A Repeating Sulfated Galactan Motif Resuscitates Dormant Micrococcus luteus Bacteria.
Böttcher, Thomas; Szamosvári, Dávid; Clardy, Jon
2018-07-01
Only a small fraction of bacteria can autonomously initiate growth on agar plates. Nongrowing bacteria typically enter a metabolically inactive dormant state and require specific chemical trigger factors or signals to exit this state and to resume growth. Micrococcus luteus has become a model organism for this important yet poorly understood phenomenon. Only a few resuscitation signals have been described to date, and all of them are produced endogenously by bacterial species. We report the discovery of a novel type of resuscitation signal that allows M. luteus to grow on agar but not agarose plates. Fractionation of the agar polysaccharide complex and sulfation of agarose allowed us to identify the signal as highly sulfated saccharides found in agar or carrageenans. Purification of hydrolyzed κ-carrageenan ultimately led to the identification of the signal as a small fragment of a large linear polysaccharide, i.e., an oligosaccharide of five or more sugars with a repeating disaccharide motif containing d-galactose-4-sulfate (G4S) 1,4-linked to 3,6-anhydro-α-d-galactose (DA), G4S-(DA-G4S) n ≥2 IMPORTANCE Most environmental bacteria cannot initiate growth on agar plates, but they can flourish on the same plates once growth is initiated. While there are a number of names for and manifestations of this phenomenon, the underlying cause appears to be the requirement for a molecular signal indicating safe growing conditions. Micrococcus luteus has become a model organism for studying this growth initiation process, often called resuscitation, because of its apparent connection with the persistent or dormant form of Mycobacterium tuberculosis , an important human pathogen. In this report, we identify a highly sulfated saccharide from agar or carrageenans that robustly resuscitates dormant M. luteus on agarose plates. We identified and characterized the signal as a small repeating disaccharide motif. Our results indicate that signals inherent in or absent from the
[Preparation and characterization of monoclonal antibodies against Micrococcus luteus Rpf domain].
Fan, Ai-lin; Shi, Chang-hong; Su, Ming-quan; Ma, Jing; Bai, Yin-lan; Cheng, Xiao-dong; Xu, Zhi-kai; Hao, Xiao-ke
2008-05-01
To express Micrococcus luteus Rpf domain in prokaryotic cells and prepare monoclonal antibodies against Rpf domain. The gene encoding Micrococcus luteus Rpf domain was amplified from genome of Micrococcus luteus by polymerase chain reaction(PCR), and inserted into cloning vector pUC-19. After sequenced, Micrococcus luteus Rpf domain gene was subcloned into the expression vector pPro-EXHT and transfected into E.coli DH5alpha. After induced by IPTG, the bacteria controlled by T7 promoter expressed the fused Micrococcus luteus Rpf domain protein with a hexahistidine tail at its N-terminal and the target protein was purified under denaturing conditions. Using this protein as antigen to immunize the BALB/c mice and prepare monoclonal antibodies against Micrococcus luteus Rpf domain. Then specifities and relative affinities of mAbs were identified by ELISA. The fusion protein was purified by metal chelate affinity chromatography under denaturing condition. Three cloned mAbs were prepared from the mice immunized by Rpf domain. All of them could recognize Rpf domain. specifically. The prepared mAbs against Rpf domain have strong specificity with high titers, which provides useful tools for further study of the function of Rpf domain in TB prevention.
Surface interactions and fouling properties of Micrococcus luteus with microfiltration membranes.
Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian
2011-11-01
This study was conducted to investigate microbial adhesion of Micrococcus luteus to polypropylene (PP) and polyvinylidene fluoride (PVDF) membranes in relation to the variation of the interfacial energies in the membrane-bacteria systems, for revealing effects of short-range surface interactions on filtration behavior. Both the membranes and M. luteus showed typical strong electron donors and hydrophilic properties. The AB component was dominant in the interfacial energies of the two membrane-bacteria systems. M. luteus presented larger negative U(mlb)(XDLVO) to the PP membrane than to the PVDF membrane. The adhesion experiments also proved that M. luteus had higher adhesion percentage to the PP membrane. This study demonstrated that the adhesion potentials of M. luteus to the PP and PVDF membranes might be explained in terms of bacterium, membrane, and intervening medium surface properties, which are mainly determined by the interfacial energies in the systems according to the XDLVO theory.
Protein synthesis in vitro by Micrococcus luteus.
Farwell, M A; Rabinowitz, J C
1991-01-01
Bacillus subtilis and related gram-positive bacteria which have low to moderate genomic G + C contents are unable to efficiently translate mRNA derived from gram-negative bacteria, whereas Escherichia coli and other gram-negative bacteria are able to translate mRNA from both types of organisms. This phenomenon has been termed translational species specificity. Ribosomes from the low-G + C-content group (low-G + C group) of gram-positive organisms (B. subtilis and relatives) lack an equivalent to Escherichia ribosomal protein S1. The requirement for S1 for translation in E. coli (G. van Dieijen, P. H. van Knippenberg, J. van Duin, B. Koekman, and P. H. Pouwels, Mol. Gen. Genet. 153:75-80, 1977) and its specific role (A.R. Subramanian, Trends Biochem. Sci. 9:491-494, 1984) have been proposed. The group of gram-positive bacteria characterized by high genomic G + C content (formerly Actinomyces species and relatives) contain S1, in contrast to the low-G + C group (K. Mikulik, J. Smardova, A. Jiranova, and P. Branny, Eur. J. Biochem. 155:557-563, 1986). It is not known whether members of the high-G + C group are translationally specific, although there is evidence that one genus, Streptomyces, can express Escherichia genes in vivo (M. J. Bibb and S. N. Cohen, Mol. Gen. Genet. 187:265-277, 1985; J. L. Schottel, M. J. Bibb, and S. N. Cohen, J. Bacteriol. 146:360-368, 1981). In order to determine whether the organisms of this group are translationally specific, we examined the in vitro translational characteristics of a member of the high-G + C group, Micrococcus luteus, whose genomic G + C content is 73%. A semipurified coupled transcription-translation system of M. luteus translates Escherichia mRNA as well as Bacillus and Micrococcus mRNA. Therefore, M. luteus is translationally nonspecific and resembles E. coli rather than B. subtilis in its translational characteristics. Images PMID:2045372
Wieser, Monika; Denner, Ewald B M; Kämpfer, Peter; Schumann, Peter; Tindall, Brian; Steiner, Ulrike; Vybiral, Dietmar; Lubitz, Werner; Maszenan, A M; Patel, B K C; Seviour, Robert J; Radax, Christian; Busse, Hans-Jürgen
2002-03-01
Nine yellow-pigmented, spherical bacterial strains isolated from a medieval wall painting (strain D7), from indoor air (strains 3, 6, 7, 13C2, 38, 83 and 118) and from an activated-sludge plant (strain Ballarat) were classified by a polyphasic approach. Analyses of the 16S rRNA gene sequences of three representatives (strains D7, 118 and Ballarat) indicated that they all belong to the genus Micrococcus. The three isolates shared the highest sequence similarities with Micrococcus luteus DSM 20030T (97.9-98%), Micrococcus antarcticus AS 1.2372T (97.9-98.3%) and Micrococcus lylae DSM 20315T (97.5-97.9%). DNA-DNA reassociation studies clearly demonstrated that all nine isolates belong to the species M. luteus. However, neither their chemotaxonomic features nor their physiological and biochemical properties were consistent with those of M. luteus DSM 20030T. In contrast to M. luteus DSM 20030T, all isolates investigated possessed MK-8(H2) as the major respiratory quinone, and strain Ballarat had an A4alpha peptidoglycan type. On the basis of analyses of their Fourier transform-infrared spectroscopy spectra, isolates D7, 3, 6, 7, 13C2, 38, 83 and 118 could be grouped into a single cluster separate from M. luteus DSM 20030T, strain Ballarat and M. lylae DSM 20315T. In addition, all these isolates could be distinguished from M. luteus DSM 20030T by their ability to assimilate D-maltose, D-trehalose, DL-3-hydroxybutyrate, DL-lactate, pyruvate and L-histidine and to hydrolyse casein. Strains D7, 3, 6, 7, 13C2, 38, 83 and 118 differed from both M. luteus DSM 20030T and strain Ballarat by their ability to assimilate acetate, L-phenylalanine, L-serine and phenylacetate. Furthermore, REP-PCR fingerprinting yielded one common band for these strains, whereas this band was not observed for M. luteus DSM 20030T, strain Ballarat or M. lylae DSM 20315T. On the basis of these data, the species M. luteus can be divided into three biovars that are distinguished by several chemotaxonomic
Min, K R; Zimmer, M N; Rickard, A H
2010-11-01
The aim of this study was to explore the physicochemical parameters that influence coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13. Using visual coaggregation assays, the effect of different buffers, solutions of differing ionic strength, pH, temperature, and viscosity on the degree of coaggregation was assessed. Coaggregation occurred maximally in distilled water but was inhibited when coaggregates were suspended in a commonly-used oral bacterial coaggregation buffer, saline solutions, and Tris-Cl buffers. Coaggregation was weakly expressed in standard laboratory buffers. The ionic strength of inorganic salt solutions required to inhibit coaggregation depended upon the inorganic salt being tested. Coaggregation occurred at a pH of 3-10, between 5 and 80°C and was inhibited in solutions with a viscosity of 22.5 centipoises at 20°C. Inhibition of coaggregation with NaCl impaired biofilm development. When developing buffers to test for coaggregation, the natural liquid environment should be considered. Coaggregation between S. natatoria 2.1 and M. luteus 2.13 is only affected by physicochemical conditions beyond those typically found in natural freshwater ecosystems. Such a robust ability to coaggregate may enhance the ability of S. natatoria 2.1 and M. luteus 2.13 to develop a niche in freshwater biofilms.
Ding, Linxian; Zhang, Pinghua; Hong, Huachang; Lin, Hongjun; Yokota, Akira
2012-01-01
The purpose of the present study was to produce the Rpf (resuscitation promoting factor) protein by cloning and expressing the rpf gene, secreted by Micrococcus luteus IAM 14879, in Escherichia coli and to evaluate its role in the recovery of the VBNC (viable but non-culturable) state in high-GC Gram-positive bacteria. Genomic DNA was extracted from Micrococcus luteus IAM 14879 and the rpf gene was amplified by PCR using specific primers. The PCR products was purified, cloned into a pET15b expression vector, and transformed into Escherichia coli BL21 (DE3). Then the pET15b plasmid expression vector was used to confirm the purification of the recombinant proteins via SDS-PAGE. The VBNC state cells from the high-GC Gram-positive bacteria, Rhodococcus sp. DS471, were used to confirm the promotion and recovery of growth capacity. Rhodococcus sp. DS471 were isolated from soil and closely related to Micrococcus luteus IAM 14879. The gene sequences confirmed that the rpf gene from Micrococcus luteus IAM 14879 that was expressed in Escherichia coli, was 672 bp. SDS-PAGE analysis showed that the recombinant Rpf protein was obtained successfully, and further studies showed it capable of promoting the recovery of the VBNC state by about 100-fold relative to the control. Rpf of Micrococus luteus IAM 14879 can be successfully cloned and expressed in Escherichia coli and shows a strong ability to promote the recovery of the VBNC state of cells of Rhodococcus sp. DS471.
Hanafy, Radwa A; Couger, M B; Baker, Kristina; Murphy, Chelsea; O'Kane, Shannon D; Budd, Connie; French, Donald P; Hoff, Wouter D; Youssef, Noha
2016-09-01
Micrococcus luteus is a predominant member of skin microbiome. We here report on the genomic analysis of Micrococcus luteus strain O'Kane that was isolated from an elevator. The partial genome assembly of Micrococcus luteus strain O'Kane is 2.5 Mb with 2256 protein-coding genes and 62 RNA genes. Genomic analysis revealed metabolic versatility with genes involved in the metabolism and transport of glucose, galactose, fructose, mannose, alanine, aspartate, asparagine, glutamate, glutamine, glycine, serine, cysteine, methionine, arginine, proline, histidine, phenylalanine, and fatty acids. Genomic comparison to other M. luteus representatives identified the potential to degrade polyhydroxybutyrates, as well as several antibiotic resistance genes absent from other genomes.
Szczerba, Izabela; Krzemiński, Zbigniew
2002-01-01
The aim of the study was to assess the prevalence of different bacteria in the oral cavity. The bacteria were present in the oral cavities of 73 (48.7%) of 150 individuals. Nesterenkonia halobia, the most frequently isolated species, was found in 20 (27%) individuals, Micrococcus luteus in 16 (22%), Kocuria kristinae in 12 (16%), Kocuria varians in 10 (14%), Dermacoccus sedentarius in 9 (12%), Micrococcus lylae in 8 (11%), and Kytococcus nishinomiyaensis in 3 (4%). Mean counts of these microorganisms were relatively low and amounted in log10 CFU/ml saliva for M. luteus 1.87 +/- 0.52, for M. lylae 2.03 +/- 0.39, for N. halobia 2.14 +/- 0.56, for K. kristinae 2.20 +/- 0.69, for K. varians 2.19 +/- 0.67, for K. nishinomiyaensis 1.72 +/- 0.39, and for D. sedentarius 2.27 +/- 0.55. The factor limiting the population sizes of these microorganisms was most probably the antagonistic activity of the bacteria living in oral cavity.
A Proteomic Signature of Dormancy in the Actinobacterium Micrococcus luteus.
Mali, Sujina; Mitchell, Morgan; Havis, Spencer; Bodunrin, Abiodun; Rangel, Jonathan; Olson, Gabriella; Widger, William R; Bark, Steven J
2017-07-15
Dormancy is a protective state in which diverse bacteria, including Mycobacterium tuberculosis , Staphylococcus aureus , Treponema pallidum (syphilis), and Borrelia burgdorferi (Lyme disease), curtail metabolic activity to survive external stresses, including antibiotics. Evidence suggests dormancy consists of a continuum of interrelated states, including viable but nonculturable (VBNC) and persistence states. VBNC and persistence contribute to antibiotic tolerance, reemergence from latent infections, and even quorum sensing and biofilm formation. Previous studies indicate that the protein mechanisms regulating persistence and VBNC states are not well understood. We have queried the VBNC state of Micrococcus luteus NCTC 2665 (MI-2665) by quantitative proteomics combining gel electrophoresis, high-performance liquid chromatography, and tandem mass spectrometry to elucidate some of these mechanisms. MI-2665 is a nonpathogenic actinobacterium containing a small (2.5-Mb), high-GC-content genome which exhibits a well-defined VBNC state induced by nutrient deprivation. The MI-2665 VBNC state demonstrated a loss of protein diversity accompanied by increased levels of 18 proteins that are conserved across actinobacteria, 14 of which have not been previously identified in VNBC. These proteins implicate an anaplerotic strategy in the transition to VBNC, including changes in the glyoxylate shunt, redox and amino acid metabolism, and ribosomal regulatory processes. Our data suggest that MI-2665 is a viable model for dissecting the protein mechanisms underlying the VBNC stress response and provide the first protein-level signature of this state. We expect that this protein signature will enable future studies deciphering the protein mechanisms of dormancy and identify novel therapeutic strategies effective against antibiotic-tolerant bacterial infections. IMPORTANCE Dormancy is a protective state enabling bacteria to survive antibiotics, starvation, and the immune system
In Vitro Repair of UV-Irradiated Micrococcus luteus Bacteriophage N1 Transfecting DNA 1
Mahler, Inga; George, Jeanne; Grossman, Lawrence
1974-01-01
Calcium-treated UV-sensitive, host cell reactivation− strains of Micrococcus luteus are infected with UV-irradiated N1 DNA. In strains lacking UV endonuclease, in vitro treatment of the irradiated DNA results in transfection enhancement. PMID:4823319
Binding of Dissolved Strontium by Micrococcus luteus
Faison, Brendlyn D.; Cancel, Carmen A.; Lewis, Susan N.; Adler, Howard I.
1990-01-01
Resting cells of Micrococcus luteus have been shown to remove strontium (Sr) from dilute aqueous solutions of SrCl2 at pH 7. Loadings of 25 mg of Sr per g of cell dry weight were achieved by cells exposed to a solution containing 50 ppm (mg/liter) of Sr. Sr binding occurred in the absence of nutrients and did not require metabolic activity. Initial binding was quite rapid (<0.5 h), although a slow, spontaneous release of Sr was observed over time. Sr binding was inhibited in the presence of polyvalent cations but not monovalent cations. Ca and Sr were bound preferentially over all other cations tested. Sr-binding activity was localized on the cell envelope and was sensitive to various chemical and physical pretreatments. Bound Sr was displaced by divalent ions or by H+. Other monovalent ions were less effective. Bound Sr was also removed by various chelating agents. It was concluded that Sr binding by M. luteus is a reversible equilibrium process. Both ion exchange mediated by acidic cell surface components and intracellular uptake may be involved in this activity. PMID:16348370
Wu, Huifeng; Ji, Chenglong; Wei, Lei; Zhao, Jianmin; Lu, Hongjian
2013-12-06
The outbreak of pathogens can induce diseases and lead to massive mortalities of aquaculture animals including fish, mollusk and shrimp. In this work, the responses induced by Micrococcus luteus and Vibrio anguillarum were investigated in hepatopancreas of mussel Mytilus galloprovincialis using proteomics and metabolomics. Metabolic biomarkers demonstrated that M. luteus and V. anguillarum injections could induce osmotic stress and disturbance in energy metabolism. And the uniquely and more markedly altered metabolic biomarkers (glutamine, succinate, aspartate, glucose, ATP, homarine and tyrosine) indicated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. The differentially altered proteins meant that M. luteus and V. anguillarum induced different effects in mussels. However, the common proteomic biomarkers, arginine kinase and small heat shock protein, demonstrated that these two bacteria induced similar effects including oxidative stress and disturbance in energy metabolism in M. galloprovincialis. In addition, some metabolic biomarkers, ATP and glutamine, were confirmed by related proteins including arginine kinase, ATP synthase, nucleoside diphosphate kinase and glutamine synthetase in bacteria-challenged mussels. This study demonstrated that proteomics and metabolomics could provide an insightful view into the effects of environmental pathogens to the marine mussel M. galloprovincialis. The outbreak of pathogens can lead to diseases and massive mortalities of aquaculture animals including fish, mollusk and shrimp. The mussel M. galloprovincialis distributes widely along the Bohai coast and is popularly consumed as delicious seafood by local residents. This bivalve has become one of the important species in marine aquaculture industry in China. Therefore a study on pathogen-induced effects is necessary. In the present study, an integrated metabolomic and proteomic approach was used to elucidate the
Genome sequence of the Fleming strain of Micrococcus luteus, a simple free- living actinobacterium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.
Micrococcus luteus (NCTC2665, Fleming strain) has one of the smallest genomes of free living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content 73%) predicted to encode 2403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 IS elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. Themore » genome encodes only four sigma factors and fourteen response regulators, indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to {Beta}-lactam antibiotics may result from the presence of a reduced set of penicillin binding proteins and the absence of a wblC gene, which plays an important role in antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose, and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three gene cluster essential for this metabolism has been identified in the
Matsuura, Koji; Asano, Yuka; Yamada, Akira; Naruse, Keiji
2013-02-18
Biofilm formation in microfluidic channels is difficult to detect because sampling volumes are too small for conventional turbidity measurements. To detect biofilm formation, we used an ion-sensitive field-effect transistor (ISFET) measurement system to measure pH changes in small volumes of bacterial suspension. Cells of Micrococcus luteus (M. luteus) were cultured in polystyrene (PS) microtubes and polymethylmethacrylate (PMMA)-based microfluidic channels laminated with polyvinylidene chloride. In microtubes, concentrations of bacteria and pH in the suspension were analyzed by measuring turbidity and using an ISFET sensor, respectively. In microfluidic channels containing 20 μL of bacterial suspension, we measured pH changes using the ISFET sensor and monitored biofilm formation using a microscope. We detected acidification and alkalinization phases of M. luteus from the ISFET sensor signals in both microtubes and microfluidic channels. In the alkalinization phase, after 2 day culture, dense biofilm formation was observed at the bottom of the microfluidic channels. In this study, we used an ISFET sensor to detect biofilm formation in clinical and industrial microfluidic environments by detecting alkalinization of the culture medium.
Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.; Chandra, Govind; Chater, Keith F.; Dover, Lynn G.; Goh, Ee-Been; Kahan, Tamar; Kaprelyants, Arseny S.; Kyrpides, Nikos; Lapidus, Alla; Lowry, Stephen R.; Lykidis, Athanasios; Mahillon, Jacques; Markowitz, Victor; Mavromatis, Konstantinos; Mukamolova, Galina V.; Oren, Aharon; Rokem, J. Stefan; Smith, Margaret C. M.; Young, Danielle I.; Greenblatt, Charles L.
2010-01-01
Micrococcus luteus (NCTC2665, “Fleming strain”) has one of the smallest genomes of free-living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content, 73%) predicted to encode 2,403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 insertion sequence (IS) elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. The genome encodes only four sigma factors and 14 response regulators, a finding indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to β-lactam antibiotics may result from the presence of a reduced set of penicillin-binding proteins and the absence of a wblC gene, which plays an important role in the antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to most other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy, and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three-gene cluster essential for this
Wei, Guanyun; Sun, Lianjie; Li, Ruimin; Li, Lei; Xu, Jiao; Ma, Fei
2018-04-01
Pathogen bacteria infections can lead to dynamic changes of microRNA (miRNA) and mRNA expression profiles, which may control synergistically the outcome of immune responses. To reveal the role of dynamic miRNA-mRNA regulation in Drosophila innate immune responses, we have detailedly analyzed the paired miRNA and mRNA expression profiles at three time points during Drosophila adult males with Micrococcus luteus (M. luteus) infection using RNA- and small RNA-seq data. Our results demonstrate that differentially expressed miRNAs and mRNAs represent extensively dynamic changes over three time points during Drosophila with M. luteus infection. The pathway enrichment analysis indicates that differentially expressed genes are involved in diverse signaling pathways, including Toll and Imd as well as orther signaling pathways at three time points during Drosophila with M. luteus infection. Remarkably, the dynamic change of miRNA expression is delayed by compared to mRNA expression change over three time points, implying that the "time" parameter should be considered when the function of miRNA/mRNA is further studied. In particular, the dynamic miRNA-mRNA regulatory networks have shown that miRNAs may synergistically regulate gene expressions of different signaling pathways to promote or inhibit innate immune responses and maintain homeostasis in Drosophila, and some new regulators involved in Drosophila innate immune response have been identified. Our findings strongly suggest that miRNA regulation is a key mechanism involved in fine-tuning cooperatively gene expressions of diverse signaling pathways to maintain innate immune response and homeostasis in Drosophila. Taken together, the present study reveals a novel role of dynamic miRNA-mRNA regulation in immune response to bacteria infection, and provides a new insight into the underlying molecular regulatory mechanism of Drosophila innate immune responses. Copyright © 2017 Elsevier Ltd. All rights reserved.
Su, Xiao-Mei; Liu, Yin-Dong; Hashmi, Muhammad Zaffar; Ding, Lin-Xian; Shen, Chao-Feng
2015-05-01
Biphenyl (BP)-degrading bacteria were identified to degrade various polychlorinated BP (PCB) congers in long-term PCB-contaminated sites. Exploring BP-degrading capability of potentially useful bacteria was performed for enhancing PCB bioremediation. In the present study, the bacterial composition of the PCB-contaminated sediment sample was first investigated. Then extracellular organic matter (EOM) from Micrococcus luteus was used to enhance BP biodegradation. The effect of the EOM on the composition of bacterial community was investigated by combining with culture-dependent and culture-independent methods. The obtained results indicate that Proteobacteria and Actinobacteria were predominant community in the PCB-contaminated sediment. EOM from M. luteus could stimulate the activity of some potentially difficult-to-culture BP degraders, which contribute to significant enhancement of BP biodegradation. The potentially difficult-to-culture bacteria in response to EOM addition were mainly Rhodococcus and Pseudomonas belonging to Gammaproteobacteria and Actinobacteria respectively. This study provides new insights into exploration of functional difficult-to-culture bacteria with EOM addition and points out broader BP/PCB degrading, which could be employed for enhancing PCB-bioremediation processes. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Keratinolytic abilities of Micrococcus luteus from poultry waste.
Laba, Wojciech; Choinska, Anna; Rodziewicz, Anna; Piegza, Michal
2015-01-01
Keratinolytic microorganisms have become the subject of scientific interest due to their ability to biosynthesize specific keratinases and their prospective application in keratinic waste management. Among several bacterial classes, actinobacteria remain one of the most important sources of keratin-degrading strains, however members of the Micrococcaceae family are rarely scrutinized in regard to their applicatory keratinolytic potential. The tested Micrococcus sp. B1pz isolate from poultry feather waste was identified as M. luteus. The strain, grown in the medium with 1-2% chicken feathers and a yeast extract supplement, produced keratinases of 32 KU and lower level of proteases, 6 PU. It was capable to effectively decompose feathers or "soft" keratin of stratum corneum, in contrast to other "hard" hair-type keratins. The produced keratinolytic enzymes were mainly a combination of alkaline serine or thiol proteases, active at the optimum pH 9.4, 55 °C. Four main protease fractions of 62, 185, 139 and 229 kDa were identified in the crude culture fluid. The research on the auxiliary role of reducing factors revealed that reducing sulfur compounds could be applied in keratinolysis enhancement during enzymatic digestion of keratin, rather than in culture conditions. The presented M. luteus isolate exhibits a significant keratinolytic potential, which determines its feasible applicatory capacity towards biodegradation of poultry by-products or formulation of keratin-based feed components.
Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S
2010-02-01
Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.
Biosorption of lead and copper by heavy-metal tolerant Micrococcus luteus DE2008.
Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Diestra, Elia; Esteve, Isabel; Solé, Antoni
2012-12-01
Micrococcus luteus DE2008 has the ability to absorb lead and copper. The effect of these metals on biomass and viability of this microorganism were investigated and removal of the metals from culture media was determined. Lead had no effect on the biomass expressed as mg Carbon/cm(3) of M. Iuteus DE2008, but in the case of copper, the minimum metal concentration that affected the biomass was 0.1 mM Cu(II). According to these results this microorganism shows a greater tolerance for lead. The minimum metal concentration that affected viability (expressed as the percentage of live cells) was 0.5 mM for both metals. M. luteus DE2008 exhibited a specific removal capacity of 408 mg/g for copper and 1965 mg/g for lead. This microorganism has a greater ability to absorb Pb(II) than Cu(II). M. luteus DE2008 could be seen as a microorganism capable of restoring environments polluted by lead and copper. Copyright © 2012 Elsevier Ltd. All rights reserved.
Genes involved in long-chain alkene biosynthesis in Micrococcus luteus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beller, Harry R.; Goh, Ee-Been; Keasling, Jay D.
2010-01-07
Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which four decades ago was reported to biosynthesize iso- and anteiso branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty-acid overproducing E. coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3more » (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-CoA produced the same C27 monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or -ACP) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (?-ketoacyl-ACP synthase III), which catalyzes decarboxylative Claisen
Genes involved in long-chain alkene biosynthesis in Micrococcus luteus.
Beller, Harry R; Goh, Ee-Been; Keasling, Jay D
2010-02-01
Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which 4 decades ago was reported to biosynthesize iso- and anteiso-branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty acid-overproducing Escherichia coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3 (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-coenzyme A (CoA) produced the same C(27) monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or-ACP [acyl carrier protein]) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (beta-ketoacyl-ACP synthase III), which
Extrachromosomal genetic elements in Micrococcus.
Dib, Julián Rafael; Liebl, Wolfgang; Wagenknecht, Martin; Farías, María Eugenia; Meinhardt, Friedhelm
2013-01-01
Micrococci are Gram-positive G + C-rich, nonmotile, nonspore-forming actinomycetous bacteria. Micrococcus comprises ten members, with Micrococcus luteus being the type species. Representatives of the genus play important roles in the biodegradation of xenobiotics, bioremediation processes, production of biotechnologically important enzymes or bioactive compounds, as test strains in biological assays for lysozyme and antibiotics, and as infective agents in immunocompromised humans. The first description of plasmids dates back approximately 28 years, when several extrachromosomal elements ranging in size from 1.5 to 30.2 kb were found in Micrococcus luteus. Up to the present, a number of circular plasmids conferring antibiotic resistance, the ability to degrade aromatic compounds, and osmotolerance are known, as well as cryptic elements with unidentified functions. Here, we review the Micrococcus extrachromosomal traits reported thus far including phages and the only quite recently described large linear extrachromosomal genetic elements, termed linear plasmids, which range in size from 75 kb (pJD12) to 110 kb (pLMA1) and which confer putative advantageous capabilities, such as antibiotic or heavy metal resistances (inferred from sequence analyses and curing experiments). The role of the extrachromosomal elements for the frequently proven ecological and biotechnological versatility of the genus will be addressed as well as their potential for the development and use as genetic tools.
Whole genome sequences and annotation of Micrococcus luteus SUBG006, a novel phytopathogen of mango.
Rakhashiya, Purvi M; Patel, Pooja P; Thaker, Vrinda S
2015-12-01
Actinobaceria, Micrococcus luteus SUBG006 was isolated from infected leaves of Mangifera indica L. vr. Nylon in Rajkot, (22.30°N, 70.78°E), Gujarat, India. The genome size is 3.86 Mb with G + C content of 69.80% and contains 112 rRNA sequences (5S, 16S and 23S). The whole genome sequencing has been deposited in DDBJ/EMBL/GenBank under the accession number JOKP00000000.
Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.
Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S
1984-01-01
Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981
Jampasri, Kongkeat; Pokethitiyook, Prayad; Kruatrachue, Maleeya; Ounjai, Puey; Kumsopa, Acharaporn
2016-10-02
Phytoremediation is widely promoted as a cost-effective technology for treating heavy metal and total petroleum hydrocarbon (TPH) co-contaminated soil. This study investigated the concurrent removal of TPHs and Pb in co-contaminated soil (27,000 mg kg(-1) TPHs, 780 mg kg(-1) Pb) by growing Siam weed (Chromolaena odorata) in a pot experiment for 90 days. There were four treatments: co-contaminated soil; co-contaminated soil with C. odorata only; co-contaminated soil with C. odorata and Micrococcus luteus inoculum; and co-contaminated soil with M. luteus only. C. odorata survived and grew well in the co-contaminated soil. C. odorata with M. luteus showed the highest Pb accumulation (513.7 mg kg(-1)) and uptake (7.7 mg plant(-1)), and the highest reduction percentage of TPHs (52.2%). The higher TPH degradation in vegetated soils indicated the interaction between the rhizosphere microorganisms and plants. The results suggested that C. odorata together with M. luteus and other rhizosphere microorganisms is a promising candidate for the removal of Pb and TPHs in co-contaminated soils.
Kloos, Wesley E.; Musselwhite, Margaret S.
1975-01-01
The distribution of Staphylococcus and Micrococcus species and associated coryneform bacteria, Acinetobacter, Klebsiella, Enterobacter, Bacillus, and Streptomyces on skin was determined during October 1971 from samples collected on persons living in North Carolina and New Jersey. Persistence of these organisms on skin was estimated in temporal studies conducted during the period from June 1971 to June 1972 on persons living in North Carolina. Staphylococci and coryneforms were the most predominant and persistent bacteria isolated from the nares and axillae. Staphylococci, coryneforms, micrococci, and Bacillus were the most predominant and persistent bacteria isolated from the head, legs, and arms. Acinetobacters were most frequently isolated during the warmer months of the years. Staphylococcus aureus and S. epidermidis were the most predominant and persistent staphylococci isolated from the nares, whereas S. epidermidis and S. hominis were the most predominant and persistent staphylococci isolated from the axillae, head, legs, and arms. S. capitis was often isolated from the head and arms and S. haemolyticus was often isolated from the head, legs, and arms. S. simulans, S. xylosus, S. cohnii, S. saprophyticus, S. warneri, and an unclassified coagulase-positive species were only occasionally isolated from skin. Micrococcus luteus was the most predominant and persistent Micrococcus isolated from skin and preferred regions of the head, legs, and arms. M. varians was the second most frequent Micrococcus isolated. M. lylae, M. sedentarius, M. roseus, M. kristinae, and M. nishinomiyaensis were only occasionally isolated from skin. M. lylae was most frequently isolated during the colder months of the years. PMID:810086
Radiation-Resistant Micrococcus luteus SC1204 and Its Proteomics Change Upon Gamma Irradiation.
Deng, Wuyuan; Yang, Yang; Gao, Peng; Chen, Hao; Wen, Wenting; Sun, Qun
2016-06-01
To explore the radiation-resistance mechanisms in bacteria, a radiation-resistant strain SC1204 was isolated from the surrounding area of a (60)Co-γ radiation facility. SC1204 could survive up to 8 kGy dose of gamma irradiation and was identified as Micrococcus luteus by phylogenetic analysis of 16S rRNA gene sequences. Its proteomic changes under 2-kGy irradiation were examined by two-dimensional electrophoresis followed by MALDI-TOF-TOF/MS analysis. The results showed that at least 24 proteins displayed significant changes (p < 0.05) at expression level under the radiation stress, among which 22 were successfully identified and classified into the major functional categories of metabolism, energy production and conservation, translation, ribosomal structure, and biogenesis. Among these proteins, leucyl aminopeptidase involved in synthesis of glutathione was the most abundant induced protein during postirradiation recovery, indicating that anti-oxidation protection was the most important line of defense in SC1204 against radiation. The next abundant protein was phosphoribosyl aminoimidazole carboxamide formyltransferase/IMP cyclohydrolase (AICAR Tfase/IMPCH), the key enzyme in the biosynthetic pathway of purine that is anti-radiation compound. Other proteins changing significantly (p < 0.05) after radiation exposure included urocanate hydratase, dihydrolipoyl dehydrogenase, succinyl-CoA synthetase subunit alpha, phosphoglycerate kinase, cell division protein FtsZ, elongation factor Ts and Tu, translation elongation factor Tu and G, 30S ribosomal protein S1, histidyl-tRNA synthetase, and arginyl-tRNA synthetase, which were considered to be the key proteins in urocanate metabolism, tricarboxylic acid cycle, glycolysis, cell division process, and synthesis process of proteins. Therefore, these proteins may also play important roles in radiation resistance in M. luteus.
Zhang, Yongdong; Lu, Zhiqiang
2015-05-01
Reactive oxygen species (ROSs) are generated in organisms in response to infections caused by invading microbes. However, excessive ROSs will inflict oxidative damage on the host. Peroxiredoxins (Prxs) are antioxidative enzymes that may eliminate ROSs efficiently. In this study, ApPrx1 from the pea aphid Acyrthosiphon pisum was cloned, and its function was investigated in vitro and in vivo. In the presence of DTT, recombinant ApPrx1 protein from Escherichia coli showed antioxidative activity by eliminating H2O2 effectively. The H2O2 levels were significantly higher in Micrococcus luteus-infected aphids than in uninfected aphids, and ApPrx1 expression was remarkably up-regulated when the aphids were infected with M. luteus or injected with H2O2. When ApPrx1 expression was reduced by dsRNA injection, the survival of the aphids decreased significantly after M. luteus infection. Knockdown of ApPrx1 decreased M. luteus loads inside the aphids 48h post-infection. While under infection conditions, the H2O2 levels were much higher in ApPrx1 knockdown aphids than in dsGFP-injected aphids, indicating that the decreased survival of the aphids was caused by increased oxidative stress. Taken together, our results reveal that ApPrx1 plays a protective role in oxidative stress caused by bacterial infection. Copyright © 2015 Elsevier Inc. All rights reserved.
Hirata, Yoshinori; Sata, Makoto; Makiuchi, Yuko; Morikane, Keita; Wada, Akihito; Okabe, Nobuhiko; Tomoike, Hitonobu
2009-12-01
During the period 2002-2008, at the National Cardiovascular Center, Osaka, 28 Micrococcus luteus isolates and one Kocuria spp. isolate were obtained from blood cultures of pulmonary hypertension (PH) patients who were receiving continuous infusion therapy with epoprostenol. Pulsed-field gel electrophoresis patterns of the isolates were unrelated, suggesting that the infections had multiple origins. The preparation of epoprostenol solution by patients themselves was thought to be a risk factor.
Zheng, Chunli; Qu, Baocheng; Wang, Jing; Zhou, Jiti; Wang, Jing; Lu, Hong
2009-06-15
Strain Z3 was isolated from nitrobenzene-contaminated sludge. Strain Z3 was able to utilize nitrobenzene as a sole source of carbon, nitrogen and energy under aerobic condition. Based on the morphology, physiological biochemical characteristics, and 16S rDNA sequence, strain Z3 was identified as Micrococcus luteus. Strain Z3 completely degraded nitrobenzene with initial concentration of 100, 150, 200, and 250 mg L(-1) within 70, 96, 120 and 196 h, respectively. Kinetics of nitrobenzene degradation was described using the Andrews equation. The kinetic parameters were as follows: q(max)=1.19 h(-1), K(s)=29.11 mg L(-1), and K(i)=94.00 mg L(-1). Strain Z3 had a high salinity tolerance. It degraded 200 mg L(-1) nitrobenzene completely in 5% NaCl (w/w%). Strain Z3 therefore could be an excellent candidate for the bio-treatment of nitrobenzene industrial wastewaters with high salinity. This is the first report on the degradation of nitrobenzene by M. luteus and the degradation of nitrobenzene achieved in such a high salinity.
Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li
2008-10-01
To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.
Arunkumar, Pichaimani; Thanalakshmi, Muthukrishnan; Kumar, Priyadarsini; Premkumar, Kumpati
2013-03-01
In the present study we have utilized the bioreductive potential of Micrococcus luteus for the synthesis of gold nanoparticles. Biochemical and physiological analysis indicate that the biosynthesized GNPs were achieved by dual mode, involving extracellular α-amylase and cell wall teichuronic acid (TUA) of M. luteus. The biosynthetic potential of both α-amylase and TUA, after isolation from bacterium, was examined. Under optimum conditions, these biomolecules reduces Au(3+) into Au(0) and the resulting GNPs were found to be stable for 1 month. The synthesized GNPs were characterized by UV-VIS spectrometry, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR) and dynamic light scattering (DLS). Results demonstrated that the synthesized GNPs were found to be monodispersive and spherical in shape with an average size of ∼6 nm and ∼50 nm for α-amylase and teichuronic acid, respectively. These findings suggest that M. luteus can be exploited as a potential biosource for the eco-friendly synthesis of gold nanoparticles. Copyright © 2012 Elsevier B.V. All rights reserved.
Stackebrandt, E; Koch, C; Gvozdiak, O; Schumann, P
1995-10-01
The results of a phylogenetic and chemotaxonomic analysis of the genus Micrococcus indicated that it is significantly heterogeneous. Except for Micrococcus lylae, no species groups phylogenetically with the type species of the genus, Micrococcus luteus. The other members of the genus form three separate phylogenetic lines which on the basis of chemotaxonomic properties can be assigned to four genera. These genera are the genus Kocuria gen. nov. for Micrococcus roseus, Micrococcus varians, and Micrococcus kristinae, described as Kocuria rosea comb. nov., Kocuria varians comb. nov., and Kocuria kristinae comb. nov., respectively; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Dermacoccus gen. nov. for Micrococcus nishinomiyaensis, described as Dermacoccus nishinomiyaensis comb. nov.; and the genus Kytocossus gen. nov. for Micrococcus sedentarius, described as Kytococcus sedentarius comb. nov. M. luteus and M. lylae, which are closely related phylogenetically but differ in some chemotaxonomic properties, are the only species that remain in the genus Micrococcus Cohn 1872. An emended description of the genus Micrococcus is given [corrected].
Mauclaire, Laurie; Egli, Marcel
2010-08-01
Microorganisms tend to form biofilms on surfaces, thereby causing deterioration of the underlaying material. In addition, biofilm is a potential health risk to humans. Therefore, microorganism growth is not only an issue on Earth but also in manned space habitats like the International Space Station (ISS). The aim of the study was to identify physiological processes relevant for Micrococcus luteus attachment under microgravity conditions. The results demonstrate that simulated microgravity influences physiological processes which trigger bacterial attachment and biofilm formation. The ISS strains produced larger amounts of exopolymeric substances (EPS) compared with a reference strain from Earth. In contrast, M. luteus strains were growing faster, and Earth as well as ISS isolates produced a higher yield of biomass under microgravity conditions than under normal gravity. Furthermore, microgravity caused a reduction of the colloidal EPS production of ISS isolates in comparison with normal gravity, which probably influences biofilm thickness and stability as well.
Pereira, Jose H; Goh, Ee-Been; Keasling, Jay D; Beller, Harry R; Adams, Paul D
2012-10-01
Micrococcus luteus is a Gram-positive bacterium that produces iso- and anteiso-branched alkenes by the head-to-head condensation of fatty-acid thioesters [coenzyme A (CoA) or acyl carrier protein (ACP)]; this activity is of interest for the production of advanced biofuels. In an effort to better understand the control of the formation of branched fatty acids in M. luteus, the structure of FabH (MlFabH) was determined. FabH, or β-ketoacyl-ACP synthase III, catalyzes the initial step of fatty-acid biosynthesis: the condensation of malonyl-ACP with an acyl-CoA. Analysis of the MlFabH structure provides insights into its substrate selectivity with regard to length and branching of the acyl-CoA. The most structurally divergent region of FabH is the L9 loop region located at the dimer interface, which is involved in the formation of the acyl-binding channel and thus limits the substrate-channel size. The residue Phe336, which is positioned near the catalytic triad, appears to play a major role in branched-substrate selectivity. In addition to structural studies of MlFabH, transcriptional studies of M. luteus were also performed, focusing on the increase in the ratio of anteiso:iso-branched alkenes that was observed during the transition from early to late stationary phase. Gene-expression microarray analysis identified two genes involved in leucine and isoleucine metabolism that may explain this transition.
Effect of Nisin's Controlled Release on Microbial Growth as Modeled for Micrococcus luteus.
Balasubramanian, Aishwarya; Lee, Dong Sun; Chikindas, Michael L; Yam, Kit L
2011-06-01
The need for safe food products has motivated food scientists and industry to find novel technologies for antimicrobial delivery for improving food safety and quality. Controlled release packaging is a novel technology that uses the package to deliver antimicrobials in a controlled manner and sustain antimicrobial stress on the targeted microorganism over the required shelf life. This work studied the effect of controlled release of nisin to inhibit growth of Micrococcus luteus (a model microorganism) using a computerized syringe pump system to mimic the release of nisin from packaging films which was characterized by an initially fast rate and a slower rate as time progressed. The results show that controlled release of nisin was strikingly more effective than instantly added ("formulated") nisin. While instant addition experiments achieved microbial inhibition only at the beginning, controlled release experiments achieved complete microbial inhibition for a longer time, even when as little as 15% of the amount of nisin was used as compared to instant addition.
Szczerba, Izabela
2003-01-01
The aim of work was to evaluate the frequency of occurrence of bacteria from genera of Micrococcus, Kocuria, Nesterenkonia, kytococcus and Dermatococcus on human skin and mucous membranes in healthy population. Among 150 investigated persons these bacteria were found in 122 (81.3%). The frequency of isolation was similar in both sex (82.4% in female and 79.7% in male). Most often the strains were isolated from oral cavity (48.7%), and from skin of palm and forearm (40.7% and 37.3%). Least frequency of occurrence was observed in vestibule of nose (26%). The predominant isolated strains were: M. luteus (26.2%), and N. halobia (21%) followed by K. varians (16.4%), M. lylae (12.2%), D. sedentarius (9.1%), K. kristinae (7.3%), K. nishinomiyaensis (7.3%), K. rosea (0.3%).
Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng
2016-03-01
A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.
Development of a rapid optic bacteria detecting system based on ATP bioluminescence
NASA Astrophysics Data System (ADS)
Liu, Jun Tao; Luo, JinPing; Liu, XiaoHong; Cai, XinXia
2014-12-01
A rapid optic bacteria detecting system based on the principle of Adenosine triphosphate(ATP) bioluminescence was presented in this paper. This system consisted of bioluminescence-based biosensor and the high-sensitivity optic meter. A photon counting photomultiplier tube (PMT) module was used to improve the detection sensitivity, and a NIOS II/f processor based on a Field Programmable Gate Array(FPGA) was used to control the system. In this work, Micrococcus luteus were chosen as the test sample. Several Micrococcus luteus suspension with different concentration was tested by both T2011 and plate counting method. By comparing the two group results, an calibration curve was obtained from the bioluminescence intensity for Micrococcus luteus in the range of 2.3×102 ~ 2.3×106 CFU/mL with a good correlation coefficient of 0.960. An impacting Air microorganism sampler was used to capture Airborne Bacteria, and 8 samples were collected in different place. The TBC results of 8 samples by T2011 were between 10 ~ 2×103 cfu/mL, consistent with that of plate counting method, which indicated that 8 samples were between 10 ~ 3×103 cfu/mL. For total airborne bacteria count was small, correlation coefficient was poor. Also no significant difference was found between T2011 and plate counting method by statistical analyses.
Survival of Microorganisms in Nature.
1982-04-07
number) Survival of bacteria; Death of bacteria; Cysts; Dormancy; Pseudomonas aeruginosa; Azotobacter; Chemotaxis; Micrococcus luteus; Predation...attracted to and rapidly destroys (lyses) added Micrococcus luteus cells. There is also attack of predator on predator in this system. DO 1 DIT1 473 Oor I OV...and on laboratory media. 4 1 SUMMARY OF IMPORTANT RESULTS Micrococcus luteus was shown to survive only poorly in soil (Casida, 1980a). This was
Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian
2014-07-01
The physicochemical properties of the extra-cellular polysaccharide (EPS) produced by a Micrococcus luteus strain, a dominating strain isolated from membrane biofouling layer, were determined in this study. The EPS isolated from this strain was measured to have an average molecular weight of 63,540 Da and some typical polysaccharide absorption peaks in Fourier transform infrared spectrum. Monosaccharide components of the EPS contained rhamnose, fucose, arabinose, xylose, mannose, galactose and glucose in a molar ratio of 0.2074:0.0454:0.0262:0.0446:1.7942:1.2086:0.4578. Pseudo plastic properties were also observed for the EPS through the rheological measurement. The EPS was further characterized for its behavior to cause membrane flux decline. The results showed that both flux declines for polyvinylidenefluoride (PVDF) and polypropylene membranes became more severe as EPS feed concentration increased. A higher irreversible fouling for the PVDF membrane suggested that the EPS had the larger fouling potential to this microfiltration membrane.
Stimulation of Lactic Acid Bacteria by a Micrococcus Isolate: Evidence for Multiple Effects
Nath, K. R.; Wagner, B. J.
1973-01-01
Growth of, and rate of acid production by, six cultures of lactic acid bacteria were increased in the presence of Micrococcus isolate F4 or a preparation of its capsular material. Concentrations of hydrogen peroxide found in pure cultures of the lactic acid bacteria were not detectable, or were greatly reduced, in mixed culture with Micrococcus isolate F4. The capsular material was not as effective as whole cells in preventing accumulation of H2O2. Catalase stimulated growth of, and the rate of acid production by, the lactic acid bacteria, but not to the same extent as Micrococcus isolate F4 in some cultures. The existence of two mechanisms for micrococcal stimulation of the lactic acid bacteria is postulated. One mechanism involves removal of H2O2; the other has not been characterized. PMID:4199337
Setlow, R. B.; Setlow, Jane K.; Carrier, W. L.
1970-01-01
An endonuclease purified from Micrococcus luteus makes single-strand breaks in ultraviolet (UV)-irradiated, native deoxyribonucleic acid (DNA). The purified endonuclease is able to reactivate UV-inactivated transforming DNA of Haemophilus influenzae, especially when the DNA is assayed on a UV-sensitive mutant of H. influenzae. After extensive endonuclease action, there is a loss of transforming DNA when assayed on both UV-sensitive and -resistant cells. The endonuclease does not affect unirradiated DNA. The results indicate that the endonuclease function is involved in the repair of biological damage resulting from UV irradiation and that the UV-sensitive mutant is deficient in this step. We interpret the data as indicating that the various steps in the repair of DNA must be well coordinated if repair is to be effective. PMID:4314478
Surger, Maximilian J; Angelov, Angel; Stier, Philipp; Übelacker, Maria; Liebl, Wolfgang
2018-01-01
Micrococcus luteus naturally produces alkenes, unsaturated aliphatic hydrocarbons, and represents a promising host to produce hydrocarbons as constituents of biofuels and lubricants. In this work, we identify the genes for key enzymes of the branched-chain amino acid catabolism in M. luteus , whose first metabolic steps lead also to the formation of primer molecules for branched-chain fatty acid and olefin biosynthesis, and demonstrate how these genes can be used to manipulate the production of specific olefins in this organism. We constructed mutants of several gene candidates involved in the branched-chain amino acid metabolism or its regulation and investigated the resulting changes in the cellular fatty acid and olefin profiles by GC/MS. The gene cluster encoding the components of the branched-chain α-keto acid dehydrogenase (BCKD) complex was identified by deletion and promoter exchange mutagenesis. Overexpression of the BCKD gene cluster resulted in about threefold increased olefin production whereas deletion of the cluster led to a drastic reduction in branched-chain fatty acid content and a complete loss of olefin production. The specificities of the acyl-CoA dehydrogenases of the branched amino acid degradation pathways were deduced from the fatty acid and olefin profiles of the respective deletion mutant strains. In addition, growth experiments with branched amino acids as the only nitrogen source were carried out with the mutants in order to confirm our annotations. Both the deletion mutant of the BCKD complex, responsible for the further degradation of all three branched-chain amino acids, as well as the deletion mutant of the proposed isovaleryl-CoA dehydrogenase (specific for leucine degradation) were not able to grow on leucine in contrast to the parental strain. In conclusion, our experiments allow the unambigous assignment of specific functions to the genes for key enzymes of the branched-chain amino acid metabolism of M. luteus . We also show how
Standardized Procedures for Use of Nucleic Acid-Based Tools
2008-08-01
Dhc size or cell wall characteristics including Brevundimonas diminuta (small), Micrococcus sp. (small coccoid) and Halobacterium sp. (Dhc-like cell...Halobacterium species as a Dhc surrogate. Another potential surrogate based on size and shape is Micrococcus species including Micrococcus luteus... Micrococcus luteus (ATCC-4442) are relatively small (1,000 nm) spherical bacteria (Madigan et al., 2006). Due to the fact that introduction and
Sterilization effects of atmospheric cold plasma brush
NASA Astrophysics Data System (ADS)
Yu, Q. S.; Huang, C.; Hsieh, F.-H.; Huff, H.; Duan, Yixiang
2006-01-01
This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0×104-1.0×105 Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar +O2 plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structures were examined using scanning electron microscopy.
Bhattacharya, Abhishek; Shrivastava, Ankita; Sharma, Anjana
2013-06-01
Carbonic anhydrase (CA) was purified from Micrococcus lylae and Micrococcus luteus with 49.90 and 53.8 % yield, respectively, isolated from calcium carbonate kilns. CA from M. lylae retained 80 % stability in the pH and temperature range of 6.0-8.0 and 35-45 °C, respectively. However, CA from M. luteus was stable in the pH and temperature range of 7.5-10.0 and 35-55 °C, respectively. Cross-linked enzyme aggregates (CLEAs) raised the transition temperature of M. lylae and M. luteus CA up to 67.5 and 74.0 °C, while the operational stability (T(1/20) of CA at 55 °C was calculated to be 7.7 and 12.0 h, respectively. CA from both the strains was found to be monomeric in nature with subunit molecular weight and molecular mass of 29 kDa. Ethoxozolamide was identified as the most potent inhibitor based on both IC(50) values and inhibitory constant measurement (K(i)). The K(m) and V(max) for M. lylae CA (2.31 mM; 769.23 μmol/mg/min) and M. luteus CA (2.0 mM; 1,000 μmol/mg/min) were calculated from Lineweaver-Burk plots in terms of esterase activity. Enhanced thermostability of CLEAs alleviates its role in operational stability for application at an on-site scrubber. The characteristic profile of purified CA from Micrococcus spp. advocates its effective application in biomimetic CO(2) sequestration.
Sterilization effects of atmospheric cold plasma brush
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Q.S.; Huang, C.; Hsieh, F.-H.
2006-01-02
This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0x10{sup 4}-1.0x10{sup 5} Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar+O{sub 2} plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structuresmore » were examined using scanning electron microscopy.« less
University Research Initiative Program for Combat Readiness
1999-05-01
found in sponge-associated bacteria Micrococcus luteus (Bultel-Ponce et al., 1998). Such compounds have antimicrobial activity. Water contact angles...Guyot, M. 1998. Metabolites from the sponge-associated bacterium Micrococcus luteus. J. Mar. Biotechnol. 6:233-236. 3. Incze, B.I., Sea Technol. 1996, 37
Prakash, Om; Nimonkar, Yogesh; Munot, Hitendra; Sharma, Avinash; Vemuluri, Venkata Ramana; Chavadar, Mahesh S; Shouche, Yogesh S
2014-10-01
A yellow Gram-stain-positive, non-motile, non-endospore -forming, spherical endophytic actinobacterium, designated strain AE-6(T), was isolated from the inner fleshy leaf tissues of Aloe barbadensis (Aloe vera) collected from Pune, Maharashtra, India. Strain AE-6(T) grew at high salt concentrations [10% (w/v) NaCl], temperatures of 15-41 °C and a pH range of 5-12. It showed highest (99.7%) 16S rRNA gene sequence similarity with Micrococcus yunnanensis YIM 65004(T) followed by Micrococcus luteus NCTC 2665(T) (99.6%) and Micrococcus endophyticus YIM 56238(T) (99.0%). Ribosomal protein profiling by MALDI-TOF/MS also showed it was most closely related to M. yunnanensis YIM 65004(T) and M. luteus NCTC 2665(T). Like other members of the genus Micrococcus, strain AE-6(T) had a high content of branched chain fatty acids (iso-C15:0 and anteiso-C15:0). MK-8(H2) and MK-8 were the predominant isoprenoid quinones. Cell wall analysis showed an 'A2 L-Lys-peptide subunit' type of peptidoglycan and ribose to be the major cell wall sugar. The DNA G+C content was 70 mol%. Results of DNA-DNA hybridization of AE-6(T) with its closest relatives from the genus Micrococcus produced a value of less than 70%. Based on the results of this study, strain AE-6(T) could be clearly differentiated from other members of the genus Micrococcus. We propose that it represents a novel species of the genus Micrococcus and suggest the name Micrococcus aloeverae sp. nov., with strain AE-6(T) ( = MCC 2184(T) = DSM 27472(T)) as the type strain of the species. © 2014 IUMS.
Hildebrandt, K M; Anderson, J S
1990-01-01
Cytoplasmic membrane fragments of Micrococcus luteus catalyze in vitro biosynthesis of teichuronic acid from uridine diphosphate D-glucose (UDP-glucose), uridine diphosphate N-acetyl-D-mannosaminuronic acid (UDP-ManNAcA), and uridine diphosphate N-acetyl-D-glucosamine. Membrane fragments solubilized with Thesit (dodecyl alcohol polyoxyethylene ether) can utilize UDP-glucose and UDP-ManNAcA to effect elongation of teichuronic acid isolated from native cell walls. When UDP-glucose is the only substrate supplied, the detergent-solubilized glucosyltransferase incorporates a single glucosyl residue onto each teichuronic acid acceptor. When both UDP-glucose and UDP-ManNAcA are supplied, the glucosyltransferase and the N-acetylmannosaminuronosyltransferase act cooperatively to elongate the teichuronic acid acceptor by multiple additions of the disaccharide repeat unit. As shown by polyacrylamide gel electrophoresis, low-molecular-weight fractions of teichuronic acid are converted to higher-molecular-weight polymers by the addition of as many as 17 disaccharide repeat units. Images PMID:2118507
[Production and characteristics of bacteria-labeled talc dust for experimental air hygiene studies].
Ohgke, H; Oldenburg, B; Gropengiesser, R; Herbst, M
1983-04-01
Freeze-drying of suspensions of Micrococcus luteus together with talc yields bacteria-labelled dust. This material can be used in experimental air hygiene. Loss of viability due to drying in air during experiments can be expected to be negligible. A wide range of particle diameters (1 to greater than 23 micron) is available. Scanning electron microscopy shows the bacteria sticking on talc particles after freeze-drying (Fig. 3a + b). Viable counts of the material decreased very slowly on storage.
Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Esteve, Isabel; Solé, Antonio
2012-01-01
In previous studies, our group developed a method based on Confocal Laser Scanning Microscopy and Image Analysis (CLSM-IA) to analyze the diversity and biomass of cyanobacteria in microbial mats. However, this method cannot be applied to heterotrophic microorganisms, as these do not have autofluorescence. In this article, we present a method that combines CLSM-IA and Hoechst 33342 and SYTOX Green fluorochromes (FLU-CLSM-IA) to determine the viability and biomass of Micrococcus luteus DE2008, isolated from a saline microbial mat (Ebro Delta, Tarragona, Spain). The method has been applied to assess the effect of salinity on this microorganism. A reduction in viability and biomass (live cells) was observed as the salt concentration increases. The largest effect was at 100‰ NaCl with a cell death of 27.25% and a decrease in total and individual biomass of 39.75 and 0.009 mgC/cm(3), respectively, both with respect to optimal growth (10 ‰ NaCl). On the other hand, another important contribution of this article was that combining the FLU-CLSM-IA results with those achieved by plate counts enabled us to determine, for first time, the viability and the total biomass of the "dormant cells" (66.75% of viability and 40.59 mgC/cm(3) of total biomass at 100‰ NaCl). FLU-CLSM-IA is an efficient, fast, and reliable method for making a total count of cells at pixel level, including the dormant cells, to evaluate the viability and the biomass of a hetetrophic microorganism, M. luteus DE2008.
First report of linear megaplasmids in the genus Micrococcus.
Dib, Julian R; Wagenknecht, Martin; Hill, Russell T; Farías, María E; Meinhardt, Friedhelm
2010-01-01
High-altitude wetlands (above 4200m) in the northwest of Argentina are considered pristine and extreme environments. Micrococcus sp. A1, H5, and V7, isolated from such environments, were shown to contain linear megaplasmids, designated pLMA1, pLMH5, and pLMV7, respectively. As known from linear plasmids of other actinomycetes, all three plasmids were resistant to lambda exonuclease treatment, which is consistent with having terminal proteins covalently attached to their 5' DNA ends. Electrophoretic mobility, Southern analysis, and restriction endonuclease patterns revealed pLMA1 and pLMH5 being indistinguishable plasmids, even though they were found in different strains isolated from two distant wetlands - Laguna Azul and Laguna Huaca Huasi. Analysis of 16S rDNA sequences of Micrococcus sp. A1, H5, and V7 suggested a close relationship to Micrococcus luteus. Typing of isolates was performed using fingerprint patterns generated by BOX-PCR. Plasmid-deficient strains, generated from Micrococcus sp. A1, showed a significantly decreased resistance level for erythromycin. Copyright 2009 Elsevier Inc. All rights reserved.
Netzer, Roman; Stafsnes, Marit H; Andreassen, Trygve; Goksøyr, Audun; Bruheim, Per; Brautaset, Trygve
2010-11-01
We report the cloning and characterization of the biosynthetic gene cluster (crtE, crtB, crtI, crtE2, crtYg, crtYh, and crtX) of the γ-cyclic C(50) carotenoid sarcinaxanthin in Micrococcus luteus NCTC2665. Expression of the complete and partial gene cluster in Escherichia coli hosts revealed that sarcinaxanthin biosynthesis from the precursor molecule farnesyl pyrophosphate (FPP) proceeds via C(40) lycopene, C(45) nonaflavuxanthin, C(50) flavuxanthin, and C(50) sarcinaxanthin. Glucosylation of sarcinaxanthin was accomplished by the crtX gene product. This is the first report describing the biosynthetic pathway of a γ-cyclic C(50) carotenoid. Expression of the corresponding genes from the marine M. luteus isolate Otnes7 in a lycopene-producing E. coli host resulted in the production of up to 2.5 mg/g cell dry weight sarcinaxanthin in shake flasks. In an attempt to experimentally understand the specific difference between the biosynthetic pathways of sarcinaxanthin and the structurally related ε-cyclic decaprenoxanthin, we constructed a hybrid gene cluster with the γ-cyclic C(50) carotenoid cyclase genes crtYg and crtYh from M. luteus replaced with the analogous ε-cyclic C(50) carotenoid cyclase genes crtYe and crtYf from the natural decaprenoxanthin producer Corynebacterium glutamicum. Surprisingly, expression of this hybrid gene cluster in an E. coli host resulted in accumulation of not only decaprenoxanthin, but also sarcinaxanthin and the asymmetric ε- and γ-cyclic C(50) carotenoid sarprenoxanthin, described for the first time in this work. Together, these data contributed to new insight into the diverse and multiple functions of bacterial C(50) carotenoid cyclases as key catalysts for the synthesis of structurally different carotenoids.
Baek, A-Hyong; Jeon, Eun-Yeong; Lee, Sun-Mee; Park, Jin-Byung
2015-05-01
We demonstrated for the first time that the archaeal chaperones (i.e., γ-prefoldin and thermosome) can stabilize enzyme activity in vivo. Ricinoleic acid biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and the Pseudomonas putida KT2440 Baeyer-Villiger monooxygenase improved significantly with co-expression of γ-prefoldin or recombinant themosome originating from the deep-sea hyperthermophile archaea Methanocaldococcus jannaschii. Furthermore, the degree of enhanced activity was dependent on the expression levels of the chaperones. For example, whole-cell biotransformation activity was highest at 12 µmol/g dry cells/min when γ-prefoldin expression level was approximately 46% of the theoretical maximum. This value was approximately two-fold greater than that in E. coli, where the γ-prefoldin expression level was zero or set to the theoretical maximum. Therefore, it was assumed that the expression levels of chaperones must be optimized to achieve maximum biotransformation activity in whole-cell biocatalysts. © 2014 Wiley Periodicals, Inc.
Pitting failure of copper pipings for emergency fire sprinkler in ground water
NASA Astrophysics Data System (ADS)
Baek, Seung-won; Lee, Jong-kwon; Kim, Jong-jip; Kim, Kyung-ja
2015-05-01
The possibility of microbiologically influenced corrosion was investigated in the early pitted copper pipes. The pipes were installed for less than 6 months as an immergency fire sprinkler. The bacteria were cultured by sampling of corrosion by-product near pits on failed copper pipes for the aerobic as well as anaerobic bacteria. However, only aerobic bacteria was found, which were Micrococcus Luteus and Bacillus sp.. The corrosion rate of copper pipes were studied by weight loss in the groundwater and polarization method. In immersion test as well as the electrochemical polarization test in ground water, only Micrococcus Luteus could activate corrosion of copper by 20% and 15%, respectively. On the other hand, Bacillus sp. showed little effect on corrosion in the above two tests. The shape and characteristics of failed copper pipes as well as simulated copper were investigated using stereoscope, optical microscopy, scanning electron microscope and EDS. The cause of pits were discussed, related with the dissolved copper concentrations, pH, and optical density. It could be concluded that the early failure of copper pipings could be ascribed to the acceration of copper in the presence of bacteria, i.e., Micrococcus Luteus.
Characterization of Micrococcus strains isolated from indoor air.
Kooken, Jennifer M; Fox, Karen F; Fox, Alvin
2012-02-01
The characterization of microbes, such as opportunists and pathogens (e.g., methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. Copyright © 2011 Elsevier Ltd. All rights reserved.
Characterization of Micrococcus strains isolated from indoor air
Kooken, Jennifer M.; Fox, Karen F.; Fox, Alvin
2014-01-01
The characterization of microbes, such as of opportunists and pathogens (e.g. methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. PMID:21963944
Yoshimune, Kazuaki; Shirakihara, Yasuo; Wakayama, Mamoru; Yumoto, Isao
2010-02-01
Glutaminase from Micrococcus luteus K-3 [Micrococcus glutaminase (Mglu); 456 amino acid residues (aa); 48 kDa] is a salt-tolerant enzyme. Our previous study determined the structure of its major 42-kDa fragment. Here, using new crystallization conditions, we determined the structures of the intact enzyme in the presence and absence of its product L-glutamate and its activator Tris, which activates the enzyme by sixfold. With the exception of a 'lid' part (26-29 aa) and a few other short stretches, the structures were all very similar over the entire polypeptide chain. However, the presence of the ligands significantly reduced the length of the disordered regions: 41 aa in the unliganded structure (N), 21 aa for L-glutamate (G), 8 aa for Tris (T) and 6 aa for both L-glutamate and Tris (TG). L-glutamate was identified in both the G and TG structures, whereas Tris was only identified in the TG structure. Comparison of the glutamate-binding site between Mglu and salt-labile glutaminase (YbgJ) from Bacillus subtilis showed significantly smaller structural changes of the protein part in Mglu. A comparison of the substrate-binding pocket of Mglu, which is highly specific for L-glutamine, with that of Erwinia carotovora asparaginase, which has substrates other than L-glutamine, shows that Mglu has a larger substrate-binding pocket that prevents the binding of L-asparagine with proper interactions.
Nurses’ uniforms: How many bacteria do they carry after one shift?
Sanon, Marie-Anne; Watkins, Sally
2013-01-01
This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment. PMID:25285235
Nurses' uniforms: How many bacteria do they carry after one shift?
Sanon, Marie-Anne; Watkins, Sally
2012-12-01
This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment.
Shakya, S; Pradhan, B; Smith, L; Shrestha, J; Tuladhar, S
2012-03-01
Arsenic (As) contamination of groundwater is a serious Environmental Health Management issue of drinking water sources especially in Terai region of Nepal. Many studies have reported that due to natural abundance of arsenic in the environment, various bacteria have developed different resistance mechanisms for arsenic compound. In this study, the culturable arsenic-resistant bacteria indigenous to surfacewater as well as groundwater from Rautahat District of Nepal were randomly isolated by standard plate count method on the basis of viable growth on plate count agar amended with arsenate ranging from 0, 0.5, 10, 40, 80 to 160 milligram per liter (mg/l). With respect to the morphological and biochemical tests, nine morphologically distinct potent arsenate tolerant bacteria showed relatedness with Micrococcus varians, Micrococcus roseus, Micrococcus luteus, Pseudomonas maltophilia, Pseudomonas sp., Vibrio parahaemolyticus, Bacillus cereus, Bacillus smithii 1 and Bacillus smithii 2. The isolates were capable of tolerating more than 1000 mg/l of arsenate and 749 mg/l of arsenite. Likewise, bioaccumulation capability was highest with M. roseus (85.61%) and the least with B. smithii (47.88%) indicating the potential of the organisms in arsenic resistance and most probably in bioremediation. Copyright © 2011 Elsevier Ltd. All rights reserved.
Exploring the potential environmental functions of viable but non-culturable bacteria.
Su, Xiaomei; Chen, Xi; Hu, Jinxing; Shen, Chaofeng; Ding, Linxian
2013-12-01
A conventional plate count is the most commonly employed method to estimate the number of living bacteria in environmental samples. In fact, judging the level of viable culture by plate count is limited, because it is often several orders of magnitude less than the number of living bacteria actually present. Most of the bacteria are in "viable but non-culturable" (VBNC) state, whose cells are intact and alive and can resuscitate when surrounding conditions are more favorable. The most exciting recent development in resuscitating VBNC bacteria is a bacterial cytokine, namely, the resuscitation-promoting factor (Rpf), secreted by Micrococcus luteus, which promotes the resuscitation and growth of high G+C Gram-positive organisms, including some species of the genus Mycobacterium. However, most of studies deal with VBNC bacteria only from the point of view of medicine and epidemiology. It is therefore of great significance to research whether these VBNC state bacteria also possess some useful environmental capabilities, such as degradation, flocculation, etc. Further studies are needed to elucidate the possible environmental role of the VBNC bacteria, rather than only considering their role as potential pathogens from the point view of epidemiology and public health. We have studied the resuscitation of these VBNC bacteria in polluted environments by adding culture supernatant containing Rpf from M. luteus, and it was found that, as a huge microbial resource, VBNC bacteria could provide important answers to dealing with existing problems of environmental pollution. This mini-review will provide new insight for considering the potentially environmental functions of VBNC bacteria.
Micrococcus flavus sp. nov., isolated from activated sludge in a bioreactor.
Liu, Xing-Yu; Wang, Bao-Jun; Jiang, Cheng-Ying; Liu, Shuang-Jiang
2007-01-01
Bacterial strain LW4(T) was isolated from activated sludge of a wastewater-treatment bioreactor. Cells of strain LW4(T) were Gram-positive cocci, with a diameter of 0.7-1.0 microm. Colonies produced on LB agar plates were yellow, smooth, circular and 0.5-1.5 mm in diameter. Strain LW4(T) was aerobic and grew over the temperature range 26-34 degrees C and pH range 5-9, with optimal growth at 30.5-31.5 degrees C and pH 6.0-6.2. The cell-wall peptidoglycan of strain LW4(T) contained amino acid residues of lysine, glutamic acid, alanine, glycine and aspartic acid. The most abundant cellular fatty acids of strain LW4(T) were anteiso-C(15 : 0) (32.15 %) and iso-C(15 : 0) (31.65 %). Major respiratory quinones were MK-8(H(2)) (57.3 %) and MK-7(H(2)) (32.9 %). The DNA G+C content was 71.4 mol% (T(m)). 16S rRNA gene sequence analysis indicated that strain LW4(T) was phylogenetically related to members of the genus Micrococcus, with similarities ranging from 96.5 to 97.3 %. Levels of DNA-DNA relatedness of strain LW4(T) to Micrococcus luteus DSM 20030(T), Micrococcus lylae DSM 20315(T) and Micrococcus antarcticus AS 1.2372(T) were 55, 48 and 36 %, respectively. Based on these results, it is concluded that strain LW4(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus flavus sp. nov. is proposed. The type strain is strain LW4(T) (=CGMCC 1.5361(T)=JCM 14000(T)).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Keller, L.C.; Maxcy, R.B.
