium

DOEpatents

Tyndall, Richard L.

1995-01-01

New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

Bad bacteria in acute appendicitis: rare but relevant.

PubMed

Reinisch, Alexander; Malkomes, Patrizia; Habbe, Nils; Bechstein, Wolf Otto; Liese, Juliane

2017-09-01

Bacterial infections are a factor for morbidity in patients with acute appendicitis (AA). The spreading of multidrug-resistant (MDR) bacteria is a significant problem in surgery, and the most relevant MDR pathogens are summarized as Enterobacteriaceae, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterococci (ESKAPE) bacteria. Data regarding the species and distribution of bacteria in AA are available, but information about the resistances and their relevance is deficient. In this retrospective study, we analyzed microbiological swabs of patients with AA. The outcome parameters of patients after laparoscopic appendectomy were analyzed against microbiological results, including antibiotic resistance testing. Positive swabs were compared with bacteria cultivated after alternative abdominal emergency surgery (AES). In total, 584 patients with AA were included and had a mean age of 35.5 years. In 216 patients (36.9%), a swab was taken, and in 128 (59.3%) swabs, bacteria could be cultivated. The most frequent organisms were Escherichia coli, Bacteroides species, and Pseudomonas. In 9.4% of the positive AA swabs, MDR germs were cultivated, and all of them were ESKAPE pathogens. Patients with MDR bacteria in AA suffered more infectious complications (p = 0.006) and needed longer hospitalizations (p < 0.009). In AES, aside from appendicitis, a different spectrum containing more MDR bacteria was cultivated (5.9 vs. 20.9%; p < 0.0001). Although they occur less frequently in appendectomy compared to emergency surgeries for other abdominal diseases, MDR bacteria are traceable in this common disease and contribute to additional morbidity.

Fate and transport of bacteria injected into aquifers

USGS Publications Warehouse

Harvey, Ronald W.

1993-01-01

Advances in our understanding of the fate and transport of bacteria introduced into aquifers, including the potential use of genetically engineered bacteria for biorestoration, are highlighted by new findings in the following areas: modeling of bacterial attachment during transport through porous media, the long-term survival of a chlorobenzoate-degrading bacterium injected into a contaminated sandy aquifer, and molecular techniques that may be used in tracking genetically engineered bacteria in groundwater environments.

Evaluation of a High Intensity Focused Ultrasound-Immobilized Trypsin Digestion and 18O-Labeling Method for Quantitative Proteomics

PubMed Central

López-Ferrer, Daniel; Hixson, Kim K.; Smallwood, Heather; Squier, Thomas C.; Petritis, Konstantinos; Smith, Richard D.

2009-01-01

A new method that uses immobilized trypsin concomitant with ultrasonic irradiation results in ultra-rapid digestion and thorough 18O labeling for quantitative protein comparisons. The reproducible and highly efficient method provided effective digestions in <1 min with a minimized amount of enzyme required compared to traditional methods. This method was demonstrated for digestion of both simple and complex protein mixtures, including bovine serum albumin, a global proteome extract from the bacteria Shewanella oneidensis, and mouse plasma, as well as 18O labeling of such complex protein mixtures, which validated the application of this method for differential proteomic measurements. This approach is simple, reproducible, cost effective, rapid, and thus well-suited for automation. PMID:19555078

Extracellular deoxyribonuclease production by periodontal bacteria.

PubMed

Palmer, L J; Chapple, I L C; Wright, H J; Roberts, A; Cooper, P R

2012-08-01

Whilst certain bacteria have long been known to secrete extracellular deoxyribonuclease (DNase), the purpose in microbial physiology was unclear. Recently, however, this enzyme has been demonstrated to confer enhanced virulence, enabling bacteria to evade the host's immune defence of extruded DNA/chromatin filaments, termed neutrophil extracellular traps (NETs). As NETs have recently been identified in infected periodontal tissue, the aim of this study was to screen periodontal bacteria for extracellular DNase activity. To determine whether DNase activity was membrane bound or secreted, 34 periodontal bacteria were cultured in broth and on agar plates. Pelleted bacteria and supernatants from broth cultures were analysed for their ability to degrade DNA, with relative activity levels determined using an agarose gel electrophoresis assay. Following culture on DNA-supplemented agar, expression was determined by the presence of a zone of hydrolysis and DNase activity related to colony size. Twenty-seven bacteria, including red and orange complex members Porphyromonas gingivalis, Tannerella forsythia, Fusobacterium nucleatum, Parvimonas micra, Prevotella intermedia, Streptococcus constellatus, Campylobacter rectus and Prevotella nigrescens, were observed to express extracellular DNase activity. Differences in DNase activity were noted, however, when bacteria were assayed in different culture states. Analysis of the activity of secreted DNase from bacterial broth cultures confirmed their ability to degrade NETs. The present study demonstrates, for the first time, that DNase activity is a relatively common property of bacteria associated with advanced periodontal disease. Further work is required to determine the importance of this bacterial DNase activity in the pathogenesis of periodontitis. © 2011 John Wiley & Sons A/S.

Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

Bacteria in atmospheric waters: Detection, characteristics and implications

NASA Astrophysics Data System (ADS)

Hu, Wei; Niu, Hongya; Murata, Kotaro; Wu, Zhijun; Hu, Min; Kojima, Tomoko; Zhang, Daizhou

2018-04-01

In this review paper, we synthesize the current knowledges about bacteria in atmospheric waters, e.g., cloud, fog, rain, and snow, most of which were obtained very recently. First, we briefly describe the importance of bacteria in atmospheric waters, i.e., the essentiality of studying bacteria in atmospheric waters in understanding aerosol-cloud-precipitation-climate interactions in the Earth system. Next, approaches to collect atmospheric water samples for the detection of bacteria and methods to identify the bacteria are summarized and compared. Then the available data on the abundance, viability and community composition of bacteria in atmospheric waters are summarized. The average bacterial concentration in cloud water was usually on the order 104-105 cells mL-1, while that in precipitation on the order 103-104 cells mL-1. Most of the bacteria were viable or metabolically active. Their community composition was highly diverse and differed at various sites. Factors potentially influencing the bacteria, e.g., air pollution levels and sources, meteorological conditions, seasonal effect, and physicochemical properties of atmospheric waters, are described. After that, the implications of bacteria present in atmospheric waters, including their effect on nucleation in clouds, atmospheric chemistry, ecosystems and public health, are briefly discussed. Finally, based on the current knowledges on bacteria in atmospheric waters, which in fact remains largely unknown, we give perspectives that should be paid attention to in future studies.

Chemotactic selection of pollutant degrading soil bacteria

DOEpatents

Hazen, T.C.

1991-03-04

A method is described for identifying soil microbial strains which may be bacterial degraders of pollutants. This method includes: Placing a concentration of a pollutant in a substantially closed container; placing the container in a sample of soil for a period of time ranging from one minute to several hours; retrieving the container and collecting its contents; microscopically determining the identity of the bacteria present. Different concentrations of the pollutant can be used to determine which bacteria respond to each concentration. The method can be used for characterizing a polluted site or for looking for naturally occurring biological degraders of the pollutant. Then bacteria identified as degraders of the pollutant and as chemotactically attracted to the pollutant are used to innoculate contaminated soil. To enhance the effect of the bacteria on the pollutant, nutrients are cyclicly provided to the bacteria then withheld to alternately build up the size of the bacterial colony or community and then allow it to degrade the pollutant.

Freeze-drying of lactic acid bacteria.

PubMed

Fonseca, Fernanda; Cenard, Stéphanie; Passot, Stéphanie

2015-01-01

Lactic acid bacteria are of great importance for the food and biotechnology industry. They are widely used as starters for manufacturing food (e.g., yogurt, cheese, fermented meats, and vegetables) and probiotic products, as well as for green chemistry applications. Freeze-drying or lyophilization is a convenient method for preservation of bacteria. By reducing water activity to values below 0.2, it allows long-term storage and low-cost distribution at suprazero temperatures, while minimizing losses in viability and functionality. Stabilization of bacteria via freeze-drying starts with the addition of a protectant solution to the bacterial suspension. Freeze-drying includes three steps, namely, (1) freezing of the concentrated and protected cell suspension, (2) primary drying to remove ice by sublimation, and (3) secondary drying to remove unfrozen water by desorption. In this chapter we describe a method for freeze-drying of lactic acid bacteria at a pilot scale, thus allowing control of the process parameters for maximal survival and functionality recovery.

Production of Value-added Products by Lactic Acid Bacteria

USDA-ARS?s Scientific Manuscript database

Lactic acid bacteria (LAB) are a group of facultative anaerobic, catalase negative, nonmotile and nonsporeforming–Gram positive bacteria. Most LAB utilize high energy C sources including monomer sugars to produce energy to maintain cellular structure and function. This anaerobic fermentation proce...

Disruption of Putrescine Biosynthesis in Shewanella oneidensis Enhances Biofilm Cohesiveness and Performance in Cr(VI) Immobilization

PubMed Central

Ding, Yuanzhao; Peng, Ni; Du, Yonghua; Ji, Lianghui

2014-01-01

Although biofilm-based bioprocesses have been increasingly used in various applications, the long-term robust and efficient biofilm performance remains one of the main bottlenecks. In this study, we demonstrated that biofilm cohesiveness and performance of Shewanella oneidensis can be enhanced through disrupting putrescine biosynthesis. Through random transposon mutagenesis library screening, one hyperadherent mutant strain, CP2-1-S1, exhibiting an enhanced capability in biofilm formation, was obtained. Comparative analysis of the performance of biofilms formed by S. oneidensis MR-1 wild type (WT) and CP2-1-S1 in removing dichromate (Cr2O72−), i.e., Cr(VI), from the aqueous phase showed that, compared with the WT biofilms, CP2-1-S1 biofilms displayed a substantially lower rate of cell detachment upon exposure to Cr(VI), suggesting a higher cohesiveness of the mutant biofilms. In addition, the amount of Cr(III) immobilized by CP2-1-S1 biofilms was much larger, indicating an enhanced performance in Cr(VI) bioremediation. We further showed that speF, a putrescine biosynthesis gene, was disrupted in CP2-1-S1 and that the biofilm phenotypes could be restored by both genetic and chemical complementations. Our results also demonstrated an important role of putrescine in mediating matrix disassembly in S. oneidensis biofilms. PMID:24362428

Influence of sulfhydryl sites on metal binding by bacteria

NASA Astrophysics Data System (ADS)

Nell, Ryan M.; Fein, Jeremy B.

2017-02-01

The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low

Comparative analysis of microbial fuel cell based biosensors developed with a mixed culture and Shewanella loihica PV-4 and underlying biological mechanism.

PubMed

Yi, Yue; Xie, Beizhen; Zhao, Ting; Liu, Hong

2018-06-13

Microbial fuel cell based biosensors (MFC-biosensors) utilize anode biofilms as biological recognition elements to monitor biochemical oxygen demand (BOD) and biotoxicity. However, the relatively poor sensitivity constrains the application of MFC-biosensors. To address this limitation, this study provided a systematic comparison of sensitivity between the MFC-biosensors constructed with two inocula. Higher biomass density and viability were both observed in the anode biofilm of the mixed culture MFC, which resulted in better sensitivity for BOD assessment. Compared with using mixed culture as inoculum, the anode biofilm developed with Shewanella loihica PV-4 presented lower content of extracellular polymeric substances and poorer ability to secrete protein under toxic shocks. Moreover, the looser structure in the S. loihica PV-4 biofilm further facilitated its susceptibilities to toxic agents. Therefore, the MFC-biosensor with a pure culture of S. loihica PV-4 delivered higher sensitivity for biotoxicity monitoring. This study proposed a new perspective to enhance sensor performance. Copyright © 2018 Elsevier Ltd. All rights reserved.

Enhanced biofilm formation and melanin synthesis by the oyster settlement-promoting Shewanella colwelliana is related to hydrophobic surface and simulated intertidal environment.

PubMed

Mitra, Sayani; Gachhui, Ratan; Mukherjee, Joydeep

2015-01-01

A direct relationship between biofilm formation and melanogenesis in Shewanella colwelliana with increased oyster recruitment is already established. Previously, S. colwelliana was grown in a newly patented biofilm-cultivation device, the conico-cylindrical flask (CCF), offering interchangeable hydrophobic/hydrophilic surfaces. Melanization was enhanced when S. colwelliana was cultivated in a hydrophobic vessel compared with a hydrophilic vessel. In the present study, melanogenesis in the CCF was positively correlated with increased architectural parameters of the biofilm (mean thickness and biovolume obtained by confocal laser scanning microscopy) and melanin gene (melA) expression observed by densitometry. Niche intertidal conditions were mimicked in a process operated in an ultra-low-speed rotating disk bioreactor, which demonstrated enhanced biofilm formation, melanogenesis, exopolysaccharide synthesis and melA gene expression compared with a process where 12-h periodic immersion and emersion was prevented. The wettability properties of the settling plane as well as intermittent wetting and drying, which influenced biofilm formation and melA expression, may affect oyster settlement in nature.

Microbial community analysis in rice paddy soils irrigated by acid mine drainage contaminated water.

PubMed

Sun, Min; Xiao, Tangfu; Ning, Zengping; Xiao, Enzong; Sun, Weimin

2015-03-01

Five rice paddy soils located in southwest China were selected for geochemical and microbial community analysis. These rice fields were irrigated with river water which was contaminated by Fe-S-rich acid mine drainage. Microbial communities were characterized by high-throughput sequencing, which showed 39 different phyla/groups in these samples. Among these phyla/groups, Proteobacteria was the most abundant phylum in all samples. Chloroflexi, Acidobacteria, Nitrospirae, and Bacteroidetes exhibited higher relative abundances than other phyla. A number of rare and candidate phyla were also detected. Moreover, canonical correspondence analysis suggested that pH, sulfate, and nitrate were significant factors that shaped the microbial community structure. In addition, a wide diversity of Fe- and S-related bacteria, such as GOUTA19, Shewanella, Geobacter, Desulfobacca, Thiobacillus, Desulfobacterium, and Anaeromyxobacter, might be responsible for biogeochemical Fe and S cycles in the tested rice paddy soils. Among the dominant genera, GOUTA19 and Shewanella were seldom detected in rice paddy soils.

A Trojan-Horse Strategy Including a Bacterial Suicide Action for the Efficient Use of a Specific Gram-Positive Antibiotic on Gram-Negative Bacteria.

PubMed

Schalk, Isabelle J

2018-05-10

In the alarming context of rising bacterial antibiotic resistance, there is an urgent need to discover new antibiotics or increase and/or enlarge the activity of those currently in use. The need for new antibiotics is even more urgent in the case of Gram-negative bacteria, such as Acinetobacter, Pseudomonas, and Enterobacteria, which have become resistant to many antibiotics and have an outer membrane with very low permeability to drugs. Vectorization of antibiotics using siderophores may be a solution to bypass such a bacterial wall: the drugs use the iron transporters of the outer membrane as gates to enter bacteria in a Trojan-horse strategy. Designing siderophore-antibiotics that can cross outer membranes has become almost routine, but their transport across the inner membrane is still a limiting step, as well as a strategy that allows dissociation of the antibiotic from the siderophore once inside the bacteria. Liu et al. ( J. Med. Chem. 2018 , DOI: 10.1021/acs.jmedchem.8b00218 ) report the synthesis of a siderophore-cephalosporin compound and demonstrate that β-lactams, such as cephalosporins, can serve as β-lactamase-triggered releasable linkers to allow intracellular delivery of Gram-positive antibiotics to Gram-negative bacteria.

Apparatus for Cold, Pressurized Biogeochemical Experiments

NASA Technical Reports Server (NTRS)

Amashukeli, Xenia; Pappalardo, Robert T.; Connon, Stephanie A.; Gleeson, Damhnait F.

2010-01-01

A laboratory apparatus has been devised as a means of studying plausible biogeochemical reactions under high-pressure, low-temperature aqueous, anaerobic conditions like those conjectured to prevail in a liquid water ocean on Europa (the fourth largest moon of the planet Jupiter). The experiments to be performed by use of this apparatus are intended to enhance understanding of how life (if any) could originate and evolve in the Europa ocean environment. Inasmuch as terrestrial barophilic, psychrophilic organisms that thrive under anaerobic conditions are used in the experiments, the experiments may also contribute to terrestrial biogeochemistry. The apparatus (see figure) includes a bolt-closure reaction vessel secured inside a refrigerator that maintains a temperature of 4 C. Pressurized water is supplied to the interior of the vessel by a hydrostatic pump, which is attached to the vessel via high-pressure fittings. The terrestrial organisms used in the experiments thus far have been several facultative barophilic, psychrophilic stains of Shewanella bacteria. In the experiments, these organisms have been tested for reduction of ferric ion by growing them in the presence of a ferric food source under optimized terrestrial conditions. The short-term goal of these experiments has been to select Shewanella strains that exhibit iron-reduction capability and test their ability to facilitate biogeochemical reduction of iron under temperature and pressure conditions imitating those in Europa s ocean. It is anticipated, that, once growth under Europa-like conditions has been achieved, the selected Shewanella strains will be used to facilitate biogeochemical reactions of sulfate and carbonate with hydrogen gas. Any disequilibrium of the products with the environment would be interpreted as signifying biogenic activity and the possibility of life in Europa s ocean.

Molecular analysis of microbiota along the digestive tract of juvenile Atlantic salmon (Salmo salar L.).

PubMed

Navarrete, P; Espejo, R T; Romero, J

2009-04-01

Dominant bacterial microbiota of the gut of juvenile farmed Atlantic salmon was investigated using a combination of molecular approaches. Bacterial community composition from the stomach, the pyloric caeca, and the intestine was assessed by extracting DNA directly from each gut compartment. Temporal temperature gradient gel electrophoresis (TTGE) analysis of 16S ribosomal DNA (rDNA) amplicons showed very similar bacterial compositions throughout the digestive tract. Band sequencing revealed a narrow diversity of species with a dominance of Pseudomonas in the three compartments. However, cloning revealed more diversity among the Pseudomonas sequences. To confirm these results, we analyzed the bacterial community by amplifying the variable 16S-23S rDNA intergenic spacer region (ITS). Similar ITS profiles were observed among gastrointestinal compartments of salmon, confirming the TTGE results. Moreover, the dominant ITS band at 650 bp, identified as Pseudomonas, was observed in the ITS profile from fish collected in two seasons (July 2003 and 2004). In contrast, aerobic culture analysis revealed Shewanella spp. as the most prevalent isolate. This discrepancy was resolved by evaluating 16S rDNA and ITS polymerase chain reaction amplification efficiency from both Shewanella and Pseudomonas isolates. Very similar efficiencies were observed in the two bacteria. Hence, this discrepancy may be explained by preferential cultivation of Shewanella spp. under the experimental conditions. Also, we included analyses of pelleted feed and the water influent to explore environmental influences on the bacterial composition of the gut microbiota. Overall, these results indicate a homogeneous composition of the bacterial community composition along the gastrointestinal tract of reared juvenile salmon. This community is mainly composed of Pseudomonas spp., which could be derived from water influent and may be selectively associated with salmon in this hatchery.

Microfluidic Transducer for Detecting Nanomechanical Movements of Bacteria

NASA Astrophysics Data System (ADS)

Kara, Vural; Ekinci, Kamil

2017-11-01

Various nanomechanical movements of bacteria are currently being explored as an indication of bacterial viability. Most notably, these movements have been observed to subside rapidly and dramatically when the bacteria are exposed to an effective antibiotic. This suggests that monitoring bacterial movements, if performed with high fidelity, can offer a path to various clinical microbiological applications, including antibiotic susceptibility tests. Here, we introduce a robust and sensitive microfluidic transduction technique for detecting the nanomechanical movements of bacteria. The technique is based on measuring the electrical fluctuations in a microchannel which the bacteria populate. These electrical fluctuations are caused by the swimming of motile, planktonic bacteria and random oscillations of surface-immobilized bacteria. The technique provides enough sensitivity to detect even the slightest movements of a single cell and lends itself to smooth integration with other microfluidic methods and devices; it may eventually be used for rapid antibiotic susceptibility testing. We acknowledge support from Boston University Office of Technology Development, Boston University College of Engineering, NIH (1R03AI126168-01) and The Wallace H. Coulter Foundation.

The spread of carbapenemase-producing bacteria in Africa: a systematic review

PubMed Central

Manenzhe, Rendani I.; Zar, Heather J.; Nicol, Mark P.; Kaba, Mamadou

2015-01-01

Background Carbapenems are the last line of defence against ever more prevalent MDR Gram-negative bacteria, but their efficacy is threatened worldwide by bacteria that produce carbapenemase enzymes. The epidemiology of bacteria producing carbapenemases has been described in considerable detail in Europe, North America and Asia; however, little is known about their spread and clinical relevance in Africa. Methods We systematically searched in PubMed, EBSCOhost, Web of Science, Scopus, Elsevier Masson Consulte and African Journals Online, international conference proceedings, published theses and dissertations for studies reporting on carbapenemase-producing bacteria in Africa. We included articles published in English or French up to 28 February 2014. We calculated the prevalence of carbapenemase producers only including studies where the total number of isolates tested was at least 30. Results Eighty-three studies were included and analysed. Most studies were conducted in North Africa (74%, 61/83), followed by Southern Africa (12%, 10/83), especially South Africa (90%, 9/10), West Africa (8%, 7/83) and East Africa (6%, 6/83). Carbapenemase-producing bacteria were isolated from humans, the hospital environment and community environmental water samples, but not from animals. The prevalence of carbapenemase-producing isolates in hospital settings ranged from 2.3% to 67.7% in North Africa and from 9% to 60% in sub-Saharan Africa. Conclusions Carbapenemase-producing bacteria have been described in many African countries; however, their prevalence is poorly defined and has not been systematically studied. Antibiotic stewardship and surveillance systems, including molecular detection and genotyping of resistant isolates, should be implemented to monitor and reduce the spread of carbapenemase-producing bacteria. PMID:25261423

Resistance to Antibiotics, Biocides, Preservatives and Metals in Bacteria Isolated from Seafoods: Co-Selection of Strains Resistant or Tolerant to Different Classes of Compounds

PubMed Central

Romero, José L.; Grande Burgos, María J.; Pérez-Pulido, Rubén; Gálvez, Antonio; Lucas, Rosario

2017-01-01

Multi-drug resistant bacteria (particularly those producing extended-spectrum β-lactamases) have become a major health concern. The continued exposure to antibiotics, biocides, chemical preservatives, and metals in different settings such as the food chain or in the environment may result in development of multiple resistance or co-resistance. The aim of the present study was to determine multiple resistances (biocides, antibiotics, chemical preservatives, phenolic compounds, and metals) in bacterial isolates from seafoods. A 75.86% of the 87 isolates studied were resistant to at least one antibiotic or one biocide, and 6.90% were multiply resistant to at least three biocides and at least three antibiotics. Significant (P < 0.05) moderate or strong positive correlations were detected between tolerances to biocides, between antibiotics, and between antibiotics with biocides and other antimicrobials. A sub-set of 30 isolates selected according to antimicrobial resistance profile and food type were identified by 16S rDNA sequencing and tested for copper and zinc tolerance. Then, the genetic determinants for biocide and metal tolerance and antibiotic resistance were investigated. The selected isolates were identified as Pseudomonas (63.33%), Acinetobacter (13.33%), Aeromonas (13.33%), Shewanella, Proteus and Listeria (one isolate each). Antibiotic resistance determinants detected included sul1 (43.33% of tested isolates), sul2 (6.66%), blaTEM (16.66%), blaCTX−M (16.66%), blaPSE (10.00%), blaIMP (3.33%), blaNDM−1 (3.33%), floR (16.66%), aadA1 (20.0%), and aac(6′)-Ib (16.66%). The only biocide resistance determinant detected among the selected isolates was qacEΔ1 (10.00%). A 23.30 of the selected isolates were able to grow on media containing 32 mM copper sulfate, and 46.60% on 8 mM zinc chloride. The metal resistance genes pcoA/copA, pcoR, and chrB were detected in 36.66, 6.66, and 13.33% of selected isolates, respectively. Twelve isolates tested positive for

Fate and distribution of brevetoxin (PbTx) following lysis of Karenia brevis by algicidal bacteria, including analysis of open A-ring derivatives.

PubMed

Roth, Patricia B; Twiner, Michael J; Wang, Zhihong; Bottein Dechraoui, Marie-Yasmine; Doucette, Gregory J

2007-12-15

Flavobacteriaceae (strain S03) and Cytophaga sp. (strain 41-DBG2) are algicidal bacteria active against the brevetoxin (PbTx)-producing, red tide dinoflagellate, Karenia brevis. Little is known about the fate of PbTx associated with K. brevis cells following attack by such bacteria. The fate and distribution of PbTx in K. brevis cultures exposed to these algicidal strains were thus examined by receptor binding assay and liquid chromatography/mass spectrometry (LC/MS) in three size fractions (>5, 0.22-5, <0.22microm) over a 2-week time course. In control cultures, brevetoxin concentrations in the >5microm particulate size fraction correlated with changes in cell density, whereas significant increases in dissolved (i.e., <0.22microm) toxin were observed in the later stages of culture growth. Exposure of K. brevis to either of the two algicidal bacteria tested caused cell lysis, coinciding with a rapid decline in the >5microm PbTX size fraction and a simultaneous release of dissolved toxin into the growth medium. Upon cell lysis, dissolved brevetoxin accounted for ca. 60% of total toxin and consisted of 51-82% open A-ring derivatives. Open A-ring PbTx-2 and PbTx-3 derivatives bound with lower affinity (approximately 22- and 57-fold, respectively) to voltage-gated sodium channels and were considerably less cytotoxic (86- and 142-fold, respectively) to N2A cells than their individual parent toxins (i.e., PbTx-2 and PbTx-3). These novel findings of changes in PbTx size-fractioned distribution and overall reduction in K. brevis toxicity following attack by algicidal bacteria improve our understanding of potential trophic transfer routes and the fate of PbTx during red tide events. Moreover, this information will be important to consider when evaluating the potential role of algicidal bacteria in harmful algal bloom (HAB) management strategies involving control of bloom populations.

Direct electrochemistry of Shewanella loihica PV-4 on gold nanoparticles-modified boron-doped diamond electrodes fabricated by layer-by-layer technique.

PubMed

Wu, Wenguo; Xie, Ronggang; Bai, Linling; Tang, Zuming; Gu, Zhongze

2012-05-01

Microbial Fuel Cells (MFCs) are robust devices capable of taping biological energy, converting pollutants into electricity through renewable biomass. The fabrication of nanostructured electrodes with good bio- and electrochemical activity, play a profound role in promoting power generation of MFCs. Au nanoparticles (AuNPs)-modified Boron-Doped Diamond (BDD) electrodes are fabricated by layer-by-layer (LBL) self-assembly technique and used for the direct electrochemistry of Shewanella loihica PV-4 in an electrochemical cell. Experimental results show that the peak current densities generated on the Au/PAH multilayer-modified BDD electrodes increased from 1.25 to 2.93 microA/cm(-2) as the layer increased from 0 to 6. Different cell morphologies of S. loihica PV-4 were also observed on the electrodes and the highest density of cells was attached on the (Au/PAH)6/BDD electrode with well-formed three-dimensional nanostructure. The electrochemistry of S. loihica PV-4 was enhanced on the (Au/PAH)4/BDD electrode due to the appropriate amount of AuNPsand thickness of PAH layer.

Protist-Bacteria Associations: Gammaproteobacteria and Alphaproteobacteria Are Prevalent as Digestion-Resistant Bacteria in Ciliated Protozoa

PubMed Central

Gong, Jun; Qing, Yao; Zou, Songbao; Fu, Rao; Su, Lei; Zhang, Xiaoli; Zhang, Qianqian

2016-01-01

Protistan bacterivory, a microbial process involving ingestion and digestion, is ecologically important in the microbial loop in aquatic and terrestrial ecosystems. While bacterial resistance to protistan ingestion has been relatively well understood, little is known about protistan digestion in which some ingested bacteria could not be digested in cells of major protistan grazers in the natural environment. Here we report the phylogenetic identities of digestion-resistant bacteria (DRB) that could survive starvation and form relatively stable associations with 11 marine and one freshwater ciliate species. Using clone library and sequencing of 16S rRNA genes, we found that the protistan predators could host a high diversity of DRB, most of which represented novel bacterial taxa that have not been cultivated. The localization inside host cells, quantity, and viability of these bacteria were checked using fluorescence in situ hybridization. The DRB were affiliated with Actinobacteria, Bacteroidetes, Firmicutes, Parcubacteria (OD1), Planctomycetes, and Proteobacteria, with Gammaproteobacteria and Alphaproteobacteria being the most frequently occurring classes. The dominance of Gamma- and Alphaproteobacteria corresponds well to a previous study of Global Ocean Sampling metagenomic data showing the widespread types of bacterial type VI and IV secretion systems (T6SS and T4SS) in these two taxa, suggesting a putatively significant role of secretion systems in promoting marine protist-bacteria associations. In the DRB assemblages, opportunistic bacteria such as Alteromonadaceae, Pseudoalteromonadaceae, and Vibrionaceae often presented with high proportions, indicating these bacteria could evade protistan grazing thus persist and accumulate in the community, which, however, contrasts with their well-known rarity in nature. This begs the question whether viral lysis is significant in killing these indigestible bacteria in microbial communities. Taken together, our study on

Genotypic characterization of bacteria cultured from duck faeces.

