Shewanella oneidensis MR-1 nanowires are outer membrane and periplasmic extensions of the extracellular electron transport components

PubMed Central

Pirbadian, Sahand; Barchinger, Sarah E.; Leung, Kar Man; Byun, Hye Suk; Jangir, Yamini; Bouhenni, Rachida A.; Reed, Samantha B.; Romine, Margaret F.; Saffarini, Daad A.; Shi, Liang; Gorby, Yuri A.; Golbeck, John H.; El-Naggar, Mohamed Y.

2014-01-01

Bacterial nanowires offer an extracellular electron transport (EET) pathway for linking the respiratory chain of bacteria to external surfaces, including oxidized metals in the environment and engineered electrodes in renewable energy devices. Despite the global, environmental, and technological consequences of this biotic–abiotic interaction, the composition, physiological relevance, and electron transport mechanisms of bacterial nanowires remain unclear. We report, to our knowledge, the first in vivo observations of the formation and respiratory impact of nanowires in the model metal-reducing microbe Shewanella oneidensis MR-1. Live fluorescence measurements, immunolabeling, and quantitative gene expression analysis point to S. oneidensis MR-1 nanowires as extensions of the outer membrane and periplasm that include the multiheme cytochromes responsible for EET, rather than pilin-based structures as previously thought. These membrane extensions are associated with outer membrane vesicles, structures ubiquitous in Gram-negative bacteria, and are consistent with bacterial nanowires that mediate long-range EET by the previously proposed multistep redox hopping mechanism. Redox-functionalized membrane and vesicular extensions may represent a general microbial strategy for electron transport and energy distribution. PMID:25143589

Shewanella oneidensis MR-1 nanowires are outer membrane and periplasmic extensions of the extracellular electron transport components.

PubMed

Pirbadian, Sahand; Barchinger, Sarah E; Leung, Kar Man; Byun, Hye Suk; Jangir, Yamini; Bouhenni, Rachida A; Reed, Samantha B; Romine, Margaret F; Saffarini, Daad A; Shi, Liang; Gorby, Yuri A; Golbeck, John H; El-Naggar, Mohamed Y

2014-09-02

Bacterial nanowires offer an extracellular electron transport (EET) pathway for linking the respiratory chain of bacteria to external surfaces, including oxidized metals in the environment and engineered electrodes in renewable energy devices. Despite the global, environmental, and technological consequences of this biotic-abiotic interaction, the composition, physiological relevance, and electron transport mechanisms of bacterial nanowires remain unclear. We report, to our knowledge, the first in vivo observations of the formation and respiratory impact of nanowires in the model metal-reducing microbe Shewanella oneidensis MR-1. Live fluorescence measurements, immunolabeling, and quantitative gene expression analysis point to S. oneidensis MR-1 nanowires as extensions of the outer membrane and periplasm that include the multiheme cytochromes responsible for EET, rather than pilin-based structures as previously thought. These membrane extensions are associated with outer membrane vesicles, structures ubiquitous in Gram-negative bacteria, and are consistent with bacterial nanowires that mediate long-range EET by the previously proposed multistep redox hopping mechanism. Redox-functionalized membrane and vesicular extensions may represent a general microbial strategy for electron transport and energy distribution.

ArcS, the cognate sensor kinase in an atypical Arc system of Shewanella oneidensis MR-1.

PubMed

Lassak, Jürgen; Henche, Anna-Lena; Binnenkade, Lucas; Thormann, Kai M

2010-05-01

The availability of oxygen is a major environmental factor for many microbes, in particular for bacteria such as Shewanella species, which thrive in redox-stratified environments. One of the best-studied systems involved in mediating the response to changes in environmental oxygen levels is the Arc two-component system of Escherichia coli, consisting of the sensor kinase ArcB and the cognate response regulator ArcA. An ArcA ortholog was previously identified in Shewanella, and as in Escherichia coli, Shewanella ArcA is involved in regulating the response to shifts in oxygen levels. Here, we identified the hybrid sensor kinase SO_0577, now designated ArcS, as the previously elusive cognate sensor kinase of the Arc system in Shewanella oneidensis MR-1. Phenotypic mutant characterization, transcriptomic analysis, protein-protein interaction, and phosphotransfer studies revealed that the Shewanella Arc system consists of the sensor kinase ArcS, the single phosphotransfer domain protein HptA, and the response regulator ArcA. Phylogenetic analyses suggest that HptA might be a relict of ArcB. Conversely, ArcS is substantially different with respect to overall sequence homologies and domain organizations. Thus, we speculate that ArcS might have adopted the role of ArcB after a loss of the original sensor kinase, perhaps as a consequence of regulatory adaptation to a redox-stratified environment.

Synthetic Klebsiella pneumoniae-Shewanella oneidensis Consortium Enables Glycerol-Fed High-Performance Microbial Fuel Cells.

PubMed

Li, Feng; Yin, Changji; Sun, Liming; Li, Yuanxiu; Guo, Xuewu; Song, Hao

2018-05-01

Microbial fuel cell (MFC) is an eco-friendly bio-electrochemical sys-tem that uses microorganism as biocatalyst to convert biomass into electricity. Glycerol, as a waste in the biodiesel refinery processes, is an appealing substrate for MFC. Nevertheless, glycerol cannot be utilized as carbon source by well-known exoelectrogens such as Shewanella oneidensis. Herein, to generate electricity by rapidly harnessing glycerol, the authors rationally constructed a Klebsiella pneumoniae-Shewanella oneidensis microbial consortium to efficiently harvest electricity from glyc-erol, in which K. pneumoniae converted glycerol into lactate, fed to S. oneidensis as carbon source and electron donor. To improve electricity output, the authors systematically engineered the consortium in terms of carbon flux distribution and efficiency of extracellular electron transfer (EET). To direct more carbon flux to lactate biosynthesis in K. pneumoniae, the authors eliminated the ethanol pathway by knocking out the alcohol dehydrogenase gene (adhE), and enhanced lactate biosynthesis by heterologously expressing a lactate dehydrogen-ase gene (ldhD) from Lactobacillus bulgaricus and a lactate transporter gene (lldP) from Escherichia coli. To facilitate EET between S. oneidensis and anode surfaces, a biosynthetic flavins pathway from Bacillus subtilis is introduced into S. oneidensis. The author further optimized the glycerol concentration, thus S. oneidensis could be continuously fed with lactate synthesized from K. pneumoniae at a constant rate. Our glycerol-fed MFC generated a maximum power density of 19.9 mW/m 2 , significantly higher than that of the wild-type consor-tium. This work suggested that engineering microbial consortia is an effi-cient strategy to expand the spectrum of usable carbon sources and promote electricity power production in MFCs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Efficiencies of Bio-electrocatalytic Production of Hydrogen from Lactate Using Shewanella oneidensis MR-1

USDA-ARS?s Scientific Manuscript database

Shewanella oneidensis MR-1 was grown in a chemostatic, continuously-fed bioelectrochemical cell under slightly aerated conditions. The start-up phase was controlled potentiostatically (0.4 V vs. SHE). When a stable performance was achieved, the reactor was switched to bio-electrocatalytic producti...

Current Production and Metal Oxide Reduction by Shewanella oneidensis MR-1 Wild Type and Mutants▿ †

PubMed Central

Bretschger, Orianna; Obraztsova, Anna; Sturm, Carter A.; Chang, In Seop; Gorby, Yuri A.; Reed, Samantha B.; Culley, David E.; Reardon, Catherine L.; Barua, Soumitra; Romine, Margaret F.; Zhou, Jizhong; Beliaev, Alexander S.; Bouhenni, Rachida; Saffarini, Daad; Mansfeld, Florian; Kim, Byung-Hong; Fredrickson, James K.; Nealson, Kenneth H.

2007-01-01

Shewanella oneidensis MR-1 is a gram-negative facultative anaerobe capable of utilizing a broad range of electron acceptors, including several solid substrates. S. oneidensis MR-1 can reduce Mn(IV) and Fe(III) oxides and can produce current in microbial fuel cells. The mechanisms that are employed by S. oneidensis MR-1 to execute these processes have not yet been fully elucidated. Several different S. oneidensis MR-1 deletion mutants were generated and tested for current production and metal oxide reduction. The results showed that a few key cytochromes play a role in all of the processes but that their degrees of participation in each process are very different. Overall, these data suggest a very complex picture of electron transfer to solid and soluble substrates by S. oneidensis MR-1. PMID:17644630

Methods for imaging Shewanella oneidensis MR-1 nanofilaments.

PubMed

Ray, R; Lizewski, S; Fitzgerald, L A; Little, B; Ringeisen, B R

2010-08-01

Nanofilament production by Shewanella oneidensis MR-1 was evaluated as a function of lifestyle (planktonic vs. sessile) under aerobic and anaerobic conditions using different sample preparation techniques prior to imaging with scanning electron microscopy. Nanofilaments could be imaged on MR-1 cells grown in biofilms or planktonically under both aerobic and anaerobic batch culture conditions after fixation, critical point drying and coating with a conductive metal. Critical point drying was a requirement for imaging nanofilaments attached to planktonically grown MR-1 cells, but not for cells grown in a biofilm. Techniques described in this paper cannot be used to differentiate nanowires from pili or flagella.

Shewregdb: Database and visualization environment for experimental and predicted regulatory information in Shewanella oneidensis mr-1

PubMed Central

Syed, Mustafa H; Karpinets, Tatiana V; Leuze, Michael R; Kora, Guruprasad H; Romine, Margaret R; Uberbacher, Edward C

2009-01-01

Shewanella oneidensis MR-1 is an important model organism for environmental research as it has an exceptional metabolic and respiratory versatility regulated by a complex regulatory network. We have developed a database to collect experimental and computational data relating to regulation of gene and protein expression, and, a visualization environment that enables integration of these data types. The regulatory information in the database includes predictions of DNA regulator binding sites, sigma factor binding sites, transcription units, operons, promoters, and RNA regulators including non-coding RNAs, riboswitches, and different types of terminators. Availability http://shewanella-knowledgebase.org:8080/Shewanella/gbrowserLanding.jsp PMID:20198195

Anaerobic Decolorization and Detoxification of Cationic Red X-GRL by Shewanella oneidensis MR-1.

PubMed

Li, Qian; Feng, Xiao-Li; Li, Ting-Ting; Lu, Xue-Rong; Liu, Qiu-Yue; Han, Xue; Feng, Yu-Jie; Liu, Zhao-Ying; Zhang, Xi-Jia; Xiao, Xiang

2017-07-14

The ability of a electrochemically active bacterium, Shewanella oneidensis MR-1, to decolorize azo dye cationic red X-GRL (X-GRL) was investigated. S. oneidensis MR-1 showed a high decolorization capability for X-GRL under anaerobic conditions. The Mtr respiratory pathway was proved to be involved in the extracellular decolorization of X-GRL. The decolorization efficiency of S. oneidensis MR-1 was significantly inhibited when initial X-GRL concentration was over 200 mg L -1 . Increasing the inoculum volume of S. oneidensis MR-1 could obviously promote the X-GRL decolorization. The 100 mg L -1 X-GRL and 6% (v/v) inoculum volume were chosen as the optimal parameter. Under such a condition, almost all of X-GRL (100 mg L -1 ) could be completely reduced after 12-h incubation at the pH range of 5.5∼8.0 and temperature range of 30∼40 °C. Salinity in the medium also affected X-GRL decolorization. Lactate and citric acid were found to be the suitable electron donors for X-GRL decolorization. Although the genotoxicity increased slightly, the phytotoxicity of X-GRL in the decolorization process was significantly reduced by S. oneidensis MR-1.

Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1

PubMed Central

Gödeke, Julia; Paul, Kristina; Lassak, Jürgen; Thormann, Kai M

2011-01-01

Shewanella oneidensis MR-1 is capable of forming highly structured surface-attached communities. By DNase I treatment, we demonstrated that extracellular DNA (eDNA) serves as a structural component in all stages of biofilm formation under static and hydrodynamic conditions. We determined whether eDNA is released through cell lysis mediated by the three prophages LambdaSo, MuSo1 and MuSo2 that are harbored in the genome of S. oneidensis MR-1. Mutant analyses and infection studies revealed that all three prophages may individually lead to cell lysis. However, only LambdaSo and MuSo2 form infectious phage particles. Phage release and cell lysis already occur during early stages of static incubation. A mutant devoid of the prophages was significantly less prone to lysis in pure culture. In addition, the phage-less mutant was severely impaired in biofilm formation through all stages of development, and three-dimensional growth occurred independently of eDNA as a structural component. Thus, we suggest that in S. oneidensis MR-1 prophage-mediated lysis results in the release of crucial biofilm-promoting factors, in particular eDNA. PMID:20962878

Production of Manganese Oxide Nanoparticles by Shewanella Species

PubMed Central

Farooqui, Saad M.; White, Alan R.

2016-01-01

ABSTRACT Several species of the bacterial genus Shewanella are well-known dissimilatory reducers of manganese under anaerobic conditions. In fact, Shewanella oneidensis is one of the most well studied of all metal-reducing bacteria. In the current study, a number of Shewanella strains were tested for manganese-oxidizing capacity under aerobic conditions. All were able to oxidize Mn(II) and to produce solid dark brown manganese oxides. Shewanella loihica strain PV-4 was the strongest oxidizer, producing oxides at a rate of 20.3 mg/liter/day and oxidizing Mn(II) concentrations of up to 9 mM. In contrast, S. oneidensis MR-1 was the weakest oxidizer tested, producing oxides at 4.4 mg/liter/day and oxidizing up to 4 mM Mn(II). Analysis of products from the strongest oxidizers, i.e., S. loihica PV-4 and Shewanella putrefaciens CN-32, revealed finely grained, nanosize, poorly crystalline oxide particles with identical Mn oxidation states of 3.86. The biogenic manganese oxide products could be subsequently reduced within 2 days by all of the Shewanella strains when culture conditions were made anoxic and an appropriate nutrient (lactate) was added. While Shewanella species were detected previously as part of manganese-oxidizing consortia in natural environments, the current study has clearly shown manganese-reducing Shewanella species bacteria that are able to oxidize manganese in aerobic cultures. IMPORTANCE Members of the genus Shewanella are well known as dissimilatory manganese-reducing bacteria. This study shows that a number of species from Shewanella are also capable of manganese oxidation under aerobic conditions. Characterization of the products of the two most efficient oxidizers, S. loihica and S. putrefaciens, revealed finely grained, nanosize oxide particles. With a change in culture conditions, the manganese oxide products could be subsequently reduced by the same bacteria. The ability of Shewanella species both to oxidize and to reduce manganese indicates

CRISPRi-sRNA: Transcriptional-Translational Regulation of Extracellular Electron Transfer in Shewanella oneidensis.

PubMed

Cao, Yingxiu; Li, Xiaofei; Li, Feng; Song, Hao

2017-09-15

Extracellular electron transfer (EET) in Shewanella oneidensis MR-1, which is one of the most well-studied exoelectrogens, underlies many microbial electrocatalysis processes, including microbial fuel cells, microbial electrolysis cells, and microbial electrosynthesis. However, regulating the efficiency of EET remains challenging due to the lack of efficient genome regulation tools that regulate gene expression levels in S. oneidensis. Here, we systematically established a transcriptional regulation technology, i.e., clustered regularly interspaced short palindromic repeats interference (CRISPRi), in S. oneidensis MR-1 using green fluorescent protein (GFP) as a reporter. We used this CRISPRi technology to repress the expression levels of target genes, individually and in combination, in the EET pathways (e.g., the MtrCAB pathway and genes affecting the formation of electroactive biofilms in S. oneidensis), which in turn enabled the efficient regulation of EET efficiency. We then established a translational regulation technology, i.e., Hfq-dependent small regulatory RNA (sRNA), in S. oneidensis by repressing the GFP reporter and mtrA, which is a critical gene in the EET pathways in S. oneidensis. To achieve coordinated transcriptional and translational regulation at the genomic level, the CRISPRi and Hfq-dependent sRNA systems were incorporated into a single plasmid harbored in a recombinant S. oneidensis strain, which enabled an even higher efficiency of mtrA gene repression in the EET pathways than that achieved by the CRISPRi and Hfq-dependent sRNA system alone, as exhibited by the reduced electricity output. Overall, we developed a combined CRISPRi-sRNA method that enabled the synergistic transcriptional and translational regulation of target genes in S. oneidensis. This technology involving CRISPRi-sRNA transcriptional-translational regulation of gene expression at the genomic level could be applied to other microorganisms.

THE ROLE OF 4-HYDROXYPHENYLPYRUVATE DIOXYGENASE IN ENHANCEMENT OF SOLID-PHASE ELECTRON TRANSFER BY SHEWANELLA ONEIDENSIS MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Turick, C; Amy Ekechukwu, A

2007-06-01

While mechanistic details of dissimilatory metal reduction are far from being understood, it is postulated that the electron transfer to solid metal oxides is mediated by outer membrane-associated c-type cytochromes and redox active electron shuttling compounds. This study focuses on the production of homogensitate in Shewanella oneidensis MR-1, an intermediate of tyrosine degradation pathway, which is a precursor of a redox cycling metabolite, pyomelanin. In this study, we determined that two enzymes involved in this pathway, 4-hydroxyphenylpyruvate dioxygenase (4HPPD) and homogentisate 1,2-dioxygenase are responsible for homogentisate production and oxidation, respectively. Inhibition of 4-HPPD activity with the specific inhibitor sulcotrione (2-(2-chloro-4-methanemore » sulfonylbenzoyl)-1,3-cyclohexanedione), and deletion of melA, a gene encoding 4-HPPD, resulted in no pyomelanin production by S. oneidensis MR-1. Conversely, deletion of hmgA which encodes the putative homogentisate 1,2-dioxygenase, resulted in pyomelanin overproduction. The efficiency and rates, with which MR-1 reduces hydrous ferric oxide, were directly linked to the ability of mutant strains to produce pyomelanin. Electrochemical studies with whole cells demonstrated that pyomelanin substantially increases the formal potential (E{sup o}{prime}) of S. oneidensis MR-1. Based on this work, environmental production of pyomelanin likely contributes to an increased solid-phase metal reduction capacity in Shewanella oneidensis.« less

A near-infrared light responsive c-di-GMP module-based AND logic gate in Shewanella oneidensis.

PubMed

Hu, Yidan; Wu, Yichao; Mukherjee, Manisha; Cao, Bin

2017-01-31

A novel, biofilm-based AND logic gate was constructed in Shewanella oneidensis through a near-infrared (NIR) light responsive c-di-GMP module. The logic gate was demonstrated in microbial fuel cells with isopropyl β-d-thiogalactoside (IPTG) and NIR light as the inputs and electrical signals as the output.

Survival of Shewanella Oneidensis MR-1 to GPa pressures

NASA Astrophysics Data System (ADS)

Hazael, Rachael; Foglia, Fabrizia; Leighs, James; Appleby-Thomas, Gareth; Daniel, Isabelle; Eakins, Daniel; Meersman, Filip; McMillian, Paul

2013-06-01

Most life on Earth is thought to occupy near-surface environments under relatively mild conditions of temperature, pressure, pH, salinity etc. That view is changing following discovery of extremophile organisms that prefer environments based on high or low T, extreme chemistries, or very high pressures. Over the past three decades, geomicrobiologists have discovered an extensive subsurface biosphere, that may account for between 1/10 to 1/3 of Earth's living biomass. We subjected samples of Shewanella oneidensis to several pressure cycles to examine its survival to static high pressures to above 1.5 GPa. Shewanella forms part of a genus that contains several piezophile species like S. violacea and S. benthica. We have obtained growth curves for populations recovered from high P conditions and cultured in the laboratory, before being subjected to even higher pressures. We have also carried out dynamic shock experiments using a specially designed cell to maintain high-P, low-T conditions during shock-recovery experiments and observe colony formation among the survivors. Colony counts, shape and growth curves allow us to compare the static vs dynamic pressure resistance of wild type vs pressure-adapted strains. Leverhulme

Programming the quorum sensing-based AND gate in Shewanella oneidensis for logic gated-microbial fuel cells.

PubMed

Hu, Yidan; Yang, Yun; Katz, Evgeny; Song, Hao

2015-03-11

An AND logic gate based on a synthetic quorum-sensing (QS) module was constructed in a Shewanella oneidensis MR-1 mtrA knockout mutant. The presence of two input signals activated the expression of a periplasmic decaheme cytochrome MtrA to regenerate the extracellular electron transfer conduit, enabling the construction of AND-gated microbial fuel cells.

Expression of a tetraheme protein, Desulfovibrio vulgaris Miyazaki F cytochrome c(3), in Shewanella oneidensis MR-1

NASA Technical Reports Server (NTRS)

Ozawa, K.; Tsapin, A. I.; Nealson, K. H.; Cusanovich, M. A.; Akutsu, H.

2000-01-01

Cytochrome c(3) from Desulfovibrio vulgaris Miyazaki F was successfully expressed in the facultative aerobe Shewanella oneidensis MR-1 under anaerobic, microaerophilic, and aerobic conditions, with yields of 0.3 to 0.5 mg of cytochrome/g of cells. A derivative of the broad-host-range plasmid pRK415 containing the cytochrome c(3) gene from D. vulgaris Miyazaki F was used for transformation of S. oneidensis MR-1, resulting in the production of protein product that was indistinguishable from that produced by D. vulgaris Miyazaki F, except for the presence of one extra alanine residue at the N terminus.

Involvement of Shewanella oneidensis MR-1 LuxS in Biofilm Development and Sulfur Metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Learman, Deric R.; Yi, Haakrho; Brown, Steven D.

2009-01-05

The role of LuxS in Shewanella oneidensis MR-1 has been examined by transcriptomic profiling, biochemical, and physiological experiments. The results indicate that a mutation in luxS alters biofilm development, not by altering quorum-sensing abilities but by disrupting the activated methyl cycle (AMC). The S. oneidensis wild type can produce a luminescence response in the AI-2 reporter strain Vibrio harveyi MM32. This luminescence response is abolished upon the deletion of luxS. The deletion of luxS also alters biofilm formations in static and flowthrough conditions. Genetic complementation restores the mutant biofilm defect, but the addition of synthetic AI-2 has no effect. Thesemore » results suggest that AI-2 is not used as a quorum-sensing signal to regulate biofilm development in S. oneidensis. Growth on various sulfur sources was examined because of the involvement of LuxS in the AMC. A mutation in luxS produced a reduced ability to grow with methionine as the sole sulfur source. Methionine is a key metabolite used in the AMC to produce a methyl source in the cell and to recycle homocysteine. These data suggest that LuxS is important to metabolizing methionine and the AMC in S. oneidensis.« less

The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

2010-04-20

Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

Iron Reduction and Carbonate Precipitation by Shewanella oneidensis

NASA Astrophysics Data System (ADS)

Zeng, Z.; Tice, M. M.

2011-12-01

This study is to contribute to better understanding of how Archean microbes induced carbonate diagenesis in mats and stromatolites. Previous studies showed sulfate reduction, a common promoter of carbonate precipitation in modern mats[1], is likely to have been less effective in Archean mats in marine fluids lower in sulfate[2]. Alternatively, iron reduction produces far more alkalinity per unit carbon respired than sulfate reduction. Therefore, we hypothesize iron reduction can promote much more carbonate precipitation than sulfate reduction. Our study might also have some relevance to banded iron formation on which microbial iron reduction played a potential role[3]. To test our hypothesis, Shewanella oneidensis MR-1, a dissimilatory iron reducing bacterium will be cultured anaerobically (79%N2, 20%CO2 and 1%H2) in basal medium to trigger iron reduction. Lactate will be used as electron donor, and the electron acceptor will be fresh ferrihydrite. Culture medium will be added with various metal ions, such as Ca2+ and Mg2+, to obtain potential carbonate precipitate. Escherichia coli (with fumarate added as an electron acceptor) will be used to provide a comparison to live but non-iron- reduction cells. After 20 days incubation, precipitate will be collected, washed and identified by X-ray diffraction (XRD). Besides, iron reduction rate (ferrozine assay)[4], PH and amount of precipitate (carbonate and oxidize fractions)[5] will be measured over time to well understand how S. oneidensis drives carbonate precipitation.

Investigating different mechanisms for biogenic selenite transformations: Geobacter sulfurreducens, Shewanella oneidensis and Veillonella atypica

USGS Publications Warehouse

Pearce, C.I.; Pattrick, R.A.D.; Law, N.; Charnock, J.M.; Coker, V.S.; Fellowes, J.W.; Oremland, R.S.; Lloyd, J.R.

2009-01-01

The metal-reducing bacteria Geobacter sulfurreducens, Shewanella oneidensis and Veillonella atypica, use different mechanisms to transform toxic, bioavailable sodium selenite to less toxic, non-mobile elemental selenium and then to selenide in anaerobic environments, offering the potential for in situ and ex situ bioremediation of contaminated soils, sediments, industrial effluents, and agricultural drainage waters. The products of these reductive transformations depend on both the organism involved and the reduction conditions employed, in terms of electron donor and exogenous extracellular redox mediator. The intermediary phase involves the precipitation of elemental selenium nanospheres and the potential role of proteins in the formation of these structures is discussed. The bionanomineral phases produced during these transformations, including both elemental selenium nanospheres and metal selenide nanoparticles, have catalytic, semiconducting and light-emitting properties, which may have unique applications in the realm of nanophotonics. This research offers the potential to combine remediation of contaminants with the development of environmentally friendly manufacturing pathways for novel bionanominerals. ?? 2009 Taylor & Francis.

Ferrihydrite-associated organic matter (OM) stimulates reduction by Shewanella oneidensis MR-1 and a complex microbial consortia

NASA Astrophysics Data System (ADS)

Cooper, Rebecca Elizabeth; Eusterhues, Karin; Wegner, Carl-Eric; Totsche, Kai Uwe; Küsel, Kirsten

2017-11-01

The formation of Fe(III) oxides in natural environments occurs in the presence of natural organic matter (OM), resulting in the formation of OM-mineral complexes that form through adsorption or coprecipitation processes. Thus, microbial Fe(III) reduction in natural environments most often occurs in the presence of OM-mineral complexes rather than pure Fe(III) minerals. This study investigated to what extent does the content of adsorbed or coprecipitated OM on ferrihydrite influence the rate of Fe(III) reduction by Shewanella oneidensis MR-1, a model Fe(III)-reducing microorganism, in comparison to a microbial consortium extracted from the acidic, Fe-rich Schlöppnerbrunnen fen. We found that increased OM content led to increased rates of microbial Fe(III) reduction by S. oneidensis MR-1 in contrast to earlier findings with the model organism Geobacter bremensis. Ferrihydrite-OM coprecipitates were reduced slightly faster than ferrihydrites with adsorbed OM. Surprisingly, the complex microbial consortia stimulated by a mixture of electrons donors (lactate, acetate, and glucose) mimics S. oneidensis under the same experimental Fe(III)-reducing conditions suggesting similar mechanisms of electron transfer whether or not the OM is adsorbed or coprecipitated to the mineral surfaces. We also followed potential shifts of the microbial community during the incubation via 16S rRNA gene sequence analyses to determine variations due to the presence of adsorbed or coprecipitated OM-ferrihydrite complexes in contrast to pure ferrihydrite. Community profile analyses showed no enrichment of typical model Fe(III)-reducing bacteria, such as Shewanella or Geobacter sp., but an enrichment of fermenters (e.g., Enterobacteria) during pure ferrihydrite incubations which are known to use Fe(III) as an electron sink. Instead, OM-mineral complexes favored the enrichment of microbes including Desulfobacteria and Pelosinus sp., both of which can utilize lactate and acetate as an electron

Deletion of degQ gene enhances outer membrane vesicle production of Shewanella oneidensis cells.

PubMed

Ojima, Yoshihiro; Mohanadas, Thivagaran; Kitamura, Kosei; Nunogami, Shota; Yajima, Reiki; Taya, Masahito

2017-04-01

Shewanella oneidensis is a Gram-negative facultative anaerobe that can use a wide variety of terminal electron acceptors for anaerobic respiration. In this study, S. oneidensis degQ gene, encoding a putative periplasmic serine protease, was cloned and expressed. The activity of purified DegQ was inhibited by diisopropyl fluorophosphate, a typical serine protease-specific inhibitor, indicating that DegQ is a serine protease. In-frame deletion and subsequent complementation of the degQ were carried out to examine the effect of envelope stress on the production of outer membrane vesicles (OMVs). Analysis of periplasmic proteins from the resulting S. oneidensis strain showed that deletion of degQ induced protein accumulation and resulted in a significant decrease in protease activity within the periplasmic space. OMVs from the wild-type and mutant strains were purified and observed by transmission electron microscopy. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the OMVs showed a prominent band at ~37 kDa. Nanoliquid chromatography-tandem mass spectrometry analysis identified three outer membrane porins (SO3896, SO1821, and SO3545) as dominant components of the band, suggesting that these proteins could be used as indices for comparing OMV production by S. oneidensis strains. Quantitative evaluation showed that degQ-deficient cells had a fivefold increase in OMV production compared with wild-type cells. Thus, the increased OMV production following the deletion of DegQ in S. oneidensis may be responsible for the increase in envelope stress.

Contribution of direct electron transfer mechanisms to overall electron transfer in microbial fuel cells utilising Shewanella oneidensis as biocatalyst.

PubMed

Fapetu, Segun; Keshavarz, Taj; Clements, Mark; Kyazze, Godfrey

2016-09-01

To investigate the contribution of direct electron transfer mechanisms to electricity production in microbial fuel cells by physically retaining Shewanella oneidensis cells close to or away from the anode electrode. A maximum power output of 114 ± 6 mWm(-2) was obtained when cells were retained close to the anode using a dialysis membrane. This was 3.5 times more than when the cells were separated away from the anode. Without the membrane the maximum power output was 129 ± 6 mWm(-2). The direct mechanisms of electron transfer contributed significantly to overall electron transfer from S. oneidensis to electrodes, a result that was corroborated by another experiment where S. oneidensis cells were entrapped in alginate gels. S. oneidensis transfers electrons primarily by direct electron transfer as opposed to mediated electron transfer.

PBP1a/LpoA but Not PBP1b/LpoB Are Involved in Regulation of the Major β-Lactamase Gene blaA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Sun, Yiyang; Mao, Yinting; Jin, Miao

2015-01-01

β-Lactamase production is one of the most important strategies for Gram-negative bacteria to combat β-lactam antibiotics. Studies of the regulation of β-lactamase expression have largely been focused on the class C β-lactamase AmpC, whose induction by β-lactams requires LysR-type regulator AmpR and permease AmpG-dependent peptidoglycan recycling intermediates. In Shewanella, which is ubiquitous in aquatic environments and is a reservoir for antibiotic resistance, production of the class D β-lactamase BlaA confers bacteria with natural resistance to many β-lactams. Expression of the blaA gene in the genus representative Shewanella oneidensis is distinct from the AmpC paradigm because of the lack of an AmpR homologue and the presence of an additional AmpG-independent regulatory pathway. In this study, using transposon mutagenesis, we identify proteins that are involved in blaA regulation. Inactivation of mrcA and lpoA, which encode penicillin binding protein 1a (PBP1a) and its lipoprotein cofactor, LpoA, respectively, drastically enhances blaA expression in the absence of β-lactams. Although PBP1b and its cognate, LpoB, also exist in S. oneidensis, their roles in blaA induction are dispensable. We further show that the mrcA-mediated blaA expression is independent of AmpG. PMID:25824223

[Selective-differential nutrient medium "Shewanella IRHLS agar" for isolation of Shewanella genus bacteria].

PubMed

Sivolodsky, E P

2015-01-01

Development of a selective-differential nutrient medium for isolation of Shewanella genus bacteria. 73 strains of Shewanella bacteria (S. algae--3, S. baltica--26, S. putrefaciens--44) and 80 strains of 22 other bacteria genera were used. Shewanella species were identified by methods and criteria proposed by Nozue H. et al., 1992; Khashe S. et al., 1998. Nutrient media "Shewanella IRHLS Agar" for shewanella isolation was developed. Medium selective factors: irgazan DP-300 (I). 0.14-0.2 g/l and rifampicin (R) 0.0005-0.001 g/l. Shevanella colonies were detected by the production of hydrogen sulfide (H), lipase presence (L), lack of sorbitol fermentation (S). The medium suppressed the growth of hydrogen sulfide producers (Salmonella, Proteus) and blocked hydrogen sulfide production by Citrobacter. Growth of Escherichia, Enterobacter, Klebsiella, Shigella, Staphylococcus, Bacillus was also suppressed, Analytical sensitivity of the medium was 1-2 CFU/ml for Shewanella and Stenotrophomonas, Aerombnas, Serratia genera bacteria. 72 strains of Shewanella were isolated from water of Neva river in this medium, 91.7 ± 3.2% of those produced H2S. 1 strain of S. algae was isolated from clinical material. The developed media allows to use it in a complex for Stenotrophomo- nas sp., Aeromonas sp., Serratia sp., Citrobactersp. and Shewanella bacteria isolation.

Reduction of jarosite by Shewanella oneidensis MR-1 and secondary mineralization

NASA Astrophysics Data System (ADS)

Bingjie, Ouyang; Xiancai, Lu; Huan, Liu; Juan, Li; Tingting, Zhu; Xiangyu, Zhu; Jianjun, Lu; Rucheng, Wang

2014-01-01

Jarosite is a common mineral in a variety of environments formed by the oxidation of iron sulfide normally accompanying with the generation of acid mine drainage (AMD) in mining areas or acid rock drainages (ARD) in many localities. Decomposition of jarosite by dissimilatory iron reducing bacteria (DIRB) influences the mobility of many heavy metals generally accommodated in natural jarosite. This study examined the anaerobic reduction of synthesized jarosite by Shewanella oneidensis strain MR-1, a typical facultative bacteria. The release of ferrous and ferric ion, as well as sulfate and potassium, in the inoculated experimental group lasting 80 days is much higher than that in abiotic control groups. The detection of bicarbonate and acetate in experimental solution further confirms the mechanism of microbial reduction of jarosite, in which lactate acts as the electron donor. The produced ferrous iron stimulates the subsequent secondary mineralization, leading to precipitation and transformation of various iron-containing minerals. Green rust and goethite are the intermediate minerals of the microbial reduction process under anoxic conditions, and the end products include magnetite and siderite. In aerobic environments, goethite, magnetite and siderite were also detected, but the contents were relatively lower. While in abiotic experiments, only goethite has been detected as a product. Thus, the microbial reduction and subsequent mineral transformation can remarkably influence the geochemical cycling of iron and sulfur in supergene environments, as well as the mobility of heavy metals commonly accommodated in jarosite.

Transcriptional analysis of Shewanella oneidensis MR-1 with an electrode compared to Fe(III)citrate or oxygen as terminal electron acceptor

USDA-ARS?s Scientific Manuscript database

Background. Shewanella oneidensis is a target of extensive research efforts in the fields of bioelectrochemical systems and bioremediation because of its versatile metabolic capabilities, especially in regards to the respiration with extracellular electron acceptors. Here, we took a global approach ...

Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*

PubMed Central

Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.

2009-01-01

Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057

Microbial-enzymatic-hybrid biological fuel cell with optimized growth conditions for Shewanella oneidensis DSP-10.

PubMed

Roy, Jared N; Luckarift, Heather R; Sizemore, Susan R; Farrington, Karen E; Lau, Carolin; Johnson, Glenn R; Atanassov, Plamen

2013-07-10

In this work we present a biological fuel cell fabricated by combining a Shewanella oneidensis microbial anode and a laccase-modified air-breathing cathode. This concept is devised as an extension to traditional biochemical methods by incorporating diverse biological catalysts with the aim of powering small devices. In preparing the biological fuel cell anode, novel hierarchical-structured architectures and biofilm configurations were investigated. A method for creating an artificial biofilm based on encapsulating microorganisms in a porous, thin film of silica was compared with S. oneidensis biofilms that were allowed to colonize naturally. Results indicate comparable current and power densities for artificial and natural biofilm formations, based on growth characteristics. As a result, this work describes methods for creating controllable and reproducible bio-anodes and demonstrates the versatility of hybrid biological fuel cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Evidence-Based Annotation of Gene Function in Shewanella oneidensis MR-1 Using Genome-Wide Fitness Profiling across 121 Conditions

PubMed Central

Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.; Shao, Wenjun; Baumohl, Jason K.; Xu, Zhuchen; Nguyen, Michelle; Tamse, Raquel; Davis, Ronald W.; Arkin, Adam P.