1984-05-01
Physiological age-dependent variation in radiation resistance was studied for three bacteria that are highly radiation resistant: Micrococcus radiodurans, Micrococcus sp. isolate C-3, and Moraxella sp. isolate 4. Stationary-phase cultures of M. radiodurans and isolate C-3 were much more resistant to gamma radiation than were log-phase cultures. This pattern of relative resistance was reversed for isolate 4. Resistance of isolate 4 to UV light was also greater during log phase, although heat resistance and NaCl tolerance after heat stresses were greater during stationary phase. Radiation-induced injury of isolate 4 compared with injury of Escherichia coli B suggested that the injury process,more » as well as the lethal process, was affected by growth phase. The hypothesis that growth rate affects radiation resistance was tested, and results were interpreted in light of the probable confounding effect of methods used to alter growth rates of bacteria. These results indicate that dose-response experiments should be designed to measure survival during the most resistant growth phase of the organism under study. The timing is particularly important when extrapolations of survival results might be made to potential irradiation processes for foods. 17 references.« less
Nisin Migration in Shelf Stable, Tuna-Filled Tortillas During Storage
2014-09-22
RATIONS SHELF LIFE ACCEPTABILITY MICROCOCCUS LUTEUS STORAGE INHIBITION MILITARY RATIONS...7 Figure 3. The assay of nisin against Micrococcus luteus ATCC 10240 in tuna enrobed in a tortilla wrap...METHODS 2.1 BACTERIAL STRAINS, MEDIA, AND BUFFER The nisin-sensitive test organism, Micrococcus luteus ATCC® 10240, was obtained from the American
Haque, A S M Tanbirul; Moon, Jin Nam; Saravana, P S; Tilahun, Adane; Chun, Byung-Soo
2016-10-01
In this study, oils from Asarum heterotropoides were extracted by traditional solvent extraction and supercritical CO 2 (SC-CO 2 ) extraction methods and their antioxidant activities along with antimicrobial and inhibitory activities against five human body odor-producing bacteria (Staphylococcus epidermidis, Propionibacterium freudenreichii, Micrococcus luteus, Corynebacterium jeikeium, and Corynebacterium xerosis) were evaluated. The oil was found to contain 15 components, among which the most abundant component was methyl eugenol (37.6%), which was identified at every condition studied in different extraction methods. The oil extracted with n-hexane and ethanol mixture exhibited a strong antioxidant activity (92% ± 2%) and the highest ABTS and 2,2-diphenyl-1-picrylhydrazyl scavenging activities (89% ± 0.2%). The highest amounts of total phenolic content and total flavonoid content were 23.1±0.4 mg/g and 4.9±0.1 mg/g, respectively, in the traditional method. In the SC-CO 2 method performed at 200 bar/50°C using ethanol as an entrainer, the highest inhibition zone was recorded against all the aforementioned bacteria. In particular, strong antibacterial activity (38±2 mm) was found against M. luteus. The minimum inhibitory concentration (MIC) for the oil against bacteria ranged from 10.1±0.1 μg/mL to 46±2 μg/mL. The lowest MIC was found against M. luteus. Methyl eugenol was found to be one of the major compounds working against human body odor-producing bacteria. Copyright © 2016. Published by Elsevier B.V.
Yokoi, Kakeru; Koyama, Hiroaki; Minakuchi, Chieka; Tanaka, Toshiharu; Miura, Ken
2012-01-01
Using Tribolium castaneum, we quantitatively investigated the induction of nine antimicrobial peptide (AMP) genes by live gram-negative bacteria (Escherichia coli and Enterobacter cloacae), gram-positive bacteria (Micrococcus luteus and Bacillus subtilis) and the budding yeast (Saccharomyces cerevisiae). Then, five representative AMP genes were selected, and the involvement of the Toll and IMD pathways in their induction by E. coli, M. luteus and S. cerevisiae was examined by utilizing RNA interference of either MyD88 or IMD. Results indicated: Robust and acute induction of three genes by the two bacterial species was mediated mainly by the IMD pathway; slow and sustained induction of one gene by the two bacteria was mediated mainly by the Toll pathway; induction of the remaining one gene by the two bacteria was mediated by both pathways; induction of the five genes by the yeast was mediated by the Toll and/or IMD pathways depending on respective genes. These results suggest that more promiscuous activation and usage of the two pathways may occur in T. castaneum than in Drosophila melanogaster. In addition, the IMD pathway was revealed to dominantly contribute to defense against two bacterial species, gram-negative E. cloacae and gram-positive B. subtilis that possesses DAP-type peptidoglycan.
Presence of a new cytochrome b - like pigment with a peak at 567 nm in various aerobic bacteria.
Jacobs, N J; O'Hara, J; Gray, C T
1983-09-01
Several physiological groups of bacteria were examined for the presence of a cytochrome b - like pigment which is demonstrable in dithionite-reduced minus substrate-reduced difference spectra. This pigment is characterized by an unusually high alpha band at 567 nm, a low concentration relative to conventional cytochromes, and an inability to be fully reduced by endogenous substrates or NADH. Previous studies with one denitrifying and nondenitrifying species of the genus Pseudomonas, in Paracoccus denitrificans, in Alcaligenes faecalis, in Azotobacter vinelandii, in Branhamella catarrhalis, and in Neisseria lactamicus. In all these organisms, the peak of the 567-nm pigment is accompanied by a peak of about equal height at approximately 559 nm, which exhibits similar properties to the 567-nm pigment. The 567-nm pigment was not demonstrable by this technique in Gluconobacter oxydans subspecies suboxydans, Bacillus subtilis, Bacillus licheniformis, Aeromonas hydrophilia, Escherichia coli, a Klebsiella species, Moraxella osloensis, Aquaspirillum itersonii, Micrococcus lysodeikticus, Micrococcus luteus, Agrobacterium tumefaciens, or Rhizobium meliloti.
Taipale, Sami J; Brett, Michael T; Pulkkinen, Katja; Kainz, Martin J
2012-10-01
We explored how dietary bacteria affect the life history traits and biochemical composition of Daphnia magna, using three bacteria taxa with very different lipid composition. Our objectives were to (1) examine whether and how bacteria-dominated diets affect Daphnia survival, growth, and fecundity, (2) see whether bacteria-specific fatty acid (FA) biomarkers accrued in Daphnia lipids, and (3) explore the quantitative relationship between bacteria availability in Daphnia diets and the amounts of bacterial FA in their lipids. Daphnia were fed monospecific and mixed diets of heterotrophic (Micrococcus luteus) or methanotrophic bacteria (Methylomonas methanica and Methylosinus trichosporium) and two phytoplankton species (Cryptomonas ozolinii and Scenedesmus obliquus). Daphnia neonates fed pure bacteria diets died after 6-12 days and produced no viable offspring, whereas those fed pure phytoplankton diets had high survival, growth, and reproduction success. Daphnia fed a mixed diet with 80% M. luteus and 20% of either phytoplankton had high somatic growth, but low reproduction. Conversely, Daphnia fed mixed diets including 80% of either methane-oxidizing bacteria and 20% Cryptomonas had high reproduction rates, but low somatic growth. All Daphnia fed mixed bacteria and phytoplankton diets had strong evidence of both bacteria- and phytoplankton-specific FA biomarkers in their lipids. FA mixing model calculations indicated that Daphnia that received 80% of their carbon from bacteria assimilated 46 ± 25% of their FA from this source. A bacteria-phytoplankton gradient experiment showed a strong positive correlation between the proportions of the bacterial FA in the Daphnia and their diet, indicating that bacterial utilization can be traced in this keystone consumer using FA biomarkers. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.
1987-11-23
III (Gates and inn, 1977), Micrococcus luteus UV endo- nuclease (Grossman et al, 1978) and bacteriophage T UV endonuclease (Warner et al, 1980) have DNA...34, Garland Publishing, Inc. New York & London USA. Ather, A., Z. Ahmed and S. Riazxxddin, 1984. Adaptive response of Micrococcus luteus to alkylating...Laval, J., 3. Pierre and F. Laval. 1981. Release of 7-nmthylguanine residues frain alkylated ENA by extracts of Micrococcus luteus and Escherichia
Hillyer, Julián F; Schmidt, Shelley L; Christensen, Bruce M
2003-07-01
Mosquitoes are important vectors of disease. These insects respond to invading organisms with strong cellular and humoral immune responses that share many similarities with vertebrate immune systems. The strength and specificity of these responses are directly correlated to a mosquito's ability to transmit disease. In the current study, we characterized the hemocytes (blood cells) of Armigeres subalbatus by morphology (ultrastructure), lectin binding, enzyme activity, immunocytochemistry, and function. We found four hemocyte types: granulocytes, oenocytoids, adipohemocytes, and thrombocytoids. Granulocytes contained acid phosphatase activity and bound the exogenous lectins Helix pomatia agglutinin, Galanthus nivalis lectin, and wheat germ agglutinin. Following bacteria inoculation, granulocytes mounted a strong phagocytic response as early as 5 min postexposure. Bacteria also elicited a hemocyte-mediated melanization response. Phenoloxidase, the rate-limiting enzyme in the melanization pathway, was present exclusively in oenocytoids and in many of the melanotic capsules enveloping bacteria. The immune responses mounted against different bacteria were not identical; gram(-) Escherichia coli were predominantly phagocytosed and gram(+) Micrococcus luteus were melanized. These studies implicate hemocytes as the primary line of defense against bacteria.
Li, Gui; Lai, Ren; Duan, Gang; Lyu, Long-Bao; Zhang, Zhi-Ye; Liu, Huang; Xiang, Xun
2014-11-18
Endosymbionts influence many aspects of their hosts' health conditions, including physiology, development, immunity, metabolism, etc. Tree shrews (Tupaia belangeri chinensis) have attracted increasing attention in modeling human diseases and therapeutic responses due to their close relationship with primates. To clarify the situation of symbiotic bacteria from their body surface, oral cavity, and anus, 12 wild and 12 the third generation of captive tree shrews were examined. Based on morphological and cultural characteristics, physiological and biochemical tests, as well as the 16S rDNA full sequence analysis, 12 bacteria strains were isolated and identified from the wild tree shrews: body surface: Bacillus subtilis (detection rate 42%), Pseudomonas aeruginosa (25%), Staphlococcus aureus (33%), S. Epidermidis (75%), Micrococcus luteus (25%), Kurthia gibsonii (17%); oral cavity: Neisseria mucosa (58%), Streptococcus pneumonia (17%); anus: Enterococcus faecalis (17%), Lactococus lactis (33%), Escherichia coli (92%), Salmonella typhosa (17%); whereas, four were indentified from the third generation captive tree shrews: body surface: S. epidermidis (75%); oral cavity: N.mucosa (67%); anus: L. lactis (33%), E. coli (100%). These results indicate that S. epidermidis, N. mucosa, L. lactis and E. coli were major bacteria in tree shrews, whereas, S. aureus, M. luteus, K. gibsonii, E. faecalis and S. typhosa were species-specific flora. This study facilitates the future use of tree shrews as a standard experimental animal and improves our understanding of the relationship between endosymbionts and their hosts.
Unique antimicrobial spectrum of ophiobolin K produced by Aspergillus ustus.
Sohsomboon, Natthapat; Kanzaki, Hiroshi; Nitoda, Teruhiko
2018-03-01
A co-cultivation study of two fungal strains showed that Aspergillus ustus could inhibit Aspergillus repens growth. The bioactive compound responsible for the observed activity was purified and identified as a sesterterpene, ophiobolin K. Ophiobolin K exhibited marked inhibition against both fungi and bacteria, especially A. repens, A. glaucus and gram-positive bacteria including Bacillus subtilis, Staphylococcus aureus, and Micrococcus luteus.
Bacteria associated with Amblyomma cajennense tick eggs
Machado-Ferreira, Erik; Vizzoni, Vinicius Figueiredo; Piesman, Joseph; Gazeta, Gilberto Salles; Soares, Carlos Augusto Gomes
2015-01-01
Abstract Ticks represent a large group of pathogen vectors that blood feed on a diversity of hosts. In the Americas, the Ixodidae ticks Amblyomma cajennense are responsible for severe impact on livestock and public health. In the present work, we present the isolation and molecular identification of a group of culturable bacteria associated with A. cajennense eggs from females sampled in distinct geographical sites in southeastern Brazil. Additional comparative analysis of the culturable bacteria from Anocentor nitens, Rhipicephalus sanguineus and Ixodes scapularis tick eggs were also performed. 16S rRNA gene sequence analyses identified 17 different bacterial types identified as Serratia marcescens, Stenotrophomonas maltophilia, Pseudomonas fluorescens, Enterobacter spp., Micrococcus luteus, Ochrobactrum anthropi, Bacillus cereus and Staphylococcus spp., distributed in 12 phylogroups. Staphylococcus spp., especially S. sciuri, was the most prevalent bacteria associated with A. cajennense eggs, occurring in 65% of the samples and also frequently observed infecting A. nitens eggs. S. maltophilia, S. marcescens and B. cereus occurred infecting eggs derived from specific sampling sites, but in all cases rising almost as pure cultures from infected A. cajennense eggs. The potential role of these bacterial associations is discussed and they possibly represent new targets for biological control strategies of ticks and tick borne diseases. PMID:26537602
Code of Federal Regulations, 2010 CFR
2010-04-01
.... Non-spore-formers 3. Candida albicans (ATCC No. 10231) Do. 4. Micrococcus luteus (ATCC No. 9341) Do. 5.... 6633) 20 to 25 °C. Non-spore-formers 2. Candida albicans (ATCC No. 10231) Do. 3. Micrococcus luteus...
Wang, Weilin; Liu, Rui; Zhang, Tao; Zhang, Ran; Song, Xuan; Wang, Lingling; Song, Linsheng
2015-03-01
Phagocytosis is an evolutionarily conserved process to ingest the invading microbes and apoptotic or necrotic corpses, playing vital roles in defensing invaders and maintenance of normal physiological conditions. In the present study, a new Nimrod family phagocytic receptor with three EGF-like domains was identified in Pacific oyster Crassostrea gigas (designated CgNimC). CgNimC shared homology with other identified multiple EGF-like domain containing proteins. The mRNA transcripts of CgNimC were mainly distributed in mantle and hemocytes. Its relative expression level in hemocytes was significantly (P < 0.01) up-regulated after the injection of bacteria Vibrio anguillarum. Different to the NimC in Drosophila and Anopheles gambiae, the recombinant protein of CgNimC (rCgNimC) could bind directly to two gram-negative bacteria V. anguillarum and Vibrio splendidus, but not to gram-positive bacteria Staphylococci aureus, Micrococcus luteus or fungi Yarrowia lipolytica and Pichia pastoris. The affinity of rCgNimC toward M. luteus and Y. lipolytica was enhanced when the microorganisms were pre-incubated with the cell free hemolymph. rCgNimC exhibited higher affinity to lipopolysaccharide (LPS) and relatively lower affinity to peptidoglycan (PGN), while no affinity to glucan (GLU). After the CgNimC receptor was blocked by anti-rCgNimC antibody in vitro, the phagocytic rate of hemocytes toward two gram-negative bacteria V. anguillarum and V. splendidus was reduced significantly (P < 0.05), but no significant change of phagocytic rate was observed toward M. luteus and Y. lipolytica. All these results implied that CgNimC, with significant binding capability to LPS and gram-negative bacteria, was a novel phagocytic receptor involved in immune response of Pacific oyster. Further, it was speculated that receptors of Nimrod family might function as a phagocytic receptor to recognize PAMPs on the invaders and its recognition could be promoted by opsonization of molecules in
Standoff detection and classification of bacteria by multispectral laser-induced fluorescence
NASA Astrophysics Data System (ADS)
Duschek, Frank; Fellner, Lea; Gebert, Florian; Grünewald, Karin; Köhntopp, Anja; Kraus, Marian; Mahnke, Peter; Pargmann, Carsten; Tomaso, Herbert; Walter, Arne
2017-04-01
Biological hazardous substances such as certain fungi and bacteria represent a high risk for the broad public if fallen into wrong hands. Incidents based on bio-agents are commonly considered to have unpredictable and complex consequences for first responders and people. The impact of such an event can be minimized by an early and fast detection of hazards. The presented approach is based on optical standoff detection applying laser-induced fluorescence (LIF) on bacteria. The LIF bio-detector has been designed for outdoor operation at standoff distances from 20 m up to more than 100 m. The detector acquires LIF spectral data for two different excitation wavelengths (280 and 355 nm) which can be used to classify suspicious samples. A correlation analysis and spectral classification by a decision tree is used to discriminate between the measured samples. In order to demonstrate the capabilities of the system, suspensions of the low-risk and non-pathogenic bacteria Bacillus thuringiensis, Bacillus atrophaeus, Bacillus subtilis, Brevibacillus brevis, Micrococcus luteus, Oligella urethralis, Paenibacillus polymyxa and Escherichia coli (K12) have been investigated with the system, resulting in a discrimination accuracy of about 90%.
Jin, Yi; Gan, Guojuan; Yu, Xiaoyun; Wu, Dongdong; Zhang, Li; Yang, Na; Hu, Jiadan; Liu, Zhiheng; Zhang, Lixin; Hong, Huachang; Yan, Xiaoqing; Liang, Yan; Ding, Linxian; Pan, Yonglong
2017-07-01
Printing and dyeing wastewater with high content of organic matters, high colority, and poor biochemical performance is hard to be degraded. In this study, we isolated viable but non-culturable (VBNC) bacteria from printing and dyeing wastewater with the culture media contained resuscitation promoting factor (Rpf) protein secreted by Micrococcus luteus, counted the culturable cells number with the most probable number, sequenced 16S rRNA genes, and performed polymerase chain reaction-denaturing gradient gel electrophoresis. It is obviously that the addition of Rpf in the enrichment culture could promote growth and resuscitation of bacteria in VBNC state to obtain more fastidious bacteria significantly. The identified bacteria were assigned to nine genera in the treatment group, while the two strains of Ochrobactrum anthropi and Microbacterium sp. could not be isolated from the control group. The function of isolated strains was explored and these strains could degrade the dye of Congo red. This study provides a new sight into the further study including the present state, composition, formation mechanism, and recovery mechanism about VBNC bacteria in printing and dyeing wastewater, which would promote to understand bacterial community in printing and dyeing wastewater, and to obtain VBNC bacteria from ecological environment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Daly, Michael J.
2006-05-01
Ionizing Radiation (IR) Resistance in Bacteria. Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR) and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny,more » where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR.« less
Antimicrobial activity of Bryum argenteum.
Sabovljevic, Aneta; Sokovic, Marina; Sabovljevic, Marko; Grubisic, Dragoljub
2006-02-01
The antimicrobial activity of Bryum argenteum ethanol extracts was evaluated by microdilution method against four bacterial (Escherichia coli, Bacillus subtilis, Micrococcus luteus and Staphilococcus aureus) and four fungal species (Aspergillus niger, Penicillium ochrochloron, Candida albicans and Trichophyton mentagrophyes). All the investigated ethanol extracts have been proved to be active against all bacteria and fungi tested.
Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A
2007-08-01
The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
A new laboratory cultivation of Paramecium bursaria using non-pathogenic bacteria strains.
Bator, Tomasz
2010-01-01
In most studies dealing with the laboratory cultivation of paramecia (Paramecium bursaria), Klebsiella pneumoniae bacteria are used to inoculate the medium. However, Klebsiella pneumoniae is a typical pathogen, and its use is always associated with a risk of infection. The aim of the present research was to examine non-pathogenic bacteria strains as components of the medium for Paramecium bursaria. The paramecia were incubated on lettuce infusions bacterized with different bacteria strains: Bacillus subtilis DSM 10, Bacillus megaterium DSM 32, Escherichia coli DSM 498, Micrococcus luteus DSM 348. A strain derived from the natural habitat of Paramecium bursaria was used as the control one. Experiments were conducted under constant light and in the dark. Paramecia cells were counted under a stereomicroscope on consecutive days of incubation. The obtained results show that the most intensive growth of Paramecium bursaria occurs in the presence of Escherichia coli DSM 498. The use of this strain as a component of the medium allows one to obtain a high number of ciliates regardless of the light conditions. It can be concluded that the Paramecium bursaria cultivation procedure can be modified by using the non-pathogenic bacteria strain Escherichia coli DSM 498 instead of Klebsiella pneumoniae.
Natural History of Multi-Drug Resistant Organisms in a New Military Medical Facility
2012-10-01
Enterobacter cloacae Maternity Ward 05.312 Sink top Micrococcus luteus Maternity Ward 05.312 Telephone Pantoea agglomerans Maternity Ward...Acinetobacter baumannii Surgical Ward 06.316 Call box Acinetobacter baumannii/calcoaceticus complex Surgical Ward 06.316 Sink top Micrococcus luteus...Medical Ward 07.216 Sink top Micrococcus luteus Medical Ward 07.216 Room Sink Staphylococcus sciuri ICU 02.123 Toilet seat Staphylococcus
O'Mahony, Fiach C.; Papkovsky, Dmitri B.
2006-01-01
A simple method has been developed for the analysis of aerobic bacteria in complex samples such as broth and food homogenates. It employs commercial phosphorescent oxygen-sensitive probes to monitor oxygen consumption of samples containing bacteria using standard microtiter plates and fluorescence plate readers. As bacteria grow in aqueous medium, at certain points they begin to deplete dissolved oxygen, which is seen as an increase in probe fluorescence above baseline signal. The time required to reach threshold signal is used to either enumerate bacteria based on a predetermined calibration or to assess the effects of various effectors on the growth of test bacteria by comparison with an untreated control. This method allows for the sensitive (down to a single cell), rapid (0.5 to 12 h) enumeration of aerobic bacteria without the need to conduct lengthy (48 to 72 h) and tedious colony counts on agar plates. It also allows for screening a wide range of chemical and environmental samples for their toxicity. These assays have been validated with different bacteria, including Escherichia coli, Micrococcus luteus, and Pseudomonas fluorescens, with the enumeration of total viable counts in broth and industrial food samples (packaged ham, chicken, and mince meat), and comparison with established agar plating and optical-density-at-600-nm assays has been given. PMID:16461677
Feng, Z; Huang, S; Ai, Z W; Zhang, M; Zhai, S; Chen, X
2016-03-01
The technological properties of 22 micrococcus strains from traditional fermented Kedong sufu were evaluated in order to develop autochthonous starter cultures. The proteolytic, autolytic and lipolytic activity, salt tolerance, production and degradation of the biogenic amines of six Micrococcus luteus, nine Kocuria kristinae and seven Kocuria rosea were evaluated. The results indicated that these micrococcus strains exhibited a certain technological diversity, and the results also indicated the best properties to be used in mixed starter cultures. Based on the above findings, two sets of autochthonous starters were formulated. Considering the physicochemical properties and sensory characteristics of sufu, the maturation period of sufu was shortened by 30 days. The profiles of free amino acids and peptides partly revealed the mechanism of sensory quality and shorter ripening time of sufu manufactured using autochthonous mixed starters. Compared to back-slopping fermentation, sufu manufactured with selected autochthonous starter cultures exhibited lower levels of total biogenic amines. The selected strains could be used as starter to avoid the accumulation of high concentrations of biogenic amines while also maintaining typical sensory characteristics and preserving the autochthonous strains of the traditional Kedong sufu. The maturation times of Kedong sufu were shortened by 30 days with application of the autochthonous starter. Autochthonous mixed starters can reduce the generation of biogenic amines, speed up the sufu maturation process and preserve typical sensory quality. Furthermore, the rotation of two sets of mixed starter cultures can effectively resist phage attack during the production of sufu. © 2015 The Society for Applied Microbiology.
Singh, Asha; Vyas, Dhiraj; Malaviya, Piyush
2016-09-01
Two-stage sequential treatment of tannery effluent was conducted employing a wetland plant, Spirodela polyrrhiza (L.) Schleid., and chromium (Cr) resistant bacterial strains. The bacterial strains were isolated from Cr-enriched environmental matrices and rhizosphere of Spirodela polyrrhiza. The phyto-rhizoremediation of tannery effluent by Spirodela and its rhizospheric bacteria (Cellulomonas biazotea APBR1-6, Bacillus safensis APBR2-12, Staphylococcus warneri APBR3-5, Microbacterium oleivorans APBR2-6), followed by microremediation by Cr resistant bacteria (Micrococcus luteus APBS5-1, Bacillus pumilus APBS5-2, Bacillus flexus APBE3-1, Virgibacillus sediminis APBS6-1) resulted in reduction of pollution parameters [COD (81.2%), total Cr (97.3%), Cr(VI) (99.3%), Pb(II) (97.0%), Ni (95.7%)]. The LC-MS analysis showed that many pollutants detected in untreated tannery effluent were diminished after bioremediation or long chains of alcohol polyethoxylates viz. C18EO6 in untreated effluent were broken down into smaller unit of alcohol polyethoxylate ((+)HHO[CH2CH2O]H), indicating that bacteria and Spirodela polyrrhiza, alongwith its rhizospheric associates utilized them as carbon and energy source. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cruz-Guerrero, Alma; Hernández-Sánchez, Humberto; Rodríguez-Serrano, Gabriela; Gómez-Ruiz, Lorena; García-Garibay, Mariano; Figueroa-González, Ivonne
2014-08-01
Probiotics and prebiotics are among the most important functional food ingredients worldwide. The proven benefits of such ingredients to human health have encouraged the development of functional foods containing both probiotics and prebiotics. In this work, the production of antimicrobial compounds coupled to the uptake of commercial prebiotics by probiotic bacteria was investigated. The probiotic bacteria studied were able to take up commercial prebiotic carbohydrates to the same or higher extent than that observed for lactose (control carbohydrate). The growth of probiotic bacteria was coupled to the production of antimicrobials such as short-chain fatty acids (SCFA), H2 O2 and bacteriocins. A higher production of antimicrobial compounds was recorded with Oligomate 55® compared with Regulact® and Frutafit® (3-5 and 10-115 times higher SCFA and H2 O2 production, respectively). The probiotic bacteria grown with Oligomate 55® also produced bacteriocins and other non-identified antimicrobial compounds. The antimicrobials produced by the probiotic bacteria inhibited up to 50% the growth of model pathogens such as Escherichia coli, Listeria innocua and Micrococcus luteus compared with control cultures. The results here obtained are useful for the adequate selection of probiotic/prebiotics pairs and therefore in the development of efficient functional foods. © 2013 Society of Chemical Industry.
Immunochemical analysis of Micrococcus lysodeikticus (luteus) F1-ATPase and its subunits.
Urban, C; Salton, M R
1983-08-31
The F1-ATPase from Micrococcus lysodeikticus has been purified to 95% protein homogeneity in this laboratory and as all other bacterial F1S, possesses five distinct subunits with molecular weights ranging from 60 000 to 10 000 (Huberman, M. and Salton, M.R.J. (1979) Biochim. Biophys. Acta 547, 230-240). In this communication, we demonstrate the immunochemical reactivities of antibodies to native and SDS-dissociated subunits with the native and dissociated F1-ATPase and show that: (1) the antibodies generated to the native or SDS-dissociated subunits react with the native molecule; (2) all of the subunits comprising the F1 are antigenically unique as determined by crossed immunoelectrophoresis and the Ouchterlony double-diffusion techniques; (3) antibodies to the SDS-denatured individual delta- and epsilon-subunits can be used to destabilize the interaction of these specific subunits with the rest of the native F1; and (4) all subunit antibodies as well as anti-native F1 were found to inhibit ATPase activity to varying degrees, the strongest inhibition being seen with antibodies to the total F1 and anti-alpha- and anti-beta-subunit antibodies. The interaction of specific subunit antibodies may provide a new and novel way to study further and characterize the catalytic portions of F1-ATPases and in general may offer an additional method for the examination of multimeric proteins.
A marine bacterium, Micrococcus MCCB 104, antagonistic to vibrios in prawn larval rearing systems.
Jayaprakash, N S; Pai, S Somnath; Anas, A; Preetha, R; Philip, Rosamma; Singh, I S Bright
2005-12-30
A marine bacterium, Micrococcus MCCB 104, isolated from hatchery water, demonstrated extracellular antagonistic properties against Vibrio alginolyticus, V. parahaemolyticus, V. vulnificus, V. fluviallis, V. nereis, V. proteolyticus, V. mediterranei, V cholerae and Aeromonas sp., bacteria associated with Macrobrachium rosenbergii larval rearing systems. The isolate inhibited the growth of V. alginolyticus during co-culture. The antagonistic component of the extracellular product was heat-stable and insensitive to proteases, lipase, catalase and alpha-amylase. Micrococcus MCCB 104 was demonstrated to be non-pathogenic to M. rosenbergii larvae.
Parfeniuk, A; Sterlikova, O; Beznosko, I; Krut', V
2014-01-01
The article presents the results of studying the impact of bacterial strain M. luteus LBK1, stimulating the growth and development of plant varieties/hybrids of cucumber and sweet pepper on the intensity of sporulation of the fungus F. oxysporum Scelecht--fusariose rot pathogen.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fredrickson, Jim K.; Daly, Michael J.
2006-06-01
Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR), desiccation, and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and verymore » low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR (http://cfyn.ifas.ufl.edu/radiation.pdf).« less
Sasaki, Daisuke; Fujihashi, Masahiro; Okuyama, Naomi; Kobayashi, Yukiko; Noike, Motoyoshi; Koyama, Tanetoshi; Miki, Kunio
2011-02-04
Hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 (Ml-HexPPs) is a heterooligomeric type trans-prenyltransferase catalyzing consecutive head-to-tail condensations of three molecules of isopentenyl diphosphates (C(5)) on a farnesyl diphosphate (FPP; C(15)) to form an (all-E) hexaprenyl diphosphate (HexPP; C(30)). Ml-HexPPs is known to function as a heterodimer of two different subunits, small and large subunits called HexA and HexB, respectively. Compared with homooligomeric trans-prenyltransferases, the molecular mechanism of heterooligomeric trans-prenyltransferases is not yet clearly understood, particularly with respect to the role of the small subunits lacking the catalytic motifs conserved in most known trans-prenyltransferases. We have determined the crystal structure of Ml-HexPPs both in the substrate-free form and in complex with 7,11-dimethyl-2,6,10-dodecatrien-1-yl diphosphate ammonium salt (3-DesMe-FPP), an analog of FPP. The structure of HexB is composed of mostly antiparallel α-helices joined by connecting loops. Two aspartate-rich motifs (designated the first and second aspartate-rich motifs) and the other characteristic motifs in HexB are located around the diphosphate part of 3-DesMe-FPP. Despite the very low amino acid sequence identity and the distinct polypeptide chain lengths between HexA and HexB, the structure of HexA is quite similar to that of HexB. The aliphatic tail of 3-DesMe-FPP is accommodated in a large hydrophobic cleft starting from HexB and penetrating to the inside of HexA. These structural features suggest that HexB catalyzes the condensation reactions and that HexA is directly involved in the product chain length control in cooperation with HexB.
de la Fuente-Salcido, Norma M; Castañeda-Ramírez, José Cristobal; García-Almendárez, Blanca E; Bideshi, Dennis K; Salcedo-Hernández, Rubén; Barboza-Corona, José E
2015-01-01
Mexican Tuba (M-Tuba) and Tepache are Mexican fermented beverages prepared mainly with pineapple pulp and coconut palm, respectively. At present, reports on the microbiota and nutritional effects of both beverages are lacking. The purpose of this study was to determine whether M-Tuba and Tepache contain cultivable lactic acid bacteria (LAB) capable of producing bacteriocins. Tepache and M-Tuba contain mesophilic aerobic bacteria, LAB, and yeast. Bacillus subtilis, Listeria monocytogenes, Listeria innocua, Streptococcus agalactiae, Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Salmonella typhimurium, and Salmonella spp, were the microorganisms most susceptible to metabolites produced by bacterial isolates. M-Tuba and Tepache contain bacteria that harbor genes coding for nisin and enterocin, but not pediocin. The presence of Lactococcus lactis and E. faecium in M-Tuba and Tepache, was identified by 16S rDNA. These bacteria produced bacteriocins of ∼3.5 kDa and 4.0–4.5 kDa, respectively. Partial purified bacteriocins showed inhibitory effect against Micrococcus luteus, L. monocytogenes, L. innocua, Str. agalactiae, S. aureus, Bacillus cereus, B. subtilis, E. faecalis, and K. pneumoniae. We characterized, for the first time, cultivable microbiota of M-Tuba and Tepache, and specifically, identified candidate lactic bacteria (LAB) present in these beverages that were capable of synthesizing antimicrobial peptides, which collectively could provide food preservative functions. PMID:26405529
Micrococcus cohnii sp. nov., isolated from the air in a medical practice.
Rieser, Gernot; Scherer, Siegfried; Wenning, Mareike
2013-01-01
Three Gram-reaction-positive bacteria, isolated from the air in a medical practice (strains WS4601(T), WS4602) or a pharmaceutical clean room (strain WS4599), were characterized using a polyphasic approach. Phylogenetic analyses based on 16S rRNA and recA gene sequences of the three novel strains showed that they formed a distinct lineage within the genus Micrococcus, sharing 16S rRNA gene sequence similarities of 96.1-98.0 % with other species of this genus. Chemotaxonomic features also supported the classification of the three novel strains within the genus Micrococcus. The major cellular fatty acids of strain WS4601(T) were anteiso-C(15 : 0) and iso-C(15 : 0), the cell-wall peptidoglycan was of type A3α (L-Lys-L-Ala), and the predominant respiratory quinones were MK-7(H(2)) and MK-8(H(2)). The polar lipid profile contained diphosphatidylglycerol and phosphatidylglycerol, but no phosphatidylinositol. The G+C content of the genomic DNA was 70.4 mol%. Numerous physiological properties were found that clearly distinguished strains WS4599, WS4601(T) and WS4602 from established members of the genus Micrococcus. Based on the phenotypic and phylogenetic data, strains WS4599, WS4601(T) and WS4602 are considered to represent three different strains of a novel species of the genus Micrococcus, for which the name Micrococcus cohnii sp. nov. is proposed. The type strain is WS4601(T) (=DSM 23974(T)=LMG 26183(T)).
Tribolium castaneum defensins are primarily active against Gram-positive bacteria.
Tonk, Miray; Knorr, Eileen; Cabezas-Cruz, Alejandro; Valdés, James J; Kollewe, Christian; Vilcinskas, Andreas
2015-11-01
The red flour beetle Tribolium castaneum is a destructive insect pest of stored food and feed products, and a model organism for development, evolutionary biology and immunity. The insect innate immune system includes antimicrobial peptides (AMPs) with a wide spectrum of targets including viruses, bacteria, fungi and parasites. Defensins are an evolutionarily-conserved class of AMPs and a potential new source of antimicrobial agents. In this context, we report the antimicrobial activity, phylogenetic and structural properties of three T. castaneum defensins (Def1, Def2 and Def3) and their relevance in the immunity of T. castaneum against bacterial pathogens. All three recombinant defensins showed bactericidal activity against Micrococcus luteus and Bacillus thuringiensis serovar tolworthi, but only Def1 and Def2 showed a bacteriostatic effect against Staphylococcus epidermidis. None of the defensins showed activity against the Gram-negative bacteria Escherichia coli and Pseudomonas entomophila or against the yeast Saccharomyces cerevisiae. All three defensins were transcriptionally upregulated following a bacterial challenge, suggesting a key role in the immunity of T. castaneum against bacterial pathogens. Phylogenetic analysis showed that defensins from T. castaneum, mealworms, Udo longhorn beetle and houseflies cluster within a well-defined clade of insect defensins. We conclude that T. castaneum defensins are primarily active against Gram-positive bacteria and that other AMPs may play a more prominent role against Gram-negative species. Copyright © 2015 Elsevier Inc. All rights reserved.
Antibacterial properties of the skin mucus of the freshwater fishes, Rita rita and Channa punctatus.
Kumari, U; Nigam, A K; Mitial, S; Mitial, A K
2011-07-01
The skin mucus of Rita rita and Channa punctatus was investigated to explore the possibilities of its antibacterial properties. Skin mucus was extracted in acidic solvents (0.1% trifluoroacetic acid and 3% acetic acid) and in triple distilled water (aqueous medium). The antibacterial activity of the mucus extracts was analyzed, using disc diffusion method, against five strains of bacteria--the Gram-positive Staphylococcus aureus and Micrococcus luteus; and the Gram negative Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi. In both Rita rita and Channa punctatus, the skin mucus extracted in acidic solvents as well as in aqueous medium show antibacterial activity against Staphylococcus aureus and Micrococcus luteus. Nevertheless, the activity is higher in acidic solvents than that in aqueous medium. The acidic mucus extracts of Rita rita, show antibacterial activity against Salmonella typhi as well. The results suggest that fish skin mucus have bactericidal properties and thus play important role in the protection of fish against the invasion of pathogens. Fish skin mucus could thus be regarded as a potential source of novel antibacterial components.
In vitro antibacterial activity of selected medicinal plants from lower Himalayas.
Zulqarnain; Rahim, Abdur; Ahmad, Khalid; Ullah, Faizan; Ullah, Hamid; Nishan, Umar
2015-03-01
The present studies cover antibacterial activity of the crude methanolic extracts of 11 medicinal plants viz. Adhatoda vasica, Bauhenia variegate, Bombax ceiba, Carrisa opaca, Caryopteris grata, Debregeasia salicifolia, Lantana camara, Melia azedarach, Phyllanthus emblica, Pinus roxburghii and Olea ferruginea collected from lower Himalayas against two Gram positive (Staphylococcus aureus, Micrococcus luteus) and two Gram negative (Escherichia coli, Pseudomonas aureginosa) bacterial strains. The extracts were applied at four different concentrations (120 mg/mL, 90mg/mL, 60mg/mL and 30mg/mL) in dimethyl sulfoxide (DMSO) by using agar well diffusion method. Antibacterial activities against Staphylococcus aureus and Micrococcus luteus were observed formethanolic extracts of all the above mentioned plants. Greater antibacterial activity against Pseudomonas aeruginosa was only exhibited by Phyllanthus emblica, Pinus roxburghii, Debregeasia salicifolia and Lantana camara. Escherichia coli was highly resistant to all the plant extracts at all concentrations. It is inferred that methanolic crude extracts of the above mentioned plantsexhibitantibacterial activities against pathogenic bacteria, which proved the ethnobotanical importance of the selected plants that indigenous people use for cure against various diseases.
Bayat, Zeynab; Hassanshahian, Mehdi; Hesni, Majid Askari
2015-12-15
To date, little is known about existing relationships between mussels and bacteria in hydrocarbon-contaminated marine environments. The aim of this study is to find crude oil degrading bacteria in some mussels at the Persian Gulf. Twenty eight crude oil degrading bacteria were isolated from three mussels species collected from oil contaminated area at Persian Gulf. According to high growth and degradation of crude oil four strains were selected between 28 isolated strains for more study. Determination the nucleotide sequence of the gene encoding for 16S rRNA show that these isolated strains belong to: Shewanella algae isolate BHA1, Micrococcus luteus isolate BHA7, Pseudoalteromonas sp. isolate BHA8 and Shewanella haliotis isolate BHA35. The residual crude oil in culture medium was analysis by Gas Chromatography (GC). The results confirmed that these strains can degrade: 47.24%, 66.08%, 27.13% and 69.17% of crude oil respectively. These strains had high emulsification activity and biosurfactant production. Also, the effects of some factors on crude oil degradation by isolated strains were studied. The results show that the optimum concentration of crude oil was 2.5% and the best degradation take place at 12% of salinity. This research is the first reports on characterization of crude oil degrading bacteria from mussels at Persian Gulf and by using of these bacteria in the field the effect of oil pollution can be reduce on this marine environment. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kiliç, Nur Koçberber; Dönmez, Gönül
2008-06-15
Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.
Structures Containing Polyphosphate in Micrococcus lysodeikticus1
Friedberg, Ilan; Avigad, Gad
1968-01-01
Granular structures containing inorganic polyphosphate were found in Micrococcus lysodeikticus. These structures were isolated by fractionation of the bacterial extract obtained by lysing the organisms with lysozyme. The composition of the fraction which was enriched with these structures was found to be: protein, 24%; lipids, 30%; and polyphosphate, 27%. This fraction also contained small amounts of ribonucleic acids, carbohydrate, and polyvalent cations. The effect of different reagents and enzymes on the integrity of the granules was examined. It was noticed that they accumulate in the bacteria during the logarithmic phase of growth but disappear gradually during the stationary phase. Images PMID:5674060
Msaddak, Abdelhakim; Rejili, Mokhtar; Durán, David; Rey, Luis; Imperial, Juan; Palacios, Jose Manuel; Ruiz-Argüeso, Tomas; Mars, Mohamed
2017-06-01
The genetic diversity of bacterial populations nodulating Lupinus luteus (yellow lupine) in Northern Tunisia was examined. Phylogenetic analyses of 43 isolates based on recA and gyrB partial sequences grouped them in three clusters, two of which belong to genus Bradyrhizobium (41 isolates) and one, remarkably, to Microvirga (2 isolates), a genus never previously described as microsymbiont of this lupine species. Representatives of the three clusters were analysed in-depth by multilocus sequence analysis of five housekeeping genes (rrs, recA, glnII, gyrB and dnaK). Surprisingly, the Bradyrhizobium cluster with the two isolates LluI4 and LluTb2 may constitute a new species defined by a separate position between Bradyrhizobium manausense and B. denitrificans. A nodC-based phylogeny identified only two groups: one formed by Bradyrhizobium strains included in the symbiovar genistearum and the other by the Microvirga strains. Symbiotic behaviour of representative isolates was tested, and among the seven legumes inoculated only a difference was observed i.e. the Bradyrhizobium strains nodulated Ornithopus compressus unlike the two strains of Microvirga. On the basis of these data, we conclude that L. luteus root nodule symbionts in Northern Tunisia are mostly strains within the B. canariense/B. lupini lineages, and the remaining strains belong to two groups not previously identified as L. luteus endosymbionts: one corresponding to a new clade of Bradyrhizobium and the other to the genus Microvirga. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...
Micrococcus species-related peritonitis in patients receiving peritoneal dialysis.
Kao, Chih-Chin; Chiang, Chih-Kang; Huang, Jenq-Wen
2014-01-01
Peritonitis is a major complication of peritoneal dialysis (PD) and remains the most common cause of PD failure. Micrococci are catalase-positive, coagulase-negative, and gram-positive cocci that are spherical, often found in tetrad, and belong to the family Micrococcaceae. Micrococcus species are commonly found in the environment, and it is now recognized that Micrococcus species can be opportunistic pathogens in immunocompromised patients. The only consistent predisposing factor for Micrococcus infection is an immunocompromised state. We report three cases of Micrococcus PD peritonitis. Improper practice of PD may have been the causative factor. Although Micrococcus species are low-virulence pathogens, infection could result in refractory peritonitis and subsequent PD failure. Intraperitoneal administration of vancomycin for at least 2 weeks is recommended for Micrococcus peritonitis.
Braña, Alfredo F; Sarmiento-Vizcaíno, Aida; Pérez-Victoria, Ignacio; Otero, Luis; Fernández, Jonathan; Palacios, Juan José; Martín, Jesús; de la Cruz, Mercedes; Díaz, Caridad; Vicente, Francisca; Reyes, Fernando; García, Luis A; Blanco, Gloria
2017-02-24
Two new antibiotics, branimycins B (2) and C (3), were produced by fermentation of the abyssal actinobacterium Pseudonocardia carboxydivorans M-227, isolated from deep seawater of the Avilés submarine Canyon. Their structures were elucidated by HRMS and NMR analyses. These compounds exhibit antibacterial activities against a panel of Gram-positive bacteria, including Corynebacterium urealyticum, Clostridium perfringens, and Micrococcus luteus, and against the Gram-negative bacterium Neisseria meningitidis. Additionally, branimycin B displayed moderate antibacterial activity against other Gram-negative bacteria such as Bacteroides fragilis, Haemophilus influenzae, and Escherichia coli, and branimycin C against the Gram-positive Enterococcus faecalis and methicillin-sensitive and methicillin-resistant Staphylococcus aureus.
Ecological effects of a deodorant and a plain soap upon human skin bacteria.
Bibel, D. J.
1977-01-01
The effects of a commercial trichlorocarbanilide-containing deodorant soap and a commercial plain soap upon the cutaneous flora of individuals were compared. Using a cross-over design, 21 volunteers (10 women and 11 men) washed their forearms at least once a day with one soap for 3 weeks and then switched soaps for another 4 weeks use. By analysis of variance no significant difference in total colony counts was noted among individuals in their use of the two soaps. With the exception of individual variation, neither sequence of use, sex, nor any combination was influential. However, in 20 of 21 subjects an alteration in the composition of skin flora was observed. The deodorant soap, which in six cases increased total flora, tended to reduce or eliminate diphtheroids in 12 to 17 carriers (71%). Fewer kinds of bacteria were also noted. More Staphylococcus epidermidis was seen with the plain soap, but washing with the deodorant soap seemed to favour Acinetobacter calcoaceticus and Micrococcus luteus. The impact of this alteration and the use of total counts to measure effectiveness of deodorant soaps were brought into question. PMID:264493
21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Catalase derived from Micrococcus lysodeikticus... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.135 Catalase derived from Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture...
The Role of Inducible DNA Repair in W-Reactivation and Related Phenomena.
1981-10-14
unexcised dimers in X DNA. This was consistent with the finding of Tomilin and Mosevitskaya (1975) which showed that the UV-endonuclease from Micrococcus ...of DNA in vitro with UV-endonuclease from Micrococcus luteus. Mutat. Res. 27, 147-156 (1975) Tomizawa, J., Ogawa, T.: Effect of ultraviolet irradiation
Agrococcus terreus sp. nov. and Micrococcus terreus sp. nov., isolated from forest soil.
Zhang, Jia-Yue; Liu, Xing-Yu; Liu, Shuang-Jiang
2010-08-01
Two bacterial strains, DNG5T and V3M1T, isolated from forest soil of the Changbai mountains in China, were characterized using a polyphasic approach. Analysis of their 16S rRNA gene sequences indicated that strains DNG5T and V3M1T were phylogenetically related to members of the genus Agrococcus (96.0-98.4% similarity) and Micrococcus (96.7-98.0% similarity), respectively, within the order Actinomycetales. Strains DNG5T and V3M1T were Gram-stain-positive and strictly aerobic and formed yellow colonies on LB agar. Cells of strain DNG5T were short, non-motile rods, 0.4-0.5x0.8-1.0 microm. Strain DNG5T contained MK-10 and MK-11 as the major respiratory quinones and anteiso-C15:0 (49.2%) and iso-C16:0 (22.4%) as the major fatty acids. The diamino acid in the peptidoglycan of strain DNG5T was 2,4-diaminobutyric acid and the murein was of the acetyl type. Cells of strain V3M1T were cocci, 0.6-0.7 microm in diameter. The cell-wall peptidoglycan of strain V3M1T contained the amino acids lysine, glutamic acid, alanine and glycine. Strain V3M1T contained MK-7, MK-7(H2), MK-8 and MK-8(H2) as respiratory quinones and anteiso-C15:0 (78.2%) and iso-C15:0 (13.1%) as the major cellular fatty acids. The DNA G+C contents of strains DNG5T and V3M1T were 75.9 and 67.2 mol%, respectively. The DNA-DNA relatedness of strain DNG5T to Agrococcus jejuensis DSM 22002T, A. jenensis JCM 9950T, A. baldri JCM 12132T and A. citreus JCM 12398T was 58.3, 43.9, 36.1 and 54.1%, respectively. The DNA-DNA relatedness of strain V3M1T to Micrococcus luteus CGMCC 1.2299T, M. antarcticus CGMCC 1.2373T and M. lylae CGMCC 1.2300T was 57.5, 45.4 and 39.0%, respectively. Combining phenotypic and genotypic traits, strain DNG5T represents a novel species of the genus Agrococcus, for which the name Agrococcus terreus sp. nov. is proposed, with DNG5T (=CGMCC 1.6960T =NBRC 104260T) as the type strain. Strain V3M1T represents a novel species of the genus Micrococcus, for which the name Micrococcus terreus sp. nov. is
Prakash, Om; Nimonkar, Yogesh; Chavadar, Mahesh S; Bharti, Nidhi; Pawar, Shrikant; Sharma, Ashutosh; Shouche, Yogesh S
2017-06-01
An endophytic species of Micrococcus was isolated from Aloe vera leaf (syn. Aloe barbadensis ) and screened for protease production with five other species of Micrococcus . Data indicated that endophytic Micrococcus aloeverae AE-6 MCC 2184 T and Micrococcus yunnanensis DSM 21948 T showed efficient protease production potential and secreted active protease at high salt (10%), temperature (40 °C) and in wide range of pH 8-10. Unlike M . yunnanensis DSM 21948 T , protease production by M . aloeverae AE-6 MCC 2184 T was stringently controlled by pH. Protease induction study using different group of peptides, peptide carbohydrates and peptide macronutrient combinations showed variable response with both the organisms. Result indicated that the amount of protease was not directly related to cell biomass but it depends on nature of inducible peptides. In this study we also developed a modified agar-well assay for semi-quantitative data from large number of replicates.
Micrococcus lactis sp. nov., isolated from dairy industry waste.
Chittpurna; Singh, Pradip K; Verma, Dipti; Pinnaka, Anil Kumar; Mayilraj, Shanmugam; Korpole, Suresh
2011-12-01
A Gram-positive, yellow-pigmented, actinobacterial strain, DW152(T), was isolated from a dairy industry effluent treatment plant. 16S rRNA gene sequence analysis indicated that strain DW152(T) exhibited low similarity with many species with validly published names belonging to the genera Micrococcus and Arthrobacter. However, phenotypic properties including chemotaxonomic markers affiliated strain DW152(T) to the genus Micrococcus. Strain DW152(T) had ai-C(15:0) and i-C(15:0) as major cellular fatty acids, and MK-8(H(2)) as the major menaquinone. The cell-wall peptidoglycan of strain DW152(T) had l-lysine as the diagnostic amino acid and the type was A4α. The DNA G+C content of strain DW152(T) was 68.0 mol%. In 16S rRNA gene sequence analysis, strain DW152(T) exhibited significant similarity with Micrococcus terreus NBRC 104258(T), but the mean value of DNA-DNA relatedness between these strains was only 42.3%. Moreover, strain DW152(T) differed in biochemical and chemotaxonomic characteristics from M. terreus and other species of the genus Micrococcus. Based on the above differences, we conclude that strain DW152(T) should be treated as a novel species of the genus Micrococcus, for which the name Micrococcus lactis sp. nov. is proposed. The type strain of Micrococcus lactis sp. nov. is DW152(T) (=MTCC10523(T) =DSM 23694(T)).
Innate immune system capabilities of the Asian citrus psyllid, Diaphorina citri.
Arp, Alex P; Martini, Xavier; Pelz-Stelinski, Kirsten S
2017-09-01
Citrus production worldwide is currently threatened by Huanglongbing, or citrus greening disease. The associated pathogen, Candidatus Liberibacter asiaticus (CLas), is transmitted by the Asian citrus psyllid, Diaphorina citri. Annotation of the D. citri genome revealed a reduced innate immune system lacking a number of antimicrobial peptides and the Imd pathway associated with defense against Gram-negative bacteria. We characterized this apparent immune reduction in survival assays in which D. citri were exposed to Gram-negative or Gram-positive bacteria. D. citri experienced significant mortality when exposed to Serratia marcescens (Gram-negative) through oral ingestion or by septic injury. Escherichia coli (Gram-negative) also caused significant D. citri mortality, but only when inoculated at high concentrations through oral ingestion or by septic injury. Neither Micrococcus luteus (Gram-positive) or Bacillus subtilis (Gram-positive) caused significant mortality as compared to controls in any experiment. E. coli titers increased rapidly following exposure, while M. luteus titer remained stable for 72 h. We demonstrate that D. citri is capable of defending against E. coli, a Gram-negative bacterium, despite lacking the Imd defense pathway. The tolerance of D. citri to M. luteus infection, yet inability to effectively clear infections, presents questions to efficacy of D. citri immune response to effectively clear Gram-positive infections. Copyright © 2017. Published by Elsevier Inc.
Li, Yi; Xu, Yanting; Zheng, Tianling; Wang, Hailei
2018-02-01
The aim of this work was to investigate the flocculation mechanism by Gram-positive bacterium, Micrococcus sp. hsn08 as a means for harvesting Chlorella vulgaris biomass. Bacterial cells of Micrococcus sp. hsn08 were added into algal culture to harvest algal cells through direct contacting with algae to form flocs. Viability dependence test confirmed that flocculation activity does not depend on live bacteria, but on part of the peptidoglycan. The further investigation has determined that amino acids in cell wall play an important role to flocculate algal cells. Positively charged calcium can combine bacterial and algal cells together, and form a bridge between them, thereby forming the flocs, suggesting that ions bridging is the main flocculation mechanism. These results suggest that bacterial cells of Micrococcus sp. hsn08 can be applied to harvest microalgae biomass with the help of amino acids in cell wall. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Harit, Tarik; Bellaouchi, Reda; Asehraou, Abdeslam; Rahal, Mahmoud; Bouabdallah, Ibrahim; Malek, Fouad
2017-04-01
The synthesis of new thiophene-tripods with different side arms was reported. These compounds were obtained in good yields and their structures were confirmed by NMR spectroscopy, elemental analysis, infrared spectroscopy and mass spectrometry. The in vitro antibacterial and antifungal activities of these products were screened against Gram positive bacteria (Micrococcus luteus and Bacillus subtilis), Gram negative bacteria (Escherichia coli) and fungi (Candida pelliculosa). The obtained results showed that tripods containing a hydroxyl group in the side arm inhibited both Gram-positive and Gram-negative bacteria, while the tripod with an isopropyl side arm inhibited only the Gram-negative bacteria. DFT calculations with B3LYP/6-31G* level have been used to analyze the electronic and geometric characteristics. The molecular electrostatic potential surface (MEPS) indicated that the presence of electrophile site in the side arm could be responsible for activities against Gram-positive bacteria.
Airborne Bacteria in an Urban Environment
Mancinelli, Rocco L.; Shulls, Wells A.
1978-01-01
Samples were taken at random intervals over a 2-year period from urban air and tested for viable bacteria. The number of bacteria in each sample was determined, and each organism isolated was identified by its morphological and biochemical characteristics. The number of bacteria found ranged from 0.013 to 1.88 organisms per liter of air sampled. Representatives of 19 different genera were found in 21 samples. The most frequently isolated organisms and their percent of occurence were Micrococcus (41%), Staphylococcus (11%), and Aerococcus (8%). The bacteria isolated were correlated with various weather and air pollution parameters using the Pearson product-moment correlation coefficient method. Statistically significant correlations were found between the number of viable bacteria isolated and the concentrations of nitric oxide (−0.45), nitrogen dioxide (+0.43), and suspended particulate pollutants (+0.56). Calculated individually, the total number of Micrococcus, Aerococcus, and Staphylococcus, number of rods, and number of cocci isolated showed negative correlations with nitric oxide and positive correlations with nitrogen dioxide and particulates. Statistically significant positive correlations were found between the total number of rods isolated and the concentration of nitrogen dioxide (+0.54) and the percent relative humidity (+0.43). The other parameters tested, sulfur dioxide, hydrocarbons, and temperature, showed no significant correlations. Images PMID:677875
Urinary infection caused by Micrococcus subgroup 3
Kerr, Helen
1973-01-01
The laboratory findings and clinical presentations in urinary infections in 23 nurses, 10 caused by Micrococcus subgroup 3 and 13 by Escherichia coli, were studied, and the symptoms and possible predisposing factors compared. There were no important differences between the two groups. The infections caused by Micrococcus subgroup 3 were symptomatically severe, as were those caused by Escherichia coli. PMID:4593863
REDUCTION OF INORGANIC COMPOUNDS WITH MOLECULAR HYDROGEN BY MICROCOCCUS LACTILYTICUS I.
Woolfolk, C. A.; Whiteley, H. R.
1962-01-01
Woolfolk, C. A. (University of Washington, Seattle) and H. R. Whiteley. Reduction of inorganic compounds with molecular hydrogen by Micrococcus lactilyticus. I. Stoichiometry with compounds of arsenic, selenium, tellurium, transition and other elements. J. Bacteriol. 84:647–658. 1962.—Extracts of Micrococcus lactilyticus (Veillonella alcalescens) oxidize molecular hydrogen at the expense of certain compounds of arsenic, bismuth, selenium, tellurium, lead, thallium, vanadium, manganese, iron, copper, molybdenum, tungsten, osmium, ruthenium, gold, silver, and uranium, as well as molecular oxygen. Chemical and manometric data indicate that the following reductions are essentially quantitative: arsenate to arsenite, pentavalent and trivalent bismuth to the free element, selenite via elemental selenium to selenide, tellurate and tellurite to tellurium, lead dioxide and manganese dioxide to the divalent state, ferric to ferrous iron, osmium tetroxide to osmate ion, osmium dioxide and trivalent osmium to the metal, uranyl uranium to the tetravalent state, vanadate to the level of vanadyl, and polymolybdate ions to molybdenum blues with an average valence for molybdenum of +5. The results of a study of certain other hydrogenase-containing bacteria with respect to their ability to carry out some of the same reactions are also presented. PMID:14001842
Bacterial Coaggregation and Cohesion Among Isolates From Contact Lens Cases.
Datta, Ananya; Stapleton, Fiona; Willcox, Mark D P
2018-06-01
The aim of this study was to examine cohesion, coaggregation, and coculture between bacteria commonly isolated from contact lens cases. Staphylococcus epidermidis, Staphylococcus haemolyticus, Micrococcus luteus, and Acinetobacter radioresistens (two strains each) isolated from contact lens cases of two asymptomatic wearers were used in this study. In the cohesion assay, bacteria were grown, washed, and examined by incubating lens cases with two different types of bacteria sequentially and assessing the number of adhered cells of each isolate. The ability of isolates to interfere with the growth of other isolates was tested by growing strains in cocultures for 24 hours and determining the numbers of cells of individual strains. For coaggregation, equal proportions of two bacterial suspensions were mixed and allowed to coaggregate for 24 hours. Inhibition of coaggregation was tested by the addition of lactose (0.06 M) or sucrose (0.06 M) or pronase. The initial adhesion of M. luteus or A. radioresistens significantly (P < 0.05) enhanced the subsequent adhesion of the staphylococci. The addition of A. radioresistens in liquid media significantly (P < 0.05) enhanced the growth of staphylococci. S. epidermidis or S. haemolyticus coaggregated with M. luteus or A. radioresistens. The degree of coaggregation varied between 30% and 54%. The highest coaggregation (54% ± 5%) was seen between A. radioresistens 22-1 and S. epidermidis 22-1, isolated from the same lens case. Only lactose or sucrose treatment of staphylococci could partly inhibit coaggregation of some pairs. Coaggregation, cohesion, and growth promotion may facilitate the process of bacterial colonization of contact lens cases.
Mohanrasu, K; Premnath, N; Siva Prakash, G; Sudhakar, Muniyasamy; Boobalan, T; Arun, A
2018-05-19
There are copious of bacteria exist in marine environment and it is very important to screen the potential microbes that has the ability to produce biopolymer polyhydroxybutyrate (PHB) as well as polycyclic aromatic hydrocarbons (PAHs) degradation and conventional plastic high density polyethylene (HDPE) biodegradation. Numerous studies have been investigated individually on either one of characteristic feature like PHB production, PAHs and high density polyethylene (HDPE) degradation, but not all together. Hence, in this study, we tried to screen potential marine microbes that have the ability to perform all three features. We have isolated 203 phenotyphicaly different colonies from 19 different sites (marine soil sediments, marine water and oil spilled marine water) which cover the north east to down south seashore regions of Tamilnadu, India. Of the 203 microbial isolates, the best PHB producing (Micrococcus luteus), PAHs degradation (Klebsiella pneumonia) and HDPE degradation (Brevibacillus borstelensis) microorganisms were identified through 16S rRNA sequencing. Analytical studies confirmed PHB production by fourier transform infrared spectroscopy (FT-IR) and nuclear magnetic resonance ( 1 H & 13 C NMR); PAHs degradation by high performance liquid chromatography (HPLC), confocal laser scanning microscopy (CLSM), scanning electron microscopy (SEM); HDPE degradation by CLSM, FT-IR and SEM which cover the spectroscopy studies on biological systems. Copyright © 2018. Published by Elsevier B.V.
[Bacterial flora of the conjunctival sac of the horse].
Cattabiani, F; Cabassi, E; Allodi, C; Gianelli, F
1976-01-01
The AA. report the results of taxonomic research conducted on the conjunctival sac of 59 horses for identification of the present bacterial flora. In the controlled animals, it was observed, at the level of the considered niche, a community constituted of normal bacterial populations, but not autochtonous in the significance they attributed from DUBOS et al., relative to the characterization of the indigenous microbiota of the intestine. The isolated normal bacterial flora seems to be constituted of: Micrococcus (subgroup 6 of Baird-Parker, M. luteus, Micrococcus spp.) isolated in 49,15% of the samples; Staphylococcus aureus and St. epidermidis (18,64%); Moraxella osloensis, M. phenylpiruvica, M. equi and Moraxella spp. (11,86%); Bacillus cereus (11,86%); Neisseria catarrhalis (8,47%); Streptococcus equi and Str. zooepidemicus (6,77%); Corynebacterium spp. (6,77%) and Acinetobacter lwoffi (5,08%). The AA. have found, besides, a particular group of bacteria of uncertain classification, attributed to the coryneforms and found in 30,50% of the examined horses. So-called transient bacteria taxa have been considered are Streptomyces spp., isolated in the 10,16% of the controlled subjects, Aerococcus viridans and Bacillus spp. found in only one equine.
Antimicrobial activity of 9-O-acyl- and 9-O-benzoyl-substituted berberrubines.
Hong, S W; Kim, S H; Jeun, J A; Lee, S J; Kim, S U; Kim, J H
2000-05-01
In the course of a structure-activity relationship study on berberrubine derivatives, a series of compounds bearing 9-O-acyl-(4-6) and 9-O-benzoyl- (7) substituents was synthesized with the expectation of increasing the antimicrobial activity. One of the berberrubine derivatives, 9-lauroylberberrubine chloride was the most active against Gram-positive bacteria Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Micrococcus luteus, Bacillus subtilis as well as the Gram-negative bacterium Klebsiella pneumoniae in comparison to berberine, the currently used antibiotic in clinic. This result suggested that the presence of lipophilic substituents of certain structures and sizes might be crucial for the optimal antimicrobial activity.
Antibacterial properties of grapefruit seed extract against Paenibacillus larvae subsp. larvae.
Semprini, P; Langella, V; Pasini, B; Falda, M T; Calvarese, S
2004-01-01
Twenty-one samples of grapefruit seed extract (GSE) either from marketed products or provided by an apiculturist were analysed to verify their inhibition activity, in particular against Paenibacillus larvae subsp. larvae, responsible for American foulbrood. The bactericide capacity of GSE has been measured in Bacillus subtilis BGA, Bacillus cereus 11778, Bacillus cereus K250 and Micrococcus luteus 9341a; these bacteria are normally used in the laboratory to study inhibitors. The results showed that not all GSE have the same inhibitory activity and two of those analysed do not inhibit the five bacteria used. Considering that 19 samples inhibited American foulbrood bacillus, the authors conclude that the use of a natural product (such as GSE) to control this important disease of bees, can be used as a substitute for chemotherapeutic products, after appropriate expedients.
Adema, Coen M; Hanington, Patrick C.; Lun, Cheng-Man; Rosenberg, George H.; Aragon, Anthony D; Stout, Barbara A; Richard, Mara L. Lennard; Gross, Paul S.; Loker, Eric S
2009-01-01
A 70-mer oligonucleotide-based microarray (1152 features) that emphasizes stress and immune responses factors was constructed to study transcriptomic responses of the snail Biomphalaria glabrata to different immune challenges. In addition to sequences with relevant putative ID and Gene Ontology (GO) annotation, the array features non-immune factors and unknown B. glabrata ESTs for functional gene discovery. The transcription profiles of B. glabrata (3 biological replicates, each a pool of 5 snails) were recorded at 12 hours post wounding, exposure to Gram negative or Gram positive bacteria (Escherichia coli and Micrococcus luteus, respectively), or infection with compatible trematode parasites (S. mansoni or E. paraensei, 20 miracidia/snail), relative to controls, using universal reference RNA. The data were subjected to Significance Analysis for Microarrays (SAM), with a false positive rate (FPR) ≤10%. Wounding yielded a modest differential expression profile (27 up/21 down) with affected features mostly dissimilar from other treatments. Partially overlapping, yet distinct expression profiles were recorded from snails challenged with E. coli (83 up/20 down) or M. luteus (120 up/42 down), mostly showing up-regulation of defense and stress-related features. Significantly altered expression of selected immune features indicates that B. glabrata detects and responds differently to compatible trematodes. Echinostoma paraensei infection was associated mostly with down regulation of many (immune-) transcripts (42 up/68 down), whereas S. mansoni exposure yielded a preponderance of up-regulated features (140 up/23 down), with only few known immune genes affected. These observations may reflect the divergent strategies developed by trematodes during their evolution as specialized pathogens of snails to negate host defense responses. Clearly, the immune defenses of B. glabrata distinguish and respond differently to various immune challenges. PMID:19962194
MacCallum, William G.; Hastings, Thomas W.
1899-01-01
, soil and other sources, and have been unable to find a description of a micrococcus identical in all particulars with that here described. Such points as staining by Gram, liquefaction of gelatine, coagulation and peptonization of milk, served singly or in combination to distinguish our micrococcus from other forms which in some respects might resemble it. We feel justified, therefore, in recognizing this organism as a new species and from its fermentative properties propose for it the name "Micrococcus zymogenes." Micrococcus zymogenes must be added to the already considerable list of bacteria which have been found as the specific infective agents in endocarditis. That it was the cause of this affection in our case was conclusively demonstrated by its repeated isolation in pure culture from the blood during life, by its presence in pure culture and large numbers after death in the cardiac vegetations, the infarctions, and other parts of the body, and by the experimental proof of its pathogenic properties, and notably its capacity to produce vegetative endocarditis by intravenous inoculation in animals. PMID:19866921
Maccallum, W G; Hastings, T W
1899-09-01
, soil and other sources, and have been unable to find a description of a micrococcus identical in all particulars with that here described. Such points as staining by Gram, liquefaction of gelatine, coagulation and peptonization of milk, served singly or in combination to distinguish our micrococcus from other forms which in some respects might resemble it. We feel justified, therefore, in recognizing this organism as a new species and from its fermentative properties propose for it the name "Micrococcus zymogenes." Micrococcus zymogenes must be added to the already considerable list of bacteria which have been found as the specific infective agents in endocarditis. That it was the cause of this affection in our case was conclusively demonstrated by its repeated isolation in pure culture from the blood during life, by its presence in pure culture and large numbers after death in the cardiac vegetations, the infarctions, and other parts of the body, and by the experimental proof of its pathogenic properties, and notably its capacity to produce vegetative endocarditis by intravenous inoculation in animals.
Halophilic Amylase from a Moderately Halophilic Micrococcus
Onishi, Hiroshi
1972-01-01
A moderately halophilic Micrococcus sp., isolated from unrefined solar salt, produced a considerable amount of extracellular dextrinogenic amylase when cultivated aerobically in media containing 1 to 3 m NaCl. The Micrococcus amylase had maximal activity at pH 6 to 7 in 1.4 to 2 m NaCl or KCl at 50 C. Calcium ion and a high concentration of NaCl or KCl were essential for activity and stability of the amylase. The salt response of the amylase depended greatly on the pH and temperature of the enzyme assay. PMID:5058445
Kim, Ki Youn; Kim, Yoon Shin; Kim, Daekeun; Kim, Hyeon Tae
2011-01-01
The exposure level and distribution characteristics of airborne bacteria and fungi were assessed in the workers' activity areas (station office, bedroom, ticket office and driver's seat) and passengers' activity areas (station precinct, inside the passenger carriage, and platform) of the Seoul metropolitan subway. Among investigated areas, the levels of airborne bacteria and fungi in the workers' bedroom and station precincts were relatively high. No significant difference was found in the concentration of airborne bacteria and fungi between the underground and above ground activity areas of the subway. The genera identified in all subway activity areas with a 5% or greater detection rate were Staphylococcus, Micrococcus, Bacillus and Corynebacterium for airborne bacteria and Penicillium, Cladosporium, Chrysosporium, Aspergillus for airborne fungi. Staphylococcus and Micrococcus comprised over 50% of the total airborne bacteria and Penicillium and Cladosporium comprised over 60% of the total airborne fungi, thus these four genera are the predominant genera in the subway station.
Evaluation of antibacterial properties of Barium Zirconate Titanate (BZT) nanoparticle
Mohseni, Simin; Aghayan, Mahdi; Ghorani-Azam, Adel; Behdani, Mohammad; Asoodeh, Ahmad
2014-01-01
So far, the antibacterial activity of some organic and inorganic compounds has been studied. Barium zirconate titanate [Ba(ZrxTi1-x)O3] (x = 0.05) nanoparticle is an example of inorganic materials. In vitro studies have provided evidence for the antibacterial activity of this nanoparticle. In the current study, the nano-powder was synthesized by sol-gel method. X-ray diffraction showed that the powder was single-phase and had a perovskite structure at the calcination temperature of 1000 °C. Antibacterial activity of the desired nanoparticle was assessed on two gram-positive (Staphylococcus aureus PTCC1431 and Micrococcus luteus PTCC1625) and two gram-negative (Escherichia coli HP101BA 7601c and clinically isolated Klebsiella pneumoniae) bacteria according to Radial Diffusion Assay (RDA). The results showed that the antibacterial activity of BZT nano-powder on both gram-positive and gram-negative bacteria was acceptable. The minimum inhibitory concentration of this nano-powder was determined. The results showed that MIC values for E. coli, K. pneumoniae, M. luteus and S. aureus were about 2.3 μg/mL, 7.3 μg/mL, 3 μg/mL and 12 μg/mL, respectively. Minimum bactericidal concentration (MBC) was also evaluated and showed that the growth of E. coli, K. pneumoniae, M. luteus and S. aureus could be decreased at 2.3, 14, 3 and 18 μg/mL of BZT. Average log reduction in viable bacteria count in time-kill assay ranged between 6 Log10 cfu/mL to zero after 24 h of incubation with BZT nanoparticle. PMID:25763046
Parra-González, Lorena B; Aravena-Abarzúa, Gabriela A; Navarro-Navarro, Cristell S; Udall, Joshua; Maughan, Jeff; Peterson, Louis M; Salvo-Garrido, Haroldo E; Maureira-Butler, Iván J
2012-08-24
Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession's origin. L. luteus deep transcriptome sequencing will facilitate the further
Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.
von Eiff, C; Herrmann, M; Peters, G
1995-01-01
The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited. PMID:7695321
2012-01-01
Background Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Results Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession’s origin. Conclusion L. luteus deep transcriptome
Chemical constituents and antimicrobial activity of the essential oil of Lantana xenica.
Juliani, Hector R; Biurrun, Fernando; Koroch, Adolfina R; Oliva, M M; Demo, Mirta S; Trippi, Victorio S; Zygadlo, Julio A
2002-08-01
The aim of this work was to evaluate the chemical composition of Lantana xenica essential oil and its antimicrobial activity. The oil from the aerial parts of Lantana xenica Mold. (Verbenacea) was obtained by steam distillation and analyzed by gas chromatography/mass spectrometry. The major constituent of the oil was (E)-caryophyllene (35.2 %), with minor amounts of gamma-cadinene (13.3 %), alpha-pinene (9.3 %), ocimene (9.2 %) and germacrene D (6.6 %). The antimicrobial assays showed that the essential oil of L. xenica inhibited the growth of Bacillus cereus and Proteus mirabilis and both bacteria were inhibited by (E)-caryophyllene, the major component of the oil. Enterococcus faecalis, Staphylococcus epidermidis and S. aureus showed a lower inhibition. The bacteria Micrococcus luteus, Klebsiella sp., Escherichia coli and the yeast Candida albicans were insensitive to both the oil and (E)-caryophyllene.
Joshi, Rajesh K; Badakar, Vijayalaxmi M; Kholkute, Sanjiva D; Khatib, Nayeem
2011-01-01
The essential oil of the leaves of Feronia elephantum Corr. was analyzed by gas chromatography and gas chromatography/mass spectrometry. The main constituents were beta-pinene (28.4%), Z-anethole (22.1%), methyl chavicol (12.0%) and E-anethole (8.1%), among thirty-three identified compounds, which represented 92.6% of the total oil. The antimicrobial activity was tested against five Gram-positive and eight Gram-negative bacteria, and four fungi. The oil was active against Micrococcus luteus (Gram-positive bacterium), Proteus mirabilis (Gram-negative bacterium), Penicillium chrysogenum and Aspergillus niger (fungi) with MIC values of 0.31 +/- 0.06, 0.52 +/- 0.10, 0.20 +/- 0.50 and 0.26 +/- 0.52 mg/mL, respectively.