PubMed

Murphy, J; Devane, M L; Robson, B; Gilpin, B J

2005-01-01

To characterize the bacterial composition of mallard duck faeces and determine if novel bacterial species are present that could be utilized as potential indicators of avian faecal contamination. Combined samples of fresh faeces from four ducks were serially diluted and plated onto six different media selected to allow the growth of a range of organisms at 42 degrees C under three atmospheric conditions: aerobic, microaerophilic and anaerobic. Forty-seven morphologically dissimilar isolates were purified and partial sequencing of the16S rRNA indicated at least 31 bacterial species. Twenty of these could be identified to the species level including pathogenic species of Bacillus, Campylobacter, Clostridium and Streptococcus. Other species identified included: Enterococcus, Escherichia, Megamonas, Cellulosimicrobium, Neisseria, Staphylococcus and Veillonella. Potentially novel species, which could represent bacteria specific to avian fauna included Bacillus, Corynebacterium, Macrococcus and Peptostreptococcus, while four isolates had <97% similarity to known bacterial species in the available databases. A survey of the natural microflora of the mallard duck and its hybrid with the grey duck identified both bacteria that are potentially human pathogenic and putative novel bacteria species as determined by 16S rRNA sequencing. This study provides further evidence that duck faeces is a potential human health hazard, and has identified bacteria potentially useful for distinguishing duck faeces from other faecal sources.

Purification and Characterization of [NiFe]-Hydrogenase of Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Liang; Belchik, Sara M.; Plymale, Andrew E.

2011-08-02

The γ-proteobacterium Shewanella oneidensis MR-1 possesses a periplasmic [NiFe]-hydrogenase (MR-1 [NiFe]-H2ase) that was implicated in both H2 production and oxidation as well as technetium [Tc(VII)] reduction. To characterize the roles of MR-1 [NiFe]-H2ase in these proposed reactions, the genes encoding both subunits of MR-1 [NiFe]-H2ase were cloned into a protein expression vector. The resulting plasmid was transformed into a MR-1 mutant deficient in H2 formation. Expression of MR-1 [NiFe]-H2ase in trans restored the mutant’s ability to produce H2 at 37% of that for wild type. Following expression, MR-1 [NiFe]-H2ase was purified to near homogeneity. The purified MR-1 [NiFe]-H2ase could couplemore » H2 oxidation to reduction of Tc(VII) and methyl viologen directly. Change of the buffers used affected MR-1 [NiFe]-H2ase-mediated Tc(VII) but not methyl viologen reductions. Under the conditions tested, Tc(VII) reduction was complete in Tris buffer but not in HEPES buffer. The reduced Tc(IV) was soluble in Tris buffer but insoluble in HEPES buffer. Transmission electron microscopy analysis revealed that Tc(IV) precipitates formed in HEPES buffer were packed with crystallites. Although X-ray absorption near-edge spectroscopy measurements confirmed that the reduction products found in both buffers were Tc(IV), extended X-ray adsorption fine-structure measurements revealed that these products were very different. While the product in Tris buffer could not be determined, the Tc(IV) product in HEPES buffer was very similar to Tc(IV)O2•nH2O. These results shows for the first time that MR-1 [NiFe]-H2ase is a bidirectional enzyme that catalyzes both H2 formation and oxidation as well as Tc(VII) reduction directly by coupling H2 oxidation.« less

Transition Metals and Virulence in Bacteria.

PubMed

Palmer, Lauren D; Skaar, Eric P

2016-11-23

Transition metals are required trace elements for all forms of life. Due to their unique inorganic and redox properties, transition metals serve as cofactors for enzymes and other proteins. In bacterial pathogenesis, the vertebrate host represents a rich source of nutrient metals, and bacteria have evolved diverse metal acquisition strategies. Host metal homeostasis changes dramatically in response to bacterial infections, including production of metal sequestering proteins and the bombardment of bacteria with toxic levels of metals. In response, bacteria have evolved systems to subvert metal sequestration and toxicity. The coevolution of hosts and their bacterial pathogens in the battle for metals has uncovered emerging paradigms in social microbiology, rapid evolution, host specificity, and metal homeostasis across domains. This review focuses on recent advances and open questions in our understanding of the complex role of transition metals at the host-pathogen interface.

Recovery of Elemental Palladium by Shewanella putrefaciens

NASA Astrophysics Data System (ADS)

Akasaka, S.; Xia, X.; Sawada, K.; Enokida, Y.; Yamamoto, I.; Ohnuki, T.

2006-12-01

Microbial reduction of metals plays an important role in environmental behavior and provides a technique for the recovery of metals from industrial wastewater. Recently, demand for platinum group metals (PGMs) increases by their catalytic properties. The extreme rarity of PGMs have led to a growing interest in their recovery. Palladium, one of PGMs, has different oxidation states of Pd(II) and Pd(0). The oxidized form of Pd(II) is soluble, while the reduced form of Pd(0) is insoluble. In this study, microbial reduction of palladium by Fe(III)- reducing bacterium, Shewanella putrefaceins was conducted. This bacterium is known to be capable of reducing metals, such as Mn(IV), U(VI), or Tc(VII) with organic C or H2 as an electron donor. In order to investigate the potential of S. putrefaciens to reduce Pd(II) in solution, resting cells or heat-killed cells were suspended under anaerobic conditions with lactate or H2 as an electron donor. The cells of S. putrefaciens (NBRC3908) were grown in aerobic medium, harvested by centrifugation, and then washed with 25 mmol/dm3 HEPES and 100 mmol/dm3 NaCl (HEPES-NaCl) solution (pH 7.0). The heat-killed cells were autoclaved for 20 min at 121 degrees C. The cell suspension (21.5 mg in dry weight) was resuspended in the HEPES-NaCl solution which contained 1.0 mmol/dm3 Na2PdCl4 (Wako Pure chemical Industries, Ltd). The suspensions were bubbled with N2 for 15 min before 10 mmol/dm3 lactate or 4.8 v/v% H2 was added. The suspensions were then incubated at 30 degrees C. Redox potential (Eh) and pH of the solutions were measured in an inert glove box with Ar gas. Concentration of Pd(II) was measured by Inductively Coupled Plasma Atomic Emission Spectrometer (ICP-AES). Deposited Pd and cells were analyzed by X-ray powder diffraction (XRD) and Scanning Electron Microscope (SEM) with Energy-Dispersive Spectroscopy (EDS). Approximately 86% of Pd(II) of the initial concentration was removed from solution by the resting cells within 24 h when

Microbiological spoilage of fish and fish products.

PubMed

Gram, L; Huss, H H

1996-11-01

Spoilage of fresh and lightly preserved fish products is caused by microbial action. This paper reviews the current knowledge in terms of the microbiology of fish and fish products with particular emphasis on identification of specific spoilage bacteria and the qualitative and quantitative biochemical indicators of spoilage. Shewanella putrefaciens and Pseudomonas spp. are the specific spoilage bacteria of iced fresh fish regardless of the origin of the fish. Modified atmosphere stored marine fish from temperate waters are spoiled by the CO2 resistant Photobacterium phosphoreum whereas Gram-positive bacteria are likely spoilers of CO2 packed fish from fresh or tropical waters. Fish products with high salt contents may spoil due to growth of halophilic bacteria (salted fish) or growth of anaerobic bacteria and yeasts (barrel salted fish). Whilst the spoilage of fresh and highly salted fish is well understood, much less is known about spoilage of lightly preserved fish products. It is concluded that the spoilage is probably caused by lactic acid bacteria, certain psychotrophic Enterobacteriaceae and/or Photobacterium phosphoreum. However, more work is needed in this area.

Quantification and Qualification of Bacteria Trapped in Chewed Gum

PubMed Central

Wessel, Stefan W.; van der Mei, Henny C.; Morando, David; Slomp, Anje M.; van de Belt-Gritter, Betsy; Maitra, Amarnath; Busscher, Henk J.

2015-01-01

Chewing of gum contributes to the maintenance of oral health. Many oral diseases, including caries and periodontal disease, are caused by bacteria. However, it is unknown whether chewing of gum can remove bacteria from the oral cavity. Here, we hypothesize that chewing of gum can trap bacteria and remove them from the oral cavity. To test this hypothesis, we developed two methods to quantify numbers of bacteria trapped in chewed gum. In the first method, known numbers of bacteria were finger-chewed into gum and chewed gums were molded to standard dimensions, sonicated and plated to determine numbers of colony-forming-units incorporated, yielding calibration curves of colony-forming-units retrieved versus finger-chewed in. In a second method, calibration curves were created by finger-chewing known numbers of bacteria into gum and subsequently dissolving the gum in a mixture of chloroform and tris-ethylenediaminetetraacetic-acid (TE)-buffer. The TE-buffer was analyzed using quantitative Polymerase-Chain-Reaction (qPCR), yielding calibration curves of total numbers of bacteria versus finger-chewed in. Next, five volunteers were requested to chew gum up to 10 min after which numbers of colony-forming-units and total numbers of bacteria trapped in chewed gum were determined using the above methods. The qPCR method, involving both dead and live bacteria yielded higher numbers of retrieved bacteria than plating, involving only viable bacteria. Numbers of trapped bacteria were maximal during initial chewing after which a slow decrease over time up to 10 min was observed. Around 108 bacteria were detected per gum piece depending on the method and gum considered. The number of species trapped in chewed gum increased with chewing time. Trapped bacteria were clearly visualized in chewed gum using scanning-electron-microscopy. Summarizing, using novel methods to quantify and qualify oral bacteria trapped in chewed gum, the hypothesis is confirmed that chewing of gum can trap

Quantification of spatial distribution and spread of bacteria in soil at microscale

NASA Astrophysics Data System (ADS)

Juyal, Archana; Eickhorst, Thilo; Falconer, Ruth; Baveye, Philippe; Otten, Wilfred

2015-04-01

Soil bacteria play an essential role in functioning of ecosystems and maintaining of biogeochemical cycles. Soil is a complex heterogeneous environment comprising of highly variable and dynamic micro-habitats that have significant impacts on the growth and activity of resident microbiota including bacteria and fungi. Bacteria occupy a very small portion of available pore space in soil which demonstrates that their spatial arrangement in soil has a huge impact on the contact to their target and on the way they interact to carry out their functions. Due to limitation of techniques, there is scant information on spatial distribution of indigenous or introduced bacteria at microhabitat scale. There is a need to understand the interaction between soil structure and microorganisms including fungi for ecosystem-level processes such as carbon sequestration and improving the predictive models for soil management. In this work, a combination of techniques was used including X-ray CT to characterize the soil structure and in-situ detection via fluorescence microscopy to visualize and quantify bacteria in soil thin sections. Pseudomonas fluorescens bacteria were introduced in sterilized soil of aggregate size 1-2 mm and packed at bulk-densities 1.3 g cm-3 and 1.5 g cm-3. A subset of samples was fixed with paraformaldehyde and subsequently impregnated with resin. DAPI and fluorescence in situ hybridization (FISH) were used to visualize bacteria in thin sections of soil cores by epifluorescence microscopy to enumerate spatial distribution of bacteria in soil. The pore geometry of soil was quantified after X-ray microtomography scanning. The distribution of bacteria introduced locally reduced significantly (P

The spread of carbapenemase-producing bacteria in Africa: a systematic review.

PubMed

Manenzhe, Rendani I; Zar, Heather J; Nicol, Mark P; Kaba, Mamadou

2015-01-01

Carbapenems are the last line of defence against ever more prevalent MDR Gram-negative bacteria, but their efficacy is threatened worldwide by bacteria that produce carbapenemase enzymes. The epidemiology of bacteria producing carbapenemases has been described in considerable detail in Europe, North America and Asia; however, little is known about their spread and clinical relevance in Africa. We systematically searched in PubMed, EBSCOhost, Web of Science, Scopus, Elsevier Masson Consulte and African Journals Online, international conference proceedings, published theses and dissertations for studies reporting on carbapenemase-producing bacteria in Africa. We included articles published in English or French up to 28 February 2014. We calculated the prevalence of carbapenemase producers only including studies where the total number of isolates tested was at least 30. Eighty-three studies were included and analysed. Most studies were conducted in North Africa (74%, 61/83), followed by Southern Africa (12%, 10/83), especially South Africa (90%, 9/10), West Africa (8%, 7/83) and East Africa (6%, 6/83). Carbapenemase-producing bacteria were isolated from humans, the hospital environment and community environmental water samples, but not from animals. The prevalence of carbapenemase-producing isolates in hospital settings ranged from 2.3% to 67.7% in North Africa and from 9% to 60% in sub-Saharan Africa. Carbapenemase-producing bacteria have been described in many African countries; however, their prevalence is poorly defined and has not been systematically studied. Antibiotic stewardship and surveillance systems, including molecular detection and genotyping of resistant isolates, should be implemented to monitor and reduce the spread of carbapenemase-producing bacteria. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Seed-vectored endophytic bacteria modulate development of rice seedlings.

PubMed

Verma, S K; Kingsley, K; Irizarry, I; Bergen, M; Kharwar, R N; White, J F

2017-06-01

The aim of the present study was to evaluate the effects of the removal of indigenous bacteria from rice seeds on seedling growth and development. Here we report the presence of three indigenous endophytic bacteria in rice seeds that play important roles in modulating seedling development (shoot and root lengths, and formation of root hairs and secondary roots) and defence against pathogens. Seed-associated bacteria were removed using surface sterilization with NaOCl (bleach) followed by antibiotic treatment. When bacteria were absent, growth of seedlings in terms of root hair development and overall seedling size was less than that of seedlings that contained bacteria. Reactive oxygen staining of seedlings showed that endophytic bacteria became intracellular in root parenchyma cells and root hairs. Roots containing endophytic bacteria were seen to stain densely for reactive oxygen, while roots free of bacteria stained lightly for reactive oxygen. Bacteria were isolated and identified as Enterobacter asburiae (VWB1), Pantoea dispersa (VWB2) and Pseudomonas putida (VWB3) by 16S rDNA sequencing. Bacteria were found to produce indole acetic acid (auxins), inhibited the pathogen Fusarium oxysporum and solubilized phosphate. Reinoculation of bacteria onto seedlings derived from surface-disinfected rice and Bermuda grass seeds significantly restored seedling growth and development. Rice seeds harbour indigenous bacterial endophytes that greatly influence seedling growth and development, including root and shoot lengths, root hair formation and disease susceptibility of rice seedlings. This study shows that seeds of rice naturally harbour bacterial endophytes that play key roles in modulation of seedling development. © 2017 The Society for Applied Microbiology.

Improving solubility of Shewanella oneidensis MR-1 and Clostridium thermocellum JW-20 proteins expressed into Esherichia coli.

PubMed

Kataeva, Irina; Chang, Jessie; Xu, Hao; Luan, Chi-Hao; Zhou, Jizhong; Uversky, Vladimir N; Lin, Dawei; Horanyi, Peter; Liu, Z J; Ljungdahl, Lars G; Rose, John; Luo, Ming; Wang, Bi-Cheng

2005-01-01

Low solubility of proteins overexpressed in E. coli is a frequent problem in high-throughput structural genomics. To improve solubility of proteins from mesophilic Shewanella oneidensis MR-1 and thermophilic Clostridium thermocellum JW20, an approach was attempted that included a fusion of the target protein to a maltose-binding protein (MBP) and a decrease of induction temperature. The MBP was selected as the most efficient solubilizing carrier when compared to a glutathione S-transferase and a Nus A protein. A tobacco etch virus (TEV) protease recognition site was introduced between fused proteins using a double polymerase-chain reaction and four primers. In this way, 79 S. oneidensis proteins have been expressed in one case with an N-terminal 30-residue tag and in another case as a fusion protein with MBP. A foreign tag might significantly affect the properties of the target polypeptide. At 37 degrees C and 18 degrees C induction temperatures, only 5 and 17 tagged proteins were soluble, respectively. In fusion with MBP 4, 34, and 38 proteins were soluble upon induction at 37 degrees, 28 degrees, and 18 degrees C, respectively. The MBP is assumed to increase stability and solubility of a target protein by changing both the mechanism and the cooperativity of folding/unfolding. The 66 C. thermocellum proteins were expressed as fusion proteins with MBP. Induction at 37 degrees, 28 degrees, and 18 degrees C produced 34, 57, and 60 soluble proteins, respectively. The higher solubility of C. thermocellum proteins in comparison with the S. oneidensis proteins under similar conditions of induction correlates with the thermophilicity of the host. The two-factor Wilkinson-Harrison statistical model was used to identify soluble and insoluble proteins. Theoretical and experimental data showed good agreement for S. oneidensis proteins; however, the model failed to identify soluble/insoluble Clostridium proteins. A suggestion has been made that the Wilkinson-Harrison model is

Effects of atmospheric air plasma treatment of graphite and carbon felt electrodes on the anodic current from Shewanella attached cells.

PubMed

Epifanio, Monica; Inguva, Saikumar; Kitching, Michael; Mosnier, Jean-Paul; Marsili, Enrico

2015-12-01

The attachment of electrochemically active microorganisms (EAM) on an electrode is determined by both the chemistry and topography of the electrode surface. Pre-treatment of the electrode surface by atmospheric air plasma introduces hydrophilic functional groups, thereby increasing cell attachment and electroactivity in short-term experiments. In this study, we use graphite and carbon felt electrodes to grow the model EAM Shewanella loihica PV-4 at oxidative potential (0.2 V vs. Ag/AgCl). Cell attachment and electroactivity are measured through electrodynamic methods. Atmospheric air plasma pre-treatment increases cell attachment and current output at graphite electrodes by 25%, while it improves the electroactivity of the carbon felt electrodes by 450%. Air plasma pre-treatment decreased the coulombic efficiency on both carbon felt and graphite electrodes by 60% and 80%, respectively. Microbially produced flavins adsorb preferentially at the graphite electrode, and air plasma pre-treatment results in lower flavin adsorption at both graphite and carbon felt electrodes. Results show that air plasma pre-treatment is a feasible option to increase current output in bioelectrochemical systems. Copyright © 2015 Elsevier B.V. All rights reserved.

Competitive interactions between sponge-associated bacteria.

PubMed

Esteves, Ana I S; Cullen, Alescia; Thomas, Torsten

2017-03-01

The diversity of the microbial communities associated with marine sponges has been extensively studied, but their functioning and interactions within the sponge holobiont are only recently being appreciated. Sponge-associated microorganisms are known for the production of a range of inhibitory metabolites with biotechnological application, but the ecological role that these compounds remains elusive. In this work, we explore the competitive interactions between cultivated sponge-associated bacteria to inspect whether bacteria that produce antimicrobial activities are able to inhibit potentially pathogenic bacteria. We isolated a Bacillus sp. bacterium with sponge-degrading activity, which likely has a negative impact on the host. This bacterium, along with other sponge isolates from the same genus, was found to be inhibited by a subpopulation of closely related sponge-derived Pseudovibrio spp. In some Pseudovibrio strains, these inhibitory activities were correlated with the genetic capacity to produce polyketides, such as erythronolide. Our observations suggest that antagonistic activities likely influence the composition of the sponge microbiome, including the abundance of bacteria that can be harmful to the host. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Transition Metals and Virulence in Bacteria

PubMed Central

Palmer, Lauren D.; Skaar, Eric P.

2016-01-01

Transition metals are required trace elements for all forms of life. Due to their unique inorganic and redox properties, transition metals serve as cofactors for enzymes and other proteins. In bacterial pathogenesis, the vertebrate host represents a rich source of nutrient metals, and bacteria have evolved diverse metal acquisition strategies. Host metal homeostasis changes dramatically in response to bacterial infections, including production of metal sequestering proteins and the bombardment of bacteria with toxic levels of metals. Presumably, in response, bacteria have evolved systems to subvert metal sequestration and toxicity. The coevolution of hosts and their bacterial pathogens in the battle for metals has uncovered emerging paradigms in social microbiology, rapid evolution, host specificity, and metal homeostasis across domains. This review focuses on recent advances and open questions in our understanding of the complex role of transition metals at the host-pathogen interface. PMID:27617971

Comprehensive list of names of plant pathogenic bacteria, 1980-2007.

USDA-ARS?s Scientific Manuscript database

This list contains the names of all plant pathogenic bacteria which have been effectively and validly published in terms of the International Code of Nomenclature of Bacteria and the Standards for Naming Pathovars and their revisions. Included are species names from the Approved Lists of Bacterial N...

Transgenic plants and associated bacteria for phytoremediation of chlorinated compounds.

PubMed

Van Aken, Benoit; Doty, Sharon Lafferty

2010-01-01

Phytoremediation is the use of plants for the treatment of environmental pollution, including chlorinated organics. Although conceptually very attractive, removal and biodegradation of chlorinated pollutants by plants is a rather slow and inefficient process resulting in incomplete treatment and potential release of toxic metabolites into the environment. In order to overcome inherent limitations of plant metabolic capabilities, plants have been genetically modified, following a strategy similar to the development of transgenic crops: genes from bacteria, fungi, and mammals involved in the metabolism of organic contaminants, such as cytochrome P-450 and glutathione S-transferase, have been introduced into higher plants, resulting in significant improvement of tolerance, removal, and degradation of pollutants. Recently, plant-associated bacteria have been recognized playing a significant role in phytoremediation, leading to the development of genetically modified rhizospheric and endophytic bacteria with improved biodegradation capabilities. Transgenic plants and associated bacteria constitute a new generation of genetically modified organisms for efficient and environmental-friendly treatment of polluted soil and water. This review focuses on recent advances in the development of transgenic plants and bacteria for the treatment of chlorinated pollutants, including chlorinated solvents, polychlorinated phenols, and chlorinated herbicides.

A study on the selection of indigenous leaching-bacteria for effective bioleaching

NASA Astrophysics Data System (ADS)

Oh, S. J.; Cho, K. H.; Kim, B. J.; Choi, N. C.; Park, C. Y.

2012-04-01

Bioleaching technology, which is based on the ability of microorganisms to transform solid compounds into soluble and extractable valuable elements that can be recovered, has been rapidly developed in recent decades for its advantages, which include mild reaction condition, low energy consumption, simple process, low environmental impact and being suitable for low grade mine tailings and residues. The bacteria activities (survival, adaptation of toxically environments etc.) in the bioleaching technology play a key role in the solubilization of metals. The purpose of this study was to selection of optimal leaching-bacteria through changed pH and redox potential on bio-oxidation in batch experiments for successful bioleaching technology. Twenty three indigenous bacteria used throughout this study, leaching-bacteria were obtained from various geochemical conditions; bacteria inhabitation type (acid mine drainage, mine wastes leachate and sulfur hot springs) and base-metal type (sulfur, sulfide, iron and coal). Bio-oxidation experiment result was showed that 9 cycles (1 cycle - 28days) after the leaching-bacteria were inoculated to a leaching medium, pH was observed decreasing and redox potential increased. In the bacteria inhabitation type, bio-oxidation of sulfur hot springs bacteria was greater than other types (acid mine drainage and mine wastes leachate). In addition, bio-oxidation on base-metal type was appeared sulfur was greater than other types (sulfide, iron and coal). This study informs basic knowledge when bacteria apply to eco-/economic resources utilization studies including the biomining and the recycling of mine waste system.

The life cycle of iron Fe(III) oxide: impact of fungi and bacteria

NASA Astrophysics Data System (ADS)

Bonneville, Steeve

2014-05-01

Iron oxides are ubiquitous reactive constituents of soils, sediments and aquifers. They exhibit vast surface areas which bind a large array of trace metals, nutrients and organic molecules hence controlling their mobility/reactivity in the subsurface. In this context, understanding the "life cycle" of iron oxide in soils is paramount to many biogeochemical processes. Soils environments are notorious for their extreme heterogeneity and variability of chemical, physical conditions and biological agents at play. Here, we present studies investigating the role of two biological agents driving iron oxide dynamics in soils, root-associated fungi (mycorrhiza) and bacteria. Mycorrhiza filaments (hypha) grow preferentially around, and on the surface of nutrient-rich minerals, making mineral-fungi contact zones, hot-spots of chemical alteration in soils. However, because of the microscopic nature of hyphae (only ~ 5 µm wide for up to 1 mm long) and their tendency to strongly adhere to mineral surface, in situ observations of this interfacial micro-environment are scarce. In a microcosm, ectomycorrhiza (Paxillus involutus) was grown symbiotically with a pine tree (Pinus sylvestris) in the presence of freshly-cleaved biotite under humid, yet undersaturated, conditions typical of soils. Using spatially-resolved ion milling technique (FIB), transmission electron microscopy and spectroscopy (TEM/STEM-EDS), synchrotron based X-ray microscopy (STXM), we were able to quantify the speciation of Fe at the biotite-hypha interface. The results shows that substantial oxidation of biotite structural-Fe(II) into Fe(III) subdomains occurs at the contact zone between mycorrhiza and biotite. Once formed, iron(III) oxides can reductively dissolve under suboxic conditions via several abiotic and microbial pathways. In particular, they serve as terminal electron acceptors for the oxidation of organic matter by iron reducing bacteria. We aimed here to understand the role of Fe(III) mineral

Biogeography of anaerobic ammonia-oxidizing (anammox) bacteria.

PubMed

Sonthiphand, Puntipar; Hall, Michael W; Neufeld, Josh D

2014-01-01

Anaerobic ammonia-oxidizing (anammox) bacteria are able to oxidize ammonia and reduce nitrite to produce N2 gas. After being discovered in a wastewater treatment plant (WWTP), anammox bacteria were subsequently characterized in natural environments, including marine, estuary, freshwater, and terrestrial habitats. Although anammox bacteria play an important role in removing fixed N from both engineered and natural ecosystems, broad scale anammox bacterial distributions have not yet been summarized. The objectives of this study were to explore global distributions and diversity of anammox bacteria and to identify factors that influence their biogeography. Over 6000 anammox 16S rRNA gene sequences from the public database were analyzed in this current study. Data ordinations indicated that salinity was an important factor governing anammox bacterial distributions, with distinct populations inhabiting natural and engineered ecosystems. Gene phylogenies and rarefaction analysis demonstrated that freshwater environments and the marine water column harbored the highest and the lowest diversity of anammox bacteria, respectively. Co-occurrence network analysis indicated that Ca. Scalindua strongly connected with other Ca. Scalindua taxa, whereas Ca. Brocadia co-occurred with taxa from both known and unknown anammox genera. Our survey provides a better understanding of ecological factors affecting anammox bacterial distributions and provides a comprehensive baseline for understanding the relationships among anammox communities in global environments.

Rapid separation of bacteria from blood — Chemical aspects

PubMed Central

Alizadeh, Mahsa; Wood, Ryan L.; Buchanan, Clara M.; Bledsoe, Colin G.; Wood, Madison E.; McClellan, Daniel S.; Blanco, Rae; Ravsten, Tanner V.; Husseini, Ghaleb A.; Hickey, Caroline L.; Robison, Richard A.; Pitt, William G.

2017-01-01

To rapidly diagnose infectious organisms causing blood sepsis, bacteria must be rapidly separated from blood, a very difficult process considering that concentrations of bacteria are many orders of magnitude lower than concentrations of blood cells. We have successfully separated bacteria from red and white blood cells using a sedimentation process in which the separation is driven by differences in density and size. Seven mL of whole human blood spiked with bacteria is placed in a 12-cm hollow disk and spun at 3000 rpm for 1 min. The red and white cells sediment more than 30-fold faster than bacteria, leaving much of the bacteria in the plasma. When the disk is slowly decelerated, the plasma flows to a collection site and the red and white cells are trapped in the disk. Analysis of the recovered plasma shows that about 36% of the bacteria is recovered in the plasma. The plasma is not perfectly clear of red blood cells, but about 94% have been removed. This paper describes the effects of various chemical aspects of this process, including the influence of anticoagulant chemistry on the separation efficiency and the use of wetting agents and platelet aggregators that may influence the bacterial recovery. In a clinical scenario, the recovered bacteria can be subsequently analyzed to determine their species and resistance to various antibiotics. PMID:28365426

Selection and Transmission of Antibiotic-Resistant Bacteria.

PubMed

Andersson, Dan I; Hughes, Diarmaid

2017-07-01

Ever since antibiotics were introduced into human and veterinary medicine to treat and prevent bacterial infections there has been a steady selection and increase in the frequency of antibiotic resistant bacteria. To be able to reduce the rate of resistance evolution, we need to understand how various biotic and abiotic factors interact to drive the complex processes of resistance emergence and transmission. We describe several of the fundamental factors that underlay resistance evolution, including rates and niches of emergence and persistence of resistant bacteria, time- and space-gradients of various selective agents, and rates and routes of transmission of resistant bacteria between humans, animals and other environments. Furthermore, we discuss the options available to reduce the rate of resistance evolution and/ or transmission and their advantages and disadvantages.

A Biochemical Approach to Study the Role of the Terminal Oxidases in Aerobic Respiration in Shewanella oneidensis MR-1

PubMed Central

Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

2014-01-01

The genome of the facultative anaerobic γ-proteobacterium Shewanella oneidensis MR-1 encodes for three terminal oxidases: a bd-type quinol oxidase and two heme-copper oxidases, a A-type cytochrome c oxidase and a cbb 3-type oxidase. In this study, we used a biochemical approach and directly measured oxidase activities coupled to mass-spectrometry analysis to investigate the physiological role of the three terminal oxidases under aerobic and microaerobic conditions. Our data revealed that the cbb 3-type oxidase is the major terminal oxidase under aerobic conditions while both cbb 3-type and bd-type oxidases are involved in respiration at low-O2 tensions. On the contrary, the low O2-affinity A-type cytochrome c oxidase was not detected in our experimental conditions even under aerobic conditions and would therefore not be required for aerobic respiration in S. oneidensis MR-1. In addition, the deduced amino acid sequence suggests that the A-type cytochrome c oxidase is a ccaa 3-type oxidase since an uncommon extra-C terminal domain contains two c-type heme binding motifs. The particularity of the aerobic respiratory pathway and the physiological implication of the presence of a ccaa 3-type oxidase in S. oneidensis MR-1 are discussed. PMID:24466040

Antimicrobial Photodynamic Therapy to Kill Gram-negative Bacteria

PubMed Central

Sperandio, Felipe F; Huang, Ying-Ying; Hamblin, Michael R

2013-01-01

Antimicrobial photodynamic therapy (PDT) or photodynamic inactivation (PDI) is a new promising strategy to eradicate pathogenic microorganisms such as Gram-positive and Gram-negative bacteria, yeasts and fungi. The search for new approaches that can kill bacteria but do not induce the appearance of undesired drug-resistant strains suggests that PDT may have advantages over traditional antibiotic therapy. PDT is a non-thermal photochemical reaction that involves the simultaneous presence of visible light, oxygen and a dye or photosensitizer (PS). Several PS have been studied for their ability to bind to bacteria and efficiently generate reactive oxygen species (ROS) upon photostimulation. ROS are formed through type I or II mechanisms and may inactivate several classes of microbial cells including Gram-negative bacteria such as Pseudomonas aeruginosa, which are typically characterized by an impermeable outer cell membrane that contains endotoxins and blocks antibiotics, dyes, and detergents, protecting the sensitive inner membrane and cell wall. This review covers significant peer-reviewed articles together with US and World patents that were filed within the past few years and that relate to the eradication of Gram-negative bacteria via PDI or PDT. It is organized mainly according to the nature of the PS involved and includes natural or synthetic food dyes; cationic dyes such as methylene blue and toluidine blue; tetrapyrrole derivatives such as phthalocyanines, chlorins, porphyrins, chlorophyll and bacteriochlorophyll derivatives; functionalized fullerenes; nanoparticles combined with different PS; other formulations designed to target PS to bacteria; photoactive materials and surfaces; conjugates between PS and polycationic polymers or antibodies; and permeabilizing agents such as EDTA, PMNP and CaCl2. The present review also covers the different laboratory animal models normally used to treat Gram-negative bacterial infections with antimicrobial PDT. PMID

High abundances of aerobic anoxygenic photosynthetic bacteria in the South Pacific Ocean.