2011-01-01

Most genes in bacteria are experimentally uncharacterized and cannot be annotated with a specific function. Given the great diversity of bacteria and the ease of genome sequencing, high-throughput approaches to identify gene function experimentally are needed. Here, we use pools of tagged transposon mutants in the metal-reducing bacterium Shewanella oneidensis MR-1 to probe the mutant fitness of 3,355 genes in 121 diverse conditions including different growth substrates, alternative electron acceptors, stresses, and motility. We find that 2,350 genes have a pattern of fitness that is significantly different from random and 1,230 of these genes (37% of our total assayed genes) have enough signal to show strong biological correlations. We find that genes in all functional categories have phenotypes, including hundreds of hypotheticals, and that potentially redundant genes (over 50% amino acid identity to another gene in the genome) are also likely to have distinct phenotypes. Using fitness patterns, we were able to propose specific molecular functions for 40 genes or operons that lacked specific annotations or had incomplete annotations. In one example, we demonstrate that the previously hypothetical gene SO_3749 encodes a functional acetylornithine deacetylase, thus filling a missing step in S. oneidensis metabolism. Additionally, we demonstrate that the orphan histidine kinase SO_2742 and orphan response regulator SO_2648 form a signal transduction pathway that activates expression of acetyl-CoA synthase and is required for S. oneidensis to grow on acetate as a carbon source. Lastly, we demonstrate that gene expression and mutant fitness are poorly correlated and that mutant fitness generates more confident predictions of gene function than does gene expression. The approach described here can be applied generally to create large-scale gene-phenotype maps for evidence-based annotation of gene function in prokaryotes. PMID:22125499

Promotion of Iron Oxide Reduction and Extracellular Electron Transfer in Shewanella oneidensis by DMSO

PubMed Central

Cheng, Yuan-Yuan; Li, Bing-Bing; Li, Dao-Bo; Chen, Jie-Jie; Li, Wen-Wei; Tong, Zhong-Hua; Wu, Chao; Yu, Han-Qing

2013-01-01

The dissimilatory metal reducing bacterium Shewanella oneidensis MR-1, known for its capacity of reducing iron and manganese oxides, has great environmental impacts. The iron oxides reducing process is affected by the coexistence of alternative electron acceptors in the environment, while investigation into it is limited so far. In this work, the impact of dimethyl sulphoxide (DMSO), a ubiquitous chemical in marine environment, on the reduction of hydrous ferric oxide (HFO) by S. oneidensis MR-1 was investigated. Results show that DMSO promoted HFO reduction by both wild type and ΔdmsE, but had no effect on the HFO reduction by ΔdmsB, indicating that such a promotion was dependent on the DMSO respiration. With the DMSO dosing, the levels of extracellular flavins and omcA expression were significantly increased in WT and further increased in ΔdmsE. Bioelectrochemical analysis show that DMSO also promoted the extracellular electron transfer of WT and ΔdmsE. These results demonstrate that DMSO could stimulate the HFO reduction through metabolic and genetic regulation in S. oneidensis MR-1, rather than compete for electrons with HFO. This may provide a potential respiratory pathway to enhance the microbial electron flows for environmental and engineering applications. PMID:24244312

Photoreduction of Shewanella oneidensis Extracellular Cytochromes by Organic Chromophores and Dye‐Sensitized TiO2

PubMed Central

Ainsworth, Emma V.; Lockwood, Colin W. J.; White, Gaye F.; Hwang, Ee Taek; Sakai, Tsubasa; Gross, Manuela A.; Richardson, David J.; Clarke, Thomas A.

2016-01-01

Abstract The transfer of photoenergized electrons from extracellular photosensitizers across a bacterial cell envelope to drive intracellular chemical transformations represents an attractive way to harness nature's catalytic machinery for solar‐assisted chemical synthesis. In Shewanella oneidensis MR‐1 (MR‐1), trans‐outer‐membrane electron transfer is performed by the extracellular cytochromes MtrC and OmcA acting together with the outer‐membrane‐spanning porin⋅cytochrome complex (MtrAB). Here we demonstrate photoreduction of solutions of MtrC, OmcA, and the MtrCAB complex by soluble photosensitizers: namely, eosin Y, fluorescein, proflavine, flavin, and adenine dinucleotide, as well as by riboflavin and flavin mononucleotide, two compounds secreted by MR‐1. We show photoreduction of MtrC and OmcA adsorbed on RuII‐dye‐sensitized TiO2 nanoparticles and that these protein‐coated particles perform photocatalytic reduction of solutions of MtrC, OmcA, and MtrCAB. These findings provide a framework for informed development of strategies for using the outer‐membrane‐associated cytochromes of MR‐1 for solar‐driven microbial synthesis in natural and engineered bacteria. PMID:27685371

Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bendall, Matthew L.; Luong, Khai; Wetmore, Kelly M.

2013-08-30

We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns.more » However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.« less

Cell density related H2 consumption in relation to anoxic Fe(0) corrosion and precipitation of corrosion products by Shewanella oneidensis MR-1.

PubMed

De Windt, Wim; Boon, Nico; Siciliano, Steven D; Verstraete, Willy

2003-11-01

In the absence of oxygen, a protective H2 film is formed around an Fe(0) surface, inhibiting the electron flow from this surface. Our study of anoxic corrosion of Fe(0) beads revealed that, in the presence of Shewanella oneidensis MR-1, H2 removal and precipitation of Fe mineral particles on the cell surface are determining processes for corrosion. These two biologically mediated processes were governed by cell density. H2 removal by Shewanella oneidensis was detected at cell concentrations of 1.0 x 10(6) live cells ml-1 and higher and H2 was electron donor for denitrification of NO3-. The removal of the protective H2 layer from Fe(0) beads by Shewanella oneidensis, resulted in an increase of Fe release out of the Fe(0) beads from 153 +/- 25 mg l(-1) to 196 +/- 7 mg l-1 after 20 h. When the cell concentration exceeded 1.0 x 10(8) live cells ml-1, precipitation of iron minerals on the cell surface was characteristic for the greatest percentage of MR-1 cells, whereas micrometre-scale iron precipitates not associated with culturable cell biomass significantly decreased in number. Addition of supernatant of a corrosion assay with high cell concentration induced metabolic activity in a corrosion assay with low cell concentration, resulting in increased H2 consumption and Fe release from Fe(0) beads. Homoserine lactone-like molecules were detected in the supernatant by a bio-assay, suggesting the involvement of a quorum-sensing regulatory mechanism.

Use of an Electrochemical Split Cell Technique to Evaluate the Influence of Shewanella oneidensis Activities on Corrosion of Carbon Steel

PubMed Central

Miller, Robert Bertram; Sadek, Anwar; Rodriguez, Alvaro; Iannuzzi, Mariano; Giai, Carla; Senko, John M.; Monty, Chelsea N.

2016-01-01

Microbially induced corrosion (MIC) is a complex problem that affects various industries. Several techniques have been developed to monitor corrosion and elucidate corrosion mechanisms, including microbiological processes that induce metal deterioration. We used zero resistance ammetry (ZRA) in a split chamber configuration to evaluate the effects of the facultatively anaerobic Fe(III) reducing bacterium Shewanella oneidensis MR-1 on the corrosion of UNS G10180 carbon steel. We show that activities of S. oneidensis inhibit corrosion of steel with which that organism has direct contact. However, when a carbon steel coupon in contact with S. oneidensis was electrically connected to a second coupon that was free of biofilm (in separate chambers of the split chamber assembly), ZRA-based measurements indicated that current moved from the S. oneidensis-containing chamber to the cell-free chamber. This electron transfer enhanced the O2 reduction reaction on the coupon deployed in the cell free chamber, and consequently, enhanced oxidation and corrosion of that electrode. Our results illustrate a novel mechanism for MIC in cases where metal surfaces are heterogeneously covered by biofilms. PMID:26824529

Use of an Electrochemical Split Cell Technique to Evaluate the Influence of Shewanella oneidensis Activities on Corrosion of Carbon Steel.

PubMed

Miller, Robert Bertram; Sadek, Anwar; Rodriguez, Alvaro; Iannuzzi, Mariano; Giai, Carla; Senko, John M; Monty, Chelsea N

2016-01-01

Microbially induced corrosion (MIC) is a complex problem that affects various industries. Several techniques have been developed to monitor corrosion and elucidate corrosion mechanisms, including microbiological processes that induce metal deterioration. We used zero resistance ammetry (ZRA) in a split chamber configuration to evaluate the effects of the facultatively anaerobic Fe(III) reducing bacterium Shewanella oneidensis MR-1 on the corrosion of UNS G10180 carbon steel. We show that activities of S. oneidensis inhibit corrosion of steel with which that organism has direct contact. However, when a carbon steel coupon in contact with S. oneidensis was electrically connected to a second coupon that was free of biofilm (in separate chambers of the split chamber assembly), ZRA-based measurements indicated that current moved from the S. oneidensis-containing chamber to the cell-free chamber. This electron transfer enhanced the O2 reduction reaction on the coupon deployed in the cell free chamber, and consequently, enhanced oxidation and corrosion of that electrode. Our results illustrate a novel mechanism for MIC in cases where metal surfaces are heterogeneously covered by biofilms.

Electrochemical synthesis of formic acid from CO2 catalyzed by Shewanella oneidensis MR-1 whole-cell biocatalyst.

PubMed

Le, Quang Anh Tuan; Kim, Hee Gon; Kim, Yong Hwan

2018-09-01

The electro-biocatalytic conversion of CO 2 into formic acid using whole-cell and isolated biocatalysts is useful as an alternative route for CO 2 sequestration. In this study, Shewanella oneidensis MR-1 (S. oneidensis MR-1), a facultative aerobic bacterium that has been extensively studied for its utility as biofuel cells as well as for the detoxification of heavy metal oxides (i.e., MnO 2 , uranium), has been applied for the first time as a whole-cell biocatalyst for formic acid synthesis from gaseous CO 2 and electrons supplied from an electrode. S. oneidensis MR-1, when aerobically grown in Luria-Bertani (LB) medium, exhibited its ability as a whole-cell biocatalyst for the conversion of CO 2 into formic acid with moderate productivity of 0.59 mM h -1 for 24 h. In addition, an optimization of growth conditions of S. oneidensis MR-1 resulted in a remarkable increase in productivity. The CO 2 reduction reaction catalyzed by S. oneidensis MR-1, when anaerobically grown in newly optimized LB medium supplemented with fumarate and nitrate, exhibited 3.2-fold higher productivity (1.9 mM h -1 for 72 h) compared to that grown aerobically in only LB medium. Furthermore, the average conversion rate of formic acid synthesis catalyzed by S. oneidensis MR-1 when grown in the optimal medium over a period of 72 h was 3.8 mM h -1  g -1 wet-cell, which is 9.6-fold higher than that catalyzed by Methylobacterium extorquens AM1 whole-cells in our previous study. Copyright © 2018 Elsevier Inc. All rights reserved.

Silver nanocrystallites: Facile biofabrication using Shewanella oneidensis, and an evaluation of their comparative toxicity on Gram-negative and Gram-positive bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suresh, Anil K; Wang, Wei; Pelletier, Dale A

Microorganisms have long been known to develop resistance to metal ions either by sequestering metals inside the cell or by effluxing them into the extracellular media. Here we report the biosynthesis of extracellular silver based single nanocrystallites of well-defined composition and homogeneous morphology utilizing the -proteobacterium, Shewanella oneidensis strain MR-1, upon incubation with an aqueous solution of silver nitrate. Further characterization of these particles revealed that the crystals consist of small, reasonably monodispersed spheres in the size range 2 11 nm (with an average of 4 1.5 nm). The bactericidal effect of these biologically synthesized silver nanoparticles (biogenic-Ag) are comparedmore » to similar chemically synthesized nanoparticles (colloidal silver [colloidal-Ag] and oleate capped silver [oleate-Ag]). The determination of the bactericidal effect of these different silver nanoparticles was assessed using both Gram-negative (E. coli) and Gram-positive (B. subtilis) bacteria and based on the diameter of the inhibition zone in disc diffusion tests, minimum inhibitory concentrations, Live/Dead staining assays, and atomic force microscopy. From a toxicity perspective, a clear synthesis procedure, and a surface coat- and strain-dependent inhibition were observed for silver nanoparticles. Biogenic-Ag was found to be of higher toxicity when compared to colloidal-Ag for both E. coli and B. subtilis. E. coli was found to be more resistant to either of these nanoparticles than B. subtilis. In contrast, Oleate-Ag was not toxic to either of the bacteria. These findings have important implications for the potential uses of Ag nanomaterials and for their fate in biological and environmental systems.« less

The effect of metal loading on Cd adsorption onto Shewanella oneidensis bacterial cell envelopes: The role of sulfhydryl sites

NASA Astrophysics Data System (ADS)

Yu, Qiang; Fein, Jeremy B.

2015-10-01

The adsorption and desorption of Cd onto Shewanella oneidensis bacterial cells with and without blocking of sulfhydryl sites was measured in order to determine the effect of metal loading and to understand the role of sulfhydryl sites in the adsorption reactions. The observed adsorption/desorption behaviors display strong dependence on metal loading. Under a high loading of 40 μmol Cd/g bacterial cells, blocking the sulfhydryl sites within the cell envelope by exposure of the biomass to monobromo(trimethylammonio)bimane bromide (qBBr) does not significantly affect the extent of Cd adsorption, and we observed fully reversible adsorption under this condition. In contrast, under a low metal loading of 1.3 μmol Cd/g bacterial cells, the extent of Cd adsorption onto sulfhydryl-blocked S. oneidensis cells was significantly lower than that onto untreated cells, and only approximately 50-60% of the adsorbed Cd desorbed from the cells upon acidification. In conjunction with previous EXAFS results, our findings demonstrate that Cd adsorption onto S. oneidensis under low metal loading conditions is dominated by sulfhydryl binding, and thus is controlled by a distinct adsorption mechanism from the non-sulfhydryl site binding which controls Cd adsorption under high metal loading conditions. We use the data to develop a surface complexation model that constrains the values of the stability constants for individual Cd-sulfhydryl and Cd-non-sulfhydryl bacterial complexes, and we use this approach to account for the Cd adsorption behavior as a function of both pH and metal loading. This approach is crucial in order to predict metal adsorption onto bacteria under environmentally relevant metal loading conditions where sulfhydryl binding sites can dominate the adsorption reaction.

Comparative c-type cytochrome expression analysis in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C grown with soluble and insoluble oxidised metal electron acceptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nissen, Silke; Liu, Xiaoxin; Chourey, Karuna

2012-01-01

The genomes of Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C encode 40 and 69 putative c-type cytochrome genes, respectively. Deletion mutant and biochemical studies have assigned specific functions to a few c-type cytochromes involved in electron transfer to oxidised metals in Shewanella oneidensis strain MR-1. Although promising, the genetic approach is limited to gene deletions that produce a distinct phenotype, and organism for which a genetic system is available. To more comprehensively investigate and compare c-type cytochrome expression in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C, proteomic measurements were used to characterise lysates of cells grownmore » with soluble Fe(III) (as ferric citrate) and insoluble Mn(IV) (as MnO2) as electron acceptors. Strain MR-1 expressed 19 and 20, and strain 2CP-C expressed 27 and 25 c-type cytochromes when grown with Fe(III) and Mn(IV), respectively. The majority of c-type cytochromes (77% for strain MR-1 and 63% for strain 2CP-C) were expressed under both growth conditions; however, the analysis also revealed unique c-type cytochromes that were specifically expressed in cells grown with soluble Fe(III) or insoluble Mn(IV). Proteomic characterisation proved to be a promising approach for determining the c-type cytochrome complement expressed under different growth conditions, and will help elucidating the specific functions of more c-type cytochromes that are the basis for Shewanella and Anaeromyxobacter respiratory versatility.« less

Water Dynamics in Shewanella oneidensis at Ambient and High Pressure using Quasi-Elastic Neutron Scattering.

PubMed

Foglia, Fabrizia; Hazael, Rachael; Simeoni, Giovanna G; Appavou, Marie-Sousai; Moulin, Martine; Haertlein, Michael; Trevor Forsyth, V; Seydel, Tilo; Daniel, Isabelle; Meersman, Filip; McMillan, Paul F

2016-01-07

Quasielastic neutron scattering (QENS) is an ideal technique for studying water transport and relaxation dynamics at pico- to nanosecond timescales and at length scales relevant to cellular dimensions. Studies of high pressure dynamic effects in live organisms are needed to understand Earth's deep biosphere and biotechnology applications. Here we applied QENS to study water transport in Shewanella oneidensis at ambient (0.1 MPa) and high (200 MPa) pressure using H/D isotopic contrast experiments for normal and perdeuterated bacteria and buffer solutions to distinguish intracellular and transmembrane processes. The results indicate that intracellular water dynamics are comparable with bulk diffusion rates in aqueous fluids at ambient conditions but a significant reduction occurs in high pressure mobility. We interpret this as due to enhanced interactions with macromolecules in the nanoconfined environment. Overall diffusion rates across the cell envelope also occur at similar rates but unexpected narrowing of the QENS signal appears between momentum transfer values Q = 0.7-1.1 Å(-1) corresponding to real space dimensions of 6-9 Å. The relaxation time increase can be explained by correlated dynamics of molecules passing through Aquaporin water transport complexes located within the inner or outer membrane structures.

Structural dissection of Shewanella oneidensis old yellow enzyme 4 bound to a Meisenheimer complex and (nitro)phenolic ligands.

PubMed

Elegheert, Jonathan; Brigé, Ann; Van Beeumen, Jozef; Savvides, Savvas N

2017-10-01

Shewanella oneidensis, a Gram-negative γ-proteobacterium with an extensive redox capacity, possesses four old yellow enzyme (OYE) homologs. Of these, Shewanella yellow enzyme 4 (SYE4) is implicated in resistance to oxidative stress. Here, we present a series of high-resolution crystal structures for SYE4 in the oxidized and reduced states, and in complex with phenolic ligands and the nitro-aromatic explosive picric acid. The structures unmask new features, including the identification of a binding platform for long-chain hydrophobic molecules. Furthermore, we present the first structural observation of a hydride-Meisenheimer complex of picric acid with a flavoenzyme. Overall, our study exposes the binding promiscuity of SYE4 toward a variety of electrophilic substrates and is consistent with a general detoxification function for SYE4. © 2017 Federation of European Biochemical Societies.

Transcriptome Profiling of Shewanella oneidensis Gene Expression following Exposure to Acidic and Alkaline pH†

PubMed Central

Leaphart, Adam B.; Thompson, Dorothea K.; Huang, Katherine; Alm, Eric; Wan, Xiu-Feng; Arkin, Adam; Brown, Steven D.; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Wickham, Gene S.; Zhou, Jizhong

2006-01-01

The molecular response of Shewanella oneidensis MR-1 to variations in extracellular pH was investigated based on genomewide gene expression profiling. Microarray analysis revealed that cells elicited both general and specific transcriptome responses when challenged with environmental acid (pH 4) or base (pH 10) conditions over a 60-min period. Global responses included the differential expression of genes functionally linked to amino acid metabolism, transcriptional regulation and signal transduction, transport, cell membrane structure, and oxidative stress protection. Response to acid stress included the elevated expression of genes encoding glycogen biosynthetic enzymes, phosphate transporters, and the RNA polymerase sigma-38 factor (rpoS), whereas the molecular response to alkaline pH was characterized by upregulation of nhaA and nhaR, which are predicted to encode an Na+/H+ antiporter and transcriptional activator, respectively, as well as sulfate transport and sulfur metabolism genes. Collectively, these results suggest that S. oneidensis modulates multiple transporters, cell envelope components, and pathways of amino acid consumption and central intermediary metabolism as part of its transcriptome response to changing external pH conditions. PMID:16452448

Synthetic and Evolutionary Construction of a Chlorate-Reducing Shewanella oneidensis MR-1.

PubMed

Clark, Iain C; Melnyk, Ryan A; Youngblut, Matthew D; Carlson, Hans K; Iavarone, Anthony T; Coates, John D

2015-05-19

Despite evidence for the prevalence of horizontal gene transfer of respiratory genes, little is known about how pathways functionally integrate within new hosts. One example of a mobile respiratory metabolism is bacterial chlorate reduction, which is frequently encoded on composite transposons. This implies that the essential components of the metabolism are encoded on these mobile elements. To test this, we heterologously expressed genes for chlorate reduction from Shewanella algae ACDC in the non-chlorate-reducing Shewanella oneidensis MR-1. The construct that ultimately endowed robust growth on chlorate included cld, a cytochrome c gene, clrABDC, and two genes of unknown function. Although strain MR-1 was unable to grow on chlorate after initial insertion of these genes into the chromosome, 11 derived strains capable of chlorate respiration were obtained through adaptive evolution. Genome resequencing indicated that all of the evolved chlorate-reducing strains replicated a large genomic region containing chlorate reduction genes. Contraction in copy number and loss of the ability to reduce chlorate were also observed, indicating that this phenomenon was extremely dynamic. Although most strains contained more than six copies of the replicated region, a single strain with less duplication also grew rapidly. This strain contained three additional mutations that we hypothesized compensated for the low copy number. We remade the mutations combinatorially in the unevolved strain and determined that a single nucleotide polymorphism (SNP) upstream of cld enabled growth on chlorate and was epistatic to a second base pair change in the NarP binding sequence between narQP and nrfA that enhanced growth. The ability of chlorate reduction composite transposons to form functional metabolisms after transfer to a new host is an important part of their propagation. To study this phenomenon, we engineered Shewanella oneidensis MR-1 into a chlorate reducer. We defined a set of

Evolution of Cell Size Homeostasis and Growth Rate Diversity during Initial Surface Colonization of Shewanella oneidensis.

PubMed

Lee, Calvin K; Kim, Alexander J; Santos, Giancarlo S; Lai, Peter Y; Lee, Stella Y; Qiao, David F; Anda, Jaime De; Young, Thomas D; Chen, Yujie; Rowe, Annette R; Nealson, Kenneth H; Weiss, Paul S; Wong, Gerard C L

2016-09-06

Cell size control and homeostasis are fundamental features of bacterial metabolism. Recent work suggests that cells add a constant size between birth and division ("adder" model). However, it is not known how cell size homeostasis is influenced by the existence of heterogeneous microenvironments, such as those during biofilm formation. Shewanella oneidensis MR-1 can use diverse energy sources on a range of surfaces via extracellular electron transport (EET), which can impact growth, metabolism, and size diversity. Here, we track bacterial surface communities at single-cell resolution to show that not only do bacterial motility appendages influence the transition from two- to three-dimensional biofilm growth and control postdivisional cell fates, they strongly impact cell size homeostasis. For every generation, we find that the average growth rate for cells that stay on the surface and continue to divide (nondetaching population) and that for cells that detach before their next division (detaching population) are roughly constant. However, the growth rate distribution is narrow for the nondetaching population, but broad for the detaching population in each generation. Interestingly, the appendage deletion mutants (ΔpilA, ΔmshA-D, Δflg) have significantly broader growth rate distributions than that of the wild type for both detaching and nondetaching populations, which suggests that Shewanella appendages are important for sensing and integrating environmental inputs that contribute to size homeostasis. Moreover, our results suggest multiplexing of appendages for sensing and motility functions contributes to cell size dysregulation. These results can potentially provide a framework for generating metabolic diversity in S. oneidensis populations to optimize EET in heterogeneous environments.

The Role of 4-Hydroxyphenylpyruvate Dioxygenase in Enhancement of Solid-Phase Electron Transfer by Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Turick, Charles E.; Beliaev, Alex S.; Zakrajsek, Brian A.

2009-05-01

ABSTRACT - While mechanistic details of dissimilatory metal reduction are far from being understood, it is postulated that the electron transfer to solid metal oxides is mediated by outer membrane associated c-type cytochromes and electron shuttling compounds. This study focuses on the production of homogensitate in Shewanella oneidensis MR-1, an intermediate of the tyrosine degradation pathway, which is a precursor of a redox cycling metabolite, pyomelanin. We determined that two enzymes involved in this pathway, 4-hydroxyphenylpyruvate dioxygenase (4HPPD) and homogentisate 1,2-dioxygenase are responsible for homogentisate production and oxidation, respectively. Inhibition of 4-HPPD activity with the specific inhibitor sulcotrione ([2-(2- chloro-more » 4- methane sulfonylbenzoyl)-1,3-cyclohexanedione), and deletion of melA, a gene encoding 4-HPPD, resulted in no pyomelanin production by S. oneidensis MR-1. Conversely, deletion of hmgA, which encodes the putative homogentisate 1,2-dioxygenase, resulted in pyomelanin overproduction. The efficiency and rates at which MR-1 reduces hydrous ferric oxide were directly linked to the ability of mutant strains to produce pyomelanin. Electrochemical studies with whole cells demonstrated that pyomelanin substantially increases the formal potential (E°') of S. oneidensis MR-1. Based on our findings, environmental production of pyomelanin likely contributes to an increased solid-phase metal reduction capacity in S. oneidensis MR-1.« less

Identifying the role of cytochromes upon the attachment, growth and detachment of Shewanella oneidensis MR-1 on hematite during dissimilatory iron reduction under natural- flow conditions

NASA Astrophysics Data System (ADS)

Mitchell, A. C.; Geesey, G. G.

2006-12-01

Current understanding of bacterial respiration by dissimilatory iron (Fe) reduction is based primarily on studies of closed systems using soluble Fe(III). However, natural environments likely to support Fe reduction are typically open systems and contain Fe(III) primarily in the form of crystalline (hydr)oxides. Mechanisms by which electrons are transported between bacteria and mineral terminal electron acceptors (TEAs) under open system conditions are still poorly understood. However, a number of cytochromes have been identified as potentially playing a critical role in the electron transport system of some Fe reducing bacteria. Experiments were performed using (i) omcA, (ii) mtrC, or (iii) omcA and mtrC cytochrome deficient mutants of the Fe-reducing bacteria, Shewanella oneidensis MR-1, in transparent-window flow- reactors containing hematite as the only TEA. These were operated under defined hydrodynamic and anaerobic conditions. Cells expressed green fluorescent protein (gfp), allowing real time measurement of cells at the mineral surface by epifluorescence microscopy. Cytochromes which play a critical role in the anaerobic growth of S. Oneidensis by Fe reduction under open system natural-flow conditions could then be identified. Differences in the accumulation, maximum density, detachment and total production of surface-associated cells growing on hematite surfaces were apparent between the mutants, and between the mutants and the wild-type. Mutants deficient in cytochromes grew to a lower max density by up to 2 orders of magnitude than the wild-type, and exhibited no reduced Fe in the reactor effluent or at the surface of the hematite at the conclusion of the experiment, as revealed by X-Ray photoelectron spectroscopy (XPS). Therefore omcA and / or mtrC cytochromes appear critical for electron shuttling and anaerobic growth of S. Oneidensis on hematite under natural-flow conditions.

Disruption of Putrescine Biosynthesis in Shewanella oneidensis Enhances Biofilm Cohesiveness and Performance in Cr(VI) Immobilization

PubMed Central

Ding, Yuanzhao; Peng, Ni; Du, Yonghua; Ji, Lianghui

2014-01-01

Although biofilm-based bioprocesses have been increasingly used in various applications, the long-term robust and efficient biofilm performance remains one of the main bottlenecks. In this study, we demonstrated that biofilm cohesiveness and performance of Shewanella oneidensis can be enhanced through disrupting putrescine biosynthesis. Through random transposon mutagenesis library screening, one hyperadherent mutant strain, CP2-1-S1, exhibiting an enhanced capability in biofilm formation, was obtained. Comparative analysis of the performance of biofilms formed by S. oneidensis MR-1 wild type (WT) and CP2-1-S1 in removing dichromate (Cr2O72−), i.e., Cr(VI), from the aqueous phase showed that, compared with the WT biofilms, CP2-1-S1 biofilms displayed a substantially lower rate of cell detachment upon exposure to Cr(VI), suggesting a higher cohesiveness of the mutant biofilms. In addition, the amount of Cr(III) immobilized by CP2-1-S1 biofilms was much larger, indicating an enhanced performance in Cr(VI) bioremediation. We further showed that speF, a putrescine biosynthesis gene, was disrupted in CP2-1-S1 and that the biofilm phenotypes could be restored by both genetic and chemical complementations. Our results also demonstrated an important role of putrescine in mediating matrix disassembly in S. oneidensis biofilms. PMID:24362428

Surface display of roGFP for monitoring redox status of extracellular microenvironments in Shewanella oneidensis biofilms.

PubMed

Sivakumar, Krishnakumar; Mukherjee, Manisha; Cheng, Hsin-I; Zhang, Yingdan; Ji, Lianghui; Cao, Bin

2015-03-01

Biofilms are the most ubiquitous and resilient form of microbial life on earth. One most important feature of a biofilm is the presence of a self-produced matrix, which creates highly heterogeneous and dynamic microenvironments within biofilms. Redox status in biofilm microenvironments plays a critical role in biofilm development and function. However, there is a lack of non-intrusive tools to quantify extracellular redox status of microenvironments within a biofilm matrix. In this study, using Shewanella oneidensis as a model organism, we demonstrated a novel approach to monitor extracellular redox status in biofilm microenvironments. Specifically, we displayed a redox sensitive fluorescence protein roGFP onto the cell surface of S. oneidensis by fusing it to the C-terminus of BpfA, a large surface protein, and used the surface displayed roGFP as a sensor to quantify the extracellular redox status in the matrix of S. oneidensis biofilms. The fusion of roGFP into BpfA has no negative impacts on cell growth and biofilm formation. Upon exposure to oxidizing agents such as H2 O2 , Ag(+) , and SeO3 (2-) , S. oneidensis BpfA-roGFP cells exhibited a characteristic fluorescence of roGFP. Proteinase treatment assay and super-resolution structured illumination microscopy confirmed the surface localization of BpfA-roGFP. We further used the surface displayed roGFP monitored the extracellular redox status in the matrix at different depths of a biofilm exposed to H2 O2 . This study provides a novel approach to non-invasively monitor extracellular redox status in microenvironments within biofilms, which can be used to understand redox responses of biofilms to environmental perturbations. © 2014 Wiley Periodicals, Inc.

Effect of electrode sub-micron surface feature size on current generation of Shewanella oneidensis in microbial fuel cells

NASA Astrophysics Data System (ADS)

Ye, Zhou; Ellis, Michael W.; Nain, Amrinder S.; Behkam, Bahareh

2017-04-01

Microbial fuel cells (MFCs) are envisioned to serve as compact and sustainable sources of energy; however, low current and power density have hindered their widespread use. Introduction of 3D micro/nanostructures on the MFC anode is known to improve its performance by increasing the surface area available for bacteria attachment; however, the role of the feature size remains poorly understood. To delineate the role of feature size from the ensuing surface area increase, nanostructures with feature heights of 115 nm and 300 nm, both at a height to width aspect ratio of 0.3, are fabricated in a grid pattern on glassy carbon electrodes (GCEs). Areal current densities and bacteria attachment densities of the patterned and unpatterned GCEs are compared using Shewanella oneidensis Δbfe in a three-electrode bioreactor. The 115 nm features elicit a remarkable 40% increase in current density and a 78% increase in bacterial attachment density, whereas the GCE with 300 nm pattern does not exhibit significant change in current density or bacterial attachment density. The current density dependency on feature size is maintained over the entire 160 h experiment. Thus, optimally sized surface features have a substantial effect on current production that is independent of their effect on surface area.

Water Dynamics in Shewanella oneidensis at Ambient and High Pressure using Quasi-Elastic Neutron Scattering

NASA Astrophysics Data System (ADS)

Foglia, Fabrizia; Hazael, Rachael; Simeoni, Giovanna G.; Appavou, Marie-Sousai; Moulin, Martine; Haertlein, Michael; Trevor Forsyth, V.; Seydel, Tilo; Daniel, Isabelle; Meersman, Filip; McMillan, Paul F.

2016-01-01

Quasielastic neutron scattering (QENS) is an ideal technique for studying water transport and relaxation dynamics at pico- to nanosecond timescales and at length scales relevant to cellular dimensions. Studies of high pressure dynamic effects in live organisms are needed to understand Earth’s deep biosphere and biotechnology applications. Here we applied QENS to study water transport in Shewanella oneidensis at ambient (0.1 MPa) and high (200 MPa) pressure using H/D isotopic contrast experiments for normal and perdeuterated bacteria and buffer solutions to distinguish intracellular and transmembrane processes. The results indicate that intracellular water dynamics are comparable with bulk diffusion rates in aqueous fluids at ambient conditions but a significant reduction occurs in high pressure mobility. We interpret this as due to enhanced interactions with macromolecules in the nanoconfined environment. Overall diffusion rates across the cell envelope also occur at similar rates but unexpected narrowing of the QENS signal appears between momentum transfer values Q = 0.7-1.1 Å-1 corresponding to real space dimensions of 6-9 Å. The relaxation time increase can be explained by correlated dynamics of molecules passing through Aquaporin water transport complexes located within the inner or outer membrane structures.

High-and low-affinity binding sites for Cd on the bacterial cell walls of Bacillus subtilis and Shewanella oneidensis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, B.; Boyanov, M.; Bunker, B. A.

2010-08-01

Bulk Cd adsorption isotherm experiments, thermodynamic equilibrium modeling, and Cd K edge EXAFS were used to constrain the mechanisms of proton and Cd adsorption to bacterial cells of the commonly occurring Gram-positive and Gram-negative bacteria, Bacillus subtilis and Shewanella oneidensis, respectively. Potentiometric titrations were used to characterize the functional group reactivity of the S. oneidensis cells, and we model the titration data using the same type of non-electrostatic surface complexation approach as was applied to titrations of B. subtilis suspensions by Fein et al. (2005). Similar to the results for B. subtilis, the S. oneidensis cells exhibit buffering behavior frommore » approximately pH 3-9 that requires the presence of four distinct sites, with pK{sub a} values of 3.3 {+-} 0.2, 4.8 {+-} 0.2, 6.7 {+-} 0.4, and 9.4 {+-} 0.5, and site concentrations of 8.9({+-}2.6) x 10{sup -5}, 1.3({+-}0.2) x 10{sup -4}, 5.9({+-}3.3) x 10{sup -5}, and 1.1({+-}0.6) x 10{sup -4} moles/g bacteria (wet mass), respectively. The bulk Cd isotherm adsorption data for both species, conducted at pH 5.9 as a function of Cd concentration at a fixed biomass concentration, were best modeled by reactions with a Cd:site stoichiometry of 1:1. EXAFS data were collected for both bacterial species as a function of Cd concentration at pH 5.9 and 10 g/L bacteria. The EXAFS results show that the same types of binding sites are responsible for Cd sorption to both bacterial species at all Cd loadings tested (1-200 ppm). Carboxyl sites are responsible for the binding at intermediate Cd loadings. Phosphoryl ligands are more important than carboxyl ligands for Cd binding at high Cd loadings. For the lowest Cd loadings studied here, a sulfhydryl site was found to dominate the bound Cd budgets for both species, in addition to the carboxyl and phosphoryl sites that dominate the higher loadings. The EXAFS results suggest that both Gram-positive and Gram-negative bacterial cell walls

A method adapting microarray technology for signature tagged mutagenesis of Dusulfovibrio dusulfuricans G20 and Shewanella oneidensis MR-1 in anaerobic sediment survival experiments

USGS Publications Warehouse

Groh, Jennifer L.; Luo, Qingwei; Ballard , Jimmy D.; Krumholz, Lee R.

2005-01-01

Signature-tagged mutagenesis (STM) is a powerful technique that can be used to identify genes expressed by bacteria during exposure to conditions in their natural environments. To date, there have been no reports of studies in which this approach was used to study organisms of environmental, rather than pathogenic, significance. We used a mini-Tn10 transposon-bearing plasmid, pBSL180, that efficiently and randomly mutagenized Desulfovibrio desulfuricans G20 in addition to Shewanella oneidensis MR-1. Using these organisms as model sediment-dwelling anaerobic bacteria, we developed a new screening system, modified from former STM procedures, to identify genes that are critical for sediment survival. The screening system uses microarray technology to visualize tags from input and output pools, allowing us to identify those lost during sediment incubations. While the majority of data on survival genes identified will be presented in future papers, we report here on chemotaxis-related genes identified by our STM method in both bacteria in order to validate our method. This system may be applicable to the study of numerous environmental bacteria, allowing us to identify functions and roles of survival genes in various habitats.