Rapid lysostaphin test to differentiate Staphylococcus and Micrococcus species.
Geary, C; Stevens, M
1986-01-01
A rapid, simple lysostaphin lysis susceptibility test to differentiate the genera Staphylococcus and Micrococcus was evaluated. Of 181 strains from culture collections, 95 of 95 Staphylococcus strains were lysed, and 79 of 79 Micrococcus strains were not lysed. The seven Planococcus strains were resistant. Clinical isolates (890) were tested with lysostaphin and for the ability to produce acid from glycerol in the presence of erythromycin. Overall agreement between the methods was 99.2%. All clinical Micrococcus strains (43) were resistant to lysostaphin, and all clinical Staphylococcus strains (847) were susceptible. Seven of the Staphylococcus strains did not produce acid from glycerol in the presence of erythromycin. This lysostaphin test provides results in 2 h. It is easier to perform than previously described lysostaphin lysis methods. It is also more rapid and accurate than the glycerol-erythromycin test. PMID:3519667
Factors Affecting Transformation of Micrococcus lysodeikticus
Kloos, Wesley E.
1969-01-01
Relatively high transfo mation frequencies were obtained with Micrococcus lysodeikticus cells, previou[ill]sly grown in defined broth, with a tris(hydroxymethyl)-aminomethane-glutamate b uffer containing Mg++, Ca++, Ba++, or Sr++. PMID:5788710
EFFECT OF IMPACT STRESS ON MICROBIAL RECOVERY ON AN AGAR SURFACE
Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. he relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving a...
Whole-Genome Sequence of the Soil Bacterium Micrococcus sp. KBS0714.
Kuo, V; Shoemaker, W R; Muscarella, M E; Lennon, J T
2017-08-10
We present here a draft genome assembly of Micrococcus sp. KBS0714, which was isolated from agricultural soil. The genome provides insight into the strategies that Micrococcus spp. use to contend with environmental stressors such as desiccation and starvation in environmental and host-associated ecosystems. Copyright © 2017 Kuo et al.
Micrococcus endophyticus sp. nov., isolated from surface-sterilized Aquilaria sinensis roots.
Chen, Hua-Hong; Zhao, Guo-Zhen; Park, Dong-Jin; Zhang, Yu-Qin; Xu, Li-Hua; Lee, Jae-Chan; Kim, Chang-Jin; Li, Wen-Jun
2009-05-01
A Gram-positive bacterial strain, designated YIM 56238(T), was isolated from plant roots (Aquilaria sinensis), and characterized by using a polyphasic approach. Strain YIM 56238(T) grew optimally at pH 7.0-8.0 and at 28 degrees C. Analysis of the 16S rRNA gene sequence of strain YIM 56238(T) indicated that it belongs to the genus Micrococcus. Chemotaxonomic data strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine and glycine; the predominant menaquinones were MK-8(H(2)) (63.6 %) and MK-7(H(2)) (21.1 %); the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid; and the major cellular fatty acids were iso-C(15 : 0) (30.95 %) and anteiso-C(15 : 0) (53.75 %). The G+C content of the genomic DNA was 72.9 mol%. A number of physiological features were found that clearly distinguished strain YIM 56238(T) from recognized species of the genus Micrococcus. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. On the basis of the data, therefore, strain YIM 56238(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus endophyticus sp. nov. is proposed. The type strain is YIM 56238(T) (=DSM 17945(T)=KCTC 19156(T)).
Inactivation of the Radiation-Resistant Spoilage Bacterium Micrococcus radiodurans
Duggan, D. E.; Anderson, A. W.; Elliker, P. R.
1963-01-01
A simplified technique permitting the pipetting of raw puréed meats for quantitative bacteriological study is described for use in determining survival of these non-sporing bacteria, which are exceptionally resistant to radiation. Survival curves, using gamma radiation as the sterilizing agent, were determined in raw beef with four strains of Micrococcus radiodurans. Survival curves of the R1 strain in other meat substrates showed that survival was significantly greater in raw beef and raw chicken than in raw fish or in cooked beef. Resistance was lowest in the buffer. Cells grown in broth (an artificial growth medium) and resuspended in beef did not differ in resistance from cells that had been grown and irradiated in beef. Survival rate was statistically independent of the initial cell concentration, even though there appeared to be a correlation between lower death rate and lower initial cell concentrations. The initial viable count of this culture of the domesticated R1 strain in beef was reduced by a factor of about 10-5 by 3.0 megarad, and 4.0 megarad reduced the initial count by a factor of more than 10-9. Data suggest that M. radiodurans R1 is more resistant to radiation than spore-forming spoilage bacteria for which inactivation rates have been published. PMID:14063780
Endocarditis due to Micrococcus sedentarius incertae sedis.
Old, D C; McNeill, G P
1979-01-01
The clinical and bacteriological features of a case of endocarditis are described in which a Gram-positive coccus, presently designated Micrococcus sedentarius incertae sedis, was repeatedly isolated. PMID:512056
Emmadi, Narender Reddy; Atmakur, Krishnaiah; Bingi, Chiranjeevi; Godumagadda, Narender Reddy; Chityal, Ganesh Kumar; Nanubolu, Jagadeesh Babu
2014-01-15
Regioselective synthesis of a number of highly functionalized 3-benzylpyrimidino chromen-2-ones (4) were accomplished in a one pot three component reaction in acetic acid and determined their anti-microbial and anti-biofilm activities. Compounds 4o and 4p showed an excellent anti-microbial activity against Micrococcus luteus MTCC 2470 at a par with standard control (Ciprofloxacin) and exhibited best activity against Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Further, compounds 4h, 4i, 4m, 4n and 4q showed promising activity against Micrococcus luteus MTCC 2470, Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Whereas, compounds 4m showed very promising biofilm inhibition activity against Staphylococcus aureus MLS 16 MTCC 2940 and 4o, 4p showed very potent activity against Staphylococcus aureus MTCC 96 at a par with Ciprofloxacin used as standard control. Copyright © 2013 Elsevier Ltd. All rights reserved.
Assessment of the bacterial contamination of hand air dryer in washrooms.
Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S; Zayed, M E; Al-Johny, Bassam O; Wainwright, Milton
2016-03-01
The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices.
Assessment of the bacterial contamination of hand air dryer in washrooms
Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S.; Zayed, M.E.; Al-Johny, Bassam O.; Wainwright, Milton
2015-01-01
The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices. PMID:26981009
Study of Bacterial Samples Using Laser Induced Breakdown Spectroscopy
NASA Astrophysics Data System (ADS)
W, A. Farooq; M, Atif; W, Tawfik; M, S. Alsalhi; Z, A. Alahmed; M, Sarfraz; J, P. Singh
2014-12-01
Laser-induced breakdown spectroscopy (LIBS) technique has been applied to investigate two different types of bacteria, Escherichia coli (B1) and Micrococcus luteus (B2) deposited on glass slides using Spectrolaser 7000. LIBS spectra were analyzed using spectrolaser software. LIBS spectrum of glass substrate was compared with bacteria spectra. Ca, Mg, Na, K, P, S, Cl, Fe, Al, Mn, Cu, C, H and CN-band appeared in bacterial samples in air. Two carbon lines at 193.02 nm, 247.88 nm and one hydrogen line at 656.28 nm with intensity ratios of 1.9, 1.83 and 1.53 appeared in bacterial samples B1 and B2 respectively. Carbon and hydrogen are the important components of the bio-samples like bacteria and other cancer cells. Investigation on LIBS spectra of the samples in He and Ar atmospheres is also presented. Ni lines appeared only in B2 sample in Ar atmosphere. From the present experimental results we are able to show that LIBS technique has a potential in the identification and discrimination of different types of bacteria.
Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn
2016-01-01
Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.
Antibacterial activity of oregano (Origanum vulgare Linn.) against gram positive bacteria.
Saeed, Sabahat; Tariq, Perween
2009-10-01
The present investigation is focused on antibacterial potential of infusion, decoction and essential oil of oregano (Origanum vulgare) against 111 Gram-positive bacterial isolates belonging to 23 different species related to 3 genera. Infusion and essential oil exhibited antibacterial activity against Staphylococcus saprophyticus, S. aureus, Micrococcus roseus, M. kristinae, M. nishinomiyaensis, M. lylae, M. luteus, M. sedentarius, M. varians, Bacillus megaterium, B. thuringiensis, B. alvei, B. circulans, B. brevis, B. coagulans, B. pumilus, B. laterosporus, B. polymyxa, B. macerans, B. subtilis, B. firmus, B. cereus and B. lichiniformis. The infusion exhibited maximum activity against B. laterosporus (17.5 mm mean zone of inhibition+/-1.5 Standard deviation) followed by B. polymyxa (17.0 mm+/-2.0 SD) and essential oil of oregano exhibited maximum activity against S. saprophyticus (16.8 mm+/-1.8 SD) followed by B. circulans (14.5 mm+/-0.5 SD). While all these tested isolates were found resistant to decoction of oregano.
Freitak, Dalial; Wheat, Christopher W; Heckel, David G; Vogel, Heiko
2007-01-01
Background Insects helped pioneer, and persist as model organisms for, the study of specific aspects of immunity. Although they lack an adaptive immune system, insects possess an innate immune system that recognizes and destroys intruding microorganisms. Its operation under natural conditions has not been well studied, as most studies have introduced microbes to laboratory-reared insects via artificial mechanical wounding. One of the most common routes of natural exposure and infection, however, is via food; thus, the role of dietary microbial communities in herbivorous insect immune system evolution invites study. Here, we examine the immune system response and consequences of exposing a lepidopteran agricultural pest to non-infectious microorganisms via simple oral consumption. Results Immune system response was compared between Trichoplusia ni larvae reared on diets with or without non-pathogenic bacteria (Escherichia coli and Micrococcus luteus). Two major immune response-related enzymatic activities responded to diets differently – phenoloxidase activity was inhibited in the bacteria-fed larvae, whereas general antibacterial activity was enhanced. Eight proteins were highly expressed in the hemolymph of the bacteria fed larvae, among them immune response related proteins arylphorin, apolipophorin III and gloverin. Expression response among 25 putative immune response-related genes were assayed via RT-qPCR. Seven showed more than fivefold up regulation in the presence of bacterial diet, with 22 in total being differentially expressed, among them apolipophorin III, cecropin, gallerimycin, gloverin, lysozyme, and phenoloxidase inhibiting enzyme. Finally, potential life-history trade-offs were studied, with pupation time and pupal mass being negatively affected in bacteria fed larvae. Conclusion The presence of bacteria in food, even if non-pathogenic, can trigger an immune response cascade with life history tradeoffs. Trichoplusia ni larvae are able to detect
Hakvåg, Sigrid; Fjaervik, Espen; Klinkenberg, Geir; Borgos, Sven Even F; Josefsen, Kjell D; Ellingsen, Trond E; Zotchev, Sergey B
2009-11-12
A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound.
[In vitro studies on antioxidant and antimicrobial activities of polysaccharide from Lycoris aurea].
Ru, Qiao-Mei; Pei, Zhen-Ming; Zheng, Hai-Lei
2008-10-01
To study the preliminary antioxidant and antimicrobial activities of polysaccharide extracted from Lycoris aurea. The scavenging activities of the polysaccharide in vitro on superoxide radical (O2-*), hydroxyl radical (*OH), alkyl radical (R*) and hydrogen peroxide (H2O2) were investigated by modified chemical systems. Meanwhile, the antimicrobial activities were tested using paper-discagar diffusion method. In general, the antioxidant activities of the polysaccharide were lower compared with Vc. However, the scavenging effects to *OH and H2O2 were parallel to Vc. Meanwhile, polysaccharide from Lycoris aurea had strong antimicrobial activities against Micrococcus luteus, Bacillus pumilus and Staphylococcus aureus. The polysaccharide extracted from L. aurea can scavenge *OH and H2O2 effectively and inhibit Gram-positive bacterias.
Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures
NASA Astrophysics Data System (ADS)
Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja
2018-05-01
This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not
Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures
NASA Astrophysics Data System (ADS)
Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja
2018-03-01
This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not
Zhao, Guo-Zhen; Li, Jie; Qin, Sheng; Zhang, Yu-Qin; Zhu, Wen-Yong; Jiang, Cheng-Lin; Xu, Li-Hua; Li, Wen-Jun
2009-10-01
In this study, strain YIM 65004(T), isolated from roots of Polyspora axillaris, was shown to represent a novel species of the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine, glycine and aspartic acid, the predominant menaquinones were MK-8(H(2)) (66.97 %) and MK-7(H(2)) (23.26 %), the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid, and the major cellular fatty acids were anteiso-C(15 : 0) (61.98 %), iso-C(16 : 0) (14.25 %) and iso-C(15 : 0) (13.04 %). The G+C content of the genomic DNA was 71.7 mol%. A number of physiological features were found that clearly distinguished strain YIM 65004(T) from recognized Micrococcus species. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. Based on the above data, a novel species of the genus Micrococcus, Micrococcus yunnanensis sp. nov., is proposed, with the type strain YIM 65004(T) (=CCTCC AA 208060(T)=DSM 21948(T)).
Production of gluconic acid using Micrococcus sp.: optimisation of carbon and nitrogen sources.
Joshi, V D; Sreekantiah, K R; Manjrekar, S P
1996-01-01
A process for production of gluconic acid from glucose by a Micrococcus sp. is described. More than 400 bacterial cultures isolated from local soil were tested for gluconic acid production. Three isolates, were selected on basis of their ability to produce gluconic acid and high titrable acidity. These were identified as Micrococcus sp. and were named M 27, M 54 and M 81. Nutritional and other parameters for maximum production of gluconic acid by the selected isolates were optimised. It was found that Micrococcus sp. isolate M 27 gave highest yield of 8.19 g gluconic acid from 9 g glucose utilised giving 91% conversion effeciency.
Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1
Tallur, Preeti N.; Mulla, Sikandar I.; Megadi, Veena B.; Talwar, Manjunatha P.; Ninnekar, Harichandra Z.
2015-01-01
Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water. PMID:26413046
Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1.
Tallur, Preeti N; Mulla, Sikandar I; Megadi, Veena B; Talwar, Manjunatha P; Ninnekar, Harichandra Z
2015-01-01
Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.
Antimicrobial activity of antihypertensive food-derived peptides and selected alanine analogues.
McClean, Stephen; Beggs, Louise B; Welch, Robert W
2014-03-01
This study evaluated four food-derived peptides with known antihypertensive activities for antimicrobial activity against pathogenic microorganisms, and assessed structure-function relationships using alanine analogues. The peptides (EVSLNSGYY, barley; PGTAVFK, soybean; TTMPLW, α-casein; VHLPP, α-zein) and the six alanine substitution peptides of PGTAVFK were synthesised, characterised and evaluated for antimicrobial activity using the bacteria, Escherichia coli, Staphylococcus aureus, and Micrococcus luteus and the yeast, Candida albicans. The peptides TTMPLW and PGTAVFK inhibited growth of all four microorganisms tested, with activities of a similar order of magnitude to ampicillin and ethanol controls. EVSLNSGYY inhibited the growth of the bacteria, but VHLPP showed no antimicrobial activity. The alanine analogue, PGAAVFK showed the highest overall antimicrobial activity and PGTAVFA showed no activity; overall, the activities of the analogues were consistent with their structures. Some peptides with antihypertensive activity also show antimicrobial activity, suggesting that food-derived peptides may exert beneficial effects via a number of mechanisms. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Ceyhan, Gökhan; Çelik, Cumali; Uruş, Serhan; Demirtaş, İbrahim; Elmastaş, Mahfuz; Tümer, Mehmet
2011-10-01
In this study, two Schiff base ligands (HL 1 and HL 2) and their Cu(II), Co(II), Ni(II), Pd(II) and Ru(III) metal complexes were synthesized and characterized by the analytical and spectroscopic methods. Alkane oxidation activities of the metal complexes were studied on cyclohexane as substrate. The ligands and their metal complexes were evaluated for their antimicrobial activity against Corynebacterium xerosis, Bacillus brevis, Bacillus megaterium, Bacillus cereus, Mycobacterium smegmatis, Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis (as Gram-positive bacteria) and Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Yersinia enterocolitica, Klebsiella fragilis, Saccharomyces cerevisiae, and Candida albicans (as Gram-negative bacteria). The antioxidant properties of the Schiff base ligands were evaluated in a series of in vitro tests: 1,1-diphenyl-2-picrylhydrazyl (DPPH rad ) free radical scavenging and reducing power activity of superoxide anion radical generated non-enzymatic systems. Electrochemical and thermal properties of the compounds were investigated.
Prokaryotic complex of newly formed soils on nepheline-containing industrial waste
NASA Astrophysics Data System (ADS)
Evdokimova, G. A.; Kalmykova, V. V.
2010-06-01
The characteristics are given of the prokaryotic complex participating in the processes of the primary soil formation on nepheline-containing waste and depending on the time of the waste disposal and degree of reclamation. The total population density of the bacteria determined with the method of fluorescent microscopy in “pure” sand ranged within 0.34—0.60 billion CFU/g soil; in the reclaimed sand under different vegatation communities, from 2.6 to 7.2 billion CFU/g soil. Gram-positive bacteria dominate in the prokaryotic complex of the nepheline sands, whereas the Grarrmegative ones dominate in the zonal soils. The bacteria predominating in the nepheline sands were classified on the basis of the comparative analysis of the nucleotide sequences in the 16S rRNA genes within the Actinobacteria class (Arthrobacter boritolerans, A. ramosus, Rhodococcusfascians, Micrococcus luteus, and Streptomyces spp.). The evolution of the microbial community in the nepheline sands in the course of their reclamation and in the course of their overgrowing by plants proceeds in way toward the microbial communities of the zonal soils on moraine deposits.
Identification of Staphylococcus and Micrococcus species with the STAPHYtest system.
Sedlácek, I; Kocur, M
1991-01-01
A collection of 216 well-characterized strains of Staphylococcus, Micrococcus and Stomatococcus was examined by a commercially available STAPHYtest system (Lachema, Brno, Czechoslovakia). The results of STAPHYtest agreed with those of conventional tests. The STAPHYtest permitted a clear-cut separation of Staphylococcus from Micrococcus and Stomatococcus strains and correctly identified 104 of 145 (72%) Staphylococcus strains after 24 h of incubation. However, it allowed the identification only of 19 of 29 validly published Staphylococcus species. The STAPHYtest proved to be a simple and rapid system for the separation of staphylococci from micrococci and for the identification of most frequent clinically significant staphylococci.
Degradable Polymer with Protein Resistance in a Marine Environment.
Ma, Jielin; Ma, Chunfeng; Zhang, Guangzhao
2015-06-16
Protein resistance is the central issue in marine antibiofouling. We have prepared poly(ε-caprolactone) (PCL)-based polyurethane with 2-(dimethylamino) ethyl methacrylate (DEM) as pendant groups by a combination of the thiol-ene click reaction and the condensation reaction. By the use of quartz crystal microbalance with dissipation (QCM-D) and surface plasmon resonance (SPR), we have investigated the adsorption of fibrinogen, bovine serum albumin (BSA), and lysozyme on the polymer surface. The polymer exhibits protein resistance in seawater but not in fresh water because DEM pendant groups carry net neutral charges in the former. The evaluation of antibacterial adhesion of the polymer by using Micrococcus luteus demonstrates that the polymer can effectively inhibit the settlement of marine bacteria. Our studies also show that the polymer is degradable in marine environments.
Hakvåg, Sigrid; Fjærvik, Espen; Klinkenberg, Geir; Borgos, Sven Even F.; Josefsen, Kjell D.; Ellingsen, Trond E.; Zotchev, Sergey B.
2009-01-01
A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound. PMID:20098599
Vieira, Edson Rodrigues; Xisto, Mariana Ingrid Dutra da Silva; Pele, Milagre Américo; Alviano, Daniela Sales; Alviano, Celuta Sales; Barreto-Bergter, Eliana; de Campos-Takaki, Galba Maria
2018-06-01
Monohexosylceramides (CMHs) are highly conserved fungal glycosphingolipids playing a role in several cellular processes such as growth, differentiation and morphological transition. In this study, we report the isolation, purification and chemical characterization of CMHs from Rhizopus stolonifer and R. microspores . Using positive ion mode ESI-MS, two major ion species were observed at m / z 750 and m / z 766, respectively. Both ion species consisted of a glucose/galactose residue attached to a ceramide moiety containing 9-methyl-4,8-sphingadienine with an amidic linkage to a hydroxylated C16:0 fatty acid. The antimicrobial activity of CMH was evaluated against Gram positive and Gram negative bacteria using the agar diffusion assay. CMH from both Rhizopus species inhibited the growth of Bacillus terrae , Micrococcus luteus ( M. luteus ) and Pseudomonas stutzeri ( P. stutzeri ) with a MIC 50 of 6.25, 6.25 and 3.13 mg/mL, respectively. The bactericidal effect was detected only for M. luteus and P. stutzeri , with MBC values of 25 and 6.25 mg/mL, respectively. Furthermore, the action of CMH on the biofilm produced by methicillin-resistant Staphylococcus aureus (MRSA) was analyzed using 12.5 and 25 mg/mL of CMH from R. microsporus . Total biofilm biomass, biofilm matrix and viability of the cells that form the biofilm structure were evaluated. CMH from R. microsporus was able to inhibit the MRSA biofilm formation in all parameters tested.
Frankowski, Kamil; Wilmowicz, Emilia; Kućko, Agata; Zienkiewicz, Agnieszka; Zienkiewicz, Krzysztof; Kopcewicz, Jan
2015-05-01
The BLADE-ON-PETIOLE (BOP) genes have been recently shown to play an essential role in many physiological processes, including embryogenesis, meristem determinacy, leaf patterning and nodule development. In our research we used Lupinus luteus, a plant with great agronomic potential due to its high protein content and nitrogen fixation ability. In this work, LlBOP in L. luteus was identified for the first time and its expression during nodule development was analyzed. The high expression levels of LlBOP and LlLbI (LEGHEMOGLOBIN), essential to nitrogen-fixing symbiosis, were noted in the developing root nodules and were correlated with the occurrence of leghemoglobin. All of these data indicate that LlBOP is an important regulator of root nodule formation and functioning in L. luteus. Copyright © 2015 Elsevier GmbH. All rights reserved.
Antioxidant and antibacterial properties of green, black, and herbal teas of Camellia sinensis.
Chan, Eric W C; Soh, Eu Ying; Tie, Pei Pei; Law, Yon Peng
2011-10-01
The role of non-polymeric phenolic (NP) and polymeric tannin (PT) constituents in the antioxidant and antibacterial properties of six brands of green, black, and herbal teas of Camellia sinensis were investigated. Total phenolic content (TPC) and ascorbic acid equivalent antioxidant capacity (AEAC) were assessed using the Folin-Ciocalteu and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays, respectively. Minimum inhibitory dose (MID) against Gram-positive Micrococcus luteus, Staphylococcus aureus, and Bacillus cereus, and Gram-negative. Escherichia coli, Salmonella typhi, and Pseudomonas aeruginosa was assessed using the disc-diffusion method. Teas were extracted with hot water successively three times for one hour each time. The extracts were fractionated using Sephadex LH-20 column chromatography to obtain the NP and PT constituents. Extraction yields ranged from 12 to 23%. Yields of NP fractions (70-81%) were much higher than those of PT fractions (1-11%), suggesting that the former are the major tea components. Ranking of antioxidant properties of extracts was green tea>black tea>herbal tea. For all six teas, antioxidant properties of PT fractions were significantly higher than extracts and NP fractions. Extracts and fractions of all six teas showed no activity against the three Gram-negative bacteria. Green teas inhibited all three Gram-positive bacteria with S. aureus being the least susceptible. Black and herbal teas inhibited the growth of M. luteus and B. cereus, but not S. aureus. The most potent were the PT fractions of Boh Cameron Highlands and Ho Yan Hor with MID of 0.01 and 0.03 mg/disc against M. luteus. Results suggested that NP constituents are major contributors to the antioxidant and antibacterial properties of teas of C. sinensis. Although PT constituents have stronger antioxidant and antibacterial properties, they constitute only a minor component of the teas.
Gonzalez, Lorena B Parra; Straub, Shannon C K; Doyle, Jeff J; Ortega, Paula E Mora; Garrido, Haroldo E Salvo; Butler, Iván J Maureira
2010-08-01
Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to investigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties. • Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collection of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2-4 alleles per locus. These revealed a moderate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet. • These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding strategies in yellow lupine.
[Micrococcus sp.--the pathogen of leaf necrosis of horse-chestnuts (Aesculus L.) in Kiev].
Iakovleva, L M; Makhinia, L V; Shcherbina, T N; Ogorodnik, L E
2013-01-01
A group of phytopathogenic bacteria was isolated from patterns of drying horse-chestnuts (Aesculus L.), which grow in Kyiv. The properties of slowly growing, highly aggressive microorganisms have been described in the paper. They grow up on the 8-10th day after sowing. The investigated microorganisms form very small (0.5-1 mm in diameter) colonies on the potato agar. Bacteria are protuberant, shining, smooth with flat edges, they are pale yellow, yellow, or pink. The bacteria are Gram-positive, spherical, are disposed in smears singly, in pairs, as accumulations, or netting. They are aerobes, do not form spores, are not mobile. They are inert in respect of different sources of carbon. They reduce nitrates, do not dilute gelatin, do not hydrolyze starch, do not release hydrogen sulphide and indole. The bacteria are catalase-positive, oxidase-negative. They do not cause potato and carrot rot. They lose quickly their viability under the laboratory conditions. The saturated acids C 14:0; C 15:0; C16:0; C18:0 have been revealed in the composition of cellular fatty acids. Microorganisms are identified as Micrococcus sp. Under artificial inoculation this highly aggressive pathogen causes drying of the horse-chestnut buds and necrosis, which occupies 1/3-1/2 of the leaf plate. A wide zone of chlorosis, surrounding necrosis, may occupy the whole leaf surface. The infected leaves use to twist up from the top (apex) or along a midrib and to dry.
Karuppiah, Valliappan; Li, Yingxin; Sun, Wei; Feng, Guofang; Li, Zhiyong
2015-07-01
Phenazines represent a large group of nitrogen-containing heterocyclic compounds produced by the diverse group of bacteria including actinobacteria. In this study, a total of 197 actinobacterial strains were isolated from seven different marine sponge species in the South China Sea using five different culture media. Eighty-seven morphologically different actinobacterial strains were selected and grouped into 13 genera, including Actinoalloteichus, Kocuria, Micrococcus, Micromonospora, Mycobacterium, Nocardiopsis, Prauserella, Rhodococcus, Saccharopolyspora, Salinispora, Serinicoccus, and Streptomyces by the phylogenetic analysis of 16S rRNA gene. Based on the screening of phzE genes, ten strains, including five Streptomyces, two Nocardiopsis, one Salinispora, one Micrococcus, and one Serinicoccus were found to be potential for phenazine production. The level of phzE gene expression was highly expressed in Nocardiopsis sp. 13-33-15, 13-12-13, and Serinicoccus sp. 13-12-4 on the fifth day of fermentation. Finally, 1,6-dihydroxy phenazine (1) from Nocardiopsis sp. 13-33-15 and 13-12-13, and 1,6-dimethoxy phenazine (2) from Nocardiopsis sp. 13-33-15 were isolated and identified successfully based on ESI-MS and NMR analysis. The compounds 1 and 2 showed antibacterial activity against Bacillus mycoides SJ14, Staphylococcus aureus SJ51, Escherichia coli SJ42, and Micrococcus luteus SJ47. This study suggests that the integrated approach of gene screening and chemical analysis is an effective strategy to find the target compounds and lays the basis for the production of phenazine from the sponge-associated actinobacteria.
Mu, Changkao; Song, Xiaoyan; Zhao, Jianmin; Wang, Lingling; Qiu, Limei; Zhang, Huan; Zhou, Zhi; Wang, Mengqiang; Song, Linsheng; Wang, Chunlin
2012-05-01
C-type lectins are a family of calcium-dependent carbohydrate-binding proteins. In the present study, a C-type lectin (designated as AiCTL5) was identified and characterized from Argopecten irradians. The full-length cDNA of AiCTL5 was of 673 bp, containing a 5' untranslated region (UTR) of 24 bp, a 3' UTR of 130 bp with a poly (A) tail, and an open reading frame (ORF) of 519 bp encoding a polypeptide of 172 amino acids with a putative signal peptide of 17 amino acids. A C-type lectin-like domain (CRD) containing 6 conserved cysteines and a putative glycosylation sites were identified in the deduced amino acid sequence of AiCTL5. AiCTL5 shared 11%-27.5% identity with the previous reported C-type lectin from A. irradians. The cDNA fragment encoding the mature peptide of AiCTL5 was recombined into pET-21a (+) with a C-terminal hexa-histidine tag fused in-frame, and expressed in Escherichia coli Origami (DE3). The recombinant AiCTL5 (rAiCTL5) agglutinated Gram-negative E. coli TOP10F' and Listonella anguillarum, but did not agglutinate Gram-positive bacteria Bacillus thuringiensis and Micrococcus luteus, and the agglutination could be inhibited by EDTA, indicating that AiCTL5 was a Ca(2+)-dependent lectin. rAiCTL5 exhibited a significantly strong activity to bind LPS from E. coli, which conformed to the agglutinating activity toward Gram-negative bacteria. Moreover, rAiCTL5 also agglutinated rabbit erythrocytes. These results indicated that AiCTL5 could function as a pattern recognition receptor to protect bay scallop from Gram-negative bacterial infection, and also provide evidence to understand the structural and functional diverse of lectin. Copyright © 2012 Elsevier Ltd. All rights reserved.
Kuskonmaz, Baris; Kara, Ates; Ozen, Maide; Cengiz, A Bülent; Ozen, Metehan; Seçmeer, Gülten; Gürgey, Aytemiz
2006-01-01
Haemophagocytic syndromes are the clinical manifestation of an increased macrophagic activity with haemophagocytosis. Infection-associated HS was originally described by Risdall in 1979, in viral disease. Since the initial description HS has also been documented in patients with bacterial, parasitic or fungal infections. We describe a case of Micrococcus sedentarius bacteraemia in a previously healthy 10-y-old boy with haemophagocytic syndrome. Species of micrococci are generally considered as non-pathogenic commensals that colonize the skin, mucosae and oropharynx. We report the first case of Microccoccus sedentarius bacteraemia in an immunocompetent host and first case of HS associated with Micrococcus species.
Biodegradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1.
Mulla, Sikandar I; Hoskeri, Robertcyril S; Shouche, Yogesh S; Ninnekar, Harichandra Z
2011-02-01
A bacterial consortium capable of degrading nitroaromatic compounds was isolated from pesticide-contaminated soil samples by selective enrichment on 2-nitrotoluene as a sole source of carbon and energy. The three different bacterial isolates obtained from bacterial consortium were identified as Bacillus sp. (A and C), Bacillus flexus (B) and Micrococcus sp. (D) on the basis of their morphological and biochemical characteristics and by phylogenetic analysis based on 16S rRNA gene sequences. The pathway for the degradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1 was elucidated by the isolation and identification of metabolites, growth and enzymatic studies. The organism degraded 2-nitrotoluene through 3-methylcatechol by a meta-cleavage pathway, with release of nitrite.
El Aafi, N; Brhada, F; Dary, M; Maltouf, A Filali; Pajuelo, E
2012-03-01
The aim of this work was to test Lupinus luteus plants, inoculated with metal resistant rhizobacteria, in order to phytostabilise metals in contaminated soils. The resistance to heavy metals of strains isolated from nodules of Lupinus plants was evaluated. The strain MSMC541 showed multi-resistance to several metals (up to 13.3 mM As, 2.2 mM Cd, 2.3 mM Cu, 9 mM Pb and 30 mM Zn), and it was selected for further characterization. Furthermore, this strain was able to biosorb great amounts of metals in cell biomass. 16S rDNA sequencing positioned this strain within the genus Serratia. The presence of arsenic resistance genes was confirmed by southern blot and PCR amplification. A rhizoremediation pot experiment was conducted using Lupinus luteus grown on sand supplemented with heavy metals and inoculated with MSMC541. Plant growth parameters and metal accumulation were determined in inoculated vs. non-inoculated Lupinus luteus plants. The results showed that inoculation with MSMC541 improved the plant tolerance to metals. At the same time, metal translocation to the shoot was significantly reduced upon inoculation. These results suggest that Lupinus luteus plants, inoculated with the metal resistant strain Serratia sp. MSMC541, have a great potential for phytostabilization of metal contaminated soils.
Differential expression of the lethal gene Luteus-Pa in cacao of the Parinari series.
Rehem, B C; Almeida, A-A F; Figueiredo, G S F; Gesteira, A S; Santos, S C; Corrêa, R X; Yamada, M M; Valle, R R
2016-02-22
The recessive lethal character Luteus-Pa is found in cacao (Theobroma cacao) genotypes of the Parinari series (Pa) and is characterized by expression of leaf chlorosis and seedling death. Several genotypes of the Pa series are bearers of the gene responsible for the expression of the Luteus-Pa character, which can be used as a tool for determining relationships between genotypes of this group. To evaluate this phenomenon, we analyzed the differential expression of genes between mutant seedlings and wild-type hybrid Pa 30 x 169 seedlings, with the aim of elucidating the possible lethal mechanisms of the homozygous recessive character Luteus-Pa. Plant material was harvested from leaves of wild and mutant seedlings at different periods to construct a subtractive library and perform quantitative analysis using real-time PCR. The 649 sequences obtained from the subtractive library had an average length of 500 bp, forming 409 contigs. The probable proteins encoded were grouped into 10 functional categories. Data from ESTs identified genes associated with Rubisco, peroxidases, and other proteins and enzymes related to carbon assimilation, respiration, and photosystem 2. Mutant seedlings were characterized by synthesizing defective PsbO and PsbA proteins, which were overexpressed from 15 to 20 days after seedling emergence.
An antibacterial ortho-quinone diterpenoid and its derivatives from Caryopteris mongolica.
Saruul, Erdenebileg; Murata, Toshihiro; Selenge, Erdenechimeg; Sasaki, Kenroh; Yoshizaki, Fumihiko; Batkhuu, Javzan
2015-06-15
To identify antibacterial components in traditional Mongolian medicinal plant Caryopteris mongolica, an ortho-quinone abietane caryopteron A (1) and three its derivatives caryopteron B-D (2-4) were isolated from the roots of the plant together with three known abietanes demethylcryptojaponol (5), 6α-hydroxydemethyl cryptojaponol (6), and 14-deoxycoleon U (7). The chemical structures of these abietane derivatives were elucidated on the basis of spectroscopic data. Compounds 1-4 had C-13 methylcyclopropane substructures, and 2-4 had a hexanedioic anhydride ring C instead of ortho-quinone in 1. The stereochemistry of these compound was assumed from NOE spectra and ECD Cotton effects. Compounds 1 and 5-7 showed antibacterial activities against the Gram-positive bacteria Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, and Micrococcus luteus, being 1 the more potent. Copyright © 2015 Elsevier Ltd. All rights reserved.
Antimicrobial effects of Finnish plant extracts containing flavonoids and other phenolic compounds.
Rauha, J P; Remes, S; Heinonen, M; Hopia, A; Kähkönen, M; Kujala, T; Pihlaja, K; Vuorela, H; Vuorela, P
2000-05-25
Plant phenolics, especially dietary flavonoids, are currently of growing interest owing to their supposed functional properties in promoting human health. Antimicrobial screening of 13 phenolic substances and 29 extracts prepared from Finnish plant materials against selected microbes was conducted in this study. The tests were carried out using diffusion methods with four to nine microbial species (Aspergillus niger, Bacillus subtilis, Candida albicans, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa, Saccharomyces cerevisiae, Staphylococcus aureus and Staphylococcus epidermidis). Flavone, quercetin and naringenin were effective in inhibiting the growth of the organisms. The most active plant extracts were purple loosestrife (Lythrum salicaria L.) against Candida albicans, meadowsweet (Filipendula ulmaria (L.) Maxim.), willow herb (Epilobium angustifolium L.), cloudberry (Rubus chamaemorus L.) and raspberry (Rubus idaeus L.) against bacteria, and white birch (Betula pubescens Ehrh.), pine (Pinus sylvestris L.) and potato (Solanum tuberosum. L.) against gram-positive Staphylococcus aureus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sanders, S.W.; Maxcy, R.B.
1979-01-01
Representative highly radiation-resistant Moraxella-Acinetobacter (M-A), Pseudomonas radiora, Micrococcus radiodurans, and Micrococcus radiophilus exhibited a wide variety of division systems and cell wall characteristics. However, the more resistant M-A possessed unusually thick cell walls, indicating a possible role of the cell wall in radiation resistance in the M-A. Thick septation was present in most of the bacteria studied, but was absent in P. radiora, thus excluding this as a necessity for high resistance. Reliable determination of the number of division planes of the M-A for use as a taxonomic criterion was achieved by the direct observation of dividing cells. The highlymore » resistant M-A were found to divide in multiple planes and had base compositions of 54.0 to 57.5%, unlike typical Moraxella and/or Acinetobacter species. The taxonomic position of most highly resistant bacteria remains unclear.« less
Kumar, Manoj; Srivastava, Sheela
2011-06-01
Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Cho, Ju Hyun; Lee, Janice; Lafarge, Marie-Céline; Kocks, Christine; Ferrandon, Dominique
2011-01-01
Background Two NF-kappaB signaling pathways, Toll and immune deficiency (imd), are required for survival to bacterial infections in Drosophila. In response to septic injury, these pathways mediate rapid transcriptional activation of distinct sets of effector molecules, including antimicrobial peptides, which are important components of a humoral defense response. However, it is less clear to what extent macrophage-like hemocytes contribute to host defense. Methodology/Principal Findings In order to dissect the relative importance of humoral and cellular defenses after septic injury with three different Gram-positive bacteria (Micrococcus luteus, Enterococcus faecalis, Staphylococcus aureus), we used latex bead pre-injection to ablate macrophage function in flies wildtype or mutant for various Toll and imd pathway components. We found that in all three infection models a compromised phagocytic system impaired fly survival – independently of concomitant Toll or imd pathway activation. Our data failed to confirm a role of the PGRP-SA and GNBP1 Pattern Recognition Receptors for phagocytosis of S. aureus. The Drosophila scavenger receptor Eater mediates the phagocytosis by hemocytes or S2 cells of E. faecalis and S. aureus, but not of M. luteus. In the case of M. luteus and E. faecalis, but not S. aureus, decreased survival due to defective phagocytosis could be compensated for by genetically enhancing the humoral immune response. Conclusions/Significance Our results underscore the fundamental importance of both cellular and humoral mechanisms in Drosophila immunity and shed light on the balance between these two arms of host defense depending on the invading pathogen. PMID:21390224
NASA Astrophysics Data System (ADS)
Baskar, Sushmitha; Baskar, R.; Lee, Natuschka; Theophilus, P. K.
2009-05-01
The Mawsmai cave and Krem Phyllut caves, East Khasi hills, Meghalaya, India has so far not yet attracted the attention of geomicrobiologists. Observations and hypotheses on the possible influence of identified microorganisms for speleothem formations in Meghalaya are reported for the first time. XRD studies identified calcite in speleothems and gypsum in cave wall deposits as the dominant minerals. SEM-EDAX showed interesting microfabric features showing strong resemblance with fossilised bacteria, calcified filaments, needle calcite and numerous nano scale calcite crystals, highly weathered and disintegrated crystals of calcite, that point towards a significant microbial influence in its genesis. Thin section petrography showed laminated stromatolitic features. The microorganisms identified by conventional isolation and further evaluation of isolates by molecular techniques include Bacillus cereus, Bacillus mycoides, Bacillus licheniformis, Micrococcus luteus, and Actinomycetes. Microscopic observations also showed unidentifiable cocci and four unidentifiable strains of CaSO4 (gypsum) precipitating bacteria. Experimental studies confirmed that these bacteria are able to precipitate calcium minerals (calcite, gypsum, minor amounts of dolomite) in the laboratory. These results allow us to postulate that species like these may contribute to active biogenic influence in the cave formations at Meghalaya.
Haghbeen, K.; Pourmolaei, S.; Mareftjo, M. J.; Mousavi, A.; Akbari Noghabi, K.; Hosseini Shirazi, F.; Meshkat, A.
2011-01-01
In pursuit of strong shikalkin-producing cell lines, seeds of the Iranian Arnebia euchroma were collected from Dena altitudes in the central Zagross. Chemical analysis showed that the dried root of the plant contained about 8.5% (w/w) shikalkin pigment. The root explants of the young plantlets, obtained from the germinated seeds, were used for establishing callus. Then, parameters effective on proliferation and pigment production of the resulting calli were studied in detail. Accordingly, two modified media called mLS and mM9 were optimized for propagation and pigment production, respectively. Using these media, the biomass of the A.euchroma calli was increased to 600%, and the pigment production reached to a maximum of 16.3 mg per gram of the wet biomass in a period of a subculture (21 days). Parallel to these experiments, the antimicrobial activity of shikalkin pigment was examined on some fungi and Gram-positive and Gram-negative bacteria. Results indicated that the pigment was almost ineffective on fungi and Gram-negative bacteria, but it was meaningfully effective against Micrococcus luteus. PMID:21772789
A New Perspective on Radiation Resistance Based on Deinococcus radiodurans
2009-03-01
Halobacterium sp. NRc-1 | Lactobacillus plantarum | Micrococcus luteus | Pyrococcus furiosus | Shewanella oneidensis | Synechocystis sp. Pcc... Lactobacillus plantarum16,47, which lacks the enzyme superoxide dismutase, and Synechocystis sp. PCC 68034 (Ref. 48) accumulated exceptionally high levels...high specificity for Mn2+, has been detected in L. plantarum , but has not been found in D. radiodurans. Manganese transport in D. radiodurans is
ROLE OF POTASSIUM IN THE OXIDATIVE METABOLISM OF MICROCOCCUS SODONENSIS1
Perry, Jerome J.; Evans, James B.
1961-01-01
Perry, Jerome J. (The University of Chicago, Chicago, Ill.), and James B. Evans. Role of potassium in the oxidative metabolism of Micrococcus sodonensis. J. Bacteriol. 82:551–555. 1961.—An absolute potassium requirement has been established for the growth of Micrococcus sodonensis with lactate or pyruvate as substrate. Potassium at 0.67 × 10−2m concentration was necessary for maximal growth. Resting cell and cell-free preparations from cells grown on minimal levels of potassium were stimulated by potassium but, due to residual or bound cation, did not show an absolute requirement. Rubidium and cesium replaced potassium in these cells although cesium is much less effective. PMID:14485577
Interactions between yeasts and bacteria in the smear surface-ripened cheeses.
Corsetti, A; Rossi, J; Gobbetti, M
2001-09-19
In the initial phase of ripening, the microflora of bacterial smear surface-ripened cheeses such as Limburger, Taleggio, Brick, Münster and Saint-Paulin and that of surface mould-ripened cheeses such as Camembert and Brie may be similar, but at the end of the ripening, bacteria such as Brevibacterium spp., Arthrobacter spp., Micrococcus spp., Corynebacterium spp. and moulds such as Penicillium camemberti are, respectively, the dominant microorganisms. Yeasts such as Candida spp., Cryptococcus spp., Debaryomyces spp., Geotrichum candidum, Pichia spp., Rhodotorula spp., Saccharomyces spp. and Yarrowia lipolytica are often and variably isolated from the smear surface-ripened cheeses. Although not dominant within the microorganisms of the smear surface-ripened cheeses, yeasts establish significant interactions with moulds and especially bacteria, including surface bacteria and lactic acid bacteria. Some aspects of the interactions between yeasts and bacteria in such type of cheeses are considered in this paper.
Osawa, Ayako; Ishii, Yoko; Sasamura, Nao; Morita, Marie; Kasai, Hiroaki; Maoka, Takashi; Shindo, Kazutoshi
2010-01-01
While screening for antioxidative carotenoids from marine bacteria, we isolated and identified sarcinaxanthin and its glucosylated compounds (sarcinaxanthin monoglucoside and sarcinaxanthin diglucoside) from a moderately halophilic bacterium-Micrococcus yunnanensis strain AOY-1. In the singlet oxygen ((¹O₂) quenching model, the IC(50) values of the antioxidative activities of these carotenoids were as follows: sarcinaxanthin , 57 µM; sarcinaxanthin monoglucoside, 54 µM; and sarcinaxanthin diglucoside, 74 µM. In addition, the complete proton nuclear magnetic resonance (¹H NMR) assignments of sarcinaxanthin monoglucoside pentaacetate and sarcinaxanthin diglucoside octaacetate, and fast atom bombardment mass spectrometry/mass spectrometry (FAB-MS/MS) analyses of sarcinaxanthin and sarcinaxanthin monoglucoside are reported for the first time.
21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...
21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...
21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dickson, J.S.; Maxcy, R.B.
Inhibitory effects of radiolytic products were studied using Escherichia coli, Pediococcus cerevisiae, and two radiation-resistant microorganisms, an isolate of Moraxella-Acinetobacter and a Micrococcus sp. End Products of an irradiation dose of 300 Krads completely inhibited resistant organisms on an experimental medium with a very low concentration of nutrients. Plate count agar, with higher nutrient concentration, required 600 Krads to produce the same inhibition. On the same medium, radiation-sensitive organisms could tolerate products generated by a 1000 Krad dose. However, no inhibition could be detected when either Escherichia coli or Moraxella-Acinetobacter was incubated at 5/sup 0/C on the surface of freshmore » meat irradiated to 1500 Krad. The effects of inhibitory products in culture media could be mitigated by the addition of catalase or sodium pyruvate. 19 references, 2 figures, 4 tables.« less
Gutiérrez-Ginés, M J; Hernández, A J; Pérez-Leblic, M I; Pastor, J; Vangronsveld, J
2014-10-01
In the central part of the Iberian Peninsula there are old sealed landfills containing soils co-contaminated by several heavy metals (Cu, Zn, Pb, Cd, Ni, As, Cr, Fe, Al, Mn) and organic pollutants of different families (hydrocarbons, polycyclic aromatic hydrocarbons, polychlorinated biphenyls, pesticides and other organochlorinated compounds, phenols and volatile compounds), which this work will address. We have focused on phytoremedial plants that are able to deal with this type of complex pollution, not only species that tolerate the joint effect of heavy metals in the soil, but also those that can take advantage of associated bacteria to efficiently break down organic compounds. This study was carried out with Lupinus luteus and its endophytes in two greenhouse experiments: A) growing in a substrate artificially contaminated with benzo(a)pyrene (BaP), and B) using real co-contaminated landfill soils. Endophytes of roots and shoots were isolated in both bioassays. Plant growth-promotion tests and organic pollutant tolerance and degradation tests were conducted on all strains isolated in bioassay A), and on those proving to be pure cultures from bioassay B). The selected landfill is described as are isolation and test procedures. Results indicate that plants did not show toxicity symptoms when exposed to BaP but did when grown in landfill soil. Some endophytes demonstrated plant growth-promotion capacity and tolerance to BaP and other organic compounds (diesel and PCB commercial mixtures). A few strains may even have the capacity to metabolize those organic pollutants. The overall decline in plant growth-promotion capacity in those strains isolated from the landfill soil experiment, compared with those from the bioassay with BaP, may indicate that lupin endophytes are not adapted to metal concentration in roots and shoots and fail to grow. As a result, most isolated root endophytes must have colonized root tissues from the soil. While preliminary degradation tests
Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud
2016-12-01
The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID 50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. © The Author(s) 2016.
Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud
2016-01-01
The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. PMID:27895288
Antibiotic Sensitivity of Micrococcus radiodurans
Hawiger, J.; Jeljaszewicz, J.
1967-01-01
A wild-type strain of Micrococcus radiodurans and its nonpigmented mutant W1 were tested for sensitivity to 10 antibiotics selected from the standpoint of their mechanism of action. Representatives of groups of antibiotics inhibiting deoxyribonucleic acid (DNA) synthesis, DNA-dependent ribonucleic acid synthesis, protein synthesis, and cell wall synthesis were selected. M. radiodurans and its mutant exhibited full susceptibility to all antibiotics tested (mitomycin C, actinomycin D, chloramphenicol, dihydrostreptomycin, erythromycin, neomycin, kanamycin, benzylpenicillin, bacitracin, and vancomycin), the degree of susceptibility being of the same order as that of a standard strain of Staphylococcus aureus 209 P, with the exception of dihydrostreptomycin. PMID:4166078
De Baetselier, P; Hamers-Casterman, C; Van der Loo, W; Hamers, R
1977-01-01
Rabbits capable of producing antibodies of restricted heterogeneity in response to Micrococcus lysodeikticus are equally capable of producing antibodies of restricted heterogeneity to bovine serum albumin. These antibodies are produced when animals are simultaneously injected with micrococcus and BSA and their specificity is restricted to a small number of epitopes. These results suggest that micrococcal vaccines can induce the restriction of heterogeneity in antibodies raised against totally unrelated antigens. Images Figure 4 Figure 5 Figure 2 Figure 6 Figure 7 Figure 8 PMID:71263
Tundis, R; Statti, G A; Conforti, F; Bianchi, A; Agrimonti, C; Sacchetti, G; Muzzoli, M; Ballero, M; Menichini, F; Poli, F
2005-06-01
The biovariability of Helichrysum italicum (Roth) Don grown wild in Calabria and Sardinia (Italy) was reported. This species has been characterized through the detection, isolation and quantitative evaluation of chemical markers (alpha-terpinolene, trans-cariophyllene and neryl acetate) by GC and GC-MS. Antioxidant activity of the methanolic H. italicum extracts using DPPH and beta-carotene bleaching test showed that the Calabrian samples were more active than those from Sardinia. The antibacterial activity of all extracts evidenced the best performance on the Gram positive bacteria particularly on Micrococcus luteus. Moreover, antifungal activity of all extracts was also tested evidencing important results particularly on the phytopathogene fungus Pythium ultimum. In general, as regards the antifungal activity, the extracts from Sardinia were more active than those from Calabria. The phytochemical analysis and the biological activity data suggested a possible use of these plant matrices in alimentary, cosmetic and pharmaceutical fields.
Oudiz, Ronald J; Widlitz, Allison; Beckmann, X Joy; Camanga, Daisy; Alfie, Jose; Brundage, Bruce H; Barst, Robyn J
2004-07-01
To determine the incidence of catheter-related infection in patients with pulmonary arterial hypertension (PAH) receiving epoprostenol (EPO), and to note an etiologic role for Micrococcus spp, which is rarely reported as a pathogen in the medical literature. Observational study. Two PAH specialty treatment centers, Harbor-UCLA Medical Center (Torrance, CA), and the College of Physicians and Surgeons, Columbia University (New York, NY). A total of 192 patients with PAH receiving continuous therapy with IV EPO. From 1987 to 2000, 192 patients with PAH received infusions of EPO via central venous catheter. Catheter care included regular dressing changes with dry gauze using a sterile procedure, without the use of flushes. Patients were asked to report on known infections and treatments, and symptoms. All infections were verified by a telephone call to the patient, care provider, and microbiology laboratory whenever possible. There were 335,285 catheter days (mean +/- SD, 1,325 +/- 974 catheter days). There were 88 clinical catheter infections with 51 blood culture-positive infections, necessitating catheter removal in 38 instances. The following pathogens were isolated: Staphylococcus aureus (25); Micrococcus spp (14); mixed flora (3); coagulase-negative Staphylococcus spp (2); Corynebacterium spp (2); Serratia marcessens (1); Enterobacter spp (1); Pseudomonas aeruginosa (1); enterococci (1); and unidentified Gram-positive cocci (1). The catheter infection rate was 0.26 per 1,000 catheter days. The use of long-term therapy with continuous EPO appears to be associated with a low incidence of catheter-related infections. Micrococcus spp were the second most common etiologic agent. Caregivers managing patients with PAH must be aware of the risk of catheter infection, as it may contribute to the morbidity and mortality associated with the use of EPO. When isolated, Micrococcus spp should not be viewed as a contaminant, but rather as a true pathogen that may require
[The effect of nitrofurans on the membrane apparatus of coccal bacteria].
Kutsmako, R T; Kuliash, Iu V; Rudzit, E A; Ermachenko, V A; Simakova, I M
1984-01-01
Secondary membrane effects on the membrane apparatus of coccus bacteria were being studied. Cultivation of Micrococcus lysodeikticus and Staphylococcus aureus cells on subbacteriostatic concentrations of nitrofurans results in a lower biosynthesis of many membrane proteins, as well as in inhibiting the activity of respiratory enzymes, i. e. the specific concentration of cytochromes and specific activity of NADH-, malate-, lactate oxidases and some reductases drop. Some cytological changes were revealed, when cells were grown on solafur, furazolidone, and furacriline.
de-la-Re-Vega, Enrique; García-Galaz, Alfonso; Díaz-Cinco, Martha E; Sotelo-Mundo, Rogerio R
2006-03-01
C-type lysozyme has been described as an antibacterial component of the shrimp innate defence system. We determined quantitatively the antibacterial activity of white shrimp (Litopenaeus vannamei) recombinant lysozyme against three Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae, using a turbidimetric assay with live bacteria and differential bacterial viable count after interaction with the protein. In conclusion, the antibacterial activity of recombinant shrimp lysozyme against Vibrio sp. is at least equal to the values against the Gram positive M. luteus and more active against the shrimp pathogens V. alginolyticus and V. parahemolyticus.
Limazepines A-F, pyrrolo[1,4]benzodiazepine Antibiotics from an Indonesian Micrococcus sp.
Fotso, Serge; Zabriskie, T Mark; Proteau, Philip J; Flatt, Patricia M; Santosa, Dwi Andreas; Mahmud, Taifo
2009-04-01
In our screening of Indonesian microorganisms for novel bioactive natural products we have isolated seven new compounds, designated as limazepines A, B1 and B2 (isolated as an isomeric mixture), C, D, E, and F, from the culture broth of Micrococcus sp. strain ICBB 8177. In addition, the known natural products prothracarcin and 7-O-succinylmacrolactin A, as well as two previously reported synthetic compounds, 2-amino-3-hydroxy-4-methoxybenzoic acid methyl ester and 4-ethylpyrrole-2-carboxaldehyde, were obtained from the extract. Chemical structures were determined by spectroscopic methods and by comparison with the NMR data of structurally related compounds. The limazepines belong to the growing group of the pyrrolo[1,4]benzodiazepine antitumor antibiotics isolated from various soil bacteria. Limazepines B1/B2 mixture, C, and E were active against the Gram-positive bacterium Staphylococcus aureus and the Gram-negative bacterium Escherichia coli. Limazepine D was also active against S. aureus, but was not active against E. coli. Interestingly, only the limazepines B1/B2 mixture and D were active against Pseudomonas aeruginosa.
NASA Astrophysics Data System (ADS)
Bilyi, Olexander I.; Getman, Vasyl B.; Konyev, Fedir A.; Sapunkov, Olexander; Sapunkov, Pavlo G.
2001-06-01
The devices for monitoring of parameters of efficiency of water solutions filtration, which are based on the analysis of scattered light by microparticles are considered in this article. The efficiency of using of devices in pharmaceutics in technological processes of manufacturing medical injection solutions is shown. The examples of monitoring of contents of bacterial cultures Pseudomonas aeruginosa, Escherichia coli, and Micrococcus luteus in water solutions of glucose are indicated.
Öztürk, Mehmet; Duru, Mehmet Emin; Kivrak, Seyda; Mercan-Doğan, Nazime; Türkoglu, Aziz; Özler, Mehmet Ali
2011-06-01
The fatty acids of Agaricus essettei, Agaricus bitorquis and Agaricus bisporus were investigated by using GC and GC-MS. The dominant fatty acids were found to be linoleic (61.82-67.29%) and palmitic (12.67-14.71%) acids among the 13 fatty acids detected in the oils. Total unsaturation for the oils was calculated as 77.50%, 77.44%, and 79.72%, respectively. In vitro antioxidant, anticholinesterase and antimicrobial activities were also studied. The ethyl acetate extract of Agaricus bitorquis showed the highest activity in β-carotene-linoleic acid, DPPH(·) and ABTS(·)(+) assays, while the hexane extract of Agaricus bisporus exhibited the best metal chelating activity. The ethyl acetate and hexane extract of Agaricus bitorquis and the hexane extract of Agaricus essettei showed meaningful butyrylcholinesterase activity being close to that of galantamine. The extracts were found to be effective on Gram (+) bacteria, especially against Micrococcus luteus, Micrococcus flavus, Bacillus subtilis and Bacillus cereus. In conclusion, Agaricus bitorquis and Agaricus essettei demonstrated higher iron content, and better antioxidant, anticholinesterase and antimicrobial activities than those of Agaricus bisporus commonly consumed mushroom. Hence, Agaricus species, particularly Agaricus bitorquis might be useful as antioxidant agents and moderate anticholinesterase agents, and their extracts will probably be used for development of dietary foods, food products and additives. Copyright © 2011 Elsevier Ltd. All rights reserved.
Balseiro-Romero, María; Gkorezis, Panagiotis; Kidd, Petra S; Van Hamme, Jonathan; Weyens, Nele; Monterroso, Carmen; Vangronsveld, Jaco
2017-03-01
Plant growth promoting (PGP) bacterial strains possess different mechanisms to improve plant development under common environmental stresses, and are therefore often used as inoculants in soil phytoremediation processes. The aims of the present work were to study the effects of a collection of plant growth promoting bacterial strains on plant development, antioxidant enzyme activities and nutritional status of Cytisus striatus and/or Lupinus luteus plants a) growing in perlite under non-stress conditions and b) growing in diesel-contaminated soil. For this, two greenhouse experiments were designed. Firstly, C. striatus and L. luteus plants were grown from seeds in perlite, and periodically inoculated with 6 PGP strains, either individually or in pairs. Secondly, L. luteus seedlings were grown in soil samples of the A and B horizons of a Cambisol contaminated with 1.25% (w/w) of diesel and inoculated with best PGP inoculant selected from the first experiment. The results indicated that the PGP strains tested in perlite significantly improved plant growth. Combination treatments provoked better growth of L. luteus than the respective individual strains, while individual inoculation treatments were more effective for C. striatus. L. luteus growth in diesel-contaminated soil was significantly improved in the presence of PGP strains, presenting a 2-fold or higher increase in plant biomass. Inoculants did not provoke significant changes in plant nutritional status, with the exception of a subset of siderophore-producing and P-solubilising bacterial strains that resulted in significantly modification of Fe or P concentrations in leaf tissues. Inoculants did not cause significant changes in enzyme activities in perlite experiments, however they significantly reduced oxidative stress in contaminated soils suggesting an improvement in plant tolerance to diesel. Some strains were applied to non-host plants, indicating a non-specific performance of their plant growth promotion
Wayah, Samson B.; Philip, Koshy
2018-01-01
Micrococcus luteus, Listeria monocytogenes, and Bacillus cereus are major food-borne pathogenic and spoilage bacteria. Emergence of antibiotic resistance and consumer demand for foods containing less of chemical preservatives led to a search for natural antimicrobials. A study aimed at characterizing, investigating the mechanism of action and regulation of biosynthesis and evaluating the biopreservative potential of pentocin from Lactobacillus pentosus CS2 was conducted. Pentocin MQ1 is a novel bacteriocin isolated from L. pentosus CS2 of coconut shake origin. The purification strategy involved adsorption-desorption of bacteriocin followed by RP-HPLC. It has a molecular weight of 2110.672 Da as determined by MALDI-TOF mass spectrometry and a molar extinction value of 298.82 M−1 cm−1. Pentocin MQ1 is not plasmid-borne and its biosynthesis is regulated by a quorum sensing mechanism. It has a broad spectrum of antibacterial activity, exhibited high chemical, thermal and pH stability but proved sensitive to proteolytic enzymes. It is potent against M. luteus, B. cereus, and L. monocytogenes at micromolar concentrations. It is quick-acting and exhibited a bactericidal mode of action against its targets. Target killing was mediated by pore formation. We report for the first time membrane permeabilization as a mechanism of action of the pentocin from the study against Gram-positive bacteria. Pentocin MQ1 is a cell wall-associated bacteriocin. Application of pentocin MQ1 improved the microbiological quality and extended the shelf life of fresh banana. This is the first report on the biopreservation of banana using bacteriocin. These findings place pentocin MQ1 as a potential biopreservative for further evaluation in food and medical applications. PMID:29636737
Antimicrobial and antifungal activities of the extracts and essential oils of Bidens tripartita.
Tomczykowa, Monika; Tomczyk, Michał; Jakoniuk, Piotr; Tryniszewska, Elzbieta
2008-01-01
The aim of this study was to determine the antibacterial and antifungal properties of the extracts, subextracts and essential oils of Bidens tripartita flowers and herbs. In the study, twelve extracts and two essential oils were investigated for activity against different Gram-positive Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Gram-negative bacteria Escherichia coli, E. coli (beta-laktamase+), Klebsiella pneumoniae (ESBL+), Pseudomonas aeruginosa and some fungal organisms Candida albicans, C. parapsilosis, Aspergillus fumigatus, A. terreus using a broth microdilution and disc diffusion methods. The results obtained indicate antimicrobial activity of the tested extracts (except butanolic extracts), which however did not inhibit the growth of fungi used in this study. Bacteriostatic effect of both essential oils is insignificant, but they have strong antifungal activity. These results support the use of B. tripartita to treat a microbial infections and it is indicated as an antimicrobial and antifungal agent, which may act as pharmaceuticals and preservatives.
Antimicrobial activity of Chinese bayberry extract for the preservation of surimi.
Li, Jianrong; Han, Qiang; Chen, Wei; Ye, Libin
2012-08-30
Chemical preservatives such as sodium nitrite and potassium sorbate have been widely used to keep surimi products fresh. However, the potential harmfulness to human health cannot be ignored. This study was conducted to develop natural preservatives for the storage of Collichthys surimi. Among the eight Chinese traditional herbs and fruits, Chinese bayberry extract showed the greatest inhibitory effect against surimi spoilage bacteria Serratia marcescens and Pseudomonas aeruginosa. Moreover, N-butanol phase extract of bayberry (NB) showed the greatest activity among the different phases of bayberry extract. When Chinese bayberry extract was combined with tea polyphenol, an additive inhibitory effect was observed on growth of Hansenula anomala, Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. Our results further indicated that the shelf life of surimi products stored at room temperature can be extended when supplemented with Chinese bayberry extract. Our results suggest that Chinese bayberry extract can be used as a natural preservative for the storage of Collichthys surimi. Copyright © 2012 Society of Chemical Industry.
Limayem, Alya; Gonzalez, Francisco; Micciche, Andrew; Haller, Edward; Nayak, Bina; Mohapatra, Shyam
2016-12-01
Wastewater-algal biomass is a promising option to biofuel production. However, microbial contaminants constitute a substantial barrier to algal biofuel yield. A series of algal strains, Nannochloris oculata and Chlorella vulgaris samples (n = 30), were purchased from the University of Texas, and were used for both stock flask cultures and flat-panel vertical bioreactors. A number of media were used for isolation and differentiation of potential contaminants according to laboratory standards (CLSI). Conventional PCR amplification was performed followed by 16S rDNA sequencing to identify isolates at the species level. Nanotherapeutics involving a nanomicellar combination of natural chitosan and zinc oxide (CZNPs) were tested against the microbial lytic groups through Minimum Inhibitory Concentration (MIC) tests and Transmission Electronic Microscopy (TEM). Results indicated the presence of Pseudomonas spp., Bacillus pumilus/ safensis, Cellulosimicrobium cellulans, Micrococcus luteus and Staphylococcus epidermidis strains at a substantial level in the wastewater-fed algal reactors. TEM confirmed the effectiveness of CZNPs on the lytic group while the average MICs (mg/mL) detected for the strains, Pseudomonas spp, Micrococcus luteus, and Bacillus pumilus were 0.417, 3.33, and 1.458, respectively. Conclusively, CZNP antimicrobials proved to be effective as inhibitory agents against currently identified lytic microbial group, did not impact algae cells, and shows promise for in situ interventions.
Lysozyme as a recognition element for monitoring of bacterial population.
Zheng, Laibao; Wan, Yi; Yu, Liangmin; Zhang, Dun
2016-01-01
Bacterial infections remain a significant challenge in biomedicine and environment safety. Increasing worldwide demand for point-of-care techniques and increasing concern on their safe development and use, require a simple and sensitive bioanalysis for pathogen detection. However, this goal is not yet achieved. A design for fluorescein isothiocyanate-labeled lysozyme (FITC-LYZ), which provides quantitative binding information for gram-positive bacteria, Micrococcus luteus, and detects pathogen concentration, is presented. The functional lysozyme is used not only as the pathogenic detection platform, but also as a tracking reagent for microbial population in antibacterial tests. A nonlinear relationship between the system response and the logarithm of the bacterial concentration was observed in the range of 1.2×10(2)-1.2×10(5) cfu mL(-1). The system has a potential for further applications and provides a facile and simple method for detection of pathogenic bacteria. Meanwhile, the fluorescein isothiocyanate -labeled lysozyme is also employed as the tracking agent for antibacterial dynamic assay, which show a similar dynamic curve compared with UV-vis test. Copyright © 2015 Elsevier B.V. All rights reserved.
Evaluation of antibacterial properties of some medicinal plants used in Iran.
Bonjar, Shahidi
2004-10-01
Forty-five species of 29 plant families used in the traditional medicine by Iranian people, showed antibacterial activities against one or more of the bacterial species: Bacillus cereus, Bacillus pumilus, Bordetella bronchiseptica, Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Pseudomonas aeruginosa, Pseudomonas fluorescens, Serratia marcescens, Staphylococcus aureus and Staphylococcus epidermidis. No plant showed activity against Serratia marcescens; Bordetella bronchiseptica being the most susceptible species. All extracts showed the same activity 18 months later.
NASA Astrophysics Data System (ADS)
Ghojaie, M.
1993-10-01
The genus of micrococcus and its main species like; M. Roseus, M. Nishinomiyansis consist of upto 10% of microbial contamination of disposable medical devices. Chemical alteration of Menuquinones Mainly [MK-7-(H2), MK-8(H2),…] from some Irradiated species of the micrococcus at different doses (500 Gy to 25 kGy; the sterilization dose) are quantitatively evaluated by HPLC.
Rojjanateeranaj, Pongsarun; Sangthong, Chirawee; Prapagdee, Benjaphorn
2017-10-01
This study examined the potential of three strains of cadmium-resistant bacteria, including Micrococcus sp., Pseudomonas sp. and Arthrobacter sp., to promote root elongation of Glycine max L. seedlings, soil cadmium solubility and cadmium phytoremediation in G. max L. planted in soil highly polluted with cadmium with and without nutrient biostimulation. Micrococcus sp. promoted root length in G. max L. seedlings under toxic cadmium conditions. Soil inoculation with Arthrobacter sp. increased the bioavailable fraction of soil cadmium, particularly in soil amended with a C:N ratio of 20:1. Pot culture experiments observed that the highest plant growth was in Micrococcus sp.-inoculated plants with nutrient biostimulation. Cadmium accumulation in the roots, stems and leaves of G. max L. was significantly enhanced by Arthrobacter sp. with nutrient biostimulation. A combined use of G. max L. and Arthrobacter sp. with nutrient biostimulation accelerated cadmium phytoremediation. In addition, cadmium was retained in roots more than in stems and leaves and G. max L. had the lowest translocation factor at all growth stages, suggesting that G. max L. is a phytostabilizing plant. We concluded that biostimulation-assisted bioaugmentation is an important strategy for improving cadmium phytoremediation efficiency. Copyright © 2017 Elsevier Ltd. All rights reserved.
The deoxyribonucleic acid of Micrococcus radiodurans
Schein, Arnold H.
1966-01-01
The DNA of Micrococcus radiodurans was prepared by three methods. Although the recovery of DNA varied considerably, the percentage molar base ratios of the DNA from the three preparations were essentially the same: guanine, 33±2; adenine, 18±1; cytosine, 33±2; thymine, 17±1. Base compositions calculated from Tm values and from density in caesium chloride gradients also yielded guanine+cytosine contents of 66 and 68% of total bases respectively. No unusual bases were observed. The S20,w values were characteristic of high-molecular-weight DNA. Electron microscopy showed the purified DNA in long strands; occasionally these were coiled. Images(a)(b)(c)(d)(e)Fig. 1. PMID:16742439
2009-02-01
EEM spectra of Micrococcus lysodeikticus vegetative cells, dry............................... 24 Figure 18. EEM spectra of Micrococcus lysodeikticus...tryptophan, B. subtilis (vegetative cells) ATCC 6633, Pseudomonas fluorescens, Micrococcus lysodeikticus, Staphylococcus aureus, and Clostridium...present the EEM spectra of Pseudomonas fluorescens (dry), Yersinia pestis (dry and in water), Micrococcus lysodeikticus (dry and in water
Oxidation and Assimilation of Carbohydrates by Micrococcus sodonensis1
Perry, Jerome J.; Evans, James B.
1966-01-01
Perry, Jerome J. (North Carolina State University, Raleigh), and James B. Evans. Oxidation and assimilation of carbohydrates by Micrococcus sodonensis. J. Bacteriol. 91:33–38. 1966.—Micrococcus sodonensis is a biotin-requiring strict aerobe that cannot utilize carbohydrates as sole sources of carbon and energy. However, addition of mannose, glucose, sucrose, or maltose to a medium on which the organism can grow resulted in an increase in total growth. M. sodonensis oxidized these sugars without induction, thus indicating the presence of constitutive enzymes for their transport, activation, and metabolism. Under appropriate nonproliferating cell conditions, glucose was readily incorporated into essential constituents of the cell. When glucose-1-C14 and glucose-6-C14 were oxidized by nonproliferating cells, the label was found in both the protein and nucleic acid fractions of the cell. The respiratory quotients of cells oxidizing glucose in saline and in phosphate buffer indicated assimilation of sugar carbon in buffer and virtually no assimilation in saline. The ability of M. sodonensis to completely oxidize glucose and to grow on intermediates of glucose oxidation but not on glucose suggests that glucose may suppress or repress some reaction(s) necessary for growth, and that growth substrates either derepress or circumvent this block. PMID:5903100
Hershler, Robert; Liu, Hsiu-Ping; Bradford, Corbin
2013-01-01
We describe three new species of springsnails (genus Pyrgulopsis) from the Amargosa River basin, California and Nevada (P. licina sp. n., P. perforata sp. n., P. sanchezi sp. n.), each of which was previously considered to be part of P. micrococcus. We also restrict P. micrococcus to its type locality area (Oasis Valley) and redefine a regional congener, P. turbatrix, to include populations from the central Death Valley region and San Bernardino Mountains that had been previously identified as P. micrococcus. The five species treated herein form genetically distinct lineages that differ from each other by 4.2-12.6% for mtCOI and 5.2-13.6% for mtNDI (based on previously published and newly obtained data), and are diagnosable by shell and/or penial characters. The new molecular data presented herein confirm sympatry of P. licina and P. sanchezi in Ash Meadows (consistent with morphological evidence) and delineate an additional lineage of P. micrococcus (in the broad sense) that we do not treat taxonomically owing to the paucity of morphological material. Conservation measures are needed to ensure the long term persistence of populations of P. micrococcus and a genetically differentiated lineage of P. sanchezi which live in disturbed habitats on private lands.