PubMed

Lami, Raphaël; Cottrell, Matthew T; Ras, Joséphine; Ulloa, Osvaldo; Obernosterer, Ingrid; Claustre, Hervé; Kirchman, David L; Lebaron, Philippe

2007-07-01

Little is known about the abundance, distribution, and ecology of aerobic anoxygenic phototrophic (AAP) bacteria, particularly in oligotrophic environments, which represent 60% of the ocean. We investigated the abundance of AAP bacteria across the South Pacific Ocean, including the center of the gyre, the most oligotrophic water body of the world ocean. AAP bacteria, Prochlorococcus, and total prokaryotic abundances, as well as bacteriochlorophyll a (BChl a) and divinyl-chlorophyll a concentrations, were measured at several depths in the photic zone along a gradient of oligotrophic conditions. The abundances of AAP bacteria and Prochlorococcus were high, together accounting for up to 58% of the total prokaryotic community. The abundance of AAP bacteria alone was up to 1.94 x 10(5) cells ml(-1) and as high as 24% of the overall community. These measurements were consistent with the high BChl a concentrations (up to 3.32 x 10(-3) microg liter(-1)) found at all stations. However, the BChl a content per AAP bacterial cell was low, suggesting that AAP bacteria are mostly heterotrophic organisms. Interestingly, the biovolume and therefore biomass of AAP bacteria was on average twofold higher than that of other prokaryotic cells. This study demonstrates that AAP bacteria can be abundant in various oligotrophic conditions, including the most oligotrophic regime of the world ocean, and can account for a large part of the bacterioplanktonic carbon stock.

Inhibition of biofilm development and spoilage potential of Shewanella baltica by quorum sensing signal in cell-free supernatant from Pseudomonas fluorescens.

PubMed

Zhao, Aifei; Zhu, Junli; Ye, Xiaofeng; Ge, Yangyang; Li, Jianrong

2016-08-02

The objective of this study was to in vitro evaluate the effect of a cell-free supernatant (CFS) containing quorum sensing (QS) signal of Pseudomonas fluorescens on the growth, biofilm development and spoilage potential of Shewanella baltica, and preliminarily assess the interactive influences of various chemically synthesized autoinducers on spoilage phenotypes of S. baltica. PF01 strain isolated from spoiled Pseudosciaen crocea was identified P. fluorescens. The addition of 25% and 50% CFS to S. baltica culture had no effect on the growth rate during the lag and exponential phase, however, caused cell decline during the stationary phase. The presence of CFS from P. fluorescens significantly inhibited biofilm development, and greatly decreased the production of trimethylamine (TMA) and biogenic amino in S. baltica. Various signal molecules of QS in the CFS of P. fluorescens culture were detected, including seven N-acyl-l-homoserine lactones (AHLs), autoinducer-2 (AI-2) and two diketopiperazines (DKPs). Exogenous supplement of synthesized seven AHLs containing in the CFS decreased biofilm formation and TMA production in S. baltica, while exposure to exogenous cyclo-(l-Pro-l-Leu) was showed to promote spoilage potential, which revealed that S. baltica also sense the two QS molecules. Furthermore, the stimulating effect of cyclo-(l-Pro-l-Leu) was affected when AHL was simultaneously added, suggesting that the inhibitory activity of spoilage phenotypes in S. baltica might be attributed to a competitive effect of these QS compounds in the CFS of P. fluorescens. The present studies provide a good basis for future research on the role of QS in the regulation of spoilage microbial flora. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation, Characterisation and Antagonistic Activity of Bacteria Symbionts Hardcoral Pavona sp. Isolated from Panjang Island, Jepara Against Infectious Multi-drug Resistant (MDR) Bacteria

NASA Astrophysics Data System (ADS)

Ayuningrum, D.; Kristiana, R.; Asagabaldan, M. A.; Sabdono, A.; Radjasa, O. K.; Nuryadi, H.; Trianto, A.

2017-02-01

Pavona sp. is highly spread over Indonesian waters including Panjang Island. Several studies showed that bacteria symbionts hardcoral were the big source of antibiotic product, but there was limited research of the bacteria symbionts with hardcoral Pavona sp. In this research bacteria symbionts from hardcoral Pavona sp. had been collected from Panjang Island, Jepara. Marine bacteria symbionts were isolated by serial dillution method, while antibacterial activity was performed by using overlay and agar block method. The total of 2 from 5 isolates were active to MDR bacteria such as Enterobacter aerogenes and Acinetobacter baumanii, the code were PHC 44/04 and PHC 44/05. Then both of them were identified by morphological and molecular DNA characterization using 16 S rRNA gene sequence. The result of 16 S rRNA identification shows PHC 44/04 has 99% similarities with Virgibacillus salarius strain sa-Vb 1, while PHC 44/05 shows 99% similarities with Pseudoalteromonas flavipulchra strain NCIMB 2033.

Back To Bacteria.

ERIC Educational Resources Information Center

Flannery, Maura C.

1997-01-01

Explores new research about bacteria. Discusses bacterial genomes, archaea, unusual environments, evolution, pathogens, bacterial movement, biofilms, bacteria in the body, and a bacterial obsession. Contains 29 references. (JRH)

Chemotaxis by natural populations of coral reef bacteria.

PubMed

Tout, Jessica; Jeffries, Thomas C; Petrou, Katherina; Tyson, Gene W; Webster, Nicole S; Garren, Melissa; Stocker, Roman; Ralph, Peter J; Seymour, Justin R

2015-08-01

Corals experience intimate associations with distinct populations of marine microorganisms, but the microbial behaviours underpinning these relationships are poorly understood. There is evidence that chemotaxis is pivotal to the infection process of corals by pathogenic bacteria, but this evidence is limited to experiments using cultured isolates under laboratory conditions. We measured the chemotactic capabilities of natural populations of coral-associated bacteria towards chemicals released by corals and their symbionts, including amino acids, carbohydrates, ammonium and dimethylsulfoniopropionate (DMSP). Laboratory experiments, using a modified capillary assay, and in situ measurements, using a novel microfabricated in situ chemotaxis assay, were employed to quantify the chemotactic responses of natural microbial assemblages on the Great Barrier Reef. Both approaches showed that bacteria associated with the surface of the coral species Pocillopora damicornis and Acropora aspera exhibited significant levels of chemotaxis, particularly towards DMSP and amino acids, and that these levels of chemotaxis were significantly higher than that of bacteria inhabiting nearby, non-coral-associated waters. This pattern was supported by a significantly higher abundance of chemotaxis and motility genes in metagenomes within coral-associated water types. The phylogenetic composition of the coral-associated chemotactic microorganisms, determined using 16S rRNA amplicon pyrosequencing, differed from the community in the seawater surrounding the coral and comprised known coral associates, including potentially pathogenic Vibrio species. These findings indicate that motility and chemotaxis are prevalent phenotypes among coral-associated bacteria, and we propose that chemotaxis has an important role in the establishment and maintenance of specific coral-microbe associations, which may ultimately influence the health and stability of the coral holobiont.

Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3.

PubMed

Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

2017-03-20

To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.

Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3

NASA Astrophysics Data System (ADS)

Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

2017-03-01

To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.

Winter kill in intensively stocked channel catfish (Ictalurus punctatus): Coinfection with Aeromonas veronii, Streptococcus parauberis and Shewanella putrefaciens.

PubMed

Mohammed, Haitham H; Peatman, Eric

2018-06-07

Unusual persistent natural mortality occurred in a floating in-pond raceway system intensively stocked with channel and hybrid catfish beginning in early November 2016 up until March 2017. The temperature during the period of outbreak ranged from 7.2 to 23.7°C. Gross examination of freshly dead and moribund fish revealed pale gills, slight abdominal distension and swollen inflamed vents. Comprehensive necropsy of 20 fish demonstrated vast amounts of bloody ascitic fluid in the coelomic cavity, visceral congestion, splenomegaly and pale friable livers but macroscopically normal kidneys, suggesting systemic bacterial infection. Bacterial cultures were initiated from skin, gills and major internal organs. Following incubation, a mixture of three bacterial colony phenotypes was observed on agar plates. Presumptive biochemical characterization of the isolates followed by 16S-rRNA sequence analysis resulted in the identification of Aeromonas veronii, Streptococcus parauberis and Shewanella putrefaciens. Channel catfish juveniles were experimentally infected with the recovered isolates to fulfil Koch's postulates. Moreover, an antibiogram was used to evaluate the susceptibility of the isolates to antimicrobial drugs approved for use in aquaculture. Aquaflor was used successfully for treatment. Here, we report bacterial coinfection lead by A. veronii and the first identification of S. parauberis and S. putrefaciens from cultured catfish in North America. © 2018 John Wiley & Sons Ltd.

The Role of 4-Hydroxyphenylpyruvate Dioxygenase in Enhancement of Solid-Phase Electron Transfer by Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Turick, Charles E.; Beliaev, Alex S.; Zakrajsek, Brian A.

2009-05-01

ABSTRACT - While mechanistic details of dissimilatory metal reduction are far from being understood, it is postulated that the electron transfer to solid metal oxides is mediated by outer membrane associated c-type cytochromes and electron shuttling compounds. This study focuses on the production of homogensitate in Shewanella oneidensis MR-1, an intermediate of the tyrosine degradation pathway, which is a precursor of a redox cycling metabolite, pyomelanin. We determined that two enzymes involved in this pathway, 4-hydroxyphenylpyruvate dioxygenase (4HPPD) and homogentisate 1,2-dioxygenase are responsible for homogentisate production and oxidation, respectively. Inhibition of 4-HPPD activity with the specific inhibitor sulcotrione ([2-(2- chloro-more » 4- methane sulfonylbenzoyl)-1,3-cyclohexanedione), and deletion of melA, a gene encoding 4-HPPD, resulted in no pyomelanin production by S. oneidensis MR-1. Conversely, deletion of hmgA, which encodes the putative homogentisate 1,2-dioxygenase, resulted in pyomelanin overproduction. The efficiency and rates at which MR-1 reduces hydrous ferric oxide were directly linked to the ability of mutant strains to produce pyomelanin. Electrochemical studies with whole cells demonstrated that pyomelanin substantially increases the formal potential (E°') of S. oneidensis MR-1. Based on our findings, environmental production of pyomelanin likely contributes to an increased solid-phase metal reduction capacity in S. oneidensis MR-1.« less

Presence of Pathogenic Bacteria and Viruses in the Daycare Environment.

PubMed

Ibfelt, Tobias; Engelund, Eva Hoy; Permin, Anders; Madsen, Jonas Stenløkke; Schultz, Anna Charlotte; Andersen, Leif Percival

2015-10-01

The number of children in daycare centers (DCCs) is rising. This increases exposure to microorganisms and infectious diseases. Little is known about which bacteria and viruses are present in the DCC environment and where they are located. In the study described in this article, the authors set out to determine the prevalence of pathogenic bacteria and viruses and to find the most contaminated fomites in DCCs. Fifteen locations in each DCC were sampled for bacteria, respiratory viruses, and gastrointestinal viruses. The locations were in the toilet, kitchen, and playroom areas and included nursery pillows, toys, and tables, among other things. Coliform bacteria were primarily found in the toilet and kitchen areas whereas nasopharyngeal bacteria were found mostly on toys and fabric surfaces in the playroom. Respiratory viruses were omnipresent in the DCC environment, especially on the toys.

Vibrio bacteria in raw oysters: managing risks to human health.

PubMed

Froelich, Brett A; Noble, Rachel T

2016-03-05

The human-pathogenic marine bacteria Vibrio vulnificus and V. parahaemolyticus are strongly correlated with water temperature, with concentrations increasing as waters warm seasonally. Both of these bacteria can be concentrated in filter-feeding shellfish, especially oysters. Because oysters are often consumed raw, this exposes people to large doses of potentially harmful bacteria. Various models are used to predict the abundance of these bacteria in oysters, which guide shellfish harvest policy meant to reduce human health risk. Vibrio abundance and behaviour varies from site to site, suggesting that location-specific studies are needed to establish targeted risk reduction strategies. Moreover, virulence potential, rather than simple abundance, should be also be included in future modeling efforts. © 2016 The Author(s).

Enhanced performance of hexavalent chromium reducing cathodes in the presence of Shewanella oneidensis MR-1 and lactate.

PubMed

Xafenias, Nikolaos; Zhang, Yue; Banks, Charles J

2013-05-07

Biocathodes for the reduction of the highly toxic hexavalent chromium (Cr(VI)) were investigated using Shewanella oneidensis MR-1 (MR-1) as a biocatalyst and performance was assessed in terms of current production and Cr(VI) reduction. Potentiostatically controlled experiments (-500 mV vs Ag/AgCl) showed that a mediatorless MR-1 biocathode started up under aerated conditions in the presence of lactate, received 5.5 and 1.7 times more electrons for Cr(VI) reduction over a 4 h operating period than controls without lactate and with lactate but without MR-1, respectively. Cr(VI) reduction was also enhanced, with a decrease in concentration over the 4 h operating period of 9 mg/L Cr(VI), compared to only 1 and 3 mg/L, respectively, in the controls. Riboflavin, an electron shuttle mediator naturally produced by MR-1, was also found to have a positive impact in potentiostatically controlled cathodes. Additionally, a microbial fuel cell (MFC) with MR-1 and lactate present in both anode and cathode produced a maximum current density of 32.5 mA/m(2) (1000 Ω external load) after receiving a 10 mg/L Cr(VI) addition in the cathode, and cathodic efficiency increased steadily over an 8 day operation period with successive Cr(VI) additions. In conclusion, effective and continuous Cr(VI) reduction with associated current production were achieved when MR-1 and lactate were both present in the biocathodes.

Emergence of drug resistant bacteria at the Hajj: A systematic review.

PubMed

Leangapichart, Thongpan; Rolain, Jean-Marc; Memish, Ziad A; Al-Tawfiq, Jaffar A; Gautret, Philippe

Hajj is the annual mass gathering of Muslims, and is a reservoir and potential source of bacterial transmission. The emergence of bacterial transmission, including multi-drug resistance (MDR) bacteria, during Hajj has not been systematically assessed. Articles in Pubmed, Scopus, and Google scholar were identified using controlled words relating to antibiotic resistance (AR) at the Hajj from January 2002 to January 2017. Eligible studies were identified by two researchers. AR patterns of bacteria were obtained for each study. We included 31 publications involving pilgrims, Hajj workers or local patients attending hospitals in Mecca, Mina, and the Medina area. Most of these publications provided antibiotic susceptibility results. Ten of them used the PCR approach to identify AR genes. MRSA carriage was reported in pilgrims and food handlers at a rate of 20%. Low rates of vancomycin-resistant gram-positive bacteria were reported in pilgrims and patients. The prevalence of third-generation cephalosporin-resistant bacteria was common in the Hajj region. Across all studies, carbapenem-resistant bacteria were detected in fewer than 10% of E.coli isolates tested but up to 100% in K. pneumoniae and A. baumannii. Colistin-resistant Salmonella enterica, including mcr-1 colistin-resistant E.coli and K.pneumoniae were only detected in the pilgrim cohorts. This study provides an overview of the prevalence of MDR bacteria at the Hajj. Pilgrims are at high risk of AR bacterial transmission and may carry and transfer these bacteria when returning to their home countries. Thus, pilgrims should be instructed by health care practitioners about hygiene practices aiming at reducing traveler's diarrhea and limited use of antibiotics during travel in order to reduce the risk of MDR bacterial transmission. Copyright © 2017 Elsevier Ltd. All rights reserved.

Inactivation of biofilm bacteria.

PubMed Central

LeChevallier, M W; Cawthon, C D; Lee, R G

1988-01-01

The current project was developed to examine inactivation of biofilm bacteria and to characterize the interaction of biocides with pipe surfaces. Unattached bacteria were quite susceptible to the variety of disinfectants tested. Viable bacterial counts were reduced 99% by exposure to 0.08 mg of hypochlorous acid (pH 7.0) per liter (1 to 2 degrees C) for 1 min. For monochloramine, 94 mg/liter was required to kill 99% of the bacteria within 1 min. These results were consistent with those found by other investigators. Biofilm bacteria grown on the surfaces of granular activated carbon particles, metal coupons, or glass microscope slides were 150 to more than 3,000 times more resistant to hypochlorous acid (free chlorine, pH 7.0) than were unattached cells. In contrast, resistance of biofilm bacteria to monochloramine disinfection ranged from 2- to 100-fold more than that of unattached cells. The results suggested that, relative to inactivation of unattached bacteria, monochloramine was better able to penetrate and kill biofilm bacteria than free chlorine. For free chlorine, the data indicated that transport of the disinfectant into the biofilm was a major rate-limiting factor. Because of this phenomenon, increasing the level of free chlorine did not increase disinfection efficiency. Experiments where equal weights of disinfectants were used suggested that the greater penetrating power of monochloramine compensated for its limited disinfection activity. These studies showed that monochloramine was as effective as free chlorine for inactivation of biofilm bacteria. The research provides important insights into strategies for control of biofilm bacteria. Images PMID:2849380

Molecular and chemical dialogues in bacteria-protozoa interactions.

PubMed

Song, Chunxu; Mazzola, Mark; Cheng, Xu; Oetjen, Janina; Alexandrov, Theodore; Dorrestein, Pieter; Watrous, Jeramie; van der Voort, Menno; Raaijmakers, Jos M

2015-08-06

Protozoan predation of bacteria can significantly affect soil microbial community composition and ecosystem functioning. Bacteria possess diverse defense strategies to resist or evade protozoan predation. For soil-dwelling Pseudomonas species, several secondary metabolites were proposed to provide protection against different protozoan genera. By combining whole-genome transcriptome analyses with (live) imaging mass spectrometry (IMS), we observed multiple changes in the molecular and chemical dialogues between Pseudomonas fluorescens and the protist Naegleria americana. Lipopeptide (LP) biosynthesis was induced in Pseudomonas upon protozoan grazing and LP accumulation transitioned from homogeneous distributions across bacterial colonies to site-specific accumulation at the bacteria-protist interface. Also putrescine biosynthesis was upregulated in P. fluorescens upon predation. We demonstrated that putrescine induces protozoan trophozoite encystment and adversely affects cyst viability. This multifaceted study provides new insights in common and strain-specific responses in bacteria-protozoa interactions, including responses that contribute to bacterial survival in highly competitive soil and rhizosphere environments.

Analysis of bacterial metagenomes from the Southwestern Gulf of Mexico for pathogens detection.

PubMed

Escobedo-Hinojosa, Wendy; Pardo-López, Liliana

2017-07-31

Little is known about the diversity of bacteria in the Southwestern Gulf of Mexico. The aim of the study illustrated in this perspective was to search for the presence of bacterial pathogens in this ecosystem, using metagenomic data recently generated by the Mexican research group known as the Gulf of Mexico Research Consortium. Several genera of bacteria annotated as pathogens were detected in water and sediment marine samples. As expected, native and ubiquitous pathogenic bacteria genera such as Burkolderia, Halomonas, Pseudomonas, Shewanella and Vibrio were highly represented. Surprisingly, non-native genera of public health concern were also detected, including Borrelia, Ehrlichia, Leptospira, Mycobacterium, Mycoplasma, Salmonella, Staphylococcus, Streptococcus and Treponema. While there are no previous metagenomics studies of this environment, the potential influences of natural, anthropogenic and ecological factors on the diversity of putative pathogenic bacteria found in it are reviewed. The taxonomic annotation herein reported provides a starting point for an improved understanding of bacterial biodiversity in the Southwestern Gulf of Mexico. It also represents a useful tool in public health as it may help identify infectious diseases associated with exposure to marine water and ingestion of fish or shellfish, and thus may be useful in predicting and preventing waterborne disease outbreaks. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

[Immobilization of introduced bacteria and degradation of pyrene and benzo(alpha) pyrene in soil by immobilized bacteria].

PubMed

Wang, Xin; Li, Peijun; Song, Shouzhi; Zhong, Yong; Zhang, Hui; Verkhozina, E V

2006-11-01

In this study, introduced bacteria were applied in the bioremediation of pyrene and benzo (alpha) pyrene in organic pollutants-contaminated soils, aimed to test whether it was feasible to introduce bacteria to environmental engineering. Three introduced bacteria were immobilized separately or together to degrade the pyrene and benzo (alpha) pyrene in soil, taking dissociated bacteria as the control, and comparing with three indigenous bacteria. The results showed that immobilized introduced bacteria, either single or mixed, had higher degradation efficiency than dissociated bacteria. Compared with indigenous bacteria, some introduced bacteria had predominance to some degree. The introduced bacteria-mixture had better degradation efficiency after being immobilized. The degradation rate of pyrene and benzo(alpha) pyrene after treated with immobilized bacteria-( B61-B67)-mixture for 96 hours was 43.49% and 38.55%, respectively.

The fecal bacteria

USGS Publications Warehouse

Sadowsky, Michael J.; Whitman, Richard L.

2011-01-01

The Fecal Bacteria offers a balanced, integrated discussion of fecal bacteria and their presence and ecology in the intestinal tract of mammals, in the environment, and in the food supply. This volume covers their use in examining and assessing water quality in order to offer protection from illnesses related to swimming in or ingesting contaminated water, in addition to discussing their use in engineering considerations of water quality, modeling, monitoring, and regulations. Fecal bacteria are additionally used as indicators of contamination of ready-to-eat foods and fresh produce. The intestinal environment, the microbial community structure of the gut microbiota, and the physiology and genomics of this broad group of microorganisms are explored in the book. With contributions from an internationally recognized group of experts, the book integrates medicine, public health, environmental, and microbiological topics in order to provide a unique, holistic understanding of fecal bacteria. Moreover, it shows how the latest basic science and applied research findings are helping to solve problems and develop effective management strategies. For example, readers will discover how the latest tools and molecular approaches have led to our current understanding of fecal bacteria and enabled us to improve human health and water quality. The Fecal Bacteria is recommended for microbiologists, clinicians, animal scientists, engineers, environmental scientists, food safety experts, water quality managers, and students. It will help them better understand fecal bacteria and use their knowledge to protect human and environmental health. They can also apply many of the techniques and molecular tools discussed in this book to the study of a broad range of microorganisms in a variety of habitats.

Electrogenic Single-Species Biocomposites as Anodes for Microbial Fuel Cells.

PubMed

Kaiser, Patrick; Reich, Steffen; Leykam, Daniel; Willert-Porada, Monika; Greiner, Andreas; Freitag, Ruth

2017-07-01

Integration of electrogenic microorganisms remains a challenge in biofuel cell technology. Here, synthetic biocomposites ("artificial biofilms") are proposed. Bacteria (Shewanella oneidensis) are embedded in a hydrogel matrix (poly(vinyl alcohol)) via wet- and electrospinning, creating fibers and nonwoven gauzes. The bacteria remain viable and metabolically active. The performance is compared to S. oneidensis suspension cultures and "natural" biofilms. While lower than with the suspension cultures, the power output from the fuel cells with the artificial biofilms is higher than with the natural one. Handling, reproducibility, and stability are also better. Artificial biofilms can therefore contribute to resolving fundamental issues of design, scale up, and monosepsis in biofuel cell technology. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biogeography of anaerobic ammonia-oxidizing (anammox) bacteria

PubMed Central

Sonthiphand, Puntipar; Hall, Michael W.; Neufeld, Josh D.

2014-01-01

Anaerobic ammonia-oxidizing (anammox) bacteria are able to oxidize ammonia and reduce nitrite to produce N2 gas. After being discovered in a wastewater treatment plant (WWTP), anammox bacteria were subsequently characterized in natural environments, including marine, estuary, freshwater, and terrestrial habitats. Although anammox bacteria play an important role in removing fixed N from both engineered and natural ecosystems, broad scale anammox bacterial distributions have not yet been summarized. The objectives of this study were to explore global distributions and diversity of anammox bacteria and to identify factors that influence their biogeography. Over 6000 anammox 16S rRNA gene sequences from the public database were analyzed in this current study. Data ordinations indicated that salinity was an important factor governing anammox bacterial distributions, with distinct populations inhabiting natural and engineered ecosystems. Gene phylogenies and rarefaction analysis demonstrated that freshwater environments and the marine water column harbored the highest and the lowest diversity of anammox bacteria, respectively. Co-occurrence network analysis indicated that Ca. Scalindua strongly connected with other Ca. Scalindua taxa, whereas Ca. Brocadia co-occurred with taxa from both known and unknown anammox genera. Our survey provides a better understanding of ecological factors affecting anammox bacterial distributions and provides a comprehensive baseline for understanding the relationships among anammox communities in global environments. PMID:25147546

Thermal control of virulence factors in bacteria: A hot topic

PubMed Central

Lam, Oliver; Wheeler, Jun; Tang, Christoph M

2014-01-01

Pathogenic bacteria sense environmental cues, including the local temperature, to control the production of key virulence factors. Thermal regulation can be achieved at the level of DNA, RNA or protein and although many virulence factors are subject to thermal regulation, the exact mechanisms of control are yet to be elucidated in many instances. Understanding how virulence factors are regulated by temperature presents a significant challenge, as gene expression and protein production are often influenced by complex regulatory networks involving multiple transcription factors in bacteria. Here we highlight some recent insights into thermal regulation of virulence in pathogenic bacteria. We focus on bacteria which cause disease in mammalian hosts, which are at a significantly higher temperature than the outside environment. We outline the mechanisms of thermal regulation and how understanding this fundamental aspect of the biology of bacteria has implications for pathogenesis and human health. PMID:25494856

Natural soil reservoirs for human pathogenic and fecal indicator bacteria

USGS Publications Warehouse

Boschiroli, Maria L; Falkinham, Joseph; Favre-Bonte, Sabine; Nazaret, Sylvie; Piveteau, Pascal; Sadowsky, Michael J.; Byappanahalli, Muruleedhara; Delaquis, Pascal; Hartmann, Alain

2016-01-01

Soils receive inputs of human pathogenic and indicator bacteria through land application of animal manures or sewage sludge, and inputs by wildlife. Soil is an extremely heterogeneous substrate and contains meso- and macrofauna that may be reservoirs for bacteria of human health concern. The ability to detect and quantify bacteria of human health concern is important in risk assessments and in evaluating the efficacy of agricultural soil management practices that are protective of crop quality and protective of adjacent water resources. The present chapter describes the distribution of selected Gram-positive and Gram-negative bacteria in soils. Methods for detecting and quantifying soilborne bacteria including extraction, enrichment using immunomagnetic capture, culturing, molecular detection and deep sequencing of metagenomic DNA to detect pathogens are overviewed. Methods for strain phenotypic and genotypic characterization are presented, as well as how comparison with clinical isolates can inform the potential for human health risk.

Rapid Separation of Bacteria from Blood—Review and Outlook

PubMed Central

Alizadeh, Mahsa; Husseini, Ghaleb A.; McClellan, Daniel S.; Buchanan, Clara M.; Bledsoe, Colin G.; Robison, Richard A.; Blanco, Rae; Roeder, Beverly L.; Melville, Madison; Hunter, Alex K.

2017-01-01

The high morbidity and mortality rate of bloodstream infections involving antibiotic-resistant bacteria necessitate a rapid identification of the infectious organism and its resistance profile. Traditional methods based on culturing the blood typically require at least 24 h, and genetic amplification by PCR in the presence of blood components has been problematic. The rapid separation of bacteria from blood would facilitate their genetic identification by PCR or other methods so that the proper antibiotic regimen can quickly be selected for the septic patient. Microfluidic systems that separate bacteria from whole blood have been developed, but these are designed to process only microliter quantities of whole blood or only highly diluted blood. However, symptoms of clinical blood infections can be manifest with bacterial burdens perhaps as low as 10 CFU/mL, and thus milliliter quantities of blood must be processed to collect enough bacteria for reliable genetic analysis. This review considers the advantages and shortcomings of various methods to separate bacteria from blood, with emphasis on techniques that can be done in less than 10 min on milliliter-quantities of whole blood. These techniques include filtration, screening, centrifugation, sedimentation, hydrodynamic focusing, chemical capture on surfaces or beads, field-flow fractionation, and dielectrophoresis. Techniques with the most promise include screening, sedimentation, and magnetic bead capture, as they allow large quantities of blood to be processed quickly. Some microfluidic techniques can be scaled up. PMID:27160415

Antimicrobial susceptibility of starter culture bacteria used in Norwegian dairy products.