Laue Crystal Structure of Shewanella oneidensis Cytochrome c Nitrite Reductase from a High-yield Expression System

PubMed Central

Youngblut, Matthew; Judd, Evan T.; Srajer, Vukica; Sayyed, Bilal; Goelzer, Tyler; Elliott, Sean J.; Schmidt, Marius; Pacheco, A. Andrew

2012-01-01

The high-yield expression and purification of Shewanella oneidensis cytochrome c nitrite reductase (ccNiR), and its characterization by a variety of methods, notably Laue crystallography, is reported. A key component of the expression system is an artificial ccNiR gene in which the N-terminal signal peptide from the highly expressed S. oneidensis protein “Small Tetra-heme c” replaces the wild-type signal peptide. This gene, inserted into the plasmid pHSG298 and expressed in S. oneidensis TSP-1 strain, generated ~20 mg crude ccNiR/L culture, compared with 0.5–1 mg/L for untransformed cells. Purified ccNiR has nitrite and hydroxylamine reductase activities comparable to those previously reported for E. coli ccNiR, and is stable for over two weeks in pH 7 solution at 4° C. UV/Vis spectropotentiometric titrations and protein film voltammetry identified 5 independent 1-electron reduction processes. Global analysis of the spectropotentiometric data also allowed determination of the extinction coefficient spectra for the 5 reduced ccNiR species. The characteristics of the individual extinction coefficient spectra suggest that, within each reduced species, the electrons are distributed amongst the various hemes, rather than being localized on specific heme centers. The purified ccNiR yielded good quality crystals, with which the 2.59 Å resolution structure was solved at room temperature using the Laue diffraction method. The structure is similar to that of E. coli ccNiR, except in the region where the enzyme interacts with its physiological electron donor (CymA in the case of S. oneidensis ccNiR, NrfB in the case of the E. coli protein). PMID:22382353

Growth Trade-Offs Accompany the Emergence of Glycolytic Metabolism in Shewanella oneidensis MR-1

DOE PAGES

Chubiz, Lon M.; Marx, Christopher J.

2017-03-13

Bacteria increase their metabolic capacity via the acquisition of genetic material or by the mutation of genes already present in the genome. Here, we explore the mechanisms and trade-offs involved whenShewanella oneidensis, a bacterium that typically consumes small organic and amino acids, rapidly evolves to expand its metabolic capacity to catabolize glucose after a short period of adaptation to a glucose-rich environment. Using whole-genome sequencing and genetic approaches, we discovered that deletions in a region including the transcriptional repressor (nagR) that regulates the expression of genes associated with catabolism ofN-acetylglucosamine are the common basis for evolved glucose metabolism across populations.more » The loss ofnagRresults in the constitutive expression of genes for anN-acetylglucosamine permease (nagP) and kinase (nagK). We demonstrate that promiscuous activities of both NagP and NagK toward glucose allow for the transport and phosphorylation of glucose to glucose-6-phosphate, the initial events of glycolysis otherwise thought to be absent inS. oneidensis. 13C-based metabolic flux analysis uncovered that subsequent utilization was mediated by the Entner-Doudoroff pathway. This is an example whereby gene loss and preexisting enzymatic promiscuity, and not gain-of-function mutations, were the drivers of increased metabolic capacity. However, we observed a significant decrease in the growth rate on lactate after adaptation to glucose catabolism, suggesting that trade-offs may explain why glycolytic function may not be readily observed inS. oneidensisin natural environments despite it being readily accessible through just a single mutational event.Gains in metabolic capacity are frequently associated with the acquisition of novel genetic material via natural or engineered horizontal gene transfer events. Here, we explored how a bacterium that typically consumes small organic acids and amino acids expands its metabolic capacity to include

Growth Trade-Offs Accompany the Emergence of Glycolytic Metabolism in Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chubiz, Lon M.; Marx, Christopher J.

Bacteria increase their metabolic capacity via the acquisition of genetic material or by the mutation of genes already present in the genome. Here, we explore the mechanisms and trade-offs involved whenShewanella oneidensis, a bacterium that typically consumes small organic and amino acids, rapidly evolves to expand its metabolic capacity to catabolize glucose after a short period of adaptation to a glucose-rich environment. Using whole-genome sequencing and genetic approaches, we discovered that deletions in a region including the transcriptional repressor (nagR) that regulates the expression of genes associated with catabolism ofN-acetylglucosamine are the common basis for evolved glucose metabolism across populations.more » The loss ofnagRresults in the constitutive expression of genes for anN-acetylglucosamine permease (nagP) and kinase (nagK). We demonstrate that promiscuous activities of both NagP and NagK toward glucose allow for the transport and phosphorylation of glucose to glucose-6-phosphate, the initial events of glycolysis otherwise thought to be absent inS. oneidensis. 13C-based metabolic flux analysis uncovered that subsequent utilization was mediated by the Entner-Doudoroff pathway. This is an example whereby gene loss and preexisting enzymatic promiscuity, and not gain-of-function mutations, were the drivers of increased metabolic capacity. However, we observed a significant decrease in the growth rate on lactate after adaptation to glucose catabolism, suggesting that trade-offs may explain why glycolytic function may not be readily observed inS. oneidensisin natural environments despite it being readily accessible through just a single mutational event.Gains in metabolic capacity are frequently associated with the acquisition of novel genetic material via natural or engineered horizontal gene transfer events. Here, we explored how a bacterium that typically consumes small organic acids and amino acids expands its metabolic capacity to include

Role of outer membrane c-type cytochromes MtrC and OmcA in Shewanella oneidensis MR-1 cell production, accumulation and detachment during respiration on hematite

USDA-ARS?s Scientific Manuscript database

The iron-reducing bacterium Shewanella oneidensis MR-1 has the capacity to contribute to iron cycling over the long term by respiring on crystalline iron oxides such as hematite when poorly crystalline phases are depleted. The ability of outer membrane cytochromes OmcA and MtrC of MR-1 to bind to an...

High power density from a miniature microbial fuel cell using Shewanella oneidensis DSP10.

PubMed

Ringeisen, Bradley R; Henderson, Emily; Wu, Peter K; Pietron, Jeremy; Ray, Ricky; Little, Brenda; Biffinger, Justin C; Jones-Meehan, Joanne M

2006-04-15

A miniature microbial fuel cell (mini-MFC) is described that demonstrates high output power per device cross-section (2.0 cm2) and volume (1.2 cm3). Shewanella oneidensis DSP10 in growth medium with lactate and buffered ferricyanide solutions were used as the anolyte and catholyte, respectively. Maximum power densities of 24 and 10 mW/m2 were measured using the true surface areas of reticulated vitreous carbon (RVC) and graphite felt (GF) electrodes without the addition of exogenous mediators in the anolyte. Current densities at maximum power were measured as 44 and 20 mA/m2 for RVC and GF, while short circuit current densities reached 32 mA/m2 for GF anodes and 100 mA/m2 for RVC. When the power density for GF was calculated using the cross sectional area of the device or the volume of the anode chamber, we found values (3 W/m2, 500 W/m3) similar to the maxima reported in the literature. The addition of electron mediators resulted in current and power increases of 30-100%. These power densities were surprisingly high considering a pure S. oneidensis culture was used. We found that the short diffusion lengths and high surface-area-to-chamber volume ratio utilized in the mini-MFC enhanced power density when compared to output from similar macroscopic MFCs.

Shewanella oneidensis MR-1 chemotaxis proteins and electron-transport chain components essential for congregation near insoluble electron acceptors.

PubMed

Harris, H Wayne; El-Naggar, Mohamed Y; Nealson, Kenneth H

2012-12-01

Shewanella oneidensis MR-1 cells utilize a behaviour response called electrokinesis to increase their speed in the vicinity of IEAs (insoluble electron acceptors), including manganese oxides, iron oxides and poised electrodes [Harris, El-Naggar, Bretschger, Ward, Romine, Obraztsova and Nealson (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 326-331]. However, it is not currently understood how bacteria remain in the vicinity of the IEA and accumulate both on the surface and in the surrounding medium. In the present paper, we provide results indicating that cells that have contacted the IEAs swim faster than those that have not recently made contact. In addition, fast-swimming cells exhibit an enhancement of swimming reversals leading to rapid non-random accumulation of cells on, and adjacent to, mineral particles. We call the observed accumulation near IEAs 'congregation'. Congregation is eliminated by the loss of a critical gene involved with EET (extracellular electron transport) (cymA, SO_4591) and is altered or eliminated in several deletion mutants of homologues of genes that are involved with chemotaxis or energy taxis in Escherichia coli. These genes include chemotactic signal transduction protein (cheA-3, SO_3207), methyl-accepting chemotaxis proteins with the Cache domain (mcp_cache, SO_2240) or the PAS (Per/Arnt/Sim) domain (mcp_pas, SO_1385). In the present paper, we report studies of S. oneidensis MR-1 that lend some insight into how microbes in this group can 'sense' the presence of a solid substrate such as a mineral surface, and maintain themselves in the vicinity of the mineral (i.e. via congregation), which may ultimately lead to attachment and biofilm formation.

A Biochemical Approach to Study the Role of the Terminal Oxidases in Aerobic Respiration in Shewanella oneidensis MR-1

PubMed Central

Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

2014-01-01

The genome of the facultative anaerobic γ-proteobacterium Shewanella oneidensis MR-1 encodes for three terminal oxidases: a bd-type quinol oxidase and two heme-copper oxidases, a A-type cytochrome c oxidase and a cbb 3-type oxidase. In this study, we used a biochemical approach and directly measured oxidase activities coupled to mass-spectrometry analysis to investigate the physiological role of the three terminal oxidases under aerobic and microaerobic conditions. Our data revealed that the cbb 3-type oxidase is the major terminal oxidase under aerobic conditions while both cbb 3-type and bd-type oxidases are involved in respiration at low-O2 tensions. On the contrary, the low O2-affinity A-type cytochrome c oxidase was not detected in our experimental conditions even under aerobic conditions and would therefore not be required for aerobic respiration in S. oneidensis MR-1. In addition, the deduced amino acid sequence suggests that the A-type cytochrome c oxidase is a ccaa 3-type oxidase since an uncommon extra-C terminal domain contains two c-type heme binding motifs. The particularity of the aerobic respiratory pathway and the physiological implication of the presence of a ccaa 3-type oxidase in S. oneidensis MR-1 are discussed. PMID:24466040

An extracytoplasmic function sigma factor-dependent periplasmic glutathione peroxidase is involved in oxidative stress response of Shewanella oneidensis

DOE PAGES

Dai, Jingcheng; Wei, Hehong; Tian, Chunyuan; ...

2015-01-01

Background: Bacteria use alternative sigma factors (σs) to regulate condition-specific gene expression for survival and Shewanella harbors multiple ECF (extracytoplasmic function) σ genes and cognate anti-sigma factor genes. Here we comparatively analyzed two of the rpoE-like operons in the strain MR-1: rpoE-rseA-rseB-rseC and rpoE2-chrR. Results: RpoE was important for bacterial growth at low and high temperatures, in the minimal medium, and high salinity. The degP/htrA orthologue, required for growth of Escherichia coli and Pseudomonas aeruginosa at high temperature, is absent in Shewanella, while the degQ gene is RpoE-regulated and is required for bacterial growth at high temperature. RpoE2 was essentialmore » for the optimal growth in oxidative stress conditions because the rpoE2 mutant was sensitive to hydrogen peroxide and paraquat. The operon encoding a ferrochelatase paralogue (HemH2) and a periplasmic glutathione peroxidase (PgpD) was identified as RpoE2-dependent. PgpD exhibited higher activities and played a more important role in the oxidative stress responses than the cytoplasmic glutathione peroxidase CgpD under tested conditions. The rpoE2-chrR operon and the identified regulon genes, including pgpD and hemH2, are coincidently absent in several psychrophilic and/or deep-sea Shewanella strains. Conclusion: In S. oneidensis MR-1, the RpoE-dependent degQ gene is required for optimal growth under high temperature. The rpoE2 and RpoE2-dependent pgpD gene encoding a periplasmic glutathione peroxidase are involved in oxidative stress responses. But rpoE2 is not required for bacterial growth at low temperature and it even affected bacterial growth under salt stress, indicating that there is a tradeoff between the salt resistance and RpoE2-mediated oxidative stress responses.« less

An extracytoplasmic function sigma factor-dependent periplasmic glutathione peroxidase is involved in oxidative stress response of Shewanella oneidensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Jingcheng; Wei, Hehong; Tian, Chunyuan

Background: Bacteria use alternative sigma factors (σs) to regulate condition-specific gene expression for survival and Shewanella harbors multiple ECF (extracytoplasmic function) σ genes and cognate anti-sigma factor genes. Here we comparatively analyzed two of the rpoE-like operons in the strain MR-1: rpoE-rseA-rseB-rseC and rpoE2-chrR. Results: RpoE was important for bacterial growth at low and high temperatures, in the minimal medium, and high salinity. The degP/htrA orthologue, required for growth of Escherichia coli and Pseudomonas aeruginosa at high temperature, is absent in Shewanella, while the degQ gene is RpoE-regulated and is required for bacterial growth at high temperature. RpoE2 was essentialmore » for the optimal growth in oxidative stress conditions because the rpoE2 mutant was sensitive to hydrogen peroxide and paraquat. The operon encoding a ferrochelatase paralogue (HemH2) and a periplasmic glutathione peroxidase (PgpD) was identified as RpoE2-dependent. PgpD exhibited higher activities and played a more important role in the oxidative stress responses than the cytoplasmic glutathione peroxidase CgpD under tested conditions. The rpoE2-chrR operon and the identified regulon genes, including pgpD and hemH2, are coincidently absent in several psychrophilic and/or deep-sea Shewanella strains. Conclusion: In S. oneidensis MR-1, the RpoE-dependent degQ gene is required for optimal growth under high temperature. The rpoE2 and RpoE2-dependent pgpD gene encoding a periplasmic glutathione peroxidase are involved in oxidative stress responses. But rpoE2 is not required for bacterial growth at low temperature and it even affected bacterial growth under salt stress, indicating that there is a tradeoff between the salt resistance and RpoE2-mediated oxidative stress responses.« less

The surface properties of Shewanella putrefaciens 200 and S. oneidensis MR-1: the effect of pH and terminal electron acceptors.

PubMed

Furukawa, Yoko; Dale, Jason R

2013-04-08

We investigated the surface characteristics of two strains of Shewanella sp., S. oneidensis MR-1 and S. putrefaciens 200, that were grown under aerobic conditions as well as under anaerobic conditions with trimethylamine oxide (TMAO) as the electron acceptor. The investigation focused on the experimental determination of electrophoretic mobility (EPM) under a range of pH and ionic strength, as well as by subsequent modeling in which Shewanella cells were considered to be soft particles with water- and ion-permeable outermost layers. The soft layer of p200 is significantly more highly charged (i.e., more negative) than that of MR-1. The effect of electron acceptor on the soft particle characteristics of Shewanella sp. is complex. The fixed charge density, which is a measure of the deionized and deprotonated functional groups in the soft layer polymers, is slightly greater (i.e., more negative) for aerobically grown p200 than for p200 grown with TMAO. On the other hand, the fixed charge density of aerobically grown MR1 is slightly less than that of p200 grown with TMAO. The effect of pH on the soft particle characteristics is also complex, and does not exhibit a clear pH-dependent trend. The Shewanella surface characteristics were attributed to the nature of the outermost soft layer, the extracellular polymeric substances (EPS) in case of p200 and lypopolysaccharides (LPS) in case of MR1 which generally lacks EPS. The growth conditions (i.e., aerobic vs. anaerobic TMAO) have an influence on the soft layer characteristics of Shewanella sp. cells. Meanwhile, the clear pH dependency of the mechanical and morphological characteristics of EPS and LPS layers, observed in previous studies through atomic force microscopy, adhesion tests and spectroscopies, cannot be corroborated by the electrohydrodynamics-based soft particle characteristics which does not exhibited a clear pH dependency in this study. While the electrohydrodynamics-based soft-particle model is a useful tool

Multi-heme Cytochromes in Shewanella oneidensis MR-1: Structures, functions and opportunities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen

Multi-heme cytochromes are employed by a range of microorganisms to transport electrons over distances of up to tens of nanometers. Perhaps the most spectacular utilization of these proteins is in the reduction of extracellular solid substrates, including electrodes and insoluble mineral oxides of Fe(III) and Mn(III/IV), by species of Shewanella and Geobacter. However, multi-heme cytochromes are found in numerous and phylogenetically diverse prokaryotes where they participate in electron transfer and redox catalysis that contributes to biogeochemical cycling of N, S and Fe on the global scale. These properties of multi-heme cytochromes have attracted much interest and contributed to advances inmore » bioenergy applications and bioremediation of contaminated soils. Looking forward there are opportunities to engage multi-heme cytochromes for biological photovoltaic cells, microbial electrosynthesis and developing bespoke molecular devices. As a consequence it is timely to review our present understanding of these proteins and we do this here with a focus on the multitude of functionally diverse multi-heme cytochromes in Shewanella oneidensis MR-1. We draw on findings from experimental and computational approaches which ideally complement each other in the study of these systems: computational methods can interpret experimentally determined properties in terms of molecular structure to cast light on the relation between structure and function. We show how this synergy has contributed to our understanding of multi-heme cytochromes and can be expected to continue to do so for greater insight into natural processes and their informed exploitation in biotechnologies.« less

Multi-haem cytochromes in Shewanella oneidensis MR-1: structures, functions and opportunities

PubMed Central

Breuer, Marian; Rosso, Kevin M.; Blumberger, Jochen; Butt, Julea N.

2015-01-01

Multi-haem cytochromes are employed by a range of microorganisms to transport electrons over distances of up to tens of nanometres. Perhaps the most spectacular utilization of these proteins is in the reduction of extracellular solid substrates, including electrodes and insoluble mineral oxides of Fe(III) and Mn(III/IV), by species of Shewanella and Geobacter. However, multi-haem cytochromes are found in numerous and phylogenetically diverse prokaryotes where they participate in electron transfer and redox catalysis that contributes to biogeochemical cycling of N, S and Fe on the global scale. These properties of multi-haem cytochromes have attracted much interest and contributed to advances in bioenergy applications and bioremediation of contaminated soils. Looking forward, there are opportunities to engage multi-haem cytochromes for biological photovoltaic cells, microbial electrosynthesis and developing bespoke molecular devices. As a consequence, it is timely to review our present understanding of these proteins and we do this here with a focus on the multitude of functionally diverse multi-haem cytochromes in Shewanella oneidensis MR-1. We draw on findings from experimental and computational approaches which ideally complement each other in the study of these systems: computational methods can interpret experimentally determined properties in terms of molecular structure to cast light on the relation between structure and function. We show how this synergy has contributed to our understanding of multi-haem cytochromes and can be expected to continue to do so for greater insight into natural processes and their informed exploitation in biotechnologies. PMID:25411412

Synthetic and Evolutionary Construction of a Chlorate-Reducing Shewanella oneidensis MR-1

PubMed Central

Clark, Iain C.; Melnyk, Ryan A.; Youngblut, Matthew D.; Carlson, Hans K.; Iavarone, Anthony T.

2015-01-01

ABSTRACT Despite evidence for the prevalence of horizontal gene transfer of respiratory genes, little is known about how pathways functionally integrate within new hosts. One example of a mobile respiratory metabolism is bacterial chlorate reduction, which is frequently encoded on composite transposons. This implies that the essential components of the metabolism are encoded on these mobile elements. To test this, we heterologously expressed genes for chlorate reduction from Shewanella algae ACDC in the non-chlorate-reducing Shewanella oneidensis MR-1. The construct that ultimately endowed robust growth on chlorate included cld, a cytochrome c gene, clrABDC, and two genes of unknown function. Although strain MR-1 was unable to grow on chlorate after initial insertion of these genes into the chromosome, 11 derived strains capable of chlorate respiration were obtained through adaptive evolution. Genome resequencing indicated that all of the evolved chlorate-reducing strains replicated a large genomic region containing chlorate reduction genes. Contraction in copy number and loss of the ability to reduce chlorate were also observed, indicating that this phenomenon was extremely dynamic. Although most strains contained more than six copies of the replicated region, a single strain with less duplication also grew rapidly. This strain contained three additional mutations that we hypothesized compensated for the low copy number. We remade the mutations combinatorially in the unevolved strain and determined that a single nucleotide polymorphism (SNP) upstream of cld enabled growth on chlorate and was epistatic to a second base pair change in the NarP binding sequence between narQP and nrfA that enhanced growth. PMID:25991681

Promoted reduction of tellurite and formation of extracellular tellurium nanorods by concerted reaction between iron and Shewanella oneidensis MR-1.

PubMed

Kim, Dong-Hun; Kim, Min-Gyu; Jiang, Shenghua; Lee, Ji-Hoon; Hur, Hor-Gil

2013-08-06

The reduction of tellurite (Te(IV)) by dissimilatory metal reducing bacterium, Shewanella oneidensis MR-1, was promoted in the presence of Fe(III) in comparison with Te(IV) bioreduction in the absence of Fe(III). Electron microscopic analyses revealed that iron promoted Te(IV) reduction led to form exclusively extracellular crystalline Te(0) nanorods, as compared to the mostly intracellular formation of Te(0) nanorods in the absence of Fe(III). The Te K-edge X-ray absorption spectrometric analyses demonstrated that S. oneidensis MR-1 in the presence of Fe(III) reduced Te(IV) to less harmful metallic Te(0) nanorods through the precipitation of tellurite (Te(IV)Ox) complex by the bacterial respiration of Fe(III) to Fe(II) under anaerobic conditions. However, Fe(II) ion itself was only able to precipitate the solid tellurite (Te(IV)Ox) complex from the Te(IV) solution, which was not further reduced to Te(0). The results clearly indicated that bacterial S. oneidensis MR-1 plays important roles in the reduction and crystallization of Te(0) nanorods by as yet undetermined biochemical mechanisms. As compared to the slow bacterial Te(IV) reduction in the absence of Fe(III), the rapid reduction of Te(IV) to Te(0) by the concerted biogeochemical reaction between Fe(II) and S. oneidensis MR-1 could be applied for the sequestration and detoxification of Te(IV) in the environments as well as for the preparation of extracellular Te(0) nanorod structures.

Starch-fueled microbial fuel cells by two-step and parallel fermentation using Shewanella oneidensis MR-1 and Streptococcus bovis 148.

PubMed

Uno, Megumi; Phansroy, Nichanan; Aso, Yuji; Ohara, Hitomi

2017-08-01

Shewanella oneidensis MR-1 generates electricity from lactic acid, but cannot utilize starch. On the other hand, Streptococcus bovis 148 metabolizes starch and produces lactic acid. Therefore, two methods were trialed for starch-fueled microbial fuel cell (MFC) in this study. In electric generation by two-step fermentation (EGT) method, starch was first converted to lactic acid by S. bovis 148. The S. bovis 148 were then removed by centrifugation, and the fermented broth was preserved for electricity generation by S. oneidensis MR-1. Another method was electric generation by parallel fermentation (EGP) method. In this method, the cultivation and subsequent fermentation processes of S. bovis 148 and S. oneidensis MR-1 were performed simultaneously. After 1, 2, and 3 terms (5-day intervals) of S. oneidensis MR-1 in the EGT fermented broth of S. bovis 148, the maximum currents at each term were 1.8, 2.4, and 2.8 mA, and the maximum current densities at each term were 41.0, 43.6, and 49.9 mW/m 2 , respectively. In the EGP method, starch was also converted into lactic acid with electricity generation. The maximum current density was 140-200 mA/m 2 , and the maximum power density of this method was 12.1 mW/m 2 . Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effect of anode polarization on biofilm formation and electron transfer in Shewanella oneidensis/graphite felt microbial fuel cells.

PubMed

Pinto, David; Coradin, Thibaud; Laberty-Robert, Christel

2018-04-01

In microbial fuel cells, electricity generation is assumed by bacterial degradation of low-grade organics generating electrons that are transferred to an electrode. The nature and efficiency of the electron transfer from the bacteria to the electrodes are determined by several chemical, physical and biological parameters. Specifically, the application of a specific potential at the bioanode has been shown to stimulate the formation of an electro-active biofilm, but the underlying mechanisms remain poorly understood. In this study, we have investigated the effect of an applied potential on the formation and electroactivity of biofilms established by Shewanella oneidensis bacteria on graphite felt electrodes in single- and double-chamber reactor configurations in oxic conditions. Using amperometry, cyclic voltammetry, and OCP/Power/Polarization curves techniques, we showed that a potential ranging between -0.3V and +0.5V (vs. Ag/AgCl/KCl sat.) and its converse application to a couple of electrodes leads to different electrochemical behaviors, anodic currents and biofilm architectures. For example, when the bacteria were confined in the anodic compartment of a double-chamber cell, a negative applied potential (-0.3V) at the bioanode favors a mediated electron transfer correlated with the progressive formation of a biofilm that fills the felt porosity and bridges the graphite fibers. In contrast, a positive applied potential (+0.3V) at the bioanode stimulates a direct electron transfer resulting in the fast-bacterial colonization of the fibers only. These results provide significant insight for the understanding of the complex bacteria-electrode interactions in microbial fuel cells. Copyright © 2017 Elsevier B.V. All rights reserved.

In Situ Analysis of a Silver Nanoparticle-Precipitating Shewanella Biofilm by Surface Enhanced Confocal Raman Microscopy

PubMed Central

Schkolnik, Gal; Schmidt, Matthias; Mazza, Marco G.; Harnisch, Falk; Musat, Niculina

2015-01-01

Shewanella oneidensis MR-1 is an electroactive bacterium, capable of reducing extracellular insoluble electron acceptors, making it important for both nutrient cycling in nature and microbial electrochemical technologies, such as microbial fuel cells and microbial electrosynthesis. When allowed to anaerobically colonize an Ag/AgCl solid interface, S. oneidensis has precipitated silver nanoparticles (AgNp), thus providing the means for a surface enhanced confocal Raman microscopy (SECRaM) investigation of its biofilm. The result is the in-situ chemical mapping of the biofilm as it developed over time, where the distribution of cytochromes, reduced and oxidized flavins, polysaccharides and phosphate in the undisturbed biofilm is monitored. Utilizing AgNp bio-produced by the bacteria colonizing the Ag/AgCl interface, we could perform SECRaM while avoiding the use of a patterned or roughened support or the introduction of noble metal salts and reducing agents. This new method will allow a spatially and temporally resolved chemical investigation not only of Shewanella biofilms at an insoluble electron acceptor, but also of other noble metal nanoparticle-precipitating bacteria in laboratory cultures or in complex microbial communities in their natural habitats. PMID:26709923

Growth inhibition and stimulation of Shewanella oneidensis MR-1 by surfactants and calcium polysulfide.

PubMed

Bailey, Kathryn L; Tilton, Fred; Jansik, Danielle P; Ergas, Sarina J; Marshall, Matthew J; Miracle, Ann L; Wellman, Dawn M

2012-06-01

Foam delivery technology (FDT) uses surfactant based foam to immobilize subsurface contaminants in situ. Where traditional approaches are impractical, FDT has the potential to overcome many of the technical challenges facing the remediation of contaminated deep vadose zone environments. However, little is known about the effects these reactive chemicals may have on microorganisms inhabiting the contaminated subsurface. In addition, there are currently no standard assays to assess microbial responses to subsurface remedial treatments while these agents are under development. The objective of this study was to develop a rapid laboratory assay to assess the potential growth inhibition and/or stimulation of microorganisms following exposure to candidate FDT components. Calcium polysulfide (CPS) and several surfactants (i.e. sodium laureth sulfate (SLES), sodium dodecyl sulfate (SDS), cocamidopropyl betaine (CAPB) and NINOL40-CO) have diverse chemistries and are candidate components of FDT. Shewanella oneidensis MR-1 cultures were exposed to a range of concentrations of these chemicals to determine the minimum bactericidal concentration (MBC) and the growth and viability potential of these components. Concentrations of SDS higher than 700 μM were toxic to S. oneidensis MR-1 growth over the course of four days of exposure. The relative acute toxicity order for these compounds was SDS > CPS > NINOL 40-CO>SLES≥CAPB. Dose dependent growth decreases (20-100mM) were observed in the CAPB and SLES treated cultures and both CPS and NINOL 40-CO were toxic at all concentrations tested (1.45-7.25 mM CPS). Both SLES (20-100mM) and SDS at lower concentrations (20-500 μM) were stimulatory to S. oneidensis MR-1 indicating a capacity to be used as a carbon source. These studies also identified potentially key component characteristics, such as precipitate formation and oxygen availability, which may prove valuable in assessing the response of subsurface microorganisms. This benchtop

The role of riboflavin in decolourisation of Congo red and bioelectricity production using Shewanella oneidensis-MR1 under MFC and non-MFC conditions.

PubMed

Gomaa, Ola M; Fapetu, Segun; Kyazze, Godfrey; Keshavarz, Tajalli

2017-03-01

Dissimilatory metal reducing bacteria can exchange electrons extracellularly and hold great promise for their use in simultaneous wastewater treatment and electricity production. This study investigated the role of riboflavin, an electron carrier, in the decolourisation of Congo red in microbial fuel cells (MFCs) using Shewanella oneidensis MR-1 as a model organism. The contribution of the membrane-bound protein MtrC to the decolourisation process was also investigated. Within the range of riboflavin concentrations tested, 20 µM was found to be the best with >95% of the dye (initial concentration 200 mg/L) decolourised in MFCs within 50 h compared to 90% in the case where no riboflavin was added. The corresponding maximum power density was 45 mW/m 2 . There was no significant difference in the overall decolourisation efficiencies of Shewanela oneidensis MR-1 ΔMtrC mutants compared to the wild type. However, in terms of power production the mutant produced more power (P max 76 mW/m 2 ) compared to the wild type (P max 46 mW/m 2 ) which was attributed to higher levels of riboflavin secreted in solution. Decolourisation efficiencies in non-MFC systems (anaerobic bottles) were similar to those under MFC systems indicating that electricity generation in MFCs does not impair dye decolourisation efficiencies. The results suggest that riboflavin enhances both decolourisation of dyes and simultaneous electricity production in MFCs.

Cellular Response of Shewanella oneidensis to Strontium Stress†

PubMed Central

Brown, Steven D.; Martin, Madhavi; Deshpande, Sameer; Seal, Sudipta; Huang, Katherine; Alm, Eric; Yang, Yunfeng; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Arkin, Adam; Chourey, Karuna; Zhou, Jizhong; Thompson, Dorothea K.

2006-01-01

The physiology and transcriptome dynamics of the metal ion-reducing bacterium Shewanella oneidensis strain MR-1 in response to nonradioactive strontium (Sr) exposure were investigated. Studies indicated that MR-1 was able to grow aerobically in complex medium in the presence of 180 mM SrCl2 but showed severe growth inhibition at levels above that concentration. Temporal gene expression profiles were generated from aerobically grown, mid-exponential-phase MR-1 cells shocked with 180 mM SrCl2 and analyzed for significant differences in mRNA abundance with reference to data for nonstressed MR-1 cells. Genes with annotated functions in siderophore biosynthesis and iron transport were among the most highly induced (>100-fold [P < 0.05]) open reading frames in response to acute Sr stress, and a mutant (SO3032::pKNOCK) defective in siderophore production was found to be hypersensitive to SrCl2 exposure, compared to parental and wild-type strains. Transcripts encoding multidrug and heavy metal efflux pumps, proteins involved in osmotic adaptation, sulfate ABC transporters, and assimilative sulfur metabolism enzymes also were differentially expressed following Sr exposure but at levels that were several orders of magnitude lower than those for iron transport genes. Precipitate formation was observed during aerobic growth of MR-1 in broth cultures amended with 50, 100, or 150 mM SrCl2 but not in cultures of the SO3032::pKNOCK mutant or in the abiotic control. Chemical analysis of this precipitate using laser-induced breakdown spectroscopy and static secondary ion mass spectrometry indicated extracellular solid-phase sequestration of Sr, with at least a portion of the heavy metal associated with carbonate phases. PMID:16391131

Comparative Genomics Analysis and Phenotypic Characterization of Shewanella putrefaciens W3-18-1: Anaerobic Respiration, Bacterial Microcompartments, and Lateral Flagella

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, D.; Tu, Q.; He, Zhili

2010-05-17

Respiratory versatility and psychrophily are the hallmarks of Shewanella. The ability to utilize a wide range of electron acceptors for respiration is due to the large number of c-type cytochrome genes present in the genome of Shewanella strains. More recently the dissimilatory metal reduction of Shewanella species has been extensively and intensively studied for potential applications in the bioremediation of radioactive wastes of groundwater and subsurface environments. Multiple Shewanella genome sequences are now available in the public databases (Fredrickson et al., 2008). Most of the sequenced Shewanella strains were isolated from marine environments and this genus was believed to bemore » of marine origin (Hau and Gralnick, 2007). However, the well-characterized model strain, S. oneidensis MR-1, was isolated from the freshwater lake sediment of Lake Oneida, New York (Myers and Nealson, 1988) and similar bacteria have also been isolated from other freshwater environments (Venkateswaran et al., 1999). Here we comparatively analyzed the genome sequence and physiological characteristics of S. putrefaciens W3-18-1 and S. oneidensis MR-1, isolated from the marine and freshwater lake sediments, respectively. The anaerobic respirations, carbon source utilization, and cell motility have been experimentally investigated. Large scale horizontal gene transfers have been revealed and the genetic divergence between these two strains was considered to be critical to the bacterial adaptation to specific habitats, freshwater or marine sediments.« less

Biofabrication of morphology improved cadmium sulfide nanoparticles using Shewanella oneidensis bacterial cells and ionic liquid: For toxicity against brain cancer cell lines.

PubMed

Wang, Li; Chen, Siyuan; Ding, Yiming; Zhu, Qiang; Zhang, Nijia; Yu, Shuqing

2018-01-01

The present work determines the anticancer activity of bio-mediated synthesized cadmium sulfide nanoparticles using the ionic liquid and bacterial cells (Shewanella oneidensis). Bacterial cells have been exposed to be important resources that hold huge potential as ecofriendly, cost-effective, evading toxic of dangerous chemicals and the alternative of conventional physiochemical synthesis. The Shewanella oneidensis is an important kind of metal reducing bacterium, known as its special anaerobic respiratory and sulfate reducing capacity. The crystalline nature, phase purity and surface morphology of biosynthesized cadmium sulfide nanoparticles were analyzed by Fourier transform infrared spectroscopy, X-ray diffraction, Field emission scanning electron microscopy, Energy dispersive spectroscopy and Transmission electron microscopy. The use of imidazolium based ionic liquids as soft templating agent for controlling self-assembly and crystal growth direction of metal sulfide nanoparticles has also advanced as an important method. The microscopic techniques showed that the nanoparticles are designed on the nano form and have an excellent spherical morphology, due to the self-assembled mechanism of ionic liquid assistance. The antitumor efficiency of the cadmium sulfide nanoparticles was investigated against brain cancer cell lines using rat glioma cell lines. The effectively improved nano-crystalline and morphological structure of CdS nanoparticles in the presence of IL exhibit excellent cytotoxicity and dispersion ability on the cell shape is completely spread out showing a nice toxic environment against cancer cells. The cytotoxicity effect of cadmium sulfide nanoparticles was discussed with a diagrammatic representation. Copyright © 2017. Published by Elsevier B.V.

Improving solubility of Shewanella oneidensis MR-1 and Clostridium thermocellum JW-20 proteins expressed into Esherichia coli.

PubMed

Kataeva, Irina; Chang, Jessie; Xu, Hao; Luan, Chi-Hao; Zhou, Jizhong; Uversky, Vladimir N; Lin, Dawei; Horanyi, Peter; Liu, Z J; Ljungdahl, Lars G; Rose, John; Luo, Ming; Wang, Bi-Cheng

2005-01-01

Low solubility of proteins overexpressed in E. coli is a frequent problem in high-throughput structural genomics. To improve solubility of proteins from mesophilic Shewanella oneidensis MR-1 and thermophilic Clostridium thermocellum JW20, an approach was attempted that included a fusion of the target protein to a maltose-binding protein (MBP) and a decrease of induction temperature. The MBP was selected as the most efficient solubilizing carrier when compared to a glutathione S-transferase and a Nus A protein. A tobacco etch virus (TEV) protease recognition site was introduced between fused proteins using a double polymerase-chain reaction and four primers. In this way, 79 S. oneidensis proteins have been expressed in one case with an N-terminal 30-residue tag and in another case as a fusion protein with MBP. A foreign tag might significantly affect the properties of the target polypeptide. At 37 degrees C and 18 degrees C induction temperatures, only 5 and 17 tagged proteins were soluble, respectively. In fusion with MBP 4, 34, and 38 proteins were soluble upon induction at 37 degrees, 28 degrees, and 18 degrees C, respectively. The MBP is assumed to increase stability and solubility of a target protein by changing both the mechanism and the cooperativity of folding/unfolding. The 66 C. thermocellum proteins were expressed as fusion proteins with MBP. Induction at 37 degrees, 28 degrees, and 18 degrees C produced 34, 57, and 60 soluble proteins, respectively. The higher solubility of C. thermocellum proteins in comparison with the S. oneidensis proteins under similar conditions of induction correlates with the thermophilicity of the host. The two-factor Wilkinson-Harrison statistical model was used to identify soluble and insoluble proteins. Theoretical and experimental data showed good agreement for S. oneidensis proteins; however, the model failed to identify soluble/insoluble Clostridium proteins. A suggestion has been made that the Wilkinson-Harrison model is

Transcriptome analysis reveals a stress response of Shewanella oneidensis deprived of background levels of ionizing radiation

PubMed Central

Li, Xiaoping; Schilkey, Faye; Smith, Geoffrey B.