Metabolism of dimethylphthalate by Micrococcus sp. strain 12B.
Eaton, R W; Ribbons, D W
1982-01-01
During growth of Micrococcus sp. strain 12B with dimethylphthalate, 4-carboxy-2-hydroxymuconate lactone (CHML, X) and 3,4-dihydroxyphthalate-2-methyl ester (XI) were isolated from culture filtrates. CHML is the lactone of intermediate 4-carboxy-2-hydroxymuconate (IX). Accumulation of XI which is not a substrate for 3,4-dihydroxyphthalate-2-decarboxylase in strain 12B afforded an easy access to the preparation of 3,4-dihydroxyphthalate. PMID:7085569
Antimicrobial Activities of Bacteria Associated with the Brown Alga Padina pavonica
Ismail, Amel; Ktari, Leila; Ahmed, Mehboob; Bolhuis, Henk; Boudabbous, Abdellatif; Stal, Lucas J.; Cretoiu, Mariana Silvia; El Bour, Monia
2016-01-01
Macroalgae belonging to the genus Padina are known to produce antibacterial compounds that may inhibit growth of human- and animal pathogens. Hitherto, it was unclear whether this antibacterial activity is produced by the macroalga itself or by secondary metabolite producing epiphytic bacteria. Here we report antibacterial activities of epiphytic bacteria isolated from Padina pavonica (Peacocks tail) located on northern coast of Tunisia. Eighteen isolates were obtained in pure culture and tested for antimicrobial activities. Based on the 16S rRNA gene sequences the isolates were closely related to Proteobacteria (12 isolates; 2 Alpha- and 10 Gammaproteobacteria), Firmicutes (4 isolates) and Actinobacteria (2 isolates). The antimicrobial activity was assessed as inhibition of growth of 12 species of pathogenic bacteria (Aeromonas salmonicida, A. hydrophila, Enterobacter xiangfangensis, Enterococcus faecium, Escherichia coli, Micrococcus sp., Salmonella typhimurium, Staphylococcus aureus, Streptococcus sp., Vibrio alginoliticus, V. proteolyticus, V. vulnificus) and one pathogenic yeast (Candida albicans). Among the Firmicutes, isolate P8, which is closely related to Bacillus pumilus, displayed the largest spectrum of growth inhibition of the pathogenic bacteria tested. The results emphasize the potential use of P. pavonica associated antagonistic bacteria as producers of novel antibacterial compounds. PMID:27462308
NASA Astrophysics Data System (ADS)
Abbasi Shiran, Jafar; Yahyazadeh, Asieh; Mamaghani, Manouchehr; Rassa, Mehdi
2013-05-01
Several novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole derivatives were synthesized by the reaction of allyl-thioureas and 2-bromoacetophenone. We also report the synthesis of bis-allyl-3H thiazoles using the reaction of various isothiocyanates and 1,3-phenylenediamine. The structures of all compounds were characterized by spectral and elemental analysis. Most of the synthesized compounds exhibited efficient antibacterial activities against Salmonella enterica, Micrococcus luteus, Bacillus subtilis and Pseudomonas aeruginosa.
Feiner, Rose R.; Coward, Joe E.; Rosenkranz, Herbert S.
1973-01-01
Hydroxyurea-sensitive strains of Staphylococcus epidermidis and Micrococcus lysodeikticus showed marked thickening of cell walls and reduction in deoxyribonucleic acid synthesis when grown in the presence of hydroxyurea. Images PMID:4790602
Electromechanical and Elastic Probing of Bacteria in Cell Culture Medium
Thompson, G.L.; Reukov, V.V.; Nikiforov, M.P.; Jesse, S.; Kalinin, S.V.; Vertegel, A.A.
2012-01-01
Rapid phenotype characterization and identification of cultured cells, which is needed for progress in tissue engineering and drug testing, requires an experimental technique that measures physical properties of cells with sub-micron resolution. Recently, band excitation piezoresponse force microscopy (BEPFM) has been proven useful for recognition and imaging of different types of bacteria in pure water. Here, the BEPFM method is performed for the first time in physiologically-relevant electrolyte media, such as Dulbecco’s phosphate-buffered saline (DPBS) and Dulbecco’s modified Eagle’s medium (DMEM). Distinct electromechanical responses for Micrococcus lysodeikticus (Gram-positive) and Pseudomonas fluorescens (Gram-negative) bacteria are demonstrated in DPBS. The results suggest that mechanical properties of the outer surface coating each bacterium, as well as the electrical double layer around them, are responsible for the BEPFM image formation mechanism in electrolyte media. PMID:22641388
Isolation and Identification of Echinenone from Micrococcus roseus
Schwartzel, E. H.; Cooney, J. J.
1970-01-01
An orange carotenoid from Micrococcus roseus was purified by solvent partitioning followed by column and thin-layer chromatography. Absorption spectra, chromatographic mobility, and partition coefficient suggested that the pigment was echinenone (4-keto-β-carotene). Reduction yielded a pigment with the spectral and polar properties of isocryptoxanthin (4-hydroxy-β-carotene), the expected product. The orange pigment and its reduction product co-chromatographed with the respective authentic pigments, confirming the original pigment as echinenone. To our knowledge echinenone has not been identified previously as a bacterial pigment. PMID:5473895
Obuchowska, Agnes
2008-03-01
A new electrochemical method for the quantitation of bacteria that is rapid, inexpensive, and amenable to miniaturization is reported. Cyclic voltammetry was used to quantitate M. luteus, C. sporogenes, and E. coli JM105 in exponential and stationary phases, following exposure of screen-printed carbon working electrodes (SPCEs) to lysed culture samples. Ferricyanide was used as a probe. The detection limits (3s) were calculated and the dynamic ranges for E. coli (exponential and stationary phases), M. luteus (exponential and stationary phases), and C. sporogenes (exponential phase) lysed by lysozyme were 3 x 10(4) to 5 x 10(6) colony-forming units (CFU) mL(-1), 5 x 10(6) to 2 x 10(8) CFU mL(-1) and 3 x 10(3) to 3 x 10(5) CFU mL(-1), respectively. Good overlap was obtained between the calibration curves when the electrochemical signal was plotted against the dry bacterial weight, or between the protein concentration in the bacterial lysate. In contrast, unlysed bacteria did not change the electrochemical signal of ferricyanide. The results indicate that the reduction of the electrochemical signal in the presence of the lysate is mainly due to the fouling of the electrode by proteins. Similar results were obtained with carbon-paste electrodes although detection limits were better with SPCEs. The method described herein was applied to quantitation of bacteria in a cooling tower water sample.
Numerical taxonomy and ecology of petroleum-degrading bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Austin, B.; Calomiris, J.J.; Walker, J.D.
1977-07-01
A total of 99 strains of petroleum-degrading bacteria isolated from Chesapeake Bay water and sediment were identified by using numerical taxonomy procedures. The isolates, together with 33 reference cultures, were examined for 48 biochemical, cultural, morphological, and physiological characters. The data were analyzed by computer, using both the simple matching and the Jaccard coefficients. Clustering was achieved by the unweighted average linkage method. From the sorted similarity matrix and dendrogram, 14 phenetic groups, comprising 85 of the petroleum-degrading bacteria, were defined at the 80 to 85% similarity level. These groups were identified as actinomycetes (mycelial forms, four clusters), coryneforms, Enterobacteriaceae,more » Klebsiella aerogenes, Micrococcus spp. (two clusters), Nocardia species (two clusters), Pseudomonas spp. (two clusters), and Sphaerotilus natans. It is concluded that the degradation of petroleum is accomplished by a diverse range of bacterial taxa, some of which were isolated only at given sampling stations and, more specifically, from sediment collected at a given station.« less
Numerical taxonomy and ecology of petroleum-degrading bacteria.
Austin, B; Calomiris, J J; Walker, J D; Colwell, R R
1977-01-01
A total of 99 strains of petroleum-degrading bacteria isolated from Chesapeake Bay water and sediment were identified by using numerical taxonomy procedures. The isolates, together with 33 reference cultures, were examined for 48 biochemical, cultural, morphological, and physiological characters. The data were analyzed by computer, using both the simple matching and the Jaccard coefficients. Clustering was achieved by the unweighted average linkage method. From the sorted similarity matrix and dendrogram, 14 phenetic groups, comprising 85 of the petroleum-degrading bacteria, were defined at the 80 to 85% similarity level. These groups were identified as actinomycetes (mycelial forms, four clusters), coryneforms, Enterobacteriaceae, Klebsiella aerogenes, Micrococcus spp. (two clusters), Nocardia species (two clusters), Pseudomonas spp. (two clusters), and Sphaerotilus natans. It is concluded that the degradation of petroleum is accomplished by a diverse range of bacterial taxa, some of which were isolated only at given sampling stations and, more specifically, from sediment collected at a given station. PMID:889329
Sun, Cheng-Bo; Wang, Gang; Chan, Siuming F
2015-10-01
In this study, the activities of 5 immunity related enzymes namely acid phosphatase (ACP), alkaline phosphatase (AKP), phenoloxidase (PO), peroxidase (POD) and lysozyme phosphatase (LZM)) of Litopenaeus vannamei after they have been injected with different concentrations of Micrococcus lysodeikticus and the white spot syndrome virus (WSSV) were examined. The cumulative mortality at 0, 24, 48, 72, 96 h was obtained. Copy numbers of WSSV in L. vannamei after a single infection, secondary infection and concurrent infection were measured. Hemolymph samples of M. lysodeikticus and WSSV injected shrimp were collected at 0, 6, 12 24, 48, 72, 78, 84, 96 and 120 h. The results were: (i) The cumulative mortality of L. vannamei increased as the shrimp were infected with higher concentration of the bacteria; (ii) The most sensitive changes of ACP, AKP and LZM were in the 6.2 × 10(5), 6.2 × 10(6), 6.2 × 10(7) cfu/mL M. lysodeikticus group; (iii) ACP but LZM were more sensitive to M. lysodeikticus than WSSV, and AKP, PO and POD is more sensitive to WSSV; (iv) The copies of WSSV in the co-injected group were higher than WSSV-single infection and WSSV-bacteria-secondary infection group at 48 h. The amount of WSSV in L. vannamei of concurrent infection and WSSV-bacteria-secondary infection groups were higher than that of the WSSV-single infection group. Copyright © 2015. Published by Elsevier Ltd.
Fakhri, Ali; Naji, Mahsa; Tahami, Shiva
2017-05-01
In this study, wet chemical method used for ZnSe quantum dots (QDs) and characterized by, UV-vis, photoluminescence spectroscopy, X-ray diffraction and transmission electron microscopy. The crystallites size of ZnSe QDs was 4.0nm. The average diameters of ZnSe QDs were 3.0-5.3nm. Ritalin was degraded using the UV/ZnSe QDs/persulfate process. The several parameters investigated for the influence of Rtialin degradation were the temperature, the persulfate concentration, and the initial Ritalin concentration. The values of optimum parameters ware room temperature, concentration persulfate 5mmol/L and initial Ritalin concentration 0.09mmol/L. Comparative analyses showed the maximum degradation of Ritalin was found for ZnSe/persulfate under ultra-visible and ultra-sonic irradiation process. Comparative analysis showed the maximum degradation of Ritalin was found for ZnSe/persulfate under ultra-visible and ultra-sonic irradiation process. The values of first-order rate constants from degradation of Ritalin at 25°C were 0.96×10 -2 , 1.09×10 -2 , 1.59×10 -2 and 2.19×10 -2 for US/PS, UV/PS, ZnSe/US/PS and ZnSe/UV/PS system, respectively. The antibacterial activity evaluation against two bacterials, including Gram-positive bacteria Staphylococcus aureus (ATCC 43300), Bacillus megaterium (ATCC 14581) and Gram-negative bacteria Pseudomonas aeruginosa (ATCC 27853), Micrococcus luteus (ATCC 4698) was considered. It was found that the MIC values for the antibacterial assay in the presence of ZnSe QDs were around 0.30mM with 64.0, 66.0, 79.2, and 83.5% inhibition for the S. aureus, B. megaterium, P. aeruginosa and M. luteus bacterial strains, respectively. Then, results show that the ZnSe QDs have antibacterial activity. Copyright © 2017 Elsevier B.V. All rights reserved.
Irradiation of Microbes from Spent Nuclear Fuel Storage Pool Environments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Breckenridge, C.R.; Watkins, C.S.; Bruhn, D.F.
Microbes have been isolated and identified from spent nuclear fuel storage pools at the Idaho National Engineering and Environmental Laboratory (INEEL). Included among these are Corynebacterium aquaticum, Pseudomonas putida, Comamonas acidovorans, Gluconobacter cerinus, Micrococcus diversus, Rhodococcus rhodochrous, and two strains of sulfate-reducing bacteria (SRB). We examined the sensitivity of these microbes to a variety of total exposures of radiation generated by a 6-MeV linear accelerator (LINAC). The advantage of using a LINAC is that it provides a relatively quick screen of radiation tolerance. In the first set of experiments, we exposed each of the aforementioned microbes along with four additionalmore » microbes, pseudomonas aeruginosa, Micrococcus luteus, Escherchia coli, and Deinococcus radiodurans to exposures of 5 x 10{sup 3} and 6 x 10{sup 4} rad. All microbial specimens withstood the lower exposure with little or no reduction in cell population. Upon exposing the microbes to the larger dose of 6 x 10{sup 4} rad, we observed two distinct groupings: microbes that demonstrate resistance to radiation, and microbes that display intolerance through a dramatic reduction from their initial population. Microbes in the radiation tolerant grouping were exposed to 1.1 x 10{sup 5} rad to examine the extent of their resistance. We observe a correlation between radiation resistance and gram stain. The gram-positive species we examined seem to demonstrate a greater radiation resistance.« less
Liao, Tian-Jiang; Gao, Jie; Wang, Jin-Xing; Wang, Xian-Wei
2018-08-01
Lysozymes possess antibacterial activities, making them crucial defense proteins in innate immunity. In this study, a chicken-type (c-type) lysozyme (designated PcLyzc) was cloned and characterized from red swamp crayfish Procambarus clarkii. The full-length cDNA had an open reading frame of 435 base pairs encoding a polypeptide of 144 amino acid residues. Multiple alignments and phylogenetic analysis revealed that PcLyzc shared high similarity to the other known invertebrate c-type lysozymes. PcLyzc transcripts were steadily expressed in a wide range of tissues in healthy crayfish, and were prominently up-regulated in the hepatopancreas and gills after Vibrio anguillarum or Aeromonas hydrophila challenge. Recombinant PcLyzc showed inhibitory activity in vitro against both Gram-positive bacteria, including Staphylococcus aureus, Micrococcus luteus and Bacillus thuringiensis, and Gram-negative bacteria, including A. hydrophila, V. anguillarum and Escherichia coli. By overexpressing PcLyzc through introducing exogenous recombinant protein, or silencing PcLyzc expression through injecting double strand RNA, it was found that PcLyzc could help eliminate the invading bacteria in crayfish hemolymph and could protect crayfish from death, possibly by promoting the hemocytic phagocytosis. These results indicated that PcLyzc played a role in the antibacterial immunity of crustaceans, and laid a foundation of developing new therapeutic agents in aquaculture. Copyright © 2018 Elsevier Ltd. All rights reserved.
Effect of Encapsulation on Antimicrobial Activity of Herbal Extracts with Lysozyme
Matouskova, Petra; Bokrova, Jitka; Benesova, Pavla
2016-01-01
Summary Resistance of microorganisms to antibiotics has increased. The use of natural components with antimicrobial properties can be of great significance to reduce this problem. The presented work is focused on the study of the effect of encapsulation of selected plant and animal antimicrobial substances (herbs, spices, lysozyme and nisin) on their activity and stability. Antimicrobial components were packaged into liposomes and polysaccharide particles (alginate, chitosan and starch). Antimicrobial activity was tested against two Gram-positive (Bacillus subtilis and Micrococcus luteus) and two Gram-negative (Escherichia coli and Serratia marcescens) bacteria. Encapsulation was successful in all types of polysaccharide particles and liposomes. The prepared particles exhibited very good long-term stability, especially in aqueous conditions. Antimicrobial activity was retained in all types of particles. Liposomes with encapsulated herb and spice extracts exhibited very good inhibitory effect against all tested bacterial strains. Most of herbal extracts had very good antimicrobial effect against the tested Gram-negative bacterial strains, while Gram-positive bacteria were more sensitive to lysozyme particles. Thus, particles with co-encapsulated herbs and lysozyme are more active against different types of bacteria, and more stable and more effective during long-term storage. Particles with encapsulated mixture of selected plant extracts and lysozyme could be used as complex antimicrobial preparation with controlled release in the production of food and food supplements, pharmaceutical and cosmetic industries. PMID:27956862
Evaluation of portable air samplers for monitoring airborne culturable bacteria
NASA Technical Reports Server (NTRS)
Mehta, S. K.; Bell-Robinson, D. M.; Groves, T. O.; Stetzenbach, L. D.; Pierson, D. L.
2000-01-01
Airborne culturable bacteria were monitored at five locations (three in an office/laboratory building and two in a private residence) in a series of experiments designed to compare the efficiency of four air samplers: the Andersen two-stage, Burkard portable, RCS Plus, and SAS Super 90 samplers. A total of 280 samples was collected. The four samplers were operated simultaneously, each sampling 100 L of air with collection on trypticase soy agar. The data were corrected by applying positive hole conversion factors for the Burkard portable, Andersen two-stage, and SAS Super 90 air samplers, and were expressed as log10 values prior to statistical analysis by analysis of variance. The Burkard portable air sampler retrieved the highest number of airborne culturable bacteria at four of the five sampling sites, followed by the SAS Super 90 and the Andersen two-stage impactor. The number of bacteria retrieved by the RCS Plus was significantly less than those retrieved by the other samplers. Among the predominant bacterial genera retrieved by all samplers were Staphylococcus, Bacillus, Corynebacterium, Micrococcus, and Streptococcus.
Electromechanical and elastic probing of bacteria in a cell culture medium
NASA Astrophysics Data System (ADS)
Thompson, G. L.; Reukov, V. V.; Nikiforov, M. P.; Jesse, S.; Kalinin, S. V.; Vertegel, A. A.
2012-06-01
Rapid phenotype characterization and identification of cultured cells, which is needed for progress in tissue engineering and drug testing, requires an experimental technique that measures physical properties of cells with sub-micron resolution. Recently, band excitation piezoresponse force microscopy (BEPFM) has been proven useful for recognition and imaging of bacteria of different types in pure water. Here, the BEPFM method is performed for the first time on physiologically relevant electrolyte media, such as Dulbecco’s phosphate-buffered saline (DPBS) and Dulbecco’s modified Eagle’s medium (DMEM). Distinct electromechanical responses for Micrococcus lysodeikticus (Gram-positive) and Pseudomonas fluorescens (Gram-negative) bacteria in DPBS are demonstrated. The results suggest that mechanical properties of the outer surface coating each bacterium, as well as the electrical double layer around them, are responsible for the BEPFM image formation mechanism in electrolyte media.
One-pot and two-step synthesis of novel carbonylthioureas and dicarbonyldithioureas derivatives
NASA Astrophysics Data System (ADS)
Banaei, Alireza; Shiran, Jafar Abbasi; Saadat, Afshin; Ardabili, Farnaz Fazlalizadeh; McArdle, Patrick
2015-11-01
One-pot, two-step synthesis of several 1-cyclopropanecarbonyl-3-(substituted phenyl)-thioureas and 1-(phenylene-1,4-dione)-3,3‧-(substituted phenyl)-dithioureas have been successfully prepared. The structures of the synthesized compounds were confirmed by elemental analysis, FT-IR spectroscopy and NMR. Also the crystal structure one of these compounds was determined by X-ray crystallography. All synthesized compounds were evaluated for antibacterial activity using Salmonella enterica (SE), Micrococcus luteus (ML), Bacillus subtilis (BS) and Pseudomonas aeruginosa (PS).
Halophilic Nuclease from a Moderately Halophilic Micrococcus varians
Kamekura, Masahiro; Onishi, Hiroshi
1974-01-01
The moderately halophilic bacterium Micrococcus varians, isolated from soy sauce mash, produced extracellular nuclease when cultivated aerobically in media containing 1 to 4 M NaCl or KCl. The enzyme, purified to an electrophoretically homogeneous state, had both ribonuclease and deoxyribonuclease activities. The nuclease had maximal activity in the presence of 2.9 M NaCl or 2.1 M KCl at 40 C. The enzymatic activity was lost by dialysis against low-salt buffer, whereas when the inactivated enzyme was dialyzed against 3.4 M NaCl buffer as much as 77% of the initial activity could be restored. Images PMID:4852218
Alkaliphilic and halophilic hydrocarbon-utilizing bacteria from Kuwaiti coasts of the Arabian Gulf.
Al-Awadhi, H; Sulaiman, Rasha H D; Mahmoud, Huda M; Radwan, S S
2007-11-01
Green animate materials from the intertidal zone of the Arabian Gulf coast accommodated more alkaliphilic and halophilic bacteria than inanimate materials. The alkaliphilic oil-utilizing bacteria, as identified by their 16S ribonucleic acid sequences, belonged to the following genera arranged in decreasing frequences: Marinobacter, Micrococcus, Dietzia, Bacillus, Oceanobacillus, and Citricoccus. The halophilic oil-utilizing bacteria belonged to the genera: Marinobacter, Georgenia, Microbacterium, Stappia, Bacillus, Isoptericola, and Cellulomonas. Most isolates could grow on a wide range of pure n-alkanes and aromatic compounds, as sole sources of carbon and energy. Quantitative gas liquid chromatographic analysis showed that individual isolates attenuated crude oil and representative pure hydrocarbons in culture. The optimum pH for most of the alkaliphilic genera was pH 10, and the optimum salinity for the halophiles ranged between 2.5 and 5% NaCl (w/v). It was concluded that as far as their microbial makeup is concerned, oily alkaline and saline intertidal areas of the Kuwaiti coasts have a self-cleaning potential.
Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin
Goh, Hweh Fen; Philip, Koshy
2015-01-01
A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it’s mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain. PMID:26474074
Sousa, Juliana C; Berto, Raquel F; Gois, Elicélia A; Fontenele-Cardi, Nauíla C; Honório, José E R; Konno, Katsuhiro; Richardson, Michael; Rocha, Marcos F G; Camargo, Antônio A C M; Pimenta, Daniel C; Cardi, Bruno A; Carvalho, Krishnamurti M
2009-07-01
Antimicrobial peptides are components of innate immunity that is the first-line defense against invading pathogens for a wide range of organisms. Here, we describe the isolation, biological characterization and amino acid sequencing of a novel neutral Glycine/Leucine-rich antimicrobial peptide from skin secretion of Leptodactylus pentadactylus named leptoglycin. The amino acid sequence of the peptide purified by RP-HPLC (C(18) column) was deduced by mass spectrometric de novo sequencing and confirmed by Edman degradation: GLLGGLLGPLLGGGGGGGGGLL. Leptoglycin was able to inhibit the growth of Gram-negative bacteria Pseudomonas aeruginosa, Escherichia coli and Citrobacter freundii with minimal inhibitory concentrations (MICs) of 8 microM, 50 microM, and 75 microM respectively, but it did not show antimicrobial activity against Gram-positive bacteria (Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis), yeasts (Candida albicans and Candida tropicalis) and dermatophytes fungi (Microsporum canis and Trichophyton rubrum). No hemolytic activity was observed at the 2-200 microM range concentration. The amino acid sequence of leptoglycin with high level of glycine (59.1%) and leucine (36.4%) containing an unusual central proline suggests the existence of a new class of Gly/Leu-rich antimicrobial peptides. Taken together, these results suggest that this natural antimicrobial peptide could be a tool to develop new antibiotics.
Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin.
Goh, Hweh Fen; Philip, Koshy
2015-01-01
A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it's mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain.
Saba, Martyna; Falandysz, Jerzy; Nnorom, Innocent C
2016-02-01
Presented in this paper is result of the study of the bioconcentration potential of mercury (Hg) by Suillus luteus mushroom collected from regions within Central, Eastern, and Northern regions of Europe. As determined by cold-vapor atomic absorption spectroscopy, the Hg content varied from 0.13 ± 0.05 to 0.33 ± 0.13 mg kg(-1) dry matter for caps and from 0.038 ± 0.014 to 0.095 ± 0.038 mg kg(-1) dry matter in stems. The Hg content of the soil substratum (0-10 cm layer) underneath the fruiting bodies showed generally low Hg concentrations that varied widely ranging from 0.0030 to 0.15 mg kg(-1) dry matter with mean values varying from 0.0078 ± 0.0035 to 0.053 ± 0.025 mg kg(-1) dry matter, which is below typical content in the Earth crust. The caps were observed to be on the richer in Hg than the stems at ratio between 1.8 ± 0.4 and 5.3 ± 2.6. The S. luteus mushroom showed moderate ability to accumulate Hg with bioconcentration factor (BCF) values ranging from 3.6 ± 1.3 to 42 ± 18. The consumption of fresh S. luteus mushroom in quantities up to 300 g week(-1) (assuming no Hg ingestion from other foods) from background areas in the Central, Eastern, and Northern part of Europe will not result in the intake of Hg exceeds the provisional weekly tolerance limit (PTWI) of 0.004 mg kg(-1) body mass.
Responses of Mytilus galloprovincialis to bacterial challenges by metabolomics and proteomics.
Ji, Chenglong; Wu, Huifeng; Wei, Lei; Zhao, Jianmin; Wang, Qing; Lu, Hongjian
2013-08-01
Pathogens can cause diseases and lead to massive mortalities of aquaculture animals and substantial economic loss. In this work, we studied the responses induced by Micrococcus luteus and Vibrio anguillarum in gill of mussel Mytilus galloprovincialis at protein and metabolite levels. Metabolic biomarkers (e.g., amino acids, betaine, ATP) suggested that both M. luteus and V. anguillarum induced disturbances in energy metabolism and osmotic regulation. The unique and some more remarkably altered metabolic biomarkers (threonine, alanine, aspartate, taurine, succinate) demonstrated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. Proteomic biomarkers (e.g., goose-type lysozyme 2, matrilin, ependymin-related protein, peptidyl-prolyl cis-trans isomerases) indicated that M. luteus caused immune stress, and disturbances in signaling pathways and protein synthesis. However, V. anguillarum mainly induced oxidative stress and disturbance in energy metabolism in mussel gills indicated by altered procollagen-proline dioxygenase, protein disulfide isomerase, nucleoside diphosphate kinases, electron transfer flavoprotein and glutathione S-transferase. This work confirmed that an integration of proteomics and metabolomics could provide an insightful view into the effects of pathogens to the marine mussel M. galloprovincialis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Synthesis of novel antimicrobial aryl himachalene derivatives from naturally occurring himachalenes
Chaudhary, Abha; Sood, Swati; Das, Pralay; Kaur, Pushpinder; Mahajan, Isha; Gulati, Arvind; Singh, Bikram
2014-01-01
Five new 2,9,9-trimethyl-6,7,8,9-tetrahydro-benzocyclohepten-5-ylidene-amine derivatives (16a-16e) were synthesized from α-dehydro-ar-himachalene (11) that was originally prepared from an isomeric mixture of α, β and γ himachalenes (10), the abundant sesquiterpenes of Cedrus deodara essential oil. In addition, different aryl himachalenes derivatives (9, 12, 14 and 15) were also formed from 11. The structures of the synthesized compounds were confirmed on the basis of their NMR, IR and mass spectral data. The prepared compounds were tested against a group of sixteen organisms including gram positive and gram negative bacterial and fungal strains. The introduction of a series of substituted imine groups into aryl himachalenes at 5th position (16a-16e) enhanced antimicrobial activity as compared to the aromatized derivatives (9, 12, 14 and 15) against gram-positive bacteria Bacillus subtilis, Micrococcus luteus and Staphylococcus aureus, and mycotoxigenic fungi Aspergillus parasiticus, A. ochraceous and A. sydowii. graphical Abstract, Figure 1(Fig. 1) PMID:26417335
[Preparation and characterization of polyhydroxyalkanoate bioplastics with antibacterial activity].
Lou, Qiuli; Ma, Yiming; Che, Xuemei; Zhong, Jin; Sun, Xiaoxia; Zhang, Haoqian
2016-08-25
Polyhydroxyalkanoates (PHAs), as a novel class of biopolymer, are attracting more attention due to their diverse material properties and environment-independent biodegradability. Here we report the preparation of PHA exhibiting efficient antibacterial activity by embedding Nisin, a food additive generally recognized as safe, into poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx), a type of PHA with high biocompatibility. We first prepared Nisin-containing PHBHHx films using solvent casting method. Confocal laser scanning microscopy analysis showed that a well-mixed integrated structure of the films with an even distribution of the Nisin particles in the PHBHHx matrices. Then the antimicrobial activity of PHBHHx/Nisin films against Micrococcus luteus was quantified on agar plate by measuring the size of inhibition zone. Cultivation in liquid media further confirmed the releasing of Nisin from the films and the long-time antibacterial activity. Results showed that the threshold of Nisin concentration for long-time and effective inhibition against bacteria growth is 25 μg/g. These results altogether establish a technological foundation for the application of PHA in biomedicine and food industry.
Nithya, Vadakedath; Prakash, Maya; Halami, Prakash M
2018-06-01
The bio-preservative efficacy of a partially purified antibacterial peptide (ppABP) produced by Bacillus licheniformis Me1 in an economical medium developed using agro-industry waste was evaluated by direct application in milk and milk-based food products. The addition of ppABP in milk samples stored at 4 ± 2 °C and 28 ± 2 °C resulted in the growth inhibition of pathogens Listeria monocytogenes Scott A, Micrococcus luteus ATCC 9341, and Staphylococcus aureus FRI 722. The shelf life of milk samples with added ppABP increased to 4 days at 28 ± 2 °C, whereas curdling and off-odor were noticed in samples without ppABP. Furthermore, the milk samples with ppABP were sensorily acceptable. Antilisterial effect was also observed in cheese and paneer samples treated with ppABP. These results clearly indicate that the ppABP of B. licheniformis Me1 can be utilized as a bio-preservative to control the growth of spoilage and pathogenic bacteria, thereby reducing the risk of food-borne diseases.
Trabelsi, Imen; Ktari, Naourez; Ben Slima, Sirine; Triki, Mehdi; Bardaa, Sana; Mnif, Hela; Ben Salah, Riadh
2017-10-01
The present study aimed to evaluate the in vitro antibacterial and antioxidant activities and the in vivo wound healing performance of a noval exopolysaccharides (EPS-Ca 6 ) produced by Lactobacillus sp.Ca 6 strain. The results showed that EPS-Ca 6 had a potential antioxidant activity determined through four different assays: DPPH scavenging activity, reducing power, β-carotene bleaching by linoleic acid assay, and Metal chelating activities. It also exhibited significant antibacterial activity against pathogenic bacteria Salmonella enterica and Micrococcus luteus. The wound healing activity of the EPS-Ca 6 , using excision wound model in rats, showed that this novel EPS accelerated significantly wound healing activity as compared to the control group, and a total closure was achieved after 14days of wound induction. Furthermore, histological examination of biopsies showed fully re-epithelialized wound with a complete epidermal regeneration. Overall the finding indicates that the EPS-Ca 6 might be useful as a wound healing agent in modern medicine. Copyright © 2017 Elsevier B.V. All rights reserved.
Antifouling potentials of eight deep-sea-derived fungi from the South China Sea.
Zhang, Xiao-Yong; Xu, Xin-Ya; Peng, Jiang; Ma, Chun-Feng; Nong, Xu-Hua; Bao, Jie; Zhang, Guang-Zhao; Qi, Shu-Hua
2014-04-01
Marine-derived microbial secondary metabolites are promising potential sources of nontoxic antifouling agents. The search for environmentally friendly and low-toxic antifouling components guided us to investigate the antifouling potentials of eight novel fungal isolates from deep-sea sediments of the South China Sea. Sixteen crude ethyl acetate extracts of the eight fungal isolates showed distinct antibacterial activity against three marine bacteria (Loktanella hongkongensis UST950701-009, Micrococcus luteus UST950701-006 and Pseudoalteromonas piscida UST010620-005), or significant antilarval activity against larval settlement of bryozoan Bugula neritina. Furthermore, the extract of Aspergillus westerdijkiae DFFSCS013 displayed strong antifouling activity in a field trial lasting 4 months. By further bioassay-guided isolation, five antifouling alkaloids including brevianamide F, circumdatin F and L, notoamide C, and 5-chlorosclerotiamide were isolated from the extract of A. westerdijkiae DFFSCS013. This is the first report about the antifouling potentials of metabolites of the deep-sea-derived fungi from the South China Sea, and the first stage towards the development of non- or low-toxic antifouling agents from deep-sea-derived fungi.
Heterogeneous precipitation of silver nanoparticles on kaolinite plates
NASA Astrophysics Data System (ADS)
Cabal, B.; Torrecillas, R.; Malpartida, F.; Moya, J. S.
2010-11-01
Two different methods to obtain silver nanoparticles supported on kaolin crystals have been performed: the first one followed a thermal reduction and the second one a chemical reduction. In both cases, the silver nanoparticles with two different average particles size (ca.12 and 30 nm) were perfectly isolated and attached to the surface of the kaolin plates. The silver nanoparticles were localized mainly at the edge of the single crystal plates, the hydroxyl groups being the main centres of adsorption. The samples were fully characterized by XRD, UV-vis spectroscopy and TEM. The antimicrobial benefits of the composites were evaluated as antibacterial against common Gram-positive and Gram-negative bacteria, and antifungal activity against yeast. The results indicated a high antimicrobial activity for Escherichia coli JM 110 and Micrococcus luteus, while being inactive against yeast under our experimental conditions. The chemical analysis of Ag in the fermentation broths show that only a small portion of metal (<9 ppm) is released from the kaolin/metakaolin particles. Therefore, the risk of toxicity due to a high concentration of metal in the medium is minimized.
A novel method for single bacteria identification by Raman spectroscopy
NASA Astrophysics Data System (ADS)
Schultz, Emmanuelle; Simon, Anne-Catherine; Strola, Samy Andrea; Perenon, Rémi; Espagnon, Isabelle; Allier, Cédric; Claustre, Patricia; Jary, Dorothée.; Dinten, Jean-Marc
2014-03-01
In this paper we present results on single bacteria rapid identification obtained with a low-cost and compact Raman spectrometer. At present, we demonstrate that a 1 minute procedure, including the localization of single bacterium, is sufficient to acquire comprehensive Raman spectrum in the range of 600 to 3300 cm-1. Localization and detection of single bacteria is performed by means of lensfree imaging over a large field of view of 24 mm2. An excitation source of 532 nm and 30 mW illuminates single bacteria to collect Raman signal into a Tornado Spectral Systems prototype spectrometer (HTVS technology). The acquisition time to record a single bacterium spectrum is as low as 10 s owing to the high light throughput of this spectrometer. The spectra processing features different steps for cosmic spikes removal, background subtraction, and gain normalization to correct the residual inducted fluorescence and substrate fluctuations. This allows obtaining a fine chemical fingerprint analysis. We have recorded a total of 1200 spectra over 7 bacterial species (E. coli, Bacillus species, S. epidermis, M. luteus, S. marcescens). The analysis of this database results in a high classification score of almost 90 %. Hence we can conclude that our setup enables automatic recognition of bacteria species among 7 different species. The speed and the sensitivity (<30 minutes for localization and spectra collection of 30 single bacteria) of our Raman spectrometer pave the way for high-throughput and non-destructive real-time bacteria identification assays. This compact and low-cost technology can benefit biomedical, clinical diagnostic and environmental applications.
Diversity of pigmented Gram-positive bacteria associated with marine macroalgae from Antarctica.
Leiva, Sergio; Alvarado, Pamela; Huang, Ying; Wang, Jian; Garrido, Ignacio
2015-12-01
Little is known about the diversity and roles of Gram-positive and pigmented bacteria in Antarctic environments, especially those associated with marine macroorganisms. This work is the first study about the diversity and antimicrobial activity of culturable pigmented Gram-positive bacteria associated with marine Antarctic macroalgae. A total of 31 pigmented Gram-positive strains were isolated from the surface of six species of macroalgae collected in the King George Island, South Shetland Islands. On the basis of 16S rRNA gene sequence similarities ≥99%, 18 phylotypes were defined, which were clustered into 11 genera of Actinobacteria (Agrococcus, Arthrobacter, Brachybacterium, Citricoccus, Kocuria, Labedella, Microbacterium, Micrococcus, Rhodococcus, Salinibacterium and Sanguibacter) and one genus of the Firmicutes (Staphylococcus). It was found that five isolates displayed antimicrobial activity against a set of macroalgae-associated bacteria. The active isolates were phylogenetically related to Agrococcus baldri, Brachybacterium rhamnosum, Citricoccus zhacaiensis and Kocuria palustris. The results indicate that a diverse community of pigmented Gram-positive bacteria is associated with Antartic macroalgae and suggest its potential as a promising source of antimicrobial and pigmented natural compounds. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Immunological properties of Micrococcus lysodeikticus membranes.
Fukui, Y; Nachbar, M S; Salton, M R
1971-01-01
Membranes of Micrococcus lysodeikticus possess antigens which are distinct from other cellular components such as cytoplasm, ribosomes, and cell walls. Only a few (two to three) components are found when dissociated membranes are examined by immunodiffusion and immunoelectrophoresis techniques. Membranes treated with 0.3% sodium dodecyl sulfate, 0.3% Triton X-100, trypsin, phospholipase A or C, or by sonic oscillation at pH 9.0, all showed the same pattern (three major bands) when examined against membrane antisera by immunoelectrophoresis. Immunological analysis of fractions isolated by sucrose gradient centrifugation or by polyacrylamide gel electrophoresis suggests that individual components cross-react. Antibodies to adenosine triphosphatase (EC 3.6.1.3) and fast-moving component are not removed by absorption with protoplasts. Removal of antibody to one of the membrane antigens by protoplast absorption indicated a surface location. Glutaraldehyde fixation of protoplasts resulted in the loss of membrane antigens detectable by immunodiffusion.
Efficient biotransformation of herbicide diuron by bacterial strain Micrococcus sp. PS-1.
Sharma, Priyanka; Chopra, Adity; Cameotra, Swaranjit Singh; Suri, C Raman
2010-11-01
A Gram-positive, Micrococcus sp. strain PS-1 capable of utilizing phenylurea herbicide diuron as a sole carbon source at a high concentration (up to 250 ppm) was isolated from diuron storage site by selective enrichment study. The taxonomic characterization with 16S rRNA gene sequencing (1,477 bp) identified PS-1 as a member of Micrococcus sp. It was studied for the degradation of diuron and a range of its analogues (monuron, linuron, monolinuron, chlortoluron and fenuron). The shake flasks experiments demonstrated fast degradation of diuron (up to 96% at 250 ppm within 30 h incubation) with the addition of small quantity (0.01%) of non-ionic detergent. The relative degradation profile by the isolate was in the order of fenuron > monuron > diuron > linuron > monolinuron > chlortoluron. Further, the biochemical characterization of catabolic pathway by spectroscopic and chromatographic techniques demonstrated that the degradation proceeded via formation of dealkylated metabolites to form 3,4-dichloroaniline (3,4-DCA). It was the major metabolite formed, associated with profound increase in degradation kinetics in presence of appropriate additive.
Surface Microflora of Four Smear-Ripened Cheeses
Mounier, Jérôme; Gelsomino, Roberto; Goerges, Stefanie; Vancanneyt, Marc; Vandemeulebroecke, Katrien; Hoste, Bart; Scherer, Siegfried; Swings, Jean; Fitzgerald, Gerald F.; Cogan, Timothy M.
2005-01-01
The microbial composition of smear-ripened cheeses is not very clear. A total of 194 bacterial isolates and 187 yeast isolates from the surfaces of four Irish farmhouse smear-ripened cheeses were identified at the midpoint of ripening using pulsed-field gel electrophoresis (PFGE), repetitive sequence-based PCR, and 16S rRNA gene sequencing for identifying and typing the bacteria and Fourier transform infrared spectroscopy and mitochondrial DNA restriction fragment length polymorphism (mtDNA RFLP) analysis for identifying and typing the yeast. The yeast microflora was very uniform, and Debaryomyces hansenii was the dominant species in the four cheeses. Yarrowia lipolytica was also isolated in low numbers from one cheese. The bacteria were highly diverse, and 14 different species, Corynebacterium casei, Corynebacterium variabile, Arthrobacter arilaitensis, Arthrobacter sp., Microbacterium gubbeenense, Agrococcus sp. nov., Brevibacterium linens, Staphylococcus epidermidis, Staphylococcus equorum, Staphylococcus saprophyticus, Micrococcus luteus, Halomonas venusta, Vibrio sp., and Bacillus sp., were identified on the four cheeses. Each cheese had a more or less unique microflora with four to nine species on its surface. However, two bacteria, C. casei and A. arilaitensis, were found on each cheese. Diversity at the strain level was also observed, based on the different PFGE patterns and mtDNA RFLP profiles of the dominant bacterial and yeast species. None of the ripening cultures deliberately inoculated onto the surface were reisolated from the cheeses. This study confirms the importance of the adventitious, resident microflora in the ripening of smear cheeses. PMID:16269673
NASA Astrophysics Data System (ADS)
Gündüzalp, Ayla Balaban; Özsen, İffet; Alyar, Hamit; Alyar, Saliha; Özbek, Neslihan
2016-09-01
Schiff bases; 1,8-bis(thiophene-2-carboxaldimine)-p-menthane (L1) and 1,8-bis(furan-2-carboxaldimine)-p-menthane (L2) have been synthesized and characterized by elemental analysis, 1Hsbnd 13C NMR, UV-vis, FT-IR and LC-MS methods. 1H and 13C shielding tensors for L1 and L2 were calculated with GIAO/DFT/B3LYP/6-311++G(d,p) methods in CDCl3. The vibrational band assignments, nonlinear optical (NLO) activities, frontier molecular orbitals (FMOs) and absorption spectrum have been investigated by the same basis set. Schiff base-copper(II) complexes have been synthesized and structurally characterized with spectroscopic methods, magnetic and conductivity measurements. The spectroscopic data suggest that Schiff base ligands coordinate through azomethine-N and thiophene-S/furan-O donors (as SNNS and ONNO chelating systems) to give a tetragonal geometry around the copper(II) ions. Schiff bases and Cu(II) complexes have been screened for their biological activities on different species of pathogenic bacteria, those are, Gram positive bacteria: Bacillus subtitilus, Yersinia enterotica, Bacillus cereus, Listeria monocytogenes, Micrococcus luteus and Gram negative bacteria: Escherichia coli, Pseudomonas aeroginosa, Shigella dysenteriae, Salmonella typhi, Klebsiella pseudomonas by using microdilution technique (MIC values in mM). Biological activity results show that Cu(II) complexes have higher activities than parent ligands and metal chelation may affect significantly the antibacterial behavior of the organic ligands.
A lysozyme and magnetic bead based method of separating intact bacteria.
Diler, Ebru; Obst, Ursula; Schmitz, Katja; Schwartz, Thomas
2011-07-01
As a response to environmental stress, bacterial cells can enter a physiological state called viable but noncultivable (VBNC). In this state, bacteria fail to grow on routine bacteriological media. Consequently, standard methods of contamination detection based on bacteria cultivation fail. Although they are not growing, the cells are still alive and are able to reactivate their metabolism. The VBNC state and low bacterial densities are big challenges for cultivation-based pathogen detection in drinking water and the food industry, for example. In this context, a new molecular-biological separation method for bacteria using point-mutated lysozymes immobilised on magnetic beads for separating bacteria is described. The immobilised mutated lysozymes on magnetic beads serve as bait for the specific capture of bacteria from complex matrices or water due to their remaining affinity for bacterial cell wall components. Beads with bacteria can be separated using magnetic racks. To avoid bacterial cell lysis by the lysozymes, the protein was mutated at amino acid position 35, leading to the exchange of the catalytic glutamate for alanine (LysE35A) and glutamine (LysE35Q). As proved by turbidity assay with reference bacteria, the muramidase activity was knocked out. The mutated constructs were expressed by the yeast Pichia pastoris and secreted into expression medium. Protein enrichment and purification were carried out by SO(3)-functionalised nanoscale cationic exchanger particles. For a proof of principle, the proteins were biotinylated and immobilised on streptavidin-functionalised, fluorescence dye-labelled magnetic beads. These constructs were used for the successful capture of Syto9-marked Microccocus luteus cells from cell suspension, as visualised by fluorescence microscopy, which confirmed the success of the strategy.
Rubin, S J; Lyons, R W; Murcia, A J
1978-01-01
A gram-positive coccus, presently named Micrococcus mucilaginosus incertae sedis, was isolated from 14 blood cultures from a patient with endocarditis. The first positive blood culture was drawn 5 days after the patient underwent cardiac catheterization. PMID:670378
Antimicrobial activity of a nisin-activated plastic film for food packaging.
Mauriello, G; De Luca, E; La Storia, A; Villani, F; Ercolini, D
2005-01-01
To determine the effectiveness of a packaging film coated with nisin to inhibit Micrococcus luteus ATCC 10240 in tryptone soya broth (TSB) and the microbiota of raw milk during storage. A further aim was to examine the release of nisin from the activated film. An active package, obtained from nisin-treated film, was filled with 1 l of M. luteus ATCC 10240 (ML) suspension in TSB and stored at 4 and 25 degrees C for 2 days. After 24 h at 25 degrees C there was a remarkable reduction of M. luteus ATCC 10240 compared with the control, while at 4 degrees C a slight reduction was observed. Moreover, microbial growth was controlled when 1 l of three different kinds of milk was poured into the active package and stored at 4 degrees C for 7 days. The most significant results were observed in raw milk and pasteurized milk with a reduction of 0.9 log and 1.3 log, respectively. The release experiments showed that nisin release from the film was unpredictable, but it was favoured by low pH and high temperature. It appears that nisin-coated films were effective in inhibiting M. luteus ATCC 10240 in TSB and the bacterial flora in milk, and the release of nisin was pH and temperature dependent. Nisin-activated film may control bacterial growth, maintaining food quality, safety and extending the shelf-life of food products.
Djihane, Bouzid; Wafa, Nouioua; Elkhamssa, Soltani; Pedro, De Haro Juan; Maria, Angeles Esteban; Mohamed Mihoub, Zerroug
2017-07-01
The aerial parts of Helichrysum italicum (Roth) G. Don were subjected to hydrodistillation to obtain essential oils which had been analyzed by gas chromatography and gas chromatography coupled with mass spectrometry and tested for antimicrobial activity against 12 bacteria, two yeasts and four fungi by agar diffusion method. The essential oil yielded 0.44% (v/w) and 67 compounds accounting for 99.24% of the oil were identified with a high content of oxygenated sesquiterpenes (61.42%). The most oxygenated sesquiterpene compounds were α-Cedrene (13.61%), α-Curcumene (11.41%), Geranyl acetate (10.05%), Limonene (6.07%), Nerol (5.04%), Neryl acetate (4.91%) and α-Pinene (3.78%). The antimicrobial activity of the essential oil was assayed by using the disk diffusion method on Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, Micrococcus luteus ATCC 4698, Klebsiella pneumonia ATCC 4352, Enterococcus cereus ATCC 2035, Bacillus cereus ATCC 10876, Staphylococcus epidermidis ATCC 12228, Bacillus subtilis ATCC 9372, Pseudomonas aeruginosa ATCC 27853, Enterococcus faecalis ATCC 49452, Proteus mirabilis ATCC 35659, Listeria monocytogenes ATCC 15313 and yeasts Candida albicans ATCC 10231, Saccharomyces cerevisiae ATCC 9763 and fungi, Fusarium solani var. coeruleum , Aspergillus niger , Alternaria alternata , Ascochyta rabiei . H. italicum inhibited the growth of all the tested microorganisms except three bacteria, E. coli ATCC 25922, K. pneumonia ATCC 4352 and L. monocytogenes ATCC 15313. The most sensitive bacterium was E. cereus ATCC 2035 with minimum inhibitory and bactericidal concentrations of 0.79 μg ml -1 . A minimum fungistatic and fungicide concentration of 6.325 μg ml -1 and 12.65 μg ml -1 respectively was obtained with C. albicans ATCC 10231 and S. cerevisiae ATCC 9763. However the four fungi were more resistant with fungistatic minimum concentration ranging from 6.325 μg ml -1 to 50.6 μg ml -1 and a fungicide minimum concentration of 50
Biodegradation of cypermethrin by Micrococcus sp. strain CPN 1.
Tallur, Preeti N; Megadi, Veena B; Ninnekar, Harichandra Z
2008-02-01
A bacterium capable of utilizing pyrethroid pesticide cypermethrin as sole source of carbon was isolated from soil and identified as a Micrococcus sp. The organism also utilized fenvalerate, deltamethrin, perimethrin, 3-phenoxybenzoate, phenol, protocatechuate and catechol as growth substrates. The organism degraded cypermethrin by hydrolysis of ester linkage to yield 3-phenoxybenzoate, leading to loss of its insecticidal activity. 3-Phenoxybenzoate was further metabolized by diphenyl ether cleavage to yield protocatechuate and phenol as evidenced by isolation and identification of metabolites and enzyme activities in the cell-free extracts. Protocatechuate and phenol were oxidized by ortho-cleavage pathway. Thus, the organism was versatile in detoxification and complete mineralization of pyrethroid cypermethrin.
Extraction, purification and characterization of a protease from Micrococcus sp. VKMM 037.
Manikandan, Muthu; Kannan, Vijayaraghavan; Pasić, Lejla
2011-10-01
The haloalkaliphilic bacterium Micrococcus sp. VKMM 037, isolated from an effluent of the caustic soda industry, was found to produce a protease. Maximal proteolytic activity was observed in cell culture grown at 40 degrees C using 2% (w/v) glycerol, 2% (w/v) beef extract and 2% (w/v) peptone as nutrients in medium also containing 0.85 M NaCl with a pH of 10.0. An efficient purification procedure combining ammonium sulphate precipitation and Q-Sepharose ion-exchange chromatography was developed. The purified 41 kDa protease was stable in a temperature range between 20 degrees C and 60 degrees C. The protease remained active over a wide range of pH values (4.0-12.0) and NaCl concentrations (0-3.42 M) with an optimum at pH 10.0 and 0.85 M NaCl, respectively. Furthermore, the enzyme remained stable or was only marginally inhibited in the presence of various organic solvents, surfactants and reducing agents. The purified protease of Micrococcus sp. VKMM 037 efficiently removed blood stains within 40 minutes of treatment. Given the biochemical characteristics determined, this novel protease could be exploited as an additive in the detergent industry and also for the synthesis of biomolecules and the degradation of protein.
Zhang, Yue; Liu, Zhi-Rong; Chen, Hui; Fan, Ying-Chuan; Duo, Ji; Zheng, Hong; Wang, Guang-Jin; Li, Yu-Chan; Jiachu, Dan-Ba; Zewang, Ge-Ma
2013-01-01
AIM To compare the bacterial flora in palpebral conjunctiva of xerophthalmia seniors of Tibetan, Yi and Han, and analyze the differences and similarities of the bacteria. METHODS The test subjects were selected from 2 Tibetan, 2 Yi and 3 Han populated places, respectively. Total 222 seniors (444 eyes) with dry eye were examined. Secretion was collected from the palpebral conjunctiva of the subjects and then inoculated onto a blood agar plate. After 48h of incubation, the bacteria were examined for the differences and similarities between different ethnics. RESULTS There was no significant difference (P>0.05) of Gram stain characterization, dominant bacteria and number of the bacterial species present in oxrophthalmia patients among Tibetan, Yi and Han nationalities. The bacteria presented in all groups include staphylococcus epidermidis, corynebacterium, micrococcus luteu, intracellular bacteria sphingomonas, pseudomonas aeruginosa. The bacteria detected from the two of three ethnic groups were staphylococcus aureus, staphylococcus haemolyticus, escherichia coli, kytococcus sedentarius, streptococcus angina, micrococcus lylae, and staphylococcus heads. The incidence rate of bacteria-associated dry eye in Tibetan population was significantly lower than that of Han and Yi population. CONCLUSION There is no significant difference in the bacteria flora of palpebral conjunctiva observed among dry eye elder populations of Tibetan, Yi and Han people. All of staphylococcus epidermidis, corynebacterium, micrococcus luteu, intracellular bacteria sphingomonas, pseudomonas aeruginosa, staphylococcus aureus, staphylococcus haemolyticus, escherichia coli, kytococcus sedentarius, streptococcus angina, micrococcus lylae and staphylococcus heads are common bacteria flora of the three nationalities inhibiting in this area. PMID:23991377
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz
2008-07-01
Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less
NASA Astrophysics Data System (ADS)
Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur
2014-06-01
The present investigation deals with the facile synthesis and characterization of chitosan (CTS)-based zinc oxide (ZnO) nanoparticles (NPs) and their antimicrobial activities against pathogenic microorganisms. ZnO-CTS NPs were synthesized through two different methods: nano spray drying and precipitation, using various organic compounds (citric acid, glycerol, starch and whey powder) as stabilizers. Both the synthesis methods were simple and were devoid of any chemical usage. The detailed characterization of the NPs was carried out using UV-Vis spectroscopy, dynamic light scattering particle size analysis, zeta potential measurements and scanning electron microscopy, which confirmed the fabrication of NPs with different shapes and sizes. Antimicrobial assay of synthesized ZnO-CTS NPs was carried out against different pathogenic microbial strains ( Candida albicans, Micrococcus luteus and Staphylococcus aureus). The significant ( p < 0.05) inhibition of growth was observed for both M. luteus and S. aureus with ZnO-CTS NPs (with a concentration ranging from 0.625 to 0.156 mg/ml) as compared to control treatment. ZnO-CTS NPs also showed significant biofilm inhibition activity ( p < 0.05) against M. luteus and S. aureus. The study demonstrated the potential of ZnO-CTS NPs as antimicrobial and antibiofilm agents.
Celik, Ali; Nur Herken, E; Arslan, Idris; Zafer Ozel, M; Mercan, Nazime
2010-10-01
The chemical compositions, total phenol content, antioxidant and antimicrobial activities with oxidant status of the essential oil from an endemic Turkish species, Origanum hypericifolium, were investigated. Steam distillation (SD) was used to isolate the essential oils, and the chemical analyses were performed by gas chromatography-mass spectrometry (GC-MS). The antimicrobial activity was tested by agar disc diffusion method against Morganella morganii (clinic isolate), Micrococcus flavus (clinic isolate), Micrococcus luteus NRLL B-4375, Proteus vulgaris RSKK 96026, Escherichia coli ATCC 11230, Escherichia coli ATCC 25922, Yersinia enterecolitica RSKK 1501, Staphylococcus aureus ATCC 25923, S. aureus ATCC 25933, S. aureus ATCC 12598, S. aureus (clinic isolate), MRSA 1 (clinic isolate), MRSA 2 (clinic isolate), MRSA 3 (clinic isolate) and MRSA 4 (clinic isolate). The major compounds found in volatiles of O. hypericifolium were p-cymene, carvacrol and γ-terpinene. Results showed that O. hypericifolium has the potential for being used in food and medicine because of its antioxidant and antibacterial activity.
Hatew, Bayissa; Delessa, Tenagne; Zakin, Vered; Gollop, Natan
2011-10-01
Chicken intestine harbors a vast number of bacterial strains. In the present study, antimicrobial substance produced by lactic acid bacteria (LAB) isolated from the gastrointestinal tract of healthy chicken was detected, characterized, and purified. Based on 16S rRNA sequencing, the bacteria were identified as Lactobacillus plantarum vN. The antimicrobial substance produced by this bacterium was designated vN-1 and exhibited a broad-spectrum of activity against many important pathogenic and spoilage microorganisms, including Pseudomonas aeruginosa, Staphylococcus aureus, Micrococcus luteus, Salmonella Typhimurium, and Erwinia amylovova. vN-1 was determined to be thermostable, insensitive to pH values ranging from 2.0 to 8.0, resistant to various organic solvents and to enzymatic inactivation. The inhibition kinetics displayed a bactericidal mode of action. This study revealed an antimicrobial substance with low molecular mass of less than 1 kDa as determined by ultrafiltration and having features not previously reported for LAB isolated from chicken intestines. The detection of this antimicrobial substance addresses an important aspect of biotechnological control agents of spoilage caused by Pseudomonas spp. and promises the possibility for preservation of refrigerated poultry meat. Practical Application: The newly characterized antimicrobial substance and designated as vN-1 may have the potential to be used in food preservation. © 2011 Institute of Food Technologists®
Ghehdarijani, Mahbubeh Salmanian; Hajimoradloo, Abdolmajid; Ghorbani, Rasol; Roohi, Zahra
2016-02-01
This study was conducted to evaluate the effects of garlic supplementation on some skin mucus immune parameters, mucus antimicrobial activity and growth performance of the Caspian roach (Rutilus rutilus caspicus) fry. Fish (1 ± 0.07 g) were divided into four groups fed diets containing 0 (control), 5, 10 and 15 g kg(-1) garlic for 8 weeks. The results showed that there was a significant increase in weight gain and specific growth rate in those fish fed garlic diets compared with the control (P < 0.05). Condition factor was not significantly affected by garlic dosage. At the end of trial, the epidermal mucus protein level, alkaline phosphatase and antimicrobial activity against 2 g-negative bacteria (Escherichia coli and Serratia marcescens) and gram-positive bacteria (Streptococcus faecium and Micrococcus luteus) were measured. Skin mucus alkaline phosphatase, protein levels and antimicrobial activity were increased following garlic administration, and the bacterial growth inhibition zones were significantly elevated in garlic-fed fish (P < 0.05). In salinity stress experiment, no differences were observed for survival rate among the experimental diets. No mortality was recorded during the feeding trial. These results indicated that dietary garlic beneficially affects the skin mucus immune parameters and growth performance of the Caspian roach fry. Copyright © 2015 Elsevier Ltd. All rights reserved.
Shaffer, Harry L; Harnish, Delbert A; McDonald, Michael; Vernon, Reid A; Heimbuch, Brian K
2015-12-01
Sterilized packaging systems are designed to maintain the sterility of surgical instruments and devices from the time of sterilization until use. This study evaluated the effectiveness of rigid containers versus wrapped instrument trays, sterilized using North American sterilization protocols, to maintain a sterile internal environment poststerilization when challenged with aerosolized bacteria under dynamic environmental conditions. Using a custom aerosol chamber, 111 rigid containers of various durations of use (unused, used <5 years, used 5-9 years) and 161 wrapped trays using 3 grades of sterilization wrap were challenged with ~10(2) colony-forming units per liter of air containing aerosolized Micrococcus luteus with a count median particle size of 1 μm, while simultaneously experiencing air volume exchanges due to vacuum cycles-two 1-psi cycles, three 0.7-psi cycles, and three 0.4-psi cycles-to simulate air exchange events occurring during the sterilization, transportation, and storage of sterilized instrument trays in health care facilities. Of 111 rigid containers tested, 97 (87%) demonstrated bacterial ingress into the container. Of 161 wrapped trays, 0 (0%) demonstrated bacterial ingress into the tray. Contamination rates of rigid containers increased significantly with increasing duration of use. In this study using a dynamic bacterial aerosol challenge, sterilized wrapped trays demonstrated significantly greater protection than sterilized rigid containers against the ingress of airborne bacteria. Copyright © 2015. Published by Elsevier Inc.
NASA Astrophysics Data System (ADS)
Łączkowski, Krzysztof Z.; Motylewska, Katarzyna; Baranowska-Łączkowska, Angelika; Biernasiuk, Anna; Misiura, Konrad; Malm, Anna; Fernández, Berta
2016-03-01
Synthesis and investigation of antimicrobial activities of novel thiazoles and selenazoles is presented. Their structures were determined using NMR, FAB(+)-MS, HRMS and elemental analyses. To support the experiment, theoretical calculations of the 1H NMR shifts were carried out for representative systems within the DFT B3LYP/6-311++G** approximation which additionally confirmed the structure of investigated compounds. Among the derivatives, compounds 4b, 4h, 4j and 4l had very strong activity against reference strains of Candida albicans ATCC and Candida parapsilosis ATCC 22019 with MIC = 0.49-7.81 μg/ml. In the case of compounds 4b, 4c, 4h - 4j and 4l, the activity was very strong against of Candida spp. isolated from clinical materials, i.e. C. albicans, Candida krusei, Candida inconspicua, Candida famata, Candida lusitaniae, Candida sake, C. parapsilosis and Candida dubliniensis with MIC = 0.24-15.62 μg/ml. The activity of several of these was similar to the activity of commonly used antifungal agent fluconazole. Additionally, compounds 4m - 4s were found to be active against Gram-positive bacteria, both pathogenic staphylococci Staphylococcus aureus ATCC with MIC = 31.25-125 μg/ml and opportunistic bacteria, such as Staphylococcus epidermidis ATCC 12228 and Micrococcus luteus ATCC 10240 with MIC = 7.81-31.25 μg/ml.
Characterization of microbial contamination in United States Air Force aviation fuel tanks.
Rauch, Michelle E; Graef, Harold W; Rozenzhak, Sophie M; Jones, Sharon E; Bleckmann, Charles A; Kruger, Randell L; Naik, Rajesh R; Stone, Morley O
2006-01-01
Bacteria and fungi, isolated from United States Air Force (USAF) aviation fuel samples, were identified by gas chromatograph fatty acid methyl ester (GC-FAME) profiling and 16S or 18S rRNA gene sequencing. Thirty-six samples from 11 geographically separated USAF bases were collected. At each base, an above-ground storage tank, a refueling truck, and an aircraft wing tank were sampled at the lowest sample point, or sump, to investigate microbial diversity and dispersion within the fuel distribution chain. Twelve genera, including four Bacillus species and two Staphylococcus species, were isolated and identified. Bacillus licheniformis, the most prevalent organism isolated, was found at seven of the 11 bases. Of the organisms identified, Bacillus sp., Micrococcus luteus, Sphinogmonas sp., Staphylococcus sp., and the fungus Aureobasidium pullulans have previously been isolated from aviation fuel samples. The bacteria Pantoea ananatis, Arthrobacter sp., Alcaligenes sp., Kocuria rhizophilia, Leucobacter komagatae, Dietza sp., and the fungus Discophaerina fagi have not been previously reported in USAF aviation fuel. Only at two bases were the same organisms isolated from all three sample points in the fuel supply distribution chain. Isolation of previously undocumented organisms suggests either, changes in aviation fuel microbial community in response to changes in aviation fuel composition, additives and biocide use, or simply, improvements in isolation and identification techniques.
Pathogenic bacteria carried by companion animals and their susceptibility to antibacterial agents.
Buma, Ryoko; Maeda, Takuya; Kamei, Masaharu; Kourai, Hiroki
2006-03-01
Results of the investigation showed that there was a difference in the bacteria isolated from dogs, cats and their living environment. The number and species isolated from the hair and front paw samples from dogs kept outdoors and from cats were greater and more varied than those from the samples from dogs kept indoors. Staphylococcus, Micrococcus and Bacillus were frequently detected from skin surfaces. On the other hand, Escherichia, Pseudomonas, Proteus and others were detected on each sampling area on dogs kept outdoors and on cats. About 60% of the bacteria commonly causes infectious diseases and carries a risk of food poisoning. Moreover, Pasteurella multocida, which causes pasteurellasis, a kind of zoonosis, was isolated from dogs and cats. These pathogenic bacteria were transmitted from animals to humans by direct contact. This result suggests that direct contact with dogs and cats and contact with aerosols can possibly transmit infectious diseases. Most of the isolates (75.9%, 60/79) were resistant to antibacterial agents. We then investigated the effect of household detergents and pet care deodorant sprays containing antibacterial agents on isolates from dogs and cats. They were effective in preventing the transmission of pathogens from dogs and cats to humans.
Martin, Guillaume E.; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader
2014-01-01
Background and Aims To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the ‘inverted repeat-lacking clade’, IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. Methods The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. Key Results The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip–flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. Conclusions This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and
Enhanced degradation of 2-nitrotoluene by immobilized cells of Micrococcus sp. strain SMN-1.
Mulla, Sikandar I; Talwar, Manjunatha P; Bagewadi, Zabin K; Hoskeri, Robertcyril S; Ninnekar, Harichandra Z
2013-02-01
Nitrotoluenes are the toxic pollutants of the environment because of their large scale use in the production of explosives. Biodegradation of such chemicals by microorganisms may provide an effective method for their detoxification. We have studied the degradation of 2-nitrotoluene by cells of Micrococcus sp. strain SMN-1 immobilized in various matrices such as polyurethane foam (PUF), sodium alginate (SA), sodium alginate-polyvinyl alcohol (SA-PVA), agar and polyacrylamide. The rate of degradation of 15 and 30 mM 2-nitrotoluene by freely suspended cells and immobilized cells in batches and fed-batch with shaken cultures were compared. The PUF-immobilized cells achieved higher degradation of 15 and 30 mM 2-nitrotoluene than freely suspended cells and the cells immobilized in SA-PVA, polyacrylamide, SA and agar. The PUF-immobilized cells could be reused more than 24 cycles without loosing their degradation capacity and showed more tolerance to pH and temperature changes than freely suspended cells. These results revealed the enhanced rate of degradation of 2-nitrotoluene by PUF-immobilized cells of Micrococcus sp. strain SMN-1. Copyright © 2012 Elsevier Ltd. All rights reserved.
Addis, E; Fleet, G H; Cox, J M; Kolak, D; Leung, T
2001-09-19
The growth of yeasts and bacteria were monitored during the maturation of Camembert and blue-veined cheese produced in Australia. Yeasts were prominent throughout maturation, growing to 10(5)-10(9)/g, depending on the manufacturer. Debaryomyces hansenii predominated, but there were lesser, inconsistent contributions from Yarrowia lipolytica. Of the non-lactic acid bacteria, Acinetobacter species were significant during the maturation of Camembert but not blue-veined cheeses, and grew to 10(6)-10(8) cfu/g. Staphylococcus and Micrococcus species were consistently isolated from the cheeses with Staphylococcus xylosus growing to 10(5)-10(9) cfu/g, depending on the product. Lactic acid bacteria (10(7)-10(9) cfu/g) were present throughout maturation but were not identified. Interactions between the various yeasts and bacterial isolates were examined. Several strains of D. hansenii exhibited killer activity but not against Y. lipolytica. None of the yeasts were antagonistic towards the bacteria but some strains of D. hansenii enhanced the growth of Y. lipolytica and S. xylosus. The yeast and bacterial isolates exhibited various degrees of extracellular proteolytic and lipolytic activities.
Vital, Pierangeli G; Rivera, Windell L
2011-10-01
To determine the antibacterial, antifungal, antiprotozoal, cytotoxic, and phytochemical properties of ethanol extracts of leaves of Voacanga globosa (Blanco) Merr. (V. globosa). The extracts were tested against bacteria and fungus through disc diffusion assay; against protozoa through growth curve determination, antiprotozoal and cytotoxicity assays. The extract revealed antibacterial activities, inhibiting the growth of Staphylococcus aureus, Bacillus cereus, Pseudomonas aeruginosa, Micrococcus luteus, and Salmonella typhimurium. Antifungal assay showed that it inhibited Candida albicans. The antiprotozoal assay against Trichomonas vaginalis and Entamoeba histolytica showed that V. globosa can inhibit the parasites, wherein the action can be comparable to metronidazole. With the in situ cell death detection kit, Trichomonas vaginalis and Entamoeba histolytica exposed to V. globosa leaf extract was observed to fluoresce simultaneously in red and yellow signals signifying apoptotic-like changes. Preliminary phytochemical screening revealed the chemical composition of plant extract containing alkaloids, saponins, 2-deoxysugars, and hydrolysable tannins. Thus, this study provides scientific evidence on the traditional use of V. globosa leaf extract in treating microbial diseases. Further, the leaf extract can possibly be used to produce alternative forms of antimicrobials. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
Pal, Gargi; Srivastava, Sheela
2014-02-01
Plantaricin gene-specific primers were used to obtain plnE, -F, -J and -K structural gene amplicons from soil metagenome. These amplicons were cloned and expressed in pET32a (+) vector in Escherichia coli BL21 (DE3). PlnE, -F, -J and -K peptides were expressed as His-tagged-fusion proteins and were separated by Ni(2+) -chelating affinity chromatography. The peptides were released from the fusion by enterokinase cleavage and separated from the carrier thioredoxin. The cleaved peptides were further analysed for antimicrobial activity and found to be active against Listeria innocua NRRL B33314, Micrococcus luteus MTCC 106 and lactic acid bacteria, such as Enterococcus casseliflavus NRRL B3502, Lactococcus lactis lactis NRRL 1821, Lactobacillus curvatus NRRL B4562 and Lactobacillus plantarum NRRL B4496. E. coli has been successfully exploited as a host for heterologous expression with a significant yield of fused and cleaved peptides in the range of 8-12 and 1-1.5 mg/l of the culture, respectively. Heterologous expression, therefore, can be used to overcome the constraints of low yield often reported from a native strain.
Keivanloo, Ali; Besharati-Seidani, Tayebeh; Kaboudin, Babak; Yoshida, Akihiro; Yokomatsu, Tsutomu
2018-06-16
Synthesis of 2,3-disubstituted 1-alkylpyrrolo[2,3-b]quinoxalines was accomplished through the reaction of 3-chloroquinoxalin-2-amines with internal alkynes in the presence of Pd(OAc)[Formula: see text], NaOAc, and KOtBu in DMSO. This method afforded desired pyrrolo[2,3-b]quinoxalines in 65-92% reaction yields. The minimum inhibition concentration and minimum bactericidal concentration determinations against Micrococcus luteus and Pseudomonas aeruginosa revealed that some of the synthesized compounds showed the same values compared to tetracycline. These compounds could be used in the future research for the development of new antibiotics.
Application of Lactic Acid Bacteria (LAB) in freshness keeping of tilapia fillets as sashimi
NASA Astrophysics Data System (ADS)
Cao, Rong; Liu, Qi; Chen, Shengjun; Yang, Xianqing; Li, Laihao
2015-08-01
Aquatic products are extremely perishable food commodities. Developing methods to keep the freshness of fish represents a major task of the fishery processing industry. Application of Lactic Acid Bacteria (LAB) as food preservative is a novel approach. In the present study, the possibility of using lactic acid bacteria in freshness keeping of tilapia fillets as sashimi was examined. Fish fillets were dipped in Lactobacillus plantarum 1.19 (obtained from China General Microbiological Culture Collection Center) suspension as LAB-treated group. Changes in K-value, APC, sensory properties and microbial flora were analyzed. Results showed that LAB treatment slowed the increase of K-value and APC in the earlier storage, and caused a smooth decrease in sensory score. Gram-negative bacteria dominated during refrigerated storage, with Pseudomonas and Aeromonas being relatively abundant. Lactobacillus plantarum 1.19 had no obvious inhibitory effect against these Gram-negatives. However, Lactobacillus plantarum 1.19 changed the composition of Gram-positive bacteria. No Micrococcus were detected and the proportion of Staphylococcus decreased in the spoiled LAB-treated samples. The period that tilapia fillets could be used as sashimi material extended from 24 h to 48 h after LAB treatment. The potential of using LAB in sashimi processing was confirmed.
Microbiological characteristics of "androlla", a Spanish traditional pork sausage.