PubMed

Katla, A K; Kruse, H; Johnsen, G; Herikstad, H

2001-07-20

Commercial starter culture bacteria are widely used in the production of dairy products and could represent a potential source for spread of genes encoding resistance to antimicrobial agents. To learn more about the antimicrobial susceptibility of starter culture bacteria used in Norwegian dairy products, a total of 189 isolates of lactic acid bacteria were examined for susceptibility to ampicillin, penicillin G, cephalothin, vancomycin, bacitracin, gentamicin, streptomycin, erythromycin, tetracycline, chloramphenicol, quinupristin/dalfopristin, ciprofloxacin, trimethoprim and sulphadiazine using Etest for MIC determination. Most of the isolates (140) originated from 39 dairy products (yoghurt, sour cream, fermented milk and cheese), while 49 were isolated directly from nine commercial cultures. The bacteria belonged to the genera Lactobacillus, Lactococcus, Leuconostoc and Streptococcus. Only one of the 189 isolates was classified as resistant to an antimicrobial agent included in the study. This isolate, a lactobacillus, was classified as high level resistant to streptomycin. The remaining isolates were not classified as resistant to the antimicrobial agents included other than to those they are known to have a natural reduced susceptibility to. Thus, starter culture bacteria in Norwegian dairy products do not seem to represent a source for spread of genes encoding resistance to antimicrobial agents.

Enzyme activity screening of thermophilic bacteria isolated from Dusun Tua Hot Spring, Malaysia

NASA Astrophysics Data System (ADS)

Msarah, Marwan; Ibrahim, Izyanti; Aqma, Wan Syaidatul

2018-04-01

Thermophilic bacteria have biotechnological importance due to the availability of unique enzymes which are stable in extreme circumstances. The aim of this study includes to isolate thermophilic bacteria from hot spring and screen for important enzyme activities. Water samples from the Dusun Tua Hot Spring were collected and the physiochemical characterisation of water was measured. Eight thermophilic bacteria were isolated and determined to have at least three strong enzyme activity including protease, lipase, amylase, cellulase, pectinase and xylanase. The results showed that HuluC2 displayed all the enzyme activities and can be further studied.

Arsenic biotransformation and release by bacteria indigenous to arsenic contaminated groundwater.

PubMed

Paul, Dhiraj; Kazy, Sufia K; Banerjee, Tirtha Das; Gupta, Ashok K; Pal, Taraknath; Sar, Pinaki

2015-01-01

Arsenic (As) biotransformation and release by indigenous bacteria from As rich groundwater was investigated. Metabolic landscape of 173 bacterial isolates indicated broad catabolic repertoire including abundance of As(5+) reductase activity and abilities in utilizing wide ranges of organic and inorganic respiratory substrates. Abundance of As homeostasis genes and utilization of hydrocarbon as carbon/electron donor and As(5+) as electron acceptor were noted within the isolates. Sediment microcosm study (for 300 days) showed a pivotal role of metal reducing facultative anaerobic bacteria in toxic As(3+) release in aqueous phase. Inhabitant bacteria catalyze As transformation and facilitate its release through a cascade of reactions including mineral bioweathering and As(5+) and/or Fe(3+) reduction activities. Compared to anaerobic incubation with As(5+) reducing strains, oxic state and/or incubation with As(3+) oxidizing bacteria resulted in reduced As release, thus indicating a strong role of such condition or biocatalytic mechanism in controlling in situ As contamination. Copyright © 2015 Elsevier Ltd. All rights reserved.

Sulfur cycling and metabolism of phototrophic and filamentous sulfur bacteria

NASA Technical Reports Server (NTRS)

Guerrero, R.; Brune, D.; Poplawski, R.; Schmidt, T. M.

1985-01-01

Phototrophic sulfur bacteria taken from different habitate (Alum Rock State Park, Palo Alto salt marsh, and Big Soda Lake) were grown on selective media, characterized by morphological and pigment analysis, and compared with bacteria maintained in pure culture. A study was made of the anaerobic reduction of intracellular sulfur globules by a phototrophic sulfur bacterium (Chromatium vinosum) and a filamentous aerobic sulfur bacterium (Beggiatoa alba). Buoyant densities of different bacteria were measured in Percoll gradients. This method was also used to separate different chlorobia in mixed cultures and to assess the relative homogeneity of cultures taken directly or enriched from natural samples (including the purple bacterial layer found at a depth of 20 meters at Big Soda Lake.) Interactions between sulfide oxidizing bacteria were studied.

Pulling Helices inside Bacteria: Imperfect Helices and Rings

NASA Astrophysics Data System (ADS)

Allard, Jun F.; Rutenberg, Andrew D.

2009-04-01

We study steady-state configurations of intrinsically-straight elastic filaments constrained within rod-shaped bacteria that have applied forces distributed along their length. Perfect steady-state helices result from axial or azimuthal forces applied at filament ends, however azimuthal forces are required for the small pitches observed for MreB filaments within bacteria. Helix-like configurations can result from distributed forces, including coexistence between rings and imperfect helices. Levels of expression and/or bundling of the polymeric protein could mediate this coexistence.

Macrophage defense mechanisms against intracellular bacteria

PubMed Central

Weiss, Günter; Schaible, Ulrich E

2015-01-01

Macrophages and neutrophils play a decisive role in host responses to intracellular bacteria including the agent of tuberculosis (TB), Mycobacterium tuberculosis as they represent the forefront of innate immune defense against bacterial invaders. At the same time, these phagocytes are also primary targets of intracellular bacteria to be abused as host cells. Their efficacy to contain and eliminate intracellular M. tuberculosis decides whether a patient initially becomes infected or not. However, when the infection becomes chronic or even latent (as in the case of TB) despite development of specific immune activation, phagocytes have also important effector functions. Macrophages have evolved a myriad of defense strategies to combat infection with intracellular bacteria such as M. tuberculosis. These include induction of toxic anti-microbial effectors such as nitric oxide and reactive oxygen intermediates, the stimulation of microbe intoxication mechanisms via acidification or metal accumulation in the phagolysosome, the restriction of the microbe's access to essential nutrients such as iron, fatty acids, or amino acids, the production of anti-microbial peptides and cytokines, along with induction of autophagy and efferocytosis to eliminate the pathogen. On the other hand, M. tuberculosis, as a prime example of a well-adapted facultative intracellular bacterium, has learned during evolution to counter-balance the host's immune defense strategies to secure survival or multiplication within this otherwise hostile environment. This review provides an overview of innate immune defense of macrophages directed against intracellular bacteria with a focus on M. tuberculosis. Gaining more insights and knowledge into this complex network of host-pathogen interaction will identify novel target sites of intervention to successfully clear infection at a time of rapidly emerging multi-resistance of M. tuberculosis against conventional antibiotics. PMID:25703560

[Darwin and bacteria].

PubMed

Ledermann D, Walter

2009-02-01

As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never took knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.

Detection of biological uranium reduction using magnetic resonance.

PubMed

Vogt, Sarah J; Stewart, Brandy D; Seymour, Joseph D; Peyton, Brent M; Codd, Sarah L

2012-04-01

The conversion of soluble uranyl ions (UO₂²⁺) by bacterial reduction to sparingly soluble uraninite (UO₂(s)) is being studied as a way of immobilizing subsurface uranium contamination. Under anaerobic conditions, several known types of bacteria including iron and sulfate reducing bacteria have been shown to reduce U (VI) to U (IV). Experiments using a suspension of uraninite (UO₂(s)) particles produced by Shewanella putrefaciens CN32 bacteria show a dependence of both longitudinal (T₁) and transverse (T₂) magnetic resonance (MR) relaxation times on the oxidation state and solubility of the uranium. Gradient echo and spin echo MR images were compared to quantify the effect caused by the magnetic field fluctuations (T*₂) of the uraninite particles and soluble uranyl ions. Since the precipitate studied was suspended in liquid water, the effects of concentration and particle aggregation were explored. A suspension of uraninite particles was injected into a polysaccharide gel, which simulates the precipitation environment of uraninite in the extracellular biofilm matrix. A reduction in the T₂ of the gel surrounding the particles was observed. Tests done in situ using three bioreactors under different mixing conditions, continuously stirred, intermittently stirred, and not stirred, showed a quantifiable T₂ magnetic relaxation effect over the extent of the reaction. Copyright © 2011 Wiley Periodicals, Inc.

Bee Venom (Apis Mellifera) an Effective Potential Alternative to Gentamicin for Specific Bacteria Strains: Bee Venom an Effective Potential for Bacteria.

PubMed

Zolfagharian, Hossein; Mohajeri, Mohammad; Babaie, Mahdi

2016-09-01

Mellitine, a major component of bee venom (BV, Apis mellifera ), is more active against gram positive than gram negative bacteria. Moreover, BV has been reported to have multiple effects, including antibacterial, antivirus, and anti-inflammation effects, in various types of cells. In addition, wasp venom has been reported to have antibacterial properties. The aim of this study was to evaluate the antibacterial activity of BV against selected gram positive and gram negative bacterial strains of medical importance. This investigation was set up to evaluate the antibacterial activity of BV against six grams positive and gram negative bacteria, including Staphylococcus aureus ( S. aureus ), Salmonella typhimurium , Escherichia coli ( E. coli ) O157:H7, Pseudomonas aeruginosa , Burkholderia mallei and Burkholderia pseudomallei. Three concentrations of crude BV and standard antibiotic (gentamicin) disks as positive controls were tested by using the disc diffusion method. BV was found to have a significant antibacterial effect against E. coli , S. aureus , and Salmonella typhyimurium in all three concentrations tested. However, BV had no noticeable effect on other tested bacteria for any of the three doses tested. The results of the current study indicate that BV inhibits the growth and survival of bacterial strains and that BV can be used as a complementary antimicrobial agent against pathogenic bacteria. BV lacked the effective proteins necessary for it to exhibit antibacterial activity for some specific strains while being very effective against other specific strains. Thus, one may conclude, that Apis mellifera venom may have a specific mechanism that allows it to have an antibacterial effect on certain susceptible bacteria, but that mechanism is not well understood.

High prevalence of fastidious bacteria in 1520 cases of uveitis of unknown etiology.

PubMed

Drancourt, Michel; Berger, Pierre; Terrada, Céline; Bodaghi, Bahram; Conrath, John; Raoult, Didier; LeHoang, Phuc

2008-05-01

The etiologic evaluation of uveitis is frequently unsuccessful when noninvasive methods are used. We conducted a prospective study to evaluate systematic screening for pathogens of uveitis. All patients with uveitis referred to the participating tertiary ophthalmology departments from January 2001 to September 2007 underwent intraocular and serum specimen collection. The standardized protocol for laboratory investigations included universal polymerase chain reaction (PCR)-based detection of any bacteria and mycoses, specific PCR-based detection of fastidious (difficult-to-grow) bacteria and herpes viruses, and culture of vitreous fluid. Sera were tested for fastidious bacteria. Among the 1321 included patients (1520 specimens), infection was diagnosed in 147 (11.1%) patients: 78 (53%) were caused by fastidious bacteria that included spirochetes, Bartonella species, intracellular bacteria (Chlamydia species, Rickettsia species, Coxiella burnetii), and Tropheryma whipplei; 18 by herpes viruses; and 9 by fungi. Bartonella quintana, Coxiella burnetii, Paracoccus yeei, Aspergillus oryzae, and Cryptococcus albidus were found to be associated with uveitis for the first time, to our knowledge. We recommend applying a 1-step diagnostic procedure that incorporates intraocular, specific microbial PCR with serum analyses in tertiary centers to determine the etiology of uveitis.

Beer spoilage bacteria and hop resistance.

PubMed

Sakamoto, Kanta; Konings, Wil N

2003-12-31

For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However

Biodiversity of yeasts, lactic acid bacteria and acetic acid bacteria in the fermentation of "Shanxi aged vinegar", a traditional Chinese vinegar.

PubMed

Wu, Jia Jia; Ma, Ying Kun; Zhang, Fen Fen; Chen, Fu Sheng

2012-05-01

Shanxi aged vinegar is a famous traditional Chinese vinegar made from several kinds of cereal by spontaneous solid-state fermentation techniques. In order to get a comprehensive understanding of culturable microorganism's diversity present in its fermentation, the indigenous microorganisms including 47 yeast isolates, 28 lactic acid bacteria isolates and 58 acetic acid bacteria isolates were recovered in different fermenting time and characterized based on a combination of phenotypic and genotypic approaches including inter-delta/PCR, PCR-RFLP, ERIC/PCR analysis, as well as 16S rRNA and 26S rRNA partial gene sequencing. In the alcoholic fermentation, the dominant yeast species Saccharomyces (S.) cerevisiae (96%) exhibited low phenotypic and genotypic diversity among the isolates, while Lactobacillus (Lb.) fermentum together with Lb. plantarum, Lb. buchneri, Lb. casei, Pediococcus (P.) acidilactici, P. pentosaceus and Weissella confusa were predominated in the bacterial population at the same stage. Acetobacter (A.) pasteurianus showing great variety both in genotypic and phenotypic tests was the dominant species (76%) in the acetic acid fermentation stage, while the other acetic acid bacteria species including A. senegalensis, A. indonesiensis, A. malorum and A. orientalis, as well as Gluconobacter (G.) oxydans were detected at initial point of alcoholic and acetic acid fermentation stage respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.

Bleach vs. Bacteria

MedlinePlus

... Inside Life Science > Bleach vs. Bacteria Inside Life Science View All Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds ... For Proteins, Form Shapes Function This Inside Life Science article also appears on LiveScience . Learn about related ...

The Role of Plant Growth-Promoting Bacteria in Metal Phytoremediation.

PubMed

Kong, Zhaoyu; Glick, Bernard R

2017-01-01

Phytoremediation is a promising technology that uses plants and their associated microbes to clean up contaminants from the environment. In recent years, phytoremediation assisted by plant growth-promoting bacteria (PGPB) has been highly touted for cleaning up toxic metals from soil. PGPB include rhizospheric bacteria, endophytic bacteria and the bacteria that facilitate phytoremediation by other means. This review provides information about the traits and mechanisms possessed by PGPB that improve plant metal tolerance and growth, and illustrate mechanisms responsible for plant metal accumulation/translocation in plants. Several recent examples of phytoremediation of metals facilitated by PGPB are reviewed. Although many encouraging results have been reported in the past years, there have also been numerous challenges encountered in phytoremediation in the field. To implement PGPB-assisted phytoremediation of metals in the natural environment, there is also a need to critically assess the ecological effects of PGPB, especially for those nonnative bacteria. © 2017 Elsevier Ltd All rights reserved.

Airborne bacteria in the atmosphere: Presence, purpose, and potential

NASA Astrophysics Data System (ADS)

Smets, Wenke; Moretti, Serena; Denys, Siegfried; Lebeer, Sarah

2016-08-01

Numerous recent studies have highlighted that the types of bacteria present in the atmosphere often show predictable patterns across space and time. These patterns can be driven by differences in bacterial sources of the atmosphere and a wide range of environmental factors, including UV intensity, precipitation events, and humidity. The abundance of certain bacterial taxa is of interest, not only for their ability to mediate a range of chemical and physical processes in the atmosphere, such as cloud formation and ice nucleation, but also for their implications -both beneficial and detrimental-for human health. Consequently, the widespread importance of airborne bacteria has stimulated the search for their applicability. Improving air quality, modelling the dispersal of airborne bacteria (e.g. pathogens) and biotechnological purposes are already being explored. Nevertheless, many technological challenges still need to be overcome to fully understand the roles of airborne bacteria in our health and global ecosystems.

Incorporation of therapeutically modified bacteria into gut microbiota inhibits obesity.

PubMed

Chen, Zhongyi; Guo, Lilu; Zhang, Yongqin; Walzem, Rosemary L; Pendergast, Julie S; Printz, Richard L; Morris, Lindsey C; Matafonova, Elena; Stien, Xavier; Kang, Li; Coulon, Denis; McGuinness, Owen P; Niswender, Kevin D; Davies, Sean S

2014-08-01

Metabolic disorders, including obesity, diabetes, and cardiovascular disease, are widespread in Westernized nations. Gut microbiota composition is a contributing factor to the susceptibility of an individual to the development of these disorders; therefore, altering a person's microbiota may ameliorate disease. One potential microbiome-altering strategy is the incorporation of modified bacteria that express therapeutic factors into the gut microbiota. For example, N-acylphosphatidylethanolamines (NAPEs) are precursors to the N-acylethanolamide (NAE) family of lipids, which are synthesized in the small intestine in response to feeding and reduce food intake and obesity. Here, we demonstrated that administration of engineered NAPE-expressing E. coli Nissle 1917 bacteria in drinking water for 8 weeks reduced the levels of obesity in mice fed a high-fat diet. Mice that received modified bacteria had dramatically lower food intake, adiposity, insulin resistance, and hepatosteatosis compared with mice receiving standard water or control bacteria. The protective effects conferred by NAPE-expressing bacteria persisted for at least 4 weeks after their removal from the drinking water. Moreover, administration of NAPE-expressing bacteria to TallyHo mice, a polygenic mouse model of obesity, inhibited weight gain. Our results demonstrate that incorporation of appropriately modified bacteria into the gut microbiota has potential as an effective strategy to inhibit the development of metabolic disorders.

Symbiotic bacteria enable olive fly larvae to overcome host defences

PubMed Central

Ben-Yosef, Michael; Pasternak, Zohar; Jurkevitch, Edouard; Yuval, Boaz

2015-01-01

Ripe fruit offer readily available nutrients for many animals, including fruit fly larvae (Diptera: Tephritidae) and their associated rot-inducing bacteria. Yet, during most of their ontogeny, fruit remain chemically defended and effectively suppress herbivores and pathogens by high levels of secondary metabolites. Olive flies (Bactrocera oleae) are uniquely able to develop in unripe olives. Unlike other frugivorous tephritids, the larvae maintain bacteria confined within their midgut caeca. We examined the interaction between larvae, their associated bacteria, and fruit chemical defence, hypothesizing that bacterial contribution to larval development is contingent on the phenology of fruit defensive chemistry. We demonstrate that larvae require their natural complement of bacteria (Candidatus Erwinia dacicola: Enterobacteriaceae) in order to develop in unripe olives. Conversely, when feeding on ripe fruit, larval development proceeds independently of these bacteria. Our experiments suggest that bacteria counteract the inhibitory effect of oleuropein—the principal phenolic glycoside in unripe olives. In light of these results, we suggest that the unique symbiosis in olive flies, compared with other frugivorous tephritids, is understood by considering the relationship between the fly, bacteria and fruit chemistry. When applied in an evolutionary context, this approach may also point out the forces which shaped symbioses across the Tephritidae. PMID:26587275

Pulling helices inside bacteria: imperfect helices and rings

NASA Astrophysics Data System (ADS)

Rutenberg, Andrew; Allard, Jun

2009-03-01

We study steady-state configurations of intrinsically-straight elastic filaments constrained within rod-shaped bacteria that have applied forces distributed along their length. Perfect steady-state helices result from axial or azimuthal forces applied at filament ends, however azimuthal forces are required for the small pitches observed for MreB filaments within bacteria. Helix-like configurations can result from distributed forces, including co-existence between rings and imperfect helices. Levels of expression and/or bundling of the polymeric protein could mediate this co-existence.

Synergistic reaction of silver nitrate, silver nanoparticles, and methylene blue against bacteria

PubMed Central

Li, Runze; Chen, Jie; Cesario, Thomas C.; Wang, Xin; Yuan, Joshua S.; Rentzepis, Peter M.

2016-01-01

In this paper we describe the antibacterial effect of methylene blue, MB, and silver nitrate reacting alone and in combination against five bacterial strains including Serratia marcescens and Escherichia coli bacteria. The data presented suggest that when the two components are combined and react together against bacteria, the effects can be up to three orders of magnitude greater than that of the sum of the two components reacting alone against bacteria. Analysis of the experimental data provides proof that a synergistic mechanism is operative within a dose range when the two components react together, and additive when reacting alone against bacteria. PMID:27849602

Aptamer-based viability impedimetric sensor for bacteria.

PubMed

Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V

2012-11-06

The development of an aptamer-based viability impedimetric sensor for bacteria (AptaVISens-B) is presented. Highly specific DNA aptamers to live Salmonella typhimurium were selected via the cell-systematic evolution of ligands by exponential enrichment (SELEX) technique. Twelve rounds of selection were performed; each comprises a positive selection step against viable S. typhimurium and a negative selection step against heat killed S. typhimurium and a mixture of related pathogens, including Salmonella enteritidis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii to ensure the species specificity of the selected aptamers. The DNA sequence showing the highest binding affinity to the bacteria was further integrated into an impedimetric sensor via self-assembly onto a gold nanoparticle-modified screen-printed carbon electrode (GNP-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. typhimurium down to 600 CFU mL(-1) (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based viability sensing of a variety of microorganisms, particularly viable but nonculturable (VBNC) bacteria, using a rapid, economic, and label-free electrochemical platform.

Growth of Iron(III)-Reducing Bacteria on Clay Minerals as the Sole Electron Acceptor and Comparison of Growth Yields on a Variety of Oxidized Iron Forms†

PubMed Central

Kostka, Joel E.; Dalton, Dava D.; Skelton, Hayley; Dollhopf, Sherry; Stucki, Joseph W.

2002-01-01

Smectite clay minerals are abundant in soils and sediments worldwide and are typically rich in Fe. While recent investigations have shown that the structural Fe(III) bound in clay minerals is reduced by microorganisms, previous studies have not tested growth with clay minerals as the sole electron acceptor. Here we have demonstrated that a pure culture of Shewanella oneidensis strain MR-1 as well as enrichment cultures of Fe(III)-reducing bacteria from rice paddy soil and subsurface sediments are capable of conserving energy for growth with the structural Fe(III) bound in smectite clay as the sole electron acceptor. Pure cultures of S. oneidensis were used for more detailed growth rate and yield experiments on various solid- and soluble-phase electron acceptors [smectite, Fe(III) oxyhydroxide FeOOH, Fe(III) citrate, and oxygen] in the same minimal medium. Growth was assessed as direct cell counts or as an increase in cell carbon (measured as particulate organic carbon). Cell counts showed that similar growth of S. oneidensis (108 cells ml−1) occurred with smectitic Fe(III) and on other Fe forms [amorphous Fe(III) oxyhydroxide, and Fe citrate] or oxygen as the electron acceptor. In contrast, cell yields of S. oneidensis measured as the increase in cell carbon were similar on all Fe forms tested while yields on oxygen were five times higher, in agreement with thermodynamic predictions. Over a range of particle loadings (0.5 to 4 g liter−1), the increase in cell number was highly correlated to the amount of structural Fe in smectite reduced. From phylogenetic analysis of the complete 16S rRNA gene sequences, a predominance of clones retrieved from the clay mineral-reducing enrichment cultures were most closely related to the low-G+C gram-positive members of the Bacteria (Clostridium and Desulfitobacterium) and the δ-Proteobacteria (members of the Geobacteraceae). Results indicate that growth with smectitic Fe(III) is similar in magnitude to that with Fe

Impaired cell envelope resulting from arcA mutation largely accounts for enhanced sensitivity to hydrogen peroxide in Shewanella oneidensis

PubMed Central

Wan, Fen; Mao, Yinting; Dong, Yangyang; Ju, Lili; Wu, Genfu; Gao, Haichun

2015-01-01

Oxidative stress is one of the major challenges that Shewanella encounter routinely because they thrive in redox-stratified environments prone to reactive oxygen species (ROS) formation, letting alone that ROS can be generated endogenously. As respiration is the predominant process for endogenous ROS, regulators mediating respiration have been demonstrated and/or implicated to play a role in oxidative stress response. In our efforts to unveil the involvement of global regulators for respiration in the oxidative stress response, we found that loss of the Arc system increases S. oneidensis sensitivity to H2O2 whereas neither Fnr nor Crp has a significant role. A comparison of transcriptomic profiles of the wild-type and its isogenic arcA mutant revealed that the OxyR regulon is independent of the Arc system. We then provided evidence that the enhanced H2O2 sensitivity of the arcA mutant is due to an increased H2O2 uptake rate, a result of a cell envelope defect. Although one of three proteases of the ArcA regulon when in excess is partially accountable for the envelope defect, the major contributors remain elusive. Overall, our data indicate that the Arc system influences the bacterial cell envelope biosynthesis, a physiological aspect that has not been associated with the regulator before. PMID:25975178

Effects of temperature and dissolved oxygen on Se(IV) removal and Se(0) precipitation by Shewanella sp. HN-41.

PubMed

Lee, Ji-Hoon; Han, Jaehong; Choi, Heechul; Hur, Hor-Gil

2007-08-01

Facultative anaerobic Shewanella sp. strain HN-41 was able to utilize selenite (Se(IV)) as a sole electron acceptor for respiration in anaerobic condition, resulting in reduction of Se(IV) and then precipitation of elemental Se nano-sized spherical particles, which were identified using energy-dispersive X-ray spectroscopy and X-ray absorption near-edge structure spectroscopy. When the effects on Se(IV) reduction to elemental Se were studied by varying incubation temperatures and dissolved oxygen contents, Se(IV) reduction occurred more actively with higher removal rate of Se(IV) in aqueous phase and well-shaped spherical Se(0) nanoparticles were formed from the incubations under N(2) (100%) or N(2):O(2) (80%:20%) at 30 degrees C with average diameter values of 181+/-40 nm and 164+/-24 nm, respectively, while relatively less amounts of irregular-shaped Se(0) nanoparticles were produced with negligible amount of Se(IV) reduction and removal under 100% of O(2). The Se particle size distributions based on scanning electron microscopy also showed a general tendency towards decreased Se particle size as oxygen content increased, whereas the particle size seemed uncorrelated to the change in the incubation temperature. These results also suggest that the size-controlled biological Se(0) nanospheres production may be achieved simply by changing the culture conditions.

Sequence and Genetic Characterization of etrA, an fnr Analog that Regulates Anaerobic Respiration in Shewanella putrefaciens MR-1

NASA Technical Reports Server (NTRS)

Saffarini, Daad A.; Nelson, Kenneth H.

1993-01-01

An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.

Living bacteria in silica gels

NASA Astrophysics Data System (ADS)

Nassif, Nadine; Bouvet, Odile; Noelle Rager, Marie; Roux, Cécile; Coradin, Thibaud; Livage, Jacques

2002-09-01

The encapsulation of enzymes within silica gels has been extensively studied during the past decade for the design of biosensors and bioreactors. Yeast spores and bacteria have also been recently immobilized within silica gels where they retain their enzymatic activity, but the problem of the long-term viability of whole cells in an inorganic matrix has never been fully addressed. It is a real challenge for the development of sol-gel processes. Generic tests have been performed to check the viability of Escherichia coli bacteria in silica gels. Surprisingly, more bacteria remain culturable in the gel than in an aqueous suspension. The metabolic activity of the bacteria towards glycolysis decreases slowly, but half of the bacteria are still viable after one month. When confined within a mineral environment, bacteria do not form colonies. The exchange of chemical signals between isolated bacteria rather than aggregates can then be studied, a point that could be very important for 'quorum sensing'.

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.

The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less

Functional genomics to discover antibiotic resistance genes: The paradigm of resistance to colistin mediated by ethanolamine phosphotransferase in Shewanella algae MARS 14.

PubMed

Telke, Amar A; Rolain, Jean-Marc

2015-12-01

Shewanella algae MARS 14 is a colistin-resistant clinical isolate retrieved from bronchoalveolar lavage of a hospitalised patient. A functional genomics strategy was employed to discover the molecular support for colistin resistance in S. algae MARS 14. A pZE21 MCS-1 plasmid-based genomic expression library was constructed in Escherichia coli TOP10. The estimated library size was 1.30×10(8) bp. Functional screening of colistin-resistant clones was carried out on Luria-Bertani agar containing 8 mg/L colistin. Five colistin-resistant clones were obtained after complete screening of the genomic expression library. Analysis of DNA sequencing results found a unique gene in all selected clones. Amino acid sequence analysis of this unique gene using the Integrated Microbial Genomes (IMG) and KEGG databases revealed that this gene encodes ethanolamine phosphotransferase (EptA, or so-called PmrC). Reverse transcription PCR analysis indicated that resistance to colistin in S. algae MARS 14 was associated with overexpression of EptA (27-fold increase), which plays a crucial role in the arrangement of outer membrane lipopolysaccharide. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Lipopolysaccharides in diazotrophic bacteria.

PubMed

Serrato, Rodrigo V

2014-01-01

Biological nitrogen fixation (BNF) is a process in which the atmospheric nitrogen (N2) is transformed into ammonia (NH3) by a select group of nitrogen-fixing organisms, or diazotrophic bacteria. In order to furnish the biologically useful nitrogen to plants, these bacteria must be in constant molecular communication with their host plants. Some of these molecular plant-microbe interactions are very specific, resulting in a symbiotic relationship between the diazotroph and the host. Others are found between associative diazotrophs and plants, resulting in plant infection and colonization of internal tissues. Independent of the type of ecological interaction, glycans, and glycoconjugates produced by these bacteria play an important role in the molecular communication prior and during colonization. Even though exopolysaccharides (EPS) and lipochitooligosaccharides (LCO) produced by diazotrophic bacteria and released onto the environment have their importance in the microbe-plant interaction, it is the lipopolysaccharides (LPS), anchored on the external membrane of these bacteria, that mediates the direct contact of the diazotroph with the host cells. These molecules are extremely variable among the several species of nitrogen fixing-bacteria, and there are evidences of the mechanisms of infection being closely related to their structure.

Lipopolysaccharides in diazotrophic bacteria

PubMed Central

Serrato, Rodrigo V.