2018-01-01

Natural ionizing background radiation has exerted a constant pressure on organisms since the first forms of life appeared on Earth, so that cells have developed molecular mechanisms to avoid or repair damages caused directly by radiation or indirectly by radiation-induced reactive oxygen species (ROS). In the present study, we investigated the transcriptional effect of depriving Shewanella oneidensis cultures of background levels of radiation by growing the cells in a mine 655 m underground, thus reducing the dose rate from 72.1 to 0.9 nGy h-1 from control to treatment, respectively. RNASeq transcriptome analysis showed the differential expression of 4.6 and 7.6% of the S. oneidensis genome during early- and late-exponential phases of growth, respectively. The greatest change observed in the treatment was the downregulation of ribosomal proteins (21% of all annotated ribosomal protein genes during early- and 14% during late-exponential) and tRNA genes (14% of all annotated tRNA genes in early-exponential), indicating a marked decrease in protein translation. Other significant changes were the upregulation of membrane transporters, implying an increase in the traffic of substrates across the cell membrane, as well as the up and downregulation of genes related to respiration, which could be interpreted as a response to insufficient oxidants in the cells. In other reports, there is evidence in multiple species that some ROS not just lead to oxidative stress, but act as signaling molecules to control cellular metabolism at the transcriptional level. Consistent with these reports, several genes involved in the metabolism of carbon and biosynthesis of amino acids were also regulated, lending support to the idea of a wide metabolic response. Our results indicate that S. oneidensis is sensitive to the withdrawal of background levels of ionizing radiation and suggest that a transcriptional response is required to maintain homeostasis and retain normal growth. PMID:29768440

Rapid construction of a whole-genome transposon insertion collection for Shewanella oneidensis by Knockout Sudoku.

PubMed

Baym, Michael; Shaket, Lev; Anzai, Isao A; Adesina, Oluwakemi; Barstow, Buz

2016-11-10

Whole-genome knockout collections are invaluable for connecting gene sequence to function, yet traditionally, their construction has required an extraordinary technical effort. Here we report a method for the construction and purification of a curated whole-genome collection of single-gene transposon disruption mutants termed Knockout Sudoku. Using simple combinatorial pooling, a highly oversampled collection of mutants is condensed into a next-generation sequencing library in a single day, a 30- to 100-fold improvement over prior methods. The identities of the mutants in the collection are then solved by a probabilistic algorithm that uses internal self-consistency within the sequencing data set, followed by rapid algorithmically guided condensation to a minimal representative set of mutants, validation, and curation. Starting from a progenitor collection of 39,918 mutants, we compile a quality-controlled knockout collection of the electroactive microbe Shewanella oneidensis MR-1 containing representatives for 3,667 genes that is functionally validated by high-throughput kinetic measurements of quinone reduction.

Effect of oxygen on the per‐cell extracellular electron transfer rate of Shewanella oneidensis MR‐1 explored in bioelectrochemical systems

PubMed Central

Lu, Mengqian; Chan, Shirley; Babanova, Sofia

2016-01-01

ABSTRACT Extracellular electron transfer (EET) is a mechanism that enables microbes to respire solid‐phase electron acceptors. These EET reactions most often occur in the absence of oxygen, since oxygen can act as a competitive electron acceptor for many facultative microbes. However, for Shewanella oneidensis MR‐1, oxygen may increase biomass development, which could result in an overall increase in EET activity. Here, we studied the effect of oxygen on S. oneidensis MR‐1 EET rates using bioelectrochemical systems (BESs). We utilized optically accessible BESs to monitor real‐time biomass growth, and studied the per‐cell EET rate as a function of oxygen and riboflavin concentrations in BESs of different design and operational conditions. Our results show that oxygen exposure promotes biomass development on the electrode, but significantly impairs per‐cell EET rates even though current production does not always decrease with oxygen exposure. Additionally, our results indicated that oxygen can affect the role of riboflavin in EET. Under anaerobic conditions, both current density and per‐cell EET rate increase with the riboflavin concentration. However, as the dissolved oxygen (DO) value increased to 0.42 mg/L, riboflavin showed very limited enhancement on per‐cell EET rate and current generation. Since it is known that oxygen can promote flavins secretion in S. oneidensis, the role of riboflavin may change under anaerobic and aerobic conditions. Biotechnol. Bioeng. 2017;114: 96–105. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:27399911

Growth Inhibition and Stimulation of Shewanella oneidensis MR-1 by Surfactants and Calcium Polysulfide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bailey, Kathryn L.; Tilton, Fred A.; Jansik, Danielle P.

2012-06-14

Foam delivery technology (FDT) uses surfactant based foam to immobilize subsurface contaminants in situ. Where traditional approaches are impractical, FDT has the potential to overcome many of the technical challenges facing the remediation of contaminated deep vadose zone environments. However, little is known about the effects these reactive chemicals may have on microorganisms inhabiting the contaminated subsurface. In addition, there are currently no standard assays to assess microbial responses to subsurface remedial treatments while these agents are under development. The objective of this study was to develop a rapid laboratory assay to assess the potential growth inhibition and/or stimulation ofmore » microorganisms following exposure to candidate FDT components. Calcium polysulfide (CPS) and several surfactants (i.e. sodium laureth sulfate (SLES), sodium dodecyl sulfate (SDS), cocamidopropyl betaine (CAPB) and NINOL40-CO) have diverse chemistries and are candidate components of FDT. Shewanella oneidensis MR-1 cultures were exposed to a range of concentrations of these chemicals to determine the minimum bactericidal concentration (MBC) and the growth and viability potential of these components. Concentrations of SDS higher than 700 {micro}M were toxic to S. oneidensis MR-1 growth over the course of four days of exposure. The relative acute toxicity order for these compounds was SDS>>CPS>>NINOL40-CO>SLES-CAPB. Dose dependent growth decreases (20 to 100 mM) were observed in the CAPB and SLES treated cultures and both CPS and NINOL 40-CO were toxic at all concentrations tested (1.45 to 7.25 mM CPS). Both SLES (20 to 100 mM) and SDS at lower concentrations (20 to 500 {micro}M) were stimulatory to S. oneidensis MR-1 indicating a capacity to be used as a carbon source. These studies also identified potentially key component characteristics, such as precipitate formation and oxygen availability, which may prove valuable in assessing the response of subsurface

Evaluation of the effects of various culture condition on Cr (VI)reduction by Shewanella oneidensis MR-1 in a novel high-throughputmini-bioreactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Yinjie J.; Laidlaw, David; Gani, Kishen

2006-03-16

The growth and Cr(VI) reduction by Shewanella oneidensisMR-1 was examined using a mini-bioreactor system that independentlymonitors and controls pH, dissolved oxygen, and temperature for each ofits 24, 10-mL reactors. Independent monitoring and control of eachreactor in the cassette allows the exploration of a matrix ofenvironmental conditions known to influence S. oneidensis chromiumreduction. S. oneidensis MR-1 grew in minimal medium without amino acidor vitamin supplementation under aerobic conditions but required serineand glycine supplementation under anaerobic conditions. Growth wasinhibited by dissolved oxygen concentrations>80 percent. Lactatetransformation to acetate was enhanced by low concentration of dissolvedoxygen during the logarithmic growth phase. Between 11 andmore » 35oC, thegrowth rate obeyed the Arrhenius reaction rate-temperature relationship,with a maximum growth rate occurring at 35oC. S. oneidensis MR-1 was ableto grow over a wide range of pH (6-9). At neutral pH and temperaturesranging from 30-35oC, S. oneidensis MR-1 reduced 100 mu M Cr(VI) toCr(III) within 20 minutes in the exponential growth phase, and the growthrate was not affected by the addition of chromate; it reduced chromateeven faster at temperatures between 35 and 39oC. At low temperatures(<25oC), acidic (pH<6.5), or alkaline (pH>8.5) conditions, 100mu M Cr(VI) strongly inhibited growth and chromate reduction. Themini-bioreactor system enabled the rapid determination of theseparameters reproducibly and easily by performing very few experiments.Besides its use for examining parameters of interest to environmentalremediation, the device will also allow one to quickly assess parametersfor optimal production of recombinant proteins or secondarymetabolites« less

Systematic screening of carbon-based anode materials for microbial fuel cells with Shewanella oneidensis MR-1.

PubMed

Kipf, Elena; Koch, Julia; Geiger, Bettina; Erben, Johannes; Richter, Katrin; Gescher, Johannes; Zengerle, Roland; Kerzenmacher, Sven

2013-10-01

We present a systematic screening of carbon-based anode materials for microbial fuel cells with Shewanella oneidensis MR-1. Under anoxic conditions nanoporous activated carbon cloth is a superior anode material in terms of current density normalized to the projected anode area and anode volume (24.0±0.3 μA cm(-2) and 482±7 μA cm(-3) at -0.2 vs. SCE, respectively). The good performance can be attributed to the high specific surface area of the material, which is available for mediated electron transfer through self-secreted flavins. Under aerated conditions no influence of the specific surface area is observed, which we attribute to a shift from primary indirect electron transfer by mediators to direct electron transfer via adherent cells. Furthermore, we show that an aerated initial growth phase enhances the current density under subsequent anoxic conditions fivefold when compared to a similar experiment that was conducted under permanently anoxic conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Trace Element Speciation and Distribution Study at Shewanella oneidensis MR-1 Biofilm/Mineral/Water Interfaces

NASA Astrophysics Data System (ADS)

Gelabert, A.; Wang, Y.; Gescher, J.; Ha, J.; Cordova, C. D.; Singer, D. M.; Spormann, A. M.; Trainor, T. P.; Eng, P. J.; Brown, G. E.

2006-12-01

Fe- and Al-(oxyhydr)oxides are among the most reactive mineral surfaces contacted by surface and ground waters, and thus they constitute important sorbents for heavy metal and metalloid ions. As microbial biofilms may be present as coatings on these minerals, they are likely to induce major changes in surface charges and sorption capacities for metal(loid) ions compared to biofilm-free mineral surfaces. In addition, the micro- environments in biofilms can be quite different from those in bulk solutions, which can enhance (or inhibit) metal adsorption on mineral surfaces and produce biominerals that are not predicted by equilibrium thermodynamics based on the bulk solution values. In order to provide a more quantitative understanding of these effects, we have carried out a study of the interaction of Zn(II), Pb(II), and As(V) with Shewanella oneidensis (wild type, EPS-deficient mutant, and ppx- and ppk-deficient mutants) grown on highly polished and oriented single crystal surfaces of α-Al2O3 (1-102) and α-Fe2O3 (0001). This gram-negative bacterium commonly found in soil and sediments can use a wide range of electron donors and terminal electron acceptors including Fe(III) and Mn(IV) oxides under anaerobic conditions. In-situ ATR-FTIR analyses and potentiometric titrations of S. oneidensis biofilm collected from a glass bead-filled column inoculated with S. oneidensis were conducted in order to determine the nature of functional groups present on the bacterial surfaces, to quantify the site densities and protonation constants for these groups, and to determine the electrostatic parameters for S. oneidensis surfaces. GI-XAFS analyses performed on BL 11-2 at SSRL, together with macroscopic metal adsorption experiments as a function of pH (2 to 6.5), metal concentration (10-3 to 10-7 M), and ionic strength (10-1 to 10-3 M), were used to determine ion speciation and local coordination environments in the biofilm and to develop a surface complexation model describing

Endogenous generation of hydrogen sulfide and its regulation in Shewanella oneidensis

PubMed Central

Wu, Genfu; Li, Ning; Mao, Yinting; Zhou, Guangqi; Gao, Haichun

2015-01-01

Hydrogen sulfide (H2S) has been recognized as a physiological mediator with a variety of functions across all domains of life. In this study, mechanisms of endogenous H2S generation in Shewanella oneidensis were investigated. As a research model with highly diverse anaerobic respiratory pathways, the microorganism is able to produce H2S by respiring on a variety of sulfur-containing compounds with SirACD and PsrABC enzymatic complexes, as well as through cysteine degradation with three enzymes, MdeA, SO_1095, and SseA. We showed that the SirACD and PsrABC complexes, which are predominantly, if not exclusively, responsible for H2S generation via respiration of sulfur species, do not interplay with each other. Strikingly, a screen for regulators controlling endogenous H2S generation by transposon mutagenesis identified global regulator Crp to be essential to all H2S-generating processes. In contrast, Fnr and Arc, two other global regulators that have a role in respiration, are dispensable in regulating H2S generation via respiration of sulfur species. Interestingly, Arc is involved in the H2S generation through cysteine degradation by repressing expression of the mdeA gene. We further showed that expression of the sirA and psrABC operons is subjected to direct regulation of Crp, but the mechanisms underlying the requirement of Crp for H2S generation through cysteine degradation remain elusive. PMID:25972854

Vanadium(V) Reduction by Shewanella oneidensis MR-1 Requires Menaquinone and Cytochromes from the Cytoplasmic and Outer Membranes

PubMed Central

Myers, Judith M.; Antholine, William E.; Myers, Charles R.

2004-01-01

The metal-reducing bacterium Shewanella oneidensis MR-1 displays remarkable anaerobic respiratory plasticity, which is reflected in the extensive number of electron transport components encoded in its genome. In these studies, several cell components required for the reduction of vanadium(V) were determined. V(V) reduction is mediated by an electron transport chain which includes cytoplasmic membrane components (menaquinone and the tetraheme cytochrome CymA) and the outer membrane (OM) cytochrome OmcB. A partial role for the OM cytochrome OmcA was evident. Electron spin resonance spectroscopy demonstrated that V(V) was reduced to V(IV). V(V) reduction did not support anaerobic growth. This is the first report delineating specific electron transport components that are required for V(V) reduction and of a role for OM cytochromes in the reduction of a soluble metal species. PMID:15006760

Shewanella secretes flavins that mediate extracellular electron transfer

PubMed Central

Marsili, Enrico; Baron, Daniel B.; Shikhare, Indraneel D.; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.

2008-01-01

Bacteria able to transfer electrons to metals are key agents in biogeochemical metal cycling, subsurface bioremediation, and corrosion processes. More recently, these bacteria have gained attention as the transfer of electrons from the cell surface to conductive materials can be used in multiple applications. In this work, we adapted electrochemical techniques to probe intact biofilms of Shewanella oneidensis MR-1 and Shewanella sp. MR-4 grown by using a poised electrode as an electron acceptor. This approach detected redox-active molecules within biofilms, which were involved in electron transfer to the electrode. A combination of methods identified a mixture of riboflavin and riboflavin-5′-phosphate in supernatants from biofilm reactors, with riboflavin representing the dominant component during sustained incubations (>72 h). Removal of riboflavin from biofilms reduced the rate of electron transfer to electrodes by >70%, consistent with a role as a soluble redox shuttle carrying electrons from the cell surface to external acceptors. Differential pulse voltammetry and cyclic voltammetry revealed a layer of flavins adsorbed to electrodes, even after soluble components were removed, especially in older biofilms. Riboflavin adsorbed quickly to other surfaces of geochemical interest, such as Fe(III) and Mn(IV) oxy(hydr)oxides. This in situ demonstration of flavin production, and sequestration at surfaces, requires the paradigm of soluble redox shuttles in geochemistry to be adjusted to include binding and modification of surfaces. Moreover, the known ability of isoalloxazine rings to act as metal chelators, along with their electron shuttling capacity, suggests that extracellular respiration of minerals by Shewanella is more complex than originally conceived. PMID:18316736

Expression of Shewanella oneidensis MR-1 [FeFe]-Hydrogenase Genes in Anabaena sp. Strain PCC 7120

PubMed Central

Gärtner, Katrin; Lechno-Yossef, Sigal; Cornish, Adam J.; Wolk, C. Peter

2012-01-01

H2 generated from renewable resources holds promise as an environmentally innocuous fuel that releases only energy and water when consumed. In biotechnology, photoautotrophic oxygenic diazotrophs could produce H2 from water and sunlight using the cells' endogenous nitrogenases. However, nitrogenases have low turnover numbers and require large amounts of ATP. [FeFe]-hydrogenases found in other organisms can have 1,000-fold higher turnover numbers and no specific requirement for ATP but are very O2 sensitive. Certain filamentous cyanobacteria protect nitrogenase from O2 by sequestering the enzyme within internally micro-oxic, differentiated cells called heterocysts. We heterologously expressed the [FeFe]-hydrogenase operon from Shewanella oneidensis MR-1 in Anabaena sp. strain PCC 7120 using the heterocyst-specific promoter PhetN. Active [FeFe]-hydrogenase was detected in and could be purified from aerobically grown Anabaena sp. strain PCC 7120, but only when the organism was grown under nitrate-depleted conditions that elicited heterocyst formation. These results suggest that the heterocysts protected the [FeFe]-hydrogenase against inactivation by O2. PMID:23023750

Microbial fuel cells equipped with an iron-plated carbon-felt anode and Shewanella oneidensis MR-1 with corn steep liquor as a fuel.

PubMed

Phansroy, Nichanan; Khawdas, Wichean; Watanabe, Keigo; Aso, Yuji; Ohara, Hitomi

2018-05-12

A single chamber type microbial fuel cell (MFC) with 100 mL of chamber volume and 50 cm 2 of air-cathode was developed in this study wherein a developed iron-plated carbon-felt anode and Shewanella oneidensis MR-1 were used. The performance of the iron-plated carbon-felt anode and the possibility of corn steep liquor (CSL) as a fuel, which was the byproduct of corn wet milling and contained lactic acid, was investigated here. MFCs equipped with iron-plated or non-plated carbon-felt anodes exhibited maximum current densities of 443 or 302 mA/m 2 using 10 g/L of reagent-grade lactic acid, respectively. In addition, using centrifuged CSL without insoluble ingredients or non-centrifuged CSL as a fuel, the maximum current densities of the MFCs with iron-plated carbon-felt anode were 321 or 158 mA/m 2 , respectively. This report demonstrated the effect of iron-plated carbon-felt anode for electricity generation of MFC using S. oneidensis MR-1 and the performance of CSL as a fuel. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Shewanella frigidimarina microbial fuel cells and the influence of divalent cations on current output.

PubMed

Fitzgerald, Lisa A; Petersen, Emily R; Leary, Dagmar H; Nadeau, Lloyd J; Soto, Carissa M; Ray, Richard I; Little, Brenda J; Ringeisen, Bradley R; Johnson, Glenn R; Vora, Gary J; Biffinger, Justin C

2013-02-15

The genes involved in the proposed pathway for Shewanella extracellular electron transfer (EET) are highly conserved. While extensive studies involving EET from a fresh water Shewanella microbe (S. oneidensis MR-1) to soluble and insoluble electron acceptors have been published, only a few reports have examined EET from marine strains of Shewanella. Thus, Shewanella frigidimarina (an isolate from Antarctic Sea ice) was used within miniature microbial fuel cells (mini-MFC) to evaluate potential power output. During the course of this study several distinct differences were observed between S. oneidensis MR-1 and S. frigidimarina under comparable conditions. The maximum power density with S. frigidimarina was observed when the anolyte was half-strength marine broth (1/2 MB) (0.28 μW/cm(2)) compared to Luria-Bertani (LB) (0.07 μW/cm(2)) or a defined growth minimal medium (MM) (0.02 μW/cm(2)). The systematic modification of S. frigidimarina cultured in 1/2 MB and LB with divalent cations shows that a maximum current output can be generated independent of internal ionic ohmic losses and the presence of external mediators. Published by Elsevier B.V.

Investigations of structure and metabolism within Shewanella oneidensis MR-1 biofilms.

PubMed

McLean, Jeffrey S; Majors, Paul D; Reardon, Catherine L; Bilskis, Christina L; Reed, Samantha B; Romine, Margaret F; Fredrickson, James K

2008-07-01

Biofilms possess spatially and temporally varying metabolite concentration profiles at the macroscopic and microscopic scales. This results in varying growth environments that may ultimately drive species diversity, determine biofilm structure and the spatial distribution of the community members. Using non-invasive nuclear magnetic resonance (NMR) microscopic imaging/spectroscopy and confocal imaging, we investigated the kinetics and stratification of anaerobic metabolism within live biofilms of the dissimilatory metal-reducing bacterium Shewanella oneidensis strain MR-1. Biofilms were pre-grown using a defined minimal medium in a constant-depth film bioreactor and subsequently transferred to an in-magnet sample chamber under laminar flow for NMR measurements. Biofilms generated in this manner were subjected to changing substrate/electron acceptor combinations (fumarate, dimethyl sulfoxide, and nitrate) and the metabolic responses measured. Localized NMR spectroscopy was used to non-invasively measure hydrogen-containing metabolites at high temporal resolution (4.5 min) under O(2)-limited conditions. Reduction of electron acceptor under anaerobic conditions was immediately observed upon switching feed solutions indicating that no gene induction (transcriptional response) was needed for MR-1 to switch metabolism from O(2) to fumarate, dimethyl sulfoxide or nitrate. In parallel experiments, confocal microscopy was used with constitutively expressed fluorescent reporters to independently investigate changes in population response to the availability of electron acceptor and to probe metabolic competition under O(2)-limited conditions. A clearer understanding of the metabolic diversity and plasticity of the biofilm mode of growth as well as how these factors relate to environmental fitness is made possible through the use of non-invasive and non-destructive techniques such as described herein.

Transcriptome and metabolome responses of Shewanella oneidensis MR-1 to methyl orange under microaerophilic and aerobic conditions.

PubMed

Cao, Xinhua; Qi, Yueling; Xu, Chen; Yang, Yuyi; Wang, Jun

2017-04-01

Shewanella oneidensis MR-1 degrades various azo dyes under microaerophilic and anaerobic conditions, but this process is inhibited under aerobic conditions. The mechanisms underlying azo dye biodegradation and inhibition remain unknown. Therefore, we investigated metabolic and transcriptional changes in strain MR-1, which was cultured under different conditions, to elucidate these mechanisms. At the transcriptional level, genes involved in certain metabolic processes, particularly the tricarboxylic acid (TCA) cycle, amino acid biodegradation, and the electron transfer system, were significantly altered (M ≧ 2, p > 0.8 ) in the presence of methyl orange (MO). Moreover, a high concentration of dissolved oxygen heavily impacted the expression levels of genes involved in fatty acid biodegradation. Metabolome analysis revealed significant alteration (p < 0.05) in the concentrations of nine metabolites when strain MR-1 was cultured under aerobic conditions; the majority of these metabolites were closely associated with amino acid metabolism and DNA replication. Accordingly, we propose a possible pathway for MO biodegradation and discuss the most likely causes of biodegradation inhibition due to dissolved oxygen.

13C Pathway Analysis for the Role of Formate in Electricity Generation by Shewanella Oneidensis MR-1 Using Lactate in Microbial Fuel Cells

PubMed Central

Luo, Shuai; Guo, Weihua; H. Nealson, Kenneth; Feng, Xueyang; He, Zhen

2016-01-01

Microbial fuel cell (MFC) is a promising technology for direct electricity generation from organics by microorganisms. The type of electron donors fed into MFCs affects the electrical performance, and mechanistic understanding of such effects is important to optimize the MFC performance. In this study, we used a model organism in MFCs, Shewanella oneidensis MR-1, and 13C pathway analysis to investigate the role of formate in electricity generation and the related microbial metabolism. Our results indicated a synergistic effect of formate and lactate on electricity generation, and extra formate addition on the original lactate resulted in more electrical output than using formate or lactate as a sole electron donor. Based on the 13C tracer analysis, we discovered decoupled cell growth and electricity generation in S. oneidensis MR-1 during co-utilization of lactate and formate (i.e., while the lactate was mainly metabolized to support the cell growth, the formate was oxidized to release electrons for higher electricity generation). To our best knowledge, this is the first time that 13C tracer analysis was applied to study microbial metabolism in MFCs and it was demonstrated to be a valuable tool to understand the metabolic pathways affected by electron donors in the selected electrochemically-active microorganisms. PMID:26868848

Enhanced Shewanella biofilm promotes bioelectricity generation.

PubMed

Liu, Ting; Yu, Yang-Yang; Deng, Xiao-Peng; Ng, Chun Kiat; Cao, Bin; Wang, Jing-Yuan; Rice, Scott A; Kjelleberg, Staffan; Song, Hao

2015-10-01

Electroactive biofilms play essential roles in determining the power output of microbial fuel cells (MFCs). To engineer the electroactive biofilm formation of Shewanella oneidensis MR-1, a model exoelectrogen, we herein heterologously overexpressed a c-di-GMP biosynthesis gene ydeH in S. oneidensis MR-1, constructing a mutant strain in which the expression of ydeH is under the control of IPTG-inducible promoter, and a strain in which ydeH is under the control of a constitutive promoter. Such engineered Shewanella strains had significantly enhanced biofilm formation and bioelectricity generation. The MFCs inoculated with these engineered strains accomplished a maximum power density of 167.6 ± 3.6 mW/m(2) , which was ∼ 2.8 times of that achieved by the wild-type MR-1 (61.0 ± 1.9 mW/m(2) ). In addition, the engineered strains in the bioelectrochemical system at poised potential of 0.2 V vs. saturated calomel electrode (SCE) generated a stable current density of 1100 mA/m(2) , ∼ 3.4 times of that by wild-type MR-1 (320 mA/m(2) ). © 2015 Wiley Periodicals, Inc.

Biogeochemical modification of Nontronite by Shewanella oneidensis MR-1: Evidence of Microbially induced Smectite-to-Illite reaction

NASA Astrophysics Data System (ADS)

Koo, T. H.; Kogure, T.; Kim, J. W.

2017-12-01

The biogeochemical modification of chemistry/structure of smectite associated with microbial Fe(III) respiration is a major process of promoting smectite-to-illite reaction (S-I reaction). Direct evidence of illitization including K-fixation and changes in Al/Si, formation of K-nontronite/illite-like structure has not been suggested systematically. Nontronite (NAu-1) was inoculated with Fe-reducing bacteria (FeRB), Shewanella oneidensis MR-1 at 30 ° with pH buffered (7.0 and 8.0) M1 medium in the anaerobic chamber, and the evidence of illitization was suggested by microscopic/spectroscopic measurements as well as aqueous chemistry in the supernatant with various incubation time. A progressive morphological change in bio-reduced notnronite (altered nontronite → K-nontronite → illite) corresponded to chemical modification in solid phase (Al/Si 0.16 to 0.28). Fe and Al contents in the supernatant increased continuously up to 70 days of incubation (3.4 to 20 and 1.7 to 13 20 mmol/mg of NAu-1, respectively) then decreased in 120 days of incubation (20 to 8 and 13 to 3 mmol/mg of NAu-1, respectively) indicating new mineral phase precipitated. Si contents showed slightly decreased in 7 days (133 to 100 mmol/mg of NAu-1) then showed fluctuated pattern (increased to 183 mmol/mg of NAu-1 in 70 days, then decreased to 102 mmol/mg of NAu-1 in 120 days of incubation). Formation of biotic silica globule within 120-day incubation supported the dissolution of bio-reduced notnronite. Indeed, modification in structure (appearance of 10-Å shoulder in X-ray diffraction profile) and formation of discrete illite-like packet (d001=1.0 nm) in the wavy bio-reduced nontronite matrix (d001=1.2-1.3 nm) strongly suggest that bio-reduced nontronite underwent the reductive dissolution and precipitated the newly formed illite

Metabolically engineered glucose-utilizing Shewanella strains under anaerobic conditions.

PubMed

Choi, Donggeon; Lee, Sae Bom; Kim, Sohyun; Min, Byoungnam; Choi, In-Geol; Chang, In Seop

2014-02-01

Comparative genome analysis of Shewanella strains predicted that the strains metabolize preferably two- and three-carbon carbohydrates as carbon/electron source because many Shewanella genomes are deficient of the key enzymes in glycolysis (e.g., glucokinase). In addition, all Shewanella genomes are known to have only one set of genes associated with the phosphotransferase system required to uptake sugars. To engineer Shewanella strains that can utilize five- and six-carbon carbohydrates, we constructed glucose-utilizing Shewanella oneidensis MR-1 by introducing the glucose facilitator (glf; ZMO0366) and glucokinase (glk; ZMO0369) genes of Zymomonas mobilis. The engineered MR-1 strain was able to grow on glucose as a sole carbon/electron source under anaerobic conditions. The glucose affinity (Ks) and glucokinase activity in the engineered MR-1 strain were 299.46 mM and 0.259 ± 0.034 U/g proteins. The engineered strain was successfully applied to a microbial fuel cell system and exhibited current generation using glucose as the electron source. Copyright © 2013 Elsevier Ltd. All rights reserved.

Network-Based Methods for Identifying Key Active Proteins in the Extracellular Electron Transfer Process in Shewanella oneidensis MR-1.

PubMed

Ding, Dewu; Sun, Xiao

2018-01-16

Shewanella oneidensis MR-1 can transfer electrons from the intracellular environment to the extracellular space of the cells to reduce the extracellular insoluble electron acceptors (Extracellular Electron Transfer, EET). Benefiting from this EET capability, Shewanella has been widely used in different areas, such as energy production, wastewater treatment, and bioremediation. Genome-wide proteomics data was used to determine the active proteins involved in activating the EET process. We identified 1012 proteins with decreased expression and 811 proteins with increased expression when the EET process changed from inactivation to activation. We then networked these proteins to construct the active protein networks, and identified the top 20 key active proteins by network centralization analysis, including metabolism- and energy-related proteins, signal and transcriptional regulatory proteins, translation-related proteins, and the EET-related proteins. We also constructed the integrated protein interaction and transcriptional regulatory networks for the active proteins, then found three exclusive active network motifs involved in activating the EET process-Bi-feedforward Loop, Regulatory Cascade with a Feedback, and Feedback with a Protein-Protein Interaction (PPI)-and identified the active proteins involved in these motifs. Both enrichment analysis and comparative analysis to the whole-genome data implicated the multiheme c -type cytochromes and multiple signal processing proteins involved in the process. Furthermore, the interactions of these motif-guided active proteins and the involved functional modules were discussed. Collectively, by using network-based methods, this work reported a proteome-wide search for the key active proteins that potentially activate the EET process.

¹³C Pathway Analysis for the Role of Formate in Electricity Generation by Shewanella Oneidensis MR-1 Using Lactate in Microbial Fuel Cells.

PubMed

Luo, Shuai; Guo, Weihua; Nealson, Kenneth H; Feng, Xueyang; He, Zhen

2016-02-12

Microbial fuel cell (MFC) is a promising technology for direct electricity generation from organics by microorganisms. The type of electron donors fed into MFCs affects the electrical performance, and mechanistic understanding of such effects is important to optimize the MFC performance. In this study, we used a model organism in MFCs, Shewanella oneidensis MR-1, and (13)C pathway analysis to investigate the role of formate in electricity generation and the related microbial metabolism. Our results indicated a synergistic effect of formate and lactate on electricity generation, and extra formate addition on the original lactate resulted in more electrical output than using formate or lactate as a sole electron donor. Based on the (13)C tracer analysis, we discovered decoupled cell growth and electricity generation in S. oneidensis MR-1 during co-utilization of lactate and formate (i.e., while the lactate was mainly metabolized to support the cell growth, the formate was oxidized to release electrons for higher electricity generation). To our best knowledge, this is the first time that (13)C tracer analysis was applied to study microbial metabolism in MFCs and it was demonstrated to be a valuable tool to understand the metabolic pathways affected by electron donors in the selected electrochemically-active microorganisms.

Respiration of metal (hydr)oxides by Shewanella and Geobacter: a key role for multihaem c-type cytochromes

PubMed Central

Shi, Liang; Squier, Thomas C; Zachara, John M; Fredrickson, James K

2007-01-01

Dissimilatory reduction of metal (e.g. Fe, Mn) (hydr)oxides represents a challenge for microorganisms, as their cell envelopes are impermeable to metal (hydr)oxides that are poorly soluble in water. To overcome this physical barrier, the Gram-negative bacteria Shewanella oneidensis MR-1 and Geobacter sulfurreducens have developed electron transfer (ET) strategies that require multihaem c-type cytochromes (c-Cyts). In S. oneidensis MR-1, multihaem c-Cyts CymA and MtrA are believed to transfer electrons from the inner membrane quinone/quinol pool through the periplasm to the outer membrane. The type II secretion system of S. oneidensis MR-1 has been implicated in the reduction of metal (hydr)oxides, most likely by translocating decahaem c-Cyts MtrC and OmcA across outer membrane to the surface of bacterial cells where they form a protein complex. The extracellular MtrC and OmcA can directly reduce solid metal (hydr)oxides. Likewise, outer membrane multihaem c-Cyts OmcE and OmcS of G. sulfurreducens are suggested to transfer electrons from outer membrane to type IV pili that are hypothesized to relay the electrons to solid metal (hydr)oxides. Thus, multihaem c-Cyts play critical roles in S. oneidensis MR-1- and G. sulfurreducens-mediated dissimilatory reduction of solid metal (hydr)oxides by facilitating ET across the bacterial cell envelope. PMID:17581116

Cell growth and protein expression of Shewanella oneidensis in biofilms and hydrogel-entrapped cultures.

PubMed

Zhang, Yingdan; Ng, Chun Kiat; Cohen, Yehuda; Cao, Bin

2014-05-01

The performance of biofilm-based bioprocesses is difficult to predict and control because of the intrinsic heterogeneous and dynamic properties of microbial biofilms. Biofilm mimics, such as microbial cells entrapped in polymeric scaffolds that are permeable for nutrients, have been proposed to replace real biofilms to achieve long-term robust performance in engineering applications. However, the physiological differences between cells that are physically entrapped in a synthetic polymeric matrix and biofilm cells that are encased in a self-produced polymeric matrix remain unknown. In this study, using Shewanella oneidensis as a model organism and alginate hydrogel as a model synthetic matrix, we compared the cell growth and protein expression in entrapped cultures and biofilms. The hydrogel-entrapped cultures were found to exhibit a growth rate comparable with biofilms. There was no substantial difference in cell viability, surface charge, as well as hydrophobicity between the cells grown in alginate hydrogel and those grown in biofilms. However, the gel-entrapped cultures were found to be physiologically different from biofilms. The gel-entrapped cultures had a higher demand for metabolic energy. The siderophore-mediated iron uptake was repressed in the gel-entrapped cells. The presence of the hydrogel matrix decreased the expression of proteins involved in biofilm formation, while inducing the production of extracellular DNA (eDNA) in the gel-entrapped cultures. These results advance the fundamental understanding of the physiology of hydrogel-entrapped cells, which can lead to more efficient biofilm mimic-based applications.

Structures, Compositions, and Activities of Live Shewanella Biofilms Formed on Graphite Electrodes in Electrochemical Flow Cells

PubMed Central

Kitayama, Miho; Koga, Ryota; Kasai, Takuya; Kouzuma, Atsushi

2017-01-01

ABSTRACT An electrochemical flow cell equipped with a graphite working electrode (WE) at the bottom was inoculated with Shewanella oneidensis MR-1 expressing an anaerobic fluorescent protein, and biofilm formation on the WE was observed over time during current generation at WE potentials of +0.4 and 0 V (versus standard hydrogen electrodes), under electrolyte-flow conditions. Electrochemical analyses suggested the presence of unique electron-transfer mechanisms in the +0.4-V biofilm. Microscopic analyses revealed that, in contrast to aerobic biofilms, current-generating biofilm (at +0.4 V) was thin and flat (∼10 μm in thickness), and cells were evenly and densely distributed in the biofilm. In contrast, cells were unevenly distributed in biofilm formed at 0 V. In situ fluorescence staining and biofilm recovery experiments showed that the amounts of extracellular polysaccharides (EPSs) in the +0.4-V biofilm were much smaller than those in the aerobic and 0-V biofilms, suggesting that Shewanella cells suppress the production of EPSs at +0.4 V under flow conditions. We suggest that Shewanella cells perceive electrode potentials and modulate the structure and composition of biofilms to efficiently transfer electrons to electrodes. IMPORTANCE A promising application of microbial fuel cells (MFCs) is to save energy in wastewater treatment. Since current is generated in these MFCs by biofilm microbes under horizontal flows of wastewater, it is important to understand the mechanisms for biofilm formation and current generation under water-flow conditions. Although massive work has been done to analyze the molecular mechanisms for current generation by model exoelectrogenic bacteria, such as Shewanella oneidensis, limited information is available regarding the formation of current-generating biofilms over time under water-flow conditions. The present study developed electrochemical flow cells and used them to examine the electrochemical and structural features of

Structures, Compositions, and Activities of Live Shewanella Biofilms Formed on Graphite Electrodes in Electrochemical Flow Cells.