García Fontán, María C; Lorenzo, José M; Parada, Ana; Franco, Inmaculada; Carballo, Javier
2007-02-01
Counts of total aerobic mesophilic microflora, lactic acid bacteria, salt-tolerant microflora, Enterobacteriaceae, enterococci, moulds and yeasts, and staphylococci, and some physico-chemical parameters (total solids, NaCl and nitrate contents and pH and aw values) were determined in 20 units of "androlla", a traditional dry-fermented sausage made in the NW of Spain. In general, high counts of all the investigated microbial groups were observed, with average values of 8.99 +/- 0.46 log cfu/g for the total aerobic mesophilic microflora, 9.11 +/- 0.16 log cfu/g for the lactic acid bacteria, 6.87 +/- 0.68 log cfu/g for the salt-tolerant microflora, 2.80+/-1.85 log cfu/g for the Enterobacteriaceae, 3.25 +/- 1.86 log cfu/g for the enterococci, 4.30 +/- 1.73 log cfu/g for the moulds and yeasts, and 3.62 +/- 0.60 log cfu/g for the staphylococci. From MRS agar, SPC agar + 7.5% NaCl, VRBG agar, and KAA agar, 10 colonies were randomly taken from each androlla unit and from each culture medium. A total of 200 strains per culture medium were then identified using the classical methods. Among the isolates from MRS agar, Lactobacillus sakei predominated, followed by Lactobacillus curvatus, Lactobacillus alimentarius and Lactobacillus plantarum. Of the 200 isolates obtained from SPC agar + 7.5% NaCl, only 56 strains belonged to the Staphylococcaceae or Micrococcaceae families. Among the Staphylococcaceae, Staphylococcus xylosus was the main species, followed by Staph. epidermidis; Staph. equorum, Staph. capitis and Staph. saprophyticus were isolated in very low proportions. Among the Micrococcaceae, Micrococcus luteus predominated, followed by Micrococcus lylae, Kocuria varians and Kocuria kristinae. Of the 150 isolates obtained from VRBG agar, Hafnia alvei was the main species, followed by Serratia liquefaciens and Enterobacter amnigenus; six isolates were identified as Salmonella. Among the 190 isolates obtained from KAA agar, 122 were considered enterococci; 20 isolates were
Proteomic characterization of seeds from yellow lupin (Lupinus luteus L.).
Ogura, Takahiro; Ogihara, Jun; Sunairi, Michio; Takeishi, Hidetaka; Aizawa, Tomoko; Olivos-Trujillo, Marcos R; Maureira-Butler, Iván J; Salvo-Garrido, Haroldo E
2014-06-01
Yellow lupin (Lupinus luteus L.) is a legume crop containing a large amount of protein in its seeds. In this study, we constructed a seed-protein catalog to provide a foundation for further study of the seeds. A total of 736 proteins were identified in 341 2DE spots by nano-LC-MS/MS. Eight storage proteins were found as multiple spots in the 2DE gels. The 736 proteins correspond to 152 unique proteins as shown by UniRef50 clustering. Sixty-seven of the 152 proteins were associated with KEGG-defined pathways. Of the remaining proteins, 57 were classified according to a GO term. The functions of the remaining 28 proteins have yet to be determined. This is the first yellow lupin seed-protein catalog, and it contains considerably more data than previously reported for white lupin (L. albus L.). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Musco, N; Cutrignelli, M I; Calabrò, S; Tudisco, R; Infascelli, F; Grazioli, R; Lo Presti, V; Gresta, F; Chiofalo, B
2017-12-01
In order to promote the use of lupin in pig nutrition, in this research the nutritional characteristics (i.e. dietary fibre, alkaloid and fatty acid profile) and the in vitro gas production of 12 lupin varieties grown in the Mediterranean basin and belonging to three lupin species (Lupinus albus, Lupinus angustifolius and Lupinus luteus) were assessed. Four varieties of L. albus (Asfer, Lublanc, Lutteur and Multitalia) were grown in South Campania. Three varieties of L. luteus (Dukat, Mister and Taper), three of L. angustifolius (Jindalee, Sonet and Wonga) and two of L. albus (Rosetta and Luxor) were grown in Eastern Sicily. Lupinus albus varieties showed interesting nutritional and dietetic characteristics (i.e. high protein and low fibre content); the lipid fraction, rather elevated, is well represented by monounsaturated fatty acids (544 g/kg), whereas saturated fatty acids (SFAs) are less represented (167 g/kg) and the n-3/n-6 ratio (0.510) is the most favourable. Lupinus luteus varieties presented the most remarkable dietetic aspects, in terms of polyunsaturated fatty acid (PUFA) content (569 g/kg), n-6 PUFA series (490 g/kg), UFA/SFA (5.24) and PUFA/SFA (3.56) ratios and atherogenic (0.059) and thrombogenic (0.100) indices and very low alkaloid content (1.07 mg per 100 g). Lupinus angustifolius varieties showed the least interesting nutritional and dietetic characteristics: low protein and fat content, high fibre level, high SFA amount (248 g/kg) and the lowest favourable nutritional indices (IA: 0.164 and IT: 0.334). Regarding the fermentation process, in L. albus, the tendency to increase the rate of gas production during the early stages of fermentation suggests that the high presence of alkaloids did not affect the in vitro degradability, production of short-chain fatty acids and fermentation process, probably due to their concentration and/or water solubility. Lupinus angustifolius and L. luteus showed intermediate and slightly worse in
Lehman, R Michael; Rosentrater, Kurt A
2007-09-01
Distillers grains are coproduced with ethanol and carbon dioxide during the production of fuel ethanol from the dry milling and fermentation of corn grain, yet there is little basic microbiological information on these materials. We undertook a replicated field study of the microbiology of distillers wet grains (DWG) over a 9 day period following their production at an industrial fuel ethanol plant. Freshly produced DWG had a pH of about 4.4, a moisture content of about 53.5% (wet mass basis), and 4 x 10(5) total yeast cells/g dry mass, of which about 0.1% were viable. Total bacterial cells were initially below detection limits (ca. 10(6) cells/g dry mass) and then were estimated to be approximately 5 x 10(7) cells/g dry mass during the first 4 days following production. Culturable aerobic heterotrophic organisms (fungi plus bacteria) ranged between 10(4) and 10(5) CFU/g dry mass during the initial 4 day period, and lactic acid bacteria increased from 36 to 10(3) CFU/g dry mass over this same period. At 9 days, total viable bacteria and yeasts and (or) molds topped 10(8) CFU/g dry mass and lactic acid bacteria approached 10(6) CFU/g dry mass. Community phospholipid fatty acid analysis indicated a stable microbial community over the first 4 days of storage. Thirteen morphologically distinct isolates were recovered, of which 10 were yeasts and molds from 6 different genera, 2 were strains of the lactic-acid-producing Pediococcus pentosaceus and only one was an aerobic heterotrophic bacteria, Micrococcus luteus. The microbiology of DWG is fundamental to the assessment of spoilage, deleterious effects (e.g., toxins), or beneficial effects (e.g., probiotics) in its use as feed or in alternative applications.
Wu, Shifen; Nie, Yao; Zeng, Xian-Chun; Cao, Hanjun; Zhang, Lei; Zhou, Lingli; Yang, Ye; Luo, Xuesong; Liu, Yichen
2014-03-01
Three new cysteine-free venom peptides, which are referred to as Heterin-1, Heterin-2 and Spiniferin, respectively, were identified from the scorpion Heterometrus spinifer. Heterin-1, Heterin-2 and Spiniferin contain 43, 24 and 13 amino acid residues, respectively. Genomic analysis showed that the genomic organizations of the three peptides are consistent with those of the known Na(+), K(+) or Cl(-)-channel specific toxins from scorpions; this suggests that the genes of the cysteine-free and cysteine-rich peptides from scorpions were derived from a common ancestor. Antimicrobial assay demonstrated that Heterin-1 possesses potent activities against both Gram-positive and Gram-negative bacteria. Among the tested bacterial species, Heterin-1 is the most active against Bacillus megaterium and Micrococcus luteus with MICs of 4.0 μM and 4.0 μM, respectively. Heterin-2 is able to potently inhibit the growth of Gram-positive bacteria with MICs from 5.6 μM to 30.0 μM; however, it has weaker activities against the tested Gram-negative bacteria. It is interesting to see that deletion of the C-terminal random coiled tail (KKD) in Heterin-2 markedly changed the antimicrobial specificity and activity of the peptide. Spiniferin has very weak antimicrobial activities against both Gram-positive and Gram-negative bacteria. We found that introducing three net charges into the polar face of Spiniferin significantly increased its antimicrobial activity against the majority of the tested bacteria; however, in some instances, net charge on the polar face is not important for the antimicrobial activity of the peptide. These studies have expanded our understanding of the diversity, evolution and structure/function relationships of the cysteine-free peptides from scorpions. Copyright © 2013 Elsevier Inc. All rights reserved.
Martin, Guillaume E; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader
2014-06-01
To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the 'inverted repeat-lacking clade', IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip-flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and potentially informative regions for molecular
Antibacterial potential of Calotropis procera (flower) extract against various pathogens.
Ali, Abid; Ansari, Asma; Qader, Shah Ali Ul; Mumtaz, Majid; Saied, Sumayya; Mahboob, Tabassum
2014-09-01
Increased bacterial resistance towards commonly used antibiotics has become a debated issue all over the world in a last few decades. Due to this, consumer demand towards natural anti-microbial agents is increasing day by day. Natural anti-microbial agents have gained enormous attention as an alternative therapeutic agent in pharmaceutical industry. Current study is an effort to explore and identify a bactericidal potential of various solvent extracts of Calotropis procera flower. Flowers of C. procera were extracted with hexane, butanol, ethyl acetate and aqua to evaluate the antibacterial activity by agar well diffusion method against the various human pathogens. The microorganisms used in this study includes Salmonella typhi, Escherichia coli (O157:H7), Micrococcus luteus KIBGE-IB20 (Gen Bank accession: JQ250612) and methicillin resistant Staphylococcus aureus (MRSA) KIBGE-IB23 (Gen Bank accession: KC465400). Zones of inhibition were observed against all four pathogenic strains. Fraction soluble in hexane showed broad spectrum of inhibition against all the studied pathogens. However, fractions soluble in ethyl acetate inhibited the growth of E. coli, MRSA, and M. luteus. In case of butanol and aqueous extracts only growth of M. luteus was inhibited. Results revealed that the flower extracts of C. procera have a potential to be used as an antibacterial agent against these pathogenic organisms.
Pöppel, Anne-Kathrin; Vogel, Heiko; Wiesner, Jochen; Vilcinskas, Andreas
2015-05-01
The larvae of the common green bottle fly (Lucilia sericata) produce antibacterial secretions that have a therapeutic effect on chronic and nonhealing wounds. Recent developments in insect biotechnology have made it possible to use these larvae as a source of novel anti-infectives. Here, we report the application of next-generation RNA sequencing (RNA-Seq) to characterize the transcriptomes of the larval glands, crop, and gut, which contribute to the synthesis of antimicrobial peptides (AMPs) and proteins secreted into wounds. Our data confirm that L. sericata larvae have adapted in order to colonize microbially contaminated habitats, such as carrion and necrotic wounds, and are protected against infection by a diverse spectrum of AMPs. L. sericata AMPs include not only lucifensin and lucimycin but also novel attacins, cecropins, diptericins, proline-rich peptides, and sarcotoxins. We identified 47 genes encoding putative AMPs and produced 23 as synthetic analogs, among which some displayed activities against a broad spectrum of microbial pathogens, including Pseudomonas aeruginosa, Proteus vulgaris, and Enterococcus faecalis. Against Escherichia coli (Gram negative) and Micrococcus luteus (Gram positive), we found mostly additive effects but also synergistic activity when selected AMPs were tested in combination. The AMPs that are easy to synthesize are currently being produced in bulk to allow their evaluation as novel anti-infectives that can be formulated in hydrogels to produce therapeutic wound dressings and adhesive bandages. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Bacteria Present in Comadia redtenbacheri Larvae (Lepidoptera: Cossidae).
Hernández-Flores, L; Llanderal-Cázares, C; Guzmán-Franco, A W; Aranda-Ocampo, S
2015-09-01
The external and internal culturable bacterial community present in the larvae of Comadia redtenbacheri Hammerschmidt, an edible insect, was studied. Characterization of the isolates determined the existence of 18 morphotypes and phylogenetic analysis of the 16S rRNA gene revealed the existence of Paenibacillus sp., Bacillus safensis, Pseudomonas sp., Bacillus pseudomycoides, Corynebacterium variabile, Enterococcus sp., Gordonia sp., Acinetobacter calcoaceticus, Arthrobacter sp., Micrococcus sp., and Bacillus cereus. Greater diversity of bacteria was found in those larvae obtained from vendors than in those directly taken from Agave plants in nature. Many of the larvae obtained from vendors presented signs of potential disease, and after the analysis, results showed a greater bacterial community compared with the larvae with a healthy appearance. This indicates that bacterial flora can vary in accordance with how the larvae are handled during extraction, collection, and transport. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Halovarius luteus gen. nov., sp. nov., an extremely halophilic archaeon from a salt lake.
Mehrshad, Maliheh; Amoozegar, Mohammad Ali; Makhdoumi, Ali; Rasooli, Mehrnoosh; Asadi, Basaer; Schumann, Peter; Ventosa, Antonio
2015-08-01
An extremely halophilic archaeon, strain DA50T, was isolated from a brine sample of Urmia lake, a hypersaline environment in north-west Iran. Strain DA50T was orange-pigmented, motile, pleomorphic and required at least 2.5 M NaCl but not MgCl2 for growth. Optimal growth was achieved at 4.0 M NaCl and 0.3 M MgCl2. The optimum pH and temperature for growth were pH 7.0 and 45 °C, while it was able to grow over a pH range of 6.5-8.0 and a temperature range of 25-50 °C. Analysis of 16S rRNA gene sequences revealed that strain DA50T is a member of the family Halobacteriaceae, showing a low level of similarity with other members of this family. Highest similarities, 94.4, 94.0 and 93.9 %, were obtained with the 16S rRNA gene sequences of the type strains of Natrialba aegyptia, Halobiforma lacisalsi and Halovivax asiaticus, respectively. Polar lipid analyses revealed that strain DA50T contains phosphatidylglycerol and phosphatidylglycerol phosphate methyl ester. Four unidentified glycolipids and two minor phospholipids were also observed. The only quinone present was MK-8(II-H2). The G+C content of its DNA was 62.3 mol%. On the basis of the data obtained, the new isolate could not be classified in any recognized genus. Strain DA50T is thus considered to represent a novel species of a new genus within the family Halobacteriaceae, order Halobacteriales, for which the name Halovarius luteus gen. nov., sp. nov. is proposed. The type strain of Halovarius luteus is DA50T ( = IBRC-M 10912T = CECT 8510T).
Etienne, O; Picart, C; Taddei, C; Haikel, Y; Dimarcq, J L; Schaaf, P; Voegel, J C; Ogier, J A; Egles, C
2004-10-01
Infection of implanted materials by bacteria constitutes one of the most serious complications following prosthetic surgery. In the present study, we developed a new strategy based on the insertion of an antimicrobial peptide (defensin from Anopheles gambiae mosquitoes) into polyelectrolyte multilayer films built by the alternate deposition of polyanions and polycations. Quartz crystal microbalance and streaming potential measurements were used to follow step by step the construction of the multilayer films and embedding of the defensin within the films. Antimicrobial assays were performed with two strains: Micrococcus luteus (a gram-positive bacterium) and Escherichia coli D22 (a gram-negative bacterium). The inhibition of E. coli D22 growth at the surface of defensin-functionalized films was found to be 98% when 10 antimicrobial peptide layers were inserted in the film architecture. Noticeably, the biofunctionalization could be achieved only when positively charged poly(l-lysine) was the outermost layer of the film. On the basis of the results of bacterial adhesion experiments observed by confocal or electron microscopy, these observations could result from the close interaction of the bacteria with the positively charged ends of the films, which allows defensin to interact with the bacterial membrane structure. These results open new possibilities for the use of such easily built and functionalized architectures onto any type of implantable biomaterial. The modified surfaces are active against microbial infection and represent a novel means of local host protection.
Berger, J. D.; Ludwig, C.
2014-01-01
Our understanding of within-species annual plant adaptation to rainfall gradients is fragmented. Broad-scale ecological applications of Grime’s C-S-R triangle are often superficial, while detailed drought physiology tends to be narrow, focusing on elite cultivars. The former lack the detail to explain how plants respond, while the latter provide little context to investigate trade-offs among traits, to explain where/why these might be adaptive. Ecophysiology, combining the breadth of the former with the detail of the latter, can resolve this disconnect and is applied here to describe adaptive strategies in the Mediterranean legume Lupinus luteus. Wild and domesticated material from low- and high-rainfall environments was evaluated under contrasting terminal drought. These opposing environments have selected for contrasting, integrated, adaptive strategies. Long-season, high-rainfall habitats select for competitive (C) traits: delayed phenology, high above- and below-ground biomass, productivity, and fecundity, leading to high water-use and early stress onset. Terminal drought-prone environments select for the opposite: ruderal (R) traits that facilitate drought escape/avoidance but limit reproductive potential. Surprisingly, high-rainfall ecotypes generate lower critical leaf water potentials under water deficit, maintaining higher relative water content than the latter. Given that L. luteus evolved in sandy, low-water-holding capacity soils, this represents a bet-hedging response to intermittent self-imposed water-deficits associated with a strongly C-selected adaptive strategy that is therefore redundant in R-selected low-rainfall ecotypes. Domesticated L. luteus is even more R-selected, reflecting ongoing selection for early maturity. Introgression of appropriate C-selected adaptive traits from wild germplasm may widen the crop production range. PMID:24591050
[Diversity and antimicrobial activities of cultivable bacteria isolated from Jiaozhou Bay].
Wang, Yiting; Zhang, Chuanbo; Qi, Lin; Jia, Xiaoqiang; Lu, Wenyu
2016-12-04
Marine microorganisms have a great potential in producing biologically active secondary metabolites. In order to study the diversity and antimicrobial activity, we explored 9 sediment samples in different observation sites of Jiaozhou bay. We used YPD and Z2216E culture medium to isolate bacteria from the sediments; 16S rRNA was sequenced for classification and identification of the isolates. Then, we used Oxford cup method to detect antimicrobial activities of the isolated bacteria against 7 test strains. Lastly, we selected 16 representatives to detect secondary-metabolite biosynthesis genes:PKSI, NRPS, CYP, PhzE, dTGD by PCR specific amplification. A total of 76 bacterial strains were isolated from Jiaozhou bay; according to the 16S rRNA gene sequence analysis. These strains could be sorted into 11 genera belonging to 8 different families:Aneurinibacillus, Brevibacillus, Microbacterium, Oceanisphae, Bacillus, Marinomonas, Staphylococcus, Kocuria, Arthrobacters, Micrococcus and Pseudoalteromonas. Of them 34 strains showed antimicrobial activity against at least one of the tested strains. All 16 strains had at least one function genes, 5 strains possessed more than three function genes. Jiaozhou bay area is rich in microbial resources with potential in providing useful secondary metabolites.
Spätzle-Processing Enzyme-independent Activation of the Toll Pathway in Drosophila Innate Immunity.
Yamamoto-Hino, Miki; Goto, Satoshi
2016-05-07
The Toll pathway regulates innate immunity in insects and vertebrates. The Drosophila Toll receptor is activated by a processed form of a ligand, Spätzle. Spätzle-processing enzyme (SPE) is the only enzyme identified to date that functions in converting Spätzle to an active form during the immune response. In the present study, Toll activation induced by immune challenge was almost suppressed in spätzle mutant larvae and adults, whereas it was present in SPE mutant larvae challenged with Micrococcus luteus and adults challenged with Bacillus subtilis. Our data suggest that an unidentified protease besides SPE processes Spätzle under conditions of microbial challenge.
Antimicrobial and anticancer efficacy of antineoplastic agent capped gold nanoparticles.
Selvaraj, V; Grace, A Nirmala; Alagar, M; Hamerton, I
2010-04-01
Synthesis of thioguanine (TG)-capped Au nanoparticles (Au@TG) and their enhanced in vitro antimicrobial and anticancer efficacy against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Aspergillus fumigatus, Aspergillus niger and Hep2 cancer cell (Human epidermiod cell) have been reported. The nature of binding between 6-TG and the gold nanoparticles via complexation is investigated using ultraviolet-visible spectrum, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FT-IR) spectroscopy. The present experimental studies suggests that Au@TG are more potential than TG towards antimicrobial and anticancer activities. Hence, gold nanoparticles have the potential to be used as effective carriers for anticancer drug.
Structural studies of 4-aminoantipyrine derivatives
NASA Astrophysics Data System (ADS)
Cunha, Silvio; Oliveira, Shana M.; Rodrigues, Manoel T.; Bastos, Rodrigo M.; Ferrari, Jailton; de Oliveira, Cecília M. A.; Kato, Lucília; Napolitano, Hamilton B.; Vencato, Ivo; Lariucci, Carlito
2005-10-01
Reaction of 4-aminoantipyrine with acetylacetone, ethyl acetoacetate, benzoyl isothiocyanate, phenyl isothiocyanate, maleic anhydride and methoxymethylene Meldrum's acid afforded a series of new antipyrine derivatives. The antibacterial activity of the synthesized compounds against Micrococcus luteus ATCC 9341, Staphilococcus aureus ATCC 29737, and Escherichia coli ATCC 8739 was evaluated and the minimal inhibitory concentration determined. Modest activity was found only to the maleamic acid obtained from the reaction of 4-aminoantipyrine and maleic anhydride. 1H NMR investigation of this maleamic acid showed that it is slowly converted to the corresponding toxic maleimide. The structures of three derivatives were determined by X-ray diffraction analysis.
Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolo; Roch, Philippe
2006-01-01
Complete sequence of HSP70 cDNA from the mussel, Mytilus galloprovincialis was established before quantifying its expression following moderate heat shock or injection of heat-killed bacteria. HSP70 cDNA is comprised of 2378 bp including one ORF of 654 aa, with a predicted 70 bp 5'-UTR and a 343 bp 3'-UTR (GenBank, 18 Jan 05, AY861684). Alignment identity ranged from 89% for Crassostrea ariakensis to 72% for C. virginica. Curiously, HSP70 gene and cDNA sequences from M. galloprovincialis, deposited later (03 and 27 May), show only 73% identity with the present sequence. Meanwhile, characteristic motifs of the HSP70 family were located in conserved positions. Expression of HSP70 gene was quantified on circulating hemocyte mRNA using Q-PCR after RT using random hexaprimers. Housekeeping gene was 28S rRNA. Four stresses were applied: heat shock that consisted of immersing mussels for 90 min at 30 degrees C and returning them to 20 degrees C sea water, one injection of heat-killed Gram-negative bacteria, Vibrio splendidus LGP32, one injection of heat-killed Gram-negative bacteria Vibrio anguillarum, one injection of heat-killed Gram-positive bacteria Micrococcus lysodeikticus. We found no significant modification of 28S rRNA gene expression. Significant increase of 5.2 +/- 0.4 fold the ratio HSP70/28S rRNA was observed 6 h after heat shock and was maximum at 15 h (6.1 +/- 1.1), and still significant after 24 h (1.7 +/- 0.03). Similarly, injecting V. anguillarum resulted in a significant increase of 2.7 +/- 0.1 after 12 h. Expression was maximum after 48 h (5.2 +/- 0.05) and returned to baseline after 72 h. In contrast, injecting V. splendidus or M. lysodeikticus failed to significantly modulate HSP70 gene expression at least during the first 3 days post-injection. Consequently, mussel hemocytes appeared to discriminate between pathogenic and non-pathogenic Vibrios, as well as between Gram-negative and Gram-positive bacteria.
Pavlović, Ivan; Petrović, Silvana; Milenković, Marina; Stanojković, Tatjana; Nikolić, Dejan; Krunić, Aleksej; Niketić, Marjan
2015-10-01
The antimicrobial and cytotoxic activities of isolates (CHCl3 and MeOH extracts and selected metabolites) obtained from the underground parts of the Balkan endemic plant Ferula heuffelii Griseb. ex Heuff. were assessed. The CHCl3 and MeOH extracts exhibited moderate antimicrobial activity, being more pronounced against Gram-positive than Gram-negative bacteria, especially against Staphylococcus aureus (MIC=12.5 μg/ml for both extracts) and Micrococcus luteus (MIC=50 and 12.5 μg/ml, resp.). Among the tested metabolites, (6E)-1-(2,4-dihydroxyphenyl)-3,7,11-trimethyl-3-vinyldodeca-6,10-dien-1-one (2) and (2S*,3R*)-2-[(3E)-4,8-dimethylnona-3,7-dien-1-yl]-2,3-dihydro-7-hydroxy-2,3-dimethylfuro[3,2-c]coumarin (4) demonstrated the best antimicrobial activity. Compounds 2 and 4 both strongly inhibited the growth of M. luteus (MIC=11.2 and 5.2 μM, resp.) and Staphylococcus epidermidis (MIC=22.5 and 10.5 μM, resp.) and compound 2 additionally also the growth of Bacillus subtilis (MIC=11.2 μM). The cytotoxic activity of the isolates was tested against three human cancer cell lines, viz., cervical adenocarcinoma (HeLa), chronic myelogenous leukemia (K562), and breast cancer (MCF-7) cells. The CHCl3 extract exhibited strong cytotoxic activity against all cell lines (IC50 <11.0 μg/ml). All compounds strongly inhibited the growth of the K562 and HeLa cell lines. Compound 4 exhibited also a strong activity against the MCF-7 cell line, comparable to that of cisplatin (IC50 =22.32±1.32 vs. 18.67±0.75μM). Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.
Influence of Culture Media on the Radiation Resistance of Micrococcus radiodurans
Krabbenhoft, K. L.; Anderson, A. W.; Elliker, P. R.
1967-01-01
The addition of NZ-case (a tryptic digest of casein) to a growth medium (PC) consisting of tryptone, glucose, and yeast extract caused a significant decrease in γ radiation resistance of Micrococcus radiodurans. The level of radiation resistance was inversely related to the concentration of NZ-case. The ld50 for this organism was approximately 700 krad when grown in tryptone, glucose, yeast extract, and dl-methionine (TGYM) broth, but it was approximately one-half as resistant when grown in a PC medium containing 0.5% NZ-case (PCNZ). The resistance to ultraviolet light was also reduced. Cultures transferred from PCNZ to TGYM media regained the high level of resistance. Images Fig. 2 Fig. 3 PMID:5340165
Interaction of Vibrio spp. with the Inner Surface of the Digestive Tract of Penaeus monodon
Soonthornchai, Wipasiri; Chaiyapechara, Sage; Jarayabhand, Padermsak; Söderhäll, Kenneth; Jiravanichpaisal, Pikul
2015-01-01
Several species of Vibrio are the causative agent of gastroenteritis in humans. In aquaculture, Vibrio harveyi (Vh) and V. parahaemolyticus (Vp) have long been considered as shrimp pathogens in freshwater, brackish and marine environments. Here we show by using scanning electron microscopy (SEM) that Penaeus monodon orally inoculated with each of these two pathogens via an Artemia diet had numerous bacteria attached randomly across the stomach surface, in single and in large biofilm-like clusters 6 h post-infection. A subsequent marked proliferation in the number of V. harveyi within the biofilm-like formations resulted in the development of infections in the stomach, the upper and middle midgut, but neither in the posterior midgut nor the hindgut. SEM also revealed the induced production of peritrichous pili-like structures by the Vp attaching to the stomach lining, whilst only a single polar fibre was seen forming an apparent physical bridge between Vh and the host’s epithelium. In contrast to these observations, no such adherences or linkages were seen when trials were conducted with non-pathogenic Vibrio spp. or with Micrococcus luteus, with no obvious resultant changes to the host’s gut surface. In naive shrimp, the hindgut was found to be a favorable site for bacteria notably curved, short-rod shaped bacteria which probably belong to Vibrio spp. Data from the current study suggests that pathogens of P. monodon must be able to colonize the digestive tract, particularly the stomach, where chitin is present, and then they use an array of virulent factors and enzymes to infect their host resulting in disease. Oral infection is a better way of mimicking natural routes of infection; investigating the host-bacteria interactions occurring in the digestive tract may lead to new strategies for the prevention or control of bacterial infections in penaeids. PMID:26285030
Berger, J D; Ludwig, C
2014-11-01
Our understanding of within-species annual plant adaptation to rainfall gradients is fragmented. Broad-scale ecological applications of Grime's C-S-R triangle are often superficial, while detailed drought physiology tends to be narrow, focusing on elite cultivars. The former lack the detail to explain how plants respond, while the latter provide little context to investigate trade-offs among traits, to explain where/why these might be adaptive. Ecophysiology, combining the breadth of the former with the detail of the latter, can resolve this disconnect and is applied here to describe adaptive strategies in the Mediterranean legume Lupinus luteus. Wild and domesticated material from low- and high-rainfall environments was evaluated under contrasting terminal drought. These opposing environments have selected for contrasting, integrated, adaptive strategies. Long-season, high-rainfall habitats select for competitive (C) traits: delayed phenology, high above- and below-ground biomass, productivity, and fecundity, leading to high water-use and early stress onset. Terminal drought-prone environments select for the opposite: ruderal (R) traits that facilitate drought escape/avoidance but limit reproductive potential. Surprisingly, high-rainfall ecotypes generate lower critical leaf water potentials under water deficit, maintaining higher relative water content than the latter. Given that L. luteus evolved in sandy, low-water-holding capacity soils, this represents a bet-hedging response to intermittent self-imposed water-deficits associated with a strongly C-selected adaptive strategy that is therefore redundant in R-selected low-rainfall ecotypes. Domesticated L. luteus is even more R-selected, reflecting ongoing selection for early maturity. Introgression of appropriate C-selected adaptive traits from wild germplasm may widen the crop production range. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
New antibacterial xanthone from the marine sponge-derived Micrococcus sp. EG45.
Eltamany, Enas E; Abdelmohsen, Usama Ramadan; Ibrahim, Amany K; Hassanean, Hashim A; Hentschel, Ute; Ahmed, Safwat A
2014-11-01
Microluside A [4 (19-para-hydroxy benzoyloxy-O-β-D-cellobiosyl), 5 (30-para-hydroxy benzoyloxy-O-β-D-glucopyranosyl) xanthone (1)] is a unique O-glycosylated disubstituted xanthone isolated from the broth culture of Micrococcus sp. EG45 cultivated from the Red Sea sponge Spheciospongia vagabunda. The structure of microluside A was determined by 1D- and 2D-NMR techniques as well as high resolution tandem mass spectrometry. The antimicrobial activity evaluation showed that 1 exhibited antibacterial potential against Enterococcus faecalis JH212 and Staphylococcus aureus NCTC 8325 with MIC values of 10 and 13 μM, respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.
Romero, H; Zavala, A; Musto, H
2000-01-25
It is widely accepted that the compositional pressure is the only factor shaping codon usage in unicellular species displaying extremely biased genomic compositions. This seems to be the case in the prokaryotes Mycoplasma capricolum, Rickettsia prowasekii and Borrelia burgdorferi (GC-poor), and in Micrococcus luteus (GC-rich). However, in the GC-poor unicellular eukaryotes Dictyostelium discoideum and Plasmodium falciparum, there is evidence that selection, acting at the level of translation, influences codon choices. This is a twofold intriguing finding, since (1) the genomic GC levels of the above mentioned eukaryotes are lower than the GC% of any studied bacteria, and (2) bacteria usually have larger effective population sizes than eukaryotes, and hence natural selection is expected to overcome more efficiently the randomizing effects of genetic drift among prokaryotes than among eukaryotes. In order to gain a new insight about this problem, we analysed the patterns of codon preferences of the nuclear genes of Entamoeba histolytica, a unicellular eukaryote characterised by an extremely AT-rich genome (GC = 25%). The overall codon usage is strongly biased towards A and T in the third codon positions, and among the presumed highly expressed sequences, there is an increased relative usage of a subset of codons, many of which are C-ending. Since an increase in C in third codon positions is 'against' the compositional bias, we conclude that codon usage in E. histolytica, as happens in D. discoideum and P. falciparum, is the result of an equilibrium between compositional pressure and selection. These findings raise the question of why strongly compositionally biased eukaryotic cells may be more sensitive to the (presumed) slight differences among synonymous codons than compositionally biased bacteria.
Antimicrobial, wound healing and antioxidant activity of Plagiochasma appendiculatum Lehm. et Lind.
Singh, Meenakshi; Govindarajan, Raghavan; Nath, Virendra; Rawat, Ajay Kumar Singh; Mehrotra, Shanta
2006-08-11
Plagiochasma appendiculatum (Aytoniaceae) of the order Marchantiales is widely used in the form of paste ethnomedicinally by Gaddi tribe in Kangra valley for treating skin diseases. In this context, antimicrobical potential of Plagiochasma appendiculatum against a wide range of microorganisms was studied. To validate the ethnotherapeutic claims of the plant in skin diseases, wound healing activity was studied, besides antioxidant activity to understand the mechanism of wound healing activity. The plant (alchoholic and aqueous extract) showed significant antibacterial and antifungal activity against almost all the organisms: Micrococcus luteus, Bacillus subtilis, Bacillus cereus, Staphylococcus aureus, Streptococcus pneumoniae, Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella typhimurium, and eight fungi Candida albicans and Cryptococcus albidus-dimorphic fungi, Trichophyton rubrum-dermatophyte fungi, Aspergillus niger, Aspergillus flavus, Aspergillus spinulosus, Aspergillus terreus and Aspergillus nidulans-systemic fungi, with especially good activity against the dermatophyte (Trichophyton rubrum) and some infectious bacteria (Escherichia coli, Proteus mirabilis and Salmonella typhimurium) with an MIC of 2.5 microg/disc. The results show that Plagiochasma appendiculatum extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. The results also indicated that Plagiochasma appendiculatum extract possesses potent antioxidant activity by inhibiting lipid peroxidation and increase in the superoxide dismutase (SOD) and Catalase activity.
Popović, Višnja B; Petrović, Silvana D; Milenković, Marina T; Drobac, Milica M; Couladis, Maria A; Niketić, Marjan S
2015-01-01
The chemical composition and antimicrobial activity of essential oils of Laserpitium latifolium and L. ochridanum were investigated. The essential oils were isolated by steam distillation and characterized by GC-FID and GC/MS analyses. All essential oils were distinguished by high contents of monoterpenes, and α-pinene was the most abundant compound in the essential oils of L. latifolium underground parts and fruits (contents of 44.4 and 44.0%, resp.). The fruit essential oil was also rich in sabinene (26.8%). Regarding the L. ochridanum essential oils, the main constituents were limonene in the fruit oil (57.7%) and sabinene in the herb oil (25.9%). The antimicrobial activity of these essential oils as well as that of L. ochridanum underground parts, whose composition was reported previously, was tested by the broth-microdilution method against four Gram-positive and three Gram-negative bacteria and two Candida albicans strains. Except the L. latifolium underground-parts essential oil, the other investigated oils showed a high antimicrobial potential against Staphylococcus aureus, S. epidermidis, Micrococcus luteus, or Candida albicans (minimal inhibitory concentrations of 13.0-73.0 μg/ml), comparable to or even higher than that of thymol, which was used as reference compound. Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.
An evidential example of airborne bacteria in a crowded, underground public concourse in Tokyo
NASA Astrophysics Data System (ADS)
Seino, Kaoruko; Takano, Takehito; Nakamura, Keiko; Watanabe, Masafumi
2005-01-01
We examined airborne bacteria in an underground concourse in Tokyo and investigated conditions that influenced bacterial counts. Airborne bacteria were collected by using an impactor sampler. Colonies on plate count agar (PCA) and Columbia colistin-nalidixic acid agar with 5% sheep blood (CNA agar) were enumerated. The range, geometric mean, and 95% CI of the bacterial counts (CFU m-3) on PCA and CNA agar were 150-1380, 456, 382-550 and 50-990, 237, 182-309, respectively. Bacterial counts on PCA significantly correlated with number of the pedestrians (r=0.89), relative humidity (r=0.70) and airborne dust (PM5.0) (r=0.73). Results of a multiple regression indicated independent positive association between the number of pedestrians and bacterial counts on PCA (p<0.01) after excluding the influence of relative humidity and airborne dust. Similar results were obtained with the statistical analysis for the counts of bacteria on CNA agar. Gram-positive cocci were dominant on PCA and CNA agar. Staphylococcus epidermidis and Micrococcus spp. were dominant among the 11 genera and 19 species identified in the present study. Considering the pattern of identified species and the significant independent association between number of pedestrians and bacterial counts, airborne bacteria in a crowded underground concourse were mostly originated from the pedestrians who were walking in the underground concourse. This study gave an evidential example of bacterial conditions in the air of an underground crowded public space in Tokyo.
Prapagdee, Benjaphorn; Chanprasert, Maesinee; Mongkolsuk, Skorn
2013-07-01
Micrococcus sp. MU1 and Klebsiella sp. BAM1, the cadmium-resistant plant growth-promoting rhizobacteria (PGPR), produce high levels of indole-3-acetic acid (IAA) during the late stationary phase of their growth. The ability of PGPR to promote root elongation, plant growth and cadmium uptake in sunflowers (Helianthus annuus) was evaluated. Both species of bacteria were able to remove cadmium ions from an aqueous solution and enhanced cadmium mobilization in contaminated soil. Micrococcus sp. and Klebsiella sp. use aminocyclopropane carboxylic acid as a nitrogen source to support their growth, and the minimum inhibitory concentrations of cadmium for Micrococcus sp. and Klebsiella sp. were 1000 and 800mM, respectively. These bacteria promoted root elongation in H. annuus seedlings in both the absence and presence of cadmium compared to uninoculated seedlings. Inoculation with these bacteria was found to increase the root lengths of H. annuus that had been planted in cadmium-contaminated soil. An increase in dry weight was observed for H. annuus inoculated with Micrococcus sp. Moreover, Micrococcus sp. enhanced the accumulation of cadmium in the root and leaf of H. annuus compared to untreated plants. The highest cadmium accumulation in the whole plant was observed when the plants were treated with EDTA following the treatment with Micrococcus sp. In addition, the highest translocation of cadmium from root to the above-ground tissues of H. annuus was found after treatment with Klebsiella sp. in the fourth week after planting. Our results show that plant growth and cadmium accumulation in H. annuus was significantly enhanced by cadmium-resistant PGPRs, and these bacterial inoculants are excellent promoters of phytoextraction for the rehabilitation of heavy metal-polluted environments. Copyright © 2013 Elsevier Ltd. All rights reserved.
The utilization of aconate and itaconate by Micrococcus sp
Cooper, R. A.; Itiaba, K.; Kornberg, H. L.
1965-01-01
1. An organism, identified as Micrococcus sp., was isolated by elective culture on aconate; it also grew on itaconate. 2. Washed suspensions of the aconate-grown organism readily oxidized intermediates of the tricarboxylic acid cycle, aconate and succinic semialdehyde, but not itaconate. Itaconate-grown cells oxidized tricarboxylic acid-cycle intermediates, succinic semialdehyde and itaconate, but not aconate. Succinate-grown cells oxidized neither itaconate nor aconate. 3. Extracts of aconate-grown cells catalysed the formation of succinic semialdehyde and carbon dioxide, in equimolar amounts, from aconate. In the presence of NAD or NADP, succinic semialdehyde was oxidized to succinate with concomitant reduction of the coenzyme. 4. Extracts of itaconate-grown cells catalysed the formation of pyruvate and acetyl-CoA from itaconyl-CoA. 5. Key enzymes involved in the formation of succinate from aconate, and of pyruvate and acetyl-CoA from itaconate, were distinct and inducible: their formation preceded growth on the appropriate substrate. PMID:14342240
Prakash, Om; Sharma, Avinash; Nimonkar, Yogesh; Shouche, Yogesh S
2015-11-01
Micrococcus lactis and Zhihengliuella aestuarii were described independently in 2011. Their type strains showed high levels of 16S rRNA gene sequence similarity (99.3%). Phylogenetic analysis revealed that M. lactis MCC 2278T and Z. aestuarii JCM 16166T formed a monophyletic group and showed distant relationships to other members of closely related genera such as Micrococcus, Zhihengliuella, Arthrobacter and Citricoccus. The presence of large proportions of iso-C14:0 and iso-C16:0 with small amounts of iso-C15:0 distinguished M. lactis MCC 2278T and Z. aestuarii JCM 16166T from other members of the genera Micrococcus and Zhihengliuella. Unlike other members of the genera Zhihengliuella and Micrococcus, M. lactis MCC 2278T and Z. aestuarii JCM 16166T showed growth at low concentrations of NaCl. Thus, based on distinctive phylogenetic, chemotaxonomic and physiological features of these two organisms in comparison with other members of the genera Micrococcus and Zhihengliuella, it is clear that they do not fit within the existing classification and deserve separate status. DNA-DNA hybridization between the two type strains was 63%, indicating that they represent separate species. In this study, we propose the creation of a novel genus, Neomicrococcus gen. nov., to accommodate the two species with Neomicrococcus aestuarii gen. nov., comb. nov. (type strain JCM 16166T = KCTC 19557T) as the type species. Neomicrococcus lactis comb. nov. (type strain MCC 2278T = DSM 23694T) is also proposed.
Keely, S P; Brinkman, N E; Zimmerman, B D; Wendell, D; Ekeren, K M; De Long, S K; Sharvelle, S; Garland, J L
2015-07-01
Development of efficacious grey water (GW) treatment systems would benefit from detailed knowledge of the bacterial composition of GW. Thus, the aim of this study was to characterize the bacterial composition from (i) various points throughout a GW recycling system that collects shower and sink handwash (SH) water into an equalization tank (ET) prior to treatment and (ii) laundry (LA) water effluent of a commercial-scale washer. Bacterial composition was analysed by high-throughput pyrosequencing of the 16S rRNA gene. LA was dominated by skin-associated bacteria, with Corynebacterium, Staphylococcus, Micrococcus, Propionibacterium and Lactobacillus collectively accounting for nearly 50% of the total sequences. SH contained a more evenly distributed community than LA, with some overlap (e.g. Propionibacterium), but also contained distinct genera common to wastewater infrastructure (e.g. Zoogloea). The ET contained many of these same wastewater infrastructure-associated bacteria, but was dominated by genera adapted for anaerobic conditions. The data indicate that a relatively consistent set of skin-associated genera are the dominant human-associated bacteria in GW, but infrastructure-associated bacteria from the GW collection system and ET used for transient storage will be the most common bacteria entering GW treatment and reuse systems. This study is the first to use high-throughput sequencing to identify the bacterial composition of various GW sources. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.
Kamekura, M; Hamakawa, T; Onishi, H
1982-01-01
RNA was degraded at 60 degrees C for 24 h by halophilic nuclease H in supernatants from broth cultures of Micrococcus varians subsp. halophilus containing 12% NaCl. Since contaminating 5'-nucleotidase exhibited almost no activity under these conditions, the 5'-GMP formed could be recovered from the reaction mixture, and the yield was 805 mg from 5 g of RNA. PMID:6184020
Diverse bacteria isolated from microtherm oil-production water.
Sun, Ji-Quan; Xu, Lian; Zhang, Zhao; Li, Yan; Tang, Yue-Qin; Wu, Xiao-Lei
2014-02-01
In total, 435 pure bacterial strains were isolated from microtherm oil-production water from the Karamay Oilfield, Xinjiang, China, by using four media: oil-production water medium (Cai medium), oil-production water supplemented with mineral salt medium (CW medium), oil-production water supplemented with yeast extract medium (CY medium), and blood agar medium (X medium). The bacterial isolates were affiliated with 61 phylogenetic groups that belong to 32 genera in the phyla Actinobacteria, Firmicutes, and Proteobacteria. Except for the Rhizobium, Dietzia, and Pseudomonas strains that were isolated using all the four media, using different media led to the isolation of bacteria with different functions. Similarly, nonheme diiron alkane monooxygenase genes (alkB/alkM) also clustered according to the isolation medium. Among the bacterial strains, more than 24 % of the isolates could use n-hexadecane as the sole carbon source for growth. For the first time, the alkane-degrading ability and alkB/alkM were detected in Rhizobium, Rhodobacter, Trichococcus, Micrococcus, Enterococcus, and Bavariicoccus strains, and the alkM gene was detected in Firmicutes strains.
Subban, Kamalraj; Subramani, Ramesh; Johnpaul, Muthumary
2013-01-01
A novel phenolic compound, 4-(2,4,7-trioxa-bicyclo[4.1.0]heptan-3-yl) phenol (1), was isolated from Pestalotiopsis mangiferae, an endophytic fungus associated with Mangifera indica Linn. The structure of the compound was elucidated on the basis of comprehensive spectral analysis (UV, IR, ¹H-, ¹³C- and 2D-NMR, as well as HRESI-MS). Compound (1) shows potent antibacterial and antifungal activity against Bacillus subtilis, Klebsiella pneumoniae, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa and Candida albicans. The transmission electron microscope study for the mode of inhibition of compound (1) on bacterial pathogens revealed the destruction of bacterial cells by cytoplasm agglutination with the formation of pores in cell wall membranes.
Selvaraj, Vaithilingam; Alagar, Muthukaruppan
2007-06-07
Gold nanoparticles are reported and evaluated as probes for the detection of anticancer drug 5-fluorouracil (5FU). The nature of binding between 5FU and gold nanoparticles via complexation is investigated using ultraviolet visible spectrophotometry, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FTIR) spectroscopy. The bound antileukemic drug is fluorescent and the quenching property of gold nanoparticles could be exploited for biological investigations. The 5FU-colloidal gold complex (Au@5FU) is observed to have appreciable antibacterial and antifungal activity against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus fumigatus, and Aspergillus niger. The experimental studies suggest that gold nanoparticles have the potential to be used as effective carriers for anticancer drugs.
Isolation of DNA methyltransferase from plants
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ehrlich, K.; Malbroue, C.
1987-05-01
DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from (/sup 3/H)AdoMet incorporated into acid precipitablemore » material per h at 30/sup 0/). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30/sup 0/.« less
Winnicki, Konrad; Żabka, Aneta; Bernasińska, Joanna; Matczak, Karolina; Maszewski, Janusz
2015-06-01
In plants, phosphorylated MAPKs display constitutive nuclear localization; however, not all studied plant species show co-localization of activated MAPKs to mitotic microtubules. The mitogen-activated protein kinase (MAPK) signaling pathway is involved not only in the cellular response to biotic and abiotic stress but also in the regulation of cell cycle and plant development. The role of MAPKs in the formation of a mitotic spindle has been widely studied and the MAPK signaling pathway was found to be indispensable for the unperturbed course of cell division. Here we show cellular localization of activated MAPKs (dually phosphorylated at their TXY motifs) in both interphase and mitotic root meristem cells of Lupinus luteus, Pisum sativum, Vicia faba (Fabaceae) and Lycopersicon esculentum (Solanaceae). Nuclear localization of activated MAPKs has been found in all species. Co-localization of these kinases to mitotic microtubules was most evident in L. esculentum, while only about 50% of mitotic cells in the root meristems of P. sativum and V. faba displayed activated MAPKs localized to microtubules during mitosis. Unexpectedly, no evident immunofluorescence signals at spindle microtubules and phragmoplast were noted in L. luteus. Considering immunocytochemical analyses and studies on the impact of FR180204 (an inhibitor of animal ERK1/2) on mitotic cells, we hypothesize that MAPKs may not play prominent role in the regulation of microtubule dynamics in all plant species.
Ridgway, H F; Safarik, J; Phipps, D; Carl, P; Clark, D
1990-01-01
Approximately 300 gasoline-degrading bacteria were isolated from well water and core material from a shallow coastal aquifer contaminated with unleaded gasoline. Identification of 244 isolates revealed four genera: Pseudomonas, Alcaligenes, Nocardia, and Micrococcus, with pseudomonads making up 86.9% of bacteria identified. A total of 297 isolates was sorted into 111 catabolic groups on the basis of aerobic growth responses on 15 gasoline hydrocarbons. Each test hydrocarbon was degraded by at least one isolate. Toluene, p-xylene, ethylbenzene, and 1,2,4-trimethylbenzene were most frequently utilized as growth substrates, whereas cyclic and branched alkanes were least utilized. Most isolates were able to grow on 2 or 3 different hydrocarbons, and nearly 75% utilized toluene as a sole source of carbon and energy. Isolates were remarkably specific for hydrocarbon usage, often catabolizing only one of several closely related compounds. A subset of 220 isolates was sorted into 51 groups by polyacrylamide gel electrophoresis. Pseudomonas aeruginosa was partitioned into 16 protein-banding groups (i.e., subspecies) whose catabolic activities were largely restricted to substituted aromatics. Different members of subspecies groups defined by protein-banding pattern analysis often exhibited different growth responses on the same hydrocarbon, implying marked strain diversity. The catabolic activities of well-derived, gasoline-degrading bacteria associated with this contaminated aquifer are consonant with in situ adaptation at the site. PMID:2268163
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ridgway, H.F.; Safarik, J.; Phipps, D.
1990-11-01
Approximately 300 gasoline-degrading bacteria were isolated from well water and core material from a shallow coastal aquifer contaminated with unleaded gasoline. Identification of 244 isolates revealed four genera: Pseudomonas, Alcaligenes, Nocardia, and Micrococcus, with pseudomonads making up 86.9% of bacteria identified. A total of 297 isolates was sorted into 111 catabolic groups on the basis of aerobic growth responses on 15 gasoline hydrocarbons. Each test hydrocarbon was degraded by at least one isolate. Toluene, p-xylene, ethylbenzene, and 1,2,4-trimethylbenzene were most frequently utilized as growth substrates, whereas cyclic and branched alkanes were least utilized. Most isolates were able to grow onmore » 2 or 3 different hydrocarbons, and nearly 75% utilized toluene as a sole source of carbon and energy. Isolates were remarkably specific for hydrocarbon usage, often catabolizing only one of several closely related compounds. A subset of 220 isolates was sorted into 51 groups by polyacrylamide gel electrophoresis. Pseudomonas aeruginosa was partitioned into 16 protein-banding groups (i.e., subspecies) whose catabolic activities were largely restricted to substituted aromatics. Different members of subspecies groups defined by protein-banding pattern analysis often exhibited different growth responses on the same hydrocarbon, implying marked strain diversity. The catabolic activities of well-derived, gasoline-degrading bacteria associated with this contaminated aquifer are consonant with in situ adaptation at the site.« less
Characterization of airborne bacteria at an underground subway station.
Dybwad, Marius; Granum, Per Einar; Bruheim, Per; Blatny, Janet Martha
2012-03-01
The reliable detection of airborne biological threat agents depends on several factors, including the performance criteria of the detector and its operational environment. One step in improving the detector's performance is to increase our knowledge of the biological aerosol background in potential operational environments. Subway stations are enclosed public environments, which may be regarded as potential targets for incidents involving biological threat agents. In this study, the airborne bacterial community at a subway station in Norway was characterized (concentration level, diversity, and virulence- and survival-associated properties). In addition, a SASS 3100 high-volume air sampler and a matrix-assisted laser desorption ionization-time of flight mass spectrometry-based isolate screening procedure was used for these studies. The daytime level of airborne bacteria at the station was higher than the nighttime and outdoor levels, and the relative bacterial spore number was higher in outdoor air than at the station. The bacterial content, particle concentration, and size distribution were stable within each environment throughout the study (May to September 2010). The majority of the airborne bacteria belonged to the genera Bacillus, Micrococcus, and Staphylococcus, but a total of 37 different genera were identified in the air. These results suggest that anthropogenic sources are major contributors to airborne bacteria at subway stations and that such airborne communities could harbor virulence- and survival-associated properties of potential relevance for biological detection and surveillance, as well as for public health. Our findings also contribute to the development of realistic testing and evaluation schemes for biological detection/surveillance systems by providing information that can be used to mimic real-life operational airborne environments in controlled aerosol test chambers.
Characterization of Airborne Bacteria at an Underground Subway Station
Dybwad, Marius; Granum, Per Einar; Bruheim, Per
2012-01-01
The reliable detection of airborne biological threat agents depends on several factors, including the performance criteria of the detector and its operational environment. One step in improving the detector's performance is to increase our knowledge of the biological aerosol background in potential operational environments. Subway stations are enclosed public environments, which may be regarded as potential targets for incidents involving biological threat agents. In this study, the airborne bacterial community at a subway station in Norway was characterized (concentration level, diversity, and virulence- and survival-associated properties). In addition, a SASS 3100 high-volume air sampler and a matrix-assisted laser desorption ionization–time of flight mass spectrometry-based isolate screening procedure was used for these studies. The daytime level of airborne bacteria at the station was higher than the nighttime and outdoor levels, and the relative bacterial spore number was higher in outdoor air than at the station. The bacterial content, particle concentration, and size distribution were stable within each environment throughout the study (May to September 2010). The majority of the airborne bacteria belonged to the genera Bacillus, Micrococcus, and Staphylococcus, but a total of 37 different genera were identified in the air. These results suggest that anthropogenic sources are major contributors to airborne bacteria at subway stations and that such airborne communities could harbor virulence- and survival-associated properties of potential relevance for biological detection and surveillance, as well as for public health. Our findings also contribute to the development of realistic testing and evaluation schemes for biological detection/surveillance systems by providing information that can be used to mimic real-life operational airborne environments in controlled aerosol test chambers. PMID:22247150
Finnerty, W. R.; Kallio, R. E.
1964-01-01
Finnerty, W. R. (University of Iowa, Iowa City), and R. E. Kallio. Origin of palmitic acid carbon in palmitates formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans. J. Bacteriol. 87:1261–1265. 1964.—Degradation of the palmitic acid moiety of cetyl palmitate and myristyl palmitate formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans was carried out. The patterns of C14 labeling in palmitic acid from cetyl palmitate showed that hexadecane is oxidized at the C1 position, and cetyl alcohol and palmitic acid thus formed are directly esterified. Palmitic acid arising from tetradecane and esterified to tetradecanol appeared to have been synthesized by the addition of two carbon atoms to an existing 14-carbon atom skeleton. Considerable mixing of C14 occurred in the C1 and C2 positions of palmitic acid thus synthesized. PMID:14188700
Characterization of the membrane-bound succinic dehydrogenase of Micrococcus lysodeikticus.
Pollock, J J; Linder, R; Salton, M R
1971-07-01
The occurrence of succinic dehydrogenase [succinic:(acceptor) oxidoreductase, EC 1.3.99.1] in membrane fractions of Micrococcus lysodeikticus was investigated. The enzyme could be purified 10-fold, by deoxycholate treatment. Butanol extraction of membranes yielded an active fraction, nonsedimentable at 130,000 x g for 2 hr and altered in its phospholipid content relative to membranes. The activity of the enzyme in particulate preparations was decreased in the presence of competitive inhibitors and by compounds known to react with iron, sulfhydryl groups, and flavine. In this respect, the bacterial succinic dehydrogenase is similar to the enzyme derived from yeast and mammalian sources. In certain membrane fractions, Ca(2+) and Mg(2+) exhibited inhibitory effects whereas Triton X-100 caused activation. The enzyme could also be activated by substrate. In the phenazine reductase assay, incomplete reduction of electron acceptor was observed upon addition of divalent cations and iron binding agents.
Verloes, R.; Atassi, G.; Dumont, P.; Kanarek, L.
1981-01-01
The experiments aimed at evaluating the optimal parameters in the chemo-immunotherapeutic treatment of the L1210 lymphoid leukaemia grafted to [female BALB/c (H2d) X male DBA/2 (H2d)]F1 hybrid mice, hereafter referred to as CDF1 mice. In vitro irradiation of leukaemic ascites cells by X- or gamma-rays and subsequent inoculation in mice showed that optimum immunogenicity is radiation dose-dependent. Grafting mice with 10(7) leukaemic ascites cells irradiated at optimum dose (80 GyX- or gamma-rays) delays mortality of the animals when challenged later with untreated L1210 cells, but is unable to cure mice. By contrast, specific immunoprophylaxis induced by Micrococcus, complement-triggering polysaccharides or BCG and irradiated leukaemic cells was able to protect mice against grafts of 10(4) L1210 cells. The i.p. route was notably superior to the i.v. route. When mice bearing advanced L1210 tumour were treated by chemotherapy (12 mg/kg of BCNU) on Day 6.5 after grafting 10(4) L1210 cells and subsequently treated by immunotherapy, a very high percentage (up to 90%) of mice with 10(8) leukaemic cells could be cured by repeated 1mg injections of bacterium or polysaccharide, and challenge with irradiated leukaemic cells was unnecessary. Because of the high cure rate obtained, the very regular response pattern and the non-pathogenicity, the bacterium Micrococcus lysodeikticus would seem a promising new candidate for chemo-immunotherapeutic antitumour strategies. PMID:7470382
COAGGREGATION OCCURS AMONGST BACTERIA WITHIN AND BETWEEN DOMESTIC SHOWERHEAD BIOFILMS
Vornhagen, Jay; Stevens, Michael; McCormick, David; Dowd, Scot E.; Eisenberg, Joseph N.S.; Boles, Blaise R.; Rickard, Alexander H.
2014-01-01
Showerheads support the development multi-species biofilms that can be unsightly, produce malodor, and may harbor pathogens. The outer surface spray plates of many showerheads support visible biofilms that likely contain a mixture of bacteria from freshwater and potentially from human users. Coaggregation, a mechanism by which genetically distinct bacteria specifically recognize one another, may contribute to the retention and enrichment of different species within these biofilms. The aim of this work was to identify the bacterial composition of outer spray plate biofilms of three domestic shower heads and to determine the inter- and intra-biofilm coaggregation ability of each culturable isolate. The bacterial composition of the three biofilms was determined by using bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP) and by culturing on R2A medium. An average of 31 genera per biofilm were identified using bTEFAP and a total of 30 isolates were cultured. Even though the microbial diversity of each showerhead biofilm differed, every cultured isolate was able to coaggregate with at least one other isolate from the same or different showerhead biofilm. Promiscuous coaggregating isolates belonged to the genera Brevundimonas, Micrococcus, and Lysobacter. This work suggests that coaggregation may be a common feature of showerhead biofilms. Characterization of the mechanisms mediating coaggregation, and the inter-species interactions they facilitate, may allow for novel strategies to inhibit biofilm development. PMID:23194413
Costa, Patrícia S.; Tschoeke, Diogo A.; Silva, Bruno S. O.; Thompson, Fabiano; Reis, Mariana P.; Chartone-Souza, Edmar
2015-01-01
Micrococcus sp. strain MS-AsIII-49, which was isolated from a tropical metal-polluted stream sediment in Brazil, has the ability to reduce AsV to AsIII. Analysis of its draft genome revealed 186 contigs with a total size of 2,440,924 bp encoding several metal resistance genes. PMID:25883272
Alvarado, Pamela; Huang, Ying; Wang, Jian; Garrido, Ignacio; Leiva, Sergio
2018-02-19
Marine macroalgae are emerging as an untapped source of novel microbial diversity and, therefore, of new bioactive secondary metabolites. This study was aimed at assessing the diversity and antimicrobial activity of the culturable Gram-positive bacteria associated with the surface of three co-occurring Antarctic macroalgae. Specimens of Adenocystis utricularis (brown alga), Iridaea cordata (red alga) and Monostroma hariotii (green alga) were collected from the intertidal zone of King George Island, Antarctica. Gram-positive bacteria were investigated by cultivation-based methods and 16S rRNA gene sequencing, and screened for antimicrobial activity against a panel of pathogenic microorganisms. Isolates were found to belong to 12 families, with a dominance of Microbacteriaceae and Micrococcaceae. Seventeen genera of Actinobacteria and 2 of Firmicutes were cultured from the three macroalgae, containing 29 phylotypes. Three phylotypes within Actinobacteria were regarded as potentially novel species. Sixteen isolates belonging to the genera Agrococcus, Arthrobacter, Micrococcus, Pseudarthrobacter, Pseudonocardia, Sanguibacter, Staphylococcus, Streptomyces and Tessaracoccus exhibited antibiotic activity against at least one of the indicator strains. The bacterial phylotype composition was distinct among the three macroalgae species, suggesting that these macroalgae host species-specific Gram-positive associates. The results highlight the importance of Antarctic macroalgae as a rich source of Gram-positive bacterial diversity and potentially novel species, and a reservoir of bacteria producing biologically active compounds with pharmacological potential.
Fast Mechanically Driven Daughter Cell Separation Is Widespread in Actinobacteria.
Zhou, Xiaoxue; Halladin, David K; Theriot, Julie A
2016-08-30
Dividing cells of the coccoid Gram-positive bacterium Staphylococcus aureus undergo extremely rapid (millisecond) daughter cell separation (DCS) driven by mechanical crack propagation, a strategy that is very distinct from the gradual, enzymatically driven cell wall remodeling process that has been well described in several rod-shaped model bacteria. To determine if other bacteria, especially those in the same phylum (Firmicutes) or with similar coccoid shapes as S. aureus, might use a similar mechanically driven strategy for DCS, we used high-resolution video microscopy to examine cytokinesis in a phylogenetically wide range of species with various cell shapes and sizes. We found that fast mechanically driven DCS is rather rare in the Firmicutes (low G+C Gram positives), observed only in Staphylococcus and its closest coccoid relatives in the Macrococcus genus, and we did not observe this division strategy among the Gram-negative Proteobacteria In contrast, several members of the high-G+C Gram-positive phylum Actinobacteria (Micrococcus luteus, Brachybacterium faecium, Corynebacterium glutamicum, and Mycobacterium smegmatis) with diverse shapes ranging from coccoid to rod all undergo fast mechanical DCS during cell division. Most intriguingly, similar fast mechanical DCS was also observed during the sporulation of the actinobacterium Streptomyces venezuelae Much of our knowledge on bacterial cytokinesis comes from studying rod-shaped model organisms such as Escherichia coli and Bacillus subtilis Less is known about variations in this process among different bacterial species. While cell division in many bacteria has been characterized to some extent genetically or biochemically, few species have been examined using video microscopy to uncover the kinetics of cytokinesis and daughter cell separation (DCS). In this work, we found that fast (millisecond) DCS is exhibited by species in two independent clades of Gram-positive bacteria and is particularly prevalent
Wilmowicz, Emilia; Frankowski, Kamil; Kućko, Agata; Świdziński, Michał; de Dios Alché, Juan; Nowakowska, Anna; Kopcewicz, Jan
2016-11-01
Flower abscission is a highly regulated developmental process activated in response to exogenous (e.g. changing environmental conditions) and endogenous stimuli (e.g. phytohormones). Ethylene (ET) and abscisic acid (ABA) are very effective stimulators of flower abortion in Lupinus luteus, which is a widely cultivated species in Poland, Australia and Mediterranean countries. In this paper, we show that artificial activation of abscission by flower removal caused an accumulation of ABA in the abscission zone (AZ). Moreover, the blocking of that phytohormone's biosynthesis by NDGA (nordihydroguaiaretic acid) decreased the number of abscised flowers. However, the application of NBD - an inhibitor of ET action - reversed the stimulatory effect of ABA on flower abscission, indicating that ABA itself is not sufficient to turn on the organ separation. Our analysis revealed that exogenous ABA significantly accelerated the transcriptional activity of the ET biosynthesis genes ACC synthase (LlACS) and oxidase (LlACO), and moreover, strongly increased the level of 1-aminocyclopropane-1-carboxylic acid (ACC) - ET precursor, which was specifically localized within AZ cells. We cannot exclude the possibility that ABA mediates flower abscission processes by enhancing the ET biosynthesis rate. The findings of our study will contribute to the overall basic knowledge on the phytohormone-regulated generative organs abscission in L. luteus. Copyright © 2016 Elsevier GmbH. All rights reserved.
Characterization of the Membrane-Bound Succinic Dehydrogenase of Micrococcus lysodeikticus
Pollock, Jerry J.; Linder, Regina; Salton, Milton R. J.
1971-01-01
The occurrence of succinic dehydrogenase [succinic:(acceptor) oxidoreductase, EC 1.3.99.1] in membrane fractions of Micrococcus lysodeikticus was investigated. The enzyme could be purified 10-fold, by deoxycholate treatment. Butanol extraction of membranes yielded an active fraction, nonsedimentable at 130,000 × g for 2 hr and altered in its phospholipid content relative to membranes. The activity of the enzyme in particulate preparations was decreased in the presence of competitive inhibitors and by compounds known to react with iron, sulfhydryl groups, and flavine. In this respect, the bacterial succinic dehydrogenase is similar to the enzyme derived from yeast and mammalian sources. In certain membrane fractions, Ca2+ and Mg2+ exhibited inhibitory effects whereas Triton X-100 caused activation. The enzyme could also be activated by substrate. In the phenazine reductase assay, incomplete reduction of electron acceptor was observed upon addition of divalent cations and iron binding agents. Images PMID:4327510
de Oliveira, Ygor Lucena Cabral; Nascimento da Silva, Luís Cláudio; da Silva, Alexandre Gomes; Macedo, Alexandre José; de Araújo, Janete Magali; Correia, Maria Tereza dos Santos; da Silva, Márcia Vanusa
2012-01-01
This study evaluated the antimicrobial and hemolytic activities and phytochemical constituents of hydroalcoholic extract and its fractions from Buchenavia tetraphylla leaves. Cyclohexane (BTCF), ethyl acetate (BTEF), and n-butanol-soluble (BTSBF) and non-soluble (BTNBF) fractions were obtained from a liquid-liquid partition of hydroalcoholic extract (BTHE) from B. tetraphylla leaves. The hemolytic activity of active fractions was checked. The BTHE inhibited the growth of Micrococcus luteus (MIC: 0.10 mg/mL), Pseudomonas aeruginosa (MIC: 0.20 mg/mL), Mycobacterium smegmatis (MIC: 0.39 mg/mL), Proteus vulgaris, and Staphylococcus aureus (MIC: 0.78 mg/mL for both). The more active fractions were BTCF and BTBSF. BTCF showed better potential to inhibit M. luteus (0.10 mg/mL), P. aeruginosa (0.20 mg/mL), S. enteritidis (0.39 mg/mL), and S. aureus (1.56 mg/mL). BTBSF showed the best results for M. luteus (0.10 mg/mL), M. smegmatis, B. subtilis (0.39 mg/mL for both), and P. vulgaris (0.10 mg/mL). The HC50 were greater than observed MIC: 20.30, 4.70 and 2.53 mg/mL, respectively, to BTBF, BTHE and BTCF, which. The phytochemical analysis detected the presence of flavanoids, triterpene, carbohydrate, and tannin. Our work showed for the first time the broad-spread antimicrobial activity of B. tetraphylla, which has nonhemolytic action, creating a new perspective on the interesting association of traditional and scientific knowledge. PMID:23365533
Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan
2006-01-02
To enhance the production of micrococcin GO5, a bacteriocin produced by Micrococcus sp. GO5, cultivation conditions and medium composition were optimized. The optimal initial pH and temperature for bacteriocin production were 7.0-9.0 and 37 degrees C, respectively. Micrococcus sp. GO5 displayed the highest micrococcin GO5 activity when grown in modified MRS medium that contained lactose or sucrose, rather than glucose, as a carbon source. The maximum bacteriocin activity was obtained in modified MRS medium containing 0.5% tryptone and 1.0% yeast extract as nitrogen sources instead of the other nitrogen sources present in MRS medium. Bacteriocin production was greatly affected by the concentration of K(2)HPO(4); strain GO5 produced eight-fold more bacteriocin in medium containing 2.0-2.5% K(2)HPO(4) than in medium containing 0.2% K(2)HPO(4). The optimal concentration of MgSO(4).7H(2)O for bacteriocin production was 0.5%. The production of micrococcin GO5 was increased 32-fold in shake flask culture and 16-fold in a bioreactor using the optimized medium (TY medium), compared with culturing in MRS medium.
Standoff laser-induced fluorescence of suspensions from different bacterial strains
NASA Astrophysics Data System (ADS)
Duschek, Frank; Walter, Arne; Fellner, Lea; Grünewald, Karin; Pargmann, Carsten; Handke, Jürgen; Tomaso, Herbert
2016-10-01
Biological hazardous substances like certain fungi and bacteria represent a high risk for the broad public if fallen into wrong hands. Incidents based on bio agents are commonly considered to have incalculable and complex consequences for first responders and people. The impact of such an event can be minimized by a combination of different sensor technologies that have been developed to detect bio-threats and to gather information after an incident. Sensors for bio-agents can be grouped into two categories. Sampling devices collect material from locations supposed to be contaminated, and they are able to identify biological material with high sensitivity and selectivity. However, these point sensors need to be positioned correctly in advance of an attack, and moving sources of biological material cannot be tracked. A different approach is based on optical standoff detection. For biological samples laser induced florescence (LIF) has been proven to get real time data on location and type of hazards without being in contact with the suspicious substance. This work is based on a bio-detector developed at the DLR Lampoldshausen. The LIF detection has been designed for outdoor operation at standoff distances from 20 m up to more than 100 m. The detector acquires LIF spectral data for two different excitation wavelengths (280 and 355 nm) as well as time resolved information for the fluorescence decay which can be used to classify suspicious samples. While the classification device had been trained on uncritical samples (like amino acids, NADH, yeast, chemicals, oils), this work presents the progress to more relevant, living bacteria of different strains. The low risk and non-pathogenic bacteria Bacillus thuringensis, Bacillus atrophaeus, Bacillus subtilis, Brevibacillus brevis, Micrococcus luteus, Oligella urethralis, Paenibacillus polymyxa and Escherichia coli (K12) have been investigated with the above set-up at both excitation wavelengths
[Secondary metabolites from a deep-sea-derived actinomycete Micrococcus sp. R21].
Peng, Kun; Su, Rui-qiang; Zhang, Gai-yun; Cheng, Xuan-xuan; Yang, Quan; Liu, Yong-hong; Yang, Xian-wen
2015-06-01
To investigate cytotoxic secondary metabolites of Micrococcus sp. R21, an actinomycete isolated from a deep-sea sediment (-6 310 m; 142 degrees 19. 9' E, 10 degrees 54. 6' N) of the Western Pacific Ocean, column chromatography was introduced over silica gel, ODS, and Sephadex LH-20. As a result, eight compounds were obtained. By mainly detailed analysis of the NMR data, their structures were elucidated as cyclo(4-hydroxy-L-Pro-L-leu) (1), cyclo(L-Pro-L-Gly) (2), cyclo( L-Pro-L-Ala) (3), cyclo( D-Pro-L-Leu) (4), N-β-acetyltryptamine (5), 2-hydroxybenzoic acid (6), and phenylacetic acid (7). Compound 1 exhibited weak cytotoxic activity against RAW264. 7 cells with IC50 value of 9.1 μmol x L(-1).
Repair of Ultraviolet Radiation Damage in Sensitive Mutants of Micrococcus radiodurans
Moseley, B. E. B.