2014-01-01

Biological nitrogen fixation (BNF) is a process in which the atmospheric nitrogen (N2) is transformed into ammonia (NH3) by a select group of nitrogen-fixing organisms, or diazotrophic bacteria. In order to furnish the biologically useful nitrogen to plants, these bacteria must be in constant molecular communication with their host plants. Some of these molecular plant-microbe interactions are very specific, resulting in a symbiotic relationship between the diazotroph and the host. Others are found between associative diazotrophs and plants, resulting in plant infection and colonization of internal tissues. Independent of the type of ecological interaction, glycans, and glycoconjugates produced by these bacteria play an important role in the molecular communication prior and during colonization. Even though exopolysaccharides (EPS) and lipochitooligosaccharides (LCO) produced by diazotrophic bacteria and released onto the environment have their importance in the microbe-plant interaction, it is the lipopolysaccharides (LPS), anchored on the external membrane of these bacteria, that mediates the direct contact of the diazotroph with the host cells. These molecules are extremely variable among the several species of nitrogen fixing-bacteria, and there are evidences of the mechanisms of infection being closely related to their structure. PMID:25232535

Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3

PubMed Central

Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

2017-01-01

To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels. PMID:28317859

Surface display of roGFP for monitoring redox status of extracellular microenvironments in Shewanella oneidensis biofilms.

PubMed

Sivakumar, Krishnakumar; Mukherjee, Manisha; Cheng, Hsin-I; Zhang, Yingdan; Ji, Lianghui; Cao, Bin

2015-03-01

Biofilms are the most ubiquitous and resilient form of microbial life on earth. One most important feature of a biofilm is the presence of a self-produced matrix, which creates highly heterogeneous and dynamic microenvironments within biofilms. Redox status in biofilm microenvironments plays a critical role in biofilm development and function. However, there is a lack of non-intrusive tools to quantify extracellular redox status of microenvironments within a biofilm matrix. In this study, using Shewanella oneidensis as a model organism, we demonstrated a novel approach to monitor extracellular redox status in biofilm microenvironments. Specifically, we displayed a redox sensitive fluorescence protein roGFP onto the cell surface of S. oneidensis by fusing it to the C-terminus of BpfA, a large surface protein, and used the surface displayed roGFP as a sensor to quantify the extracellular redox status in the matrix of S. oneidensis biofilms. The fusion of roGFP into BpfA has no negative impacts on cell growth and biofilm formation. Upon exposure to oxidizing agents such as H2 O2 , Ag(+) , and SeO3 (2-) , S. oneidensis BpfA-roGFP cells exhibited a characteristic fluorescence of roGFP. Proteinase treatment assay and super-resolution structured illumination microscopy confirmed the surface localization of BpfA-roGFP. We further used the surface displayed roGFP monitored the extracellular redox status in the matrix at different depths of a biofilm exposed to H2 O2 . This study provides a novel approach to non-invasively monitor extracellular redox status in microenvironments within biofilms, which can be used to understand redox responses of biofilms to environmental perturbations. © 2014 Wiley Periodicals, Inc.

Acid base activity of live bacteria: Implications for quantifying cell wall charge

NASA Astrophysics Data System (ADS)

Claessens, Jacqueline; van Lith, Yvonne; Laverman, Anniet M.; Van Cappellen, Philippe

2006-01-01

To distinguish the buffering capacity associated with functional groups in the cell wall from that resulting from metabolic processes, base or acid consumption by live and dead cells of the Gram-negative bacterium Shewanella putrefaciens was measured in a pH stat system. Live cells exhibited fast consumption of acid (pH 4) or base (pH 7, 8, 9, and 10) during the first few minutes of the experiments. At pH 5.5, no acid or base was required to maintain the initial pH constant. The initial amounts of acid or base consumed by the live cells at pH 4, 8, and 10 were of comparable magnitudes as those neutralized at the same pHs by intact cells killed by exposure to gamma radiation or ethanol. Cells disrupted in a French press required higher amounts of acid or base, due to additional buffering by intracellular constituents. At pH 4, acid neutralization by suspensions of live cells stopped after 50 min, because of loss of viability. In contrast, under neutral and alkaline conditions, base consumption continued for the entire duration of the experiments (5 h). This long-term base neutralization was, at least partly, due to active respiration by the cells, as indicated by the build-up of succinate in solution. Qualitatively, the acid-base activity of live cells of the Gram-positive bacterium Bacillus subtilis resembled that of S. putrefaciens. The pH-dependent charging of ionizable functional groups in the cell walls of the live bacteria was estimated from the initial amounts of acid or base consumed in the pH stat experiments. From pH 4 to 10, the cell wall charge increased from near-zero values to about -4 × 10 -16 mol cell -1 and -6.5 × 10 -16 mol cell -1 for S. putrefaciens and B. subtilis, respectively. The similar cell wall charging of the two bacterial strains is consistent with the inferred low contribution of lipopolysaccharides to the buffering capacity of the Gram-negative cell wall (of the order of 10%).

Method of Detecting Coliform Bacteria from Reflected Light

NASA Technical Reports Server (NTRS)

Vincent, Robert K. (Inventor)

2014-01-01

The present invention relates to a method of detecting coliform bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

Mechanistic modeling of biocorrosion caused by biofilms of sulfate reducing bacteria and acid producing bacteria.

PubMed

Xu, Dake; Li, Yingchao; Gu, Tingyue

2016-08-01

Biocorrosion is also known as microbiologically influenced corrosion (MIC). Most anaerobic MIC cases can be classified into two major types. Type I MIC involves non-oxygen oxidants such as sulfate and nitrate that require biocatalysis for their reduction in the cytoplasm of microbes such as sulfate reducing bacteria (SRB) and nitrate reducing bacteria (NRB). This means that the extracellular electrons from the oxidation of metal such as iron must be transported across cell walls into the cytoplasm. Type II MIC involves oxidants such as protons that are secreted by microbes such as acid producing bacteria (APB). The biofilms in this case supply the locally high concentrations of oxidants that are corrosive without biocatalysis. This work describes a mechanistic model that is based on the biocatalytic cathodic sulfate reduction (BCSR) theory. The model utilizes charge transfer and mass transfer concepts to describe the SRB biocorrosion process. The model also includes a mechanism to describe APB attack based on the local acidic pH at a pit bottom. A pitting prediction software package has been created based on the mechanisms. It predicts long-term pitting rates and worst-case scenarios after calibration using SRB short-term pit depth data. Various parameters can be investigated through computer simulation. Copyright © 2016 Elsevier B.V. All rights reserved.

Endocarditis Due to Rare and Fastidious Bacteria

PubMed Central

Brouqui, P.; Raoult, D.

2001-01-01

The etiologic diagnosis of infective endocarditis is easily made in the presence of continuous bacteremia with gram-positive cocci. However, the blood culture may contain a bacterium rarely associated with endocarditis, such as Lactobacillus spp., Klebsiella spp., or nontoxigenic Corynebacterium, Salmonella, Gemella, Campylobacter, Aeromonas, Yersinia, Nocardia, Pasteurella, Listeria, or Erysipelothrix spp., that requires further investigation to establish the relationship with endocarditis, or the blood culture may be uninformative despite a supportive clinical evaluation. In the latter case, the etiologic agents are either fastidious extracellular or intracellular bacteria. Fastidious extracellular bacteria such as Abiotrophia, HACEK group bacteria, Clostridium, Brucella, Legionella, Mycobacterium, and Bartonella spp. need supplemented media, prolonged incubation time, and special culture conditions. Intracellular bacteria such as Coxiella burnetii cannot be isolated routinely. The two most prevalent etiologic agents of culture-negative endocarditis are C. burnetti and Bartonella spp. Their diagnosis is usually carried out serologically. A systemic pathologic examination of excised heart valves including periodic acid-Schiff (PAS) staining and molecular methods has allowed the identification of Whipple's bacillus endocarditis. Pathologic examination of the valve using special staining, such as Warthin-Starry, Gimenez, and PAS, and broad-spectrum PCR should be performed systematically when no etiologic diagnosis is evident through routine laboratory evaluation. PMID:11148009

Interactions between yeasts and bacteria in the smear surface-ripened cheeses.

PubMed

Corsetti, A; Rossi, J; Gobbetti, M

2001-09-19

In the initial phase of ripening, the microflora of bacterial smear surface-ripened cheeses such as Limburger, Taleggio, Brick, Münster and Saint-Paulin and that of surface mould-ripened cheeses such as Camembert and Brie may be similar, but at the end of the ripening, bacteria such as Brevibacterium spp., Arthrobacter spp., Micrococcus spp., Corynebacterium spp. and moulds such as Penicillium camemberti are, respectively, the dominant microorganisms. Yeasts such as Candida spp., Cryptococcus spp., Debaryomyces spp., Geotrichum candidum, Pichia spp., Rhodotorula spp., Saccharomyces spp. and Yarrowia lipolytica are often and variably isolated from the smear surface-ripened cheeses. Although not dominant within the microorganisms of the smear surface-ripened cheeses, yeasts establish significant interactions with moulds and especially bacteria, including surface bacteria and lactic acid bacteria. Some aspects of the interactions between yeasts and bacteria in such type of cheeses are considered in this paper.

Clay enhancement of methane, low molecular weight hydrocarbon and halocarbon conversion by methanotrophic bacteria

DOEpatents

Apel, William A.; Dugan, Patrick R.

1995-01-01

An apparatus and method for increasing the rate of oxidation of toxic vapors by methanotrophic bacteria. The toxic vapors of interest are methane and trichloroethylene. The apparatus includes a gas phase bioreactor within a closed loop pumping system or a single pass system. The methanotrophic bacteria include Methylomonas methanica, Methylosinus trichosporium, and uncharacterized environmental enrichments.

Clay enhancement of methane, low molecular weight hydrocarbon and halocarbon conversion by methanotrophic bacteria

DOEpatents

Apel, William A.; Dugan, Patrick R.

1995-04-04

An apparatus and method for increasing the rate of oxidation of toxic vapors by methanotrophic bacteria. The toxic vapors of interest are methane and trichloroethylene. The apparatus includes a gas phase bioreactor within a closed loop pumping system or a single pass system. The methanotrophic bacteria include Methylomonas methanica, Methylosinus trichosporium, and uncharacterized environmental enrichments.

Characterization of lactic acid bacteria from local cow´s milk kefir

NASA Astrophysics Data System (ADS)

Ismail, YS; Yulvizar, C.; Mazhitov, B.

2018-03-01

One of products from milk fermentation is kefir. It is made by adding kefir grains which are composed of lactic acid bacteria and yeast into milk. The lactic acid bacteria are a group of bacteria that produce antimicrobial substances and able to inhibit the growth of pathogenic bacteria. In this research, the lactic acid bacteria were isolated from Aceh local cow`s milk kefir to determine the genus of the isolates. The methods used in the characterization of lactic acid bacteria are colony morphology, cell morphology, and biochemical tests which includes a catalase test; 5%, 6.5%, and 10% salt endurance tests; 37°C and 14°C temperature endurance tests, SIM test, TSIA test, MR-VP test, and O/F test. Of the four isolates found from the cow’s milk kefir, two isolates were confirmed as lactic acid bacteria (isolates SK-1 and SK-4). Both isolates are Gram positive bacteria, and have negative catalase activity. From the observations of colony morphology, cell morphology, and biochemical tests, it was found that the genus of SK-1 is Lactobacillus and the genus of SK-4 is Enterococcus.

Microbes Enhance Mobility of Arsenic in Pleistocene Aquifer Sand from Bangladesh

PubMed Central

Dhar, Ratan K.; Zheng, Yan; Saltikov, Chad W.; Radloff, Kathleen A.; Mailloux, Brian; Ahmed, Kazi. M.; van Geen, Alexander

2018-01-01

Dissimilatory metal-reducing bacteria can mobilize As, but few studies have studied such processes in deeper orange-colored Pleistocene sands containing 1–2 mg kg−1 As that are associated with low-As groundwater in Bangladesh. To address this gap, anaerobic incubations were conducted in replicate over 90 days using natural orange sands initially containing 0.14 mg kg−1 of 1 M phosphate-extractable As (24 hr), >99% as As(V), and 0.8 g kg−1 of 1.2 M HCl-leachable Fe (1 hr at 80°C), 95% as Fe(III). The sediment was resuspended in artificial groundwater, with or without lactate as a labile carbon source, and inoculated with metal-reducing Shewanella sp. ANA-3. Within 23 days, dissolved As concentrations increased to 17 μg L−1 with lactate, 97% as As(III), and 2 μg L−1 without lactate. Phosphate-extractable As concentrations increased 4-fold to 0.6 mg kg−1 in the same incubations, even without the addition of lactate. Dissolved As levels in controls without Shewanella, both with and without lactate, instead remained <1 μg L−1. These observations indicate that metal-reducers such as Shewanella can trigger As release to groundwater by converting sedimentary As to a more mobilizable form without the addition of high levels of labile carbon. Such interactions need to be better understood to determine the vulnerability of low-As aquifers from which drinking water is increasingly drawn in Bangladesh. PMID:21405115

Incorporation of therapeutically modified bacteria into gut microbiota inhibits obesity

PubMed Central

Chen, Zhongyi; Guo, Lilu; Zhang, Yongqin; L. Walzem, Rosemary; Pendergast, Julie S.; Printz, Richard L.; Morris, Lindsey C.; Matafonova, Elena; Stien, Xavier; Kang, Li; Coulon, Denis; McGuinness, Owen P.; Niswender, Kevin D.; Davies, Sean S.

2014-01-01

Metabolic disorders, including obesity, diabetes, and cardiovascular disease, are widespread in Westernized nations. Gut microbiota composition is a contributing factor to the susceptibility of an individual to the development of these disorders; therefore, altering a person’s microbiota may ameliorate disease. One potential microbiome-altering strategy is the incorporation of modified bacteria that express therapeutic factors into the gut microbiota. For example, N-acylphosphatidylethanolamines (NAPEs) are precursors to the N-acylethanolamide (NAE) family of lipids, which are synthesized in the small intestine in response to feeding and reduce food intake and obesity. Here, we demonstrated that administration of engineered NAPE-expressing E. coli Nissle 1917 bacteria in drinking water for 8 weeks reduced the levels of obesity in mice fed a high-fat diet. Mice that received modified bacteria had dramatically lower food intake, adiposity, insulin resistance, and hepatosteatosis compared with mice receiving standard water or control bacteria. The protective effects conferred by NAPE-expressing bacteria persisted for at least 4 weeks after their removal from the drinking water. Moreover, administration of NAPE-expressing bacteria to TallyHo mice, a polygenic mouse model of obesity, inhibited weight gain. Our results demonstrate that incorporation of appropriately modified bacteria into the gut microbiota has potential as an effective strategy to inhibit the development of metabolic disorders. PMID:24960158

Platelets and Infections – Complex Interactions with Bacteria

PubMed Central

Hamzeh-Cognasse, Hind; Damien, Pauline; Chabert, Adrien; Pozzetto, Bruno; Cognasse, Fabrice; Garraud, Olivier

2015-01-01

Platelets can be considered sentinels of vascular system due to their high number in the circulation and to the range of functional immunoreceptors they express. Platelets express a wide range of potential bacterial receptors, including complement receptors, FcγRII, Toll-like receptors but also integrins conventionally described in the hemostatic response, such as GPIIb–IIIa or GPIb. Bacteria bind these receptors either directly, or indirectly via fibrinogen, fibronectin, the first complement C1q, the von Willebrand Factor, etc. The fate of platelet-bound bacteria is questioned. Several studies reported the ability of activated platelets to internalize bacteria such as Staphylococcus aureus or Porphyromonas gingivalis, though there is no clue on what happens thereafter. Are they sheltered from the immune system in the cytoplasm of platelets or are they lysed? Indeed, while the presence of phagolysosome has not been demonstrated in platelets, they contain antimicrobial peptides that were shown to be efficient on S. aureus. Besides, the fact that bacteria can bind to platelets via receptors involved in hemostasis suggests that they may induce aggregation; this has indeed been described for Streptococcus sanguinis, S. epidermidis, or C. pneumoniae. On the other hand, platelets are able to display an inflammatory response to an infectious triggering. We, and others, have shown that platelet release soluble immunomodulatory factors upon stimulation by bacterial components. Moreover, interactions between bacteria and platelets are not limited to only these two partners. Indeed, platelets are also essential for the formation of neutrophil extracellular traps by neutrophils, resulting in bacterial clearance by trapping bacteria and concentrating antibacterial factors but in enhancing thrombosis. In conclusion, the platelet–bacteria interplay is a complex game; its fine analysis is complicated by the fact that the inflammatory component adds to the aggregation response

Purification and Characterization of the [NiFe]-Hydrogenase of Shewanella oneidensis MR-1 ▿

PubMed Central

Shi, Liang; Belchik, Sara M.; Plymale, Andrew E.; Heald, Steve; Dohnalkova, Alice C.; Sybirna, Kateryna; Bottin, Hervé; Squier, Thomas C.; Zachara, John M.; Fredrickson, James K.

2011-01-01

Shewanella oneidensis MR-1 possesses a periplasmic [NiFe]-hydrogenase (MR-1 [NiFe]-H2ase) that has been implicated in H2 production and oxidation as well as technetium [Tc(VII)] reduction. To characterize the roles of MR-1 [NiFe]-H2ase in these proposed reactions, the genes encoding both subunits of MR-1 [NiFe]-H2ase were cloned and then expressed in an MR-1 mutant without hyaB and hydA genes. Expression of recombinant MR-1 [NiFe]-H2ase in trans restored the mutant's ability to produce H2 at 37% of that for the wild type. Following purification, MR-1 [NiFe]-H2ase coupled H2 oxidation to reduction of Tc(VII)O4− and methyl viologen. Change of the buffers used affected MR-1 [NiFe]-H2ase-mediated reduction of Tc(VII)O4− but not methyl viologen. Under the conditions tested, all Tc(VII)O4− used was reduced in Tris buffer, while in HEPES buffer, only 20% of Tc(VII)O4− was reduced. The reduced products were soluble in Tris buffer but insoluble in HEPES buffer. Transmission electron microscopy analysis revealed that Tc precipitates reduced in HEPES buffer were aggregates of crystallites with diameters of ∼5 nm. Measurements with X-ray absorption near-edge spectroscopy revealed that the reduction products were a mixture of Tc(IV) and Tc(V) in Tris buffer but only Tc(IV) in HEPES buffer. Measurements with extended X-ray adsorption fine structure showed that while the Tc bonding environment in Tris buffer could not be determined, the Tc(IV) product in HEPES buffer was very similar to Tc(IV)O2·nH2O, which was also the product of Tc(VII)O4− reduction by MR-1 cells. These results shows for the first time that MR-1 [NiFe]-H2ase catalyzes Tc(VII)O4− reduction directly by coupling to H2 oxidation. PMID:21724888

Growth inhibition and stimulation of Shewanella oneidensis MR-1 by surfactants and calcium polysulfide.

PubMed

Bailey, Kathryn L; Tilton, Fred; Jansik, Danielle P; Ergas, Sarina J; Marshall, Matthew J; Miracle, Ann L; Wellman, Dawn M

2012-06-01

Foam delivery technology (FDT) uses surfactant based foam to immobilize subsurface contaminants in situ. Where traditional approaches are impractical, FDT has the potential to overcome many of the technical challenges facing the remediation of contaminated deep vadose zone environments. However, little is known about the effects these reactive chemicals may have on microorganisms inhabiting the contaminated subsurface. In addition, there are currently no standard assays to assess microbial responses to subsurface remedial treatments while these agents are under development. The objective of this study was to develop a rapid laboratory assay to assess the potential growth inhibition and/or stimulation of microorganisms following exposure to candidate FDT components. Calcium polysulfide (CPS) and several surfactants (i.e. sodium laureth sulfate (SLES), sodium dodecyl sulfate (SDS), cocamidopropyl betaine (CAPB) and NINOL40-CO) have diverse chemistries and are candidate components of FDT. Shewanella oneidensis MR-1 cultures were exposed to a range of concentrations of these chemicals to determine the minimum bactericidal concentration (MBC) and the growth and viability potential of these components. Concentrations of SDS higher than 700 μM were toxic to S. oneidensis MR-1 growth over the course of four days of exposure. The relative acute toxicity order for these compounds was SDS > CPS > NINOL 40-CO>SLES≥CAPB. Dose dependent growth decreases (20-100mM) were observed in the CAPB and SLES treated cultures and both CPS and NINOL 40-CO were toxic at all concentrations tested (1.45-7.25 mM CPS). Both SLES (20-100mM) and SDS at lower concentrations (20-500 μM) were stimulatory to S. oneidensis MR-1 indicating a capacity to be used as a carbon source. These studies also identified potentially key component characteristics, such as precipitate formation and oxygen availability, which may prove valuable in assessing the response of subsurface microorganisms. This benchtop

Exploring the potential environmental functions of viable but non-culturable bacteria.

PubMed

Su, Xiaomei; Chen, Xi; Hu, Jinxing; Shen, Chaofeng; Ding, Linxian

2013-12-01

A conventional plate count is the most commonly employed method to estimate the number of living bacteria in environmental samples. In fact, judging the level of viable culture by plate count is limited, because it is often several orders of magnitude less than the number of living bacteria actually present. Most of the bacteria are in "viable but non-culturable" (VBNC) state, whose cells are intact and alive and can resuscitate when surrounding conditions are more favorable. The most exciting recent development in resuscitating VBNC bacteria is a bacterial cytokine, namely, the resuscitation-promoting factor (Rpf), secreted by Micrococcus luteus, which promotes the resuscitation and growth of high G+C Gram-positive organisms, including some species of the genus Mycobacterium. However, most of studies deal with VBNC bacteria only from the point of view of medicine and epidemiology. It is therefore of great significance to research whether these VBNC state bacteria also possess some useful environmental capabilities, such as degradation, flocculation, etc. Further studies are needed to elucidate the possible environmental role of the VBNC bacteria, rather than only considering their role as potential pathogens from the point view of epidemiology and public health. We have studied the resuscitation of these VBNC bacteria in polluted environments by adding culture supernatant containing Rpf from M. luteus, and it was found that, as a huge microbial resource, VBNC bacteria could provide important answers to dealing with existing problems of environmental pollution. This mini-review will provide new insight for considering the potentially environmental functions of VBNC bacteria.

Virulence properties of cariogenic bacteria

PubMed Central

Kuramitsu, Howard K; Wang, Bing-Yan

2006-01-01

The importance of Streptococcus mutans in the etiology of dental caries has been well documented. However, there is growing recognition that the cariogenic potential of dental plaque may be determined by the composite interactions of the total plaque bacteria rather than solely the virulence properties of a single organism. This study will examine how the interactions of S. mutans with other biofilm constituents may influence the cariogenicity of plaque samples. In order to begin to investigate the effects of nonmutans streptococci on the cariogenic potential of S. mutans, we have examined the effects of Streptococcus gordonii on the virulence properties of the former organisms. These studies have indicated that S.gordonii can attenuate several potential virulence properties of S. mutans including bacteriocin production, genetic transformation, and biofilm formation. Therefore, modulation of the interactions between plaque bacteria might be a novel approach for attenuating dental caries initiation. PMID:16934112

The Interaction between Heterotrophic Bacteria and Coliform, Fecal Coliform, Fecal Streptococci Bacteria in the Water Supply Networks.

PubMed

Amanidaz, Nazak; Zafarzadeh, Ali; Mahvi, Amir Hossein

2015-12-01

This study investigated the interaction between heterotrophic bacteria and coliform, fecal coliforms, fecal streptococci bacteria in water supply networks. This study was conducted during 2013 on water supply distribution network in Aq Qala City, Golestan Province, Northern Iran and standard methods were applied for microbiological analysis. The surface method was applied to test the heterotrophic bacteria and MPN method was used for coliform, fecal coliform and fecal streptococci bacteria measurements. In 114 samples, heterotrophic bacteria count were over 500 CFU/ml, which the amount of fecal coliform, coliform, and fecal streptococci were 8, 32, and 20 CFU/100 ml, respectively. However, in the other 242 samples, with heterotrophic bacteria count being less than 500 CFU/ml, the amount of fecal coliform, coliform, and fecal streptococci was 7, 23, and 11 CFU/100ml, respectively. The relationship between heterotrophic bacteria, coliforms and fecal streptococci was highly significant (P<0.05). We observed the concentration of coliforms, fecal streptococci bacteria being high, whenever the concentration of heterotrophic bacteria in the water network systems was high. Interaction between heterotrophic bacteria and coliform, fecal coliforms, fecal streptococci bacteria in the Aq Qala City water supply networks was not notable. It can be due to high concentrations of organic carbon, bio-films and nutrients, which are necessary for growth, and survival of all microorganisms.

The Interaction between Heterotrophic Bacteria and Coliform, Fecal Coliform, Fecal Streptococci Bacteria in the Water Supply Networks

PubMed Central

AMANIDAZ, Nazak; ZAFARZADEH, Ali; MAHVI, Amir Hossein

2015-01-01

Background: This study investigated the interaction between heterotrophic bacteria and coliform, fecal coliforms, fecal streptococci bacteria in water supply networks. Methods: This study was conducted during 2013 on water supply distribution network in Aq Qala City, Golestan Province, Northern Iran and standard methods were applied for microbiological analysis. The surface method was applied to test the heterotrophic bacteria and MPN method was used for coliform, fecal coliform and fecal streptococci bacteria measurements. Results: In 114 samples, heterotrophic bacteria count were over 500 CFU/ml, which the amount of fecal coliform, coliform, and fecal streptococci were 8, 32, and 20 CFU/100 ml, respectively. However, in the other 242 samples, with heterotrophic bacteria count being less than 500 CFU/ml, the amount of fecal coliform, coliform, and fecal streptococci was 7, 23, and 11 CFU/100ml, respectively. The relationship between heterotrophic bacteria, coliforms and fecal streptococci was highly significant (P<0.05). We observed the concentration of coliforms, fecal streptococci bacteria being high, whenever the concentration of heterotrophic bacteria in the water network systems was high. Conclusion: Interaction between heterotrophic bacteria and coliform, fecal coliforms, fecal streptococci bacteria in the Aq Qala City water supply networks was not notable. It can be due to high concentrations of organic carbon, bio-films and nutrients, which are necessary for growth, and survival of all microorganisms. PMID:26811820

In vitro enzymatic reduction kinetics of mineral oxides by membrane fractions from Shewanella oneidensis MR-1

NASA Astrophysics Data System (ADS)

Ruebush, Shane S.; Icopini, Gary A.; Brantley, Susan L.; Tien, Ming

2006-01-01

This study documents the first example of in vitro solid-phase mineral oxide reduction by enzyme-containing membrane fractions. Previous in vitro studies have only reported the reduction of aqueous ions. Total membrane (TM) fractions from iron-grown cultures of Shewanella oneidensis MR-1 were isolated and shown to catalyze the reduction of goethite, hematite, birnessite, and ramsdellite/pyrolusite using formate. In contrast, nicotinamide adenine dinucleotide (NADH) and succinate cannot function as electron donors. The significant implications of observations related to this cell-free system are: (i) both iron and manganese mineral oxides are reduced by the TM fraction, but aqueous U(VI) is not; (ii) TM fractions from anaerobically grown, but not aerobically grown, cells can reduce the mineral oxides; (iii) electron shuttles and iron chelators are not needed for this in vitro reduction, documenting conclusively that reduction can occur by direct contact with the mineral oxide; (iv) electron shuttles and EDTA stimulate the in vitro Fe(III) reduction, documenting that exogenous molecules can enhance rates of enzymatic mineral reduction; and (v) multiple membrane components are involved in solid-phase oxide reduction. The membrane fractions, consisting of liposomes of cytoplasmic and outer membrane segments, contain at least 100 proteins including the enzyme that oxidizes formate, formate dehydrogenase. Mineral oxide reduction was inhibited by the addition of detergent Triton X-100, which solubilizes membranes and their associated proteins, consistent with the involvement of multiple electron carriers that are disrupted by detergent addition. In contrast, formate dehydrogenase activity was not inhibited by Triton X-100. The addition of anthraquinone-2,6-disulfonate (AQDS) and menaquinone-4 was unable to restore activity; however, menadione (MD) restored 33% of the activity. The addition of AQDS and MD to reactions without added detergent increased the rate of goethite

Quality assessment of salted, modified atmosphere packaged rainbow trout under treatment with oregano essential oil.

PubMed

Pyrgotou, Nikoletta; Giatrakou, Vasiliki; Ntzimani, Athina; Savvaidis, Ioannis N

2010-09-01

The present study evaluated the effect of oregano essential oil (EO) on fresh salted, packaged (45%CO(2)/5%O(2)/50%N(2)) rainbow trout fillets and stored for a period of 21 d at 4 °C. Treatments included the following: M1 (control without added EO), M2 (EO 0.2%, v/w), and M3 (0.4%, v/w). Populations of lactic acid bacteria (LAB), H(2)S-producing bacteria (including Shewanella putrefaciens), Enterobacteriaceae, and Pseudomonas spp. reached higher final numbers in control (M1) than for M2 and M3 samples. Under treatments M2 and M3, total volatile basic nitrogen (TVBN) and trimethylamine nitrogen (TMAN) values were lower than for M1 samples, whereas lipid oxidation, as judged by determination of thiobarbituric acid values (TBA), did not occur during the refrigerated storage period. Interestingly, treatment M2 resulted in a shelf-life extension of 7 to 8 d for the fresh trout fillets, whereas treatment M3 proved unsuitable (due to strong odor) for trout fillet preservation, as determined by sensory evaluation. The use of an essential oil such as oregano oil in fresh fish preservation may be considered an alternative "natural" additive, enhancing the sensory characteristics and extending the shelf life of the product.

Genomics of Probiotic Bacteria

NASA Astrophysics Data System (ADS)

O'Flaherty, Sarah; Goh, Yong Jun; Klaenhammer, Todd R.

Probiotic bacteria from the Lactobacillus and Bifidobacterium species belong to the Firmicutes and the Actinobacteria phylum, respectively. Lactobacilli are members of the lactic acid bacteria (LAB) group, a broadly defined family of microorganisms that ferment various hexoses into primarily lactic acid. Lactobacilli are typically low G + C gram-positive species which are phylogenetically diverse, with over 100 species documented to date. Bifidobacteria are heterofermentative, high G + C content bacteria with about 30 species of bifidobacteria described to date.