PubMed

Kitayama, Miho; Koga, Ryota; Kasai, Takuya; Kouzuma, Atsushi; Watanabe, Kazuya

2017-09-01

An electrochemical flow cell equipped with a graphite working electrode (WE) at the bottom was inoculated with Shewanella oneidensis MR-1 expressing an anaerobic fluorescent protein, and biofilm formation on the WE was observed over time during current generation at WE potentials of +0.4 and 0 V (versus standard hydrogen electrodes), under electrolyte-flow conditions. Electrochemical analyses suggested the presence of unique electron-transfer mechanisms in the +0.4-V biofilm. Microscopic analyses revealed that, in contrast to aerobic biofilms, current-generating biofilm (at +0.4 V) was thin and flat (∼10 μm in thickness), and cells were evenly and densely distributed in the biofilm. In contrast, cells were unevenly distributed in biofilm formed at 0 V. In situ fluorescence staining and biofilm recovery experiments showed that the amounts of extracellular polysaccharides (EPSs) in the +0.4-V biofilm were much smaller than those in the aerobic and 0-V biofilms, suggesting that Shewanella cells suppress the production of EPSs at +0.4 V under flow conditions. We suggest that Shewanella cells perceive electrode potentials and modulate the structure and composition of biofilms to efficiently transfer electrons to electrodes. IMPORTANCE A promising application of microbial fuel cells (MFCs) is to save energy in wastewater treatment. Since current is generated in these MFCs by biofilm microbes under horizontal flows of wastewater, it is important to understand the mechanisms for biofilm formation and current generation under water-flow conditions. Although massive work has been done to analyze the molecular mechanisms for current generation by model exoelectrogenic bacteria, such as Shewanella oneidensis , limited information is available regarding the formation of current-generating biofilms over time under water-flow conditions. The present study developed electrochemical flow cells and used them to examine the electrochemical and structural features of current

c-Type Cytochrome-Dependent Formation of U(IV) Nanoparticles by Shewanella oneidensis

PubMed Central

Marshall, Matthew J; Dohnalkova, Alice C; Kennedy, David W; Shi, Liang; Wang, Zheming; Boyanov, Maxim I; Lai, Barry; Kemner, Kenneth M; McLean, Jeffrey S; Reed, Samantha B; Culley, David E; Bailey, Vanessa L; Simonson, Cody J; Saffarini, Daad A; Romine, Margaret F; Zachara, John M

2006-01-01

Modern approaches for bioremediation of radionuclide contaminated environments are based on the ability of microorganisms to effectively catalyze changes in the oxidation states of metals that in turn influence their solubility. Although microbial metal reduction has been identified as an effective means for immobilizing highly-soluble uranium(VI) complexes in situ, the biomolecular mechanisms of U(VI) reduction are not well understood. Here, we show that c-type cytochromes of a dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, are essential for the reduction of U(VI) and formation of extracelluar UO 2 nanoparticles. In particular, the outer membrane (OM) decaheme cytochrome MtrC (metal reduction), previously implicated in Mn(IV) and Fe(III) reduction, directly transferred electrons to U(VI). Additionally, deletions of mtrC and/or omcA significantly affected the in vivo U(VI) reduction rate relative to wild-type MR-1. Similar to the wild-type, the mutants accumulated UO 2 nanoparticles extracellularly to high densities in association with an extracellular polymeric substance (EPS). In wild-type cells, this UO 2-EPS matrix exhibited glycocalyx-like properties and contained multiple elements of the OM, polysaccharide, and heme-containing proteins. Using a novel combination of methods including synchrotron-based X-ray fluorescence microscopy and high-resolution immune-electron microscopy, we demonstrate a close association of the extracellular UO 2 nanoparticles with MtrC and OmcA (outer membrane cytochrome). This is the first study to our knowledge to directly localize the OM-associated cytochromes with EPS, which contains biogenic UO 2 nanoparticles. In the environment, such association of UO 2 nanoparticles with biopolymers may exert a strong influence on subsequent behavior including susceptibility to oxidation by O 2 or transport in soils and sediments. PMID:16875436

Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

The genus Shewanella: from the briny depths below to human pathogen.

PubMed

Janda, J Michael; Abbott, Sharon L

2014-11-01

The genus Shewanella is currently composed of more than 50 species that inhabit a range of marine environs and ecosystems. Several members of this genus, including S. oneidensis, have been identified that could potentially play key roles in environmental processes such as bioremediation of toxic elements and heavy metals and serving as microbial fuel cells. In contrast to this beneficial role, shewanellae are increasingly being implicated as human pathogens in persons exposed through occupational or recreational activities to marine niches containing shewanellae. Documented illnesses linked to Shewanella include skin and soft tissue infections, bacteremia, and otitis media. At present, it is unclear exactly how many Shewanella species are truly bona fide human pathogens. Recent advances in the taxonomy and phylogenetic relatedness of members of this genus, however, support the concept that most human infections are caused by a single species, S. algae. Some phylogenetic data further suggest that some current members of the genus are not true Shewanella species sensu stricto. The current review summarizes our present knowledge of the distribution, epidemiology, disease spectrum, and identification of microbial species focusing on a clinical perspective.

Purification and Characterization of [NiFe]-Hydrogenase of Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Liang; Belchik, Sara M.; Plymale, Andrew E.

2011-08-02

The γ-proteobacterium Shewanella oneidensis MR-1 possesses a periplasmic [NiFe]-hydrogenase (MR-1 [NiFe]-H2ase) that was implicated in both H2 production and oxidation as well as technetium [Tc(VII)] reduction. To characterize the roles of MR-1 [NiFe]-H2ase in these proposed reactions, the genes encoding both subunits of MR-1 [NiFe]-H2ase were cloned into a protein expression vector. The resulting plasmid was transformed into a MR-1 mutant deficient in H2 formation. Expression of MR-1 [NiFe]-H2ase in trans restored the mutant’s ability to produce H2 at 37% of that for wild type. Following expression, MR-1 [NiFe]-H2ase was purified to near homogeneity. The purified MR-1 [NiFe]-H2ase could couplemore » H2 oxidation to reduction of Tc(VII) and methyl viologen directly. Change of the buffers used affected MR-1 [NiFe]-H2ase-mediated Tc(VII) but not methyl viologen reductions. Under the conditions tested, Tc(VII) reduction was complete in Tris buffer but not in HEPES buffer. The reduced Tc(IV) was soluble in Tris buffer but insoluble in HEPES buffer. Transmission electron microscopy analysis revealed that Tc(IV) precipitates formed in HEPES buffer were packed with crystallites. Although X-ray absorption near-edge spectroscopy measurements confirmed that the reduction products found in both buffers were Tc(IV), extended X-ray adsorption fine-structure measurements revealed that these products were very different. While the product in Tris buffer could not be determined, the Tc(IV) product in HEPES buffer was very similar to Tc(IV)O2•nH2O. These results shows for the first time that MR-1 [NiFe]-H2ase is a bidirectional enzyme that catalyzes both H2 formation and oxidation as well as Tc(VII) reduction directly by coupling H2 oxidation.« less

Targeted Protein Degradation of Outer Membrane Decaheme Cytochrome MtrC Metal Reductase in Shewanella oneidensis MR-1 Measured Using Biarsenical Probe CrAsH-EDT2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiong, Yijia; Chen, Baowei; Shi, Liang

2011-10-14

Development of efficient microbial biofuel cells requires an ability to exploit interfacial electron transfer reactions to external electron acceptors, such as metal oxides; such reactions occur in the facultative anaerobic gram-negative bacterium Shewanella oneidensis MR-1 through the catalytic activity of the outer membrane decaheme c-type cytochrome MtrC. Central to the utility of this pathway to synthetic biology is an understanding of cellular mechanisms that maintain optimal MtrC function, cellular localization, and renewal by degradation and resynthesis. In order to monitor trafficking to the outer membrane, and the environmental sensitivity of MtrC, we have engineered a tetracysteine tag (i.e., CCPGCC) atmore » its C-terminus that permits labeling by the cell impermeable biarsenical fluorophore, carboxy-FlAsH (CrAsH) of MtrC at the surface of living Shewanella oneidensis MR-1 cells. In comparison, the cell permeable reagent FlAsH permits labeling of the entire population of MtrC, including proteolytic fragments resulting from incorrect maturation. We demonstrate specific labeling by CrAsH of engineered MtrC which is dependent on the presence of a functional type-2 secretion system (T2S), as evidenced by T2S system gspD or gspG deletion mutants which are incapable of CrAsH labeling. Under these latter conditions, MtrC undergoes proteolytic degradation to form a large 35-38 kDa fragment; this degradation product is also resolved during normal turnover of the CrAsH-labeled MtrC protein. No MtrC protein is released into the medium during turnover, suggesting the presence of cellular turnover systems involving MtrC reuptake and degradation. The mature MtrC localized on the outer membrane is a long-lived protein, with a turnover rate of 0.043 hr-1 that is insensitive to O2 concentration. Maturation of MtrC is relatively inefficient, with substantial rates of turnover of the immature protein prior to export to the outer membrane (i.e., 0.028 hr-1) that are

Particle size effect and the mechanism of hematite reduction by the outer membrane cytochrome OmcA of Shewanella oneidensis MR-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Juan; Pearce, Carolyn I.; Shi, Liang

The cycling of iron at the Earth’s near surface is profoundly influenced by dissimilatory metal reducing microorganisms, and many studies have focused on unraveling electron transfer mechanisms between these bacteria and Fe(III)-(oxyhydr)oxides. However, these efforts have been complicated by the fact that these minerals often occur in the micro- to nanosize regime, and in relevant natural environments as well as in the laboratory are subject to aggregation. The nature of the physical interface between the cellular envelope, the outer-membrane cytochromes responsible for facilitating the interfacial electron transfer step, and these complex mineral particulates is thus difficult to probe. Previous studiesmore » using whole cells have reported reduction rates that do not correlate with particle size. In the present study we isolate the interaction between the decaheme outer-membrane cytochrome OmcA of Shewanella oneidensis and nanoparticulate hematite, examining the reduction rate as a function of particle size and reaction products through detailed characterization of the electron balance and the structure and valence of iron at particle surfaces. By comparison with abiotic reduction via the smaller molecule ascorbic acid, we show that the reduction rate is systematically controlled by the sterically accessible interfacial contact area between OmcA and hematite in particle aggregates; rates increase once pore throat sizes in aggregates become as large as OmcA. Simultaneous measure of OmcA oxidation against Fe(II) release shows a ratio of 1:10, consistent with a cascade OmcA oxidation mechanism heme by heme. X-ray absorption spectroscopies reveal incipient magnetite on the reacted surfaces of the hematite nanoparticles after reaction. The collective findings establish the importance of accessibility of physical contact between the terminal reductases and iron oxide surfaces, and through apparent consistency of observations help reconcile behavior reported at the

Particle size effect and the mechanism of hematite reduction by the outer membrane cytochrome OmcA of Shewanella oneidensis MR-1

NASA Astrophysics Data System (ADS)

Liu, Juan; Pearce, Carolyn I.; Shi, Liang; Wang, Zheming; Shi, Zhi; Arenholz, Elke; Rosso, Kevin M.

2016-11-01

The cycling of iron at the Earth's near surface is profoundly influenced by dissimilatory metal reducing microorganisms, and many studies have focused on unraveling electron transfer mechanisms between these bacteria and Fe(III)-(oxyhydr)oxides. However, these efforts have been complicated by the fact that these minerals often occur in the micro- to nanosize regime, and in relevant natural environments as well as in the laboratory are subject to aggregation. The nature of the physical interface between the cellular envelope, the outer-membrane cytochromes responsible for facilitating the interfacial electron transfer step, and these complex mineral particulates is thus difficult to probe. Previous studies using whole cells have reported reduction rates that do not correlate with particle size. In the present study we isolate the interaction between the decaheme outer-membrane cytochrome OmcA of Shewanella oneidensis and nanoparticulate hematite, examining the reduction rate as a function of particle size and reaction products through detailed characterization of the electron balance and the structure and valence of iron at particle surfaces. By comparison with abiotic reduction via the smaller molecule ascorbic acid, we show that the reduction rate is systematically controlled by the sterically accessible interfacial contact area between OmcA and hematite in particle aggregates; rates increase once pore throat sizes in aggregates become as large as OmcA. Simultaneous measure of OmcA oxidation against Fe(II) release shows a ratio of 1:10, consistent with a cascade OmcA oxidation mechanism heme by heme. X-ray absorption spectroscopies reveal incipient magnetite on the reacted surfaces of the hematite nanoparticles after reaction. The collective findings establish the importance of accessibility of physical contact between the terminal reductases and iron oxide surfaces, and through apparent consistency of observations help reconcile behavior reported at the larger

Extracellular Polymeric Substances from Shewanella sp. HRCR-1 Biofilms: Characterization by Infrared Spectroscopy and Proteomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao, Bin; Shi, Liang; Brown, Roslyn N.

This study characterizes the composition of extracellular polymeric substances (EPS) from Shewanella sp. HRCR-1 biofilms to provide insight into potential interactions of EPS with redox-active metals and radionuclides. Both bound and loosely associated EPS were extracted from Shewanella sp. HRCR-1 biofilms prepared using a hollow-fiber membrane biofilm reactor (HfMBR). FTIR spectra revealed the presence of proteins, polysaccharides, nucleic acids, membrane lipids, and fatty acids in both bound and loosely associated EPS. Using a global proteomic approach, a total of 58 extracellular and outer membrane proteins were identified in the EPS. These included homologues of multiple S. oneidensis MR-1 proteins thatmore » potentially contribute to key physiological biofilm processes, such as biofilm-promoting protein BpfA, surface-associated serine protease, nucleotidases (CpdB and UshA), an extracellular lipase, and oligopeptidases (PtrB and a M13 family oligopeptidase lipoprotein). In addition, 20 redox proteins were found in extracted EPS. Among the detected redox proteins were the homologues of two S. oneidensis MR-1 c-type cytochromes, MtrC and OmcA, which have been implicated in extracellular electron transfer. Given their detection in the EPS of Shewanella sp. HRCR 1 biofilms, c-type cytochromes may contribute to the possible redox activity of the biofilm matrix and play important roles in extracellular electron transfer reactions.« less

Enhanced performance of hexavalent chromium reducing cathodes in the presence of Shewanella oneidensis MR-1 and lactate.

PubMed

Xafenias, Nikolaos; Zhang, Yue; Banks, Charles J

2013-05-07

Biocathodes for the reduction of the highly toxic hexavalent chromium (Cr(VI)) were investigated using Shewanella oneidensis MR-1 (MR-1) as a biocatalyst and performance was assessed in terms of current production and Cr(VI) reduction. Potentiostatically controlled experiments (-500 mV vs Ag/AgCl) showed that a mediatorless MR-1 biocathode started up under aerated conditions in the presence of lactate, received 5.5 and 1.7 times more electrons for Cr(VI) reduction over a 4 h operating period than controls without lactate and with lactate but without MR-1, respectively. Cr(VI) reduction was also enhanced, with a decrease in concentration over the 4 h operating period of 9 mg/L Cr(VI), compared to only 1 and 3 mg/L, respectively, in the controls. Riboflavin, an electron shuttle mediator naturally produced by MR-1, was also found to have a positive impact in potentiostatically controlled cathodes. Additionally, a microbial fuel cell (MFC) with MR-1 and lactate present in both anode and cathode produced a maximum current density of 32.5 mA/m(2) (1000 Ω external load) after receiving a 10 mg/L Cr(VI) addition in the cathode, and cathodic efficiency increased steadily over an 8 day operation period with successive Cr(VI) additions. In conclusion, effective and continuous Cr(VI) reduction with associated current production were achieved when MR-1 and lactate were both present in the biocathodes.

Identification of Shewanella baltica as the most important H2S-producing species during iced storage of Danish marine fish.

PubMed

Fonnesbech Vogel, Birte; Venkateswaran, Kasthuri; Satomi, Masataka; Gram, Lone

2005-11-01

Shewanella putrefaciens has been considered the main spoilage bacteria of low-temperature stored marine seafood. However, psychrotropic Shewanella have been reclassified during recent years, and the purpose of the present study was to determine whether any of the new Shewanella species are important in fish spoilage. More than 500 H2S-producing strains were isolated from iced stored marine fish (cod, plaice, and flounder) caught in the Baltic Sea during winter or summer time. All strains were identified as Shewanella species by phenotypic tests. Different Shewanella species were present on newly caught fish. During the warm summer months the mesophilic human pathogenic S. algae dominated the H2S-producing bacterial population. After iced storage, a shift in the Shewanella species was found, and most of the H2S-producing strains were identified as S. baltica. The 16S rRNA gene sequence analysis confirmed the identification of these two major groups. Several isolates could only be identified to the genus Shewanella level and were separated into two subgroups with low (44%) and high (47%) G+C mol%. The low G+C% group was isolated during winter months, whereas the high G+C% group was isolated on fish caught during summer and only during the first few days of iced storage. Phenotypically, these strains were different from the type strains of S. putrefaciens, S. oneidensis, S. colwelliana, and S. affinis, but the high G+C% group clustered close to S. colwelliana by 16S rRNA gene sequence comparison. The low G+C% group may constitute a new species. S. baltica, and the low G+C% group of Shewanella spp. strains grew well in cod juice at 0 degrees C, but three high G+C Shewanella spp. were unable to grow at 0 degrees C. In conclusion, the spoilage reactions of iced Danish marine fish remain unchanged (i.e., trimethylamine-N-oxide reduction and H2S production); however, the main H2S-producing organism was identified as S. baltica.

Impaired cell envelope resulting from arcA mutation largely accounts for enhanced sensitivity to hydrogen peroxide in Shewanella oneidensis

PubMed Central

Wan, Fen; Mao, Yinting; Dong, Yangyang; Ju, Lili; Wu, Genfu; Gao, Haichun

2015-01-01

Oxidative stress is one of the major challenges that Shewanella encounter routinely because they thrive in redox-stratified environments prone to reactive oxygen species (ROS) formation, letting alone that ROS can be generated endogenously. As respiration is the predominant process for endogenous ROS, regulators mediating respiration have been demonstrated and/or implicated to play a role in oxidative stress response. In our efforts to unveil the involvement of global regulators for respiration in the oxidative stress response, we found that loss of the Arc system increases S. oneidensis sensitivity to H2O2 whereas neither Fnr nor Crp has a significant role. A comparison of transcriptomic profiles of the wild-type and its isogenic arcA mutant revealed that the OxyR regulon is independent of the Arc system. We then provided evidence that the enhanced H2O2 sensitivity of the arcA mutant is due to an increased H2O2 uptake rate, a result of a cell envelope defect. Although one of three proteases of the ArcA regulon when in excess is partially accountable for the envelope defect, the major contributors remain elusive. Overall, our data indicate that the Arc system influences the bacterial cell envelope biosynthesis, a physiological aspect that has not been associated with the regulator before. PMID:25975178

Purification and Characterization of the [NiFe]-Hydrogenase of Shewanella oneidensis MR-1 ▿

PubMed Central

Shi, Liang; Belchik, Sara M.; Plymale, Andrew E.; Heald, Steve; Dohnalkova, Alice C.; Sybirna, Kateryna; Bottin, Hervé; Squier, Thomas C.; Zachara, John M.; Fredrickson, James K.

2011-01-01

Shewanella oneidensis MR-1 possesses a periplasmic [NiFe]-hydrogenase (MR-1 [NiFe]-H2ase) that has been implicated in H2 production and oxidation as well as technetium [Tc(VII)] reduction. To characterize the roles of MR-1 [NiFe]-H2ase in these proposed reactions, the genes encoding both subunits of MR-1 [NiFe]-H2ase were cloned and then expressed in an MR-1 mutant without hyaB and hydA genes. Expression of recombinant MR-1 [NiFe]-H2ase in trans restored the mutant's ability to produce H2 at 37% of that for the wild type. Following purification, MR-1 [NiFe]-H2ase coupled H2 oxidation to reduction of Tc(VII)O4− and methyl viologen. Change of the buffers used affected MR-1 [NiFe]-H2ase-mediated reduction of Tc(VII)O4− but not methyl viologen. Under the conditions tested, all Tc(VII)O4− used was reduced in Tris buffer, while in HEPES buffer, only 20% of Tc(VII)O4− was reduced. The reduced products were soluble in Tris buffer but insoluble in HEPES buffer. Transmission electron microscopy analysis revealed that Tc precipitates reduced in HEPES buffer were aggregates of crystallites with diameters of ∼5 nm. Measurements with X-ray absorption near-edge spectroscopy revealed that the reduction products were a mixture of Tc(IV) and Tc(V) in Tris buffer but only Tc(IV) in HEPES buffer. Measurements with extended X-ray adsorption fine structure showed that while the Tc bonding environment in Tris buffer could not be determined, the Tc(IV) product in HEPES buffer was very similar to Tc(IV)O2·nH2O, which was also the product of Tc(VII)O4− reduction by MR-1 cells. These results shows for the first time that MR-1 [NiFe]-H2ase catalyzes Tc(VII)O4− reduction directly by coupling to H2 oxidation. PMID:21724888

Probing electron transfer mechanisms in Shewanella oneidensis MR-1 using a nanoelectrode platform and single-cell imaging

PubMed Central

Jiang, Xiaocheng; Hu, Jinsong; Fitzgerald, Lisa A.; Biffinger, Justin C.; Xie, Ping; Ringeisen, Bradley R.; Lieber, Charles M.

2010-01-01

Microbial fuel cells (MFCs) represent a promising approach for sustainable energy production as they generate electricity directly from metabolism of organic substrates without the need for catalysts. However, the mechanisms of electron transfer between microbes and electrodes, which could ultimately limit power extraction, remain controversial. Here we demonstrate optically transparent nanoelectrodes as a platform to investigate extracellular electron transfer in Shewanella oneidensis MR-1, where an array of nanoholes precludes or single window allows for direct microbe-electrode contacts. Following addition of cells, short-circuit current measurements showed similar amplitude and temporal response for both electrode configurations, while in situ optical imaging demonstrates that the measured currents were uncorrelated with the cell number on the electrodes. High-resolution imaging showed the presence of thin, 4- to 5-nm diameter filaments emanating from cell bodies, although these filaments do not appear correlated with current generation. Both types of electrodes yielded similar currents at longer times in dense cell layers and exhibited a rapid drop in current upon removal of diffusible mediators. Reintroduction of the original cell-free media yielded a rapid increase in current to ∼80% of original level, whereas imaging showed that the positions of > 70% of cells remained unchanged during solution exchange. Together, these measurements show that electron transfer occurs predominantly by mediated mechanism in this model system. Last, simultaneous measurements of current and cell positions showed that cell motility and electron transfer were inversely correlated. The ability to control and image cell/electrode interactions down to the single-cell level provide a powerful approach for advancing our fundamental understanding of MFCs. PMID:20837546

Characterization of the periplasmic redox network that sustains the versatile anaerobic metabolism of Shewanella oneidensis MR-1

PubMed Central

Alves, Mónica N.; Neto, Sónia E.; Alves, Alexandra S.; Fonseca, Bruno M.; Carrêlo, Afonso; Pacheco, Isabel; Paquete, Catarina M.; Soares, Cláudio M.; Louro, Ricardo O.

2015-01-01

The versatile anaerobic metabolism of the Gram-negative bacterium Shewanella oneidensis MR-1 (SOMR-1) relies on a multitude of redox proteins found in its periplasm. Most are multiheme cytochromes that carry electrons to terminal reductases of insoluble electron acceptors located at the cell surface, or bona fide terminal reductases of soluble electron acceptors. In this study, the interaction network of several multiheme cytochromes was explored by a combination of NMR spectroscopy, activity assays followed by UV-visible spectroscopy and comparison of surface electrostatic potentials. From these data the small tetraheme cytochrome (STC) emerges as the main periplasmic redox shuttle in SOMR-1. It accepts electrons from CymA and distributes them to a number of terminal oxidoreductases involved in the respiration of various compounds. STC is also involved in the electron transfer pathway to reduce nitrite by interaction with the octaheme tetrathionate reductase (OTR), but not with cytochrome c nitrite reductase (ccNiR). In the main pathway leading the metal respiration STC pairs with flavocytochrome c (FccA), the other major periplasmic cytochrome, which provides redundancy in this important pathway. The data reveals that the two proteins compete for the binding site at the surface of MtrA, the decaheme cytochrome inserted on the periplasmic side of the MtrCAB–OmcA outer-membrane complex. However, this is not observed for the MtrA homologues. Indeed, neither STC nor FccA interact with MtrD, the best replacement for MtrA, and only STC is able to interact with the decaheme cytochrome DmsE of the outer-membrane complex DmsEFABGH. Overall, these results shown that STC plays a central role in the anaerobic respiratory metabolism of SOMR-1. Nonetheless, the trans-periplasmic electron transfer chain is functionally resilient as a consequence of redundancies that arise from the presence of alternative pathways that bypass/compete with STC. PMID:26175726

Iron triggers λSo prophage induction and release of extracellular DNA in Shewanella oneidensis MR-1 biofilms.

PubMed

Binnenkade, Lucas; Teichmann, Laura; Thormann, Kai M

2014-09-01

Prophages are ubiquitous elements within bacterial chromosomes and affect host physiology and ecology in multiple ways. We have previously demonstrated that phage-induced lysis is required for extracellular DNA (eDNA) release and normal biofilm formation in Shewanella oneidensis MR-1. Here, we investigated the regulatory mechanisms of prophage λSo spatiotemporal induction in biofilms. To this end, we used a functional fluorescence fusion to monitor λSo activation in various mutant backgrounds and in response to different physiological conditions. λSo induction occurred mainly in a subpopulation of filamentous cells in a strictly RecA-dependent manner, implicating oxidative stress-induced DNA damage as the major trigger. Accordingly, mutants affected in the oxidative stress response (ΔoxyR) or iron homeostasis (Δfur) displayed drastically increased levels of phage induction and abnormal biofilm formation, while planktonic cells were not or only marginally affected. To further investigate the role of oxidative stress, we performed a mutant screen and identified two independent amino acid substitutions in OxyR (T104N and L197P) that suppress induction of λSo by hydrogen peroxide (H2O2). However, λSo induction was not suppressed in biofilms formed by both mutants, suggesting a minor role of intracellular H2O2 in this process. In contrast, addition of iron to biofilms strongly enhanced λSo induction and eDNA release, while both processes were significantly suppressed at low iron levels, strongly indicating that iron is the limiting factor. We conclude that uptake of iron during biofilm formation triggers λSo-mediated lysis of a subpopulation of cells, likely by an increase in iron-mediated DNA damage sensed by RecA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Effect of biofilm coatings at metal-oxide/water interfaces I: Pb(II) and Zn(II) partitioning and speciation at Shewanella oneidensis/metal-oxide/water interfaces

DOE PAGES

Wang, Yingge; Gelabert, Alexandre; Michel, F. Marc; ...

2016-05-30

Microbial biofilms are often present as coatings on metal-oxide surfaces in natural and industrial environments and may induce significant changes in the partitioning behavior and speciation of aqueous metal ions, which in turn can impact their transport and fate. In this study, long-period X-ray standing wave-fluorescence yield (LP-XSW-FY) spectroscopy was used to measure under in situ conditions the partitioning of aqueous Pb(II) and Zn(II) between multilayer Shewanella oneidensis MR-1 biofilms and highly polished, oriented single-crystal surfaces of α-Al 2O 3 and α-Fe 2O 3 as a function of metal-ion concentration and time at pH 6.0. We show that after 3-hmore » exposure time, Pb(II) binds preferentially to the alpha-Al 2O 3 (1-102) and α-Fe 2O 3 (0001) surfaces at low Pb concentration ([Pb] = 10 –7 M) and then increasingly partitions into the biofilm coatings at higher concentrations (10 –6 to 10 –4 M). In contrast, Zn(II) partitions preferentially into the biofilm coating for both surfaces at all Zn concentrations studied (10 –7 to 10 –4 M). In comparison, the α-Al 2O 3 (0001) surface has a low affinity for both Pb(II) and Zn(II), and the biofilm coatings are the dominant sink for both ions. These findings suggest that in the presence of S. oneidensis biofilm coatings, α-Al 2O 3 (0001) is the least reactive surface for Pb(II) and Zn(II) compared to α-Al 2O 3 (1-102) and α-Fe 2O 3 (0001). They also show that Zn(II) has a lower affinity than Pb(II) for reactive sites on α-Al 2O 3 (1-102) and α-Fe 2O 3 (0001) at [Me(II)] of 10 –7 M; at 10 –5 M, the bulk of the metal ions partition into the biofilm coatings. At longer exposure times (20-24 h), both Pb(II) and Zn(II) increasingly partition to the metal-oxide surfaces at [Me(II)] = 10 –5 M and pH 6.0, indicating possible reaction/diffusion-controlled sorption processes. Pb L-III-edge and Zn K-edge grazing-incidence extended X-ray absorption fine structure (GI-EXAFS) measurements suggest

Effect of biofilm coatings at metal-oxide/water interfaces I: Pb(II) and Zn(II) partitioning and speciation at Shewanella oneidensis/metal-oxide/water interfaces

NASA Astrophysics Data System (ADS)

Wang, Yingge; Gélabert, Alexandre; Michel, F. Marc; Choi, Yongseong; Gescher, Johannes; Ona-Nguema, Georges; Eng, Peter J.; Bargar, John R.; Farges, Francois; Spormann, Alfred M.; Brown, Gordon E.

2016-09-01

Microbial biofilms are often present as coatings on metal-oxide surfaces in natural and industrial environments and may induce significant changes in the partitioning behavior and speciation of aqueous metal ions, which in turn can impact their transport and fate. In this study, long-period X-ray standing wave-fluorescence yield (LP-XSW-FY) spectroscopy was used to measure under in situ conditions the partitioning of aqueous Pb(II) and Zn(II) between multilayer Shewanella oneidensis MR-1 biofilms and highly polished, oriented single-crystal surfaces of α-Al2O3 and α-Fe2O3 as a function of metal-ion concentration and time at pH 6.0. We show that after 3-h exposure time, Pb(II) binds preferentially to the α-Al2O3 (1-102) and α-Fe2O3 (0 0 0 1) surfaces at low Pb concentration ([Pb] = 10-7 M) and then increasingly partitions into the biofilm coatings at higher concentrations (10-6 to 10-4 M). In contrast, Zn(II) partitions preferentially into the biofilm coating for both surfaces at all Zn concentrations studied (10-7 to 10-4 M). In comparison, the α-Al2O3 (0 0 0 1) surface has a low affinity for both Pb(II) and Zn(II), and the biofilm coatings are the dominant sink for both ions. These findings suggest that in the presence of S. oneidensis biofilm coatings, α-Al2O3 (0 0 0 1) is the least reactive surface for Pb(II) and Zn(II) compared to α-Al2O3 (1-102) and α-Fe2O3 (0 0 0 1). They also show that Zn(II) has a lower affinity than Pb(II) for reactive sites on α-Al2O3 (1-102) and α-Fe2O3 (0 0 0 1) at [Me(II)] of 10-7 M; at 10-5 M, the bulk of the metal ions partition into the biofilm coatings. At longer exposure times (20-24 h), both Pb(II) and Zn(II) increasingly partition to the metal-oxide surfaces at [Me(II)] = 10-5 M and pH 6.0, indicating possible reaction/diffusion-controlled sorption processes. Pb LIII-edge and Zn K-edge grazing-incidence extended X-ray absorption fine structure (GI-EXAFS) measurements suggest that both Pb(II) and Zn(II) ions may be

In Situ Characterization of Shewanella oneidensis MR1 Biofilms by SALVI and ToF-SIMS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komorek, Rachel; Wei, Wenchao; Yu, Xiaofei

Bacterial biofilms are surface-associated communities that are vastly studied to understand their self-produced extracellular polymeric substances (EPS) and their roles in environmental microbiology. This study outlines a method to cultivate biofilm attachment to the System for Analysis at the Liquid Vacuum Interface (SALVI) and achieve in situ chemical mapping of a living biofilm by time-of-flight secondary ion mass spectrometry (ToF-SIMS). This is done through the culturing of bacteria both outside and within the SALVI channel with our specialized setup, as well as through optical imaging techniques to detect the biofilm presence and thickness before ToF-SIMS analysis. Our results show themore » characteristic peaks of the Shewanella biofilm in its natural hydrated state, highlighting upon its localized water cluster environment, as well as EPS fragments, which are drastically different from the same biofilm’s dehydrated state. These results demonstrate the breakthrough capability of SALVI that allows for in situ biofilm imaging with a vacuum-based chemical imaging instrument.« less

Tolerance of anaerobic bacteria to chlorinated solvents.

PubMed

Koenig, Joanna C; Groissmeier, Kathrin D; Manefield, Mike J

2014-01-01

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation.

Combined effect of loss of the caa3 oxidase and Crp regulation drives Shewanella to thrive in redox-stratified environments.

PubMed

Zhou, Guangqi; Yin, Jianhua; Chen, Haijiang; Hua, Yijie; Sun, Linlin; Gao, Haichun

2013-09-01

Shewanella species are a group of facultative Gram-negative microorganisms with remarkable respiration abilities that allow the use of a diverse array of terminal electron acceptors (EA). Like most bacteria, S. oneidensis possesses multiple terminal oxidases, including two heme-copper oxidases (caa3- and cbb3-type) and a bd-type quinol oxidase. As aerobic respiration is energetically favored, mechanisms underlying the fact that these microorganisms thrive in redox-stratified environments remain vastly unexplored. In this work, we discovered that the cbb3-type oxidase is the predominant system for respiration of oxygen (O2), especially when O2 is abundant. Under microaerobic conditions, the bd-type quinol oxidase has a significant role in addition to the cbb3-type oxidase. In contrast, multiple lines of evidence suggest that under test conditions the caa3-type oxidase, an analog to the mitochondrial enzyme, has no physiological significance, likely because of its extremely low expression. In addition, expression of both cbb3- and bd-type oxidases is under direct control of Crp (cAMP receptor protein) but not the well-established redox regulator Fnr (fumarate nitrate regulator) of canonical systems typified in Escherichia coli. These data, collectively, suggest that adaptation of S. oneidensis to redox-stratified environments is likely due to functional loss of the caa3-type oxidase and switch of the regulatory system for respiration.

Species-dependent hydrodynamics of flagellum-tethered bacteria in early biofilm development.

PubMed

Bennett, Rachel R; Lee, Calvin K; De Anda, Jaime; Nealson, Kenneth H; Yildiz, Fitnat H; O'Toole, George A; Wong, Gerard C L; Golestanian, Ramin

2016-02-01

Monotrichous bacteria on surfaces exhibit complex spinning movements. Such spinning motility is often a part of the surface detachment launch sequence of these cells. To understand the impact of spinning motility on bacterial surface interactions, we develop a hydrodynamic model of a surface-bound bacterium, which reproduces behaviours that we observe in Pseudomonas aeruginosa, Shewanella oneidensis and Vibrio cholerae, and provides a detailed dictionary for connecting observed spinning behaviour to bacteria-surface interactions. Our findings indicate that the fraction of the flagellar filament adhered to the surface, the rotation torque of this appendage, the flexibility of the flagellar hook and the shape of the bacterial cell dictate the likelihood that a microbe will detach and the optimum orientation that it should have during detachment. These findings are important for understanding species-specific reversible attachment, the key transition event between the planktonic and biofilm lifestyle for motile, rod-shaped organisms. © 2016 The Author(s).

Shewanella oneidensis cytochrome c nitrite reductase (ccNiR) does not disproportionate hydroxylamine to ammonia and nitrite, despite a strongly favorable driving force.

PubMed

Youngblut, Matthew; Pauly, Daniel J; Stein, Natalia; Walters, Daniel; Conrad, John A; Moran, Graham R; Bennett, Brian; Pacheco, A Andrew

2014-04-08

Cytochrome c nitrite reductase (ccNiR) from Shewanella oneidensis, which catalyzes the six-electron reduction of nitrite to ammonia in vivo, was shown to oxidize hydroxylamine in the presence of large quantities of this substrate, yielding nitrite as the sole free nitrogenous product. UV-visible stopped-flow and rapid-freeze-quench electron paramagnetic resonance data, along with product analysis, showed that the equilibrium between hydroxylamine and nitrite is fairly rapidly established in the presence of high initial concentrations of hydroxylamine, despite said equilibrium lying far to the left. By contrast, reduction of hydroxylamine to ammonia did not occur, even though disproportionation of hydroxylamine to yield both nitrite and ammonia is strongly thermodynamically favored. This suggests a kinetic barrier to the ccNiR-catalyzed reduction of hydroxylamine to ammonia. A mechanism for hydroxylamine reduction is proposed in which the hydroxide group is first protonated and released as water, leaving what is formally an NH2(+) moiety bound at the heme active site. This species could be a metastable intermediate or a transition state but in either case would exist only if it were stabilized by the donation of electrons from the ccNiR heme pool into the empty nitrogen p orbital. In this scenario, ccNiR does not catalyze disproportionation because the electron-donating hydroxylamine does not poise the enzyme at a sufficiently low potential to stabilize the putative dehydrated hydroxylamine; presumably, a stronger reductant is required for this.