1969-01-01
Various aspects of the repair of ultraviolet (UV) radiation-induced damage were compared in wild-type Micrococcus radiodurans and two UV-sensitive mutants. Unlike the wild type, the mutants are more sensitive to radiation at 265 nm than at 280 nm. The delay in deoxyribonucleic acid (DNA) synthesis following exposure to UV is about seven times as long in the mutants as in the wild type. All three strains excise UV-induced pyrimidine dimers from their DNA, although the rate at which cytosine-thymine dimers are excised is slower in the mutants. The three strains also mend the single-strand breaks that appear in the irradiated DNA as a result of dimer excision, although the process is less efficient in the mutants. It is suggested that the increased sensitivity of the mutants to UV radiation may be caused by a partial defect in the second step of dimer excision. PMID:5773016
Gupta, Aabha; Tiwari, Santosh Kumar; Netrebov, Victoria; Chikindas, Michael L
2016-09-01
Enterocin LD3 was purified using activity-guided multistep chromatography techniques such as cation-exchange and gel-filtration chromatography. The preparation's purity was tested using reverse-phase ultra-performance liquid chromatography. The specific activity was tested to be 187.5 AU µg(-1) with 13-fold purification. Purified enterocin LD3 was heat stable up to 121 °C (at 15 psi pressure) and pH 2-6. The activity was lost in the presence of papain, reduced by proteinase K, pepsin and trypsin, but was unaffected by amylase and lipase, suggesting proteinaceous nature of the compound and no role of carbohydrate and lipid moieties in the activity. MALDI-TOF/MS analysis of purified enterocin LD3 resolved m/z 4114.6, and N-terminal amino acid sequence was found to be H2NQGGQANQ-COOH suggesting a new bacteriocin. Dissipation of membrane potential, loss of internal ATP and bactericidal effect were recorded when indicator strain Micrococcus luteus was treated with enterocin LD3. It inhibited Gram-positive and Gram-negative bacteria including human pathogens such as Staphylococcus aureus, Pseudomonas fluorescens, Pseudomonas aeruginosa, Salmonella typhi, Shigella flexneri, Listeria monocytogenes, Escherichia coli O157:H7, E. coli (urogenic, a clinical isolate) and Vibrio sp. These properties of purified enterocin LD3 suggest its applications as a food biopreservative and as an alternative to clinical antibiotics.
Mastore, Maristella; Binda Rossetti, Simona; Giovannardi, Stefano; Scarì, Giorgio; Brivio, Maurizio F
2015-05-01
Insects are capable of innate immune responses elicited after microbial infection. In this process, the receptor-mediated recognition of foreign bodies and the subsequent activation of immunocompetent cells lead to the synthesis ex novo of a peptide pool with antimicrobial activity. We investigated the inducible immune response of a coleopteran, Rhynchophorus ferrugineus, challenged with both Gram-negative and Gram-positive bacteria. After immunization, we evaluated the presence of antimicrobial peptides using either biochemical analyses or microbiological techniques. The antimicrobial properties of the newly synthesized protein pool, detectable in haemolymph fractions of low molecular mass, showed strong antibacterial activity against various bacterial strains (Escherichia coli, Pseudomonas sp. OX1, Bacillus subtilis and Micrococcus luteus). In addition to the preliminary study of the mechanism of action of the pool of antimicrobial peptides, we also investigated its effects on bacterial cell walls by means of fluorescence microscopy and scanning electron microscopy. The data suggest that the main effects seem to be directed at destabilizing and damaging the bacterial wall. This study provides data that help us to understand some aspects of the inducible innate immunity in a system model that lacks anticipatory responses. However, the weevil has finely tuned its defensive strategies to counteract effectively microbial infection. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.
Hernández-Hernández, Elvia; Lira-Moreno, César Y; Guerrero-Legarreta, Isabel; Wild-Padua, Graciela; Di Pierro, Prospero; García-Almendárez, Blanca E; Regalado-González, Carlos
2017-06-01
Fresh meat is a highly perishable food. This work aimed to evaluate the influence of Mexican oregano (Lippia graveolens Kunth) incorporated into active coatings (ACs) spread on fresh pork meat as free (FEO), nanoemulsified (NEO), and microencapsulated (MEO) essential oil (EO), on its microbiological, physicochemical and sensory properties during 15 d at 4 ± 1 °C. Thymol and γ-terpinene were identified in the EO. In vitro effect of 2.85 mg EO/cm 2 was tested against Brochothrix thermosphacta, Micrococcus luteus, Lactobacillus plantarum, Pseudomonas fragi, and Salmonella Infantis. FEO antioxidant capacity (DPPH assay) was significantly higher than that of thymol, NEO and MEO (93.53%, 89.92%, 77.79%, and 78.50% inhibition, respectively), and similar to BHA (96.03%) and gallic acid (95.57%). FEO, NEO, and MEO ACs on meat caused growth inhibition of lactic acid bacteria (5 log population reduction) and Pseudomonas spp. (4 log reduction), whereas ≤1.5 log population reduction was observed for B. thermosphacta and Salmonella Infantis. Meat microbiota was more efficiently controlled by MEO than by FEO or NEO. ACs delayed lipid and oxymyoglobin oxidation of fresh pork meat. After 15 d of cold storage meat added with EO coatings was desirable for panelists, whereas untreated (UT) samples were undesirable. Active coatings are a significant alternative method for fresh meat preservation. © 2017 Institute of Food Technologists®.
Sorkhoh, N A; Ali, N; Al-Awadhi, H; Dashti, N; Al-Mailem, D M; Eliyas, M; Radwan, S S
2010-11-01
The rhizospheric soils of three tested legume crops: broad beans (Vicia faba), beans (Phaseolus vulgaris) and pea (Pisum sativum), and two nonlegume crops: cucumber (Cucumis sativus) and tomato, (Lycopersicon esculentum) contained considerable numbers (the magnitude of 10(5)g(-1) soil) of bacteria with the combined potential for hydrocarbon-utilization and mercury-resistance. Sequencing of the 16S rRNA coding genes of rhizobacteria associated with broad beans revealed that they were affiliated to Citrobacter freundii, Enterobacter aerogenes, Exiquobacterium aurantiacum, Pseudomonas veronii, Micrococcus luteus, Brevibacillus brevis, Arthrobacter sp. and Flavobacterium psychrophilum. These rhizobacteria were also diazotrophic, i.e. capable of N(2) fixation, which makes them self-sufficient regarding their nitrogen nutrition and thus suitable remediation agents in nitrogen-poor soils, such as the oily desert soil. The crude oil attenuation potential of the individual rhizobacteria was inhibited by HgCl(2), but about 50% or more of this potential was still maintained in the presence of up to 40 mgl(-1) HgCl(2). Rhizobacteria-free plants removed amounts of mercury from the surrounding media almost equivalent to those removed by the rhizospheric bacterial consortia in the absence of the plants. It was concluded that both the collector plants and their rhizospheric bacterial consortia contributed equivalently to mercury removal from soil. Copyright © 2010 Elsevier Inc. All rights reserved.
Król, Żaneta; Marycz, Krzysztof; Kulig, Dominika; Marędziak, Monika; Jarmoluk, Andrzej
2017-01-01
The aim of the study was to investigate the effect of using direct electric current (DC) of 0, 200, and 400 mA for five minutes on the physiochemical properties, cytotoxicity, antibacterial, and antioxidant activity of sodium alginate hydrosols with different sodium chloride concentrations. The pH, oxidation-reduction potential (ORP), electrical conductivity (EC), and available chlorine concentration (ACC) were measured. The effect of sodium alginate hydrosols treated with DC on Staphylococcus aureus, Listeria monocytogenes, Bacillus cereus, Micrococcus luteus, Escherichia coli, Salmonella enteritidis, Yersinia enterocolitica, Pseudomonas fluorescence, and RAW 264.7 and L929 cells was investigated. Subsequently, the antioxidant properties of hydrosols were evaluated by determining the scavenging ability of 1,1-diphenyl-2-picrylhydrazyl free radical (DPPH) and ferric reducing antioxidant power (FRAP). The results have shown that after applying 400 mA in hydrosol samples with 0.1% and 0.2% NaCl all tested bacteria were inactivated. The ACC concentration of C400 samples with NaCl was equal to 13.95 and 19.71 mg/L, respectively. The cytotoxicity analysis revealed that optimized electric field conditions and the addition of sodium chloride allow for the avoidance of toxicity effects on normal cells without disturbing the antibacterial effects. Due to the presence of oxidizing substances, the DPPH of variants treated with DC was lower than the DPPH of control samples. PMID:28327520
Zhao, Jian-Chun; Li, Xiao-Ming; Gloer, James B.; Wang, Bin-Gui
2014-01-01
The first total synthesis of marine-derived penicimonoterpene (±)-1 has been achieved in four steps from 6-methylhept-5-en-2-one using a Reformatsky reaction as the key step to construct the basic carbon skeleton. A total of 24 new derivatives of 1 have also been designed and synthesized. Their structures were characterized by analysis of their 1H NMR, 13C NMR and HRESIMS data. Some of them showed significant antibacterial activity against Aeromonas hydrophila, Escherichia coli, Micrococcus luteus, Staphylococcus aureus, Vibrio anguillarum, V. harveyi and/or V. parahaemolyticus, and some showed activity against plant-pathogenic fungi (Alternaria brassicae, Colletotrichum gloeosporioides and/or Fusarium graminearum). Some of the derivatives exhibited antimicrobial MIC values ranging from 0.25 to 4 μg/mL, which were stronger than those of the positive control. Notably, Compounds 3b and 10 showed extremely high selectively against plant-pathogenic fungus F. graminearum (MIC 0.25 μg/mL) and pathogenic bacteria E. coli (MIC 1 μg/mL), implying their potential as antimicrobial agents. SAR analysis of 1 and its derivatives indicated that modification of the carbon-carbon double bond at C-6/7, of groups on the allylic methylene unit and of the carbonyl group at C-1, effectively enhanced the antimicrobial activity. PMID:24897384
Król, Żaneta; Marycz, Krzysztof; Kulig, Dominika; Marędziak, Monika; Jarmoluk, Andrzej
2017-03-22
The aim of the study was to investigate the effect of using direct electric current (DC) of 0, 200, and 400 mA for five minutes on the physiochemical properties, cytotoxicity, antibacterial, and antioxidant activity of sodium alginate hydrosols with different sodium chloride concentrations. The pH, oxidation-reduction potential (ORP), electrical conductivity (EC), and available chlorine concentration (ACC) were measured. The effect of sodium alginate hydrosols treated with DC on Staphylococcus aureus , Listeria monocytogenes , Bacillus cereus , Micrococcus luteus , Escherichia coli , Salmonella enteritidis , Yersinia enterocolitica , Pseudomonas fluorescence , and RAW 264.7 and L929 cells was investigated. Subsequently, the antioxidant properties of hydrosols were evaluated by determining the scavenging ability of 1,1-diphenyl-2-picrylhydrazyl free radical (DPPH) and ferric reducing antioxidant power (FRAP). The results have shown that after applying 400 mA in hydrosol samples with 0.1% and 0.2% NaCl all tested bacteria were inactivated. The ACC concentration of C400 samples with NaCl was equal to 13.95 and 19.71 mg/L, respectively. The cytotoxicity analysis revealed that optimized electric field conditions and the addition of sodium chloride allow for the avoidance of toxicity effects on normal cells without disturbing the antibacterial effects. Due to the presence of oxidizing substances, the DPPH of variants treated with DC was lower than the DPPH of control samples.
Moura, M C; Napoleão, T H; Coriolano, M C; Paiva, P M G; Figueiredo, R C B Q; Coelho, L C B B
2015-09-01
This work evaluated the antibacterial activity of a water-soluble Moringa oleifera seed lectin (WSMoL) by evaluating its effect on growth, survival and cell permeability of Bacillus sp., Bacillus cereus, Bacillus pumillus, Bacillus megaterium, Micrococcus sp., Pseudomonas sp., Pseudomonas fluorescens, Pseudomonas stutzeri and Serratia marcescens. In addition, the effect of lectin on membrane integrity of most sensitive species was also evaluated. All the tested bacteria are able to cause biocorrosion and some are also responsible for human infections. WSMoL inhibited the bacterial growth, induced agglutination and promoted the leakage of proteins from cells of all strains. Bactericidal effect was detected against Bacillus sp., B. pumillus, B. megaterium, Ps. fluorescens and Ser. marcescens. The bacteriostatic effect of lectin was evident with only 6 h of incubation. Fluorescence microscopy of Ser. marcescens showed that WSMoL caused loss of cell integrity and indicated an anti-biofilm activity of the lectin. WSMoL was active against the bacteria by inhibiting growth and affecting cell permeability. The lectin also interfered with membrane integrity of Ser. marcescens, the most sensitive species. The study indicates that WSMoL was active against bacteria that cause serious problems in both industrial and health sectors. Also, the study contributes for the 'state-of-art' on antibacterial mechanisms of lectins. © 2015 The Society for Applied Microbiology.
Highly efficient decolorization of Malachite Green by a novel Micrococcus sp. strain BD15.
Du, Lin-Na; Zhao, Ming; Li, Gang; Zhao, Xiao-Ping; Zhao, Yu-Hua
2011-08-01
Malachite Green (MG) is used for a variety of applications but is also known to be carcinogenic and mutagenic. In this study, a novel Micrococcus sp. (strain BD15) was observed to efficiently decolorize MG. The purposes of this study were to explore the optimal conditions for decolorization and to evaluate the potential use of this strain for MG decolorization. Optical microscope and UV-visible analyses were carried out to determine whether the decolorization was due to biosorption or biodegradation. A Plackett-Burman design was employed to investigate the effect of various parameters on decolorization, and response surface methodology was then used to explore the optimal decolorization conditions. Kinetics analysis and antimicrobial activity tests were also performed. The results indicated that the decolorization by the strain was mainly due to biodegradation. Concentrations of MG, urea, and yeast extract and inoculum size had significantly positive effects on MG decolorization, while concentrations of CuCl(2) and MgCl(2), and temperature had significantly negative effects. The interaction between different parameters could significantly affect decolorization, and the optimal conditions for decolorization were 1.0 g/L urea, 0.9 g/L yeast extract, 100 mg/L MG, 0.1 g/L inoculums (dry weight), and incubation at 25.2°C. Under the optimal conditions, 96.9% of MG was removed by the strain within 1 h, which represents highly efficient microbial decolorization. Moreover, the kinetic data for decolorization fit a second-order model well, and the strain showed a good MG detoxification capability. Based on the results of this study, we propose Micrococcus sp. strain BD15 as an excellent candidate strain for MG removal from wastewater.
Bioremediation of contaminated surface water by immobilized Micrococcus roseus.
Li, H; Li, P; Hua, T; Zhang, Y; Xiong, X; Gong, Z
2005-08-01
The problems caused by contaminated surface water have gradually become more serious in recent years. Although various remediation technologies were investigated, unfortunately, no efficient method was developed. In this paper, a new bioremediation technology was studied using Micrococcus roseus, which was immobilized in porous spherical beads by an improved polyvinyl alcohol (PVA) - sodium alginate (SA) embedding method. The experimental results indicated that COD removal rate could reach 64.7 % within 72 hours when immobilized M. roseus beads were used, which was ten times as high as that of free cells. The optimum inoculation rate of immobilized M. roseus beads was 10 % (mass percent of the beads in water sample, g g(-1)). Suitable aeration was proved necessary to enhance the bioremediation process. The immobilized cells had an excellent tolerance to pH and temperature changes, and were also more resistant to heavy metal stress compared with free cells. The immobilized M. roseus beads had an excellent regeneration capacity and could be reused after 180-day continuous usage. The Scanning Electronic Microscope (SEM) analysis showed that the bead microstructure was suitable for M. roseus growth, however, some defect structures should still be improved.
Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y.I.; Stothard, Paul
2016-01-01
We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds. PMID:27672405
Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y I; Stothard, Paul
2016-01-01
We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds.
Ning, Xianhui; Wang, Ruijia; Li, Xue; Wang, Shuyue; Zhang, Mengran; Xing, Qiang; Sun, Yan; Wang, Shi; Zhang, Lingling; Hu, Xiaoli; Bao, Zhenmin
2015-10-01
Myeloid differentiation factor 88 (MyD88) is a pivotal adaptor in the TLR/IL-1R signaling pathway, which plays an important role in activating the innate immune system. Although MyD88 genes have been identified in a variety of species, they have not been systematically characterized in scallops. In this study, five MyD88 genes were identified in Yesso scallop (Patinopecten yessoensis), PyMyD88-1, PyMyD88-2a, PyMyD88-2b, PyMyD88-3 and PyMyD88-4, which consisted of two pairs of tandem duplications located on the same chromosome. To our knowledge, this is the largest number of MyD88 genes found in an invertebrate. Phylogenetic and protein structural analyses were carried out to determine the identities and evolutionary relationships of these genes. PyMyD88s have highly conserved structures compared to MyD88 genes from other invertebrate species, except for PyMyD88-4, which contains only a DD domain, suggesting the evolutionarily conserved form of this particular gene member. We investigated the expression profiles of PyMyD88 genes at different developmental stages and in healthy adult tissues and hemocytes after Micrococcus luteus and Vibrio anguillarum infection using quantitative real-time PCR (qRT-PCR). The expression of most PyMyD88s was significantly induced in the acute phase (3-6 h) after infection with both gram-positive (M. luteus) and gram-negative (V. anguillarum) bacteria, with much more dramatic changes in PyMyD88 expression being observed after V. anguillarum challenge. Collectively, the abundance of MyD88s and their specific expression patterns provide insight into their versatile roles in the response of the bivalve innate immune system to gram-negative bacterial pathogens. Copyright © 2015 Elsevier Ltd. All rights reserved.
Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E.
2014-01-01
The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano. PMID:25177730
Riazi, Shadi; Dover, Sara E.; Chikindas, Michael L.
2012-01-01
Aims To determine the mechanism of action of antimicrobial protein, lactosporin, against Gardnerella vaginalis and to evaluate its safety in-vitro. Methods and Results Bacillus coagulans ATCC 7050 was grown at 37 °C for 18 hours. The cell free supernatant was concentrated 10-fold and screened for antimicrobial activity against indicator strain Micrococcus luteus. The mode of action of lactosporin was determined by measuring the potassium release and monitoring the changes in transmembrane potential (Δψ) and transmembrane pH (ΔpH) of the sensitive cells. Lactosporin caused efflux of potassium ions from M. luteus cells and dissipation of ΔpH in G. vaginalis while it had no effect on the Δψ. The safety of lactosporin was evaluated by using EpiVaginal™ ectocervical (VEC-100) tissue model. Over 80% of the cells in the vaginal tissue remained viable after exposure to lactosporin for 24 hours. Conclusions Lactosporin potentially exerts its antimicrobial activity by selective dissipation of ΔpH and/or by causing leakage of ions from the sensitive cells. Safety studies suggest that lactosporin is a non-cytotoxix antimicrobial for vaginal application. Significance and Impact of the Study This study revealed that lactosporin is an effective and safe antimicrobial preparation with potential application for control of bacterial vaginosis. PMID:22737982
Antimicrobial activity in the common seawhip, Leptogorgia virgulata (Cnidaria: Gorgonaceae).
Shapo, Jacqueline L; Moeller, Peter D; Galloway, Sylvia B
2007-09-01
Antimicrobial activity was examined in the gorgonian Leptogorgia virgulata (common seawhip) from South Carolina waters. Extraction and assay protocols were developed to identify antimicrobial activity in crude extracts of L. virgulata. Detection was determined by liquid growth inhibition assays using Escherichia coli BL21, Vibrio harveyii, Micrococcus luteus, and a Bacillus sp. isolate. This represents the first report of antimicrobial activity in L. virgulata, a temperate/sub-tropical coral of the western Atlantic Ocean. Results from growth inhibition assays guided a fractionation scheme to identify active compounds. Reverse-phase HPLC, HPLC-mass spectrometry, and 1H and 13C NMR spectroscopy were used to isolate, purify, and characterize metabolites in antimicrobial fractions of L. virgulata. Corroborative HPLC-MS/NMR evidence validated the presence of homarine and a homarine analog, well-known emetic metabolites previously isolated from L. virgulata, in coral extracts. In subsequent assays, partially-purified L. virgulata fractions collected from HPLC-MS fractionation were shown to contain antimicrobial activity using M. luteus and V. harveyii. This study provides evidence that homarine is an active constituent of the innate immune system in L. virgulata. We speculate it may act synergistically with cofactors and/or congeners in this octocoral to mount a response to microbial invasion and disease.
Hernández-Hernández, Elvia; Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E
2014-01-01
The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano.
Multiplicity of genome equivalents in the radiation-resistant bacterium Micrococcus radiodurans.
Hansen, M T
1978-01-01
The complexity of the genome of Micrococcus radiodurans was determined to be (2.0 +/- 0.3) X 10(9) daltons by DNA renaturation kinetics. The number of genome equivalents of DNA per cell was calculated from the complexity and the content of DNA. A lower limit of four genome equivalents per cell was approached with decreasing growth rate. Thus, no haploid stage appeared to be realized in this organism. The replication time was estimated from the kinetics and amount of residual DNA synthesis after inhibiting initiation of new rounds of replication. From this, the redundancy of terminal genetic markers was calculated to vary with growth rate from four to approximately eight copies per cell. All genetic material, including the least abundant, is thus multiply represented in each cell. The potential significance of the maintenance in each cell of multiple gene copies is discussed in relation to the extreme radiation resistance of M. radiodurans. PMID:649572
Yamada, M; Koyama, T; Matsuhashi, M
1977-01-01
Micrococcus rubens, a gram-positive occus, usually forms large, cubic packets of more than 500 cells that are regularly arranged in three-dimensional cell groups. In medium with extremely low concentration of Mg2+ and phosphate, in which the cells can only grow on a agar surface, it formed small groups of 2 to 20 cells. Irregularly arraged cell groups of intermediated size were obtained in culture media containing intermediated concentrations of Mg2+ and phosphate. Mutants that formed irregular cell groups of intermediate size under normal culture conditions were also obtained. Images PMID:845123
Li, Xihong; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen; Shi, Guohui
2013-01-01
Background The Chinese mitten crab Eriocheir sinensis is an important economic crustacean and has been seriously attacked by various diseases, which requires more and more information for immune relevant genes on genome background. Recently, high-throughput RNA sequencing (RNA-seq) technology provides a powerful and efficient method for transcript analysis and immune gene discovery. Methods/Principal Findings A cDNA library from hepatopancreas of E. sinensis challenged by a mixture of three pathogen strains (Gram-positive bacteria Micrococcus luteus, Gram-negative bacteria Vibrio alginolyticus and fungi Pichia pastoris; 108 cfu·mL−1) was constructed and randomly sequenced using Illumina technique. Totally 39.76 million clean reads were assembled to 70,300 unigenes. After ruling out short-length and low-quality sequences, 52,074 non-redundant unigenes were compared to public databases for homology searching and 17,617 of them showed high similarity to sequences in NCBI non-redundant protein (Nr) database. For function classification and pathway assignment, 18,734 (36.00%) unigenes were categorized to three Gene Ontology (GO) categories, 12,243 (23.51%) were classified to 25 Clusters of Orthologous Groups (COG), and 8,983 (17.25%) were assigned to six Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. Potentially, 24, 14, 47 and 132 unigenes were characterized to be involved in Toll, IMD, JAK-STAT and MAPK pathways, respectively. Conclusions/Significance This is the first systematical transcriptome analysis of components relating to innate immune pathways in E. sinensis. Functional genes and putative pathways identified here will contribute to better understand immune system and prevent various diseases in crab. PMID:23874555
Seo, Jung-Kil; Lee, Min Jeong; Go, Hye-Jin; Kim, Yeon Jun; Park, Nam Gyu
2014-02-01
A 3.4 kDa of antimicrobial peptide was purified from an acidified skin extract of skipjack tuna, Katsuwonus pelamis, by preparative acid-urea-polyacrylamide gel electrophoresis and C18 reversed-phase HPLC. A comparison of the N-terminal amino acid sequence of the purified peptide with that of other known polypeptides revealed high sequence homology with the YFGAP (Yellowfin tuna Glyceraldehyde-3-phosphate dehydrogenase-related Antimicrobial Peptide); thus, this peptide was identified as the skipjack tuna GAPDH-related antimicrobial peptide (SJGAP). SJGAP showed potent antimicrobial activity against Gram-positive bacteria, such as Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, and Streptococcus iniae (minimal effective concentrations [MECs], 1.2-17.0 μg/mL), Gram-negative bacteria, such as Aeromonas hydrophila, Escherichia coli D31, and Vibrio parahaemolyticus (MECs, 3.1-12.0 μg/mL), and against Candida albicans (MEC, 16.0 μg/mL) without significant hemolytic activity. Antimicrobial activity of this peptide is heat-stable but salt-sensitive. According to the secondary structural prediction and the homology modeling, this peptide consists of three secondary structural motifs, including one α-helix and two parallel β-strands, and forms an amphipathic structure. This peptide showed neither membrane permeabilization ability nor killing ability, but did display a small degree of leakage ability. These results suggest that SJGAP acts through a bacteriostatic process rather than bactericidal one. SJGAP is another GAPDH-related antimicrobial peptide isolated from skipjack tuna and likely plays an important role for GAPDH in the innate immune defense of tuna fish. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ravagnani, Adriana; Finan, Christopher L; Young, Michael
2005-03-17
In Micrococcus luteus growth and resuscitation from starvation-induced dormancy is controlled by the production of a secreted growth factor. This autocrine resuscitation-promoting factor (Rpf) is the founder member of a family of proteins found throughout and confined to the actinobacteria (high G + C Gram-positive bacteria). The aim of this work was to search for and characterise a cognate gene family in the firmicutes (low G + C Gram-positive bacteria) and obtain information about how they may control bacterial growth and resuscitation. In silico analysis of the accessory domains of the Rpf proteins permitted their classification into several subfamilies. The RpfB subfamily is related to a group of firmicute proteins of unknown function, represented by YabE of Bacillus subtilis. The actinobacterial RpfB and firmicute YabE proteins have very similar domain structures and genomic contexts, except that in YabE, the actinobacterial Rpf domain is replaced by another domain, which we have called Sps. Although totally unrelated in both sequence and secondary structure, the Rpf and Sps domains fulfil the same function. We propose that these proteins have undergone "non-orthologous domain displacement", a phenomenon akin to "non-orthologous gene displacement" that has been described previously. Proteins containing the Sps domain are widely distributed throughout the firmicutes and they too fall into a number of distinct subfamilies. Comparative analysis of the accessory domains in the Rpf and Sps proteins, together with their weak similarity to lytic transglycosylases, provide clear evidence that they are muralytic enzymes. The results indicate that the firmicute Sps proteins and the actinobacterial Rpf proteins are cognate and that they control bacterial culturability via enzymatic modification of the bacterial cell envelope.
Effect of impact stress on microbial recovery on an agar surface.
Stewart, S L; Grinshpun, S A; Willeke, K; Terzieva, S; Ulevicius, V; Donnelly, J
1995-01-01
Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. The relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving agar slide impactor operating over a flow rate range from 3.8 to 40 liters/min yielding impaction velocities from 24 to 250 m/s. As a reference, the sixth stage of the Andersen Six-Stage Viable Particle Sizing Sampler was used at its operating flow rate of 28.3 liters/min (24 m/s). At a collection efficiency of close to 100% for the agar slide impactor, an increase in sampling flow rate and, therefore, in impaction velocity produced a significant decline in the percentage of microorganisms recovered. Conversely, when the collection efficiency was less than 100%, greater recovery and lower injury rates occurred. The highest relative rate of recovery (approximately 51% for P. fluorescens and approximately 62% for M. luteus) was obtained on the complete (Trypticase soy agar) medium at 40 and 24 m/s (6.4 and 3.8 liters/min), respectively. M. luteus demonstrated less damage than P. fluorescens, suggesting the hardy nature of the gram-positive strain versus that of the gram-negative microorganism. Comparison of results from the agar slide and Andersen impactors at the same sampling velocity showed that recovery and injury due to collection depends not only on the magnitude of the impaction velocity but also on the degree to which the microorganisms may be embedded in the collection medium.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7747946
Retreived bacteria from Noctiluca miliaris (green) bloom of the northeastern Arabian Sea
NASA Astrophysics Data System (ADS)
Basu, Subhajit; Matondkar, S. G. Prabhu; Furtado, Irene
2013-01-01
In recent years, seasonal blooms of the dinoflagellate Noctiluca miliaris have appeared in the open-waters of the northern Arabian Sea (NAS). This study provides the first characterization of bacteria from a seasonal bloom of green Noctiluca of NAS (20°N-17°N and 64°E-70°E), during the spring-inter-monsoon cruise of Sagar Sampada 253, in March 2007. Bacterial growth as assessed by most-probable number (MPN) and plate counts, revealed `variable-physiotypes' over a wide range of salinities (0%-25% w/v NaCl), pH levels (5-8.5), and organic nutrient strengths, in comparison to non-bloom waters. MPN indices of bacteria in surface waters of bloom stations *DWK and *PRB, corresponded to (3.08-4.41)×103 cells/mL at 3.5% NaCl (w/v), and (2.82-9.49)×102 cells/mL at 25% (w/v) NaCl in tryptone-yeast extract broth (TYE). Plate counts were (1.12-4)×106 CFU/mL at 0% (w/v) NaCl, (1.28-3.9)×106 CFU/mL at 3.5% (w/v) NaCl, and (0.4-7)×104 CFU/mL at 25% NaCl (w/v) on TYE. One-tenth-strength Zobell's gave (0.6-3.74)×105 CFU/mL at pH 5 to (3.58-7.5)×105 CFU/mL at pH 8.5. These bacteria were identified to the genera Bacillus, Cellulomonas, Staphylococcus, Planococcus, Dietzia, Virgibacillus, Micrococcus, Sporosarcinae, Leucobacter, and Halomonas. The identity of three strains (GUFBSS253N2, GUFBSS253N30, and GUFBSS253N84) was confirmed through 16S rDNA sequence homology as Bacillus cohnii, Bacillus flexus, and Bacillus cereus. The ˜2-3-fold higher plate counts of culturable bacteria from the open-waters of the NAS indicate that these bacteria could critically determine the biogeochemical dynamics of the bloom and its milieu. The role of these bacteria in sustaining/terminating the bloom is under evaluation.
Shahzad, Raheem; Waqas, Muhammad; Khan, Abdul Latif; Al-Hosni, Khadija; Kang, Sang-Mo; Seo, Chang-Woo; Lee, In-Jung
2017-06-01
Bacterial endophytes from the phyllosphere and rhizosphere have been used to produce bioactive metabolites and to promote plant growth. However, little is known about the endophytes residing in seeds. This study aimed to isolate and identify seed-borne bacterial endophytes from rice and elucidate their potential for phytohormone production and growth enhancement. The isolated endophytes included Micrococcus yunnanensis RWL-2, Micrococcus luteus RWL-3, Enterobacter soli RWL-4, Leclercia adecarboxylata RWL-5, Pantoea dispersa RWL-6, and Staphylococcus epidermidis RWL-7, which were identified using 16S rRNA sequencing and phylogenetic analysis. These strains were analyzed for indoleacetic acid (IAA) production by using GC-MS and IAA was found in the range of 11.50 ± 0.77 μg ml -1 to 38.80 ± 1.35 μg ml -1 . We also assessed the strains for plant growth promoting potential because these isolates were able to produce IAA in pure culture. Most of the growth attributes of rice plants (shoot and root length, fresh and dry biomass, and chlorophyll content) were significantly increased by bacterial endophytes compared to the controls. These results show that IAA producing bacterial endophytes can improve hostplant growth traits and can be used as bio-fertilizers.
Reichel, Mirja; Heisig, Peter; Kampf, Günter
2008-01-01
Background Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Methods Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 – 8°C onto tryptic soy agar containing a neutralizing mixture. Results The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Conclusion Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy
Reichel, Mirja; Heisig, Peter; Kampf, Günter
2008-12-02
Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 - 8 degrees C onto tryptic soy agar containing a neutralizing mixture. The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy data. Attention should be paid
Survival of epiphytic bacteria from seed stored on the Long Duration Exposure Facility (LDEF)
NASA Technical Reports Server (NTRS)
Schuerger, Andrew C.; Norman, Bret L.; Angelo, Joseph A., Jr.
1991-01-01
This study was designed to determine the survival of microorganisms exposed to the relatively harsh conditions found in low Earth orbit (LEO). Seed of corn, sunflower, canteloupe, zucchini, bean, pea, and pumpkin cultivars were packaged in two 18 x 2.5 cm aluminum tubes; wall thickness for each tube was 1.33 mm. One seed tube was attacked to payload M0006, tray C-2; a second tube was stored at room temperature in a lab on Earth. Five lithium fluoride thermoluminescent dosimetry wafers (TLD-100 wafers) were placed in each aluminum tube. The total mean dosages for flight and ground-control TLD wafers were 210.0 and 0.9 rads, respectively. Seeds were washed for 2 hrs in a phosphate buffered saline solution. Bacteria were isolated by plating samples of the seed-washings onto dilute tryptic soy agar. Pure isolates of morphologically distinct bacteria were obtained by standard microbiological procedures. Bacteria were grouped according to colony-type and preliminary identification was completed using a fatty-acid analysis system. Bacillus spp. were the primary microoganisms that survived on seed during the experiment. Bacterial diversity and relative abundance were similar for the ground flight seed. Bacillus subtilus, B. pumilus, B. licheniformis, B. polymyxa, B. megaterium, and B. pabuli were isolated most frequently. Members of the genera Kurthia, Listeria, Micrococcus, and Arthrobacter were also isolated from flight and ground control seed. Results support the hypothesis that terrestrial microorganisms can survive long periods of time in the relatively harsh LEO environment.
Gomes-Figueiredo, Josiane; Pimentel, Ida C; Vicente, Vânia A; Pie, Marcio R; Kava-Cordeiro, Vanessa; Galli-Terasawa, Lygia; Pereira, José O; de Souza, Antonia Q L; Glienke, Chirlei
2007-10-01
Thirteen endophytic fungal strains of the genus Pestalotiopsis were isolated from the medicinal plant Maytenus ilicifolia Mart. ex. Reiss (commonly known as "espinheira santa") and their antimicrobial properties were investigated. Two isolates were successful in inhibiting the growth of the tested microorganisms (Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Staphylococcus aureus, and methicillin-resistant Staphylococcus aureus (MRSA)) using the technique of bioautographic thin-layer chromatography (TLC) agar overlay assay. An analysis based on a polyphasic approach integrating taxonomic information, morphological traits, RAPD markers, and the sequencing of the ITS1-5.8S-ITS2 of the rDNA led to the assignment of the isolates as belonging to the species Pestalotiopsis microspora, Pestalotiopsis vismiae, and Pestalotiopsis leucothoes. Therefore, the present study presents a new approach to the study of endophytic fungi of the genus Pestalotiopsis.
Development of a simple and low cost microbioreactor for high-throughput bioprocessing.
Rahman, Pattanathu K S M; Pasirayi, Godfrey; Auger, Vincent; Ali, Zulfiqur
2009-02-01
A simple microbioreactor for high-throughput bioprocessing made from low cost polymer polytetrafluoroethylene (PTFE) tubes with a working volume of 1.5 ml is described. We have developed a microfluidic system that handles a small population of cells of a model microorganism, Pseudomonas aeruginosa DS10-129. Under the conditions of the microbioreactor, the organism produced extracellular secondary metabolites by using nutrient broth modified with glycerol. Pyocyanins were isolated from the fermented medium as a metabolite of interest. Antibiotic properties of pyocyanin were effective against a number of microorganisms such as Staphylococcus aureus, S. epidermis, Bacillus subtilis, Micrococcus luteus and Saccharomyces cerevisiae. Batch fermentation of the model organism in the microbioreactor was compared to shake-flask and conventional bench fermenter methods. Results obtained from the microbioreactor compared favourably with the conventional processes.
NASA Astrophysics Data System (ADS)
Venkatesham, Maragoni; Ayodhya, Dasari; Madhusudhan, Alle; Veera Babu, Nagati; Veerabhadram, Guttena
2014-01-01
Stable silver nanoparticles were synthesized using chitosan acting as both reducing and stabilizing agent without using any toxic chemicals. This reaction was carried out in an autoclave at a pressure of 15 psi and 120 °C temperature by varying the time. The influence of different parameters such as time, change of concentration of silver nitrate and concentration of chitosan on the formation of silver nanoparticles were studied. The synthesized silver nanoparticles were characterized by UV-visible spectroscopy, Fourier transform infrared, X-ray diffraction and transmission electron microscopy. The results of catalytic reduction of 4-nitrophenol by sodium borohydride in the presence of green synthesized silver nanoparticles were presented. The antimicrobial activity of silver nanoparticles was tested against Escherichia coli and Micrococcus luteus and was found to be possessing inhibiting property.
Isolation and properties of mesosomal membrane fractions from Micrococcus lysodeikticus
Owen, Peter; Freer, John H.
1972-01-01
1. A method is described for the isolation of pure mesosomal membrane fractions from Micrococcus lysodeikticus. 2. Plasmolysis of cells, before wall digestion, was necessary for effective mesosome release. 3. The effect of mild shearing forces, temperature and time upon the release of mesosomal membrane from protoplasts was investigated. 4. The optimum yield of mesosomal membranes from stable protoplasts was achieved at 10mm-Mg2+. 5. Mesosomal membrane vesicle fractions prepared at differing Mg2+ concentrations above 10mm were similar in chemical composition. 6. Comparison of the properties of peripheral and mesosomal membrane fractions revealed major differences in the distribution of protein components, membrane phosphorus, mannose and dehydrogenase activities between the two fractions. 7. Only cytochrome b556 was detected in mesosomal membranes, whereas peripheral membranes contained a full complement of cytochromes. 8. Preliminary investigations suggested the localization of an autolytic enzyme(s) in the mesosomal vesicles. 9. The anatomy of mesosomal and peripheral membrane have been compared by the negative-staining and freeze-fracture technique. 10. The results are discussed in relation to a plausible role for the mesosome. ImagesPLATE 1PLATE 2PLATE 3PLATE 4 PMID:4655825
Posada, Luisa F; Alvarez, Javier C; Hu, Chia-Hui; de-Bashan, Luz E; Bashan, Yoav
2016-09-01
Strains of Bacillus subtilis are plant growth-promoting bacteria (PGPB) of many crops and are used as inoculants. PGPB colonization is an important trait for success of a PGPB on plants. A specific probe, based on the 16 s rRNA of Bacillus subtilis, was designed and evaluated to distinguishing, by fluorescence in situ hybridization (FISH), between this species and the closely related Bacillus amyloliquefaciens. The selected target for the probe was between nucleotides 465 and 483 of the gene, where three different nucleotides can be identified. The designed probe successfully hybridized with several strains of Bacillus subtilis, but failed to hybridize not only with B. amyloliquefaciens, but also with other strains such as Bacillus altitudinis, Bacillus cereus, Bacillus gibsonii, Bacillus megaterium, Bacillus pumilus; and with the external phylogenetic strains Azospirillum brasilense Cd, Micrococcus sp. and Paenibacillus sp. The results showed the specificity of this molecular probe for B. subtilis.
Egert, Markus; Späth, Kerstin; Weik, Karoline; Kunzelmann, Heike; Horn, Christian; Kohl, Matthias; Blessing, Frithjof
2015-03-01
Smartphone touchscreens are known as pathogen carriers in clinical environments. However, despite a rapidly growing number of smartphone users worldwide, little is known about bacterial contamination of smartphone touchscreens in non-clinical settings. Such data are needed to better understand the hygienic relevance of these increasingly popular items. Here, 60 touchscreens of smartphones provided by randomly chosen students of a German university were sampled by directly touching them with contact agar plates. The average bacterial load of uncleaned touchscreens was 1.37 ± 0.33 CFU/cm(2). Touchscreens wiped with commercially available microfiber cloths or alcohol-impregnated lens wipes contained significantly less bacteria than uncleaned touchscreens, i.e., 0.22 ± 0.10 CFU/cm(2) and 0.06 ± 0.02 CFU/cm(2), respectively. Bacteria isolated from cleaned and uncleaned touchscreens were identified by means of MALDI Biotyping. Out of 111 bacterial isolates, 56 isolates (50 %) were identified to genus level and 27 (24 %) to species level. The vast majority of the identified bacteria were typical human skin, mouth, lung, and intestinal commensals, mostly affiliated with the genera Staphylococcus and Micrococcus. Five out of 10 identified species were opportunistic pathogens. In conclusion, the touchscreens investigated here showed low bacterial loads and a species spectrum that is typical for frequently touched surfaces in domestic and public environments, the general health risk of which is still under debate.
Kimoto, Hideyuki; Yoshimune, Kazuaki; Matsuyma, Hidetoshi; Yumoto, Isao
2012-01-01
A psychrotolerant bacterium, strain T-3 (identified as Psychrobacter piscatorii), that exhibited an extraordinarily high catalase activity was isolated from the drain pool of a plant that uses H2O2 as a bleaching agent. Its cell extract exhibited a catalase activity (19,700 U·mg protein−1) that was higher than that of Micrococcus luteus used for industrial catalase production. Catalase was approximately 10% of the total proteins in the cell extract of the strain. The catalase (PktA) was purified homogeneously by only two purification steps, anion exchange and hydrophobic chromatographies. The purified catalase exhibited higher catalytic efficiency and higher sensitivity of activity at high temperatures than M. luteus catalase. The deduced amino acid sequence showed the highest homology with catalase of Psycrobacter cryohalolentis, a psychrotolelant bacterium obtained from Siberian permafrost. These findings suggest that the characteristics of the PktA molecule reflected the taxonomic relationship of the isolate as well as the environmental conditions (low temperatures and high concentrations of H2O2) under which the bacterium survives. Strain T-3 efficiently produces a catalase (PktA) at a higher rate than Exiguobacterium oxidotolerans, which produces a very strong activity of catalase (EktA) at a moderate rate, in order to adapt to high concentration of H2O2. PMID:22408420
Zhang, Mingming; Zhou, Fan; Chu, Yuan; Zhao, Zhangwu; An, Chunju
2013-01-01
Antimicrobial peptides/proteins (AMPs) are a group of immune proteins that exhibit strong antibiotic properties against numerous infectious bacterial strains. They are evolutionarily conserved and present in every kingdom and phylum, ranging from prokaryotes to humans. We analyzed the transciptome from the larvae of Asian corn borer, Ostrinia furnacalis (Guenée), and identified several putative AMP transcripts, OfgLys5, OfgLys6, OfgLys10, OfgAtt, and OfgIID. OfgLys5, OfgLys6, and OfgLys10 are all highly homologous with c-type lysozymes, and OfgAtt shows significant identities with Lepidoptera attacin. The amino acid sequence of OfgLys5 and OfgLys6 possessed all conserved features critical for fundamental structure and function of c-type lysozyme, including the two catalytic sites, Glu32 and Asp50. OfgAtt is a typical glycine-rich protein. The antimicrobial activity of O. furnacalis hemolymph increased significantly after injection with Escherichia coli, Micrococcus luteus, or Beauveria bassiana. OfgAtt, IDD, and Lys6 are expressed at low level prior to the challenge, but strongly induced against Gram-positive and negative bacteria, and fungi. Under the same inducement conditions, the transcripts of these three genes elevated most when fifth instar larvae were injected. Therefore, O. furnacalis larvae are induced to produce antimicrobial materials in the hemolymph after the infection, and increase of lysozyme and attacin may contribute to the antimicrobial activity. PMID:24155672
The transcriptome of Spodoptera exigua larvae exposed to different types of microbes.
Pascual, Laura; Jakubowska, Agata K; Blanca, Jose M; Cañizares, Joaquin; Ferré, Juan; Gloeckner, Gernot; Vogel, Heiko; Herrero, Salvador
2012-08-01
We have obtained and characterized the transcriptome of Spodoptera exigua larvae with special emphasis on pathogen-induced genes. In order to obtain a highly representative transcriptome, we have pooled RNA from diverse insect colonies, conditions and tissues. Sequenced cDNA included samples from 3 geographically different colonies. Enrichment of RNA from pathogen-related genes was accomplished by exposing larvae to different pathogenic and non-pathogenic microbial agents such as the bacteria Bacillus thuringiensis, Micrococcus luteus, and Escherichia coli, the yeast Saccharomyces cerevisiae, and the S. exigua nucleopolyhedrovirus (SeMNPV). In addition, to avoid the loss of tissue-specific genes we included cDNA from the midgut, fat body, hemocytes and integument derived from pathogen exposed insects. RNA obtained from the different types of samples was pooled, normalized and sequenced. Analysis of the sequences obtained using the Roche 454 FLX and Sanger methods has allowed the generation of the largest public set of ESTs from S. exigua, including a large group of immune genes, and the identification of an important number of SSR (simple sequence repeats) and SNVs (single nucleotide variants: SNPs and INDELs) with potential use as genetic markers. Moreover, data mining has allowed the discovery of novel RNA viruses with potential influence in the insect population dynamics and the larval interactions with the microbial pesticides that are currently in use for the biological control of this pest. Copyright © 2012 Elsevier Ltd. All rights reserved.
Viskelis, P; Rubinskiene, M; Jasutiene, I; Sarkinas, A; Daubaras, R; Cesoniene, L
2009-03-01
Amounts of total phenolics, anthocyanins, and ascorbic acid in 4 American cranberry varieties harvested at 4 stages of maturity were measured. The larger amount of phenolic compounds was found in berries of "Black Veil" cultivar (504 mg/100 g) at II stage of maturity. Significantly larger amounts of anthocyanins were determined in the overripe berries of the cultivars "Ben Lear" and "Black Veil." The amount of ascorbic acid in berries increased during ripening from I to III stage, and slightly decreased in the overripe berries. The biggest quantities of ascorbic acid were found in the ripe berries of "Ben Lear" cultivar (15.8 mg/100 g). The distribution of anthocyanins pigments was determined by HPLC-UV/MS in mature berries. The composition of individual anthocyanins in berries was quite similar in all the studied cranberry cultivars. While skins of cranberries are rich in anthocyanins and other phenolic compounds, the extracts of the by-products of cranberries juice-berry cakes, were analyzed and obtained results were compared with the properties of extracts made from whole berries. The anthocyanins and total phenolics content, radical scavenging activity, antimicrobial activity of the whole berries, and their press cakes extracts were measured. All investigated extracts from berries and their press cakes showed good radical scavenging activity and revealed antimicrobial properties. It was found that Bacillus cereus (ATCC 10876) and Micrococcus luteus (ATCC 9341) were the most sensitive among 10 tested Gram-negative and Gram-positive bacteria.
Zhang, Xiao-Yong; Fu, Wen; Chen, Xiao; Yan, Mu-Ting; Huang, Xian-De; Bao, Jie
2018-06-09
To search for more microbial resources for screening environment-friendly antifoulants, we investigated the phylogenetic diversity and antifouling potentials of culturable fungi in mangrove sediments from Techeng Isle, China. A total of 176 isolates belonging to 57 fungal taxa were recovered and identified. The high levels of diversity and abundance of mangrove fungi from Techeng Isle were in accordance with previous studies on fungi from other mangrove ecosystems. Fifteen of the 176 isolates demonstrated high divergence (87-93%) from the known fungal taxa in GenBank. Moreover, 26 isolates recorded in mangrove ecosystems for the first time. These results suggested that mangrove sediments from Techeng Isle harbored some new fungal communities compared with other mangrove ecosystems. The antifouling activity of 57 representative isolates (belonging to 57 different fungal taxa) was tested against three marine bacteria (Loktanella hongkongensis, Micrococcus luteus and Pseudoalteromonas piscida) and two marine macrofoulers (bryozoan Bugula neritina and barnacle Balanus amphitrite). Approximately 40% of the tested isolates displayed distinct antifouling activity. Furthermore, 17 fungal isolates were found to display strong or a wide spectrum of antifouling activity in this study, suggesting that these isolates deserve further study as potential sources of novel antifouling metabolites. To our knowledge, this is the first report on the investigation of the phylogenetic diversity and antifouling potential of culturable fungi in mangrove sediments from Techeng Isle, China. These results contribute to our knowledge of mangrove fungi and further increases the pool of fungi available for natural bioactive product screening.
NASA Astrophysics Data System (ADS)
Devi, Jai; Batra, Nisha; Malhotra, Rajesh
2012-11-01
New Schiff bases pyrazine-2-carboxylicacid (phenyl-pyridin-2-yl-methylene)-hydrazide (Hpch-bp) HL1 and pyrazine-2-carboxylicacid (pyridin-2-ylmethylene)-hydrazide (Hpch-pc) HL2 derived from condensation of pyrazine carboxylic hydrazide (Hpch) with 2-benzoyl pyridine (bp) or pyridine 2-carbaldehyde (pc) and their transition metal complexes of type ML(1-2)2 have been synthesized, where M = Mn(II), Co(II), Ni(II), Cu(II) and Zn(II). Characterization of ligands and their metal complexes was carried out by elemental analysis, conductimetric studies, magnetic susceptibility, spectroscopic techniques (IR, UV-VIS, NMR, ESR, Mass) and thermogravimetric analysis. The physico-chemical studies revealed octahedral geometry or distorted octahedral geometry around metal ion. These azomethine Schiff base ligands acted as tridentate ? coordinating through carbonyl, azomethine and pyridine nitrogen present in the ligand. The thermodynamic and thermal properties of the complexes have been investigated and it was observed on the basis of these studies that thermal stability of complexes follows the order Mn < Zn < Cu < Co < Ni. The ligands and their complexes were tested for in vitro antibacterial activity at different concentrations against bacteria viz. Gram positive Bacillus subtilis, Micrococcus luteus and Gram negative Pseudomonas aeruginosa, Pseudomonas mendocina. A marked enhancement in biocidal activity of the ligands under similar experimental conditions was observed as a consequence of coordination with metal ions. The trend of growth inhibition in the complexes was found to be in the order: Cu > Mn > Ni > Co > Zn.
Antimicrobial Air Filters Using Natural Euscaphis japonica Nanoparticles
Yun, Ji Ho; Lee, Jung Eun; Lee, Hee Ju; Nho, Chu Won; Bae, Gwi- Nam; Jung, Jae Hee
2015-01-01
Controlling bioaerosols has become more important with increasing participation in indoor activities. Treatments using natural-product nanomaterials are a promising technique because of their relatively low toxicity compared to inorganic nanomaterials such as silver nanoparticles or carbon nanotubes. In this study, antimicrobial filters were fabricated from natural Euscaphis japonica nanoparticles, which were produced by nebulizing E. japonica extract. The coated filters were assessed in terms of pressure drop, antimicrobial activity, filtration efficiency, major chemical components, and cytotoxicity. Pressure drop and antimicrobial activity increased as a function of nanoparticle deposition time (590, 855, and 1150 µg/cm2filter at 3-, 6-, and 9-min depositions, respectively). In filter tests, the antimicrobial efficacy was greater against Staphylococcus epidermidis than Micrococcus luteus; ~61, ~73, and ~82% of M. luteus cells were inactivated on filters that had been coated for 3, 6, and 9 min, respectively, while the corresponding values were ~78, ~88, and ~94% with S. epidermidis. Although statistically significant differences in filtration performance were not observed between samples as a function of deposition time, the average filtration efficacy was slightly higher for S. epidermidis aerosols (~97%) than for M. luteus aerosols (~95%). High-performance liquid chromatography (HPLC) and electrospray ionization-tandem mass spectrometry (ESI/MS) analyses confirmed that the major chemical compounds in the E. japonica extract were 1(ß)-O-galloyl pedunculagin, quercetin-3-O-glucuronide, and kaempferol-3-O-glucoside. In vitro cytotoxicity and disk diffusion tests showed that E. japonica nanoparticles were less toxic and exhibited stronger antimicrobial activity toward some bacterial strains than a reference soluble nickel compound, which is classified as a human carcinogen. This study provides valuable information for the development of a bioaerosol control
Diversity and physiology of culturable bacteria associated with a coastal Antarctic ice core.
Antony, Runa; Krishnan, K P; Laluraj, C M; Thamban, Meloth; Dhakephalkar, P K; Engineer, Anupama S; Shivaji, S
2012-06-20
Microbiological studies of polar ice at different depths may provide important comparisons, as they preserve records of microbial cells and past climate. In this study, we examined bacterial abundance, diversity and glaciochemical composition from three depths of an ice core from coastal Dronning Maud Land, East Antarctica. Higher bacterial abundance corresponded with high in situ sea-salt Na(+) and dust concentration, suggesting that bacteria might have been transported and deposited into ice along with dust particles and marine aerosols. Fourteen bacterial isolates belonging to the genera Methylobacterium, Brevundimonas, Paenibacillus, Bacillus and Micrococcus were retrieved. Frequent isolation of similar bacterial genera from different cold environments suggests that they possess features that enable survival and metabolism for extended periods of time at sub-zero temperatures. The highest number and diversity of recoverable bacteria was obtained from 49 m depth corresponding to 1926 AD and consisted of bacteria from 4 different genera whereas at 11 m (1989 AD) and 33 m (1953 AD) samples only species belonging to the genera Bacillus was recovered. Among the Bacillus species, Bacillus aryabhattai which has been reported only from the upper stratosphere, was isolated and is the first record from the Earth's surface. Methylobacterium was the most dominant genera at 49 m depth and its prevalence is attributable to a combination of high in situ methanesulfonate concentration, specialized metabolism and environmental hardiness of Methylobacterium. Some of the isolated bacteria were found to respire and grow using methanesulfonate, suggesting that they may utilize this substrate to sustain growth in ice. In addition, NO(3)(-) (2.93-3.69 μM), NH(4)(+) (1.45-3.90 μM) and PO(4)(3-) (0.01-0.75 μM) present in the ice could be potential sources fueling bacterial metabolism in this environment. It could be deduced from the study that variation in bacterial abundance and
Roychowdhury, Roopali; Mukherjee, Pritam; Roy, Madhumita
2016-02-01
Eight chromium resistant bacteria were isolated from a dry fly ash sample of DVC-MTPS thermal power plant located in Bankura, West Bengal, India. These isolates displayed different degrees of chromate reduction under aerobic conditions. According to 16S rDNA gene analysis, five of them were Staphylococcus, two were Bacillus and one was Micrococcus. The minimum inhibitory concentration towards chromium and the ability to reduce hexavalent chromium to trivalent chromium was highest in Staphylococcus haemolyticus strain HMR17. All the strains were resistant to multiple heavy metals (As, Cu, Cd, Co, Zn, Mn, Pb and Fe) and reduced toxic hexavalent chromium to relatively non toxic trivalent chromium even in the presence of these multiple heavy metals. All of them showed resistance to different antibiotics. In a soil microcosm study, S. haemolyticus strain HMR17 completely reduced 4 mM hexavalent chromium within 7 days of incubation.
Simmonds, Peter G.
1970-01-01
Pyrolysis-gas chromatography-mass spectrometric studies of two microorganisms, Micrococcus luteus and Bacillus subtilis var. niger, indicate that the majority of thermal fragments originate from the principal classes of bio-organic matter found in living systems such as protein and carbohydrate. Furthermore, there is a close qualitative similarity between the type of pyrolysis products found in microorganisms and the pyrolysates of other biological materials. Conversely, there is very little correlation between microbial pyrolysates and comparable pyrolysis studies of meteoritic and fossil organic matter. These observations will aid in the interpretation of a soil organic analysis experiment to be performed on the surface of Mars in 1975. The science payload of this landed mission will include a combined pyrolysis-gas chromatography-mass spectrometry instrument as well as several “direct biology experiments” which are designed to search for extraterrestrial life. PMID:16349890
Enzymatic synthesis of polymers containing nicotinamide mononucleotide
NASA Technical Reports Server (NTRS)
Liu, Rihe
1995-01-01
Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.
Enzymatic Synthesis of Polymers Containing Nicotinamide Mononucleotide
NASA Technical Reports Server (NTRS)
Liu, Rihe; Orgel, Leslie E.
1995-01-01
Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.
Antimicrobial Activity and Phytochemical Analysis of Organic Extracts from Cleome spinosa Jaqc.
da Silva, Ana P. Sant'Anna; Nascimento da Silva, Luís C.; Martins da Fonseca, Caíque S.; de Araújo, Janete M.; Correia, Maria T. dos Santos; Cavalcanti, Marilene da Silva; Lima, Vera L. de Menezes
2016-01-01
Due to the use of Cleome spinosa Jacq. (Cleomaceae) in traditional medicine against inflammatory and infectious processes, this study evaluated the in vitro antimicrobial potential and phytochemical composition of extracts from its roots and leaves. From leaves (L) and roots (R) of C. spinosa different extracts were obtained (cyclohexane: ChL and ChR; chloroform: CL and CR; ethyl acetate: EAL and EAR, methanol: ML and MR). The antimicrobial activity was evaluated by the broth microdilution method to obtain the minimum inhibitory (MIC) and microbicidal (MMC) concentrations against 17 species, including bacteria and yeasts. Additionally, antimicrobial and combinatory effects with oxacillin were assessed against eight clinical isolates of Staphylococcus aureus. All C. spinosa extracts showed a broad spectrum of antimicrobial activity, as they have inhibited all tested bacteria and yeasts. This activity seems to be related to the phytochemicals (flavonoid, terpenoids and saponins) detected into the extracts of C. spinosa. ChL and CL extracts were the most actives, with MIC less than 1 mg/mL against S. aureus, Bacillus subtilis, and Micrococcus luteus. It is important to note that these concentrations are much lower than their 50% hemolysis concentration (HC50) values. Strong correlations were found between the average MIC against S. aureus and their phenolic (r = −0.89) and flavonoid content (r = −0.87), reinforcing the possible role of these metabolite classes on the antimicrobial activity of C. spinosa derived extracts. Moreover, CL and CR showed the best inhibitory activity against S. aureus clinical isolates, they also showed synergistic action with oxacillin against all these strains (at least at one combined proportion). These results encourage the identification of active substances which could be used as lead(s) molecules in the development of new antimicrobial drugs. PMID:27446005
Wang, Yang; Sumathipala, Niranji; Rayaprolu, Subrahmanyam; Jiang, Haobo
2011-01-01
Detection of pathogenic invaders is the essential first step of a successful defense response in multicellular organisms. In this study, we have identified a new member of the β-1,3-glucanase-related protein superfamily from the tobacco hornworm Manduca sexta. This protein, designated microbe binding protein (MBP), is 61% identical in sequence to Bombyx mori Gram-negative bacteria binding protein, but only 34-36% identical to M. sexta β-1,3-glucan recognition protein-1 and 2. Its mRNA levels were strongly up-regulated in hemocytes and fat body of immune challenged larvae, along with an increase in concentration of the plasma protein. We expressed M. sexta MBP in a baculovirus-insect cell system. The purified protein associated with intact bacteria and fungi. It specifically bound to lipoteichoic acid, lipopolysaccharide, diaminopimelic acid-type peptidoglycans (DAP-PGs) from Escherichia coli and Bacillus subtilis, but less so to laminarin or Lys-type PG from Staphylococcus aureus. The complex binding pattern was influenced by other plasma factors and additional microbial surface molecules. After different amounts of MBP had been incubated with larval plasma on ice, a concentration-dependent increase in phenoloxidase (PO) activity occurred in the absence of any microbial elicitor. The activity increase was also observed in the mixture of plasma and a bacterial or fungal cell wall component. The prophenoloxidase (proPO) activation became more prominent when DAP-PGs, Micrococcus luteus Lys-PG, or lipoteichoic acid was included in the mixture of MBP and plasma. Statistic analysis suggested that a synergistic enhancement of proPO activation was caused by an interaction between MBP and these elicitors, but not S. aureus Lys-PG, lipopolysaccharide, curdlan, or laminarin. These data indicate that M. sexta MBP is a component of the surveillance mechanism and, by working together with other pattern recognition molecules and serine proteinases, triggers the proPO activation
Synthesis, structural characterization and photoluminescence properties of a novel La(III) complex
NASA Astrophysics Data System (ADS)
Köse, Muhammet; Ceyhan, Gökhan; Atcı, Emine; McKee, Vickie; Tümer, Mehmet
2015-05-01
In this study, a novel La(III) complex [La(H2L)2(NO3)3(MeOH)] of a Schiff base ligand was synthesized and characterized by spectroscopic and analytical methods. Single crystals of the complex suitable for X-ray diffraction study were obtained by slow diffusion of diethyl ether into a MeOH solution of the complex which was found to crystallise as [La(H2L)2(NO3)3(MeOH)]ṡ2MeOHṡH2O. The structure was solved in monoclinic crystal system, P21/n space group with unit cell parameters a = 10.5641(11), b = 12.6661(16), c = 16.0022(17) Å, α = 67.364(2), β = 83.794(2)°, γ = 70.541(2)°, V = 1862.9(4) Å3 and Z = 2 with R final value of 0.526. In the complex, the La(III) ion is ten-coordinated by O atoms, five of which come from three nitrate ions, four from the two Schiff base ligands and one from MeOH oxygen atom. The Schiff base ligands in the structure are in a zwitter ion form with the phenolic H transferred to the imine N atom. Thermal properties of the La(III) complex were examined by thermogravimetric analysis and the complex was found to be thermally stable up to 310 °C. The Schiff base ligand and its La(II) complex were screened for their in vitro antimicrobial activity against Bacillus megaterium, Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus (Gram positive bacteria), Klebsiella pneumonia, Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa (Gram negative bacteria), Candida albicans,Yarrowia lipolytica (fungus) and Saccharomyces cerevisiae (yeast). The complex shows more antimicrobial activity than the free ligand.
Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan
2005-01-01
Strain GO5, a bacteriocin-producing bacterium, was isolated from green onion kimchi and identified as Micrococcus sp. The bacteriocin, micrococcin GO5, displayed a broad spectrum of inhibitory activity against a variety of pathogenic and nonpathogenic microorganisms, as tested by the spot-on-lawn method; its activity spectrum was almost identical to that of nisin. Micrococcin GO5 was inactivated by trypsin (whereas nisin was not) and was completely stable at 100 degrees C for 30 min and in the pH range of 2.0 to 7.0. Micrococcin GO5 exhibited a typical mode of bactericidal activity against Micrococcus flavus ATCC 10240. It was purified to homogeneity through ammonium sulfate precipitation, ultrafiltration, and CM-Sepharose column chromatography. The molecular mass of micrococcin GO5 was estimated to be about 5.0 kDa by tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis and in situ activity assay with the indicator organism. The amino acid sequence of micrococcin GO5 lacks lanthionine and beta-methyllanthionine and is rich in hydrophobic amino acids and glycine, providing the basis for the high heat stability of this bacteriocin. The N-terminal amino acid sequence of micrococcin GO5 is Lys-Lys-Ser-Phe-Cys-Gln-Lys, and no homology to bacteriocins reported previously was observed in the amino acid composition or N-terminal amino acid sequence. Based on the physicochemical properties, small molecular size, and inhibition of Listeria monocytogenes, micrococcin GO5 has been placed with the class II bacteriocins, but its broad spectrum of activity differs from that of other bacteriocins in this class.
Goda, Sayed K; Elsayed, Iman E; Khodair, Taha A; El-Sayed, Walaa; Mohamed, Mervat E
2010-11-01
Five malathion-degrading bacterial strains were enriched and isolated from soil samples collected from different agricultural sites in Cairo, Egypt. Malathion was used as a sole source of carbon (50 mg/l) to enumerate malathion degraders, which were designated as IS1, IS2, IS3, IS4, and IS5. They were identified, based on their morphological and biochemical characteristics, as Pseudomonas sp., Pseudomonas putida, Micrococcus lylae, Pseudomonas aureofaciens, and Acetobacter liquefaciens, respectively. IS1 and IS2, which showed the highest degrading activity, were selected for further identification by partial sequence analysis of their 16S rRNA genes. The 16S rRNA gene of IS1 shared 99% similarity with that of Alphaprotoebacterium BAL284, while IS2 scored 100% similarity with that of Pseudomonas putida 32zhy. Malathion residues almost completely disappeared within 6 days of incubation in IS2 liquid cultures. LC/ESI-MS analysis confirmed the degradation of malathion to malathion monocarboxylic and dicarboxylic acids, which formed as a result of carboxylesterase activity. A carboxylesterase gene (CE) was amplified from the IS2 genome by using specifically designed PCR primers. The sequence analysis showed a significant similarity to a known CE gene in different Pseudomonas sp. We report here the isolation of a new malathion-degrading bacteria from soils in Egypt that may be very well adapted to the climatic and environmental conditions of the country. We also report the partial cloning of a new CE gene. Due to their high biodegradation activity, the bacteria isolated from this work merit further study as potential biological agents for the remediation of soil, water, or crops contaminated with the pesticide malathion.
Rhoden, D L; Hancock, G A; Miller, J M
1993-03-01
A numerical-code system for the reference identification of Staphylococcus species, Stomatococcus mucilaginosus, and Micrococcus species was established by using a selected panel of conventional biochemicals. Results from 824 cultures (289 eye isolate cultures, 147 reference strains, and 388 known control strains) were used to generate a list of 354 identification code numbers. Each six-digit code number was based on results from 18 conventional biochemical reactions. Seven milliliters of purple agar base with 1% sterile carbohydrate solution added was poured into 60-mm-diameter agar plates. All biochemical tests were inoculated with 1 drop of a heavy broth suspension, incubated at 35 degrees C, and read daily for 3 days. All reactions were read and interpreted by the method of Kloos et al. (G. A. Hebert, C. G. Crowder, G. A. Hancock, W. R. Jarvis, and C. Thornsberry, J. Clin. Microbiol. 26:1939-1949, 1988; W. E. Kloos and D. W. Lambe, Jr., P. 222-237, in A. Balows, W. J. Hansler, Jr., K. L. Herrmann, H. D. Isenberg, and H. J. Shadomy, ed., Manual of Clinical Microbiology, 5th ed., 1991). This modified reference identification method was 96 to 98% accurate and could have value in reference and public health laboratory settings.
Phylogenetic and Biochemical Studies on Stomatococcus mucilaginosus.
Stackebrandt, E; Scheuerlein, C; Schleifer, K H
1983-01-01
The degree of relatedness of nine strains of Stomatococcus mucilaginosus (formerly classified as 'Micrococcus mucilaginosus') was investigated by deoxyribonucleic acid hybridization. We confirm that all strains are highly related. Differences in the peptidoglycan type and the cytochrome pattern between S. mucilaginosus and members of Micrococcus, together with the results of 23 S ribosomal ribonucleic acid cistron similarity studies and the analysis of the 16S ribosomal ribonucleic acid support the exclusion of this species from the genus Micrococcus and justifies its reclassification as a member of a new genus, Stomatococcus (Bergan and Kocur, 1982). Phylogenetically, S. mucilaginosus represents an independent line of descent within a broad group of Gram-positive bacteria that contains arthrobacteria, micrococci, cellulomonads, brevibacteria and microbacteria. Copyright © 1983 Gustav Fischer Verlag, Stuttgart/New York. Published by Elsevier GmbH.. All rights reserved.
Functional properties of honey supplemented with bee bread and propolis.
Kowalski, S; Makarewicz, M
2017-11-01
The aim of this work was characterisation of functional properties of honey enriched with propolis and beebread. In first step of experiment, soft propolis extract (SPEx) was obtained by extraction of propolis with ethanol. SPEx (0.25 to 1.0% w/w) as well as beebread (5 to 15% w/w) were implemented into natural honey. Fortified honeys were investigated in terms of total phenolic content, radical scavenging activity and ferric reducing antioxidant power, also their effects on the micro-organisms growth was examined. It was found that beebread had the most significant influence on antioxidant properties. On the other hand, all tested honeys showed antibacterial activity against Escherichia coli but not against Micrococcus luteus. Honeys with 1% of propolis addition were the most effective in this case. Research has indicated that for antioxidant and antimicrobial properties of honey, it is beneficial to enrich it in both beebread and propolis.
Antimicrobial activity of honokiol and magnolol isolated from Magnolia officinalis.
Ho, K Y; Tsai, C C; Chen, C P; Huang, J S; Lin, C C
2001-03-01
The antimicrobial activity of honokiol and magnolol, the main constituents of Magnolia officinalis was investigated. The antimicrobial activity was assayed by the agar dilution method using brain heart infusion medium and the minimum inhibitory concentration (MIC) were determined for each compound using a twofold serial dilution assay. The results showed that honokiol and magnolol have a marked antimicrobial effect (MIC = 25 microg/mL) against Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Micrococcus luteus and Bacillus subtilis, but did not show antimicrobial activity (MIC > or = 100 microg/mL) for Shigella flexneii, Staphylococcus epidermidis, Enterobacter aerogenes, Proteus vulgaris, Escherichia coli and Pseudomonas aeruginosa. Our results indicate that honokiol and magnolol, although less potent than tetracycline, show a significant antimicrobial activity for periodontal pathogens. Hence we suggest that honokiol and magnolol might have the potential to be an adjunct in the treatment of periodontitis. Copyright 2001 John Wiley & Sons, Ltd.
Tantapakul, Cholpisut; Maneerat, Wisanu; Sripisut, Tawanun; Ritthiwigrom, Thunwadee; Andersen, Raymond J; Cheng, Ping; Cheenpracha, Sarot; Raksat, Achara; Laphookhieo, Surat
2016-11-23
Two new benzophenones (1 and 2) and four new xanthones (4-6 and 17) together with 24 known compounds (3, 7-16, and 18-30) were isolated from the roots and twigs of Cratoxylum sumatranum ssp. neriifolium. Their structures were elucidated by spectroscopic methods. Compounds 5 and 26 showed antibacterial activity against Micrococcus luteus, Bacillus cereus, and Staphylococcus epidermis with minimum inhibitory concentrations ranging from 4 to 8 μg/mL, whereas compounds 7, 20, and 26 displayed selective antibacterial activities against Staphylococcus aureus (8 μg/mL), Salmonella typhimurium (4 μg/mL), and Pseudomonas aeruginosa (4 μg/mL), respectively. The radical scavenging effects of some isolated compounds were investigated. Compounds 11 and 21 exhibited potent activity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) with IC 50 values of 7.0 ± 1.0 and 6.0 ± 0.2 μM, respectively.
NASA Astrophysics Data System (ADS)
Salih Ağırtaş, M.; Karataş, Ceyhun; Özdemir, Sadin
2015-01-01
The synthesis, characterization, spectral, antioxidant and antibacterial properties of dimethyl 5-(phenoxy)-isophthalate substituted Zinc, Cobalt, Copper, and Nickel phthalocyanines are reported. The novel compounds have been characterized by using electronic absorption, nuclear magnetic resonance spectroscopy, infrared, elemental analysis and mass spectrometry. The antioxidant and antibacterial activities of newly synthesized phthalocyanines and its starting material are tested. The DPPH free radical scavenging ability of phthalocyanine Co(II) and Zn(II) complexes on DPPH are 44.8% and 40.1% at 100 mg/L concentration, respectively. The phthalocyanine Co(II) and Cu(II) complexes show very strong ferrous ion chelating activity of 91.2% and 89.3% at concentration of 100 mg/L, respectively. Compound 3 displays strong reducing power like α-tocopherol. Antibacterial activities of phthalocyanine Co(II) and Amikacin (30 μg/disk) against Micrococcus luteus (ATCC 9341) are 16 mm in diameter.
Activity and immunodetection of lysozyme in earthworm Dendrobaena veneta (Annelida).