Antibacterial activity of plant extracts on foodborne bacterial pathogens and food spoilage bacteria

USDA-ARS?s Scientific Manuscript database

Bacterial foodborne diseases are caused by consumption of foods contaminated with bacteria and/or their toxins. In this study, we evaluated antibacterial properties of twelve different extracts including turmeric, lemon and different kinds of teas against four major pathogenic foodborne bacteria inc...

Biotechnology of Anoxygenic Phototrophic Bacteria.

PubMed

Frigaard, Niels-Ulrik

Anoxygenic phototrophic bacteria are a diverse collection of organisms that are defined by their ability to grow using energy from light without evolving oxygen. The dominant groups are purple sulfur bacteria, purple nonsulfur bacteria, green sulfur bacteria, and green and red filamentous anoxygenic phototrophic bacteria. They represent several bacterial phyla but they all have bacteriochlorophylls and carotenoids and photochemical reaction centers which generate ATP and cellular reductants used for CO 2 fixation. They typically have an anaerobic lifestyle in the light, although some grow aerobically in the dark. Some of them oxidize inorganic sulfur compounds for light-dependent CO 2 fixation; this ability can be exploited for photobiological removal of hydrogen sulfide from wastewater and biogas. The anoxygenic phototrophic bacteria also perform bioremediation of recalcitrant dyes, pesticides, and heavy metals under anaerobic conditions. Finally, these organisms may be useful for overexpression of membrane proteins and photobiological production of H 2 and other valuable compounds.

Microbial fuel cells equipped with an iron-plated carbon-felt anode and Shewanella oneidensis MR-1 with corn steep liquor as a fuel.

PubMed

Phansroy, Nichanan; Khawdas, Wichean; Watanabe, Keigo; Aso, Yuji; Ohara, Hitomi

2018-05-12

A single chamber type microbial fuel cell (MFC) with 100 mL of chamber volume and 50 cm 2 of air-cathode was developed in this study wherein a developed iron-plated carbon-felt anode and Shewanella oneidensis MR-1 were used. The performance of the iron-plated carbon-felt anode and the possibility of corn steep liquor (CSL) as a fuel, which was the byproduct of corn wet milling and contained lactic acid, was investigated here. MFCs equipped with iron-plated or non-plated carbon-felt anodes exhibited maximum current densities of 443 or 302 mA/m 2 using 10 g/L of reagent-grade lactic acid, respectively. In addition, using centrifuged CSL without insoluble ingredients or non-centrifuged CSL as a fuel, the maximum current densities of the MFCs with iron-plated carbon-felt anode were 321 or 158 mA/m 2 , respectively. This report demonstrated the effect of iron-plated carbon-felt anode for electricity generation of MFC using S. oneidensis MR-1 and the performance of CSL as a fuel. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Membrane-active macromolecules kill antibiotic-tolerant bacteria and potentiate antibiotics towards Gram-negative bacteria

PubMed Central

Uppu, Divakara S. S. M.; Konai, Mohini M.; Sarkar, Paramita; Samaddar, Sandip; Fensterseifer, Isabel C. M.; Farias-Junior, Celio; Krishnamoorthy, Paramanandam; Shome, Bibek R.; Franco, Octávio L.

2017-01-01

Chronic bacterial biofilms place a massive burden on healthcare due to the presence of antibiotic-tolerant dormant bacteria. Some of the conventional antibiotics such as erythromycin, vancomycin, linezolid, rifampicin etc. are inherently ineffective against Gram-negative bacteria, particularly in their biofilms. Here, we report membrane-active macromolecules that kill slow dividing stationary-phase and antibiotic tolerant cells of Gram-negative bacteria. More importantly, these molecules potentiate antibiotics (erythromycin and rifampicin) to biofilms of Gram-negative bacteria. These molecules eliminate planktonic bacteria that are liberated after dispersion of biofilms (dispersed cells). The membrane-active mechanism of these molecules forms the key for potentiating the established antibiotics. Further, we demonstrate that the combination of macromolecules and antibiotics significantly reduces bacterial burden in mouse burn and surgical wound infection models caused by Acinetobacter baumannii and Carbapenemase producing Klebsiella pneumoniae (KPC) clinical isolate respectively. Colistin, a well-known antibiotic targeting the lipopolysaccharide (LPS) of Gram-negative bacteria fails to kill antibiotic tolerant cells and dispersed cells (from biofilms) and bacteria develop resistance to it. On the contrary, these macromolecules prevent or delay the development of bacterial resistance to known antibiotics. Our findings emphasize the potential of targeting the bacterial membrane in antibiotic potentiation for disruption of biofilms and suggest a promising strategy towards developing therapies for topical treatment of Gram-negative infections. PMID:28837596

Material and method for promoting the growth of anaerobic bacteria

DOEpatents

Adler, Howard I.

1984-01-01

A material and method for promoting the growth of anaerobic bacteria which includes a nutrient media containing a hydrogen donor and sterile membrane fragments of bacteria having an electron transfer system which reduces oxygen to water. Dissolved oxygen in the medium is removed by adding the sterile membrane fragments to the nutrient medium and holding the medium at a temperature of about 10.degree. to about 60.degree. C. until the dissolved oxygen is removed.

Bacteria Mediate Methylation of Iodine in Marine and Terrestrial Environments

PubMed Central

Amachi, Seigo; Kamagata, Yoichi; Kanagawa, Takahiro; Muramatsu, Yasuyuki

2001-01-01

Methyl iodide (CH3I) plays an important role in the natural iodine cycle and participates in atmospheric ozone destruction. However, the main source of this compound in nature is still unclear. Here we report that a wide variety of bacteria including terrestrial and marine bacteria are capable of methylating the environmental level of iodide (0.1 μM). Of the strains tested, Rhizobium sp. strain MRCD 19 was chosen for further analysis, and it was found that the cell extract catalyzed the methylation of iodide with S-adenosyl-l-methionine as the methyl donor. These results strongly indicate that bacteria contribute to iodine transfer from the terrestrial and marine ecosystems into the atmosphere. PMID:11375186

Electro-responsive supramolecular graphene oxide hydrogels for active bacteria adsorption and removal

NASA Astrophysics Data System (ADS)

Xue, Bin; Cao, Yi; Wang, Wei

Bacteria are major contaminations in drinking water and healthcare products. Bacteria contamination may cause severe health problems, including food poisoning and diseases. Currently water sterilization and purification methods to remove contaminated bacteria are mainly based on the size-exclusion mechanism. In order to completely remove all bacteria in water, the pore sizes of the membranes or cartilages should be comparable to the size of bacteria, which inevitable leads to high cross-membrane water pressure and slow purification speed. Moreover, the membranes can easily get clogged. Therefore it is highly demanded to develop efficient methods and novel materials for water purification. Recently, Cui and coworker have introduced a bacteria inactivation method with high efficiency and fast purification speed based on a kind of complex materials made of silver nanofibers, carbon nanotubes and cotton, operating in an electric field. With the help of electric field, the bacteria can be efficiently kill when passing through the membrance even the pore sizes are larger than bacteria. Inspired by their work, here we report a proof-of-principle demonstration of bacteria removal using electro-reponsive hydrogels. This work is funded by Six talent peaks project in Jiangsu Province, the National Natural Science Foundation of China (Nos. 11304156, 11334004, 31170813, 81421091 and 91127026), the 973 Program of China (No. 2012CB921801 and 2013CB834100), the Priority Ac.

Psychobiotics and the Manipulation of Bacteria-Gut-Brain Signals.

PubMed

Sarkar, Amar; Lehto, Soili M; Harty, Siobhán; Dinan, Timothy G; Cryan, John F; Burnet, Philip W J

2016-11-01

Psychobiotics were previously defined as live bacteria (probiotics) which, when ingested, confer mental health benefits through interactions with commensal gut bacteria. We expand this definition to encompass prebiotics, which enhance the growth of beneficial gut bacteria. We review probiotic and prebiotic effects on emotional, cognitive, systemic, and neural variables relevant to health and disease. We discuss gut-brain signalling mechanisms enabling psychobiotic effects, such as metabolite production. Overall, knowledge of how the microbiome responds to exogenous influence remains limited. We tabulate several important research questions and issues, exploration of which will generate both mechanistic insights and facilitate future psychobiotic development. We suggest the definition of psychobiotics be expanded beyond probiotics and prebiotics to include other means of influencing the microbiome. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Detection and categorization of bacteria habitats using shallow linguistic analysis

PubMed Central

2015-01-01

Background Information regarding bacteria biotopes is important for several research areas including health sciences, microbiology, and food processing and preservation. One of the challenges for scientists in these domains is the huge amount of information buried in the text of electronic resources. Developing methods to automatically extract bacteria habitat relations from the text of these electronic resources is crucial for facilitating research in these areas. Methods We introduce a linguistically motivated rule-based approach for recognizing and normalizing names of bacteria habitats in biomedical text by using an ontology. Our approach is based on the shallow syntactic analysis of the text that include sentence segmentation, part-of-speech (POS) tagging, partial parsing, and lemmatization. In addition, we propose two methods for identifying bacteria habitat localization relations. The underlying assumption for the first method is that discourse changes with a new paragraph. Therefore, it operates on a paragraph-basis. The second method performs a more fine-grained analysis of the text and operates on a sentence-basis. We also develop a novel anaphora resolution method for bacteria coreferences and incorporate it with the sentence-based relation extraction approach. Results We participated in the Bacteria Biotope (BB) Task of the BioNLP Shared Task 2013. Our system (Boun) achieved the second best performance with 68% Slot Error Rate (SER) in Sub-task 1 (Entity Detection and Categorization), and ranked third with an F-score of 27% in Sub-task 2 (Localization Event Extraction). This paper reports the system that is implemented for the shared task, including the novel methods developed and the improvements obtained after the official evaluation. The extensions include the expansion of the OntoBiotope ontology using the training set for Sub-task 1, and the novel sentence-based relation extraction method incorporated with anaphora resolution for Sub-task 2. These

Phenotypic and phylogenetic characterization of ruminal tannin-tolerant bacteria.

PubMed

Nelson, K E; Thonney, M L; Woolston, T K; Zinder, S H; Pell, A N

1998-10-01

The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed.

Phenotypic and Phylogenetic Characterization of Ruminal Tannin-Tolerant Bacteria

PubMed Central

Nelson, Karen E.; Thonney, Michael L.; Woolston, Tina K.; Zinder, Stephen H.; Pell, Alice N.

1998-01-01

The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed. PMID:9758806

Interactions between Diatoms and Bacteria

PubMed Central

Amin, Shady A.; Parker, Micaela S.

2012-01-01

Summary: Diatoms and bacteria have cooccurred in common habitats for hundreds of millions of years, thus fostering specific associations and interactions with global biogeochemical consequences. Diatoms are responsible for one-fifth of the photosynthesis on Earth, while bacteria remineralize a large portion of this fixed carbon in the oceans. Through their coexistence, diatoms and bacteria cycle nutrients between oxidized and reduced states, impacting bioavailability and ultimately feeding higher trophic levels. Here we present an overview of how diatoms and bacteria interact and the implications of these interactions. We emphasize that heterotrophic bacteria in the oceans that are consistently associated with diatoms are confined to two phyla. These consistent bacterial associations result from encounter mechanisms that occur within a microscale environment surrounding a diatom cell. We review signaling mechanisms that occur in this microenvironment to pave the way for specific interactions. Finally, we discuss known interactions between diatoms and bacteria and exciting new directions and research opportunities in this field. Throughout the review, we emphasize new technological advances that will help in the discovery of new interactions. Deciphering the languages of diatoms and bacteria and how they interact will inform our understanding of the role these organisms have in shaping the ocean and how these interactions may change in future oceans. PMID:22933565

Pathways for degradation of lignin in bacteria and fungi.

PubMed

Bugg, Timothy D H; Ahmad, Mark; Hardiman, Elizabeth M; Rahmanpour, Rahman

2011-11-01

Lignin is a heterogeneous aromatic polymer found as 10-35% of lignocellulose, found in plant cell walls. The bio-conversion of plant lignocellulose to glucose is an important part of second generation biofuel production, but the resistance of lignin to breakdown is a major obstacle in this process, hence there is considerable interest in the microbial breakdown of lignin. White-rot fungi are known to break down lignin with the aid of extracellular peroxidase and laccase enzymes. There are also reports of bacteria that can degrade lignin, and recent work indicates that bacterial lignin breakdown may be more significant than previously thought. The review will discuss the enzymes for lignin breakdown in fungi and bacteria, and the catabolic pathways for breakdown of the β-aryl ether, biphenyl and other components of lignin in bacteria and fungi. The review will also discuss small molecule phenolic breakdown products from lignin that have been identified from lignin-degrading microbes, and includes a bioinformatic analysis of the occurrence of known lignin-degradation pathways in Gram-positive and Gram-negative bacteria.

Biodegradable gelatin-chitosan films incorporated with essential oils as antimicrobial agents for fish preservation.

PubMed

Gómez-Estaca, J; López de Lacey, A; López-Caballero, M E; Gómez-Guillén, M C; Montero, P

2010-10-01

Essential oils of clove (Syzygium aromaticum L.), fennel (Foeniculum vulgare Miller), cypress (Cupressus sempervirens L.), lavender (Lavandula angustifolia), thyme (Thymus vulgaris L.), herb-of-the-cross (Verbena officinalis L.), pine (Pinus sylvestris) and rosemary (Rosmarinus officinalis) were tested for their antimicrobial activity on 18 genera of bacteria, which included some important food pathogen and spoilage bacteria. Clove essential oil showed the highest inhibitory effect, followed by rosemary and lavender. In an attempt to evaluate the usefulness of these essential oils as food preservatives, they were also tested on an extract made of fish, where clove and thyme essential oils were the most effective. Then, gelatin-chitosan-based edible films incorporated with clove essential oil were elaborated and their antimicrobial activity tested against six selected microorganisms: Pseudomonas fluorescens, Shewanella putrefaciens, Photobacterium phosphoreum, Listeria innocua, Escherichia coli and Lactobacillus acidophilus. The clove-containing films inhibited all these microorganisms irrespectively of the film matrix or type of microorganism. In a further experiment, when the complex gelatin-chitosan film incorporating clove essential oil was applied to fish during chilled storage, the growth of microorganisms was drastically reduced in gram-negative bacteria, especially enterobacteria, while lactic acid bacteria remained practically constant for much of the storage period. The effect on the microorganisms during this period was in accordance with biochemical indexes of quality, indicating the viability of these films for fish preservation. 2010 Elsevier Ltd. All rights reserved.

Ice-Nucleating Bacteria

NASA Astrophysics Data System (ADS)

Obata, Hitoshi

Since the discovery of ice-nucleating bacteria in 1974 by Maki et al., a large number of studies on the biological characteristics, ice-nucleating substance, ice nucleation gene and frost damage etc. of the bacteria have been carried out. Ice-nucleating bacteria can cause the freezing of water at relatively warm temperature (-2.3°C). Tween 20 was good substrates for ice-nucleating activity of Pseudomonas fluorescens KUIN-1. Major fatty acids of Isolate (Pseudomonas fluorescens) W-11 grown at 30°C were palmitic, cis-9-hexadecenoic and cis-11-octadecenoic which amounted to 90% of the total fatty acids. Sequence analysis shows that an ice nucleation gene from Pseudomonas fluorescens is related to the gene of Pseudomonas syringae.

Transcriptome analysis reveals a stress response of Shewanella oneidensis deprived of background levels of ionizing radiation

PubMed Central

Li, Xiaoping; Schilkey, Faye; Smith, Geoffrey B.

2018-01-01

Natural ionizing background radiation has exerted a constant pressure on organisms since the first forms of life appeared on Earth, so that cells have developed molecular mechanisms to avoid or repair damages caused directly by radiation or indirectly by radiation-induced reactive oxygen species (ROS). In the present study, we investigated the transcriptional effect of depriving Shewanella oneidensis cultures of background levels of radiation by growing the cells in a mine 655 m underground, thus reducing the dose rate from 72.1 to 0.9 nGy h-1 from control to treatment, respectively. RNASeq transcriptome analysis showed the differential expression of 4.6 and 7.6% of the S. oneidensis genome during early- and late-exponential phases of growth, respectively. The greatest change observed in the treatment was the downregulation of ribosomal proteins (21% of all annotated ribosomal protein genes during early- and 14% during late-exponential) and tRNA genes (14% of all annotated tRNA genes in early-exponential), indicating a marked decrease in protein translation. Other significant changes were the upregulation of membrane transporters, implying an increase in the traffic of substrates across the cell membrane, as well as the up and downregulation of genes related to respiration, which could be interpreted as a response to insufficient oxidants in the cells. In other reports, there is evidence in multiple species that some ROS not just lead to oxidative stress, but act as signaling molecules to control cellular metabolism at the transcriptional level. Consistent with these reports, several genes involved in the metabolism of carbon and biosynthesis of amino acids were also regulated, lending support to the idea of a wide metabolic response. Our results indicate that S. oneidensis is sensitive to the withdrawal of background levels of ionizing radiation and suggest that a transcriptional response is required to maintain homeostasis and retain normal growth. PMID:29768440

Laue Crystal Structure of Shewanella oneidensis Cytochrome c Nitrite Reductase from a High-yield Expression System

PubMed Central

Youngblut, Matthew; Judd, Evan T.; Srajer, Vukica; Sayyed, Bilal; Goelzer, Tyler; Elliott, Sean J.; Schmidt, Marius; Pacheco, A. Andrew

2012-01-01

The high-yield expression and purification of Shewanella oneidensis cytochrome c nitrite reductase (ccNiR), and its characterization by a variety of methods, notably Laue crystallography, is reported. A key component of the expression system is an artificial ccNiR gene in which the N-terminal signal peptide from the highly expressed S. oneidensis protein “Small Tetra-heme c” replaces the wild-type signal peptide. This gene, inserted into the plasmid pHSG298 and expressed in S. oneidensis TSP-1 strain, generated ~20 mg crude ccNiR/L culture, compared with 0.5–1 mg/L for untransformed cells. Purified ccNiR has nitrite and hydroxylamine reductase activities comparable to those previously reported for E. coli ccNiR, and is stable for over two weeks in pH 7 solution at 4° C. UV/Vis spectropotentiometric titrations and protein film voltammetry identified 5 independent 1-electron reduction processes. Global analysis of the spectropotentiometric data also allowed determination of the extinction coefficient spectra for the 5 reduced ccNiR species. The characteristics of the individual extinction coefficient spectra suggest that, within each reduced species, the electrons are distributed amongst the various hemes, rather than being localized on specific heme centers. The purified ccNiR yielded good quality crystals, with which the 2.59 Å resolution structure was solved at room temperature using the Laue diffraction method. The structure is similar to that of E. coli ccNiR, except in the region where the enzyme interacts with its physiological electron donor (CymA in the case of S. oneidensis ccNiR, NrfB in the case of the E. coli protein). PMID:22382353

Money and transmission of bacteria

PubMed Central

2013-01-01

Money is one of the most frequently passed items in the world. The aim of this study was to ascertain the survival status of bacteria including Staphylococcus aureus, Escherichia coli, and Vancomycin- Resistant Enterococci (VRE) on banknotes from different countries and the transmission of bacteria to people who come in contact with the banknotes. The survival rate was highest for the Romanian Leu yielding all three microorganisms used after both three and six hours of drying. Furthermore, the Leu was the only banknote to yield VRE after one day of drying. Other currencies either enabled the survival of Extended-Spectrum Beta-Lactamases (ESBL) and VRE (e.g. Euro), but not of MRSA, or the other way round (e.g. US Dollar). While a variety of factors such as community hygiene levels, people’s behaviour, and antimicrobial resistance rates at community level obviously have influence on the transmission of resistant microorganisms, the type of banknote-paper may be an additional variable to consider. PMID:23985137

Silver enhances antibiotic activity against gram-negative bacteria.

PubMed

Morones-Ramirez, J Ruben; Winkler, Jonathan A; Spina, Catherine S; Collins, James J

2013-06-19

A declining pipeline of clinically useful antibiotics has made it imperative to develop more effective antimicrobial therapies, particularly against difficult-to-treat Gram-negative pathogens. Silver has been used as an antimicrobial since antiquity, yet its mechanism of action remains unclear. We show that silver disrupts multiple bacterial cellular processes, including disulfide bond formation, metabolism, and iron homeostasis. These changes lead to increased production of reactive oxygen species and increased membrane permeability of Gram-negative bacteria that can potentiate the activity of a broad range of antibiotics against Gram-negative bacteria in different metabolic states, as well as restore antibiotic susceptibility to a resistant bacterial strain. We show both in vitro and in a mouse model of urinary tract infection that the ability of silver to induce oxidative stress can be harnessed to potentiate antibiotic activity. Additionally, we demonstrate in vitro and in two different mouse models of peritonitis that silver sensitizes Gram-negative bacteria to the Gram-positive-specific antibiotic vancomycin, thereby expanding the antibacterial spectrum of this drug. Finally, we used silver and antibiotic combinations in vitro to eradicate bacterial persister cells, and show both in vitro and in a mouse biofilm infection model that silver can enhance antibacterial action against bacteria that produce biofilms. This work shows that silver can be used to enhance the action of existing antibiotics against Gram-negative bacteria, thus strengthening the antibiotic arsenal for fighting bacterial infections.

Electrochemical synthesis of formic acid from CO2 catalyzed by Shewanella oneidensis MR-1 whole-cell biocatalyst.

PubMed

Le, Quang Anh Tuan; Kim, Hee Gon; Kim, Yong Hwan

2018-09-01

The electro-biocatalytic conversion of CO 2 into formic acid using whole-cell and isolated biocatalysts is useful as an alternative route for CO 2 sequestration. In this study, Shewanella oneidensis MR-1 (S. oneidensis MR-1), a facultative aerobic bacterium that has been extensively studied for its utility as biofuel cells as well as for the detoxification of heavy metal oxides (i.e., MnO 2 , uranium), has been applied for the first time as a whole-cell biocatalyst for formic acid synthesis from gaseous CO 2 and electrons supplied from an electrode. S. oneidensis MR-1, when aerobically grown in Luria-Bertani (LB) medium, exhibited its ability as a whole-cell biocatalyst for the conversion of CO 2 into formic acid with moderate productivity of 0.59 mM h -1 for 24 h. In addition, an optimization of growth conditions of S. oneidensis MR-1 resulted in a remarkable increase in productivity. The CO 2 reduction reaction catalyzed by S. oneidensis MR-1, when anaerobically grown in newly optimized LB medium supplemented with fumarate and nitrate, exhibited 3.2-fold higher productivity (1.9 mM h -1 for 72 h) compared to that grown aerobically in only LB medium. Furthermore, the average conversion rate of formic acid synthesis catalyzed by S. oneidensis MR-1 when grown in the optimal medium over a period of 72 h was 3.8 mM h -1  g -1 wet-cell, which is 9.6-fold higher than that catalyzed by Methylobacterium extorquens AM1 whole-cells in our previous study. Copyright © 2018 Elsevier Inc. All rights reserved.

Probing electron transfer mechanisms in Shewanella oneidensis MR-1 using a nanoelectrode platform and single-cell imaging

PubMed Central

Jiang, Xiaocheng; Hu, Jinsong; Fitzgerald, Lisa A.; Biffinger, Justin C.; Xie, Ping; Ringeisen, Bradley R.; Lieber, Charles M.

2010-01-01

Microbial fuel cells (MFCs) represent a promising approach for sustainable energy production as they generate electricity directly from metabolism of organic substrates without the need for catalysts. However, the mechanisms of electron transfer between microbes and electrodes, which could ultimately limit power extraction, remain controversial. Here we demonstrate optically transparent nanoelectrodes as a platform to investigate extracellular electron transfer in Shewanella oneidensis MR-1, where an array of nanoholes precludes or single window allows for direct microbe-electrode contacts. Following addition of cells, short-circuit current measurements showed similar amplitude and temporal response for both electrode configurations, while in situ optical imaging demonstrates that the measured currents were uncorrelated with the cell number on the electrodes. High-resolution imaging showed the presence of thin, 4- to 5-nm diameter filaments emanating from cell bodies, although these filaments do not appear correlated with current generation. Both types of electrodes yielded similar currents at longer times in dense cell layers and exhibited a rapid drop in current upon removal of diffusible mediators. Reintroduction of the original cell-free media yielded a rapid increase in current to ∼80% of original level, whereas imaging showed that the positions of > 70% of cells remained unchanged during solution exchange. Together, these measurements show that electron transfer occurs predominantly by mediated mechanism in this model system. Last, simultaneous measurements of current and cell positions showed that cell motility and electron transfer were inversely correlated. The ability to control and image cell/electrode interactions down to the single-cell level provide a powerful approach for advancing our fundamental understanding of MFCs. PMID:20837546

Influences of Media Compositions on Characteristics of Isolated Bacteria Exhibiting Lignocellulolytic Activities from Various Environmental Sites.

PubMed

Gong, Gyeongtaek; Lee, Sun-Mi; Woo, Han Min; Park, Tai Hyun; Um, Youngsoon

2017-11-01

Efficient isolation of lignocellulolytic bacteria is essential for the utilization of lignocellulosic biomass. In this study, bacteria with cellulolytic, xylanolytic, and lignolytic activities were isolated from environmental sites such as mountain, wetland, and mudflat using isolation media containing the combination of lignocellulose components (cellulose, xylan, and lignin). Eighty-nine isolates from the isolation media were characterized by analyzing taxonomic ranks and cellulolytic, xylanolytic, and lignolytic activities. Most of the cellulolytic bacteria showed multienzymatic activities including xylanolytic activity. The isolation media without lignin were efficient in isolating bacteria exhibiting multienzymatic activities even including lignolytic activity, whereas a lignin-containing medium was effective to isolate bacteria exhibiting lignolytic activity only. Multienzymatic activities were mainly observed in Bacillus and Streptomyces, while Burkholderia was the most abundant genus with lignolytic activity only. This study provides insight into isolation medium for efficient isolation of lignocellulose-degrading microorganisms.

Diverse Bacteria Inhabit Living Hyphae of Phylogenetically Diverse Fungal Endophytes▿ †

PubMed Central

Hoffman, Michele T.; Arnold, A. Elizabeth

2010-01-01

Both the establishment and outcomes of plant-fungus symbioses can be influenced by abiotic factors, the interplay of fungal and plant genotypes, and additional microbes associated with fungal mycelia. Recently bacterial endosymbionts were documented in soilborne Glomeromycota and Mucoromycotina and in at least one species each of mycorrhizal Basidiomycota and Ascomycota. Here we show for the first time that phylogenetically diverse endohyphal bacteria occur in living hyphae of diverse foliar endophytes, including representatives of four classes of Ascomycota. We examined 414 isolates of endophytic fungi, isolated from photosynthetic tissues of six species of cupressaceous trees in five biogeographic provinces, for endohyphal bacteria using microscopy and molecular techniques. Viable bacteria were observed within living hyphae of endophytic Pezizomycetes, Dothideomycetes, Eurotiomycetes, and Sordariomycetes from all tree species and biotic regions surveyed. A focus on 29 fungus/bacterium associations revealed that bacterial and fungal phylogenies were incongruent with each other and with taxonomic relationships of host plants. Overall, eight families and 15 distinct genotypes of endohyphal bacteria were recovered; most were members of the Proteobacteria, but a small number of Bacillaceae also were found, including one that appears to occur as an endophyte of plants. Frequent loss of bacteria following subculturing suggests a facultative association. Our study recovered distinct lineages of endohyphal bacteria relative to previous studies, is the first to document their occurrence in foliar endophytes representing four of the most species-rich classes of fungi, and highlights for the first time their diversity and phylogenetic relationships with regard both to the endophytes they inhabit and the plants in which these endophyte-bacterium symbiota occur. PMID:20435775

Relationship between antibiotic- and disinfectant-resistance profiles in bacteria harvested from tap water.

PubMed

Khan, Sadia; Beattie, Tara K; Knapp, Charles W

2016-06-01

Chlorination is commonly used to control levels of bacteria in drinking water; however, viable bacteria may remain due to chlorine resistance. What is concerning is that surviving bacteria, due to co-selection factors, may also have increased resistance to common antibiotics. This would pose a public health risk as it could link resistant bacteria in the natural environment to human population. Here, we investigated the relationship between chlorine- and antibiotic-resistances by harvesting 148 surviving bacteria from chlorinated drinking-water systems and compared their susceptibilities against chlorine disinfectants and antibiotics. Twenty-two genera were isolated, including members of Paenibacillus, Burkholderia, Escherichia, Sphingomonas and Dermacoccus species. Weak (but significant) correlations were found between chlorine-tolerance and minimum inhibitory concentrations against the antibiotics tetracycline, sulfamethoxazole and amoxicillin, but not against ciprofloxacin; this suggest that chlorine-tolerant bacteria are more likely to also be antibiotic resistant. Further, antibiotic-resistant bacteria survived longer than antibiotic-sensitive organisms when exposed to free chlorine in a contact-time assay; however, there were little differences in susceptibility when exposed to monochloramine. Irrespective of antibiotic-resistance, spore-forming bacteria had higher tolerance against disinfection compounds. The presence of chlorine-resistant bacteria surviving in drinking-water systems may carry additional risk of antibiotic resistance. Copyright © 2016 Elsevier Ltd. All rights reserved.

Material and method for promoting the growth of anaerobic bacteria

DOEpatents

Adler, H.I.

1984-10-09

A material and method is disclosed for promoting the growth of anaerobic bacteria which includes a nutrient media containing a hydrogen donor and sterile membrane fragments of bacteria having an electron transfer system which reduces oxygen to water. Dissolved oxygen in the medium is removed by adding the sterile membrane fragments to the nutrient medium and holding the medium at a temperature of about 10 to about 60 C until the dissolved oxygen is removed. No Drawings

Geothrix fermentans Secretes Two Different Redox-Active Compounds To Utilize Electron Acceptors across a Wide Range of Redox Potentials

PubMed Central

Mehta-Kolte, Misha G.