Tolerance of Anaerobic Bacteria to Chlorinated Solvents

PubMed Central

Koenig, Joanna C.; Groissmeier, Kathrin D.; Manefield, Mike J.

2014-01-01

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

High Performance Heteroatoms Quaternary-doped Carbon Catalysts Derived from Shewanella Bacteria for Oxygen Reduction.

PubMed

Guo, Zhaoyan; Ren, Guangyuan; Jiang, Congcong; Lu, Xianyong; Zhu, Ying; Jiang, Lei; Dai, Liming

2015-11-25

A novel heteroatoms (N, P, S and Fe) quaternary-doped carbon (HQDC-X, X refers to the pyrolysis temperature) can be fabricated by directly pyrolyzing a gram-negative bacteria, S. oneidensis MR-1 as precursors at 800 °C, 900 °C and 1000 °C under argon atmosphere. These HQDC-X catalysts maintain the cylindrical shape of bacteria after pyrolysis under high temperatures, while heteroatoms including N, P, S and Fe distribute homogeneously on the carbon frameworks. As a result, HQDC-X catalysts exhibit excellent electrocatalytic activity for ORR via a dominant four-electron oxygen reduction pathway in alkaline medium, which is comparable with that of commercial Pt/C. More importantly, HQDC-X catalysts show better tolerance for methanol crossover and CO poisoning effects, long-term durability than commercial Pt/C, which could be promising alternatives to costly Pt-based electrocatalysts for ORR. The method may provide a promising avenue to develop cheap ORR catalysts from inexpensive, scalable and biological recursors.

Effect of biofilm coatings at metal-oxide/water interfaces II: Competitive sorption between Pb(II) and Zn(II) at Shewanella oneidensis/metal-oxide/water interfaces

DOE PAGES

Wang, Yingge; Gelabert, Alexandre; Michel, F. Marc; ...

2016-05-07

Competitive sorption of Pb(II) and Zn(II) on Shewanella oneidensis MR-1 biofilm-coated single-crystal α-Al 2O 3 (1 –1 0 2) and α-Fe 2O 3 (0 0 0 1) surfaces was investigated using long-period X-ray standing wave-florescence yield (LP-XSW-FY) spectroscopy. In situ partitioning of aqueous Pb(II) and Zn(II) between the biofilms and underlying metal-oxide substrates was probed following exposure of these complex interfaces to equi-molar Pb and Zn solutions (0.01 M NaNO 3 as background electrolyte, pH = 6.0, and 3-h equilibration time). At higher Pb and Zn concentrations (≥10 –5 M), more than 99% of these ions partitioned into the biofilmsmore » at S. oneidensis/α-Al 2O 3 (1 –1 0 2)/water interfaces, which is consistent with the partitioning behavior of both Pb(II) or Zn(II) in single-metal-ion experiments. Furthermore, no apparent competitive effects were found in this system at these relatively high metal-ion concentrations. However, at lower equi-molar concentrations (≤10 –6 M), Pb(II) and Zn(II) partitioning in the same system changed significantly compared to the single-metal-ion systems. The presence of Zn(II) decreased Pb(II) partitioning onto α-Al 2O 3 (1 –1 0 2) substantially (~52% to ~13% at 10 –7 M, and ~23% to ~5% at 10–6 M), whereas the presence of Pb(II) caused more Zn(II) to partition onto α-Al 2O 3 (1 –1 0 2) surfaces (~15% to ~28% at 10 –7 M, and ~1% to ~7% at 10 –6 M) .The higher observed partitioning of Zn(II) (~28%) at the α-Al 2O 3 (1 –1 0 2) surfaces compared to Pb(II) (~13%) in the mixed-metal-ion systems at the lowest concentration (10 –7 M) suggests that Zn(II) is slightly favored over Pb(II) for sorption sites on α-Al 2O 3 (1 –1 0 2) surfaces under our experimental conditions.« less

Rapid Quantification of Mutant Fitness in Diverse Bacteria by Sequencing Randomly Bar-Coded Transposons

PubMed Central

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth

2015-01-01

ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644

Contributions of the [NiFe]- and [FeFe]-hydrogenase to H2 production in Shewanella oneidensis MR-1 as revealed by isotope ratio analysis of evolved H2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kreuzer, Helen W.; Hill, Eric A.; Moran, James J.

2014-03-01

Shewanella oneidensis MR-1 encodes both a [NiFe]- and an [FeFe]-hydrogenase. While the output of these proteins has been characterized in mutant strains expressing only one of the enzymes, the contribution of each to H2 synthesis in the wild-type organism is not clear. Here we use stable isotope analysis of H2 in the culture headspace, along with transcription data and measurements of the concentrations of gases in the headspace, to characterize H2 production in the wild-type strain. After most of the O2 in the headspace had been consumed, H2 was produced and then consumed by the bidirectional [NiFe]-hydrogenase. Once the culturesmore » were completely anaerobic, a new burst of H2 synthesis catalyzed by both enzymes took place. Our data is consistent with the hypothesis that at this point in the culture cycle, a pool of electrons is shunted toward both hydrogenases in the wild-type organism, but that in the absence of one of the hydrogenases, the flux is redirected to the available enzyme. To our knowledge, this is the first use of stable isotope analysis of a metabolic product to elucidate substrate flux through two alternative enzymes in the same cellular system.« less

In vitro enzymatic reduction kinetics of mineral oxides by membrane fractions from Shewanella oneidensis MR-1

NASA Astrophysics Data System (ADS)

Ruebush, Shane S.; Icopini, Gary A.; Brantley, Susan L.; Tien, Ming

2006-01-01

This study documents the first example of in vitro solid-phase mineral oxide reduction by enzyme-containing membrane fractions. Previous in vitro studies have only reported the reduction of aqueous ions. Total membrane (TM) fractions from iron-grown cultures of Shewanella oneidensis MR-1 were isolated and shown to catalyze the reduction of goethite, hematite, birnessite, and ramsdellite/pyrolusite using formate. In contrast, nicotinamide adenine dinucleotide (NADH) and succinate cannot function as electron donors. The significant implications of observations related to this cell-free system are: (i) both iron and manganese mineral oxides are reduced by the TM fraction, but aqueous U(VI) is not; (ii) TM fractions from anaerobically grown, but not aerobically grown, cells can reduce the mineral oxides; (iii) electron shuttles and iron chelators are not needed for this in vitro reduction, documenting conclusively that reduction can occur by direct contact with the mineral oxide; (iv) electron shuttles and EDTA stimulate the in vitro Fe(III) reduction, documenting that exogenous molecules can enhance rates of enzymatic mineral reduction; and (v) multiple membrane components are involved in solid-phase oxide reduction. The membrane fractions, consisting of liposomes of cytoplasmic and outer membrane segments, contain at least 100 proteins including the enzyme that oxidizes formate, formate dehydrogenase. Mineral oxide reduction was inhibited by the addition of detergent Triton X-100, which solubilizes membranes and their associated proteins, consistent with the involvement of multiple electron carriers that are disrupted by detergent addition. In contrast, formate dehydrogenase activity was not inhibited by Triton X-100. The addition of anthraquinone-2,6-disulfonate (AQDS) and menaquinone-4 was unable to restore activity; however, menadione (MD) restored 33% of the activity. The addition of AQDS and MD to reactions without added detergent increased the rate of goethite

Viability and metal reduction of Shewanella oneidensis MR-1 under CO2 stress: implications for ecological effects of CO2 leakage from geologic CO2 sequestration.

PubMed

Wu, Bing; Shao, Hongbo; Wang, Zhipeng; Hu, Yandi; Tang, Yinjie J; Jun, Young-Shin

2010-12-01

To study potential ecological impacts of CO(2) leakage to shallow groundwater and soil/sediments from geologic CO(2) sequestration (GCS) sites, this work investigated the viability and metal reduction of Shewanella oneidensis MR-1 under CO(2) stress. While MR-1 could grow under high-pressure nitrogen gas (500 psi), the mix of 1% CO(2) with N(2) at total pressures of 15 or 150 psi significantly suppressed the growth of MR-1, compared to the N(2) control. When CO(2) partial pressures were over 15 psi, the growth of MR-1 stopped. The reduced bacterial viability was consistent with the pH decrease and cellular membrane damage under high pressure CO(2). After exposure to 150 psi CO(2) for 5 h, no viable cells survived, the cellular contents were released, and microscopy images confirmed significant cell structure deformation. However, after a relatively short exposure (25 min) to 150 psi CO(2), MR-1 could fully recover their growth within 24 h after the stress was removed, and the reduction of MnO(2) by MR-1 was observed right after the stress was removed. Furthermore, MR-1 survived better if the cells were aggregated rather than suspended, or if pH buffering minerals, such as calcite, were present. To predict the cell viability under different CO(2) pressures and exposure times, a two-parameter mathematical model was developed.

Electrogenic Single-Species Biocomposites as Anodes for Microbial Fuel Cells.

PubMed

Kaiser, Patrick; Reich, Steffen; Leykam, Daniel; Willert-Porada, Monika; Greiner, Andreas; Freitag, Ruth

2017-07-01

Integration of electrogenic microorganisms remains a challenge in biofuel cell technology. Here, synthetic biocomposites ("artificial biofilms") are proposed. Bacteria (Shewanella oneidensis) are embedded in a hydrogel matrix (poly(vinyl alcohol)) via wet- and electrospinning, creating fibers and nonwoven gauzes. The bacteria remain viable and metabolically active. The performance is compared to S. oneidensis suspension cultures and "natural" biofilms. While lower than with the suspension cultures, the power output from the fuel cells with the artificial biofilms is higher than with the natural one. Handling, reproducibility, and stability are also better. Artificial biofilms can therefore contribute to resolving fundamental issues of design, scale up, and monosepsis in biofuel cell technology. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bioremediation of nanomaterials

DOEpatents

Chen, Frank Fanqing; Keasling, Jay D; Tang, Yinjie J

2013-05-14

The present invention provides a method comprising the use of microorganisms for nanotoxicity study and bioremediation. In some embodiment, the microorganisms are bacterial organisms such as Gram negative bacteria, which are used as model organisms to study the nanotoxicity of the fullerene compounds: E. coli W3110, a human related enterobacterium and Shewanella oneidensis MR-1, an environmentally important bacterium with versatile metabolism.

Shewanella canadensis sp. nov. and Shewanella atlantica sp. nov., manganese dioxide- and hexahydro-1,3,5-trinitro-1,3,5-triazine-reducing, psychrophilic marine bacteria.

PubMed

Zhao, Jian-Shen; Manno, Dominic; Thiboutot, Sonia; Ampleman, Guy; Hawari, Jalal

2007-09-01

Two strains belonging to the genus Shewanella, HAW-EB2(T) and HAW-EB5(T), were isolated previously from marine sediment sampled from the Atlantic Ocean, near Halifax harbour in Canada, for their potential to degrade explosive hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). In the present study, strains HAW-EB2(T) and HAW-EB5(T) were found to display high 16S rRNA gene sequence similarity (90-99.5 %) to species of Shewanella, but their gyrB sequences were significantly different from each other and from species of Shewanella (79-87.6 %). Furthermore, DNA-DNA hybridization showed that the genomic DNA of the two strains was only 22 % related and showed less than 41 % relatedness to closely related species of Shewanella. In comparison to other species of Shewanella, strains HAW-EB2(T) and HAW-EB5(T) were also unique in some phenotypic properties such as activities of beta-galactosidase and tyrosine arylamidase and the ability to metabolize certain organic acids and sugars. Both strains HAW-EB2(T) and HAW-EB5(T) utilize malate, valerate, peptone and yeast extract as sole carbon and energy sources. The major membrane fatty acids of the two strains were C(14 : 0), iso-C(15 : 0), C(16 : 0), C(16 : 1)omega7, C(18 : 1)omega7 and C(20 : 5)omega3 and their major quinones were Q-7, Q-8 and MK-7. On the basis of these results, strain HAW-EB2(T) (=NCIMB 14238(T) =CCUG 54553(T)) is proposed as the type strain of Shewanella canadensis sp. nov. and strain HAW-EB5(T) (=NCIMB 14239(T) =CCUG 54554(T)) is proposed as the type strain of Shewanella atlantica sp. nov.

Current trends of human infections and antibiotic resistance of the genus Shewanella.

PubMed

Yousfi, K; Bekal, S; Usongo, V; Touati, A

2017-08-01

Shewanella spp. are commonly known as environmental bacteria and are most frequently isolated from aquatic areas. Currently, diseases syndromes and multidrug resistance have increasingly been reported in the genus Shewanella. Some species are associated with various infections, such as skin and soft tissue infections, as well as bacteremia. Generally, these bacteria are opportunistic and mostly affect people with an impaired immune system. This genus is also a probable vehicle and progenitor of antibiotic resistance genes. In fact, several resistance genes and mobile genetic elements have been identified in some resistant species isolated from environmental or clinical settings. These genes confer resistance to different antibiotic classes, including those used in therapies such as β-lactams and quinolones, and are generally located on the chromosome. Recently, a multidrug-resistant (MDR) plasmid harboring several drug resistance genes associated with transposons and integrons has been identified in Shewanella xiamenensis. These antibiotic resistance genes can circulate in the environment and contribute to the emergence of antibiotic resistance. This review describes different aspects of Shewanella, focusing on the infections caused by this genus, as well as their role in the propagation of antibiotic resistance via mobile genetic elements.

Bioleaching of arsenic in contaminated soil using metal-reducing bacteria

NASA Astrophysics Data System (ADS)

Lee, So-Ra; Lee, Jong-Un; Chon, Hyo-Taek

2014-05-01

A study on the extraction of arsenic in the contaminated soil collected from an old smelting site in Korea was carried out using metal-reducing bacteria. Two types of batch-type experiments, biostimulation and bioaugmentation, were conducted for 28 days under anaerobic conditions. The biostimulation experiments were performed through activation of indigenous bacteria by supply with glucose or lactate as a carbon source. The contaminated, autoclaved soil was inoculated with metal-reducing bacteria, Shewanella oneidensis MR-1 and S. algae BrY, in the bioaugmentation experiments. The results indicated that the maximum concentration of the extracted As was 11.2 mg/L at 4 days from the onset of the experiment when 20 mM glucose was supplied and the extraction efficiency of As ranged 60~63% in the biostimulation experiments. In the case of bioaugmentation, the highest dissolved As concentration was 24.4 mg/L at 2 days, though it dramatically decreased over time through re-adsorption onto soil particles. After both treatments, mode of As occurrence in the soil appeared to be changed to readily extractable fractions. This novel technique of bioleaching may be practically applied for remediation of As-contaminated soil after determination of optimum operational conditions such as operation time and proper carbon source and its concentration.

Gaseous ligand selectivity of the H-NOX sensor protein from Shewanella oneidensis and comparison to those of other bacterial H-NOXs and soluble guanylyl cyclase.

PubMed

Wu, Gang; Liu, Wen; Berka, Vladimir; Tsai, Ah-Lim

2017-09-01

To delineate the commonalities and differences in gaseous ligand discrimination among the heme-based sensors with Heme Nitric oxide/OXygen binding protein (H-NOX) scaffold, the binding kinetic parameters for gaseous ligands NO, CO, and O 2 , including K D , k on , and k off , of Shewanella oneidensis H-NOX (So H-NOX) were characterized in detail in this study and compared to those of previously characterized H-NOXs from Clostridium botulinum (Cb H-NOX), Nostoc sp. (Ns H-NOX), Thermoanaerobacter tengcongensis (Tt H-NOX), Vibrio cholera (Vc H-NOX), and human soluble guanylyl cyclase (sGC), an H-NOX analogue. The K D (NO) and K D (CO) of each bacterial H-NOX or sGC follow the "sliding scale rule"; the affinities of the bacterial H-NOXs for NO and CO vary in a small range but stronger than those of sGC by at least two orders of magnitude. On the other hand, each bacterial H-NOX exhibits different characters in the stability of its 6c NO complex, reactivity with secondary NO, stability of oxyferrous heme and autoxidation to ferric heme. A facile access channel for gaseous ligands is also identified, implying that ligand access has only minimal effect on gaseous ligand selectivity of H-NOXs or sGC. This comparative study of the binding parameters of the bacterial H-NOXs and sGC provides a basis to guide future new structural and functional studies of each specific heme sensor with the H-NOX protein fold. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species

PubMed Central

McGraw, Joseph E.; Jensen, Brittany J.; Bishop, Sydney S.; Lokken, James P.; Dorff, Kellen J.; Ripley, Michael P.; Munro, James B.

2015-01-01

Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452

Growth of Iron(III)-Reducing Bacteria on Clay Minerals as the Sole Electron Acceptor and Comparison of Growth Yields on a Variety of Oxidized Iron Forms†

PubMed Central

Kostka, Joel E.; Dalton, Dava D.; Skelton, Hayley; Dollhopf, Sherry; Stucki, Joseph W.

2002-01-01

Smectite clay minerals are abundant in soils and sediments worldwide and are typically rich in Fe. While recent investigations have shown that the structural Fe(III) bound in clay minerals is reduced by microorganisms, previous studies have not tested growth with clay minerals as the sole electron acceptor. Here we have demonstrated that a pure culture of Shewanella oneidensis strain MR-1 as well as enrichment cultures of Fe(III)-reducing bacteria from rice paddy soil and subsurface sediments are capable of conserving energy for growth with the structural Fe(III) bound in smectite clay as the sole electron acceptor. Pure cultures of S. oneidensis were used for more detailed growth rate and yield experiments on various solid- and soluble-phase electron acceptors [smectite, Fe(III) oxyhydroxide FeOOH, Fe(III) citrate, and oxygen] in the same minimal medium. Growth was assessed as direct cell counts or as an increase in cell carbon (measured as particulate organic carbon). Cell counts showed that similar growth of S. oneidensis (108 cells ml−1) occurred with smectitic Fe(III) and on other Fe forms [amorphous Fe(III) oxyhydroxide, and Fe citrate] or oxygen as the electron acceptor. In contrast, cell yields of S. oneidensis measured as the increase in cell carbon were similar on all Fe forms tested while yields on oxygen were five times higher, in agreement with thermodynamic predictions. Over a range of particle loadings (0.5 to 4 g liter−1), the increase in cell number was highly correlated to the amount of structural Fe in smectite reduced. From phylogenetic analysis of the complete 16S rRNA gene sequences, a predominance of clones retrieved from the clay mineral-reducing enrichment cultures were most closely related to the low-G+C gram-positive members of the Bacteria (Clostridium and Desulfitobacterium) and the δ-Proteobacteria (members of the Geobacteraceae). Results indicate that growth with smectitic Fe(III) is similar in magnitude to that with Fe

Role of Outer Membrane C-Type Cytochromes MtrC and OmcA in Shewanella Oneidensis MR-1 Cell Production, Accumulation, and Detachment During Respiration on Hematite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mitchell, Andrew C.; Peterson, L.; Reardon, Catherine L.

2012-07-01

Solid phase iron oxides are considered to be important terminal electron acceptors for microbial respiration in many anoxic environments. Besides the knowledge that cells attach to and reduce these substrates, other aspects of surface-associated cell behavior and the related cell surface components that influence cell-mineral interactions are not well understood. In the present study, wild-type cells of the dissimilatory iron-reducing bacterium Shewanella oneidensis MR-1 formed thin biofilms one-to-two cell layers in thickness when respiring on natural specular hematite under flow conditions similar to those which exist in aquatic sediments and subsurface environments. The distribution of cells within the biofilm indicatedmore » that direct contact was not required for electron transfer from cells to the mineral surface. Detached biomass in the form of single cells represented >99% of the surface-associated wild-type cell production from respiration on hematite over the biofilm life cycle. A mutant deficient in the outer membrane c35 type cytochrome OmcA, while still able to respire and replicate on hematite, established a lower steady-state cell density on the mineral surface than that of the wild-type strain. A mutant deficient in MtrC, another outer membrane c-type cytochrome, and a mutant deficient in both cytochromes were unable to reduce sufficient amounts of hematite to support detectable growth on the mineral surface. When considered in the context of previous work, the results support a growing body of evidence that the relative importance of OmcA and MtrC to cell respiration and replication depends on the form of iron oxide available as terminal electron acceptor.« less

The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species.

PubMed

Dailey, Frank E; McGraw, Joseph E; Jensen, Brittany J; Bishop, Sydney S; Lokken, James P; Dorff, Kellen J; Ripley, Michael P; Munro, James B

2016-01-01

Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Outer membrane cytochromes/flavin interactions in Shewanella spp.—A molecular perspective

DOE PAGES

Babanova, Sofia; Matanovic, Ivana; Cornejo, Jose; ...

2017-05-31

Extracellular electron transfer (EET) is intrinsically associated with the core phenomena of energy harvesting/energy conversion in natural ecosystems and biotechnology applications. But, the mechanisms associated with EET are complex and involve molecular interactions that take place at the “bionano interface” where biotic/abiotic interactions are usually explored. Our work provides molecular perspective on the electron transfer mechanism(s) employed by Shewanella oneidensis MR-1. Molecular docking simulations were used to explain the interfacial relationships between two outer-membrane cytochromes (OMC) OmcA and MtrC and riboflavin (RF) and flavin mononucleotide (FMN), respectively. OMC-flavin interactions were analyzed by studying the electrostatic potential, the hydrophilic/hydrophobic surface properties,more » and the van der Waals surface of the OMC proteins. As a result, it was proposed that the interactions between flavins and OMCs are based on geometrical recognition event. The possible docking positions of RF and FMN to OmcA and MtrC were also shown.« less

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

Potent antimicrobial and antibiofilm activities of bacteriogenically synthesized gold-silver nanoparticles against pathogenic bacteria and their physiochemical characterizations.

PubMed

Ramasamy, Mohankandhasamy; Lee, Jin-Hyung; Lee, Jintae

2016-09-01

The objective of this study was to develop a bimetallic nanoparticle with enhanced antibacterial activity that would improve the therapeutic efficacy against bacterial biofilms. Bimetallic gold-silver nanoparticles were bacteriogenically synthesized using γ-proteobacterium, Shewanella oneidensis MR-1. The antibacterial activities of gold-silver nanoparticles were assessed on the planktonic and biofilm phases of individual and mixed multi-cultures of pathogenic Gram negative (Escherichia coli and Pseudomonas aeruginosa) and Gram positive bacteria (Enterococcus faecalis and Staphylococcus aureus), respectively. The minimum inhibitory concentration of gold-silver nanoparticles was 30-50 µM than that of other nanoparticles (>100 µM) for the tested bacteria. Interestingly, gold-silver nanoparticles were more effective in inhibiting bacterial biofilm formation at 10 µM concentration. Both scanning and transmission electron microscopy results further accounted the impact of gold-silver nanoparticles on biocompatibility and bactericidal effect that the small size and bio-organic materials covering on gold-silver nanoparticles improves the internalization and thus caused bacterial inactivation. Thus, bacteriogenically synthesized gold-silver nanoparticles appear to be a promising nanoantibiotic for overcoming the bacterial resistance in the established bacterial biofilms. © The Author(s) 2016.

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3.

PubMed

Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

2017-03-20

To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.

Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3

NASA Astrophysics Data System (ADS)

Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

2017-03-01

To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE PAGES

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...

2015-05-12

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are

Molecular characterization and bioactivity profile of the tropical sponge-associated bacterium Shewanella algae VCDB

NASA Astrophysics Data System (ADS)

Rachanamol, R. S.; Lipton, A. P.; Thankamani, V.; Sarika, A. R.; Selvin, J.

2014-06-01

The pigmented, rod-shaped, Gram-negative, motile bacteria isolated from marine sponge Callyspongia diffusa exhibiting bioactivity was characterized as Shewanella algae (GenBank: KC623651). The 16S rRNA gene sequence-based phylogenetic analysis showed its similarity with the member of Shewanella and placed in a separate cluster with the recognized bacteria S. algae (PSB-05 FJ86678) with which it showed 99.0 % sequence similarity. Growth of the strain was optimum at temperature 30 °C, pH 8.0 in the presence of 2.0-4.0 % of NaCl. High antibiotic activity against microbes such as Escherichia coli (MTCC 40), S. typhii (MTCC 98), P. vulgaris (MTCC 426), V. fluvialis, V. anguillarum, E. cloacae, and L. lactis was recorded. The growth of fungal pathogens such as Aspergillus niger, Aspergillus fumigatus, Saccharomyces cerevisiae, and Colletotrichum gloeosporioides was effectively controlled.

Physiological and Growth Characteristics of Shewanella Species

DTIC Science & Technology

2016-05-01

AFCEC-CX-TY-TR-2016-0016 PHYSIOLOGICAL AND GROWTH CHARACTERISTICS OF SHEWANELLA SPECIES Karen Farrington, D. Matthew Eby, Susan Sizemore...Technical Report 01 March 2012 - 01 March 2014 Physiological and growth characteristics of Shewanella species FA4819-11-C-0003 Karen Farrington (1...unconventional operating temperatures. Secondly, the unusual growth characteristics of another Shewanella sp., Shewanella japonica, were investigated

Integrated genome-based studies of Shewanella Ecophysiology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tiedje, James M.; Konstantinidis, Kostas; Worden, Mark

2014-01-08

The aim of the work reported is to study Shewanella population genomics, and to understand the evolution, ecophysiology, and speciation of Shewanella. The tasks supporting this aim are: to study genetic and ecophysiological bases defining the core and diversification of Shewanella species; to determine gene content patterns along redox gradients; and to Investigate the evolutionary processes, patterns and mechanisms of Shewanella.

Comparative analysis of microbial community between different cathode systems of microbial fuel cells for denitrification.

PubMed

Li, Chao; Xu, Ming; Lu, Yi; Fang, Fang; Cao, Jiashun

2016-01-01

Two types of cathodic biofilm in microbial fuel cells (MFC) were established for comparison on their performance and microbial communities. Complete autotrophic simultaneous nitrification and denitrification (SND) without organics addition was achieved in nitrifying-MFC (N-MFC) with a total nitrogen (TN) removal rate of 0.35 mg/(L·h), which was even higher than that in denitrifying-MFC (D-MFC) at same TN level. Integrated denaturing gradient gel electrophoresis analysis based on both 16S rRNA and nirK genes showed that Alpha-, Gammaproteobacteria were the main denitrifier communities. Some potential autotrophic denitrifying bacteria which can use electrons and reducing power from cathodes, such as Shewanella oneidensis, Shewanella loihica, Pseudomonas aeruginosa, Starkeya novella and Rhodopseudomonas palustris were identified and selectively enriched on cathode biofilms. Further, relative abundance of denitrifying bacteria characterized by nirK/16S ratios was much higher in biofilm than suspended sludge according to real-time polymerase chain reaction. The highest enrichment efficiency for denitrifiers was obtained in N-MFC cathode biofilms, which confirmed autotrophic denitrifying bacteria enrichment is the key factor for a D-MFC system.

Electron energy loss spectroscopy techniques for the study of microbial chromium(VI) reduction

NASA Technical Reports Server (NTRS)

Daulton, Tyrone L.; Little, Brenda J.; Lowe, Kristine; Jones-Meehan, Joanne

2002-01-01

Electron energy loss spectroscopy (EELS) techniques were used to determine oxidation state, at high spatial resolution, of chromium associated with the metal-reducing bacteria, Shewanella oneidensis, in anaerobic cultures containing Cr(VI)O4(2-). These techniques were applied to fixed cells examined in thin section by conventional transmission electron microscopy (TEM) as well as unfixed, hydrated bacteria examined by environmental cell (EC)-TEM. Two distinct populations of bacteria were observed by TEM: bacteria exhibiting low image contrast and bacteria exhibiting high contrast in their cell membrane (or boundary) structure which was often encrusted with high-contrast precipitates. Measurements by EELS demonstrated that cell boundaries became saturated with low concentrations of Cr and the precipitates encrusting bacterial cells contained a reduced form of Cr in oxidation state + 3 or lower.

Shewanella spp. Genomic Evolution for a Cold Marine Lifestyle and In-Situ Explosive Biodegradation

PubMed Central

Zhao, Jian-Shen; Deng, Yinghai; Manno, Dominic; Hawari, Jalal

2010-01-01

Shewanella halifaxensis and Shewanella sediminis were among a few aquatic γ-proteobacteria that were psychrophiles and the first anaerobic bacteria that degraded hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). Although many mesophilic or psychrophilic strains of Shewanella and γ-proteobacteria were sequenced for their genomes, the genomic evolution pathways for temperature adaptation were poorly understood. On the other hand, the genes responsible for anaerobic RDX mineralization pathways remain unknown. To determine the unique genomic properties of bacteria responsible for both cold-adaptation and RDX degradation, the genomes of S. halifaxensis and S. sediminis were sequenced and compared with 108 other γ-proteobacteria including Shewanella that differ in temperature and Na+ requirements, as well as RDX degradation capability. Results showed that for coping with marine environments their genomes had extensively exchanged with deep sea bacterial genomes. Many genes for Na+-dependent nutrient transporters were recruited to use the high Na+ content as an energy source. For coping with low temperatures, these two strains as well as other psychrophilic strains of Shewanella and γ-proteobacteria were found to decrease their genome G+C content and proteome alanine, proline and arginine content (p-value <0.01) to increase protein structural flexibility. Compared to poorer RDX-degrading strains, S. halifaxensis and S. sediminis have more number of genes for cytochromes and other enzymes related to RDX metabolic pathways. Experimentally, one cytochrome was found induced in S. halifaxensis by RDX when the chemical was the sole terminal electron acceptor. The isolated protein degraded RDX by mono-denitration and was identified as a multiheme 52 kDa cytochrome using a proteomic approach. The present analyses provided the first insight into divergent genomic evolution of bacterial strains for adaptation to the specific cold marine conditions and to the degradation of the

Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3

PubMed Central

Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

2017-01-01

To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels. PMID:28317859

Shewanella halifaxensis sp. nov., a novel obligately respiratory and denitrifying psychrophile.

PubMed

Zhao, Jian-Shen; Manno, Dominic; Leggiadro, Cindy; O'Neil, David; Hawari, Jalal

2006-01-01

Indigenous bacteria found in the sediment of the Emerald Basin (depth of 215 m, Atlantic Ocean) located offshore of Halifax Harbour (Nova Scotia, Canada) were previously found to be able to degrade the explosive compound hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). In the present study, a novel obligately respiratory, denitrifying and RDX-mineralizing bacterium, designated strain HAW-EB4(T), was isolated from the marine sediment. This bacterium utilized peptone, yeast extract, Casamino acids, esters (Tweens 20, 40 and 80), sugars (N-acetyl-D-glucosamine, ribose), several C2 and C3 acids (acetate, pyruvate, lactate, propionate) and amino acids (serine, proline) as sole carbon and energy sources. Aerobically grown cells (in marine broth 2216 at 10 degrees C) contained C(14 : 0) (6 %), iso-C(15 : 0) (12 %), C(16 : 0) (20 %), C(16 : 1)omega7 (37 %), C(18 : 1)omega7 (7 %) and C(20 : 5)omega3 (7 %) as major membrane fatty acids, and Q7 (28.1 %) and MK-7 (60.9 %) as dominant respiratory quinones, consistent with deep-sea species of Shewanella. The novel bacterium had a DNA G+C content of 45 mol% and showed similarity to Shewanella species in terms of 16S rRNA and gyrB gene sequences (93-99 and 67.3-88.4 % similarity, respectively), with Shewanella pealeana being the most closely related species. Genomic DNA-DNA hybridization between strain HAW-EB4T and S. pealeana revealed a level of relatedness of 17.9 %, lower than the 70 % species cut-off value, indicating that strain HAW-EB4T (= NCIMB 14093T = DSM 17350T) is the type strain of a novel species of Shewanella, for which the name Shewanella halifaxensis sp. nov. is proposed.

Physiological and hydrological controls on mineral redox cycling by long-range electron transport by bacteria in anaerobic sediments

NASA Astrophysics Data System (ADS)

Michelson, K.; Werth, C. J.; Sanford, R. A.; Valocchi, A. J.

2016-12-01

The cycling of iron and manganese oxides plays a critical role in the bioavailability of trace elements and macronutrients, the flux of carbon across terrestrial and atmospheric ecosystems, and the remediation of groundwater contaminated by toxic metals and radionuclides. Bacteria control one half of the redox cycle as the primary drivers of iron and manganese reduction in anaerobic soils and sediments. However, Fe(III) and Mn(IV) are almost exclusively present under anaerobic conditions as insoluble oxides, the reduction of which are facilitated by extracellular electron transport via conductive `nanowires', electron shuttling, and direct contact with outer membrane cytochromes. Our research focus is on the relative contribution of nanowires and electron shuttles under different physiological and hydrological conditions, which remains unexplored. We present a novel microfluidic platform that allows us to directly observe these phenomena under a controlled environment representative of groundwater conditions, monitor the metabolic activity and redox state of bacteria, and determine the presence of reduced products in-situ using Raman spectroscopy. Using Geobacter sulfurreducens and Shewanella oneidensis as model metal-reducing bacteria, and insoluble manganese dioxide (i.e. birnessite) as an electron acceptor, we show that 1) electron shuttling is more effective under static conditions 2) the presence of exogenous shuttles allows efficient electron transport under all flow regimes 3) redox potential of the bulk medium exerts significant control over reduction by both nanowires and electron shuttles 4) shuttling is amplified by orders of magnitude in nanopores.

Tracking Electron Uptake from a Cathode into Shewanella Cells: Implications for Energy Acquisition from Solid-Substrate Electron Donors

PubMed Central

Rajeev, Pournami; Jain, Abhiney; Pirbadian, Sahand; Okamoto, Akihiro; Gralnick, Jeffrey A.; El-Naggar, Mohamed Y.; Nealson, Kenneth H.

2018-01-01

ABSTRACT While typically investigated as a microorganism capable of extracellular electron transfer to minerals or anodes, Shewanella oneidensis MR-1 can also facilitate electron flow from a cathode to terminal electron acceptors, such as fumarate or oxygen, thereby providing a model system for a process that has significant environmental and technological implications. This work demonstrates that cathodic electrons enter the electron transport chain of S. oneidensis when oxygen is used as the terminal electron acceptor. The effect of electron transport chain inhibitors suggested that a proton gradient is generated during cathode oxidation, consistent with the higher cellular ATP levels measured in cathode-respiring cells than in controls. Cathode oxidation also correlated with an increase in the cellular redox (NADH/FMNH2) pool determined with a bioluminescence assay, a proton uncoupler, and a mutant of proton-pumping NADH oxidase complex I. This work suggested that the generation of NADH/FMNH2 under cathodic conditions was linked to reverse electron flow mediated by complex I. A decrease in cathodic electron uptake was observed in various mutant strains, including those lacking the extracellular electron transfer components necessary for anodic-current generation. While no cell growth was observed under these conditions, here we show that cathode oxidation is linked to cellular energy acquisition, resulting in a quantifiable reduction in the cellular decay rate. This work highlights a potential mechanism for cell survival and/or persistence on cathodes, which might extend to environments where growth and division are severely limited. PMID:29487241

Microbial activity at gigapascal pressures.

PubMed

Sharma, Anurag; Scott, James H; Cody, George D; Fogel, Marilyn L; Hazen, Robert M; Hemley, Russell J; Huntress, Wesley T

2002-02-22

We observed physiological and metabolic activity of Shewanella oneidensis strain MR1 and Escherichia coli strain MG1655 at pressures of 68 to 1680 megapascals (MPa) in diamond anvil cells. We measured biological formate oxidation at high pressures (68 to 1060 MPa). At pressures of 1200 to 1600 MPa, living bacteria resided in fluid inclusions in ice-VI crystals and continued to be viable upon subsequent release to ambient pressures (0.1 MPa). Evidence of microbial viability and activity at these extreme pressures expands by an order of magnitude the range of conditions representing the habitable zone in the solar system.