Fiołka, Marta J; Zagaja, Mirosław P; Hułas-Stasiak, Monika; Wielbo, Jerzy
2012-01-01
In the present study, lysozyme-like activity against Micrococcus luteus was detected in the coelomic fluid, the extract from coelomocytes, intestine and in the homogenates from cocoons of Dendrobaena veneta. Four hours after immunization with Escherichia coli, the lysozyme activity in the coelomic fluid increased about three times and in the extract of coelomocytes - four times, in comparison to the control. In three cases: of the coelomic fluid, the homogenates from cocoons and the extract from coelomocytes, the antibody against HEWL (hen egg white lysozyme) recognized only one protein with a molecular mass of about 14.4 kDa. In the coelomic fluid, apart from the protein with molecular mass of 14.4 kDa the antibody directed against human lysozyme recognized an additional protein of 22 kDa. Using the bioautography technique after electrophoretic resolution of native proteins in acidic polyacrylamide gels, two lytic zones of M. luteus were observed in the case of the coelomic fluid and three after the analysis of the extract of coelomocytes and the egg homogenates. The results indicated the existence of several forms of lysozyme with a different electric charge in the analyzed D. veneta samples. The highest lysozyme activity in the intestine of D. veneta was observed in the midgut. The antibody directed against human lysozyme indicated a strong positive signal in epidermal and midgut cells of earthworm. Copyright © 2011 Elsevier Inc. All rights reserved.
Resistance of bacterial biofilms formed on stainless steel surface to disinfecting agent.
Królasik, Joanna; Zakowska, Zofia; Krepska, Milena; Klimek, Leszek
2010-01-01
The natural ability of microorganisms for adhesion and biofilm formation on various surfaces is one of the factors causing the inefficiency of a disinfection agent, despite its proven activity in vitro. The aim of the study was to determine the effectiveness of disinfecting substances on bacterial biofilms formed on stainless steel surface. A universally applied disinfecting agent was used in the tests. Bacterial strains: Listeria innocua, Pseudomonas putida, Micrococcus luteus, Staphylococcus hominis strains, were isolated from food contact surfaces, after a cleaning and disinfection process. The disinfecting agent was a commercially available acid specimen based on hydrogen peroxide and peroxyacetic acid, the substance that was designed for food industry usage. Model tests were carried out on biofilm formed on stainless steel (type 304, no 4 finish). Biofilms were recorded by electron scanning microscope. The disinfecting agent in usable concentration, 0.5% and during 10 minutes was ineffective for biofilms. The reduction of cells in biofilms was only 1-2 logarithmic cycles. The use of the agent in higher concentration--1% for 30 minutes caused reduction of cell number by around 5 logarithmic cycles only in the case of one microorganism, M. luteus. For other types: L. innocua, P. putida, S. hominis, the requirements placed on disinfecting agents were not fulfilled. The results of experiments proved that bacterial biofilms are resistant to the disinfectant applied in its operational parameters. Disinfecting effectiveness was achieved after twofold increase of the agent's concentration.
Improved agar diffusion method for detecting residual antimicrobial agents.
Tsai, C E; Kondo, F
2001-03-01
The improved agar diffusion method for determination of residual antimicrobial agents was investigated, and the sensitivities of various combinations of test organisms and assay media were determined using 7 organisms, 5 media, and 31 antimicrobial agents. Bacillus stearothermophilus and synthetic assay medium (SAM) showed the greatest sensitivity for screening penicillins (penicillin G and ampicillin). The combination of Bacillus subtilis and minimum medium (MM) was the most sensitive for tetracyclines (oxytetracycline and chlortetracycline), B. stearothermophilus and SAM or Micrococcus luteus and Mueller-Hinton agar (MHA) for detecting tylosin and erythromycin, B. subtilis and MHA for aminoglycosides (streptomycin, kanamycin, gentamicin, and dihydrostreptomycin), B. stearothermophilus and SAM for polyethers (salinomycin and lasalocid), and B. subtilis and MM or Clostridium perfringens and GAM for polypeptides (thiopeptin, enramycin, virginiamycin, and bacitracin). However, gram-negative bacterium Escherichia coli ATCC 27166 and MM were better for screening for colistin and polymixin-B. For detecting the synthetic drugs tested, the best combination was B. subtilis and MM for sulfonamides, E. coli 27166 and MM for quinolones (oxolinic acid and nalidixic acid), B. subtilis and MM for furans (furazolidone), and the bioluminescent bacterium Photobacterium phosphoreum and luminescence assay medium for chloramphenicol and oxolinic acid. The results showed that the use of four assay plates, B. stearothermophilus and SAM, B. subtilis and MM, M. luteus and MHA, and E. coli 27166 and MM, was superior to the currently available techniques for screening for residual antimicrobial agents in edible animal tissues.
Cooke, Delwyn G; Blackwell, Leonard F
2007-01-01
Lysozymes (3.2.1.17) from goose (Anser anser) egg white, turkey (Melagris gallopavo) egg white, phage T4 and human milk were compared with hen egg white lysozyme in their ability to clear a suspension of Micrococcus lysodeikticus. All of the lysozymes, except hen egg white lysozyme, catalysed the clearing of the Micrococcus lysodeikticus suspension in a biphasic fashion. Compared to hen egg white lysozyme, the total absorbance or transmission change over 5 and 20 minutes was less in all cases, except for human lysozyme. Human lysozyme was, therefore, a potential alternative, more rapid signal generator for the measurement of urinary estrone glucuronide excretion rates because of its structural similarity to hen egg white lysozyme. The apparent K(M) values for hen egg white lysozyme increased with the enzyme concentration.
Takano, Yoshinori; Chikaraishi, Yoshito; Ogawa, Nanako O; Kitazato, Hiroshi; Ohkouchi, Naohiko
2009-01-01
We have developed an analytical method to determine the compound-specific nitrogen isotope compositions of individual amino acid enantiomers using gas chromatography/combustion/isotope ratio mass spectrometry. A novel derivatization of amino acid diastereomers by optically active (R)-(-)-2-butanol or (S)-(+)-2-butanol offers two advantages for nitrogen isotope analysis. First, chromatographic chiral separation can be achieved without the use of chiral stationary-phase columns. Second, the elution order of these compounds on the chromatogram can be switched by a designated esterification reaction. We applied the method to the compound-specific nitrogen isotope analysis of D- and L-alanine in a peptidoglycan derived from the cell walls of cultured bacteria (Firmicutes and Actinobacteria; Enterococcus faecalis, Staphylococcus aureus, Staphylococcus staphylolyticus, Lactobacillus acidophilus, Bacillus subtilis, Micrococcus luteus, and Streptomyces sp.), natural whole bacterial cells (Bacillus subtilis var. natto), (pseudo)-peptidoglycan from archaea (Methanobacterium sp.), and cell wall from eukaryota (Saccharomyces cerevisiae). We observed statistically significant differences in nitrogen isotopic compositions; e.g., delta15N ( per thousand vs air) in Staphylococcus staphylolyticus for d-alanine (19.2 +/- 0.5 per thousand, n = 4) and L-alanine (21.3 +/- 0.8 per thousand, n = 4) and in Bacillus subtilis for D-alanine (6.2 +/- 0.2 per thousand, n = 3) and L-alanine (8.2 +/- 0.4 per thousand, n = 3). These results suggest that enzymatic reaction pathways, including the alanine racemase reaction, produce a nitrogen isotopic difference in amino acid enantiomers, resulting in 15N-depleted D-alanine. This method is expected to facilitate compound-specific nitrogen isotope studies of amino acid stereoisomers.
Xing, Qiang; Yu, Qian; Dou, Huaiqian; Wang, Jing; Li, Ruojiao; Ning, Xianhui; Wang, Ruijia; Wang, Shi; Zhang, Lingling; Hu, Xiaoli; Bao, Zhenmin
2016-05-01
Tumor necrosis factors receptors (TNFRs) comprise a superfamily of proteins characterized by a unique cysteine-rich domain (CRD) and play important roles in diverse physiological and pathological processes in the innate immune system, including inflammation, apoptosis, autoimmunity and organogenesis. Although significant effects of TNFRs on immunity have been reported in most vertebrates as well as some invertebrates, the complete TNFR superfamily has not been systematically characterized in scallops. In this study, two different types of TNFR-like genes, including PyTNFR1 and PyTNFR2 genes were identified from Yesso scallop (Patinopecten yessoensis, Jay, 1857) through whole-genome scanning. Phylogenetic and protein structural analyses were carried out to determine the identities and evolutionary relationships of the two genes. The expression profiling of PyTNFRs was performed at different development stages, in healthy adult tissues and in hemocytes after bacterial infection and heat stress. Expression analysis revealed that both PyTNFRs were significantly induced during the acute phase (3 h) after infection with Gram-positive (Micrococcus luteus) and Gram-negative (Vibrio anguillarum) bacteria, though much more dramatic chronic-phase (24 h) changes were observed after V. anguillarum challenge. For heat stress, only PyTNFR2 displayed significant elevation at 12 h and 24 h, which suggests a functional difference in the two PyTNFRs. Collectively, this study provides novel insight into the PyTNFRs and the specific role and response of TNFR-involved pathways in host immune responses against different bacterial pathogens and heat stress in bivalves. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Zainuri, D. Alwani; Arshad, Suhana; Khalib, N. Che; Razak, I. Abdul; Pillai, Renjith Raveendran; Sulaiman, S. Fariza; Hashim, N. Shafiqah; Ooi, K. Leong; Armaković, Stevan; Armaković, Sanja J.; Panicker, C. Yohannan; Van Alsenoy, C.
2017-01-01
In the present study, the title compound named as (E)-1-(4-bromophenyl)-3-(4-iodophenyl)prop-2-en-1-one was synthesized and structurally characterized by single-crystal X-ray diffraction. The compound crystallizes in the monoclinic system with P21/c space group with the unit cell parameters of a = 16.147 (2) Å, b = 14.270 (2) Å, c = 5.9058 (9) Å, β = 92.577 (3)° and Z = 4. The molecular geometry obtained from X-Ray structure determination was optimized by Density Functional Theory (DFT) using B3LYP/6-31G+(d, p)/Lanl2dz(f) method in the ground state. The IR spectrum was recorded and interpreted in details with the aid of Density Functional Theory (DFT) calculations and Potential Energy Distribution (PED) analysis. In order to investigate local reactivity properties of the title molecule, we have conducted DFT calculations of average local ionization energy surface and Fukui functions which were mapped to the electron density surface. In order to predict the open air stability and possible degradation properties, within DFT approach, we have also calculated bond dissociation energies. 1H and 13C NMR spectra were recorded and chemical shifts were calculated theoretically and compared with the experimental values. In addition, in vitro antimicrobial results show that the title compound has great potential of antibacterial activity against Staphylococcus aureus, Staphylococcus epidermidis and Micrococcus luteus bacteria and antifungal activity against Candida albicans in comparison to some reported chalcone derivatives. Antioxidant studies revealed the highest metal chelating activity of this compound.
Palomo, Sara; González, Ignacio; de la Cruz, Mercedes; Martín, Jesús; Tormo, José Rubén; Anderson, Matthew; Hill, Russell T.; Vicente, Francisca; Reyes, Fernando; Genilloud, Olga
2013-01-01
Forty four marine actinomycetes of the family Microccocaceae isolated from sponges collected primarily in Florida Keys (USA) were selected from our strain collection to be studied as new sources for the production of bioactive natural products. A 16S rRNA gene based phylogenetic analysis showed that the strains are members of the genera Kocuria and Micrococcus. To assess their biosynthetic potential, the strains were PCR screened for the presence of secondary metabolite genes encoding nonribosomal synthetase (NRPS) and polyketide synthases (PKS). A small extract collection of 528 crude extracts generated from nutritional microfermentation arrays was tested for the production of bioactive secondary metabolites against clinically relevant strains (Bacillus subtilis, methicillin-resistant Staphylococcus aureus (MRSA), Acinetobacter baumannii and Candida albicans). Three independent isolates were shown to produce a new anti-MRSA bioactive compound that was identified as kocurin, a new member of the thiazolyl peptide family of antibiotics emphasizing the role of this family as a prolific resource for novel drugs. PMID:23538871
Palomo, Sara; González, Ignacio; de la Cruz, Mercedes; Martín, Jesús; Tormo, José Rubén; Anderson, Matthew; Hill, Russell T; Vicente, Francisca; Reyes, Fernando; Genilloud, Olga
2013-03-28
Forty four marine actinomycetes of the family Microccocaceae isolated from sponges collected primarily in Florida Keys (USA) were selected from our strain collection to be studied as new sources for the production of bioactive natural products. A 16S rRNA gene based phylogenetic analysis showed that the strains are members of the genera Kocuria and Micrococcus. To assess their biosynthetic potential, the strains were PCR screened for the presence of secondary metabolite genes encoding nonribosomal synthetase (NRPS) and polyketide synthases (PKS). A small extract collection of 528 crude extracts generated from nutritional microfermentation arrays was tested for the production of bioactive secondary metabolites against clinically relevant strains (Bacillus subtilis, methicillin-resistant Staphylococcus aureus (MRSA), Acinetobacter baumannii and Candida albicans). Three independent isolates were shown to produce a new anti-MRSA bioactive compound that was identified as kocurin, a new member of the thiazolyl peptide family of antibiotics emphasizing the role of this family as a prolific resource for novel drugs.
Vasilescu, Alina; Gáspár, Szilveszter; Gheorghiu, Mihaela; David, Sorin; Dinca, Valentina; Peteu, Serban; Wang, Qian; Li, Musen; Boukherroub, Rabah; Szunerits, Sabine
2017-03-15
Lysozyme is an enzyme found in biological fluids, which is upregulated in leukemia, renal diseases as well as in a number of inflammatory gastrointestinal diseases. We present here the development of a novel lysozyme sensing concept based on the use of Micrococcus lysodeikticus whole cells adsorbed on graphene oxide (GO)-coated Surface Plasmon Resonance (SPR) interfaces. M. lysodeikticus is a typical enzymatic substrate for lysozyme. Unlike previously reported sensors which are based on the detection of lysozyme through bioaffinity interactions, the bioactivity of lysozyme will be used here for sensing purposes. Upon exposure to lysozyme containing serum, the integrity of the bacterial cell wall is affected and the cells detach from the GO based interfaces, causing a characteristic decrease in the SPR signal. This allows sensing the presence of clinically relevant concentrations of lysozyme in undiluted serum samples. Copyright © 2016 Elsevier B.V. All rights reserved.
Bradley, W.H.
1963-01-01
Unmineralized bacterial cells, mostly Micrococcus sp., but including also Streptococcus sp. and Actinomyces sp., were found in enormous numbers in lake beds of the Newark Canyon Formation of Early Cretaceous age, Eureka County, Nevada. The micrococci are black, and have an average diameter about 0.5 ??. Similar black micrococci (0.4 to 0.7 ??.) were found in profusion in the bottom mud of Green Lake, New York. About 80 percent of this mud consists of minute idiomorphic calcite crystals and about 20 percent of these contain enormous numbers of the black micrococci. It is suggested that the Early Cretaceous bacterial cells owe their preservation to occlusion in calcite crystals that grew in a black, bacterial mud in a meromictic lake in which part of the Newark Canyon Formation accumulated.
Chitosan/Mimosa tenuiflora films as potential cellular patch for skin regeneration.
Valencia-Gómez, Laura Elizabeth; Martel-Estrada, Santos Adriana; Vargas-Requena, Claudia; Rivera-Armenta, José Luis; Alba-Baena, Noe; Rodríguez-González, Claudia; Olivas-Armendáriz, Imelda
2016-12-01
Bio-composites films were prepared by casting and drying of aqueous solutions containing different weight ratios of chitosan and bark of Mimosa tenuiflora. The physico-chemical and functional properties of the films were characterized by scanning electron microscopy, dynamical mechanical analysis, wettability, cytotoxicity and in vitro antibacterial activities. The morphology studies confirmed that the presence of Mimosa tenuiflora change the surface of films. Moreover, the incorporation of Mimosa tenuiflora improved the thermal stability of the films, as it was indicated by the changes in the glass temperatures obtained. Water-uptake ability changed in relation to polymeric composition of film. This property increased by the addition of Mimosa tenuiflora to the film. Improved antibacterial properties were measured against Escherichia Coli and Micrococcus lysodeikticus or luteus. Finally, cytotoxicity was studied by MTT assay and the films were non-toxic. These preliminary results provide a cheap way to prepare chitosan/Mimosa tenuiflora films for wound healing and skin regeneration. Copyright © 2016 Elsevier B.V. All rights reserved.
Ulukanli, Zeynep; Karabörklü, Salih; Bozok, Fuat; Ates, Burhan; Erdogan, Selim; Cenet, Menderes; Karaaslan, Merve Göksin
2014-12-01
Essential oils of the resins of Pinus brutia and Pinus pinea were evaluated for their biological potential. Essential oils were characterized using GC-MS and GC/FID. in vitro antimicrobial, phytotoxic, antioxidant, and insecticidal activities were carried out using the direct contact and the fumigant assays, respectively. The chemical profile of the essential oils of the resins of P. pinea and P. brutia included mainly α-pinene (21.39% and 25.40%), β-pinene (9.68% and 9.69%), and caryophyllene (9.12% and 4.81%). The essential oils of P. pinea and P. brutia exerted notable antimicrobial activities on Micrococcus luteus and Bacillus subtilis, insecticidal activities on Ephestia kuehniella eggs, phytotoxic activities on Lactuca sativa, Lepidium sativum, and Portulaca oleracea, as well as antioxidant potential. Indications of the biological activities of the essential oils suggest their use in the formulation of ecofriendly and biocompatible pharmaceuticals. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
dos Santos, Edilene T.; Pereira, Mara Lúcia A.; da Silva, Camilla Flávia P.G.; Souza-Neta, Lourdes C.; Geris, Regina; Martins, Dirceu; Santana, Antônio Euzébio G.; Barbosa, Luiz Cláudio A.; Silva, Herymá Giovane O.; Freitas, Giovana C.; Figueiredo, Mauro P.; de Oliveira, Fernando F.; Batista, Ronan
2013-01-01
The purpose of this study was to assess the in vitro antimicrobial activity of alkaloid-enriched extracts from Prosopis juliflora (Fabaceae) pods in order to evaluate them as feed additives for ruminants. As only the basic chloroformic extract (BCE), whose main constituents were juliprosopine (juliflorine), prosoflorine and juliprosine, showed Gram-positive antibacterial activity against Micrococcus luteus (MIC = 25 μg/mL), Staphylococcus aureus (MIC = 50 μg/mL) and Streptococcus mutans (MIC = 50 μg/mL), its influence on ruminal digestion was evaluated using a semi-automated in vitro gas production technique, with monensin as the positive control. Results showed that BCE has decreased gas production as efficiently as monensin after 36 h of fermentation, revealing its positive influence on gas production during ruminal digestion. Since P. juliflora is a very affordable plant, this study points out this alkaloid enriched extract from the pods of Prosopis juliflora as a potential feed additive to decrease gas production during ruminal digestion. PMID:23595000
An easy, rapid and inexpensive method to monitor tributyltin (TBT) toxicity in the laboratory.
Cruz, Andreia; Moreira, Rafael; Mendo, Sónia
2014-05-01
Tributyltin (TBT) contamination remains a major problem worldwide. Many laboratories are committed to the development of remediation methodologies that could help reduce the negative impact of this compound in the environment. Furthermore, it is important to have at hand simple methodologies for evaluating TBT toxicity in the laboratory, besides the use of complex and costly analytical instrumentation. With that purpose, a method was adapted that is based on the inhibition of growth of an indicator strain, Micrococcus luteus ATCC 9341, under TBT. Different types of matrices, of TBT concentrations and sample treatments were tested. The results herein reported show that the bioassay method can be applied for both aqueous and soil samples and also for a high range of TBT concentrations (at least up to 500 μmol/L). Besides being cheap and easy to perform, it can be performed in any laboratory. Additionally, one possible application of the method to monitor TBT degradation is presented as an example.
Search for antibacterial and antifungal agents from selected Indian medicinal plants.
Kumar, V Prashanth; Chauhan, Neelam S; Padh, Harish; Rajani, M
2006-09-19
A series of 61 Indian medicinal plants belonging to 33 different families used in various infectious disorders, were screened for their antimicrobial properties. Screening was carried out at 1000 and 500 microg/ml concentrations by agar dilution method against Bacillus cereus var mycoides, Bacillus pumilus, Bacillus subtilis, Bordetella bronchiseptica, Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus faecalis, Candida albicans, Aspergillus niger and Saccharomyces cerevisiae. Twenty-eight plant extracts showed activity against at least one of the test organisms used in the screening. On the basis of the results obtained, we conclude that the crude extracts of Dorema ammoniacum, Sphaeranthus indicus, Dracaena cinnabari, Mallotus philippinensis, Jatropha gossypifolia, Aristolochia indica, Lantana camara, Nardostachys jatamansi, Randia dumetorum and Cassia fistula exhibited significant antimicrobial activity and properties that support folkloric use in the treatment of some diseases as broad-spectrum antimicrobial agents. This probably explains the use of these plants by the indigenous people against a number of infections.
NASA Astrophysics Data System (ADS)
Hudson, E. D.; Ariya, P. A.
2006-12-01
Whole air, size-fractionated marine aerosols, and surface ocean water DOC were sampled together during June-July 2004 on the Nordic seas, in order to explore factors leading to the formation of volatile organic compounds (VOCs) at the sea surface and their transfer to the atmosphere. High site-to-site variability in 19 non-methane hydrocarbon concentrations suggests highly variable, local sources for these compounds. Acetone, C5 and C6 hydrocarbons, and dimethylsulfide were identified in the seawater samples using solid-phase microextraction/GC-MS. The aerosols were analysed by SEM-EDX and contained primarily inorganic material (sea salt, marine sulfates, and carbonates) and little organic matter. However, a culturable bacterium was isolated from the large (9.9 - 18 μ m) fraction at one site, and identified as Micrococcus luteus. We will discuss the implication of these results on potential exchange processes at the ocean-atmosphere interface and the impact of bioaerosols in transferring marine organic carbon to atmospheric organic carbon.
In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics
NASA Astrophysics Data System (ADS)
Saha, Biswarup; Bhattacharya, Jaydeep; Mukherjee, Ananda; Ghosh, Anup Kumar; Santra, Chitta Ranjan; Dasgupta, Anjan K.; Karmakar, Parimal
2007-12-01
Bactericidal efficacy of gold nanoparticles conjugated with ampicillin, streptomycin and kanamycin were evaluated. Gold nanoparticles (Gnps) were conjugated with the antibiotics during the synthesis of nanoparticles utilizing the combined reducing property of antibiotics and sodium borohydride. The conjugation of nanoparticles was confirmed by dynamic light scattering (DLS) and electron microscopic (EM) studies. Such Gnps conjugated antibiotics showed greater bactericidal activity in standard agar well diffusion assay. The minimal inhibitory concentration (MIC) values of all the three antibiotics along with their Gnps conjugated forms were determined in three bacterial strains, Escherichia coli DH5α, Micrococcus luteus and Staphylococcus aureus. Among them, streptomycin and kanamycin showed significant reduction in MIC values in their Gnps conjugated form whereas; Gnps conjugated ampicillin showed slight decrement in the MIC value compared to its free form. On the other hand, all of them showed more heat stability in their Gnps conjugated forms. Thus, our findings indicated that Gnps conjugated antibiotics are more efficient and might have significant therapeutic implications.
NASA Astrophysics Data System (ADS)
Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.
2014-09-01
The structural, antimicrobial, and hemolytic properties and bioactivity have been studied of pure hydroxyapatite (HAP) and zinc doped hydroxyapatite (Zn-HAP) nano-particles for their medical applications. Pure HAP and Zn-HAP nano-particles were synthesized by the surfactant mediated approach. The doping of zinc was estimated by EDAX. The average particle size was determined by applying Scherrer's formula to powdered XRD patterns. The nano-particle morphology was studied by TEM and the presence of various functional groups was identified by FTIR spectroscopy. Good antimicrobial activity of nano-HAP and nano-Zn-HAP was found against five organisms, viz., Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus, Staphylococcous aureus and Bacillus cereus as Gram positive. The ability of new apatite formation on the surface of pure and doped HAP samples was studied by using Simulated Body Fluid (SBF) in vitro. Hemolytic study indicated that all samples were non-hemolytic and suggesting potential application as bone implant material.
Phylogenetic analyses of bacteria associated with the processing of iru and ogiri condiments.
Ademola, Oluwatoyin M; Adeyemi, Taiwo E; Ezeokoli, Obinna T; Ayeni, Kolawole I; Obadina, Adewale O; Somorin, Yinka M; Omemu, Adebukola M; Adeleke, Rasheed A; Nwangburuka, Cyril C; Oluwafemi, Flora; Oyewole, Olusola B; Ezekiel, Chibundu N
2018-06-27
Analysis of the bacterial community dynamics during the production of traditional fermented condiments is important for food safety assessment, quality control and development of starter culture technology. In this study, bacteria isolated during the processing of iru and ogiri, two commonly consumed condiments in Nigeria, were characterised based on phylogenetic analyses of the bacterial 16S rRNA gene. A total of 227 isolates were obtained and clustered into 12 operational taxonomic units (OTUs) based on 97% 16S rRNA gene similarity. The OTUs spanned three phyla (Firmicutes, Actinobacteria and Proteobacteria), and nine genera: Acinetobacter, Aerococcus, Bacillus, Enterococcus, Enterobacter, Lysinibacillus, Micrococcus, Proteus and Staphylococcus. OTUs closely related to species of Bacillus dominated the processing stages of both condiments. Although no single OTU occurred throughout iru processing stages, an OTU (mostly related to B. safensis) dominated the ogiri processing stages indicating potentials for the development of starter culture. However, other isolates such as those of Enterococcus spp. and Lysinibacillus spp. may be potential starters for iru fermentation. Presumptive foodborne pathogens were also detected at some stages of the condiments' processing, possibly due to poor hygienic practices. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Ranjan, Ravi; Jadeja, Vasantba
2017-10-01
Endophytic actinomycetes are considered as one of the relatively unexplored potential sources in search of antibiotic producer against antibiotic resistant pathogens. A potent strain isolated from Catharanthus roseus that displays antibacterial potential against antibiotic resistant human pathogen Staphylococcus aureus was characterized and designated as Micrococcus yunnanensis strain rsk5. Rsk5 is capable of producing optimum antibacterial metabolites on starch casein medium at 30 °C, pH 5 and 2% NaCl condition. The crude antibacterial agent was extracted from fermentation broth by ethyl acetate and separated by TLC using chloroform-methanol (24:1, v/v) solvent system with R f value of 0.26. It was partially purified by flash chromatography, followed by HPLC and analyzed by ultraviolet visible spectrophotometer to get absorption maxima at 208.4 nm. The ESI-MS spectra showed molecular ion peaks at m / z 472.4 [M-H], which does not match with any known antibacterial compound.
Okaiyeto, Kunle; Nwodo, Uchechukwu U; Mabinya, Leonard V; Okoh, Anthony I
2013-10-16
The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2-10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment.
Okaiyeto, Kunle; Nwodo, Uchechukwu U.; Mabinya, Leonard V.; Okoh, Anthony I.
2013-01-01
The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2–10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment. PMID:24135818
Linder, R; Salton, M R
1975-06-16
Conversion of whole cells of Micrococcus lysodeikticus to protoplasts allowed the release of a soluble form of a D-alanine carboxypeptidase into the protoplasting medium. The enzyme cleaves the terminal D-alanine from the radioactively labelled UDP-N-acetylmuramyl-pentapeptide containing L-lysine as the diamino acid. However, the enzyme is only minimally active in this fraction so that it had to be enriched and partially purified before its properties could be studied. Chromatography on carboxymethyl-Sephadex removed the lysozyme used in the protoplasting of the cells. The material which was unadsorbed to the column was applied to an affinity chromatography column of Ampicillin-Sepharose. Most of the contaminating protein was washed from the column while the D-alanine carboxypeptidase adhered to the resin and could be eluted with 0.5 M Tris-HCl buffer pH 8.6. Some of the properties of the enzymic activity were studied using this preparation. The enzyme was activated by Mg2+ ions with a broad optimum from 15--35 mM. It was maximally active when NaCl at a concentrations of 0.06--0.08 M was added to the assay, and the pH curve was biphasic with an alkaline optimum. The Km for substrate was found to be 0.118 mM. Enzymic activity was completely inhibited by low concentrations of Ampicillin and penicillin G.
Rinland, María Emilia; Gómez, Marisa Anahí
2015-03-01
Onion production in Argentina generates a significant amount of waste. Finding an effective method to recycle it is a matter of environmental concern. Among organic waste reuse techniques, anaerobic digestion could be a valuable alternative to current practices. Substrate inoculation with appropriate bacterial strains enhances the rate-limiting step (hydrolysis) of anaerobic digestion of biomass wastes. Selection of indigenous bacteria with the ability to degrade onion waste could be a good approach to find a suitable bioaugmentation or pretreatment agent. We isolated bacterial strains from onion waste in different degradation stages and from different localities. In order to characterize and select the best candidates, we analyzed the growth patterns of the isolates in a medium prepared with onion juice as the main source of nutrients and we evaluated carbon source utilization. Nine strains were selected to test their ability to grow using onion tissue and the five most remarkable ones were identified by 16S rRNA gene sequencing. Strains belonged to the genera Pseudoxanthomonas, Bacillus, Micrococcus and Pseudomonas. Two strains, Bacillus subtilis subsp. subtillis MB2-62 and Pseudomonas poae VE-74 have characteristics that make them promising candidates for bioaugmentation or pretreatment purposes.
Jiang, Zhi-Liang; Huang, Guo-Xia
2007-02-01
Several methods, including turbidimetric and colorimetric methods, have been reported for the detection of lysozyme activity. However, there is no report about the resonance scattering spectral (RSS) assay, which is based on the catalytic effect of lysozyme on the hydrolysis of micrococcus lysodeikticus (ML) and its resonance scattering effect. ML has 5 resonance scattering peaks at 360 400, 420, 470, and 520 nm with the strongest one at 470 nm. The concentration of ML in the range of 2.0x10(6)-9.3x10(8) cells/ml is proportional to the RS intensity at 470 nm (I(470 nm)). A new catalytic RSS method has been proposed for 0.24-40.0 U/ml (or 0.012-2.0 mug/ml) lysozyme activity, with a detection limit (3sigma) of 0.014 U/ml (or 0.0007 microg/ml). Saliva samples were assayed by this method, and it is in agreement with the results of turbidimetric method. The slope, intercept and the correlation coefficient of the regression analysis of the 2 assays were 0.9665, -87.50, and 0.9973, respectively. The assay has high sensitivity and simplicity.
Dinca, Valentina; Zaharie-Butucel, Diana; Stanica, Luciana; Brajnicov, Simona; Marascu, Valentina; Bonciu, Anca; Cristocea, Andra; Gaman, Laura; Gheorghiu, Mihaela; Astilean, Simion; Vasilescu, Alina
2018-02-01
Whole cell optical biosensors, made by immobilizing whole algal, bacterial or mammalian cells on various supports have found applications in several fields, from ecology and ecotoxicity testing to biopharmaceutical production or medical diagnostics. We hereby report the deposition of functional bacterial layers of Micrococcus lysodeikticus (ML) via Matrix-Assisted Pulsed Laser Evaporation (MAPLE) on poly(diallyldimethylamonium) (PDDA)-coated-glass slides and their application as an optical biosensor for the detection of lysozyme in serum. Lysozyme is an enzyme upregulated in inflammatory diseases and ML is an enzymatic substrate for this enzyme. The MAPLE-deposited bacterial interfaces were characterised by Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Fourier-Transformed Infrared Spectroscopy (FTIR), Raman and optical microscopy and were compared with control interfaces deposited via layer-by-layer on the same substrate. After MAPLE deposition and coating with graphene oxide (GO), ML-modified interfaces retained their functionality and sensitivity to lysozyme's lytic action. The optical biosensor detected lysozyme in undiluted serum in the clinically relevant range up to 10μgmL -1 , in a fast and simple manner. Copyright © 2017 Elsevier B.V. All rights reserved.
Tiwari, Santosh Kumar; Sutyak Noll, Katia; Cavera, Veronica L; Chikindas, Michael L
2015-03-01
Two hybrid bacteriocins, enterocin E50-52/pediocin PA-1 (EP) and pediocin PA-1/enterocin E50-52 (PE), were designed by combining the N terminus of enterocin E50-52 and the C terminus of pediocin PA-1 and by combining the C terminus of pediocin PA-1 and the N terminus of enterocin E50-52, respectively. Both hybrid bacteriocins showed reduced MICs compared to those of their natural counterparts. The MICs of hybrid PE and EP were 64- and 32-fold lower, respectively, than the MIC of pediocin PA-1 and 8- and 4-fold lower, respectively, than the MIC of enterocin E50-52. In this study, the effect of hybrid as well as wild-type (WT) bacteriocins on the transmembrane electrical potential (ΔΨ) and their ability to induce the efflux of intracellular ATP were investigated. Enterocin E50-52, pediocin PA-1, and hybrid bacteriocin PE were able to dissipate ΔΨ, but EP was unable to deplete this component. Both hybrid bacteriocins caused a loss of the intracellular concentration of ATP. EP, however, caused a faster efflux than PE and enterocin E50-52. Enterocin E50-52 and hybrids PE and EP were active against the Gram-positive and Gram-negative bacteria tested, such as Micrococcus luteus, Salmonella enterica serovar Enteritidis 20E1090, and Escherichia coli O157:H7. The hybrid bacteriocins designed and described herein are antimicrobial peptides with MICs lower those of their natural counterparts. Both hybrid peptides induce the loss of intracellular ATP and are capable of inhibiting Gram-negative bacteria, and PE dissipates the electrical potential. In this study, the MIC of hybrid bacteriocin PE decreased 64-fold compared to the MIC of its natural peptide counterpart, pediocin PA-1. Inhibition of Gram-negative pathogens confers an additional advantage for the application of these peptides in therapeutics. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Tiwari, Santosh Kumar; Sutyak Noll, Katia; Cavera, Veronica L.
2014-01-01
Two hybrid bacteriocins, enterocin E50-52/pediocin PA-1 (EP) and pediocin PA-1/enterocin E50-52 (PE), were designed by combining the N terminus of enterocin E50-52 and the C terminus of pediocin PA-1 and by combining the C terminus of pediocin PA-1 and the N terminus of enterocin E50-52, respectively. Both hybrid bacteriocins showed reduced MICs compared to those of their natural counterparts. The MICs of hybrid PE and EP were 64- and 32-fold lower, respectively, than the MIC of pediocin PA-1 and 8- and 4-fold lower, respectively, than the MIC of enterocin E50-52. In this study, the effect of hybrid as well as wild-type (WT) bacteriocins on the transmembrane electrical potential (ΔΨ) and their ability to induce the efflux of intracellular ATP were investigated. Enterocin E50-52, pediocin PA-1, and hybrid bacteriocin PE were able to dissipate ΔΨ, but EP was unable to deplete this component. Both hybrid bacteriocins caused a loss of the intracellular concentration of ATP. EP, however, caused a faster efflux than PE and enterocin E50-52. Enterocin E50-52 and hybrids PE and EP were active against the Gram-positive and Gram-negative bacteria tested, such as Micrococcus luteus, Salmonella enterica serovar Enteritidis 20E1090, and Escherichia coli O157:H7. The hybrid bacteriocins designed and described herein are antimicrobial peptides with MICs lower those of their natural counterparts. Both hybrid peptides induce the loss of intracellular ATP and are capable of inhibiting Gram-negative bacteria, and PE dissipates the electrical potential. In this study, the MIC of hybrid bacteriocin PE decreased 64-fold compared to the MIC of its natural peptide counterpart, pediocin PA-1. Inhibition of Gram-negative pathogens confers an additional advantage for the application of these peptides in therapeutics. PMID:25527560
Huang, Mengmeng; Zhou, Tao; Wu, Yuehong; Fei, Hui; Wang, Gaoyang; Li, Zhi; Lei, Yutong; Liu, Qian; Sun, Cong; Lv, Zhengbing; Xu, Xue-Wei
2018-04-18
Galectins are β-galactoside binding lectins that play crucial roles in innate immunity in vertebrates and invertebrates through their conserved carbohydrate-recognition domains (CRDs). In the present study, single- and four-CRD-containing galectins were identified in oyster Crassostrea gigas (designated CgGal-2 and CgGal-3). The open reading frames (ORFs) of CgGal-2 and CgGal-3 encode polypeptides of 200 and 555 amino acids, respectively. All CRDs of CgGal-3 include two consensus motifs essential for ligand-binding, and a novel motif is present in CgGal-2. Pathogen-associated molecular pattern (PAMP) profiles were determined for recombinant rCgGal-2 and rCgGal-3, and rCgGal-2 displayed low binding affinity for PAMPs, while rCgGal-3 bound various PAMPs including glucan, lipopolysaccharide (LPS), and peptidoglycan (PGN) with relatively high affinity. Furthermore, rCgGal-2 and rCgGal-3 exhibited different microbe binding profiles; rCgGal-2 bound to Gram-negative bacteria (Escherichia coli and Vibrio vulnificus) and fungi (Saccharomyces cerevisiae and Pichia pastoris), while rCgGal-3 bound to these microbes but also to Gram-positive bacteria (Micrococcus luteus). In addition, rCgGal-3 possessed microbial agglutinating activity and coagulation activity against fungi and erythrocytes, respectively, but rCgGal-2 lacked any agglutinating activity. Carbohydrate binding specificity analysis showed that rCgGal-3 specifically bound D-galactose. Furthermore, rCgGal-2 and rCgGal-3 functioned as opsonin participating in the clearance against invaders in C. gigas. Thus, CgGal-2 with one CRD and CgGal-3 with four CRDs are new members of the galectin family involved in immune responses against bacterial infection. Differences in the organisation and amino acid sequences of CRDs may affect their specificity and affinity for nonself substances. Copyright © 2018 Elsevier Ltd. All rights reserved.
Bacterial populations associated with the dirty area of a South African poultry abattoir.
Geornaras, I; de Jesus, A E; von Holy, A
1998-06-01
Bacterial populations associated with three sample types from the neck region of poultry carcasses in the dirty area of an abattoir were characterized. Sample types before and after scalding were skin only, feathers only, and a skin and feather combination. The neck skin of carcasses after the defeathering processing stage was also sampled. Bacterial populations associated with water from the scald tank, rubber fingers at the exit of the defeathering machine, and air in the dirty area were also characterized. Bacterial colonies (751) were randomly isolated from yeast extract-supplemented tryptone soya agar plates exhibiting 30 to 300 colonies. Micrococcus spp. were isolated in the highest proportion from pre-and postscalded carcass samples (63.5 to 86.1% of isolates), regardless of the sample type. Conversely, Enterobacteriaceae (40.3%), Acinetobacter (19.4%), and Aeromonas/Vibrio (12.5%) species predominated on neck skin samples taken from mechanically defeathered carcasses. Isolates from the rubber fingers were, however, predominantly Micrococcus spp. (94.4%). Bacterial groups isolated in the highest proportion from scald tank water samples were Micrococcus spp. (38.3%), species of Enterobacteriaceae (29.1%), and lactic acid bacteria (17.0%). Corynebacterium spp., species of Enterobacteriaceae, and Micrococcus spp. were dominant on air settle plates.
Glazinska, Paulina; Wojciechowski, Waldemar; Kulasek, Milena; Glinkowski, Wojciech; Marciniak, Katarzyna; Klajn, Natalia; Kesy, Jacek; Kopcewicz, Jan
2017-01-01
Yellow lupine ( Lupinus luteus L., Taper c.), a member of the legume family ( Fabaceae L.), has an enormous practical importance. Its excessive flower and pod abscission represents an economic drawback, as proper flower and seed formation and development is crucial for the plant's productivity. Generative organ detachment takes place at the basis of the pedicels, within a specialized group of cells collectively known as the abscission zone (AZ). During plant growth these cells become competent to respond to specific signals that trigger separation and lead to the abolition of cell wall adhesion. Little is known about the molecular network controlling the yellow lupine organ abscission. The aim of our study was to establish the divergences and similarities in transcriptional networks in the pods, flowers and flower pedicels abscised or maintained on the plant, and to identify genes playing key roles in generative organ abscission in yellow lupine. Based on de novo transcriptome assembly, we identified 166,473 unigenes representing 219,514 assembled unique transcripts from flowers, flower pedicels and pods undergoing abscission and from control organs. Comparison of the cDNA libraries from dropped and control organs helped in identifying 1,343, 2,933 and 1,491 differentially expressed genes (DEGs) in the flowers, flower pedicels and pods, respectively. In DEG analyses, we focused on genes involved in phytohormonal regulation, cell wall functioning and metabolic pathways. Our results indicate that auxin, ethylene and gibberellins are some of the main factors engaged in generative organ abscission. Identified 28 DEGs common for all library comparisons are involved in cell wall functioning, protein metabolism, water homeostasis and stress response. Interestingly, among the common DEGs we also found an miR169 precursor, which is the first evidence of micro RNA engaged in abscission. A KEGG pathway enrichment analysis revealed that the identified DEGs were predominantly
Glazinska, Paulina; Wojciechowski, Waldemar; Kulasek, Milena; Glinkowski, Wojciech; Marciniak, Katarzyna; Klajn, Natalia; Kesy, Jacek; Kopcewicz, Jan
2017-01-01
Yellow lupine (Lupinus luteus L., Taper c.), a member of the legume family (Fabaceae L.), has an enormous practical importance. Its excessive flower and pod abscission represents an economic drawback, as proper flower and seed formation and development is crucial for the plant's productivity. Generative organ detachment takes place at the basis of the pedicels, within a specialized group of cells collectively known as the abscission zone (AZ). During plant growth these cells become competent to respond to specific signals that trigger separation and lead to the abolition of cell wall adhesion. Little is known about the molecular network controlling the yellow lupine organ abscission. The aim of our study was to establish the divergences and similarities in transcriptional networks in the pods, flowers and flower pedicels abscised or maintained on the plant, and to identify genes playing key roles in generative organ abscission in yellow lupine. Based on de novo transcriptome assembly, we identified 166,473 unigenes representing 219,514 assembled unique transcripts from flowers, flower pedicels and pods undergoing abscission and from control organs. Comparison of the cDNA libraries from dropped and control organs helped in identifying 1,343, 2,933 and 1,491 differentially expressed genes (DEGs) in the flowers, flower pedicels and pods, respectively. In DEG analyses, we focused on genes involved in phytohormonal regulation, cell wall functioning and metabolic pathways. Our results indicate that auxin, ethylene and gibberellins are some of the main factors engaged in generative organ abscission. Identified 28 DEGs common for all library comparisons are involved in cell wall functioning, protein metabolism, water homeostasis and stress response. Interestingly, among the common DEGs we also found an miR169 precursor, which is the first evidence of micro RNA engaged in abscission. A KEGG pathway enrichment analysis revealed that the identified DEGs were predominantly
Shakeri, Abolfazl; Akhtari, Javad; Soheili, Vahid; Taghizadeh, Seyedeh Faezeh; Sahebkar, Amirhossein; Shaddel, Rezvan; Asili, Javad
2017-08-01
Chemical composition and biological (antimicrobial, antioxidant and cytotoxic) activities of essential oils (EO) obtained from the aerial parts of Glycyrrhiza triphylla Fisch. & C.A.Mey (G. triphylla) were evaluated in the present study. The EO was isolated and analyzed using gas chromatography-mass spectrometry (GC-MS). Fifty-five compounds representing 99.3% of the total oil composition were identified. Major components of the oil were β-caryophyllene (25.4%), limonene (16.7%), β-myrcene (16.0%) and α-humulene (4.4%). The oil composition was dominated by the presence of sesquiterpene hydrocarbons comprising 43.6% of the total oil. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the oil were determined against eight bacterial strains and one fungus. The EO showed a good antibacterial activity against both Gram-positive and Gram-negative bacteria. The most susceptible strain was Micrococcus luteus (MIC = 2.7 μg/mL, MBC = 43.6 μg/mL). The antioxidant potential of the EO was examined using DPPH and β-carotene/linoleic acid (BCB) assays. The oil was considerably active in the DPPH assay (IC 50 = 100.40 ± 0.03 μg/mL). Moreover, in vitro cytotoxic activity was assessed against six cancer cell lines using MTT assay. The EO showed no significant cytotoxic activity. In light of the present findings, G. triphylla oil may deserves to be further investigated for its potential therapeutic effects and also as a natural preservative in food industry. Copyright © 2017 Elsevier Ltd. All rights reserved.
Filthy lucre: A metagenomic pilot study of microbes found on circulating currency in New York City
Maritz, Julia M.; Sullivan, Steven A.; Prill, Robert J.; Aksoy, Emre; Scheid, Paul; Carlton, Jane M.
2017-01-01
Background Paper currency by its very nature is frequently transferred from one person to another and represents an important medium for human contact with—and potential exchange of—microbes. In this pilot study, we swabbed circulating $1 bills obtained from a New York City bank in February (Winter) and June (Summer) 2013 and used shotgun metagenomic sequencing to profile the communities found on their surface. Using basic culture conditions, we also tested whether viable microbes could be recovered from bills. Results Shotgun metagenomics identified eukaryotes as the most abundant sequences on money, followed by bacteria, viruses and archaea. Eukaryotic assemblages were dominated by human, other metazoan and fungal taxa. The currency investigated harbored a diverse microbial population that was dominated by human skin and oral commensals, including Propionibacterium acnes, Staphylococcus epidermidis and Micrococcus luteus. Other taxa detected not associated with humans included Lactococcus lactis and Streptococcus thermophilus, microbes typically associated with dairy production and fermentation. Culturing results indicated that viable microbes can be isolated from paper currency. Conclusions We conducted the first metagenomic characterization of the surface of paper money in the United States, establishing a baseline for microbes found on $1 bills circulating in New York City. Our results suggest that money amalgamates DNA from sources inhabiting the human microbiome, food, and other environmental inputs, some of which can be recovered as viable organisms. These monetary communities may be maintained through contact with human skin, and DNA obtained from money may provide a record of human behavior and health. Understanding these microbial profiles is especially relevant to public health as money could potentially mediate interpersonal transfer of microbes. PMID:28384336
Silva, Fabrício Souza; Menezes, Pedro Modesto Nascimento; de Sá, Pedro Guilherme Souza; Oliveira, André Luís de Santana; Souza, Eric Alencar Araújo; Almeida, Jackson Roberto Guedes da Silva; de Lima, Julianeli Tolentino; Uetanabaro, Ana Paula Trovatti; Silva, Tânia Regina dos Santos; Peralta, Edna Dória; Lucchese, Angélica Maria
2016-01-01
Lippia thymoides Mart. & Schauer (Verbenaceae) is used in folk medicine to treat wounds, fever, bronchitis, rheumatism, headaches, and weakness. This study determinates the chemical composition of essential oils from L. thymoides, obtained at during each of the four seasons and correlates with pharmacological properties. Essential oils were obtained by hydrodistillation and analyzed by gas chromatography coupled to mass spectroscopy (GC-MS). Antioxidant activity was determined by DPPH free radical scavenging and β-carotene bleaching methods. The antimicrobial assays were performed by minimum inhibitory concentration (MIC) and minimum microbicidal concentration (MMC) methods. Isolated rat aorta and uterus, and guinea-pig trachea were utilized to evaluate relaxant potential in pre-contracted smooth muscle. Essential oils from leaves of L. thymoides had the sesquiterpene β-caryophyllene (17.22-26.27%) as the major constituent followed by borneol (4.45-7.36%), camphor (3.22-8.61%), camphene (2.64-5.66%), and germacrene D (4.72-6.18%). In vitro assays showed that these essential oils do not have antioxidant activity, have antimicrobial selectivity to Gram-positive bacteria Staphylococcus aureus (MIC = 0.004 mg/mL and MMC = 0.26-10.19 mg/mL) and Micrococcus luteus (MIC = 0.03 mg/mL and MMC = 8.43 mg/mL), relax isolated rat aorta (EC50 = 305-544 μg/mL, with endothelium; and EC50 = 150-283 μg/mL, without endothelium), and uterus (EC50 = 74-257 μg/mL), and minor potency, isolated guinea-pig trachea. Lippia thymoides is a source of natural products of pharmaceutical interest, being necessary additional studies to determine the substances involved in the biological activities.
Saratale, R G; Saratale, G D; Chang, J S; Govindwar, S P
2009-09-01
Micrococcus glutamicus NCIM-2168 exhibited complete decolorization and degradation of C.I. Reactive Green 19A (an initial concentration of 50 mg l(-1)) within 42 h at temperature 37 degrees C and pH 8, under static condition. Extent of mineralization was determined with total organic carbon (TOC) and chemical oxygen demand (COD) measurement, showing a satisfactory reduction of TOC (72%) and COD (66%) within 42 h. Enzyme studies shows involvement of oxidoreductive enzymes in decolorization/degradation process. Analytical studies of the extracted metabolites confirmed the significant degradation of Reactive Green 19A into various metabolites. The microbial toxicity and phytotoxicity assay revealed that the degradation of Reactive Green 19A produced nontoxic metabolites. In addition, the M. glutamicus strain was applied to decolorize a mixture of ten reactive dyes showing a 63% decolorization (in terms of decrease in ADMI value) within 72 h, along with 48% and 42% reduction in TOC and COD under static condition.
NASA Technical Reports Server (NTRS)
Siebert, J.; Hirsch, P.; Friedmann, E. I. (Principal Investigator)
1988-01-01
Approximately 1500 cultures of microorganisms were isolated from rocks and soils of the Ross Desert (McMurdo-Dry Valleys). From these, 15 coccoid strains were chosen for more detailed investigation. They were characterized by morphological, physiological and chemotaxonomical properties. All isolates were Gram-positive, catalase-positive and nonmotile. Six strains showed red pigmentation and could be identified as members of the genera Micrococcus (M. roseus, M. agilis) or Deinococcus. In spite of their coccoid morphology, the remaining nine strains had to be associated with coryneform bacteria (Arthrobacter, Brevibacterium), because of their cell wall composition and G+C ratios. Most of the strains were psychrotrophic, but one strain was even obligately psychrophilic, with a temperature maximum below 20 degrees C. Red cocci had in vitro pH optima above 9.0 although they generally originated from acid samples. Most isolates showed a preference for sugar alcohols and organic acids, compounds which are commonly known to be released by lichens, molds and algae, the other components of the cryptoendolithic ecosystem. These properties indicate that our strains are autochthonous members of the natural Antarctic microbial population.
The inhibitory effects of wine phenolics on lysozyme activity against lactic acid bacteria.
Guzzo, F; Cappello, M S; Azzolini, M; Tosi, E; Zapparoli, G
2011-08-15
The lysozyme of hen's egg white is used in winemaking to control spontaneous lactic acid bacteria (LAB). A total of eight LAB strains, isolated from grape must and wine, were used to assess the inhibitory effects of wine phenolics on lysozyme activity. The presence of phenolics, extracted from grape pomace, in growth medium reduced the mortality rate due to the lysozyme activity. This effect was especially clear in the case of strains belonging to Lactobacillus uvarum, Pediococcus parvulus and Oenococccus oeni, which are more sensitive to lysozyme than L. plantarum and L. hilgardii strains. Cell lysis assays carried out on four strains sensitive to lysozyme and Micrococcus lysodeikticus ATCC 4698, used as a reference strain, confirmed the inhibition of grape pomace phenolics on the muramidase. There was no interference from non-flavonoids, flavanols and flavonol compounds, when they were tested individually, on the lysozyme activity against the strains. Anthocyanins extracted from grape skins slightly inhibited the activity only against M. lysodeikticus. However, proanthocyanidins extracted from seed berries, strongly inhibited the lysozyme. In this extract, dimers were the predominant oligomers of flavan-3-ol. The study demonstrated that the effectiveness of lysozyme against LAB in red winemaking is related to the amount of low molecular weight proanthocyanidins that are released when the grapes are macerating. Copyright © 2011 Elsevier B.V. All rights reserved.
Anaerobic bacteria are bacteria that do not live or grow when oxygen is present. In humans, these bacteria ... Brook I. Diseases caused by non-spore-forming anaerobic bacteria. In: Goldman L, Schafer AI, eds. Goldman-Cecil ...
Guranowski, Andrzej; Wojdyła, Anna M; Rydzik, Anna M; Stepiński, Janusz; Jemielity, Jacek
2011-01-01
Adenosine 5'-phosphoramidate (NH₂-pA) is an uncommon natural nucleotide of poorly understood biochemistry and function. We studied a plant enzyme potentially involved in the catabolism of NH₂-pA. A fast and simple method comprising extraction of yellow lupin (Lupinus luteus) seed-meal with a low ionic strength buffer, ammonium sulfate and acetone fractionations, removal of contaminating proteins by heat denaturation, and affinity chromatography on AMP-agarose, yielded homogenous nucleoside 5'-phosphoramidase. Mass spectrometric analysis showed that the lupin hydrolase exhibits closest similarity to Arabidopsis thaliana Hint1 protein. The substrate specificity of the lupin enzyme, in particular its ability to split the P-S bond in adenosine 5'-phosphorothioate, is typical of known Hint1 proteins. Adenosine 5'-phosphofluoride and various derivatives of guanosine 5'-phosphoramidate were also substrates. Neither common divalent metal cations nor 10 mM EDTA or EGTA affected the hydrolysis of NH₂-pA. The enzyme functions as a homodimer (2 x 15,800 Da). At the optimum pH of 7.0, the K(m) for NH₂-pA was 0.5 µM and k(cat) 0.8 s⁻¹ (per monomer active site). The properties of the lupin nucleoside 5'-phosphoramidase are compared with those of its counterparts from other organisms.
Li, Hong-Lei; Li, Xiao-Ming; Mándi, Attila; Antus, Sándor; Li, Xin; Zhang, Peng; Liu, Yang; Kurtán, Tibor; Wang, Bin-Gui
2017-10-06
Four new cladosporol derivatives, cladosporols F-I (1-4), the known cladosporol C (5), and its new epimer, cladosporol J (6), were isolated and identified from the marine algal-derived endophytic fungus Cladosporium cladosporioides EN-399. Their structures were determined by detailed interpretation of NMR and MS data, and the absolute configurations were established on the basis of TDDFT-ECD and OR calculations. The configurational assignment of cladosporols F (1) and G (2) showed that the previously reported absolute configuration of cladosporol A and all the related cladosporols need to be revised from (4'R) to (4'S). Compounds 1-6 showed antibacterial activity against Escherichia coli, Micrococcus luteus, and Vibrio harveyi with MIC values ranging from 4 to 128 μg/mL. Compound 3 showed significant cytotoxicity against A549, Huh7, and LM3 cell lines with IC 50 values of 5.0, 1.0, and 4.1 μM, respectively, and compound 5 showed activity against H446 cell line with IC 50 value of 4.0 μM.
Lee, Keyong Ho; Kim, Kye-Woong; Rhee, Ki-Hyeong
2010-12-01
The Actinomycete strain KH29 is antagonistic to the multidrug-resistant Acinetobacter baumannii. Based on the diaminopimelic acid (DAP) type, and the morphological and physiological characteristics observed through the use of scanning electron microscopy (SEM), KH29 was confirmed as belonging to the genus Streptomyces. By way of its noted 16S rDNA nucleotide sequences, KH29 was found to have a relationship with Streptomyces cinnamonensis. The production of an antibiotic from this strain was found to be most favorable when cultured with glucose, polypeptone, and yeast extract (PY) medium for 6 days at 27 degrees C. The antibiotic produced was identified, through comparisons with reported spectral data including MS and NMR as a cyclo(L-tryptophanyl-L-tryptophanyl). Cyclo(L-Trp-L-Trp), from the PY cultures of KH29, was seen to be highly effective against 41 of 49 multidrugresistant Acinetobacter baumannii. Furthermore, cyclo(LTrp- L-Trp) had antimicrobial activity against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Saccharomyces cerevisiae, Aspergillus niger, and Candida albicans, However, it was ineffective against Streptomyces murinus.
El-Hewaity, Mohamed; Abd El Latif, Amera
2014-01-01
The comparative pharmacokinetic profile of cefquinome was studied in sheep and goats following repeated intramuscular (IM) administrations of 2 mg/kg body weight. Cefquinome concentrations in serum were determined by microbiological assay technique using Micrococcus luteus (ATCC 9341) as test organism. Following intramuscular injection of cefquinome in sheep and goats, the disposition curves were best described by two-compartment open model in both sheep and goats. The pharmacokinetics of cefquinome did not differ significantly between sheep and goats; similar intramuscular dose rate of cefquinome should therefore be applicable to both species. On comparing the data of serum levels of repeated intramuscular injections with first intramuscular injection, it was revealed that repeated intramuscular injections of cefquinome have cumulative effect in both species sheep and goats. The in vitro serum protein-binding tendency was 15.65% in sheep and 14.42% in goats. The serum concentrations of cefquinome along 24 h after injection in this study were exceeding the MICs of different susceptible microorganisms responsible for serious disease problems. These findings indicate successful use of cefquinome in sheep and goats. PMID:26464946
Glycosidases in Brachionus plicatilis (Rotifera).
Kühle, K; Kleinow, W
1990-01-01
1. Tests for glycosidases were performed in homogenates of Brachionus plicatilis. 2. Hydrolytic activity was detected with the following substrates: (a) with synthetic substrates (NP = 4-nitrophenyl): NP-alpha- and NP-beta-D-glucopyranoside, NP-alpha- and NP-beta-D-galactopyranoside, NP-N-acetyl-beta-D-glucosaminide, NP-N-acetyl-beta-D-galactosaminide, NP-alpha- and NP-beta-D-mannopyranoside and NP-alpha-L-fucopyranoside; (b) with disaccharides: sucrose, maltose, trehalose, isomaltose, cellobiose, gentiobiose and lactose; (c) with polysaccharides: laminarine, carboxymethyl-cellulose, avicel, Micrococcus luteus (for lysozyme) and 4-nitrophenyl-alpha-D-maltoheptaoside (for amylase). 3. The pH dependence of the glycosidase activities was determined. 4. The distribution of enzyme activities within fractions from the homogenate was studied in order to localize them within the cell. 5. Proteins from Brachionus homogenate were separated by SDS-gel electrophoresis and the positions of the following glycosidase activities were detected by assays performed on the gels (estimated molecular weights in parentheses): alpha-glucosidase (250,000); beta-glucosidase (200,000); beta-galactosidase (70,000); N-acetyl-beta-glucosaminidase (60,000).
Production of human lactoferrin in animal milk.
Goldman, I L; Georgieva, S G; Gurskiy, Ya G; Krasnov, A N; Deykin, A V; Popov, A N; Ermolkevich, T G; Budzevich, A I; Chernousov, A D; Sadchikova, E R
2012-06-01
Genetic constructs containing the human lactoferrin (hLf) gene were created within a joint program of Russian and Belorussian scientists. Using these constructs, transgenic mice were bred (the maximum hLf concentration in their milk was 160 g/L), and transgenic goats were also generated (up to 10 g/L hLf in their milk). Experimental goatherds that produced hLf in their milk were also bred, and the recombinant hLf was found to be identical to the natural protein in its physical and chemical properties. These properties included electrophoretic mobility, isoelectric point, recognition by polyclonal and monoclonal antibodies, circular dichroic spectra, interaction with natural ligands (DNA, lipopolysaccharides, and heparin), the binding of iron ions, the sequence of the 7 terminal amino acids, and its biological activity. The latter was assessed by the agglutination of Micrococcus luteus protoplasts, bactericidal activity against Escherichia coli and Listeria monocytogenes , and fungicidal activity against Candida albicans . We also demonstrated a significant increase in the activity of antibiotics when used in combination with Lf.
Gálvez-López, Ruben; Peña-Monje, Alejandro; Antelo-Lorenzo, Ramón; Guardia-Olmedo, Juan; Moliz, Juan; Hernández-Quero, José; Parra-Ruiz, Jorge
2014-01-01
Antibiotic-loaded acrylic bone cements (ALABC) spacers are routinely used in the treatment of prosthetic joint infections. The objectives of our study were to evaluate different ALABC for elution kinetics, thermal stability, and mechanical properties. A 10 or 20% mixture (w/w) beads of medium viscosity bone cement (DePuy, Inc) and vancomycin (VAN), gentamycin (GM), daptomycin (DAP), moxifloxacin (MOX), rifampicin (RIF), cefotaxime (CTX), cefepime (FEP), amoxicillin clavulanate (AmC), ampicillin (AMP), meropenem (MER), and ertapenem (ERT) were formed and placed into wells filled with phosphate-buffered saline. Antibiotic concentrations were determined using high-performance liquid chromatography. Antimicrobial activity was tested against Micrococcus luteus ATCC 9341 or Escherichia coli ATCC 25922. AmC, AMP, and FEP concentration rapidly decreased after day 2, being almost undetectable at day 4. Sustained and high elution rates were observed with VAN, GM, MOX, and RIF for the 30-day duration of the experiment. DAP, MER, ERT, and CTX elution rates constantly decreased from day 4. All antibiotics tested retained antimicrobial activity proving thermal stability. Mechanical properties of ALABC were maintained except when RIF was used. © 2013.
Lipopeptide biosurfactants from Paenibacillus polymyxa inhibit single and mixed species biofilms.
Quinn, Gerry A; Maloy, Aaron P; McClean, Stephen; Carney, Brian; Slater, John W
2012-01-01
Although biofilms are recognised as important in microbial colonisation, solutions to their inhibition are predominantly based on planktonic assays. These solutions have limited efficacy against biofilms. Here, a series of biofilm-orientated tests were used to identify anti-biofilm compounds from marine micro-flora. This led to the isolation of a complex of anti-biofilm compounds from an extract of Paenibacillus polymyxa (PPE). A combination of rpHPLC and mass spectrometry identified the principle components of PPE as fusaricidin B (LI-FO4b) and polymyxin D1, with minor contributions from surfactins. This complex (PPE) reduced the biofilm biomass of Bacillus subtilis, Micrococcus luteus, Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus bovis. In contrast, ampicillin was only effective against S. aureus. PPE also inhibited a self-assembling marine biofilm (SAMB) in co-incubation assays by 99.3% ± 1.9 and disrupted established SAMB by 72.4% ± 4.4, while ampicillin showed no significant reduction. The effectiveness of this complex of lipopeptides against single and multispecies biofilms suggests a future role in biofilm prevention strategies.
Chemical and biological evaluation of Ranunculus muricatus.
Khan, Farhat Ali; Zahoor, Muhammad; Khan, Ezzat
2016-03-01
Ranunculus muricatus is commonly known as spiny fruit buttercup and is used in the treatment of intermittent fevers, gout and asthma. Qualitative analysis of phytochemicals of Ranunculus muricatus indicated the presence of saponins, tannins, phenols, flavonoids and alkaloids. Saponins were present in high amount as compared with other chemicals. Inorganic and heavy metals constituents were determined. Heavy metals estimation in the sample showed that iron was present in high amount followed by zinc even then the concentration of these metals is below acceptable limit. The physical parameters, antioxidant and antimicrobial activities of the extracts were determined. Acetone extract fraction showed optimal antioxidant activity as compared to ethanol and chloroform fractions of the candidate plant. The antimicrobial and antifungal activities of the crude extract and extract fractions were determined by well agar diffusion method. Highest zone of inhibitions were observed for crude extract followed by acetone extract fraction against Micrococcus luteus. Antifungal activities were high for crude extracts against Candida Albican. Findings of this study show that Ranunculus muricatus has a good medicinal impact.
[Isolation and antimicrobial activities of actinomycetes from vermicompost].
Wang, Xue-jun; Yan, Shuang-lin; Min, Chang-li; Yang, Yan
2015-02-01
In this paper, actinomycetes were isolated from vermicompost by tablet coating method. Antimicrobial activities of actinomycetes were measured by the agar block method. Strains with high activity were identified based on morphology and biochemical characteristics, as well as 16S rDNA gene sequence analysis. The results showed that 26 strains of actinomycetes were isolated, 16 of them had antimicrobial activities to the test strains which accounts for 61.54% of all strains. Among the 16 strains, the strain QYF12 and QYF22 had higher antimicrobial activity to Micrococcus luteus, with a formed inhibition zone of 27 mm and 31 mm, respectively. While the strain QYF26 had higher antimicrobial activity to Bacillus subtilis, and the inhibition zone diameter was 21 mm. Based on the identification of strains with high activity, the strain QYF12 was identified as Streptomyces chartreusis, the strain QYF22 was S. ossamyceticus and the strain QYF26 was S. gancidicus. This study provided a theoretical basis for further separate antibacterial product used for biological control.
Li, Bing; Yu, Hai-Zhong; Ye, Chong-Jun; Ma, Yan; Li, Xing; Fan, Tao; Chen, Fu-Sheng; Xu, Jia-Ping
2017-04-30
Serpins are a family of serine protease inhibitors that are found widely in insects. They play an important role in insect physiological responses, such as innate immunity and development. In this study, we obtained the Bombyx mori serpin6 (BmSerpin6) sequence from National Center for Biotechnology Information (NCBI) and the silkworm genome database (SilkDB). Reverse transcription PCR (RT-PCR) results showed that BmSerpin6 was expressed highly in hemocytes, the midgut, and the fat body. After challenging with Micrococcus luteus (Mi) and Serratia marcescens (Sm), the BmSerpin6 expression level was induced significantly. Transcript levels of gloverin2 and prophenoloxidase (PPO) activity were reduced significantly in the fat body and hemocytes after injecting the recombinant BmSerpin6 protein into silkworm larvae. A BmSerpin6 recombinant plasmid (BmSerpin6-pAC 5.1) was constructed successfully and transfected into Drosophila S2 cells, which resulted in significantly reduced expression of the drosomycin protein. These results indicated that BmSerpin6 might regulate silkworm immune responses. Copyright © 2017 Elsevier B.V. All rights reserved.
Herken, Emine Nur; Celik, Ali; Aslan, Mustafa; Aydınlık, Nilüfer
2012-09-01
The chemical composition, antimicrobial activity, total phenol content, total antioxidant activity, and total oxidant status of the essential oil from Micromeria congesta Boiss. & Hausskn. ex Boiss. were investigated. Steam distillation was used to obtain the essential oil, and the chemical analyses were performed by gas chromatography-mass spectrometry. The antimicrobial activity was tested by an agar disc diffusion method against the tested microorganisms: Bacillus subtilis NRRL B-744, Bacillus cereus NRRL B-3711, Staphylococcus aureus ATCC 12598, S. aureus ATCC 25923, S. aureus ATCC 25933, Escherichia coli 0157H7, E. coli ATCC25922, Micrococcus luteus NRLL B-4375, Enterococcus faecalis ATCC 19433, Proteus vulgaris RSKK 96026, and Yersinia enterecolitica RSKK 1501. The major compounds found in volatiles of M. congesta were piperitone oxide, linalool oxide, veratrole, pulegone, dihydro carvone, naphthalene, iso-menthone, para-menthone, and cyclohexanone. Compared to that of reference antibiotics, the antibacterial activity of the essential oil is considered as significant. Results showed that M. congesta has the potential for being used in food and medicine depending on its antioxidant and antibacterial activity.
Dayakar, Cherupally; Kumar, Buddana Sudheer; Sneha, Galande; Sagarika, Gudem; Meghana, Koneru; Ramakrishna, Sistla; Prakasham, Reddy Shetty; China Raju, Bhimapaka
2017-10-15
A series of novel pyrazolyl alcohols (5a-h), pyrazolyl azides (6a-h), and pyrazolyltriazoles (8a-h, 10a-p and 12a-l) were prepared and evaluated for their bioactivity (anti-bacterial and anti-inflammatory) profile. The compound 5c displayed the potent anti-bacterial activity against Micrococcus luteus (MIC 3.9 and MBC 7.81µg/mL). In vitro anti-inflammatory activity data denoted that compound 8b is effective among the tested compounds against IL-6 (IC 50 6.23μM). Docking analysis of compounds 5f, 8a-b, 8e-f and 8h displayed high binding energies for the compounds 8a-b and 8h towards TNF-α dimer (2AZ5 protein) and IL-6 (1ALU protein). In vivo anti-inflammatory activity of compounds 8b and 8h with respect to LPS induced mice model indicated that compound 8h showed significant reduction in TNF-α. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Stanić, Vojislav; Radosavljević-Mihajlović, Ana S.; Živković-Radovanović, Vukosava; Nastasijević, Branislav; Marinović-Cincović, Milena; Marković, Jelena P.; Budimir, Milica D.
2015-05-01
Silver doped fluorapatite nanopowders were synthesised by neutralization method, which consists of dissolving Ag2O in solution of HF and H3PO4 and addition to suspension of Ca(OH)2. The powder XRD, SEM and FTIR studies indicated the formation of a fluorapatite nanomaterials with average length of the particles is about 80 nm and a width of about 15 nm. The FTIR studies show that carbonate content in samples is very small and carbonte ions substitute both phosphate and hydroxyl groups in the crystal structure of samples, forming AB-type fluorapatite. Antibacterial studies have demonstrated that all Ag+-doped fluorapatite samples exhibit bactericidal effect against pathogens: Staphylococcus aureus, Micrococcus luteus and Kllebsiela pneumoniae. Antibacterial activity increased with the increase of Ag+ in the samples. The atomic force microscopy studies revealed extensive damage to the bacterial cell envelops in the presence of Ag+-doped fluorapatite particles which may lead to their death. The synthesized Ag+-doped fluorapatite nanomaterials are promising as antibacterial biomaterials in orthopedics and dentistry.
NASA Astrophysics Data System (ADS)
Pant, Gaurav; Nayak, Nitesh; Gyana Prasuna, R.
2013-10-01
The present investigation describes simple and effective method for synthesis of silver nanoparticles via green route. Solanum trilobatum Linn extract were prepared by both conventional and homogenization method. We optimized the production of silver nanoparticles under sunlight, microwave and room temperature. The best results were obtained with sunlight irradiation, exhibiting 15-20 nm silver nanoparticles having cubic and hexagonal shape. Biosynthesized nanoparticles were highly toxic to various bacterial strains tested. In this study we report antibacterial activity against various Gram negative ( Klebsiella pneumoniae, Vibrio cholerae and Salmonella typhi) and Gram positive ( Staphylococcus aureus, Bacillus cereus and Micrococcus luteus) bacterial strains. Screening was also performed for any antifungal properties of the nanoparticles against human pathogenic fungal strains ( Candida albicans and Candida parapsilosis). We also demonstrated that these nanoparticles when mixed with shampoo enhance the anti-dandruff effect against dandruff causing fungal pathogens ( Pityrosporum ovale and Pityrosporum folliculitis). The present study showed a simple, rapid and economical route to synthesize silver nanoparticles and their applications hence has a great potential in biomedical field.
Kawai, Shigeyuki; Mori, Shigetarou; Murata, Kousaku
2003-08-01
The gene encoding an inorganic polyphosphate/ATP-NAD kinase was cloned from Micrococcus flavus, and its primary structure was analyzed. Alignment of the primary structure with those of other characterized NAD kinases revealed candidate amino acid residues, mainly charged ones, that would be related to inorganic polyphosphate use. The alignment also showed that the primary structure found carried a protruding C-terminal polypeptide. Although the C-terminal polypeptide was demonstrated to be dispensable for the kinase activities, and was proposed to be removed in M. flavus, the entire primary structure including the C-terminal polypeptide was homologous with that of the ATP synthase beta chain. The inorganic polyphosphate used by the inorganic polyphosphate/ATP-NAD kinase as a phosphoryl donor was isolated from cells of M. flavus, suggesting that the ability of the enzyme to use inorganic polyphosphate is of physiological significance and is not an evolutionary trait alone.