2012-01-01

The current understanding of dissimilatory metal reduction is based primarily on isolates from the proteobacterial genera Geobacter and Shewanella. However, environments undergoing active Fe(III) reduction often harbor less-well-studied phyla that are equally abundant. In this work, electrochemical techniques were used to analyze respiratory electron transfer by the only known Fe(III)-reducing representative of the Acidobacteria, Geothrix fermentans. In contrast to previously characterized metal-reducing bacteria, which typically reach maximal rates of respiration at electron acceptor potentials of 0 V versus standard hydrogen electrode (SHE), G. fermentans required potentials as high as 0.55 V to respire at its maximum rate. In addition, G. fermentans secreted two different soluble redox-active electron shuttles with separate redox potentials (−0.2 V and 0.3 V). The compound with the lower midpoint potential, responsible for 20 to 30% of electron transfer activity, was riboflavin. The behavior of the higher-potential compound was consistent with hydrophilic UV-fluorescent molecules previously found in G. fermentans supernatants. Both electron shuttles were also produced when cultures were grown with Fe(III), but not when fumarate was the electron acceptor. This study reveals that Geothrix is able to take advantage of higher-redox-potential environments, demonstrates that secretion of flavin-based shuttles is not confined to Shewanella, and points to the existence of high-potential-redox-active compounds involved in extracellular electron transfer. Based on differences between the respiratory strategies of Geothrix and Geobacter, these two groups of bacteria could exist in distinctive environmental niches defined by redox potential. PMID:22843516

Genomics of Methylotrophy in Gram-Positive Methylamine-Utilizing Bacteria

PubMed Central

McTaggart, Tami L.; Beck, David A. C.; Setboonsarng, Usanisa; Shapiro, Nicole; Woyke, Tanja; Lidstrom, Mary E.; Kalyuzhnaya, Marina G.; Chistoserdova, Ludmila

2015-01-01

Gram-positive methylotrophic bacteria have been known for a long period of time, some serving as model organisms for characterizing the specific details of methylotrophy pathways/enzymes within this group. However, genome-based knowledge of methylotrophy within this group has been so far limited to a single species, Bacillus methanolicus (Firmicutes). The paucity of whole-genome data for Gram-positive methylotrophs limits our global understanding of methylotrophy within this group, including their roles in specific biogeochemical cycles, as well as their biotechnological potential. Here, we describe the isolation of seven novel strains of Gram-positive methylotrophs that include two strains of Bacillus and five representatives of Actinobacteria classified within two genera, Arthrobacter and Mycobacterium. We report whole-genome sequences for these isolates and present comparative analysis of the methylotrophy functional modules within these genomes. The genomic sequences of these seven novel organisms, all capable of growth on methylated amines, present an important reference dataset for understanding the genomic basis of methylotrophy in Gram-positive methylotrophic bacteria. This study is a major contribution to the field of methylotrophy, aimed at closing the gap in the genomic knowledge of methylotrophy within this diverse group of bacteria. PMID:27682081

Forest Soil Bacteria: Diversity, Involvement in Ecosystem Processes, and Response to Global Change

PubMed Central

Lladó, Salvador; López-Mondéjar, Rubén

2017-01-01

SUMMARY The ecology of forest soils is an important field of research due to the role of forests as carbon sinks. Consequently, a significant amount of information has been accumulated concerning their ecology, especially for temperate and boreal forests. Although most studies have focused on fungi, forest soil bacteria also play important roles in this environment. In forest soils, bacteria inhabit multiple habitats with specific properties, including bulk soil, rhizosphere, litter, and deadwood habitats, where their communities are shaped by nutrient availability and biotic interactions. Bacteria contribute to a range of essential soil processes involved in the cycling of carbon, nitrogen, and phosphorus. They take part in the decomposition of dead plant biomass and are highly important for the decomposition of dead fungal mycelia. In rhizospheres of forest trees, bacteria interact with plant roots and mycorrhizal fungi as commensalists or mycorrhiza helpers. Bacteria also mediate multiple critical steps in the nitrogen cycle, including N fixation. Bacterial communities in forest soils respond to the effects of global change, such as climate warming, increased levels of carbon dioxide, or anthropogenic nitrogen deposition. This response, however, often reflects the specificities of each studied forest ecosystem, and it is still impossible to fully incorporate bacteria into predictive models. The understanding of bacterial ecology in forest soils has advanced dramatically in recent years, but it is still incomplete. The exact extent of the contribution of bacteria to forest ecosystem processes will be recognized only in the future, when the activities of all soil community members are studied simultaneously. PMID:28404790

Forest Soil Bacteria: Diversity, Involvement in Ecosystem Processes, and Response to Global Change.

PubMed

Lladó, Salvador; López-Mondéjar, Rubén; Baldrian, Petr

2017-06-01

The ecology of forest soils is an important field of research due to the role of forests as carbon sinks. Consequently, a significant amount of information has been accumulated concerning their ecology, especially for temperate and boreal forests. Although most studies have focused on fungi, forest soil bacteria also play important roles in this environment. In forest soils, bacteria inhabit multiple habitats with specific properties, including bulk soil, rhizosphere, litter, and deadwood habitats, where their communities are shaped by nutrient availability and biotic interactions. Bacteria contribute to a range of essential soil processes involved in the cycling of carbon, nitrogen, and phosphorus. They take part in the decomposition of dead plant biomass and are highly important for the decomposition of dead fungal mycelia. In rhizospheres of forest trees, bacteria interact with plant roots and mycorrhizal fungi as commensalists or mycorrhiza helpers. Bacteria also mediate multiple critical steps in the nitrogen cycle, including N fixation. Bacterial communities in forest soils respond to the effects of global change, such as climate warming, increased levels of carbon dioxide, or anthropogenic nitrogen deposition. This response, however, often reflects the specificities of each studied forest ecosystem, and it is still impossible to fully incorporate bacteria into predictive models. The understanding of bacterial ecology in forest soils has advanced dramatically in recent years, but it is still incomplete. The exact extent of the contribution of bacteria to forest ecosystem processes will be recognized only in the future, when the activities of all soil community members are studied simultaneously. Copyright © 2017 American Society for Microbiology.

Re-engineering bacteria for ethanol production

DOEpatents

Yomano, Lorraine P; York, Sean W; Zhou, Shengde; Shanmugam, Keelnatham; Ingram, Lonnie O

2014-05-06

The invention provides recombinant bacteria, which comprise a full complement of heterologous ethanol production genes. Expression of the full complement of heterologous ethanol production genes causes the recombinant bacteria to produce ethanol as the primary fermentation product when grown in mineral salts medium, without the addition of complex nutrients. Methods for producing the recombinant bacteria and methods for producing ethanol using the recombinant bacteria are also disclosed.

Denitrification by extremely halophilic bacteria

NASA Technical Reports Server (NTRS)

Hochstein, L. I.; Tomlinson, G. A.

1985-01-01

Extremely halophilic bacteria were isolated from widely separated sites by anaerobic enrichment in the presence of nitrate. The anaerobic growth of several of these isolates was accompanied by the production of nitrite, nitrous oxide, and dinitrogen. These results are a direct confirmation of the existence of extremely halophilic denitrifying bacteria, and suggest that such bacteria may be common inhabitants of hypersaline environments.

Application Of Bacterial Iron Reduction For The Removal Of Iron Impurities From Industrial Silica Sand And Kaolin

NASA Astrophysics Data System (ADS)

Zegeye, A.; Yahaya, S.; Fialips, C. I.; White, M.; Manning, D. A.; Gray, N.

2008-12-01

Biogeochemical evidence exists to support the potential importance of crystalline or amorphous Fe minerals as electron acceptor for Fe reducing bacteria in soils and subsurface sediments. This microbial metabolic activity can be exploited as alternative method in different industrial applications. For instance, the removal of ferric iron impurities from minerals for the glass and paper industries currently rely on physical and chemical treatments having substantial economical and environmental disadvantages. The ability to remove iron by other means, such as bacterial iron reduction, may reduce costs, allow lower grade material to be mined, and improve the efficiency of mineral processing. Kaolin clay and silica sand are used in a wide range of industrial applications, particularly in paper, ceramics and glass manufacturing. Depending on the geological conditions of deposition, they are often associated with iron (hydr)oxides that are either adsorbed to the mineral surfaces or admixed as separate iron bearing minerals. In this study, we have examined the Fe(III) removal efficiency from kaolin and silica sand by a series of iron- reducing bacteria from the Shewanella species (S. alga BrY, S. oneidensis MR-1, S. putrefaciens CN32 and S. putrefaciens ATCC 8071) in the presence of anthraquinone 2,6 disulfonate (AQDS). We have also investigated the effectiveness of a natural organic matter, extracted with the silica sand, as a substitute to AQDS for enhancing Fe(III) reduction kinetics. The microbial reduction of Fe(III) was achieved using batch cultures under non-growth conditions. The rate and the extent of Fe(III) reduction was monitored as a function of the initial Fe(III) content, Shewanella species and temperature. The bacterially- treated minerals were analyzed by transmission electron microscopy (TEM) and X-ray diffraction (XRD) to observe any textural and mineralogical transformation. The whiteness and ISO brightness of the kaolin was also measured by

Influence of surfaces on sulphidogenic bacteria.

PubMed

Bass, C J; Webb, J S; Sanders, P F; Lappin-Scott, H M

1996-01-01

Sulphidogenic bacteria in oil reservoirs are of great economic importance in terms of souring, fouling and corrosion. Mixed cultures containing these bacteria were isolated from chalk formations in North Sea oil reservoirs. These were thermophilic cultures, growing optimally at 60°C. Oil formations are porous matrices, providing a very large surface area and ideal conditions for bacterial attachment, survival and growth. This study included assessments of sulphide production rates of thermophilic (t-)sulphidogen consortia with and without additional surfaces. The availability of a surface contributed significantly to the rate and extent of sulphide generation. Surfaces were offered in varying amounts to growing planktonic cultures: significantly more sulphide was produced from cultures in contact with a surface than from identical cultures in the absence of a surface. In another series of experiments, t-sulphidogens were added to chalk rock chips in the presence of nutrients and incubated for several months. This resulted in rapid sulphide generation, the final concentration being related to the initial nutrient concentration. Subsequent nutrient addition resulted in renewed sulphide generation. It is suggested that bacteria in reservoirs can withstand long periods of nutrient deprivation while attached within the porous rock matrix and opportunistically utilise nutrients when they become available.

Efflux-Mediated Drug Resistance in Bacteria: an Update

PubMed Central

Li, Xian-Zhi; Nikaido, Hiroshi

2010-01-01

Drug efflux pumps play a key role in drug resistance and also serve other functions in bacteria. There has been a growing list of multidrug and drug-specific efflux pumps characterized from bacteria of human, animal, plant and environmental origins. These pumps are mostly encoded on the chromosome although they can also be plasmid-encoded. A previous article (Li X-Z and Nikaido H, Drugs, 2004; 64[2]: 159–204) had provided a comprehensive review regarding efflux-mediated drug resistance in bacteria. In the past five years, significant progress has been achieved in further understanding of drug resistance-related efflux transporters and this review focuses on the latest studies in this field since 2003. This has been demonstrated in multiple aspects that include but are not limited to: further molecular and biochemical characterization of the known drug efflux pumps and identification of novel drug efflux pumps; structural elucidation of the transport mechanisms of drug transporters; regulatory mechanisms of drug efflux pumps; determining the role of the drug efflux pumps in other functions such as stress responses, virulence and cell communication; and development of efflux pump inhibitors. Overall, the multifaceted implications of drug efflux transporters warrant novel strategies to combat multidrug resistance in bacteria. PMID:19678712

Salivary Periodontopathic Bacteria in Children and Adolescents with Down Syndrome

PubMed Central

Lopes Devito, Karina; Ribeiro, Luiz Cláudio

2016-01-01

Objective To assess and compare salivary periodontopathic bacteria between groups of Down syndrome and non-Down syndrome children and adolescents. Materials and Methods This study included a sample of 30 Down syndrome children and adolescents (G-DS) and 30 age- and sex-matched non-Down syndrome subjects (G-ND). Clinical examination determined the gingival bleeding index (GBI) and plaque index. Unstimulated whole saliva samples were collected from all participants. The fluorescence in situ hybridization (FISH) technique identified the presence and density of eight periodontopathic bacteria in saliva. The statistical analysis included chi-square and Mann-Whitney U tests. Results In the G-DS group, bleeding on probing was more frequent (p = 0.037) and higher densities of Campylobacter rectus (p = 0.013), Porphyromonas gingivalis (p = 0.025), Treponema denticola (p = 0.026), Fusobacterium nucleatum (p = 0.013), Prevotella intermedia (p = 0.001) and Prevotella nigrescens (p = 0.008) were observed. Besides, in the G-DS, the densities of bacteria from the orange complex were significantly higher in the age group 3–7 years for F. nucleatum (p = 0.029), P. intermedia (p = 0.001) and P. nigrescens (p = 0.006). C. rectus was higher in the age group 8–12 years (p = 0.045). Conclusion The results showed that children and adolescents with Down syndrome have higher susceptibility to periodontal disease and number of periodontopathic bacteria. PMID:27727287

Social behavior of bacteria: from physics to complex organization

NASA Astrophysics Data System (ADS)

Ben-Jacob, E.

2008-10-01

I describe how bacteria develop complex colonial patterns by utilizing intricate communication capabilities, such as quorum sensing, chemotactic signaling and exchange of genetic information (plasmids) Bacteria do not store genetically all the information required for generating the patterns for all possible environments. Instead, additional information is cooperatively generated as required for the colonial organization to proceed. Each bacterium is, by itself, a biotic autonomous system with its own internal cellular informatics capabilities (storage, processing and assessments of information). These afford the cell certain plasticity to select its response to biochemical messages it receives, including self-alteration and broadcasting messages to initiate alterations in other bacteria. Hence, new features can collectively emerge during self-organization from the intra-cellular level to the whole colony. Collectively bacteria store information, perform decision make decisions (e.g. to sporulate) and even learn from past experience (e.g. exposure to antibiotics)-features we begin to associate with bacterial social behavior and even rudimentary intelligence. I also take Schrdinger’s’ “feeding on negative entropy” criteria further and propose that, in addition organisms have to extract latent information embedded in the environment. By latent information we refer to the non-arbitrary spatio-temporal patterns of regularities and variations that characterize the environmental dynamics. In other words, bacteria must be able to sense the environment and perform internal information processing for thriving on latent information embedded in the complexity of their environment. I then propose that by acting together, bacteria can perform this most elementary cognitive function more efficiently as can be illustrated by their cooperative behavior.

Potential sources of bacteria that are isolated from contact lenses during wear.

PubMed

Willcox, M D; Power, K N; Stapleton, F; Leitch, C; Harmis, N; Sweeney, D F

1997-12-01

The aim of this paper was to determine the possible contamination sources of contact lenses during wear. Potential sources of the microbiota that colonized hydrogel contact lenses during wear were examined. The microorganisms that colonize contact lenses were grown, identified, and compared to those microorganisms that colonized the lower lid margins, upper bulbar conjunctiva, hands, and contact lens cases of contact lens wearers. In addition, the incidence of contamination of the domestic water supply in the Sydney area was obtained, and this was compared to the incidence of colonization of contact lenses by microorganisms in general and gram-negative bacteria in particular. There was a wide diversity of bacteria that were isolated from each site sampled. Coagulase-negative staphylococci and Propionibacterium spp. were the most common isolates from all ocular sites examined, and constituted the normal ocular microbiota. Other bacteria, including members of the families Enterobacteriaceae and Pseudomonadaceae, were isolated infrequently from all sites, but most frequently from contact lens cases. Statistical analysis revealed that there was a correlation between the isolation of bacteria from the contact lens and the lower lid margin (p < 0.001). Analysis of this correlation revealed that this was true for the normal microbiota. A correlation was also noted between the colonization of contact lenses by gram-negative bacteria and contamination of the domestic water supply. This study has demonstrated that the likely route for the normal ocular microbiota colonizing contact lenses is via the lid margins, whereas colonization by gram-negative bacteria, including potential agents of microbial keratitis, is likely to be from the domestic water supply.

Effect of air pollution on the total bacteria and pathogenic bacteria in different sizes of particulate matter.

PubMed

Liu, Huan; Zhang, Xu; Zhang, Hao; Yao, Xiangwu; Zhou, Meng; Wang, Jiaqi; He, Zhanfei; Zhang, Huihui; Lou, Liping; Mao, Weihua; Zheng, Ping; Hu, Baolan

2018-02-01

In recent years, air pollution events have occurred frequently in China during the winter. Most studies have focused on the physical and chemical composition of polluted air. Some studies have examined the bacterial bioaerosols both indoors and outdoors. But few studies have focused on the relationship between air pollution and bacteria, especially pathogenic bacteria. Airborne PM samples with different diameters and different air quality index values were collected in Hangzhou, China from December 2014 to January 2015. High-throughput sequencing of 16S rRNA was used to categorize the airborne bacteria. Based on the NCBI database, the "Human Pathogen Database" was established, which is related to human health. Among all the PM samples, the diversity and concentration of total bacteria were lowest in the moderately or heavily polluted air. However, in the PM2.5 and PM10 samples, the relative abundances of pathogenic bacteria were highest in the heavily and moderately polluted air respectively. Considering the PM samples with different particle sizes, the diversities of total bacteria and the proportion of pathogenic bacteria in the PM10 samples were different from those in the PM2.5 and TSP samples. The composition of PM samples with different sizes range may be responsible for the variances. The relative humidity, carbon monoxide and ozone concentrations were the main factors, which affected the diversity of total bacteria and the proportion of pathogenic bacteria. Among the different environmental samples, the compositions of the total bacteria were very similar in all the airborne PM samples, but different from those in the water, surface soil, and ground dust samples. Which may be attributed to that the long-distance transport of the airflow may influence the composition of the airborne bacteria. This study of the pathogenic bacteria in airborne PM samples can provide a reference for environmental and public health researchers. Copyright © 2017 Elsevier Ltd

The impact of bacteria of circulating water on apatite-nepheline ore flotation.

PubMed

Evdokimova, G A; Gershenkop, A Sh; Fokina, N V

2012-01-01

A new phenomenon has been identified and studied-the impact of bacteria on the benefication process of non-sulphide ores using circulating water supply-a case study of apatite-nepheline ore. It is shown that bacteria deteriorate the floatability of apatite due to their interaction with active centres of calcium-containing minerals and intense flocculation, resulting in a decrease of the flotation process selectivity thus deteriorating the quality of concentrate. Based on the comparative analysis of primary sequences of 16S rRNA genes, there have been identified dominating bacteria species, recovered from the circulating water used at apatite-nepheline concentrating mills, and their phylogenetic position has been determined. All the bacteria were related to γ-Proteobacteria, including the Acinetobacter species, Pseudomonas alcaliphila, Ps. plecoglossicida, Stenotrophomonas rhizophila. A method of non-sulphide ores flotation has been developed with consideration of the bacterial factor. It consists in use of small concentrations of sodium hypochlorite, which inhibits the development of bacteria in the flotation of apatite-nepheline ores.

40 CFR 165.43 - Scope of pesticide products included.

Code of Federal Regulations, 2010 CFR

2010-07-01

... of pesticide products included. (a) Are manufacturing use products subject to the regulations in this subpart? No, the regulations in this subpart do not apply to manufacturing use products, as defined in... other chemical substances from contamination, fouling, or deterioration caused by bacteria, viruses...

Microbial activity at gigapascal pressures.

PubMed

Sharma, Anurag; Scott, James H; Cody, George D; Fogel, Marilyn L; Hazen, Robert M; Hemley, Russell J; Huntress, Wesley T

2002-02-22

We observed physiological and metabolic activity of Shewanella oneidensis strain MR1 and Escherichia coli strain MG1655 at pressures of 68 to 1680 megapascals (MPa) in diamond anvil cells. We measured biological formate oxidation at high pressures (68 to 1060 MPa). At pressures of 1200 to 1600 MPa, living bacteria resided in fluid inclusions in ice-VI crystals and continued to be viable upon subsequent release to ambient pressures (0.1 MPa). Evidence of microbial viability and activity at these extreme pressures expands by an order of magnitude the range of conditions representing the habitable zone in the solar system.

Diallylthiosulfinate (Allicin), a Volatile Antimicrobial from Garlic (Allium sativum), Kills Human Lung Pathogenic Bacteria, Including MDR Strains, as a Vapor.

PubMed

Reiter, Jana; Levina, Natalja; van der Linden, Mark; Gruhlke, Martin; Martin, Christian; Slusarenko, Alan J

2017-10-12

Garlic ( Allium sativum ) has potent antimicrobial activity due to allicin (diallylthiosulfinate) synthesized by enzyme catalysis in damaged garlic tissues. Allicin gives crushed garlic its characteristic odor and its volatility makes it potentially useful for combating lung infections. Allicin was synthesized (>98% pure) by oxidation of diallyl disulfide by H₂O₂ using formic acid as a catalyst and the growth inhibitory effect of allicin vapor and allicin in solution to clinical isolates of lung pathogenic bacteria from the genera Pseudomonas , Streptococcus , and Staphylococcus , including multi-drug resistant (MDR) strains, was demonstrated. Minimal inhibitory (MIC) and minimal bactericidal concentrations (MBC) were determined and compared to clinical antibiotics using standard European Committee on Antimicrobial Susceptibility Testing (EUCAST) procedures. The cytotoxicity of allicin to human lung and colon epithelial and murine fibroblast cells was tested in vitro and shown to be ameliorated by glutathione (GSH). Similarly, the sensitivity of rat precision-cut lung slices (PCLS) to allicin was decreased by raising the [GSH] to the approximate blood plasma level of 1 mM. Because allicin inhibited bacterial growth as a vapor, it could be used to combat bacterial lung infections via direct inhalation. Since there are no volatile antibiotics available to treat pulmonary infections, allicin, particularly at sublethal doses in combination with oral antibiotics, could make a valuable addition to currently available treatments.

Label-Free in Situ Discrimination of Live and Dead Bacteria by Surface-Enhanced Raman Scattering.

PubMed

Zhou, Haibo; Yang, Danting; Ivleva, Natalia P; Mircescu, Nicoleta E; Schubert, Sören; Niessner, Reinhard; Wieser, Andreas; Haisch, Christoph

2015-07-07

Techniques to distinguish between live and dead bacteria in a quantitative manner are in high demand in numerous fields including medical care, food safety, and public security as well as basic science research. This work demonstrates new nanostructures (silver nanoparticles coating bacteria structure, Bacteria@AgNPs) and their utility for rapid counting of live and dead bacteria by surface-enhanced Raman scattering (SERS). We found that suspensions containing Gram-negative organisms as well as AgNPs give strong SERS signals of live bacteria when generated selectively on the particle surface. However, almost no SERS signals can be detected from Bacteria@AgNPs suspensions containing dead bacteria. We demonstrate successful quantification of different percentages of dead bacteria both in bulk liquid and on glass surfaces by using SERS mapping on a single cell basis. Furthermore, different chemicals have been used to elucidate the mechanism involved in this observation. Finally, we used the Bacteria@AgNPs method to detect antibiotic resistance of E. coli strains against several antibiotics used in human medicine.

Bacteria, the endoplasmic reticulum and the unfolded protein response: friends or foes?

PubMed

Celli, Jean; Tsolis, Renée M

2015-02-01

The unfolded protein response (UPR) is a cytoprotective response that is aimed at restoring cellular homeostasis following physiological stress exerted on the endoplasmic reticulum (ER), which also invokes innate immune signalling in response to invading microorganisms. Although it has been known for some time that the UPR is modulated by various viruses, recent evidence indicates that it also has multiple roles during bacterial infections. In this Review, we describe how bacteria interact with the ER, including how bacteria induce the UPR, how subversion of the UPR promotes bacterial proliferation and how the UPR contributes to innate immune responses against invading bacteria.

The Effect of Bacteriophage Preparations on Intracellular Killing of Bacteria by Phagocytes

PubMed Central

Jończyk-Matysiak, Ewa; Łusiak-Szelachowska, Marzanna; Kłak, Marlena; Bubak, Barbara; Międzybrodzki, Ryszard; Weber-Dąbrowska, Beata; Żaczek, Maciej; Fortuna, Wojciech; Rogóż, Paweł; Letkiewicz, Sławomir; Szufnarowski, Krzysztof; Górski, Andrzej

2015-01-01

Intracellular killing of bacteria is one of the fundamental mechanisms against invading pathogens. Impaired intracellular killing of bacteria by phagocytes may be the reason of chronic infections and may be caused by antibiotics or substances that can be produced by some bacteria. Therefore, it was of great practical importance to examine whether phage preparations may influence the process of phagocyte intracellular killing of bacteria. It may be important especially in the case of patients qualified for experimental phage therapy (approximately half of the patients with chronic bacterial infections have their immunity impaired). Our analysis included 51 patients with chronic Gram-negative and Gram-positive bacterial infections treated with phage preparations at the Phage Therapy Unit in Wroclaw. The aim of the study was to investigate the effect of experimental phage therapy on intracellular killing of bacteria by patients' peripheral blood monocytes and polymorphonuclear neutrophils. We observed that phage therapy does not reduce patients' phagocytes' ability to kill bacteria, and it does not affect the activity of phagocytes in patients with initially reduced ability to kill bacteria intracellularly. Our results suggest that experimental phage therapy has no significant adverse effects on the bactericidal properties of phagocytes, which confirms the safety of the therapy. PMID:26783541

Metabolic plasticity for isoprenoid biosynthesis in bacteria.

PubMed

Pérez-Gil, Jordi; Rodríguez-Concepción, Manuel

2013-05-15

Isoprenoids are a large family of compounds synthesized by all free-living organisms. In most bacteria, the common precursors of all isoprenoids are produced by the MEP (methylerythritol 4-phosphate) pathway. The MEP pathway is absent from archaea, fungi and animals (including humans), which synthesize their isoprenoid precursors using the completely unrelated MVA (mevalonate) pathway. Because the MEP pathway is essential in most bacterial pathogens (as well as in the malaria parasites), it has been proposed as a promising new target for the development of novel anti-infective agents. However, bacteria show a remarkable plasticity for isoprenoid biosynthesis that should be taken into account when targeting this metabolic pathway for the development of new antibiotics. For example, a few bacteria use the MVA pathway instead of the MEP pathway, whereas others possess the two full pathways, and some parasitic strains lack both the MVA and the MEP pathways (probably because they obtain their isoprenoids from host cells). Moreover, alternative enzymes and metabolic intermediates to those of the canonical MVA or MEP pathways exist in some organisms. Recent work has also shown that resistance to a block of the first steps of the MEP pathway can easily be developed because several enzymes unrelated to isoprenoid biosynthesis can produce pathway intermediates upon spontaneous mutations. In the present review, we discuss the major advances in our knowledge of the biochemical toolbox exploited by bacteria to synthesize the universal precursors for their essential isoprenoids.

Bacteria entombed in the center of cholesterol gallstones induce fewer infectious manifestations than bacteria in the matrix of pigment stones.

PubMed

Stewart, Lygia; Griffiss, J McLeod; Jarvis, Gary A; Way, Lawrence W

2007-10-01

The clinical significance of bacteria in the pigment centers of cholesterol stones is unknown. We compared the infectious manifestations and characteristics of bacteria from pigment stones and predominantly cholesterol stones. Three hundred forty patients were studied. Bile was cultured. Gallstones were cultured and examined with scanning electron microscopy. Level of bacterial immunoglobulin G (bile, serum), complement killing, and tumor necrosis factor-alpha production were determined. Twenty-three percent of cholesterol stones and 68% of pigment stones contained bacteria (P < 0.0001). Stone culture correlated with scanning electron microscopy results. Pigment stone bacteria were more often present in bile and blood. Cholesterol stone bacteria caused more severe infections (19%) than sterile stones (0%), but less than pigment stone bacteria (57%) (P < 0.0001). Serum and bile from patients with cholesterol stone bacteria had less bacterial-specific immunoglobulin G. Cholesterol stone bacteria produced more slime. Pigment stone bacteria were more often killed by a patient's serum. Tumor necrosis factor-alpha production of the groups was similar. Bacteria are readily cultured from cholesterol stones with pigment centers, allowing for analysis of their virulence factors. Bacteria sequestered in cholesterol stones cause infectious manifestations, but less than bacteria in pigment stones. Possibly because of their isolation, cholesterol stone bacteria were less often present in bile and blood, induced less immunoglobulin G, were less often killed by a patient's serum, and demonstrated fewer infectious manifestations than pigment stone bacteria. This is the first study to analyze the clinical relevance of bacteria within cholesterol gallstones.

Anaerobic carboxydotrophic bacteria in geothermal springs identified using stable isotope probing.

PubMed

Brady, Allyson L; Sharp, Christine E; Grasby, Stephen E; Dunfield, Peter F

2015-01-01

Carbon monoxide (CO) is a potential energy and carbon source for thermophilic bacteria in geothermal environments. Geothermal sites ranging in temperature from 45 to 65°C were investigated for the presence and activity of anaerobic CO-oxidizing bacteria. Anaerobic CO oxidation potentials were measured at up to 48.9 μmoles CO g(-1) (wet weight) day(-1) within five selected sites. Active anaerobic carboxydotrophic bacteria were identified using (13)CO DNA stable isotope probing (SIP) combined with pyrosequencing of 16S rRNA genes amplified from labeled DNA. Bacterial communities identified in heavy DNA fractions were predominated by Firmicutes, which comprised up to 95% of all sequences in (13)CO incubations. The predominant bacteria that assimilated (13)C derived from CO were closely related (>98% 16S rRNA gene sequence identity) to genera of known carboxydotrophs including Thermincola, Desulfotomaculum, Thermolithobacter, and Carboxydocella, although a few species with lower similarity to known bacteria were also found that may represent previously unconfirmed CO-oxidizers. While the distribution was variable, many of the same OTUs were identified across sample sites from different temperature regimes. These results show that bacteria capable of using CO as a carbon source are common in geothermal springs, and that thermophilic carboxydotrophs are probably already quite well known from cultivation studies.