Cation-limited kinetic model for microbial extracellular electron transport via an outer membrane cytochrome C complex

PubMed Central

Okamoto, Akihiro; Tokunou, Yoshihide; Saito, Junki

2016-01-01

Outer-membrane c-type cytochrome (OM c-Cyt) complexes in several genera of iron-reducing bacteria, such as Shewanella and Geobacter, are capable of transporting electrons from the cell interior to extracellular solids as a terminal step of anaerobic respiration. The kinetics of this electron transport has implications for controlling the rate of microbial electron transport during bioenergy or biochemical production, iron corrosion, and natural mineral cycling. Herein, we review the findings from in-vivo and in-vitro studies examining electron transport kinetics through single OM c-Cyt complexes in Shewanella oneidensis MR-1. In-vitro electron flux via a purified OM c-Cyt complex, comprised of MtrA, B, and C proteins from S. oneidensis MR-1, embedded in a proteoliposome system is reported to be 10- to 100-fold faster compared with in-vivo estimates based on measurements of electron flux per cell and OM c-Cyts density. As the proteoliposome system is estimated to have 10-fold higher cation flux via potassium channels than electrons, we speculate that the slower rate of electron-coupled cation transport across the OM is responsible for the significantly lower electron transport rate that is observed in-vivo. As most studies to date have primarily focused on the energetics or kinetics of interheme electron hopping in OM c-Cyts in this microbial electron transport mechanism, the proposed model involving cation transport provides new insight into the rate detemining step of EET, as well as the role of self-secreted flavin molecules bound to OM c-Cyt and proton management for energy conservation and production in S. oneidensis MR-1. PMID:27924259

Culturable Rhodobacter and Shewanella species are abundant in estuarine turbidity maxima of the Columbia River

PubMed Central

Bräuer, S. L.; Adams, C.; Kranzler, K.; Murphy, D.; Xu, M.; Zuber, P.; Simon, H. M.; Baptista, A. M.; Tebo, B. M.

2017-01-01

Summary Measurements of dissolved, ascorbate-reducible and total Mn by ICP-OES revealed significantly higher concentrations during estuarine turbidity maxima (ETM) events, compared with non-events in the Columbia River. Most probable number (MPN) counts of Mn-oxidizing or Mn-reducing heterotrophs were not statistically different from that of other heterotrophs (103–104 cells ml−1) when grown in defined media, but counts of Mn oxidizers were significantly lower in nutrient-rich medium (13 cells ml−1). MPN counts of Mn oxidizers were also significantly lower on Mn(III)-pyrophosphate and glycerol (21 cells ml−1). Large numbers of Rhodobacter spp. were cultured from dilutions of 10−2 to 10−5, and many of these were capable of Mn(III) oxidation. Up to c. 30% of the colonies tested LBB positive, and all 77 of the successfully sequenced LBB positive colonies (of varying morphology) yielded sequences related to Rhodobacter spp. qPCR indicated that a cluster of Rhodobacter isolates and closely related strains (95–99% identity) represented approximately 1–3% of the total Bacteria, consistent with clone library results. Copy numbers of SSU rRNA genes for either Rhodobacter spp. or Bacteria were four to eightfold greater during ETM events compared with non-events. Strains of a Shewanella sp. were retrieved from the highest dilutions (10−5) of Mn reducers, and were also capable of Mn oxidation. The SSU rRNA gene sequences from these strains shared a high identity score (98%) with sequences obtained in clone libraries. Our results support previous findings that ETMs are zones with high microbial activity. Results indicated that Shewanella and Rhodobacter species were present in environmentally relevant concentrations, and further demonstrated that a large proportion of culturable bacteria, including Shewanella and Rhodobacter spp., were capable of Mn cycling in vitro. PMID:20977571

Metal Cycling by Bacteria: Moving Electrons Around

ScienceCinema

Nealson, Ken

2017-12-09

About 20 years ago, Shewanella oneidensis MR-1 was isolated from a manganese-rich lack in upstate New York, and subsequently shown to utilize solid forms of oxidized manganese or iron as an electron acceptor. Recent studies of metal-reducing bacterial have unveiled a number of unexpected properties of microbes that have enlarged our view of microbes and their role(s) in natural ecosystems. For example, the processes of metal reduction themselves are fundamental to the carbon cycle in many lakes and sediments, where iron and manganese account for the major portion of organic carbon oxidation in many sediments. On more modest spatial scales, iron and manganese reduction can be linked to the oxidation of a wide variety of carbon compounds, many of them recalcitrant and/or toxic. One remarkable property of metal reducers is their ability to reduce solid, often highly crystalline substrates such as iron and manganese oxides and oxyhydroxides. It is now clear that this is done via the utilization of enzymes located on the outer wall of the bacteria - enzymes that apparently interact directly with these solid substrates. Molecular and genomic studies combined have revealed the genes and protoeins responsible for these activities, and many facets of the regulation. This talk focuses on the general features and properties of these remarkable organisms that seem to communicate via electron transfer across a wide variety of soluable, insoluable, and even "inert" substrates, and the way that these processes may be mechanistically linked.

Nile Red Detection of Bacterial Hydrocarbons and Ketones in a High-Throughput Format

PubMed Central

Pinzon, Neissa M.; Aukema, Kelly G.; Gralnick, Jeffrey A.; Wackett, Lawrence P.

2011-01-01

ABSTRACT A method for use in high-throughput screening of bacteria for the production of long-chain hydrocarbons and ketones by monitoring fluorescent light emission in the presence of Nile red is described. Nile red has previously been used to screen for polyhydroxybutyrate (PHB) and fatty acid esters, but this is the first report of screening for recombinant bacteria making hydrocarbons or ketones. The microtiter plate assay was evaluated using wild-type and recombinant strains of Shewanella oneidensis and Escherichia coli expressing the enzyme OleA, previously shown to initiate hydrocarbon biosynthesis. The strains expressing exogenous Stenotrophomonas maltophilia oleA, with increased levels of ketone production as determined by gas chromatography-mass spectrometry, were distinguished with Nile red fluorescence. Confocal microscopy images of S. oneidensis oleA-expressing strains stained with Nile red were consistent with a membrane localization of the ketones. This differed from Nile red staining of bacterial PHB or algal lipid droplets that showed intracellular inclusion bodies. These results demonstrated the applicability of Nile red in a high-throughput technique for the detection of bacterial hydrocarbons and ketones. PMID:21712420

Enabling Unbalanced Fermentations by Using Engineered Electrode-Interfaced Bacteria

PubMed Central

Flynn, Jeffrey M.; Ross, Daniel E.; Hunt, Kristopher A.; Bond, Daniel R.; Gralnick, Jeffrey A.

2010-01-01

Cellular metabolism is a series of tightly linked oxidations and reductions that must be balanced. Recycling of intracellular electron carriers during fermentation often requires substrate conversion to undesired products, while respiration demands constant addition of electron acceptors. The use of electrode-based electron acceptors to balance biotransformations may overcome these constraints. To test this hypothesis, the metal-reducing bacterium Shewanella oneidensis was engineered to stoichiometrically convert glycerol into ethanol, a biotransformation that will not occur unless two electrons are removed via an external reaction, such as electrode reduction. Multiple modules were combined into a single plasmid to alter S. oneidensis metabolism: a glycerol module, consisting of glpF, glpK, glpD, and tpiA from Escherichia coli, and an ethanol module containing pdc and adh from Zymomonas mobilis. A further increase in product yields was accomplished through knockout of pta, encoding phosphate acetyltransferase, shifting flux toward ethanol and away from acetate production. In this first-generation demonstration, conversion of glycerol to ethanol required the presence of an electrode to balance the reaction, and electrode-linked rates were on par with volumetric conversion rates observed in engineered E. coli. Linking microbial biocatalysis to current production can eliminate redox constraints by shifting other unbalanced reactions to yield pure products and serve as a new platform for next-generation bioproduction strategies. PMID:21060736

Genome Sequences of Shewanella baltica and Shewanella morhuae Strains Isolated from the Gastrointestinal Tract of Freshwater Fish.

PubMed

Castillo, Daniel; Gram, Lone; Dailey, Frank E

2018-06-21

We present here the genome sequences of Shewanella baltica strain CW2 and Shewanella morhuae strain CW7, isolated from the gastrointestinal tract of Salvelinus namaycush (lean lake trout) and Coregonus clupeaformis (whitefish), respectively. These genome sequences provide insights into the niche adaptation of these specific species in freshwater systems. Copyright © 2018 Castillo et al.

Bacteria-Affinity 3D Macroporous Graphene/MWCNTs/Fe3O4 Foams for High-Performance Microbial Fuel Cells.

PubMed

Song, Rong-Bin; Zhao, Cui-E; Jiang, Li-Ping; Abdel-Halim, Essam Sayed; Zhang, Jian-Rong; Zhu, Jun-Jie

2016-06-29

Promoting the performance of microbial fuel cells (MFCs) relies heavily on the structure design and composition tailoring of electrode materials. In this work, three-dimensional (3D) macroporous graphene foams incorporated with intercalated spacer of multiwalled carbon nanotubes (MWCNTs) and bacterial anchor of Fe3O4 nanospheres (named as G/MWCNTs/Fe3O4 foams) were first synthesized and used as anodes for Shewanella-inoculated microbial fuel cells (MFCs). Thanks to the macroporous structure of 3D graphene foams, the expanded electrode surface by MWCNTs spacing, as well as the high affinity of Fe3O4 nanospheres toward Shewanella oneidensis MR-1, the anode exhibited high bacterial loading capability. In addition to spacing graphene nanosheets for accommodating bacterial cells, MWCNTs paved a smoother way for electron transport in the electrode substrate of MFCs. Meanwhile, the embedded bioaffinity Fe3O4 nanospheres capable of preserving the bacterial metabolic activity provided guarantee for the long-term durability of the MFCs. With these merits, the constructed MFC possessed significantly higher power output and stronger stability than that with conventional graphite rod anode.

Accumulation of Mn(II) in Deinococcus radiodurans Facilitates Gamma-Radiation Resistance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daly, Michael J.; Gaidamakova, E; Matrosova, V

2004-11-05

Deinococcus radiodurans is extremely resistant to ionizing radiation. How this bacterium can grow under chronic gamma-radiation (50 Gy/hour) or recover from acute doses greater than 10 kGy is unknown. We show that D. radiodurans accumulates very high intracellular manganese and low iron levels compared to radiation sensitive bacteria, and resistance exhibits a concentration-dependent response to Mn(II). Among the most radiation-resistant bacterial groups reported, Deinococcus, Enterococcus, Lactobacillus and cyanobacteria spp. accumulate Mn(II). In contrast, Shewanella oneidensis and Pseudomonas putida have high Fe but low intracellular Mn concentrations and are very sensitive. We propose that Mn(II) accumulation facilitates recovery from radiation injury.

Oxygen Consumption Rates of Bacteria under Nutrient-Limited Conditions

PubMed Central

Riedel, Timothy E.; Nealson, Kenneth H.; Finkel, Steven E.

2013-01-01

Many environments on Earth experience nutrient limitation and as a result have nongrowing or very slowly growing bacterial populations. To better understand bacterial respiration under environmentally relevant conditions, the effect of nutrient limitation on respiration rates of heterotrophic bacteria was measured. The oxygen consumption and population density of batch cultures of Escherichia coli K-12, Shewanella oneidensis MR-1, and Marinobacter aquaeolei VT8 were tracked for up to 200 days. The oxygen consumption per CFU (QO2) declined by more than 2 orders of magnitude for all three strains as they transitioned from nutrient-abundant log-phase growth to the nutrient-limited early stationary phase. The large reduction in QO2 from growth to stationary phase suggests that nutrient availability is an important factor in considering environmental respiration rates. Following the death phase, during the long-term stationary phase (LTSP), QO2 values of the surviving population increased with time and more cells were respiring than formed colonies. Within the respiring population, a subpopulation of highly respiring cells increased in abundance with time. Apparently, as cells enter LTSP, there is a viable but not culturable population whose bulk community and per cell respiration rates are dynamic. This result has a bearing on how minimal energy requirements are met, especially in nutrient-limited environments. The minimal QO2 rates support the extension of Kleiber's law to the mass of a bacterium (100-fg range). PMID:23770901

Genome analysis of a clinical isolate of Shewanella sp. uncovered an active hybrid integrative and conjugative element carrying an integron platform inserted in a novel genomic locus.

PubMed

Parmeciano Di Noto, Gisela; Jara, Eugenio; Iriarte, Andrés; Centrón, Daniela; Quiroga, Cecilia

2016-08-01

Shewanella spp. are currently considered to be emerging pathogens that can code for a blaOXA carbapenemase in their chromosome. Complete genome analysis of the clinical isolate Shewanella sp. Sh95 revealed that this strain is a novel species, which shares a lineage with marine isolates. Characterization of its resistome showed that it codes for genes drfA15, qacH and blaOXA-48. We propose that Shewanella sp. Sh95 acts as reservoir of blaOXA-48. Moreover, analysis of mobilome showed that it contains a novel integrative and conjugative element (ICE), named ICESh95. Comparative analysis between the close relatives ICESpuPO1 from Shewanella sp. W3-18-1 and ICE SXTMO10 from Vibrio cholerae showed that ICESh95 encompassed two new regions, a type III restriction modification system and a multidrug resistance integron. The integron platform contained a novel arrangement formed by gene cassettes drfA15 and qacH, and a class C-attC group II intron. Furthermore, insertion of ICESh95 occurred at a unique target site, which correlated with the presence of a different xis/int module. Mobility of ICESh95 was assessed and demonstrated its ability to self-transfer with high efficiency to different species of bacteria. Our results show that ICESh95 is a self-transmissible, mobile element, which can contribute to the dissemination of antimicrobial resistance; this is clearly a threat when natural bacteria from water ecosystems, such as Shewanella, act as vectors in its propagation.

Growth of the facultative anaerobe Shewanella putrefaciens by elemental sulfur reduction

NASA Technical Reports Server (NTRS)

Moser, D. P.; Nealson, K. H.

1996-01-01

The growth of bacteria by dissimilatory elemental sulfur reduction is generally associated with obligate anaerobes and thermophiles in particular. Here we describe the sulfur-dependent growth of the facultatively anaerobic mesophile Shewanella putrefaciens. Six of nine representative S. putrefaciens isolates from a variety of environments proved able to grow by sulfur reduction, and strain MR-1 was chosen for further study. Growth was monitored in a minimal medium (usually with 0.05% Casamino Acids added as a growth stimulant) containing 30 mM lactate and limiting concentrations of elemental sulfur. When mechanisms were provided for the removal of the metabolic end product, H2S, measurable growth was obtained at sulfur concentrations of from 2 to 30 mM. Initial doubling times were ca. 1.5 h and substrate independent over the range of sulfur concentrations tested. In the cultures with the highest sulfur concentrations, cell numbers increased by greater than 400-fold after 48 h, reaching a maximum density of 6.8 x 10(8) cells ml-1. Yields were determined as total cell carbon and ranged from 1.7 to 5.9 g of C mol of S(0) consumed-1 in the presence of the amino acid supplement and from 0.9 to 3.4 g of C mol of S(0-1) in its absence. Several lines of evidence indicate that cell-to-sulfur contact is not required for growth. Approaches for the culture of sulfur-metabolizing bacteria and potential ecological implications of sulfur reduction in Shewanella-like heterotrophs are discussed.

Shewanella putrefaciens Adhesion and Biofilm Formation on Food Processing Surfaces

PubMed Central

Bagge, Dorthe; Hjelm, Mette; Johansen, Charlotte; Huber, Ingrid; Gram, Lone

2001-01-01

Laboratory model systems were developed for studying Shewanella putrefaciens adhesion and biofilm formation under batch and flow conditions. S. putrefaciens plays a major role in food spoilage and may cause microbially induced corrosion on steel surfaces. S. putrefaciens bacteria suspended in buffer adhered readily to stainless steel surfaces. Maximum numbers of adherent bacteria per square centimeter were reached in 8 h at 25°C and reflected the cell density in suspension. Numbers of adhering bacteria from a suspension containing 108 CFU/ml were much lower in a laminar flow system (modified Robbins device) (reaching 102 CFU/cm2) than in a batch system (reaching 107 CFU/cm2), and maximum numbers were reached after 24 h. When nutrients were supplied, S. putrefaciens grew in biofilms with layers of bacteria. The rate of biofilm formation and the thickness of the film were not dependent on the availability of carbohydrate (lactate or glucose) or on iron starvation. The number of S. putrefaciens bacteria on the surface was partly influenced by the presence of other bacteria (Pseudomonas fluorescens) which reduced the numbers of S. putrefaciens bacteria in the biofilm. Numbers of bacteria on the surface must be quantified to evaluate the influence of environmental factors on adhesion and biofilm formation. We used a combination of fluorescence microscopy (4′,6′-diamidino-2-phenylindole staining and in situ hybridization, for mixed-culture studies), ultrasonic removal of bacteria from surfaces, and indirect conductometry and found this combination sufficient to quantify bacteria on surfaces. PMID:11319118

Endobiotic bacteria and their pathogenic potential in cnidarian tentacles

NASA Astrophysics Data System (ADS)

Schuett, Christian; Doepke, Hilke

2010-09-01

Endobiotic bacteria colonize the tentacles of cnidaria. This paper provides first insight into the bacterial spectrum and its potential of pathogenic activities inside four cnidarian species. Sample material originating from Scottish waters comprises the jellyfish species Cyanea capillata and C. lamarckii, hydrozoa Tubularia indivisa and sea anemone Sagartia elegans. Mixed cultures of endobiotic bacteria, pure cultures selected on basis of haemolysis, but also lyophilized samples were prepared from tentacles and used for DGGE-profiling with subsequent phylogenetic analysis of 16S rDNA fragments. Bacteria were detected in each of the cnidarian species tested. Twenty-one bacterial species including four groups of closely related organisms were found in culture material. The species within these groups could not be differentiated from each other (one group of Pseudoalteromonas spp., two groups of Shewanella spp., one group of Vibrio spp.). Each of the hosts exhibits a specific endobacterial spectrum. Solely Cyanea lamarckii harboured Moritella viscosa. Only in Cyanea capillata, members of the Shewanella group #2 and the species Pseudoalteromonas arctica, Shewanella violacea, Sulfitobacter pontiacus and Arcobacter butzleri were detected. Hydrozoa Tubularia indivisa provided an amazingly wide spectrum of nine bacterial species. Exclusively, in the sea anemone Sagartia elegans, the bacterial species P. aliena was found. Overall eleven bacterial species detected were described recently as novel species. Four 16S rDNA fragments generated from lyophilized material displayed extremely low relationship to their next neighbours. These organisms are regarded as members of the endobiotic “terra incognita”. Since the origin of cnidarian toxins is unclear, the possible pathogenic activity of endobiotic bacteria has to be taken into account. Literature data show that their next neighbours display an interesting diversity of haemolytic, septicaemic and necrotic actions including

Evaluation of a High Intensity Focused Ultrasound-Immobilized Trypsin Digestion and 18O-Labeling Method for Quantitative Proteomics

PubMed Central

López-Ferrer, Daniel; Hixson, Kim K.; Smallwood, Heather; Squier, Thomas C.; Petritis, Konstantinos; Smith, Richard D.

2009-01-01

A new method that uses immobilized trypsin concomitant with ultrasonic irradiation results in ultra-rapid digestion and thorough 18O labeling for quantitative protein comparisons. The reproducible and highly efficient method provided effective digestions in <1 min with a minimized amount of enzyme required compared to traditional methods. This method was demonstrated for digestion of both simple and complex protein mixtures, including bovine serum albumin, a global proteome extract from the bacteria Shewanella oneidensis, and mouse plasma, as well as 18O labeling of such complex protein mixtures, which validated the application of this method for differential proteomic measurements. This approach is simple, reproducible, cost effective, rapid, and thus well-suited for automation. PMID:19555078

Structure of a bacterial cell surface decaheme electron conduit

USDA-ARS?s Scientific Manuscript database

Some bacterial species are able to utilize extracellular mineral forms of iron and manganese as respiratory electron acceptors. In Shewanella oneidensis this involves decaheme cytochromes that are located on the bacterial cell surface at the termini of trans-outer-membrane electron transfer conduits...

Activity-Based Screening of Metagenomic Libraries for Hydrogenase Enzymes.

PubMed

Adam, Nicole; Perner, Mirjam

2017-01-01

Here we outline how to identify hydrogenase enzymes from metagenomic libraries through an activity-based screening approach. A metagenomic fosmid library is constructed in E. coli and the fosmids are transferred into a hydrogenase deletion mutant of Shewanella oneidensis (ΔhyaB) via triparental mating. If a fosmid exhibits hydrogen uptake activity, S. oneidensis' phenotype is restored and hydrogenase activity is indicated by a color change of the medium from yellow to colorless. This new method enables screening of 48 metagenomic fosmid clones in parallel.

Contamination of salmon fillets and processing plants with spoilage bacteria.

PubMed

Møretrø, Trond; Moen, Birgitte; Heir, Even; Hansen, Anlaug Å; Langsrud, Solveig

2016-11-21

The processing environment of salmon processing plants represents a potential major source of bacteria causing spoilage of fresh salmon. In this study, we have identified major contamination routes of important spoilage associated species within the genera Pseudomonas, Shewanella and Photobacterium in pre-rigor processing of salmon. Bacterial counts and culture-independent 16S rRNA gene analysis on salmon fillet from seven processing plants showed higher levels of Pseudomonas spp. and Shewanella spp. in industrially processed fillets compared to salmon processed under strict hygienic conditions. Higher levels of Pseudomonas spp. and Shewanella spp. were found on fillets produced early on the production day compared to later processed fillets. The levels of Photobacterium spp. were not dependent on the processing method or time of processing. In follow-up studies of two plants, bacterial isolates (n=2101) from the in-plant processing environments (sanitized equipment/machines and seawater) and from salmon collected at different sites in the production were identified by partial 16S rRNA gene sequencing. Pseudomonas spp. dominated in equipment/machines after sanitation with 72 and 91% of samples from the two plants being Pseudomonas-positive. The phylogenetic analyses, based on partial 16S rRNA gene sequencing, showed 48 unique sequence profiles of Pseudomonas of which two were dominant. Only six profiles were found on both machines and in fillets in both plants. Shewanella spp. were found on machines after sanitation in the slaughter department while Photobacterium spp. were not detected after sanitation in any parts of the plants. Shewanella spp. and Photobacterium spp. were found on salmon in the slaughter departments. Shewanella was frequently present in seawater tanks used for bleeding/short term storage. In conclusion, this study provides new knowledge on the processing environment as a source of contamination of salmon fillets with Pseudomonas spp. and

Conservation of Transcription Start Sites within Genes across a Bacterial Genus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.

Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less

Chromosome-Based blaOXA-48-Like Variants in Shewanella Species Isolates from Food-Producing Animals, Fish, and the Aquatic Environment.

PubMed

Ceccarelli, Daniela; van Essen-Zandbergen, Alieda; Veldman, Kees T; Tafro, Nedzib; Haenen, Olga; Mevius, Dik J

2017-02-01

Carbapenems are considered last-resort antibiotics in health care. Increasing reports of carbapenemase-producing bacteria in food-producing animals and in the environment indicate the importance of this phenomenon in public health. Surveillance for carbapenemase genes and carbapenemase-producing bacteria in Dutch food-producing animals, environmental freshwater, and imported ornamental fish revealed several chromosome-based bla OXA-48 -like variants in Shewanella spp., including two new alleles, bla OXA-514 and bla OXA-515 Carbapenemase genes were not associated with mobile genetic elements or Enterobacteriaceae. Copyright © 2017 American Society for Microbiology.

A synthetic microbial consortium of Shewanella and Bacillus for enhanced generation of bioelectricity.

PubMed

Liu, Ting; Yu, Yang-Yang; Chen, Tao; Chen, Wei Ning

2017-03-01

In this study, a synthetic microbial consortium containing exoelectrogen Shewanella oneidensis MR-1 and riboflavin-producing strain, Bacillus subtilis RH33, was rationally designed and successfully constructed, enabling a stable, multiple cycles of microbial fuel cells (MFCs) operation for more than 500 h. The maximum power density of MFCs with this synthetic microbial consortium was 277.4 mW/m 2 , which was 4.9 times of that with MR-1 (56.9 mW/m 2 ) and 40.2 times of RH33 (6.9 mW/m 2 ), separately. At the same time, the Coulombic efficiency of the synthetic microbial consortium (5.6%) was higher than MR-1 (4.1%) and RH33 (2.3%). Regardless the high concentration of riboflavin produced by RH33, the power density of RH33 was rather low. The low bioelectricity generation can be ascribed to the low efficiency of RH33 in utilizing riboflavin for extracellular electron transfer (EET). In the synthetic microbial consortium of MR-1 and RH33, it was found that both mediated and direct electron transfer efficiencies were enhanced. By exchanging the anolyte of MR-1 and RH33, it was confirmed that the improved MFC performance with the synthetic microbial consortium was because MR-1 could efficiently utilize the high concentration of riboflavin produced by RH33. Biotechnol. Bioeng. 2017;114: 526-532. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Microbial Iron Respiration Can Protect Steel from Corrosion

PubMed Central

Dubiel, M.; Hsu, C. H.; Chien, C. C.; Mansfeld, F.; Newman, D. K.

2002-01-01

Microbiologically influenced corrosion (MC) of steel has been attributed to the activity of biofilms that include anaerobic microorganisms such as iron-respiring bacteria, yet the mechanisms by which these organisms influence corrosion have been unclear. To study this process, we generated mutants of the iron-respiring bacterium Shewanella oneidensis strain MR-1 that were defective in biofilm formation and/or iron reduction. Electrochemical impedance spectroscopy was used to determine changes in the corrosion rate and corrosion potential as a function of time for these mutants in comparison to the wild type. Counter to prevailing theories of MC, our results indicate that biofilms comprising iron-respiring bacteria may reduce rather than accelerate the corrosion rate of steel. Corrosion inhibition appears to be due to reduction of ferric ions to ferrous ions and increased consumption of oxygen, both of which are direct consequences of microbial respiration. PMID:11872499

Microfabricated Microbial Fuel Cell Arrays Reveal Electrochemically Active Microbes

PubMed Central

Cho, Younghak; de Figueiredo, Paul; Han, Arum

2009-01-01

Microbial fuel cells (MFCs) are remarkable “green energy” devices that exploit microbes to generate electricity from organic compounds. MFC devices currently being used and studied do not generate sufficient power to support widespread and cost-effective applications. Hence, research has focused on strategies to enhance the power output of the MFC devices, including exploring more electrochemically active microbes to expand the few already known electricigen families. However, most of the MFC devices are not compatible with high throughput screening for finding microbes with higher electricity generation capabilities. Here, we describe the development of a microfabricated MFC array, a compact and user-friendly platform for the identification and characterization of electrochemically active microbes. The MFC array consists of 24 integrated anode and cathode chambers, which function as 24 independent miniature MFCs and support direct and parallel comparisons of microbial electrochemical activities. The electricity generation profiles of spatially distinct MFC chambers on the array loaded with Shewanella oneidensis MR-1 differed by less than 8%. A screen of environmental microbes using the array identified an isolate that was related to Shewanella putrefaciens IR-1 and Shewanella sp. MR-7, and displayed 2.3-fold higher power output than the S. oneidensis MR-1 reference strain. Therefore, the utility of the MFC array was demonstrated. PMID:19668333

Antioxidant and Antimicrobial Potential of the Bifurcaria bifurcata Epiphytic Bacteria

PubMed Central

Horta, André; Pinteus, Susete; Alves, Celso; Fino, Nádia; Silva, Joana; Fernandez, Sara; Rodrigues, Américo; Pedrosa, Rui

2014-01-01

Surface-associated marine bacteria are an interesting source of new secondary metabolites. The aim of this study was the isolation and identification of epiphytic bacteria from the marine brown alga, Bifurcaria bifurcata, and the evaluation of the antioxidant and antimicrobial activity of bacteria extracts. The identification of epiphytic bacteria was determined by 16S rRNA gene sequencing. Bacteria extracts were obtained with methanol and dichloromethane (1:1) extraction. The antioxidant activity of extracts was performed by quantification of total phenolic content (TPC), 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity and oxygen radical absorbance capacity (ORAC). Antimicrobial activities were evaluated against Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, Salmonella enteritidis, Staphylococcus aureus, Saccharomyces cerevisiae and Candida albicans. A total of 39 Bifurcaria bifurcata-associated bacteria were isolated and 33 were identified as Vibrio sp. (48.72%), Alteromonas sp. (12.82%), Shewanella sp. (12.26%), Serratia sp. (2.56%), Citricoccus sp. (2.56%), Cellulophaga sp. (2.56%), Ruegeria sp. (2.56%) and Staphylococcus sp. (2.56%). Six (15.38%) of the 39 bacteria Bifurcaria bifurcata-associated bacteria presented less than a 90% Basic Local Alignment Search Tool (BLAST) match, and some of those could be new. The highest antioxidant activity and antimicrobial activity (against B. subtilis) was exhibited by strain 16 (Shewanella sp.). Several strains also presented high antimicrobial activity against S. aureus, mainly belonging to Alteromonas sp. and Vibrio sp. There were no positive results against fungi and Gram-negative bacteria. Bifurcaria bifurcata epiphytic bacteria were revealed to be excellent sources of natural antioxidant and antimicrobial compounds. PMID:24663118

Antioxidant and antimicrobial potential of the Bifurcaria bifurcata epiphytic bacteria.

PubMed

Horta, André; Pinteus, Susete; Alves, Celso; Fino, Nádia; Silva, Joana; Fernandez, Sara; Rodrigues, Américo; Pedrosa, Rui

2014-03-24

Surface-associated marine bacteria are an interesting source of new secondary metabolites. The aim of this study was the isolation and identification of epiphytic bacteria from the marine brown alga, Bifurcaria bifurcata, and the evaluation of the antioxidant and antimicrobial activity of bacteria extracts. The identification of epiphytic bacteria was determined by 16S rRNA gene sequencing. Bacteria extracts were obtained with methanol and dichloromethane (1:1) extraction. The antioxidant activity of extracts was performed by quantification of total phenolic content (TPC), 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity and oxygen radical absorbance capacity (ORAC). Antimicrobial activities were evaluated against Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, Salmonella enteritidis, Staphylococcus aureus, Saccharomyces cerevisiae and Candida albicans. A total of 39 Bifurcaria bifurcata-associated bacteria were isolated and 33 were identified as Vibrio sp. (48.72%), Alteromonas sp. (12.82%), Shewanella sp. (12.26%), Serratia sp. (2.56%), Citricoccus sp. (2.56%), Cellulophaga sp. (2.56%), Ruegeria sp. (2.56%) and Staphylococcus sp. (2.56%). Six (15.38%) of the 39 bacteria Bifurcaria bifurcata-associated bacteria presented less than a 90% Basic Local Alignment Search Tool (BLAST) match, and some of those could be new. The highest antioxidant activity and antimicrobial activity (against B. subtilis) was exhibited by strain 16 (Shewanella sp.). Several strains also presented high antimicrobial activity against S. aureus, mainly belonging to Alteromonas sp. and Vibrio sp. There were no positive results against fungi and Gram-negative bacteria. Bifurcaria bifurcata epiphytic bacteria were revealed to be excellent sources of natural antioxidant and antimicrobial compounds.

Whole genome sequence to decipher the resistome of Shewanella algae, a multidrug-resistant bacterium responsible for pneumonia, Marseille, France.

PubMed

Cimmino, Teresa; Olaitan, Abiola Olumuyiwa; Rolain, Jean-Marc

2016-01-01

We characterize and decipher the resistome and the virulence factors of Shewanella algae MARS 14, a multidrug-resistant clinical strain using the whole genome sequencing (WGS) strategy. The bacteria were isolated from the bronchoalveolar lavage of a hospitalized patient in the Timone Hospital in Marseille, France who developed pneumonia after plunging into the Mediterranean Sea. The genome size of S. algae MARS 14 was 5,005,710 bp with 52.8% guanine cytosine content. The resistome includes members of class C and D beta-lactamases and numerous multidrug-efflux pumps. We also found the presence of several hemolysins genes, a complete flagellum system gene cluster and genes responsible for biofilm formation. Moreover, we reported for the first time in a clinical strain of Shewanella spp. the presence of a bacteriocin (marinocin). The WGS analysis of this pathogen provides insight into its virulence factors and resistance to antibiotics.

Enhancement of Survival and Electricity Production in an Engineered Bacterium by Light-Driven Proton Pumping▿ †

PubMed Central

Johnson, Ethan T.; Baron, Daniel B.; Naranjo, Belén; Bond, Daniel R.; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A.

2010-01-01

Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments. PMID:20453141

Enhancement of survival and electricity production in an engineered bacterium by light-driven proton pumping.

PubMed

Johnson, Ethan T; Baron, Daniel B; Naranjo, Belén; Bond, Daniel R; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A

2010-07-01

Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments.

The Role of Shewanella oneidensis MR-1 Outer Surface Structures in Extracellular Electron Transfer

DTIC Science & Technology

2010-01-01

Supernatants from the wells of the air-exposed VBSA that had been in operation for 220 h were harvested and planktonic cells were removed via...prepilins. In some bacteria, such as Pseudomonas aerugino- sa and Vibrio cholerae, PilD plays a dual role and processes type IVand T2SS prepilins [38 – 41... harvested from the VBSA at the times indicated by arrows in Fig. 4 (100 h data not shown). Fig. 6. Presence of riboflavin in cell-free supernatants

Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

PubMed Central

Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

2003-01-01

The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

The Molecular Density of States in Bacterial Nanowires

PubMed Central

El-Naggar, Mohamed Y.; Gorby, Yuri A.; Xia, Wei; Nealson, Kenneth H.

2008-01-01

The recent discovery of electrically conductive bacterial appendages has significant physiological, ecological, and biotechnological implications, but the mechanism of electron transport in these nanostructures remains unclear. We here report quantitative measurements of transport across bacterial nanowires produced by the dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, whose electron transport system is being investigated for renewable energy recovery in microbial fuel cells and bioremediation of heavy metals and radionuclides. The Shewanella nanowires display a surprising nonlinear electrical transport behavior, where the voltage dependence of the conductance reveals peaks indicating discrete energy levels with higher electronic density of states. Our results indicate that the molecular constituents along the Shewanella nanowires possess an intricate electronic structure that plays a role in mediating transport. PMID:18441026

Below-Background Ionizing Radiation as an Environmental Cue for Bacteria

DOE PAGES

Castillo, Hugo; Smith, Geoffrey B.

2017-02-14

All organisms on earth grow under the influence of a natural and relatively constant dose of ionizing radiation referred to as background radiation, and so cells have different mechanisms to prevent the accumulation of damage caused by its different components. However, current knowledge of the deleterious effects of radiation on cells is based on the exposure to acute and high or to chronic, above background doses of radiation and therefore is not appropriate to explain the cellular and biochemical mechanisms that cells employ to sense and respond to chronic below-background levels. Studies at below-background radiation doses can provide insight intomore » the biological role of radiation, as suggested by several examples of what appears to be a stress response in cells grown at doses that range from 10 to 79 times lower than background. Here, we discuss some of the technical constraints to shield cells from radiation to below-background levels, as well as different approaches used to detect and measure responses to such unusual environmental conditions. Then, we present data from Shewanella oneidensis and Deinococcus radiodurans experiments that show how two taxonomically distant bacterial species sense and respond to unnaturally low levels of radiation. Finally, in brief, we grew S. oneidensis and D. radiodurans in liquid culture at dose rates of 72.05 (control) and 0.91 (treatment) nGy hr -1 (including radon) for up to 72 h and measured cell density and the expression of stress-related genes. Our results suggest that a stress response is triggered in the absence of normal levels of radiation.« less

Below-Background Ionizing Radiation as an Environmental Cue for Bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castillo, Hugo; Smith, Geoffrey B.