Khochamit, Nalisa; Siripornadulsil, Surasak; Sukon, Peerapol; Siripornadulsil, Wilailak
2015-01-01
The antimicrobial activity and probiotic properties of Bacillus subtilis strain KKU213, isolated from local soil, were investigated. The cell-free supernatant (CFS) of a KKU213 culture containing crude bacteriocins exhibited inhibitory effects on Gram-positive bacteria, including Bacillus cereus, Listeria monocytogenes, Micrococcus luteus, and Staphylococcus aureus. The antibacterial activity of the CFS precipitated with 40% ammonium sulfate (AS) remained even after treatment at 60 and 100 °C, at pH 4 and 10 and with proteolytic enzymes, detergents and heavy metals. When analyzed by SDS-PAGE and overlaid with the indicator strains B. cereus and S. aureus, the 40% AS precipitate exhibited inhibitory activity on proteins smaller than 10 kDa. However, proteins larger than 25 kDa and smaller than 10 kDa were still observed on a native protein gel. Purified subtilosin A was prepared by Amberlite XAD-16 bead extraction and HPLC and analyzed by Nano-LC-QTOF-MS. Its molecular mass was found to be 3.4 kDa, and it retained its antibacterial activity. These results are consistent with the detection of the anti-listerial subtilosin A gene of the sbo/alb cluster in the KKU213 strain, which is 100% identical to that of B. subtilis subsp. subtilis 168. In addition to stable and cyclic subtilosin A, a mixture of many extracellular antibacterial peptides was also detected in the KKU213 culture. The KKU213 strain produced extracellular amylase, cellulase, lipase and protease, is highly acid-resistant (pH 2) when cultured in inulin and promotes health and reduces infection of intestinally colonized broiler chickens. Therefore, we propose that bacteriocin-producing B. subtilis KKU213 could be used as a potential probiotic strain or protective culture. Copyright © 2014 Elsevier GmbH. All rights reserved.
An Integrin from Shrimp Litopenaeus vannamei Mediated Microbial Agglutination and Cell Proliferation
Zhang, Ying; Wang, Leilei; Wang, Lingling; Wu, Ning; Zhou, Zhi; Song, Linsheng
2012-01-01
Background Integrins are a family of adhesion receptors which regulate cell proliferation, differentiation, leukocyte migration, and complement receptor-dependent phagocytosis. In invertebrates, as a cell adhesion receptor, β integrins play an important role for the balanced activation of immune defense responses especially during the encounter of infections. The present study attempts to characterize the immune functions of shrimp integrin (LvIntegrin) to have better understanding on the immune system and its regulation mechanisms in shrimps. Methodology A shrimp integrin was identified from the Pacific white shrimp Litopenaeus vannamei (designated as LvIntegrin). Its full-length cDNA was of 2621 bp with an open reading frame (ORF) of 2439 bp encoding a polypeptide of 812 amino acids. The mRNA expression of LvIntegrin was significantly up-regulated at 3, 6 and 12 h after Listonella anguillarum challenge. The cDNA fragment encoding β integrin domains (βA and hybrid domain) of LvIntegrin was recombined and expressed in Escherichia coli BL21(DE3)-pLysS. The recombinant protein (rLvIntegrin) could significantly agglutinate the tested microbe including E. coli JM109, L. anguillarum, Micrococcus luteus and Candida dattiladattila in the presence of divalent cations. Moreover, when NIH3T3 cells were cultured with rLvIntegrin, the proliferation rate increased significantly in a dose-dependent manner. Conclusions LvIntegrin, a shrimp β integrin was identified from L. vannamei, shared several highly conserved features. LvIntegrin exhibited broad-spectrum agglutination activity towards both bacteria and fungi and could improve the proliferation of NIH3T3 cells, indicating that LvIntegrin is involved in the immune response against microbe challenge and regulation of cell proliferation as a cell adhesion receptor in shrimp. PMID:22792387
Zhang, Ying; Wang, Leilei; Wang, Lingling; Wu, Ning; Zhou, Zhi; Song, Linsheng
2012-01-01
Integrins are a family of adhesion receptors which regulate cell proliferation, differentiation, leukocyte migration, and complement receptor-dependent phagocytosis. In invertebrates, as a cell adhesion receptor, β integrins play an important role for the balanced activation of immune defense responses especially during the encounter of infections. The present study attempts to characterize the immune functions of shrimp integrin (LvIntegrin) to have better understanding on the immune system and its regulation mechanisms in shrimps. A shrimp integrin was identified from the Pacific white shrimp Litopenaeus vannamei (designated as LvIntegrin). Its full-length cDNA was of 2621 bp with an open reading frame (ORF) of 2439 bp encoding a polypeptide of 812 amino acids. The mRNA expression of LvIntegrin was significantly up-regulated at 3, 6 and 12 h after Listonella anguillarum challenge. The cDNA fragment encoding β integrin domains (βA and hybrid domain) of LvIntegrin was recombined and expressed in Escherichia coli BL21(DE3)-pLysS. The recombinant protein (rLvIntegrin) could significantly agglutinate the tested microbe including E. coli JM109, L. anguillarum, Micrococcus luteus and Candida dattiladattila in the presence of divalent cations. Moreover, when NIH3T3 cells were cultured with rLvIntegrin, the proliferation rate increased significantly in a dose-dependent manner. LvIntegrin, a shrimp β integrin was identified from L. vannamei, shared several highly conserved features. LvIntegrin exhibited broad-spectrum agglutination activity towards both bacteria and fungi and could improve the proliferation of NIH3T3 cells, indicating that LvIntegrin is involved in the immune response against microbe challenge and regulation of cell proliferation as a cell adhesion receptor in shrimp.
Liu, Conghui; Wang, Mengqiang; Jiang, Shuai; Wang, Lingling; Chen, Hao; Liu, Zhaoqun; Qiu, Limei; Song, Linsheng
2016-02-01
Junctional adhesion molecule (JAM), a subfamily of immunoglobulin superfamily (IgSF) with a couple of immunoglobulin domains, can act as regulator in homeostasis and inflammation of vertebrates. In the present study, a structural homolog of JAM-A (designated CgJAM-A-L) was screened out from oyster, Crassostrea gigas, through a search of JAM-A D1 domain (N-terminal Ig domain in JAM-A). The cDNA of CgJAM-A-L was of 1188 bp encoding a predicted polypeptide of 395 amino acids. The immunoreactive area of CgJAM-A-L mainly distributed over the plasma membrane of hemocytes. After Vibro splendidus or tumor necrosis factor (CgTNF-1) stimulation, the mRNA transcripts of CgJAM-A-L in hemocytes increased significantly by 4.46-fold and 9.00-fold (p < 0.01) of those in control group, respectively. The recombinant CgJAM-A-L protein (rCgJAM-A-L) could bind multiple PAMPs including lipopolysaccharides (LPS), peptidoglycan (PGN), lipoteichoic acid (LTA), mannose (MAN), β-glucan (GLU) and poly(I:C), and various microorganisms including Micrococcus luteus, Staphylococcus aureus, Escherichia coli, Vibro anguillarum, V. splendidus, Pastoris pastoris and Yarrowia lipolytica. The phagocytic rates of oyster hemocytes towards Gram-negative bacteria V. anguillarum and yeast P. pastoris were significantly enhanced after the incubation of rCgJAM-A-L, and even increased more significantly after the pre-incubation of rCgJAM-A-L with microbes (p < 0.01). The results collectively indicated that CgJAM-A-L functioned as an important pattern recognition receptor (PRR) and opsonin in the immune defense against invading pathogen in oyster. Moreover, as the most primitive specie with homolog of JAMs, the information of CgJAM-A-L in oyster would provide useful clues for the evolutionary study of JAMs and immunoglobulins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Effect of Flash-Heat Treatment on Antimicrobial Activity of Breastmilk
Wiedeman, Jean; Buehring, Gertrude; Peerson, Janet M.; Hayfron, Kweku; K'Aluoch, Okumu; Lonnerdal, Bo; Israel-Ballard, Kiersten; Coutsoudis, Anna; Abrams, Barbara
2011-01-01
Abstract Background and Objectives The World Health Organization recommends human immunodeficiency virus (HIV)-positive mothers in resource-poor regions heat-treat expressed breastmilk during periods of increased maternal-to-child transmission risk. Flash-heat, a “low tech” pasteurization method, inactivates HIV, but effects on milk protein bioactivity are unknown. The objectives were to measure flash-heat's effect on antimicrobial properties of lactoferrin, lysozyme, and whole milk and on the digestive resistance of lactoferrin and lysozyme. Methods Flash-heated and unheated breastmilk aliquots from HIV-positive mothers in South Africa were “spiked” with Staphylococcus aureus and Escherichia coli and then cultured for 0, 3, and 6 hours. Lysozyme and lactoferrin activities were determined by lysis of Micrococcus luteus cells and inhibition of enteropathogenic E. coli, respectively, measured spectrophotometrically. Percentages of proteins surviving in vitro digestion, lactoferrin and lysozyme activity, and bacteriostatic activity of whole milk in heated versus unheated samples were compared. Results There was no difference in rate of growth of E. coli or S. aureus in flash-heated versus unheated whole milk (p = 0.61 and p = 0.96, respectively). Mean (95% confidence interval) antibacterial activity of lactoferrin was diminished 11.1% (7.8%, 14.3%) and that of lysozyme by up to 56.6% (47.1%, 64.5%) by flash-heat. Digestion of lysozyme was unaffected (p = 0.12), but 25.4% less lactoferrin survived digestion (p < 0.0001). Conclusions In summary, flash-heat resulted in minimally decreased lactoferrin and moderately decreased lysozyme bioactivity, but bacteriostatic activity of whole milk against representative bacteria was unaffected. This suggests flash-heated breastmilk likely has a similar profile of resistance to bacterial contamination as that of unheated milk. Clinical significance of the decreased bioactivity should be tested in clinical
Blechnum Orientale Linn - a fern with potential as antioxidant, anticancer and antibacterial agent
2010-01-01
Background Blechnum orientale Linn. (Blechnaceae) is used ethnomedicinally for the treatment of various skin diseases, stomach pain, urinary bladder complaints and sterilization of women. The aim of the study was to evaluate antioxidant, anticancer and antibacterial activity of five solvent fractions obtained from the methanol extract of the leaves of Blechnum orientale Linn. Methods Five solvent fractions were obtained from the methanol extract of B. orientale through successive partitioning with petroleum ether, chloroform, ethyl acetate, butanol and water. Total phenolic content was assessed using Folin-Ciocalteu's method. The antioxidant activity was determined by measuring the scavenging activity of DPPH radicals. Cytotoxic activity was tested against four cancer cell lines and a non-malignant cell using MTT assay. Antibacterial activity was assessed using the disc diffusion and broth microdilution assays. Standard phytochemical screening tests for saponins, tannins, terpenoids, flavonoids and alkaloids were also conducted. Results The ethyl acetate, butanol and water fractions possessed strong radical scavenging activity (IC50 8.6-13.0 μg/ml) and cytotoxic activity towards human colon cancer cell HT-29 (IC50 27.5-42.8 μg/ml). The three extracts were also effective against all Gram-positive bacteria tested: Bacillus cereus, Micrococcus luteus, methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant Staphylococcus aureus (MRSA) and Stapylococcus epidermidis(minimum inhibitory concentration MIC 15.6-250 μg/ml; minimum bactericidal concentration MBC 15.6-250 μg/ml). Phytochemical analysis revealed the presence of flavonoids, terpenoids and tannins. Ethyl acetate and butanol fractions showed highest total phenolic content (675-804 mg gallic acid equivalent/g). Conclusions The results indicate that this fern is a potential candidate to be used as an antioxidant agent, for colon cancer therapy and for treatment of MRSA infections and other
Effect of flash-heat treatment on antimicrobial activity of breastmilk.
Chantry, Caroline J; Wiedeman, Jean; Buehring, Gertrude; Peerson, Janet M; Hayfron, Kweku; K'Aluoch, Okumu; Lonnerdal, Bo; Israel-Ballard, Kiersten; Coutsoudis, Anna; Abrams, Barbara
2011-06-01
The World Health Organization recommends human immunodeficiency virus (HIV)-positive mothers in resource-poor regions heat-treat expressed breastmilk during periods of increased maternal-to-child transmission risk. Flash-heat, a "low tech" pasteurization method, inactivates HIV, but effects on milk protein bioactivity are unknown. The objectives were to measure flash-heat's effect on antimicrobial properties of lactoferrin, lysozyme, and whole milk and on the digestive resistance of lactoferrin and lysozyme. Flash-heated and unheated breastmilk aliquots from HIV-positive mothers in South Africa were "spiked" with Staphylococcus aureus and Escherichia coli and then cultured for 0, 3, and 6 hours. Lysozyme and lactoferrin activities were determined by lysis of Micrococcus luteus cells and inhibition of enteropathogenic E. coli, respectively, measured spectrophotometrically. Percentages of proteins surviving in vitro digestion, lactoferrin and lysozyme activity, and bacteriostatic activity of whole milk in heated versus unheated samples were compared. There was no difference in rate of growth of E. coli or S. aureus in flash-heated versus unheated whole milk (p = 0.61 and p = 0.96, respectively). Mean (95% confidence interval) antibacterial activity of lactoferrin was diminished 11.1% (7.8%, 14.3%) and that of lysozyme by up to 56.6% (47.1%, 64.5%) by flash-heat. Digestion of lysozyme was unaffected (p = 0.12), but 25.4% less lactoferrin survived digestion (p < 0.0001). In summary, flash-heat resulted in minimally decreased lactoferrin and moderately decreased lysozyme bioactivity, but bacteriostatic activity of whole milk against representative bacteria was unaffected. This suggests flash-heated breastmilk likely has a similar profile of resistance to bacterial contamination as that of unheated milk. Clinical significance of the decreased bioactivity should be tested in clinical trials.
Bacteria isolated from amoebae/bacteria consortium
Tyndall, R.L.
1995-05-30
New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.
Bacteria isolated from amoebae/bacteria consortium
Tyndall, Richard L.
1995-01-01
New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.
Yang, Zhi; Hu, Xueqian; Wu, Shihua
2016-02-01
In the course of screening new anticancer natural products, an edible forest mushroom Suillus luteus (L. Ex Franch). Gray was found to have potent cytotoxicity against several human cancer cells. However, the lipophilic sample made some countercurrent chromatography solvent systems emulsify, which caused difficulties in the separation of its cytotoxic components. Here, we found that the addition of an organic salt sodium dodecyl sulfate could efficiently shorten the settling time of the mushroom sample solutions by eliminating the emulsification of two-phase solvent systems. Moreover, we found that sodium dodecyl sulfate could play a new "salting-in" role and made the partition coefficients of the solutes decrease with the increased concentrations. Thus, a sodium dodecyl sulfate based salting-in countercurrent chromatography method has been successfully established for the first time for preparative isolation of a cytotoxic principle of the mushroom. The active component was identified as isosuillin. Whole results indicated that sodium dodecyl sulfate could be used as an efficient salting-in reagent for two-phase solvent system selection and targeted countercurrent chromatography isolation. It is very useful for current natural products isolation and drug discovery. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dastager, Syed G; Deepa, C K; Pandey, Ashok
2010-12-01
A phosphate-solubilizing bacterial strain NII-0909 isolated from the Western ghat forest soil in India was identified as Micrococcus sp on the basis of phenotypic characteristics, carbon source utilization pattern, fatty acid methyl esters analysis, and 16S rRNA gene sequence. The strain exhibited the plant growth-promoting attributes of phosphate solubilization, auxin production, 1-aminocyclopropane-1-carboxylate deaminase activity, and siderophore production. It was able to solubilize (122.4μg of Ca(3)PO(4) ml(-1)), and produce IAA (109μgml(-1)) at 30°C. P-solubilizing activity of the strain NII-0909 was associated with the release of organic acids and a drop in the pH of the NBRIP medium. HPLC analysis detected two organic acids in the course of P-solubilization. A significant increase in the growth of cow pea was recorded for inoculations under controlled conditions. Scanning electron microscopic study revealed the root colonization of strain on cow pea seedlings. These results demonstrate that isolates NII-0909 has the promising PGPR attributes to be develop as a biofertilizer to enhance soil fertility and promote the plant growth. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Jones, Ronald N; Stilwell, Matthew G
2013-06-01
Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.
Production and consumption of nitric oxide by three methanotrophic bacteria.
Ren, T; Roy, R; Knowles, R
2000-09-01
We studied nitrogen oxide production and consumption by methanotrophs Methylobacter luteus (group I), Methylosinus trichosporium OB3b (group II), and an isolate from a hardwood swamp soil, here identified by 16S ribosomal DNA sequencing as Methylobacter sp. strain T20 (group I). All could consume nitric oxide (nitrogen monoxide, NO), and produce small amounts of nitrous oxide (N(2)O). Only Methylobacter strain T20 produced large amounts of NO (>250 parts per million by volume [ppmv] in the headspace) at specific activities of up to 2.0 x 10(-17) mol of NO cell(-1) day(-1), mostly after a culture became O(2) limited. Production of NO by strain T20 occurred mostly in nitrate-containing medium under anaerobic or nearly anaerobic conditions, was inhibited by chlorate, tungstate, and O(2), and required CH(4). Denitrification (methanol-supported N(2)O production from nitrate in the presence of acetylene) could not be detected and thus did not appear to be involved in the production of NO. Furthermore, cd(1) and Cu nitrite reductases, NO reductase, and N(2)O reductase could not be detected by PCR amplification of the nirS, nirK, norB, and nosZ genes, respectively. M. luteus and M. trichosporium produced some NO in ammonium-containing medium under aerobic conditions, likely as a result of methanotrophic nitrification and chemical decomposition of nitrite. For Methylobacter strain T20, arginine did not stimulate NO production under aerobiosis, suggesting that NO synthase was not involved. We conclude that strain T20 causes assimilatory reduction of nitrate to nitrite, which then decomposes chemically to NO. The production of NO by methanotrophs such as Methylobacter strain T20 could be of ecological significance in habitats near aerobic-anaerobic interfaces where fluctuating O(2) and nitrate availability occur.
Production and Consumption of Nitric Oxide by Three Methanotrophic Bacteria
Ren, Tie; Roy, Réal; Knowles, Roger
2000-01-01
We studied nitrogen oxide production and consumption by methanotrophs Methylobacter luteus (group I), Methylosinus trichosporium OB3b (group II), and an isolate from a hardwood swamp soil, here identified by 16S ribosomal DNA sequencing as Methylobacter sp. strain T20 (group I). All could consume nitric oxide (nitrogen monoxide, NO), and produce small amounts of nitrous oxide (N2O). Only Methylobacter strain T20 produced large amounts of NO (>250 parts per million by volume [ppmv] in the headspace) at specific activities of up to 2.0 × 10−17 mol of NO cell−1 day−1, mostly after a culture became O2 limited. Production of NO by strain T20 occurred mostly in nitrate-containing medium under anaerobic or nearly anaerobic conditions, was inhibited by chlorate, tungstate, and O2, and required CH4. Denitrification (methanol-supported N2O production from nitrate in the presence of acetylene) could not be detected and thus did not appear to be involved in the production of NO. Furthermore, cd1 and Cu nitrite reductases, NO reductase, and N2O reductase could not be detected by PCR amplification of the nirS, nirK, norB, and nosZ genes, respectively. M. luteus and M. trichosporium produced some NO in ammonium-containing medium under aerobic conditions, likely as a result of methanotrophic nitrification and chemical decomposition of nitrite. For Methylobacter strain T20, arginine did not stimulate NO production under aerobiosis, suggesting that NO synthase was not involved. We conclude that strain T20 causes assimilatory reduction of nitrate to nitrite, which then decomposes chemically to NO. The production of NO by methanotrophs such as Methylobacter strain T20 could be of ecological significance in habitats near aerobic-anaerobic interfaces where fluctuating O2 and nitrate availability occur. PMID:10966405
Shafirovich, V; Dourandin, A; Luneva, N P; Singh, C; Kirigin, F; Geacintov, N E
1999-03-01
The excitation of pBr322 supercoiled plasmid DNA with intense near-IR 810 nm fs laser pulses by a simultaneous multiphoton absorption mechanism results in single-strand breaks after treatment of the irradiated samples with Micrococcus luteus UV endonuclease. This enzyme cleaves DNA strands at sites of cyclobutane dimers that are formed by the simultaneous absorption of three (or more) 810 nm IR photons (pulse width approximately 140 fs, 76 MHz pulse repetition, average power output focused through 10x microscope objective is approximately 1.2 MW/cm2). Direct single-strand breaks (without treatment with M. luteus) were not observed under these conditions. However, in the presence of 6 microM of the intercalator proflavine (PF), both direct single- and double-strand breaks are observed under conditions where substantial fractions of undamaged supercoiled DNA molecules are still present. The fraction of direct double-strand breaks is 30 +/- 5% of all measurable strand cleavage events, is independent of dosage (up to 6.4 GJ/cm2) and is proportional to In, where I is the average power/area of the 810 nm fs laser pulses, and n = 3 +/- 1. The nicking of two DNA strands in the immediate vicinity of the excited PF molecules gives rise to this double-strand cleavage. In contrast, excitation of the same samples under low-power, single-photon absorption conditions (approximately 400-500 nm) gives rise predominantly to single-strand breaks, but some double-strand breaks are observed at the higher dosages. Thus, single-photon excitation with 400-500 nm light and multiphoton activation of PF by near-IR fs laser pulses produces different distributions of single- and double-strand breaks. These results suggest that DNA strand cleavage originates from unrelaxed, higher excited states when PF is excited by simultaneous IR multiphoton absorption processes.
Chen, Chen; Eldein, Salah; Zhou, Xiaosan; Sun, Yu; Gao, Jin; Sun, Yuxuan; Liu, Chaoliang; Wang, Lei
2018-01-01
The Rab-family GTPases mainly regulate intracellular vesicle transport, and play important roles in the innate immune response in invertebrates. However, the function and signal transduction of Rab proteins in immune reactions remain unclear in silkworms. In this study, we analyzed a Rab-related protein of silkworm Bombyx mori (BmRABRP) by raising antibodies against its bacterially expressed recombinant form. Tissue distribution analysis showed that BmRABRP mRNA and protein were high expressed in the Malpighian tubule and fat body, respectively. However, among the different stages, only the fourth instar larvae and pupae showed significant BmRABRP levels. After challenge with four pathogenic microorganisms (Escherichia coli, BmNPV, Beauveria bassiana, Micrococcus luteus), the expression of BmRABRP mRNA in the fat body was significantly upregulated. In contrast, the BmRABRP protein was significantly upregulated after infection with BmNPV, while it was downregulated by E. coli, B. bassiana, and M. luteus. A specific dsRNA was used to explore the immune function and relationship between BmRABRP and the JAK-STAT signaling pathway. After BmRABRP gene interference, significant reduction in the number of nodules and increased mortality suggested that BmRABRP plays an important role in silkworm's response to bacterial challenge. In addition, four key genes (BmHOP, BmSTAT, BmSOCS2, and BmSOCS6) of the JAK-STAT signaling pathway showed significantly altered expressions after BmRABRP silencing. BmHOP and BmSOCS6 expressions were significantly decreased, while BmSTAT and BmSOCS2 were significantly upregulated. Our results suggested that BmRABRP is involved in the innate immune response against pathogenic microorganisms through the JAK-STAT signaling pathway in silkworm. © 2017 Wiley Periodicals, Inc.
Enhanced anti-cancer and antimicrobial activities of curcumin nanoparticles.
Adahoun, Mo'ath Ahmad; Al-Akhras, Mohammed-Ali Hassan; Jaafar, Mohamad Suhaimi; Bououdina, Mohamed
2017-02-01
Background Curcumin (diferuloylmethane) is a polyphenol derived from the plant Curcuma longa, commonly called turmeric. Extensive research over the last 50 years has demonstrated that these polyphenols play an important role in the maintenance of health and prevention of diseases, in addition to its therapeutic benefits such as anti-tumor, anti-inflammatory, and anti-oxidant activities. Materials and methods This study is devoted to the enhancement of the solubility and bioavailability of curcumin nanoparticles prepared by a process based on a wet-milling technique and then examine in vitro against prostate cancer cell line 3 (PC3), human embryonic kidney cell line (HEK), human erythrocytes (red blood cells (RBCs)), and against fourth different bacterial strains two gram-positive (Micrococcus luteus ATCC 9341, Staphylococcus aureus ATCC 29213), two gram-negative (Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853). Results The cell viability curve, the half maximal inhibitory concentration (IC 50 ), and the minimum bactericidal concentration (MBC) were evaluated. Nanocurcumin displayed significant activity against cancer cell line (PC3) and low toxicity against normal cells (HEK) compared with parent curcumin in favor of PC3 (P < 0.05). In addition, it was found that the efficiency of toxicity for nanocurcumin against PC3 (E% = 59.66%) was much better than HEK (E% = 36.07%) compared with parent curcumin. The results also demonstrate that, although nanocurcumin has a little more ability to lays RBCs than parent curcumin after incubated 60 min, but the hemolysis % remained very low and there was no significant difference between hemolysis % of nanocurcumin and parent curcumin (P > 0.05). On the other hand, the results demonstrate that, the MBCs of nanocurcumin were lower than curcumin for all different bacterial strains. Moreover, the selected gram-positive bacteria had higher sensitivity than the selected gram-negative bacteria for both
Mefteh, Fedia B.; Daoud, Amal; Chenari Bouket, Ali; Alenezi, Faizah N.; Luptakova, Lenka; Rateb, Mostafa E.; Kadri, Adel; Gharsallah, Neji; Belbahri, Lassaad
2017-01-01
In this study, we aimed to explore and compare the composition, metabolic diversity and antimicrobial potential of endophytic fungi colonizing internal tissues of healthy and brittle leaf diseased (BLD) date palm trees (Phoenix dactylifera L.) widely cultivated in arid zones of Tunisia. A total of 52 endophytic fungi were isolated from healthy and BLD roots of date palm trees, identified based on internal transcribed spacer-rDNA sequence analysis and shown to represent 13 species belonging to five genera. About 36.8% of isolates were shared between healthy and diseased root fungal microbiomes, whereas 18.4 and 44.7% of isolates were specific to healthy and BLD root fungal microbiomes, respectively. All isolates were able to produce at least two of the screened enzymes including amylase, cellulase, chitinase, pectinase, protease, laccase and lipase. A preliminary screening of the isolates using disk diffusion method for antibacterial activity against four Gram-positive and three Gram-negative bacteria and antifungal activities against three phytopathogenic fungi indicated that healthy and BLD root fungal microbiomes displayed interesting bioactivities against examined bacteria and broad spectrum bioactivity against fungal pathogens. Some of these endophytic fungi (17 isolates) were fermented and their extracts were evaluated for antimicrobial potential against bacterial and fungal isolates. Results revealed that fungal extracts exhibited antibacterial activities and were responsible for approximately half of antifungal activities against living fungi. These results suggest a strong link between fungal bioactivities and their secondary metabolite arsenal. EtOAc extracts of Geotrichum candidum and Thielaviopsis punctulata originating from BLD microbiome gave best results against Micrococcus luteus and Bacillus subtilis with minimum inhibitory concentration (MIC, 0.78 mg/mL) and minimum bactericidal concentration (6.25 mg/mL). G. candidum gave the best result against
Mefteh, Fedia B; Daoud, Amal; Chenari Bouket, Ali; Alenezi, Faizah N; Luptakova, Lenka; Rateb, Mostafa E; Kadri, Adel; Gharsallah, Neji; Belbahri, Lassaad
2017-01-01
In this study, we aimed to explore and compare the composition, metabolic diversity and antimicrobial potential of endophytic fungi colonizing internal tissues of healthy and brittle leaf diseased (BLD) date palm trees ( Phoenix dactylifera L.) widely cultivated in arid zones of Tunisia. A total of 52 endophytic fungi were isolated from healthy and BLD roots of date palm trees, identified based on internal transcribed spacer-rDNA sequence analysis and shown to represent 13 species belonging to five genera. About 36.8% of isolates were shared between healthy and diseased root fungal microbiomes, whereas 18.4 and 44.7% of isolates were specific to healthy and BLD root fungal microbiomes, respectively. All isolates were able to produce at least two of the screened enzymes including amylase, cellulase, chitinase, pectinase, protease, laccase and lipase. A preliminary screening of the isolates using disk diffusion method for antibacterial activity against four Gram-positive and three Gram-negative bacteria and antifungal activities against three phytopathogenic fungi indicated that healthy and BLD root fungal microbiomes displayed interesting bioactivities against examined bacteria and broad spectrum bioactivity against fungal pathogens. Some of these endophytic fungi (17 isolates) were fermented and their extracts were evaluated for antimicrobial potential against bacterial and fungal isolates. Results revealed that fungal extracts exhibited antibacterial activities and were responsible for approximately half of antifungal activities against living fungi. These results suggest a strong link between fungal bioactivities and their secondary metabolite arsenal. EtOAc extracts of Geotrichum candidum and Thielaviopsis punctulata originating from BLD microbiome gave best results against Micrococcus luteus and Bacillus subtilis with minimum inhibitory concentration (MIC, 0.78 mg/mL) and minimum bactericidal concentration (6.25 mg/mL). G. candidum gave the best result against
Madsen, Anne Mette; Moslehi-Jenabian, Saloomeh; Islam, Md Zohorul; Frankel, Mika; Spilak, Michal; Frederiksen, Margit W
2018-01-01
The aim of this study was to obtain knowledge about concentrations of Staphylococcus aureus, MRSA (methicillin-resistant S. aureus), and other Staphylococcus species in indoor air in Greater Copenhagen and about factors affecting the concentrations. The effects of season, temperature, relative humidity, air change rate (ACR), other bacterial genera, area per occupant, and presence of S. aureus-positive occupants were studied. In samples from 67 living rooms, S. hominis, S. warneri, S. epidermidis, and S. capitis were found in 13-25%; S. saprophyticus, S. cohnii, and S. pasteuri in 5-10%; and S. lugdunensis, S. haemolyticus, S. caprae, S. equorum, S. kloosii, S. pettenkoferi, S. simulans, and S. xylosus in less than 3%. Staphylococcus aureus were found in two of 67 living rooms: spa type t034 (an MRSA) was recovered from a farmhouse, while spa type t509 was found in an urban home. Two species, S. equorum and S. kloosii, were found only in the farmhouse. Staphylococcus was significantly associated with season with lowest concentration and richness in winter. Genera composition was associated with ACR with smaller fractions of Staphylococcus at higher ACR, while richness was significantly and negatively associated with area per occupant. Concentration of Staphylococcus correlated positively with the total concentration of bacteria, but negatively with the total concentration of other bacteria. The concentration of Staphylococcus was not significantly associated with concentrations of the other abundant genera Bacillus, Kocuria, and Micrococcus. In offices with S. aureus-positive occupants, airborne S. aureus was not found. In conclusion, Staphylococcus species constitute a considerable proportion of the airborne bacteria in the studied homes and offices. However, both S. aureus and MRSA had very low prevalence during all seasons. Thus, transmission of S. aureus and MRSA through the air in living rooms in Copenhagen is expected to be limited. The negative associations
Mitsui, Ryoji; Hirota, Mizuho; Tsuno, Takuo; Tanaka, Mitsuo
2010-02-01
Vanillin dehydrogenases (VDHs) were purified and characterized from two bacterial strains that have different pH dependencies for growth. The alkaliphile Micrococcus sp. TA1, isolated from an alkaline spa, can grow on several aromatic compounds such as ferulic acid, vanillin, vanillic acid, and protocatechuic acid under alkaline conditions. The neutrophile Burkholderia cepacia TM1, which was isolated previously, also grew on the above-mentioned compounds because they functioned as the sole carbon source under neutral conditions. Purified VDHs showed activities toward some aromatic aldehydes. These enzymes have the same subunit molecular mass of about 57 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, but differed in some of their observed properties. Native molecular masses also differed between the purified enzymes. These were 250 kDa for the enzyme from alkaliphilic strain TA1 and 110 kDa for that from neutrophilic strain TM1, as determined by gel filtration. The enzyme from strain TA1 required NADP(+) as a coenzyme for its activity, but that from strain TM1 required NAD(+). These results are important because this is the first report of an alkaliphilic bacterium consuming lignin monomers.
Subramanian, Pramodhini; Ramakrishnan, Kalaivani; Seetha, K.S
2016-01-01
Kocuria species were placed previously under the genus Micrococcus, are skin and oropharynx commensals in mammals, including man. A rare bacteria, Kocuria kristinae isolated from a new born with umbilical sepsis. Identification and antibiotic susceptibility was done by Vitek 2 compact system (Biomerieux). The isolate was sensitive to higher antibiotics like vancomycin, teicoplanin and linezolid. As this new pathogen resembles coagulase negative staphylococcus, it should not be misidentified. PMID:27190805
Sivaraman, Umadevi; Subramanian, Pramodhini; Ramakrishnan, Kalaivani; Seetha, K S
2016-04-01
Kocuria species were placed previously under the genus Micrococcus, are skin and oropharynx commensals in mammals, including man. A rare bacteria, Kocuria kristinae isolated from a new born with umbilical sepsis. Identification and antibiotic susceptibility was done by Vitek 2 compact system (Biomerieux). The isolate was sensitive to higher antibiotics like vancomycin, teicoplanin and linezolid. As this new pathogen resembles coagulase negative staphylococcus, it should not be misidentified.
Zhang, Yinping; Wang, Fang; Zhu, Xiaoshu; Zeng, Jun; Zhao, Qiguo; Jiang, Xin
2015-10-01
The hypothesis that extracellular polymeric substances (EPS) affect the formation of biofilms for subsequent enhanced biodegradation of polycyclic aromatic hydrocarbons was tested. Controlled formation of biofilms on humin particles and biodegradation of phenanthrene and pyrene were performed with bacteria and EPS-extracted bacteria of Micrococcus sp. PHE9 and Mycobacterium sp. NJS-P. Bacteria without EPS extraction developed biofilms on humin, in contrast the EPS-extracted bacteria could not attach to humin particles. In the subsequent biodegradation of phenanthrene and pyrene, the biodegradation rates by biofilms were significantly higher than those of EPS-extracted bacteria. Although, both the biofilms and EPS-extracted bacteria showed increases in EPS contents, only the EPS contents in biofilms displayed significant correlations with the biodegradation efficiencies of phenanthrene and pyrene. It is proposed that the bacterial-produced EPS was a key factor to mediate bacterial attachment to other surfaces and develop biofilms, thereby increasing the bioavailability of poorly soluble PAH for enhanced biodegradation. Copyright © 2015. Published by Elsevier Ltd.
Microbiological assay for the determination of meropenem in pharmaceutical dosage form.
Mendez, Andreas S L; Weisheimer, Vanessa; Oppe, Tércio P; Steppe, Martin; Schapoval, Elfrides E S
2005-04-01
Meropenem is a highly active carbapenem antibiotic used in the treatment of a wide range of serious infections. The present work reports a microbiological assay, applying the cylinder-plate method, for the determination of meropenem in powder for injection. The validation method yielded good results and included linearity, precision, accuracy and specificity. The assay is based on the inhibitory effect of meropenem upon the strain of Micrococcus luteus ATCC 9341 used as the test microorganism. The results of assay were treated statistically by analysis of variance (ANOVA) and were found to be linear (r=0.9999) in the range of 1.5-6.0 microg ml(-1), precise (intra-assay: R.S.D.=0.29; inter-assay: R.S.D.=0.94) and accurate. A preliminary stability study of meropenem was performed to show that the microbiological assay is specific for the determination of meropenem in the presence of its degradation products. The degraded samples were also analysed by the HPLC method. The proposed method allows the quantitation of meropenem in pharmaceutical dosage form and can be used for the drug analysis in routine quality control.
Hexapeptide Derivatives of Glycopeptide Antibiotics: Tools for Mechanism of Action Studies
Allen, Norris E.; LeTourneau, Deborah L.; Hobbs, Joe N.; Thompson, Richard C.
2002-01-01
Hexapeptide (des-N-methylleucyl) derivatives of LY264826 were prepared in order to examine further the role of N-substituted hydrophobic side chains in defining the mechanisms of action of semisynthetic glycopeptide antibiotics. The hexapeptide of LY264826 binds to the cell wall intermediate analog l-Lys-d-Ala-d-Ala with a 100-fold lower affinity than LY264826 and inhibits Micrococcus luteus almost 200-fold more poorly than LY264826 does. Alkylation of the 4-epi-vancosamine moiety of the disaccharide significantly enhanced the antibacterial activity of the hexapeptide. Alkylation did not affect the binding affinity for d-alanyl-d-alanine residues; however, it did enhance dimerization 7,000-fold and enhanced binding to bacterial membrane vesicles noticeably compared with the levels of dimerization and binding for the unsubstituted hexapeptide. The findings from this study complement those presented in an earlier report (N. E. Allen, D. L. LeTourneau, and J. N. Hobbs, Jr., J. Antibiot. 50:677-684, 1997) and are consistent with the conclusion that the enhanced antibacterial activities of semisynthetic glycopeptide antibiotics derive from the ability of the hydrophobic side chain to markedly affect both dimerization and binding to bacterial membranes. PMID:12121903
Antimicrobial and free radical scavenging activities of five Palestinian medicinal plants.
Qabaha, Khaled Ibraheem
2013-01-01
Extracts from five indigenous Palestinian medicinal plants including Rosmarinus officinalis, Pisidium guajava, Punica granatum peel, grape seeds and Teucrium polium were investigated for antimicrobial and free radical scavenging activities against eight microorganisms, using well diffusion method. The microorganisms included six bacterial isolates (i.e. Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginos, Klebsiella pneumonia, Bacillus subtilis and Micrococcus luteus) and two fungal isolates (i.e. Candida albicans and Aspergillus niger). A standard antioxidant assay was performed on the plant extracts to assess their capability in scavenging 2,2-diphenyl-1-picrylhydrazyl (DPPH). Of the five tested plant extract, only Rosmarinus offcinalis extract contained significant antimicrobial activity against all eight microbial isolates including Pseudomonas aeruginosa. Extracts from other four plants exhibited a variable antimicrobial activity against all microorganisms, except Pseudomonas aeruginosa. Significant antioxidant activity was detected in all plant extracts. However, extracts from Pisidium guajava leaves contained significantly higher antioxidant activity compared to the other extracts tested. The antimicrobial and scavenging activities detected in this in vitro study in extracts from the five Palestinian medicinal plants suggest that further study is needed to identify active compounds to target diseases caused by a wide-spectrum pathogens.
High-Throughput Identification of Antimicrobial Peptides from Amphibious Mudskippers
You, Xinxin; Bian, Chao; Chen, Shixi; Lv, Zhao; Qiu, Limei; Shi, Qiong
2017-01-01
Widespread existence of antimicrobial peptides (AMPs) has been reported in various animals with comprehensive biological activities, which is consistent with the important roles of AMPs as the first line of host defense system. However, no big-data-based analysis on AMPs from any fish species is available. In this study, we identified 507 AMP transcripts on the basis of our previously reported genomes and transcriptomes of two representative amphibious mudskippers, Boleophthalmus pectinirostris (BP) and Periophthalmus magnuspinnatus (PM). The former is predominantly aquatic with less time out of water, while the latter is primarily terrestrial with extended periods of time on land. Within these identified AMPs, 449 sequences are novel; 15 were reported in BP previously; 48 are identically overlapped between BP and PM; 94 were validated by mass spectrometry. Moreover, most AMPs presented differential tissue transcription patterns in the two mudskippers. Interestingly, we discovered two AMPs, hemoglobin β1 and amylin, with high inhibitions on Micrococcus luteus. In conclusion, our high-throughput screening strategy based on genomic and transcriptomic data opens an efficient pathway to discover new antimicrobial peptides for ongoing development of marine drugs. PMID:29165344
Chemsa, Ahmed Elkhalifa; Erol, Ebru; Öztürk, Mehmet; Zellagui, Amar; Özgür, Ceylan; Gherraf, Noureddine; Duru, Mehmet Emin
2016-09-01
Twenty compounds were detected in the essential oil of Rhanterium suaveolens representing 98.01% of the total oil content. Perillaldehyde (45.79%), caryophyllene oxide (24.82%) and β-cadinol (5.61%) were identified as the main constituents. In β-carotene-linoleic acid assay, both the oil and the methanol extract exhibited good lipid peroxidation inhibition activity, with IC50 values of 17.97 ± 5.40 and 11.55 ± 3.39 μg/mL, respectively. In DPPH and CUPRAC assays, however, the methanol extract exhibited a good antioxidant activity. The highest antibiofilm activity has been found 50.30% against Staphylococcus epidermidis (MU 30) at 20 μg/mL for essential oil and 58.34% against Micrococcus luteus (NRRL B-4375) at 25 mg/mL concentration for methanol extract. The in vitro anticholinesterase activity of methanol extract showed a moderate acetylcholinesterase inhibitory (IC50 = 168.76 ± 0.62 μg/mL) and good butyrylcholinesterase inhibitory (IC50 = 54.79 ± 1.89 μg/mL) activities. The essential oil was inactive against both enzymes.
Wencewicz, Timothy A; Yang, Baiyuan; Rudloff, James R; Oliver, Allen G; Miller, Marvin J
2011-10-13
The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ∼100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring-opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC(90) = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds.
Wencewicz, Timothy A.; Yang, Baiyuan; Rudloff, James R.; Oliver, Allen G.; Miller, Marvin J.
2011-01-01
The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ~100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC90 = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds. PMID:21859126
High-Throughput Identification of Antimicrobial Peptides from Amphibious Mudskippers.
Yi, Yunhai; You, Xinxin; Bian, Chao; Chen, Shixi; Lv, Zhao; Qiu, Limei; Shi, Qiong
2017-11-22
Widespread existence of antimicrobial peptides (AMPs) has been reported in various animals with comprehensive biological activities, which is consistent with the important roles of AMPs as the first line of host defense system. However, no big-data-based analysis on AMPs from any fish species is available. In this study, we identified 507 AMP transcripts on the basis of our previously reported genomes and transcriptomes of two representative amphibious mudskippers, Boleophthalmus pectinirostris (BP) and Periophthalmus magnuspinnatus (PM). The former is predominantly aquatic with less time out of water, while the latter is primarily terrestrial with extended periods of time on land. Within these identified AMPs, 449 sequences are novel; 15 were reported in BP previously; 48 are identically overlapped between BP and PM; 94 were validated by mass spectrometry. Moreover, most AMPs presented differential tissue transcription patterns in the two mudskippers. Interestingly, we discovered two AMPs, hemoglobin β1 and amylin, with high inhibitions on Micrococcus luteus . In conclusion, our high-throughput screening strategy based on genomic and transcriptomic data opens an efficient pathway to discover new antimicrobial peptides for ongoing development of marine drugs.
Tiku, A. K.; Koul, Apurva; Gupta, Sahil; Singh, Gurjinder; Razdan, V. K.
2013-01-01
The essential oil obtained from the fresh leaves of Zanthoxylum alatum was analysed by gas chromatography/mass spectrometry (GC/MS). Fourteen components were identified, and linalool (30.58%), 2-decanone (20.85%), β-fenchol (9.43%), 2-tridecanone (8.86%), β-phellandrene (5.99%), Sabinene (4.82%), and α-pinene (4.11%) were the main components. The EO and methanolic extract of Z. alatum exhibited potent antifungal activity against Alternaria alternata, Alternaria brassicae, and Curvularia lunata. The EO also showed significant antibacterial activity against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, and Escherichia coli. Further, antimicrobial constituents of the EO were isolated by bioautography and preparative thin layer chromatography (PTLC) and identified as β-fenchol and linalool using GC/MS analysis. In addition to this, the free radical scavenging activity and antioxidant potential of EO and methanolic extract/fractions of Z. alatum were also investigated using in vitro assays including scavenging ability against DPPH•, reducing power and chelating ability on Fe2+ ions. Our results demonstrate that Z. alatum could be used as a resource of antioxidant and antimicrobial compounds which may find applications in food and pesticide industries. PMID:23781160
DNA-binding studies and biological activities of new nitrosubstituted acyl thioureas
NASA Astrophysics Data System (ADS)
Tahir, Shaista; Badshah, Amin; Hussain, Raja Azadar; Tahir, Muhammad Nawaz; Tabassum, Saira; Patujo, Jahangir Ali; Rauf, Muhammad Khawar
2015-11-01
Four new nitrosubstituted acylthioureas i.e. 1-acetyl-3-(4-nitrophenyl)thiourea (TU1), 1-acetyl-3-(2-methyl-4-nitrophenyl)thiourea (TU2), 1-acetyl-3-(2-methoxy-4-nitrophenyl)thiourea (TU3) and 1-acetyl-3-(4-chloro-3-nitrophenyl)thiourea (TU4) have been synthesized and characterized (by C13 and H1 nuclear magnetic resonance, Fourier transform infrared spectroscopy and single crystal X-ray diffraction). As a preliminary investigation of the anti-cancer potencies of the said compounds, DNA interaction studies have been carried out using cyclic voltammetry and UV-vis spectroscopy along with verification from computational studies. The drug-DNA binding constants are found to be in the order, KTU3 9.04 × 106 M-1 > KTU4 8.57 × 106 M-1 > KTU2 6.05 × 106 M-1 > KTU1 1.16 × 106 M-1. Furthermore, the antioxidant, cytotoxic, antibacterial and antifungal activities have been carried out against DPPH (1,1-diphenyl-2-dipicrylhydrazyl), Brine shrimp eggs, gram positive (Micrococcus luteus, Staphylococcus aureus) and gram negative (Bordetella bronchiseptica, Salmonella typhimurium, Enterobacter aerogens) and fungal cultures (Aspergillus fumigatus, Mucor species, Aspergillus niger, Aspergillus flavus) respectively.
Cobalt-doped nanohydroxyapatite: synthesis, characterization, antimicrobial and hemolytic studies
NASA Astrophysics Data System (ADS)
Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.
2013-05-01
Hydroxyapatite (Ca10(PO4)6(OH)2; HAP) is a major mineral component of the calcified tissues, and it has various applications in medicine and dentistry. In the present investigation, cobalt-doped hydroxyapatite (Co-HAP) nanoparticles were synthesized by surfactant-mediated approach and characterized by different techniques. The EDAX was carried out to estimate the amount of doping in Co-HAP. The transmission electron microscopy result suggested the transformation of morphology from needle shaped to spherical type on increasing the doping concentration. The powder XRD study indicated the formation of a new phase of brushite for higher concentration of cobalt. The average particle size and strain were calculated using Williamson-Hall analysis. The average particle size was found to be 30-60 nm. The FTIR study confirmed the presence of various functional groups in the samples. The antimicrobial activity was evaluated against four organisms Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus and Staphylococcus aureus as Gram positive. The hemolytic test result suggested that all samples were non-hemolytic. The photoluminescence study was carried out to identify its possible applicability as a fluorescent probe.
Plants as sources of airborne bacteria, including ice nucleation-active bacteria.
Lindemann, J; Constantinidou, H A; Barchet, W R; Upper, C D
1982-11-01
Vertical wind shear and concentration gradients of viable, airborne bacteria were used to calculate the upward flux of viable cells above bare soil and canopies of several crops. Concentrations at soil or canopy height varied from 46 colony-forming units per m over young corn and wet soil to 663 colony-forming units per m over dry soil and 6,500 colony-forming units per m over a closed wheat canopy. In simultaneous samples, concentrations of viable bacteria in the air 10 m inside an alfalfa field were fourfold higher than those over a field with dry, bare soil immediately upwind. The upward flux of viable bacteria over alfalfa was three- to fourfold greater than over dry soil. Concentrations of ice nucleation-active bacteria were higher over plants than over soil. Thus, plant canopies may constitute a major source of bacteria, including ice nucleation-active bacteria, in the air.
Owen, P; Salton, M R
1975-10-06
The carbohydrate content of mesosomal membranes of Micrococcus lysodeikticus has been shown to be consistently higher (about four times) than that of corresponding plasma membrane preparations. Analysis of washed membrane fractions by gas-liquid chromatography indicated that mannose was the major neutral sugar of both types of membrane (accounting for 95 and 89%, respectively, of the mesosomal and plasma membrane carbohydrate). Small amounts of inositol, glucose and ribose were also detected. We have shown by polyacrylamide gel electrophoresis in sodium dodecylsulphate and by precipitation and agar gel diffusion experiments with concanavalin A that a mannan is the major carbohydrate component of both types of membrane. This polymer can be selectively released from mesosomal membranes by a simple procedure involving low ionic strength-shock and heating to 80 degrees C for 1 min, and purified by ultrafiltration and ethanol precipitation. The mannan contains mannose as the only neutral carbohydrate, is not phosphorylated and does not contain significant amounts of amino sugars or uronic acids. Agar gel electrophoresis experiments, however, indicate an anionic polymer whose acidic properties are eliminated upon mild base hydrolysis. Analysis of native mannan by infrared spectroscopy reveals absorption bands attributable to ester carbonyl groups and to carboxylate ions, consistent with the presence of succinyl residues in the polymer (Owen, P. and Salton, M.R.J. (1975) Biochem, Biophys. Res. Commun. 63, 875--800). A sedimentation coefficient of 1.39 S was obtained by analytical ultracentrifugation in 1.0 M NaCl and a value of one reducing equivalent per 50 mannose residues by reduction with NaB3H4. The polysaccharide was only slightly degraded (2%) by jack bean alpha-mannosidase and could precipitate 15 times its own weight of concanavalin A. The acidic polymers was also detected in the cell "periplasm" and was secreted from cells grown in defined media during the
Hanson, R S; Hanson, T E
1996-01-01
Methane-utilizing bacteria (methanotrophs) are a diverse group of gram-negative bacteria that are related to other members of the Proteobacteria. These bacteria are classified into three groups based on the pathways used for assimilation of formaldehyde, the major source of cell carbon, and other physiological and morphological features. The type I and type X methanotrophs are found within the gamma subdivision of the Proteobacteria and employ the ribulose monophosphate pathway for formaldehyde assimilation, whereas type II methanotrophs, which employ the serine pathway for formaldehyde assimilation, form a coherent cluster within the beta subdivision of the Proteobacteria. Methanotrophic bacteria are ubiquitous. The growth of type II bacteria appears to be favored in environments that contain relatively high levels of methane, low levels of dissolved oxygen, and limiting concentrations of combined nitrogen and/or copper. Type I methanotrophs appear to be dominant in environments in which methane is limiting and combined nitrogen and copper levels are relatively high. These bacteria serve as biofilters for the oxidation of methane produced in anaerobic environments, and when oxygen is present in soils, atmospheric methane is oxidized. Their activities in nature are greatly influenced by agricultural practices and other human activities. Recent evidence indicates that naturally occurring, uncultured methanotrophs represent new genera. Methanotrophs that are capable of oxidizing methane at atmospheric levels exhibit methane oxidation kinetics different from those of methanotrophs available in pure cultures. A limited number of methanotrophs have the genetic capacity to synthesize a soluble methane monooxygenase which catalyzes the rapid oxidation of environmental pollutants including trichloroethylene. PMID:8801441
Wendel, Sebastian O; Menon, Sailesh; Alshetaiwi, Hamad; Shrestha, Tej B; Chlebanowski, Lauren; Hsu, Wei-Wen; Bossmann, Stefan H; Narayanan, Sanjeev; Troyer, Deryl L
2015-01-01
The recent WHO report on antibiotic resistances shows a dramatic increase of microbial resistance against antibiotics. With only a few new antibiotics in the pipeline, a different drug delivery approach is urgently needed. We have obtained evidence demonstrating the effectiveness of a cell based drug delivery system that utilizes the innate immune system as targeting carrier for antibacterial drugs. In this study we show the efficient loading of neutrophil granulocytes with chlorhexidine and the complete killing of E. coli as well as Fusobacterium necrophorum in in-vitro studies. Fusobacterium necrophorum causes hepatic abscesses in cattle fed high grain diets. We also show in a mouse model that this delivery system targets infections of F. necrophorum in the liver and reduces the bacterial burden by an order of magnitude from approximately 2•106 to 1•105.
Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species
Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao
2016-01-01
Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species. PMID:27630804
NASA Astrophysics Data System (ADS)
Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao
2017-04-01
Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.
NASA Astrophysics Data System (ADS)
Feshangsaz, Niloofar; Van Loon, ing.. Jack J. W. A.; Nazmi, Kamran; Semsarha, Farid
2016-07-01
Studying halophiles from different environments of Earth provide new insights into our search for life in the universe. Haloarchaea show some unique characteristics and physiological adaptations like acidic proteins against harsh environments such as natural brine with salt concentration approaching saturation (5 M) and regions with low active water. These properties make haloarchaea interesting candidate for astrobiological studies. Halovarius luteus gen. nov., sp. nov. a novel extremely halophilic archaeon from Urmia salt lake, in Iran has been chosen to explore its resistance against a series of extreme conditions. The aim of this study is to assess the resistance of strain DA50T under the effects of simulated space conditions like simulated microgravity, hypergravity, and desiccation. In this paper we will discuss the results of these studies where we specifically focus on changes in carotenoid pigments production and whole cell proteome. This is the first report of very novel Iranian archaea in response to extreme space conditions. The pigments were extracted by acetone and methanol. Pigments were analyzed by scanning the absorbance spectrum in the UV-VIS spectrophotometer. And they were separated by TLC. Whole protein from cell lysate supernatant was extracted after lysis with Bacterial Protein Extraction Reagent and fractionated by RP-HPLC using C18 column. Proteome analyzed by electrophoresis (SDS-PAGE), and MALDI-TOF. Carotenoid pigments are formed under different extreme conditions such as dry environment and gravitational changes. Also the protein composition exhibits alterations after exposure to the same conditions. Our conclusion is that pigments and proteins formation depend on the growth circumstances. Halophiles use this as an adaptation to survive under different environmental conditions.
ERIC Educational Resources Information Center
Flannery, Maura C.
1997-01-01
Explores new research about bacteria. Discusses bacterial genomes, archaea, unusual environments, evolution, pathogens, bacterial movement, biofilms, bacteria in the body, and a bacterial obsession. Contains 29 references. (JRH)
Inactivation of biofilm bacteria.
LeChevallier, M W; Cawthon, C D; Lee, R G
1988-01-01
The current project was developed to examine inactivation of biofilm bacteria and to characterize the interaction of biocides with pipe surfaces. Unattached bacteria were quite susceptible to the variety of disinfectants tested. Viable bacterial counts were reduced 99% by exposure to 0.08 mg of hypochlorous acid (pH 7.0) per liter (1 to 2 degrees C) for 1 min. For monochloramine, 94 mg/liter was required to kill 99% of the bacteria within 1 min. These results were consistent with those found by other investigators. Biofilm bacteria grown on the surfaces of granular activated carbon particles, metal coupons, or glass microscope slides were 150 to more than 3,000 times more resistant to hypochlorous acid (free chlorine, pH 7.0) than were unattached cells. In contrast, resistance of biofilm bacteria to monochloramine disinfection ranged from 2- to 100-fold more than that of unattached cells. The results suggested that, relative to inactivation of unattached bacteria, monochloramine was better able to penetrate and kill biofilm bacteria than free chlorine. For free chlorine, the data indicated that transport of the disinfectant into the biofilm was a major rate-limiting factor. Because of this phenomenon, increasing the level of free chlorine did not increase disinfection efficiency. Experiments where equal weights of disinfectants were used suggested that the greater penetrating power of monochloramine compensated for its limited disinfection activity. These studies showed that monochloramine was as effective as free chlorine for inactivation of biofilm bacteria. The research provides important insights into strategies for control of biofilm bacteria. Images PMID:2849380
Study of Antibacterial Activity and Bacteriology of Latex from Asclepias syriaca L
McCay, Steven; Mahlberg, Paul
1973-01-01
Whole and fractionated latex of Asclepias syriaca was tested for antimicrobial or growth-promoting activity with 16 genera and species of bacteria. Latex and extracted fractions (distilled water, acetic acid, sodium bicarbonate, sulfuric acid, and ethyl ether) possessed no detectable antimicrobial activity. Comparison of growth curves of selected bacteria incubated with serum and rubber fractions, as well as controls, revealed no detectable inhibition of growth, except for a slight inhibitory response to autoclaved serum. Most bacteria were capable of utilizing latex for a substrate as indicated by the increased growth rate in the exponential phase. The stationary phase was entered simultaneously by both the treated cultures and the controls. Various bacteria cultured in a litmus latex mixture yielded populations which ranged from <104 organisms/ml for Lactobacillus casei, Staphylococcus aureus and Micrococcus lysodeikticus to 1.1 × 1010 organisms/ml for Clostridium acetobutylicum. Whole latex, as well as the serum and rubber fractions, support the growth of various bacteria, but under field conditions there is no evidence for systemic infection of this type of cell by bacteria. PMID:4790590
Wang, Xin; Li, Peijun; Song, Shouzhi; Zhong, Yong; Zhang, Hui; Verkhozina, E V
2006-11-01
In this study, introduced bacteria were applied in the bioremediation of pyrene and benzo (alpha) pyrene in organic pollutants-contaminated soils, aimed to test whether it was feasible to introduce bacteria to environmental engineering. Three introduced bacteria were immobilized separately or together to degrade the pyrene and benzo (alpha) pyrene in soil, taking dissociated bacteria as the control, and comparing with three indigenous bacteria. The results showed that immobilized introduced bacteria, either single or mixed, had higher degradation efficiency than dissociated bacteria. Compared with indigenous bacteria, some introduced bacteria had predominance to some degree. The introduced bacteria-mixture had better degradation efficiency after being immobilized. The degradation rate of pyrene and benzo(alpha) pyrene after treated with immobilized bacteria-( B61-B67)-mixture for 96 hours was 43.49% and 38.55%, respectively.
Sadowsky, Michael J.; Whitman, Richard L.
2011-01-01
The Fecal Bacteria offers a balanced, integrated discussion of fecal bacteria and their presence and ecology in the intestinal tract of mammals, in the environment, and in the food supply. This volume covers their use in examining and assessing water quality in order to offer protection from illnesses related to swimming in or ingesting contaminated water, in addition to discussing their use in engineering considerations of water quality, modeling, monitoring, and regulations. Fecal bacteria are additionally used as indicators of contamination of ready-to-eat foods and fresh produce. The intestinal environment, the microbial community structure of the gut microbiota, and the physiology and genomics of this broad group of microorganisms are explored in the book. With contributions from an internationally recognized group of experts, the book integrates medicine, public health, environmental, and microbiological topics in order to provide a unique, holistic understanding of fecal bacteria. Moreover, it shows how the latest basic science and applied research findings are helping to solve problems and develop effective management strategies. For example, readers will discover how the latest tools and molecular approaches have led to our current understanding of fecal bacteria and enabled us to improve human health and water quality. The Fecal Bacteria is recommended for microbiologists, clinicians, animal scientists, engineers, environmental scientists, food safety experts, water quality managers, and students. It will help them better understand fecal bacteria and use their knowledge to protect human and environmental health. They can also apply many of the techniques and molecular tools discussed in this book to the study of a broad range of microorganisms in a variety of habitats.
Synthesis of ectomycorrhizae on northern red oak seedlings in a Michigan nursery
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dixon, R.K.; Johnson, P.S.
1993-01-01
Vegetative inoculum of the ectomycorrhizal fungus Suillus luteus was thoroughly mixed into fumigated nursery soil, and northern red oak seedlings of four families were evaluated one and two years after sowing for ectomycorrhizal development, growth, and nutrition. At the end of year one, treated seedlings were successfully inoculated with S. luteus, but the percentage varied significantly with family. Suillus luteus persisted on lateral roots two years following sowing. Two of four seedling families inoculated with S. luteus were significantly larger in size than control plants. These results suggest that the fungal symbiont S. luteus can be successfully introduced into nurseriesmore » and that early ectomycorrhizal development improves the growth of northern red oak seedlings.« less
Miao, Li-Li; Fan, Hong-Xia; Qu, Jie; Liu, Ying; Liu, Zhi-Pei
2017-03-01
Psychrophilic enzymes display efficient activity at moderate or low temperatures (4-25 °C) and are therefore of great interest in biotechnological industries. We previously examined the crystal structure of BglU, a psychrophilic β-glucosidase from the bacterium Micrococcus antarcticus, at 2.2 Å resolution. In structural comparison and sequence alignment with mesophilic (BglB) and thermophilic (GlyTn) counterpart enzymes, BglU showed much lower contents of Pro residue and of charged amino acids (particularly positively charged) on the accessible surface area. In the present study, we investigated the roles of specific amino acid residues in the cold adaptedness of BglU. Mutagenesis assays showed that the mutations G261R and Q448P increased optimal temperature (from 25 to 40-45 °C) at the expense of low-temperature activity, but had no notable effects on maximal activity or heat lability. Mutations A368P, T383P, and A389E significantly increased optimal temperature (from 25 to 35-40 °C) and maximal activity (~1.5-fold relative to BglU). Thermostability of A368P and A389E increased slightly at 30 °C. Mutations K163P, N228P, and H301A greatly reduced enzymatic activity-almost completely in the case of H301A. Low contents of Pro, Arg, and Glu are important factors contributing to BglU's psychrophilic properties. Our findings will be useful in structure-based engineering of psychrophilic enzymes and in production of mutants suitable for a variety of industrial processes (e.g., food production, sewage treatment) at cold or moderate temperatures.
Hossain, Belal; Islam, Mohammad Shahidul; Rahman, Atiqur; Marzan, Mahfuza; Rafiqullah, Iftekhar; Connor, Nicholas E; Hasanuzzaman, Mohammad; Islam, Maksuda; Hamer, Davidson H; Hibberd, Patricia L; Saha, Samir K
2016-05-01
Interpretation of blood culture isolates is challenging due to a lack of standard methodologies for identifying contaminants. This problem becomes more complex when the specimens are from sick young infants, as a wide range of bacteria can cause illness among this group. We used 43 key words to find articles published between 1970 and 2011 on blood culture isolates and possible contaminants in the PubMed database. Experts were also consulted to obtain other relevant articles. Selection of articles followed systematic methods considering opinions from more than 1 reviewer. After reviewing the titles of 3869 articles extracted from the database, we found 307 relevant to our objective. Based on the abstracts, 42 articles were selected for the literature review. In addition, we included 7 more articles based on cross-references and expert advice. The most common methods for differentiating blood culture isolates were multiple blood cultures from the same subject, antibiograms and molecular testing. Streptococcus pneumoniae, Hemophilus influenzae, Neisseria meningitidis and group A and B streptococcus were always considered as pathogens, whereas Bacillus sp., Diphtheroids, Propionibacterium and Micrococcus were commonly regarded as contaminants. Coagulase-negative staphylococci were the most frequent isolates and usually reported as contaminants unless the patient had a specific condition, such as long-term hospitalization or use of invasive devices (catheters). Inaccurate interpretation of blood culture may falsely guide treatment and also has long-term policy implications. The combination of clinical and microbiological knowledge, patient's clinical history and laboratory findings are essential for appropriate interpretation of blood culture.
Ledermann D, Walter
2009-02-01
As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never took knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.
Mesa, Jennifer; Mateos-Naranjo, Enrique; Caviedes, Miguel A.; Redondo-Gómez, Susana; Pajuelo, Eloisa; Rodríguez-Llorente, Ignacio D.
2015-01-01
Endophytic bacterial population was isolated from Spartina maritima tissues, a heavy metal bioaccumulator cordgrass growing in the estuaries of Tinto, Odiel, and Piedras River (south west Spain), one of the most polluted areas in the world. Strains were identified and ability to tolerate salt and heavy metals along with plant growth promoting and enzymatic properties were analyzed. A high proportion of these bacteria were resistant toward one or several heavy metals and metalloids including As, Cu, and Zn, the most abundant in plant tissues and soil. These strains also exhibited multiple enzymatic properties as amylase, cellulase, chitinase, protease and lipase, as well as plant growth promoting properties, including nitrogen fixation, phosphates solubilization, and production of indole-3-acetic acid (IAA), siderophores and 1-aminocyclopropane-1-carboxylate (ACC) deaminase. The best performing strains (Micrococcus yunnanensis SMJ12, Vibrio sagamiensis SMJ18, and Salinicola peritrichatus SMJ30) were selected and tested as a consortium by inoculating S. maritima wild plantlets in greenhouse conditions along with wild polluted soil. After 30 days, bacterial inoculation improved plant photosynthetic traits and favored intrinsic water use efficiency. However, far from stimulating plant metal uptake, endophytic inoculation lessened metal accumulation in above and belowground tissues. These results suggest that inoculation of S. maritima with indigenous metal-resistant endophytes could mean a useful approach in order to accelerate both adaption and growth of this indigenous cordgrass in polluted estuaries in restorative operations, but may not be suitable for rhizoaccumulation purposes. PMID:26733985
... Inside Life Science > Bleach vs. Bacteria Inside Life Science View All Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds ... For Proteins, Form Shapes Function This Inside Life Science article also appears on LiveScience . Learn about related ...
Buchan, Blake W.; Ginocchio, Christine C.; Manii, Ryhana; Cavagnolo, Robert; Pancholi, Preeti; Swyers, Lettie; Thomson, Richard B.; Anderson, Christopher; Kaul, Karen; Ledeboer, Nathan A.
2013-01-01
Background A multicenter study was conducted to evaluate the diagnostic accuracy (sensitivity and specificity) of the Verigene Gram-Positive Blood Culture Test (BC-GP) test to identify 12 Gram-positive bacterial gene targets and three genetic resistance determinants directly from positive blood culture broths containing Gram-positive bacteria. Methods and Findings 1,252 blood cultures containing Gram-positive bacteria were prospectively collected and tested at five clinical centers between April, 2011 and January, 2012. An additional 387 contrived blood cultures containing uncommon targets (e.g., Listeria spp., S. lugdunensis, vanB-positive Enterococci) were included to fully evaluate the performance of the BC-GP test. Sensitivity and specificity for the 12 specific genus or species targets identified by the BC-GP test ranged from 92.6%–100% and 95.4%–100%, respectively. Identification of the mecA gene in 599 cultures containing S. aureus or S. epidermidis was 98.6% sensitive and 94.3% specific compared to cefoxitin disk method. Identification of the vanA gene in 81 cultures containing Enterococcus faecium or E. faecalis was 100% sensitive and specific. Approximately 7.5% (87/1,157) of single-organism cultures contained Gram-positive bacteria not present on the BC-GP test panel. In 95 cultures containing multiple organisms the BC-GP test was in 71.6% (68/95) agreement with culture results. Retrospective analysis of 107 separate blood cultures demonstrated that identification of methicillin resistant S. aureus and vancomycin resistant Enterococcus spp. was completed an average of 41.8 to 42.4 h earlier using the BC-GP test compared to routine culture methods. The BC-GP test was unable to assign mecA to a specific organism in cultures containing more than one Staphylococcus isolate and does not identify common blood culture contaminants such as Micrococcus, Corynebacterium, and Bacillus. Conclusions The BC-GP test is a multiplex test capable of detecting most
Living bacteria in silica gels
NASA Astrophysics Data System (ADS)
Nassif, Nadine; Bouvet, Odile; Noelle Rager, Marie; Roux, Cécile; Coradin, Thibaud; Livage, Jacques
2002-09-01
The encapsulation of enzymes within silica gels has been extensively studied during the past decade for the design of biosensors and bioreactors. Yeast spores and bacteria have also been recently immobilized within silica gels where they retain their enzymatic activity, but the problem of the long-term viability of whole cells in an inorganic matrix has never been fully addressed. It is a real challenge for the development of sol-gel processes. Generic tests have been performed to check the viability of Escherichia coli bacteria in silica gels. Surprisingly, more bacteria remain culturable in the gel than in an aqueous suspension. The metabolic activity of the bacteria towards glycolysis decreases slowly, but half of the bacteria are still viable after one month. When confined within a mineral environment, bacteria do not form colonies. The exchange of chemical signals between isolated bacteria rather than aggregates can then be studied, a point that could be very important for 'quorum sensing'.
Comparative study of antibiotic-containing polymethylmetacrylate capsules and beads.
Borzsei, László; Mintál, Tibor; Horváth, Aranka; Koós, Zoltán; Kocsis, Béla; Nyárády, József
2006-01-01
This study aimed at making local antibiotic therapy wider in cases of chronic suppurations by administering antibiotics which previously could not be given in this way through the conventional polymethylmetacrylate (PMMA) carrier techniques. Capsules from this material were produced with a pressing machine designed and laid out by us. The characteristics of antibiotic penetration from this novel carrier were compared to those of PMMA beads. The time-dependent outflow of amikacin, clindamycin, pefloxacin, piperacillin + tazobactam, amoxicillin + clavulanic acid and cefotaxime was examined from the capsules and the beads with standard microbiological techniques using the Micrococcus luteus ATCC9341 test strain. The diameter of the inhibitory zones was measured after 24 h incubation at 37 degrees C and converted to mug/ml antibiotic concentrations. Our results revealed that all antibiotics showed longer-lasting and higher concentration outflow from the PMMA capsules than from the beads. Therefore, these capsules can provide a more promising new opportunity for specific local antimicrobial treatment in cases of chronic suppurative bone and soft tissue injuries. In these cases the polymerization has already been completed and the heat does not influence the structure of the antibiotics; therefore, it can be inserted into the capsules in powder or solution form. Copyright 2006 S. Karger AG, Basel.
Microbiological assay for the analysis of certain macrolides in pharmaceutical dosage forms.
Mahmoudi, A; Fourar, R E-A; Boukhechem, M S; Zarkout, S
2015-08-01
Clarithromycin (CLA) and roxithromycin (ROX) are macrolide antibiotics with an expanded spectrum of activity that are commercially available as tablets. A microbiological assay, applying the cylinder-plate method and using a strain of Micrococcus luteus ATCC 9341 as test organism, has been used and validated for the quantification of two macrolide drugs; CLA and ROX in pure and pharmaceutical formulations. The validation of the proposed method was carried out for linearity, precision, accuracy and specificity. The linear dynamic ranges were from 0.1 to 0.5μg/mL for both compounds. Logarithmic calibration curve was obtained for each macrolide (r>0.989) with statistically equal slopes varying from 3.275 to 4.038, and a percentage relative standard deviation in the range of 0.24-0.92%. Moreover, the method was applied successfully for the assay of the studied drugs in pharmaceutical tablet dosage forms. Recovery from standard addition experiments in commercial products was 94.71-96.91% regarding clarithromycin and 93.94-98.12% regarding roxithromycin, with a precision (%RSD) 1.32-2.11%. Accordingly, this microbiological assay can be used for routine quality control analysis of titled drugs in tablet formulations. Copyright © 2015 Elsevier B.V. All rights reserved.
Koike-Takeshita, A; Koyama, T; Ogura, K
1998-10-01
Among prenyltransferases that catalyze the sequential condensation of isopentenyl diphosphate with allylic diphosphate to produce prenyl diphosphates with various chain lengths and stereochemistries, medium-chain prenyl diphosphate synthases are exceptional in that they comprise two dissociable heteromeric protein components. These components exist without binding with each other under physiological conditions, and neither of them has any prenyltransferase activity by itself. In order to elucidate the precise molecular mechanism underlying expression of the catalytic function by such a unique two-component system, we examined the possibility of forming a hybrid between two of the components of three different medium-chain prenyl diphosphate synthases, components I and II of heptaprenyl diphosphate synthase from Bacillus subtilis, components I' and II' of heptaprenyl diphosphate synthase from Bacillus stearothermophilus, and components A and B of hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26. As a result, only the hybrid-type combination of component I and component II' gave distinct prenyltransferase activity. The hybrid-type enzyme catalyzed the synthesis of heptaprenyl diphosphate and showed moderate heat stability, which lay between those of the natural enzymes from B. subtilis and B. stearothermophilus. There is no possibility of forming a hybrid between the heptaprenyl and hexaprenyl diphosphate synthases.