Intervening in disease through genetically-modified bacteria.

PubMed

Ferreira, Adilson K; Mambelli, Lisley I; Pillai, Saravanan Y

2017-12-01

The comprehension of the molecular basis of different diseases is rapidly being dissected as a consequence of advancing technology. Consequently, proteins with potential therapeutic usefulness, including cytokines and signaling molecules have been identified in the last decades. However, their clinical use is hampered by disadvantageous functional and economic considerations. One of the most important of these considerations is targeted topical delivery and also the synthesis of such proteins, which for intravenous use requires rigorous purification whereas proteins often do not withstand digestive degradation and thus cannot be applied per os. Recently, the idea of using genetically modified bacteria has emerged as an attempt to evade these important barriers. Using such bacteria can deliver therapeutic proteins or other molecules at place of disease, especially when disease is at a mucosal surface. Further, whereas intravenously applied therapeutic proteins require expensive methodology in order to become endotoxin-free, this is not necessary for local application of therapeutic proteins in the intestine. In addition, once created further propagation of genetically modified bacteria is both cheap and requires relatively little in conditioning with respect to transport of the medication, making such organisms also suitable for combating disease in developing countries with poor infrastructure. Although first human trials with such bacteria were already performed more as a decade ago, the recent revolution in our understanding of the role of human gut microbiome in health and diseases has unleashed a revolution in this field resulting in a plethora of potential novel prophylactic and therapeutic intervention against disease onset and development employing such organisms. Today, the engineering of human microbiome for health benefits and related applications now chances many aspects of biology, nanotechnology and chemistry. Here, we review genetically modified

An ice-binding and tandem beta-sandwich domain-containing protein in Shewanella frigidimarina is a potential new type of ice adhesin.

PubMed

Vance, Tyler D R; Graham, Laurie A; Davies, Peter L

2018-04-01

Out of the dozen different ice-binding protein (IBP) structures known, the DUF3494 domain is the most widespread, having been passed many times between prokaryotic and eukaryotic microorganisms by horizontal gene transfer. This ~25-kDa β-solenoid domain with an adjacent parallel α-helix is most commonly associated with an N-terminal secretory signal peptide. However, examples of the DUF3494 domain preceded by tandem Bacterial Immunoglobulin-like (BIg) domains are sometimes found, though uncharacterized. Here, we present one such protein (SfIBP_1) from the Antarctic bacterium Shewanella frigidimarina. We have confirmed and characterized the ice-binding activity of its ice-binding domain using thermal hysteresis measurements, fluorescent ice plane affinity analysis, and ice recrystallization inhibition assays. X-ray crystallography was used to solve the structure of the SfIBP_1 ice-binding domain, to further characterize its ice-binding surface and unique method of stabilizing or 'capping' the ends of the solenoid structure. The latter is formed from the interaction of two loops mediated by a combination of tandem prolines and electrostatic interactions. Furthermore, given their domain architecture and membrane association, we propose that these BIg-containing DUF3494 IBPs serve as ice-binding adhesion proteins that are capable of adsorbing their host bacterium onto ice. Submitted new structure to the Protein Data Bank (PDB: 6BG8). © 2018 Federation of European Biochemical Societies.

Human body may produce bacteria.

PubMed

Salerian, Alen J

2017-06-01

"Human body may produce bacteria" proposes that human body may produce bacteria and represent an independent source of infections contrary to the current paradigm of infectious disorders proposed by Louis Pasteur in 1880. The following observations are consistent with this hypothesis: A. Bidirectional transformations of both living and nonliving things have been commonly observed in nature. B. Complex multicellular organisms harbor the necessary properties to produce bacteria (water, nitrogen and oxygen). C. Physical laws suggest any previously observed phenomenon or action will occur again (life began on earth; a non living thing). D. Animal muscle cells may generate energy (fermentation). E. Sterilized food products (i.e. boiled eggs), may produce bacteria and fungus under special conditions and without any exposure to foreign living cells. "Human body may produce bacteria" may challenge the current medical paradigm that views human infectious disorders as the exclusive causative byproducts of invading foreign cells. It may also introduce new avenues to treat infectious disorders. Copyright © 2017 Elsevier Ltd. All rights reserved.

Growth of saprotrophic fungi and bacteria in soil.

PubMed

Rousk, Johannes; Bååth, Erland

2011-10-01

Bacterial and fungal growth rate measurements are sensitive variables to detect changes in environmental conditions. However, while considerable progress has been made in methods to assess the species composition and biomass of fungi and bacteria, information about growth rates remains surprisingly rudimentary. We review the recent history of approaches to assess bacterial and fungal growth rates, leading up to current methods, especially focusing on leucine/thymidine incorporation to estimate bacterial growth and acetate incorporation into ergosterol to estimate fungal growth. We present the underlying assumptions for these methods, compare estimates of turnover times for fungi and bacteria based on them, and discuss issues, including for example elusive conversion factors. We review what the application of fungal and bacterial growth rate methods has revealed regarding the influence of the environmental factors of temperature, moisture (including drying/rewetting), pH, as well as the influence of substrate additions, the presence of plants and toxins. We highlight experiments exploring the competitive and facilitative interaction between bacteria and fungi enabled using growth rate methods. Finally, we predict that growth methods will be an important complement to molecular approaches to elucidate fungal and bacterial ecology, and we identify methodological concerns and how they should be addressed. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Gaseous ligand selectivity of the H-NOX sensor protein from Shewanella oneidensis and comparison to those of other bacterial H-NOXs and soluble guanylyl cyclase.

PubMed

Wu, Gang; Liu, Wen; Berka, Vladimir; Tsai, Ah-Lim

2017-09-01

To delineate the commonalities and differences in gaseous ligand discrimination among the heme-based sensors with Heme Nitric oxide/OXygen binding protein (H-NOX) scaffold, the binding kinetic parameters for gaseous ligands NO, CO, and O 2 , including K D , k on , and k off , of Shewanella oneidensis H-NOX (So H-NOX) were characterized in detail in this study and compared to those of previously characterized H-NOXs from Clostridium botulinum (Cb H-NOX), Nostoc sp. (Ns H-NOX), Thermoanaerobacter tengcongensis (Tt H-NOX), Vibrio cholera (Vc H-NOX), and human soluble guanylyl cyclase (sGC), an H-NOX analogue. The K D (NO) and K D (CO) of each bacterial H-NOX or sGC follow the "sliding scale rule"; the affinities of the bacterial H-NOXs for NO and CO vary in a small range but stronger than those of sGC by at least two orders of magnitude. On the other hand, each bacterial H-NOX exhibits different characters in the stability of its 6c NO complex, reactivity with secondary NO, stability of oxyferrous heme and autoxidation to ferric heme. A facile access channel for gaseous ligands is also identified, implying that ligand access has only minimal effect on gaseous ligand selectivity of H-NOXs or sGC. This comparative study of the binding parameters of the bacterial H-NOXs and sGC provides a basis to guide future new structural and functional studies of each specific heme sensor with the H-NOX protein fold. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Some bacteria are beneficial!

USGS Publications Warehouse

McMahon, Peter B.

1995-01-01

Most people would agree that bacteria usually spell trouble where the quality of drinking water is con cerned. However, recent studies conducted by the U.S. Geological Survey (USGS) under the National Water-Quality Assessment (NAWQA) program have shown that some bacteria can improve the quality of water.

Enteric bacteria in aerobically digested sludge.

PubMed Central

Farrah, S R; Bitton, G

1984-01-01

Indicator bacteria, Salmonella spp., and total aerobic bacteria were determined in samples of undigested sludge and sludge that had been treated by one or two stages of aerobic digestion. Aerobic sludge digestion reduced the level of indicator bacteria by 1 to 2 log10 per g. The level of Salmonella spp. was also reduced during aerobic treatment of sludge. In general, aerobic treatment of sludge reduced, but did not eliminate, indicator bacteria and Salmonella spp. PMID:6721492

Antibiotic Production by Anaerobic Bacteria1

PubMed Central

Sturgen, Nancy O.; Casida, L. E.

1962-01-01

Soils from aerobic and anaerobic sources were investigated for the possible presence of bacteria which produce antibiotics under anaerobic conditions of growth. The screening techniques devised for this study yielded 157 soil bacteria which, during anaerobic growth, produced antibiotic activity against aerobic test bacteria. Studies on choice of media, presence of oxygen, and changes in antibiotic activity during growth indicated that representative strains of these bacteria produced mixtures of antibiotics. The activity was heat labile. PMID:13918037

Fluctuating hydrodynamics and microrheology of a dilute suspension of swimming bacteria.

PubMed

Lau, A W C; Lubensky, T C

2009-07-01

A bacterial bath is a model active system consisting of a population of rodlike motile or self-propelled bacteria suspended in a fluid environment. This system can be viewed as an active, nonequilibrium version of a lyotropic liquid crystal or as a generalization of a driven diffusive system. We derive a set of phenomenological equations, which include the effects of internal force generators in the bacteria, describing the hydrodynamic flow, orientational dynamics of the bacteria, and fluctuations induced by both thermal and nonthermal noises. These equations violate the fluctuation dissipation theorem and the Onsager reciprocity relations. We use them to provide a quantitative account of results from recent microrheological experiments on bacterial baths.

In vitro activity of daptomycin against clinical isolates of Gram-positive bacteria.

PubMed

Piper, Kerryl E; Steckelberg, James M; Patel, Robin

2005-08-01

We determined the activity of daptomycin, a recently FDA-approved antimicrobial agent, against clinical isolates of Gram-positive bacteria, including viridans group streptococci (16 Streptococcus mitis species group, 12 S. mutans species group, 9 S. anginosus species group, 8 S. sanguinis species group, 5 S. salivarius species group) from patients with infective endocarditis, 32 methicillin-resistant Staphylococcus aureus, 32 high-level penicillin-resistant Streptococcus pneumoniae, 38 vancomycin-resistant enterococci (including 1 linezolid-resistant isolate), and the following unusual Gram-positive bacteria: 3 Listeria monocytogenes, 4 Erysipelothrix rhusiopathiae, 9 Corynebacterium species, 10 Abiotrophia/Granulicatella species, 2 Rothia (Stomatococcus) mucilaginosus, and 4 Gemella morbillorum. Daptomycin minimum inhibitory concentration (MIC)(90) values for the viridans group streptococci, methicillin-resistant S. aureus, penicillin-resistant S. pneumoniae, and Enterococcus species were 0.5, 0.5, < or =0.125, and 4 microg/ml, respectively. The daptomycin MIC range for the unusual Gram-positive bacteria was < or =0.125-2 microg/ml. We conclude that daptomycin has in vitro activity against viridans group streptococci associated with endocarditis as well as against several types of unusual Gram-positive bacteria that can cause endocarditis.

Seasonal dynamics and diversity of bacteria in retail oyster tissues.

PubMed

Wang, Dapeng; Zhang, Qian; Cui, Yan; Shi, Xianming

2014-03-03

Oysters are one of the important vehicles for the transfer of foodborne pathogens. It was reported that bacteria could be bio-accumulated mainly in the gills and digestive glands. In artificially treated oysters, bacterial communities have been investigated by culture-independent methods after harvest. However, little information is available on the seasonal dynamics of bacterial accumulation in retail oyster tissues. In this study, retail oysters were collected from local market in different seasons. The seasonal dynamics and diversity of bacteria in oyster tissues, including the gills, digestive glands and residual tissues, were analyzed by denaturing gradient gel electrophoresis (DGGE). It was interesting that the highest bacterial diversity appeared in the Fall season, not in summer. Our results indicated that Proteobacteria was the predominant member (23/46) in oyster tissues. Our results also suggested that bacterial diversity in gills was higher than that in digestive glands and other tissues. In addition, not all the bacteria collected from surrounding water by gills were transferred to digestive glands. On the other hand, few bacteria were found in oyster tissues except in the gills. Therefore, the gills could be the best candidate target tissue for monitoring of pathogenic bacteria either to human or to oyster. Copyright © 2013 Elsevier B.V. All rights reserved.

Community proteogenomics reveals insights into the physiology of phyllosphere bacteria

PubMed Central

Delmotte, Nathanaël; Knief, Claudia; Chaffron, Samuel; Innerebner, Gerd; Roschitzki, Bernd; Schlapbach, Ralph; von Mering, Christian; Vorholt, Julia A.

2009-01-01

Aerial plant surfaces represent the largest biological interface on Earth and provide essential services as sites of carbon dioxide fixation, molecular oxygen release, and primary biomass production. Rather than existing as axenic organisms, plants are colonized by microorganisms that affect both their health and growth. To gain insight into the physiology of phyllosphere bacteria under in situ conditions, we performed a culture-independent analysis of the microbiota associated with leaves of soybean, clover, and Arabidopsis thaliana plants using a metaproteogenomic approach. We found a high consistency of the communities on the 3 different plant species, both with respect to the predominant community members (including the alphaproteobacterial genera Sphingomonas and Methylo bacterium) and with respect to their proteomes. Observed known proteins of Methylobacterium were to a large extent related to the ability of these bacteria to use methanol as a source of carbon and energy. A remarkably high expression of various TonB-dependent receptors was observed for Sphingomonas. Because these outer membrane proteins are involved in transport processes of various carbohydrates, a particularly large substrate utilization pattern for Sphingomonads can be assumed to occur in the phyllosphere. These adaptations at the genus level can be expected to contribute to the success and coexistence of these 2 taxa on plant leaves. We anticipate that our results will form the basis for the identification of unique traits of phyllosphere bacteria, and for uncovering previously unrecorded mechanisms of bacteria-plant and bacteria-bacteria relationships. PMID:19805315

Nasal septal abscess caused by anaerobic bacteria of oral flora.

PubMed

Hyo, Yukiyoshi; Fukushima, Hisaki; Harada, Tamotsu; Hara, Hirotaka

2018-06-07

Although nasal septal abscess (NSA) was formerly common, it has become rare since the development of antibiotics. NSA, if left untreated, can lead to intracranial complications such as meningitis and eventually result in saddle-nose deformity. NSA often occurs after injury, and indigenous skin bacteria such as Staphylococcus aureus are frequently detected. We treated a patient who had injured the upper alveolus in a fall on the stairs and developed NSA two weeks later. Anaerobic bacteria, including Veillonella parvula and Peptostreptococcus sp., were detected. Symptoms were relieved by needle and incisional drainage. Our patient represents a very rare case of NSA in terms of the cause of onset and the detected bacteria. Early drainage can result in good outcomes. Copyright © 2018 Elsevier B.V. All rights reserved.

Effects on intestinal microbiota and immune genes of Solea senegalensis after suspension of the administration of Shewanella putrefaciens Pdp11.

PubMed

Vidal, Sara; Tapia-Paniagua, Silvana Teresa; Moriñigo, Jesús Miguel; Lobo, Carmen; García de la Banda, Inés; Balebona, María Del Carmen; Moriñigo, Miguel Ángel

2016-11-01

The interaction host-intestinal microbiota is essential for the immunological homeostasis of the host. Probiotics, prebiotics and synbiotics are promising tools for the manipulation of the intestinal microbiota towards beneficial effects to the host. The objective of this study was to evaluate the modulation effect on the intestinal microbiota and the transcription of genes involved in the immune response in head kidney of Solea senegalensis after administration of diet supplemented with the prebiotic alginate and the probiotic Shewanella putrefaciens Pdp11 CECT 7627 (SpPdp11). The results showed higher adaptability to dietary changes in the intestinal microbiota of fish fed diet with alginate and SpPdp11 together compared to those fish that received an alginate-supplemented diet. The alginate-supplemented diet produced up-regulation of genes encoding proteins involved in immunological responses, such as complement, lysozyme G and transferrin, and oxidative stress, such as NADPH oxidase and glutation peroxidase. On the other hand, the administration of alginate combined with SpPdp11 resulted in a significant increase of the transcription of genes encoding for glutation peroxidase and HSP70, indicating a potential protective effect of SpPdp11 against oxidative stress. In addition, these effects were maintained after the suspension of the probiotic treatment. The relationship between the modulation of the intestinal microbiota and the expression of genes with protective effect against the oxidative stress was demonstrated by the Principal Components Analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Promoted reduction of tellurite and formation of extracellular tellurium nanorods by concerted reaction between iron and Shewanella oneidensis MR-1.

PubMed

Kim, Dong-Hun; Kim, Min-Gyu; Jiang, Shenghua; Lee, Ji-Hoon; Hur, Hor-Gil

2013-08-06

The reduction of tellurite (Te(IV)) by dissimilatory metal reducing bacterium, Shewanella oneidensis MR-1, was promoted in the presence of Fe(III) in comparison with Te(IV) bioreduction in the absence of Fe(III). Electron microscopic analyses revealed that iron promoted Te(IV) reduction led to form exclusively extracellular crystalline Te(0) nanorods, as compared to the mostly intracellular formation of Te(0) nanorods in the absence of Fe(III). The Te K-edge X-ray absorption spectrometric analyses demonstrated that S. oneidensis MR-1 in the presence of Fe(III) reduced Te(IV) to less harmful metallic Te(0) nanorods through the precipitation of tellurite (Te(IV)Ox) complex by the bacterial respiration of Fe(III) to Fe(II) under anaerobic conditions. However, Fe(II) ion itself was only able to precipitate the solid tellurite (Te(IV)Ox) complex from the Te(IV) solution, which was not further reduced to Te(0). The results clearly indicated that bacterial S. oneidensis MR-1 plays important roles in the reduction and crystallization of Te(0) nanorods by as yet undetermined biochemical mechanisms. As compared to the slow bacterial Te(IV) reduction in the absence of Fe(III), the rapid reduction of Te(IV) to Te(0) by the concerted biogeochemical reaction between Fe(II) and S. oneidensis MR-1 could be applied for the sequestration and detoxification of Te(IV) in the environments as well as for the preparation of extracellular Te(0) nanorod structures.

Starch-fueled microbial fuel cells by two-step and parallel fermentation using Shewanella oneidensis MR-1 and Streptococcus bovis 148.

PubMed

Uno, Megumi; Phansroy, Nichanan; Aso, Yuji; Ohara, Hitomi

2017-08-01

Shewanella oneidensis MR-1 generates electricity from lactic acid, but cannot utilize starch. On the other hand, Streptococcus bovis 148 metabolizes starch and produces lactic acid. Therefore, two methods were trialed for starch-fueled microbial fuel cell (MFC) in this study. In electric generation by two-step fermentation (EGT) method, starch was first converted to lactic acid by S. bovis 148. The S. bovis 148 were then removed by centrifugation, and the fermented broth was preserved for electricity generation by S. oneidensis MR-1. Another method was electric generation by parallel fermentation (EGP) method. In this method, the cultivation and subsequent fermentation processes of S. bovis 148 and S. oneidensis MR-1 were performed simultaneously. After 1, 2, and 3 terms (5-day intervals) of S. oneidensis MR-1 in the EGT fermented broth of S. bovis 148, the maximum currents at each term were 1.8, 2.4, and 2.8 mA, and the maximum current densities at each term were 41.0, 43.6, and 49.9 mW/m 2 , respectively. In the EGP method, starch was also converted into lactic acid with electricity generation. The maximum current density was 140-200 mA/m 2 , and the maximum power density of this method was 12.1 mW/m 2 . Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effect of oxygen on the per‐cell extracellular electron transfer rate of Shewanella oneidensis MR‐1 explored in bioelectrochemical systems

PubMed Central

Lu, Mengqian; Chan, Shirley; Babanova, Sofia

2016-01-01

ABSTRACT Extracellular electron transfer (EET) is a mechanism that enables microbes to respire solid‐phase electron acceptors. These EET reactions most often occur in the absence of oxygen, since oxygen can act as a competitive electron acceptor for many facultative microbes. However, for Shewanella oneidensis MR‐1, oxygen may increase biomass development, which could result in an overall increase in EET activity. Here, we studied the effect of oxygen on S. oneidensis MR‐1 EET rates using bioelectrochemical systems (BESs). We utilized optically accessible BESs to monitor real‐time biomass growth, and studied the per‐cell EET rate as a function of oxygen and riboflavin concentrations in BESs of different design and operational conditions. Our results show that oxygen exposure promotes biomass development on the electrode, but significantly impairs per‐cell EET rates even though current production does not always decrease with oxygen exposure. Additionally, our results indicated that oxygen can affect the role of riboflavin in EET. Under anaerobic conditions, both current density and per‐cell EET rate increase with the riboflavin concentration. However, as the dissolved oxygen (DO) value increased to 0.42 mg/L, riboflavin showed very limited enhancement on per‐cell EET rate and current generation. Since it is known that oxygen can promote flavins secretion in S. oneidensis, the role of riboflavin may change under anaerobic and aerobic conditions. Biotechnol. Bioeng. 2017;114: 96–105. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:27399911

Seasonal variation of fecal indicator bacteria in storm events within the US stormwater database.

PubMed

Pan, Xubin; Jones, Kim D

2012-01-01

Bacteria are one of the major causes of surface water impairments in the USA. Over the past several years, best management practices, including detention basins, manufactured devices, grass swales, filters and bioretention cells have been used to remove bacteria and other pollutants from stormwater runoff. However, there are data gaps in the comprehensive studies of bacteria concentrations in stormwater runoff. In this paper, the event mean concentration (EMC) of fecal indicator bacteria (Enterococcus, Escherichia coli, fecal Streptococcus group bacteria, and fecal coliform) across the USA was retrieved from the international stormwater best management practices database to analyze the seasonal variations of inflow and outflow event mean concentrations and removal efficiencies. The Kruskal-Wallis test was employed to determine the seasonal variations of bacteria indicator concentrations and removals, and the two-sample Kolmogorov-Smirnov test was used for comparing different seasonal outcomes. The results indicate that all the inflow EMC of FIB in stormwater runoff is above the water quality criteria. The seasonal differences of fecal Streptococcus group bacteria and fecal coliform are significant. Summer has the potential to increase the bacteria EMC and illustrate the seasonal differences.

Antibiotic-resistant bacteria in the Hudson River Estuary linked to wet weather sewage contamination.

PubMed

Young, Suzanne; Juhl, Andrew; O'Mullan, Gregory D

2013-06-01

Heterotrophic bacteria resistant to tetracycline and ampicillin were assessed in waterways of the New York City metropolitan area using culture-dependent approaches and 16S rRNA gene sequence analysis of resultant isolates. Resistant microbes were detected at all 10 sampling sites in monthly research cruises on the lower Hudson River Estuary (HRE), with highest concentrations detected at nearshore sites. Higher frequency sampling was conducted in Flushing Bay, to enumerate resistant microbes under both dry and wet weather conditions. Concentrations of ampicillin- and tetracycline-resistant bacteria, in paired samples, were positively correlated with one another and increased following precipitation. Counts of the fecal indicator, Enterococcus, were positively correlated with levels of resistant bacteria, suggesting a shared sewage-associated source. Analysis of 16S rRNA from isolates identified a phylogenetically diverse group of resistant bacteria, including genera containing opportunistic pathogens. The occurrence of Enterobacteriaceae, a family of enteric bacteria, was found to be significantly higher in resistant isolates compared to total heterotrophic bacteria and increased following precipitation. This study is the first to document the widespread distribution of antibiotic-resistant bacteria in the HRE and to demonstrate clearly a link between the abundance of antibiotic-resistant bacteria and levels of sewage-associated bacteria in an estuary.

Growth Inhibition and Stimulation of Shewanella oneidensis MR-1 by Surfactants and Calcium Polysulfide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bailey, Kathryn L.; Tilton, Fred A.; Jansik, Danielle P.

2012-06-14

Foam delivery technology (FDT) uses surfactant based foam to immobilize subsurface contaminants in situ. Where traditional approaches are impractical, FDT has the potential to overcome many of the technical challenges facing the remediation of contaminated deep vadose zone environments. However, little is known about the effects these reactive chemicals may have on microorganisms inhabiting the contaminated subsurface. In addition, there are currently no standard assays to assess microbial responses to subsurface remedial treatments while these agents are under development. The objective of this study was to develop a rapid laboratory assay to assess the potential growth inhibition and/or stimulation ofmore » microorganisms following exposure to candidate FDT components. Calcium polysulfide (CPS) and several surfactants (i.e. sodium laureth sulfate (SLES), sodium dodecyl sulfate (SDS), cocamidopropyl betaine (CAPB) and NINOL40-CO) have diverse chemistries and are candidate components of FDT. Shewanella oneidensis MR-1 cultures were exposed to a range of concentrations of these chemicals to determine the minimum bactericidal concentration (MBC) and the growth and viability potential of these components. Concentrations of SDS higher than 700 {micro}M were toxic to S. oneidensis MR-1 growth over the course of four days of exposure. The relative acute toxicity order for these compounds was SDS>>CPS>>NINOL40-CO>SLES-CAPB. Dose dependent growth decreases (20 to 100 mM) were observed in the CAPB and SLES treated cultures and both CPS and NINOL 40-CO were toxic at all concentrations tested (1.45 to 7.25 mM CPS). Both SLES (20 to 100 mM) and SDS at lower concentrations (20 to 500 {micro}M) were stimulatory to S. oneidensis MR-1 indicating a capacity to be used as a carbon source. These studies also identified potentially key component characteristics, such as precipitate formation and oxygen availability, which may prove valuable in assessing the response of subsurface

Heme and menaquinone induced electron transport in lactic acid bacteria

PubMed Central

Brooijmans, Rob; Smit, Bart; Santos, Filipe; van Riel, Jan; de Vos, Willem M; Hugenholtz, Jeroen

2009-01-01

Background For some lactic acid bacteria higher biomass production as a result of aerobic respiration has been reported upon supplementation with heme and menaquinone. In this report, we have studied a large number of species among lactic acid bacteria for the existence of this trait. Results Heme- (and menaquinone) stimulated aerobic growth was observed for several species and genera of lactic acid bacteria. These include Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacilllus brevis, Lactobacillus paralimentarius, Streptococcus entericus and Lactococcus garviae. The increased biomass production without further acidification, which are respiration associated traits, are suitable for high-throughput screening as demonstrated by the screening of 8000 Lactococcus lactis insertion mutants. Respiration-negative insertion-mutants were found with noxA, bd-type cytochrome and menaquinol biosynthesis gene-disruptions. Phenotypic screening and in silico genome analysis suggest that respiration can be considered characteristic for certain species. Conclusion We propose that the cyd-genes were present in the common ancestor of lactic acid bacteria, and that multiple gene-loss events best explains the observed distribution of these genes among the species. PMID:19480672

Heme and menaquinone induced electron transport in lactic acid bacteria.

PubMed

Brooijmans, Rob; Smit, Bart; Santos, Filipe; van Riel, Jan; de Vos, Willem M; Hugenholtz, Jeroen

2009-05-29

For some lactic acid bacteria higher biomass production as a result of aerobic respiration has been reported upon supplementation with heme and menaquinone. In this report, we have studied a large number of species among lactic acid bacteria for the existence of this trait. Heme- (and menaquinone) stimulated aerobic growth was observed for several species and genera of lactic acid bacteria. These include Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacilllus brevis, Lactobacillus paralimentarius, Streptococcus entericus and Lactococcus garviae. The increased biomass production without further acidification, which are respiration associated traits, are suitable for high-throughput screening as demonstrated by the screening of 8000 Lactococcus lactis insertion mutants. Respiration-negative insertion-mutants were found with noxA, bd-type cytochrome and menaquinol biosynthesis gene-disruptions. Phenotypic screening and in silico genome analysis suggest that respiration can be considered characteristic for certain species. We propose that the cyd-genes were present in the common ancestor of lactic acid bacteria, and that multiple gene-loss events best explains the observed distribution of these genes among the species.

Bacteriophage sensitivity patterns among bacteria isolated from marine waters

NASA Astrophysics Data System (ADS)

Moebus, K.; Nattkemper, H.

1981-09-01

Phage-host cross-reaction tests were performed with 774 bacterial strains and 298 bacteriophages. The bacteria (bacteriophages) were isolated at different times from water samples collected in the Atlantic Ocean between the European continental shelf and the Sargasso Sea: 733 (258) strains; in the North Sea near Helgoland: 31 (31) strains; and in the Bay of Biscay: 10 (9) strains. Of the Atlantic Ocean bacteria 326 were found to be susceptible to one or more Atlantic Ocean bacteriophage(s). The bacteriophage sensitivity patterns of these bacteria vary considerably, placing 225 of them in two large clusters of bacteriophage-host systems. Taking all into account, 250 of the 326 Atlantic Ocean bacteria are different from each other. This high degree of variation among the bacteria distinguishes microbial populations derived from widely separated eastern and western regions of the Atlantic Ocean. It also sets apart from each other the populations derived from samples collected at successive stations some 200 miles apart, although to a lesser degree. With bacterial populations found from samples collected on the way back and forth between Europe and the Sargasso Sea a gradual change was observed from "western" phage sensitivity patterns to "eastern" ones. Sixty-nine Atlantic Ocean bacteria are sensitive to bacteriophages isolated from the North Sea and the Bay of Biscay; of these only 26 strains are also susceptible to Atlantic Ocean phages. The interpretation of the results is based on the hydrographical conditions prevailing in the northern Atlantic Ocean including the North Sea, and on the assumption that the microbial populations investigated have undergone genetic changes while being transported within water masses from west to east.

Relatedness of amylase-producing, endospore-forming bacteria from the alimentary tract of commercially processed broilers

USDA-ARS?s Scientific Manuscript database

Introduction: Competitive exclusion (CE) by bacteria from adult poultry reduces colonization of young chicks by Salmonella. CE might include the ability of these bacteria to breakdown complex carbohydrates to produce metabolites that inhibit Salmonella growth. Purpose: To isolate amylase producing, ...