All organisms on earth grow under the influence of a natural and relatively constant dose of ionizing radiation referred to as background radiation, and so cells have different mechanisms to prevent the accumulation of damage caused by its different components. However, current knowledge of the deleterious effects of radiation on cells is based on the exposure to acute and high or to chronic, above background doses of radiation and therefore is not appropriate to explain the cellular and biochemical mechanisms that cells employ to sense and respond to chronic below-background levels. Studies at below-background radiation doses can provide insight intomore » the biological role of radiation, as suggested by several examples of what appears to be a stress response in cells grown at doses that range from 10 to 79 times lower than background. Here, we discuss some of the technical constraints to shield cells from radiation to below-background levels, as well as different approaches used to detect and measure responses to such unusual environmental conditions. Then, we present data from Shewanella oneidensis and Deinococcus radiodurans experiments that show how two taxonomically distant bacterial species sense and respond to unnaturally low levels of radiation. Finally, in brief, we grew S. oneidensis and D. radiodurans in liquid culture at dose rates of 72.05 (control) and 0.91 (treatment) nGy hr -1 (including radon) for up to 72 h and measured cell density and the expression of stress-related genes. Our results suggest that a stress response is triggered in the absence of normal levels of radiation.« less

Charge-associated effects of fullerene derivatives on microbialstructural integrity and central metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Yinjie J.; Ashcroft, Jared M.; Chen, Ding

2007-01-23

The effects of four types of fullerene compounds (C60,C60-OH, C60-COOH, C60-NH2) were examined on two model microorganisms(Escherichia coli W3110 and Shewanella oneidensis MR-1). Positivelycharged C60-NH2 at concentrations as low as 10 mg/L inhibited growth andreduced substrate uptake for both microorganisms. Scanning ElectronMicroscopy (SEM) revealed damage to cellular structures.Neutrally-charged C60 and C60-OH had mild negative effects on S.oneidensis MR-1, whereas the negatively-charged C60-COOH did not affecteither microorganism s growth. The effect of fullerene compounds onglobal metabolism was further investigated using [3-13C]L-lactateisotopic labeling, which tracks perturbations to metabolic reaction ratesin bacteria by examining the change in the isotopic labeling pattern inthe resultingmore » metabolites (often amino acids).1-3 The 13C isotopomeranalysis from all fullerene-exposed cultures revealed no significantdifferences in isotopomer distributions from unstressed cells. Thisresult indicates that microbial central metabolism is robust toenvironmental stress inflicted by fullerene nanoparticles. In addition,although C60-NH2 compounds caused mechanical stress on the cell wall ormembrane, both S. oneidensis MR-1 and E. coli W3110 can efficientlyalleviate such stress by cell aggregation and precipitation of the toxicnanoparticles. The results presented here favor the hypothesis thatfullerenes cause more membrane stress4, 5, 6 than perturbation to energymetabolism7« less

Shewanella gelidii sp. nov., isolated from the red algae Gelidium amansii, and emended description of Shewanella waksmanii.

PubMed

Wang, Yan; Chen, Hongli; Liu, Zhenhua; Ming, Hong; Zhou, Chenyan; Zhu, Xinshu; Zhang, Peng; Jing, Changqin; Feng, Huigen

2016-08-01

A novel Gram-stain-negative, straight or slightly curved rod-shaped, non-spore-forming, facultatively anaerobic bacterium with a single polar flagellum, designated RZB5-4T, was isolated from a sample of the red algae Gelidium amansii collected from the coastal region of Rizhao, PR China (119.625° E 35.517° N). The organism grew optimally between 24 and 28 °C, at pH 7.0 and in the presence of 2-3 % (w/v) NaCl. The strain required seawater or artificial seawater for growth, and NaCl alone did not support growth. Strain RZB5-4T contained C16 : 1ω7c and/or C16 : 1ω6c, C16 : 0 and iso-C15 : 0 as the dominant fatty acids. The respiratory quinones detected in strain RZB5-4T were ubiquinone 7, ubiquinone 8, menaquinone 7 and methylmenaquinone 7. The polar lipids of strain RZB5-4T comprised phosphatidylethanolamine, phosphatidylglycerol, phosphatidylmonomethylethanolamine, one unidentified glycolipid, one unidentified phospholipid and one unknown lipid. The DNA G+C content of strain RZB5-4T was 47 mol %. Phylogenetic analysis based on 16S rRNA and gyrase B (gyrB) gene sequences showed that strain RZB5-4T belonged to the genus Shewanella, clustering with Shewanella waksmanii ATCC BAA-643T. Strain RZB5-4T exhibited the highest 16S rRNA gene sequence similarity value (96.6 %) and the highest gyrB gene sequence similarity value (80.7 %), respectively, to S. waksmanii ATCC BAA-643T. On the basis of polyphasic analyses, strain RZB5-4T represents a novel species of the genus Shewanella, for which the name Shewanella gelidii sp. nov. is proposed. The type strain is RZB5-4T (=JCM 30804T=KCTC 42663T=MCCC 1K00697T).

Microbial mediated iron redox cycling in Fe (hydr)oxides for nitrite removal.

PubMed

Lu, Yongsheng; Xu, Lu; Shu, Weikang; Zhou, Jizhi; Chen, Xueping; Xu, Yunfeng; Qian, Guangren

2017-01-01

Nitrite, at an environmentally relevant concentration, was significantly reduced with iron (hydr)oxides mediated by Shewanella oneidensis MR-1. The average nitrite removal rates of 1.28±0.08 and 0.65±0.02(mgL -1 )h -1 were achieved with ferrihydrite and magnetite, respectively. The results showed that nitrite removal was able to undergo multiple redox cycles with iron (hydr)oxides mediated by Shewanella oneidensis MR-1. During the bioreduction of the following cycles, biogenic Fe(II) was subsequently chemically oxidized to Fe(III), which is associated with nitrite reduction. There was 11.18±1.26mgL -1 of NH 4 + -N generated in the process of redox cycling of ferrihydrite. Additionally, results obtained by using X-ray diffraction showed that ferrihydrite and magnetite remained mainly stable in the system. This study indicated that redox cycling of Fe in iron (hydr)oxides was a potential process associated with NO 2 - -N removal from solution, and reduced most nitrite abiotically to gaseous nitrogen species. Copyright © 2016 Elsevier Ltd. All rights reserved.

Synergistic microbial consortium for bioenergy generation from complex natural energy sources.

PubMed

Wang, Victor Bochuan; Yam, Joey Kuok Hoong; Chua, Song-Lin; Zhang, Qichun; Cao, Bin; Chye, Joachim Loo Say; Yang, Liang

2014-01-01

Microbial species have evolved diverse mechanisms for utilization of complex carbon sources. Proper combination of targeted species can affect bioenergy production from natural waste products. Here, we established a stable microbial consortium with Escherichia coli and Shewanella oneidensis in microbial fuel cells (MFCs) to produce bioenergy from an abundant natural energy source, in the form of the sarcocarp harvested from coconuts. This component is mostly discarded as waste. However, through its usage as a feedstock for MFCs to produce useful energy in this study, the sarcocarp can be utilized meaningfully. The monospecies S. oneidensis system was able to generate bioenergy in a short experimental time frame while the monospecies E. coli system generated significantly less bioenergy. A combination of E. coli and S. oneidensis in the ratio of 1:9 (v:v) significantly enhanced the experimental time frame and magnitude of bioenergy generation. The synergistic effect is suggested to arise from E. coli and S. oneidensis utilizing different nutrients as electron donors and effect of flavins secreted by S. oneidensis. Confocal images confirmed the presence of biofilms and point towards their importance in generating bioenergy in MFCs.

Synergistic Microbial Consortium for Bioenergy Generation from Complex Natural Energy Sources

PubMed Central

Yam, Joey Kuok Hoong; Chua, Song-Lin; Zhang, Qichun; Cao, Bin; Chye, Joachim Loo Say

2014-01-01

Microbial species have evolved diverse mechanisms for utilization of complex carbon sources. Proper combination of targeted species can affect bioenergy production from natural waste products. Here, we established a stable microbial consortium with Escherichia coli and Shewanella oneidensis in microbial fuel cells (MFCs) to produce bioenergy from an abundant natural energy source, in the form of the sarcocarp harvested from coconuts. This component is mostly discarded as waste. However, through its usage as a feedstock for MFCs to produce useful energy in this study, the sarcocarp can be utilized meaningfully. The monospecies S. oneidensis system was able to generate bioenergy in a short experimental time frame while the monospecies E. coli system generated significantly less bioenergy. A combination of E. coli and S. oneidensis in the ratio of 1 : 9 (v : v) significantly enhanced the experimental time frame and magnitude of bioenergy generation. The synergistic effect is suggested to arise from E. coli and S. oneidensis utilizing different nutrients as electron donors and effect of flavins secreted by S. oneidensis. Confocal images confirmed the presence of biofilms and point towards their importance in generating bioenergy in MFCs. PMID:25097866

Structure of 2C-Methyl-D-erythritol-2,4-cyclodiphosphate Synthase from Shewanella oneidensis at 1.6 angstrom: Identification of Farnesyl pyrophosphate Trapped in a Hydrophobic Cavity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ni, Shuisong; Robinson, Howard; Marsing, Gregory C.

2004-11-01

prohibited a definitive analysis of the identity and mode of binding of the bound molecule. Kishida et al. (2003) reported that no cavity existed in a 1.6Å structure of the SO3437 homolog from Thermus thermophilus, presumably due to tighter packing of the protein from the thermophilic organism. Steinbacher et al. (2002) make no description of a hydrophobic cavity in a lower resolution (2.5-3.2Å) of the Escherichia coli protein. Here, we report a high-resolution (1.6Å) structure of MECDP synthase from Shewanella oneidensis in the absence of substrate in the active site. We provide unambiguous data that confirms the presence of Zn2+ in one of the metal binding sites and observe what appears to be farnesyl diphosphate (FPP) bound in the hydrophobic cavity along the non-crystallographic three-fold symmetry axis of the homotrimer. The high-resolution structure clarifies the mode of binding of the pyrophosphate of FPP in the arginine cluster that caps the hydrophobic cavity.« less

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

PubMed

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

DTIC Science & Technology

2009-03-01

Halobacterium sp. NRc-1 | Lactobacillus plantarum | Micrococcus luteus | Pyrococcus furiosus | Shewanella oneidensis | Synechocystis sp. Pcc... Lactobacillus plantarum16,47, which lacks the enzyme superoxide dismutase, and Synechocystis sp. PCC 68034 (Ref. 48) accumulated exceptionally high levels...high specificity for Mn2+, has been detected in L. plantarum , but has not been found in D. radiodurans. Manganese transport in D. radiodurans is

DOE Office of Scientific and Technical Information (OSTI.GOV)

NEALSON, KENNETH H.

This project had as its goals the understanding of the ecophysiology of the genus Shewanella using various genomics approaches. As opposed to other programs involving Shewanella, this one branched out into the various areas in which Shewanella cells are active, and included both basic and applied studies. All of the work was, to some extent, related to the ability of the bacteria to accomplish electron exchange between the cell and solid state electron acceptors and/or electron donors, a process we call Extracellular Electron Transport, or EET. The major accomplishments related to several different areas: Basic Science Studies: 1. Genetics andmore » genomics of nitrate reduction, resulting in elucidation of atypical nitrate reduction systems in Shewanella oneidensis (MR-1)[2]. 2. Influence of bacterial strain and growth conditions on iron reduction, showing that rates of reduction, extents of reduction, and the formation of secondary minerals were different for different strains of Shewanella [3,4,9]. 3. Comparative genomics as a tool for comparing metabolic capacities of different Shewanella strains, and for predicting growth and metabolism [6,10,15]. In these studies, collaboration with ORNL, PNNL, and 4. Basic studies of electron transport in strain MR-1, both to poised electrodes, and via conductive nanowires [12,13]. This included the first accurate measurements of electrical energy generation by a single cell during electrode growth [12], and the demonstration of electrical conductivity along the length of bacterial nanowires [13]. 5. Impact of surface charge and electron flow on cell movement, cell attachment, cell growth, and biofilm formation [7.18]. The demonstration that interaction with solid state electron acceptors resulted in increased motility [7] led to the description of a phenomenon called electrokinesis. The importance of this for biofilm formation and for electron flow was hypothesized by Nealson & Finkel [18], and is now under study in

Differentiation of Shewanella putrefaciens and Shewanella alga on the basis of whole-cell protein profiles, ribotyping, phenotypic characterization, and 16S rRNA gene sequence analysis.

PubMed Central

Vogel, B F; Jørgensen, K; Christensen, H; Olsen, J E; Gram, L

1997-01-01

Seventy-six presumed Shewanella putrefaciens isolates from fish, oil drillings, and clinical specimens, the type strain of Shewanella putrefaciens (ATCC 8071), the type strain of Shewanella alga (IAM 14159), and the type strain of Shewanella hanedai (ATCC 33224) were compared by several typing methods. Numerical analysis of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell protein and ribotyping patterns showed that the strains were separated into two distinct clusters with 56% +/- 10% and 40% +/- 14% similarity for whole-cell protein profiling and ribotyping, respectively. One cluster consisted of 26 isolates with 52 to 55 mol% G + C and included 15 human isolates, mostly clinical specimens, 8 isolates from marine waters, and the type strain of S. alga. This homogeneous cluster of mesophilic, halotolerant strains was by all analyses identical to the recently defined species S. alga (U. Simidu et al., Int. J. Syst. Bacteriol, 40:331-336, 1990). Fifty-two typically psychrotolerant strains formed the other, more heterogeneous major cluster, with 43 to 47 mol% G + C. The type strain of S. putrefaciens was included in this group. The two groups were confirmed by 16S rRNA gene sequence analysis. It is concluded that the isolates must be considered two different species, S. alga and S. putrefaciens, and that most mesophilic isolates formerly identified as S. putrefaciens belong to S. alga. The ecological role and potential pathogenicity of S. alga can be evaluated only if the organism is correctly identified. PMID:9172338

Shewanella species as the origin of blaOXA-48 genes: insights into gene diversity, associated phenotypes and possible transfer mechanisms.

PubMed

Tacão, Marta; Araújo, Susana; Vendas, Maria; Alves, Artur; Henriques, Isabel

2018-03-01

Chromosome-encoded beta-lactamases of Shewanella spp. have been indicated as probable progenitors of bla OXA-48 -like genes. However, these have been detected in few Shewanella spp. and dissemination mechanisms are unclear. Thus, our main objective was to confirm the role of Shewanella species as progenitors of bla OXA-48 -like genes. In silico analysis of Shewanella genomes was performed to detect bla OXA-48 -like genes and context, and 43 environmental Shewanella spp. were characterised. Clonal relatedness was determined by BOX-PCR. Phylogenetic affiliation was assessed by 16S rDNA and gyrB sequencing. Antibiotic susceptibility phenotypes were determined. The bla OXA-48 -like genes and genetic context were inspected by PCR, hybridisation and sequence analysis. Gene variants were cloned in Escherichia coli and MICs were determined. Shewanella isolates were screened for integrons, plasmids and insertion sequences. Analysis of Shewanella spp. genomes showed that putative bla OXA-48 -like is present in the majority and in an identical context. Isolates presenting unique BOX profiles affiliated with 11 Shewanella spp. bla OXA-48 -like genes were detected in 22 isolates from 6 species. Genes encoded enzymes identical to OXA-48, OXA-204, OXA-181, and 7 new variants differing from OXA-48 from 2 to 82 amino acids. IS1999 was detected in 24 isolates, although not in the vicinity of bla OXA-48 genes. Recombinant E. coli strains presented altered MICs. The presence/absence of bla OXA-48 -like genes was species-related. Gene variants encoded enzymes with hydrolytic spectra similar to OXA-48-like from non-shewanellae. From the mobile elements previously described in association with bla OXA-48 -like genes, only the IS1999 was found in Shewanella, which indicates its relevance in bla OXA-48 -like genes transfer to other hosts. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Shewanella amazonensis sp. nov., a novel metal-reducing facultative anaerobe from Amazonian shelf muds

NASA Technical Reports Server (NTRS)

Venkateswaran, K.; Dollhopf, M. E.; Aller, R.; Stackebrandt, E.; Nealson, K. H.

1998-01-01

A new bacterial species belonging to the genus Shewanella is described on the basis of phenotypic characterization and sequence analysis of its 16S rRNA-encoding and gyrase B (gyrB) genes. This organism, isolated from shallow-water marine sediments derived from the Amazon River delta, is a Gram-negative, motile, polarly flagellated, facultatively anaerobic, rod-shaped eubacterium and has a G&C content of 51.7 mol%. Strain SB2BT is exceptionally active in the anaerobic reduction of iron, manganese and sulfur compounds. SB2BT grows optimally at 35 degrees C, with 1-3% NaCl and over a pH range of 7-8. Analysis of the 16S rDNA sequence revealed a clear affiliation between strain SB2BT and members of the gamma subclass of the class Proteobacteria. High similarity values were found with certain members of the genus Shewanella, especially with Shewanella putrefaciens, and this was supported by cellular fatty acid profiles and phenotypic characterization. DNA-DNA hybridization between strain SB2BT and its phylogenetically closest relatives revealed low similarity values (24.6-42.7%) which indicated species status for strain SB2BT. That SB2BT represents a distinct bacterial species within the genus Shewanella is also supported by gyrB sequence analysis. Considering the source of the isolate, the name Shewanella amazonensis sp. nov. is proposed and strain SB2BT (= ATCC 700329T) is designated as the type strain.

Isolation and Physiological Characterization of Psychrophilic Denitrifying Bacteria from Permanently Cold Arctic Fjord Sediments (Svalbard, Norway)

NASA Technical Reports Server (NTRS)

Canion, Andy; Prakash, Om; Green, Stefan J.; Jahnke, Linda; Kuypers, Marcel M. M.; Kostka, Joel E.

2013-01-01

A large proportion of reactive nitrogen loss from polar sediments is mediated by denitrification, but microorganisms mediating denitrification in polar environments remain poorly characterized. A combined approach of most-probable-number (MPN) enumeration, cultivation and physiological characterization was used to describe psychrophilic denitrifying bacterial communities in sediments of three Arctic fjords in Svalbard (Norway). A MPN assay showed the presence of 10(sup 3)-10(sup 6) cells of psychrophilic nitrate-respiring bacteria g(sup -1) of sediment. Fifteen strains within the Proteobacteria were isolated using a systematic enrichment approach with organic acids as electron donors and nitrate as an electron acceptor. Isolates belonged to five genera, including Shewanella, Pseudomonas, Psychromonas (Gammaproteobacteria), Arcobacter (Epsilonproteobacteria) and Herminiimonas (Betaproteobacteria). All isolates were denitrifiers, except Shewanella, which exhibited the capacity for dissimilatory nitrate reduction to ammonium (DNRA). Growth from 0 to 40 degC demonstrated that all genera except Shewanella were psychrophiles with optimal growth below 15 degC, and adaptation to low temperature was demonstrated as a shift from primarily C16:0 saturated fatty acids to C16:1 monounsaturated fatty acids at lower temperatures. This study provides the first targeted enrichment and characterization of psychrophilic denitrifying bacteria from polar sediments, and two genera, Arcobacter and Herminiimonas, are isolated for the first time from permanently cold marine sediments.

Methods of producing protoporphyrin IX and bacterial mutants therefor

DOEpatents

Zhou, Jizhong; Qiu, Dongru; He, Zhili; Xie, Ming

2016-03-01

The presently disclosed inventive concepts are directed in certain embodiments to a method of producing protoporphyrin IX by (1) cultivating a strain of Shewanella bacteria in a culture medium under conditions suitable for growth thereof, and (2) recovering the protoporphyrin IX from the culture medium. The strain of Shewanella bacteria comprises at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX. In certain embodiments of the method, the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or of shew_1140. In other embodiments, the presently disclosed inventive concepts are directed to mutant strains of Shewanella bacteria having at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX during cultivation of the bacteria. In certain embodiments the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or shew_1140.

A miniature microbial fuel cell with conducting nanofibers-based 3D porous biofilm

NASA Astrophysics Data System (ADS)

Jiang, Huawei; Halverson, Larry J.; Dong, Liang

2015-12-01

Miniature microbial fuel cell (MFC) technology has received growing interest due to its potential applications in high-throughput screening of bacteria and mutants to elucidate mechanisms of electricity generation. This paper reports a novel miniature MFC with an improved output power density and short startup time, utilizing electrospun conducting poly(3,4-ethylenedioxythiophene) (PEDOT) nanofibers as a 3D porous anode within a 12 μl anolyte chamber. This device results in 423 μW cm-3 power density based on the volume of the anolyte chamber, using Shewanella oneidensis MR-1 as a model biocatalyst without any optimization of bacterial culture. The device also excels in a startup time of only 1hr. The high conductivity of the electrospun nanofibers makes them suitable for efficient electron transfer. The mean pore size of the conducting nanofibers is several micrometers, which is favorable for bacterial penetration and colonization of surfaces of the nanofibers. We demonstrate that S. oneidensis can fully colonize the interior region of this nanofibers-based porous anode. This work represents a new attempt to explore the use of electrospun PEDOT nanofibers as a 3D anode material for MFCs. The presented miniature MFC potentially will provide a high-sensitivity, high-throughput tool to screen suitable bacterial species and mutant strains for use in large-size MFCs.

Spoilage bacteria of fresh broiler chicken carcasses.

PubMed

Russell, S M; Fletcher, D L; Cox, N A

1995-12-01

Studies were conducted to identify the bacteria responsible for spoilage of fresh broiler chicken carcasses and to characterize the off-odors these bacteria produce. Broiler carcasses were collected from processing plants in the northeast Georgia area, the southeastern U.S., Arkansas, California, and North Carolina. The carcasses were allowed to spoil under controlled conditions at 3 C and spoilage bacteria were isolated. Each spoilage bacterium was separately inoculated into a sterile chicken skin medium, incubated at 25 C for 48 h, and subjectively evaluated for odor. The bacteria isolated from spoiled carcasses that consistently produced off-odors in the chicken skin medium, regardless of the geographical location from which the chickens were obtained, were Shewanella putrefaciens A, B, and D, Pseudomonas fluorescens A, B, and D, and Pseudomonas fragi. These bacteria produced off-odors that resembled "sulfur", "dishrag", "ammonia", "wet dog", "skunk", "dirty socks", "rancid fish", "unspecified bad odor", or a sweet smell resembling "canned corn". Odors produced by the spoilage bacteria were varied; however, odors most associated with spoiled poultry, such as "dishraggy" odors, were produced by the bacteria that were most consistently isolated, such as S. putrefaciens and the pseudomonads.

Reduction of Fe(III) colloids by Shewanella putrefaciens: A kinetic model

NASA Astrophysics Data System (ADS)

Bonneville, Steeve; Behrends, Thilo; van Cappellen, Philippe; Hyacinthe, Christelle; Röling, Wilfred F. M.

2006-12-01

A kinetic model for the microbial reduction of Fe(III) oxyhydroxide colloids in the presence of excess electron donor is presented. The model assumes a two-step mechanism: (1) attachment of Fe(III) colloids to the cell surface and (2) reduction of Fe(III) centers at the surface of attached colloids. The validity of the model is tested using Shewanella putrefaciens and nanohematite as model dissimilatory iron reducing bacteria and Fe(III) colloidal particles, respectively. Attachment of nanohematite to the bacteria is formally described by a Langmuir isotherm. Initial iron reduction rates are shown to correlate linearly with the relative coverage of the cell surface by nanohematite particles, hence supporting a direct electron transfer from membrane-bound reductases to mineral particles attached to the cells. Using internally consistent parameter values for the maximum attachment capacity of Fe(III) colloids to the cells, Mmax, the attachment constant, KP, and the first-order Fe(III) reduction rate constant, k, the model reproduces the initial reduction rates of a variety of fine-grained Fe(III) oxyhydroxides by S. putrefaciens. The model explains the observed dependency of the apparent Fe(III) half-saturation constant, Km∗, on the solid to cell ratio, and it predicts that initial iron reduction rates exhibit saturation with respect to both the cell density and the abundance of the Fe(III) oxyhydroxide substrate.

Enrichment and isolation of crude oil degrading bacteria from some mussels collected from the Persian Gulf.

PubMed

Bayat, Zeynab; Hassanshahian, Mehdi; Hesni, Majid Askari

2015-12-15

To date, little is known about existing relationships between mussels and bacteria in hydrocarbon-contaminated marine environments. The aim of this study is to find crude oil degrading bacteria in some mussels at the Persian Gulf. Twenty eight crude oil degrading bacteria were isolated from three mussels species collected from oil contaminated area at Persian Gulf. According to high growth and degradation of crude oil four strains were selected between 28 isolated strains for more study. Determination the nucleotide sequence of the gene encoding for 16S rRNA show that these isolated strains belong to: Shewanella algae isolate BHA1, Micrococcus luteus isolate BHA7, Pseudoalteromonas sp. isolate BHA8 and Shewanella haliotis isolate BHA35. The residual crude oil in culture medium was analysis by Gas Chromatography (GC). The results confirmed that these strains can degrade: 47.24%, 66.08%, 27.13% and 69.17% of crude oil respectively. These strains had high emulsification activity and biosurfactant production. Also, the effects of some factors on crude oil degradation by isolated strains were studied. The results show that the optimum concentration of crude oil was 2.5% and the best degradation take place at 12% of salinity. This research is the first reports on characterization of crude oil degrading bacteria from mussels at Persian Gulf and by using of these bacteria in the field the effect of oil pollution can be reduce on this marine environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Adhesion and formation of microbial biofilms in complex microfluidic devices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Aloke; Karig, David K; Neethirajan, Suresh

2012-01-01

Shewanella oneidensis is a metal reducing bacterium, which is of interest for bioremediation and clean energy applications. S. oneidensis biofilms play a critical role in several situations such as in microbial energy harvesting devices. Here, we use a microfluidic device to quantify the effects of hydrodynamics on the biofilm morphology of S. oneidensis. For different rates of fluid flow through a complex microfluidic device, we studied the spatiotemporal dynamics of biofilms, and we quantified several morphological features such as spatial distribution, cluster formation and surface coverage. We found that hydrodynamics resulted in significant differences in biofilm dynamics. The baffles inmore » the device created regions of low and high flow in the same device. At higher flow rates, a nonuniform biofilm develops, due to unequal advection in different regions of the microchannel. However, at lower flow rates, a more uniform biofilm evolved. This depicts competition between adhesion events, growth and fluid advection. Atomic force microscopy (AFM) revealed that higher production of extra-cellular polymeric substances (EPS) occurred at higher flow velocities.« less

Crystal structures of two novel dye-decolorizing peroxidases reveal a beta-barrel fold with a conserved heme-binding motif.

PubMed

Zubieta, Chloe; Krishna, S Sri; Kapoor, Mili; Kozbial, Piotr; McMullan, Daniel; Axelrod, Herbert L; Miller, Mitchell D; Abdubek, Polat; Ambing, Eileen; Astakhova, Tamara; Carlton, Dennis; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C; Duan, Lian; Elsliger, Marc-André; Feuerhelm, Julie; Grzechnik, Slawomir K; Hale, Joanna; Hampton, Eric; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kumar, Abhinav; Marciano, David; Morse, Andrew T; Nigoghossian, Edward; Okach, Linda; Oommachen, Silvya; Reyes, Ron; Rife, Christopher L; Schimmel, Paul; van den Bedem, Henry; Weekes, Dana; White, Aprilfawn; Xu, Qingping; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

2007-11-01

BtDyP from Bacteroides thetaiotaomicron (strain VPI-5482) and TyrA from Shewanella oneidensis are dye-decolorizing peroxidases (DyPs), members of a new family of heme-dependent peroxidases recently identified in fungi and bacteria. Here, we report the crystal structures of BtDyP and TyrA at 1.6 and 2.7 A, respectively. BtDyP assembles into a hexamer, while TyrA assembles into a dimer; the dimerization interface is conserved between the two proteins. Each monomer exhibits a two-domain, alpha+beta ferredoxin-like fold. A site for heme binding was identified computationally, and modeling of a heme into the proposed active site allowed for identification of residues likely to be functionally important. Structural and sequence comparisons with other DyPs demonstrate a conservation of putative heme-binding residues, including an absolutely conserved histidine. Isothermal titration calorimetry experiments confirm heme binding, but with a stoichiometry of 0.3:1 (heme:protein). (c) 2007 Wiley-Liss, Inc.

Preparation of Biocomposite Microfibers Ready for Processing into Biologically Active Textile Fabrics for Bioremediation.

PubMed

Kaiser, Patrick; Reich, Steffen; Greiner, Andreas; Freitag, Ruth

2018-06-12

Biocomposites, i.e., materials consisting of metabolically active microorganisms embedded in a synthetic extracellular matrix, may find applications as highly specific catalysts in bioproduction and bioremediation. 3D constructs based on fibrous biocomposites, so-called "artificial biofilms," are of particular interest in this context. The inability to produce biocomposite fibers of sufficient mechanical strength for processing into bioactive fabrics has so far hindered progress in the area. Herein a method is proposed for the direct wet spinning of microfibers suitable for weaving and knitting. Metabolically active bacteria (either Shewanella oneidensis or Nitrobacter winogradskyi (N. winogradskyi)) are embedded in these fibers, using poly(vinyl alcohol) as matrix. The produced microfibers have a partially crystalline structure and are stable in water without further treatment, such as coating. In a first application, their potential for nitrite removal (N. winogradskyi) is demonstrated, a typical challenge in potable water treatment. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cold adaptation of the mononuclear molybdoenzyme periplasmic nitrate reductase from the Antarctic bacterium Shewanella gelidimarina

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simpson, Philippa J.L.; Codd, Rachel, E-mail: rachel.codd@sydney.edu.au; School of Medical Sciences

2011-11-04

Highlights: Black-Right-Pointing-Pointer Cold-adapted phenotype of NapA from the Antarctic bacterium Shewanella gelidimarina. Black-Right-Pointing-Pointer Protein homology model of NapA from S. gelidimarina and mesophilic homologue. Black-Right-Pointing-Pointer Six amino acid residues identified as lead candidates governing NapA cold adaptation. Black-Right-Pointing-Pointer Molecular-level understanding of designing cool-temperature in situ oxyanion sensors. -- Abstract: The reduction of nitrate to nitrite is catalysed in bacteria by periplasmic nitrate reductase (Nap) which describes a system of variable protein subunits encoded by the nap operon. Nitrate reduction occurs in the NapA subunit, which contains a bis-molybdopterin guanine dinucleotide (Mo-MGD) cofactor and one [4Fe-4S] iron-sulfur cluster. The activity ofmore » periplasmic nitrate reductase (Nap) isolated as native protein from the cold-adapted (psychrophilic) Antarctic bacterium Shewanella gelidimarina (Nap{sub Sgel}) and middle-temperature adapted (mesophilic) Shewanella putrefaciens (Nap{sub Sput}) was examined at varied temperature. Irreversible deactivation of Nap{sub Sgel} and Nap{sub Sput} occurred at 54.5 and 65 Degree-Sign C, respectively. When Nap{sub Sgel} was preincubated at 21-70 Degree-Sign C for 30 min, the room-temperature nitrate reductase activity was maximal and invariant between 21 and 54 Degree-Sign C, which suggested that Nap{sub Sgel} was poised for optimal catalysis at modest temperatures and, unlike Nap{sub Sput}, did not benefit from thermally-induced refolding. At 20 Degree-Sign C, Nap{sub Sgel} reduced selenate at 16% of the rate of nitrate reduction. Nap{sub Sput} did not reduce selenate. Sequence alignment showed 46 amino acid residue substitutions in Nap{sub Sgel} that were conserved in NapA from mesophilic Shewanella, Rhodobacter and Escherichia species and could be associated with the Nap{sub Sgel} cold-adapted phenotype. Protein homology modeling of Nap{sub Sgel

Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens

NASA Technical Reports Server (NTRS)

Nealson, K. H.; Moser, D. P.; Saffarini, D. A.

1995-01-01

Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.

Modeling biofilms with dual extracellular electron transfer mechanisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renslow, Ryan S.; Babauta, Jerome T.; Kuprat, Andrew P.

2013-11-28

Electrochemically active biofilms have a unique form of respiration in which they utilize solid external materials as their terminal electron acceptor for metabolism. Currently, two primary mechanisms have been identified for long-range extracellular electron transfer (EET): a diffusion- and a conduction-based mechanism. Evidence in the literature suggests that some biofilms, particularly Shewanella oneidensis, produce components requisite for both mechanisms. In this study, a generic model is presented that incorporates both diffusion- and conduction-based mechanisms and allows electrochemically active biofilms to utilize both simultaneously. The model was applied to Shewanella oneidensis and Geobacter sulfurreducens biofilms using experimentally generated data found themore » literature. Our simulation results showed that 1) biofilms having both mechanisms available, especially if they can interact, may have metabolic advantage over biofilms that can use only a single mechanism; 2) the thickness of Geobacter sulfurreducens biofilms is likely not limited by conductivity; 3) accurate intrabiofilm diffusion coefficient values are critical for current generation predictions; and 4) the local biofilm potential and redox potential are two distinct measurements and cannot be assumed to have identical values. Finally, we determined that cyclic and squarewave voltammetry are currently not good tools to determine the specific percentage of extracellular electron transfer mechanisms used by biofilms. The developed model will be a critical tool in designing experiments to explain EET mechanisms.« less

Physiological changes induced in four bacterial strains following oxidative stress.

PubMed

Baatout, S; De Boever, P; Mergeay, M

2006-01-01

In order to study the behaviour and resistance of bacteria under extreme conditions, physiological changes associated with oxidative stress were monitored using flow cytometry. The study was conducted to assess the maintenance of membrane integrity and potential as well as the esterase activity, the intracellular pH and the production of superoxide anions in four bacterial strains (Ralstonia metallidurans, Escherichia coli, Shewanella oneidensis and Deinococcus radiodurans). The strains were chosen for their potential usefulness in bioremediation. Suspensions of R. metallidurans, E. coli, S. oneidensis and D. radiodurans were submitted to 1 h oxidative stress (H2O2 at various concentrations from 0 to 880 mM). Cell membrane permeability (propidium iodide) and potential (rhodamine-123, 3,3'-dihexyloxacarbocyanine iodide), intracellular esterase activity (fluorescein diacetate), intracellular reactive oxygen species concentration (hydroethidine) and intracellular pH (carboxyflurorescein diacetate succinimidyl ester (5(6)) were monitored to evaluate the physiological state and the overall fitness of individual bacterial cells under oxidative stress. The four bacterial strains exhibited varying sensitivities towards H2O2. However, for all bacterial strains, some physiological damage could already be observed from 13.25 mM H2O2 onwards, in particular with regard to their membrane permeability. Depending on the bacterial strains, moderate to high physiological damage could be observed between 13.25 mM and 220 mM H2O2. Membrane potential, esterase activity, intracellular pH and production of superoxide anion production were considerably modified at high H2O2 concentrations in all four strains. In conclusion, we show that a range of significant physiological alterations occurs when bacteria are challenged with H2O2 and fluorescent staining methods coupled with flow cytometry are useful for monitoring the changes induced not only by oxidative stress but also by other

Metabolic Profiling Directly from the Petri Dish Using Nanospray Desorption Electrospray Ionization Imaging Mass Spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watrous, Jeramie D.; Roach, Patrick J.; Heath, Brandi S.

2013-11-05

Understanding molecular interaction pathways in complex biological systems constitutes a treasure trove of knowledge that might facilitate the specific, chemical manipulation of the countless microbiological systems that occur throughout our world. However, there is a lack of methodologies that allow the direct investigation of chemical gradients and interactions in living biological systems, in real time. Here, we report the use of nanospray desorption electrospray ionization (nanoDESI) imaging mass spectrometry for in vivo metabolic profiling of living bacterial colonies directly from the Petri dish with absolutely no sample preparation needed. Using this technique, we investigated single colonies of Shewanella oneidensis MR-1,more » Bacillus subtilis 3610, and Streptomyces coelicolor A3(2) as well as a mixed biofilm of S. oneidensis MR-1 and B. subtilis 3610. Data from B. subtilis 3610 and S. coelicolor A3(2) provided a means of validation for the method while data from S. oneidensis MR-1 and the mixed biofilm showed a wide range of compounds that this bacterium uses for the dissimilatory reduction of extracellular metal oxides, including riboflavin, iron-bound heme and heme biosynthetic intermediates, and the siderophore putrebactin.« less

Influence of sulfhydryl sites on metal binding by bacteria

NASA Astrophysics Data System (ADS)

Nell, Ryan M.; Fein, Jeremy B.

2017-02-01

The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low

Production and Dietary Uptake of PUFA by Piezophilic Bacteria, Implications for Marine Biogeochemistry

NASA Astrophysics Data System (ADS)

Fang, J.; Chan, O.; Agarkar, N.; Kato, C.; Sato, T.

2003-12-01

Polyunsaturated fatty acids (PUFAs) have been used extensively as proxies for determining the source and preservation of organic matter in marine sediments. However, the origin of polyunsaturated fatty acids in deep-sea sediments is not well understood; the ultimate source of PUFAs is only partially constrained. At issue is whether PUFAs in deep-sea sediments are derived from the primary production of the photic zone or from the in situ piezophilic bacterial production in the deep-sea, or both. In this study, we tested three deep-sea piezophilic strains, Shewanella violacea DSS12, Shewanella benthica DB21MT-2, Moritella yayanosii DB21MT-5, in biosynthesis and dietary uptake of PUFAs. These piezophilic bacteria were characterized by high abundance of unsaturated fatty acids (62-73% of total fatty acids). In particularly, polyunsaturated fatty acids (PUFA) were detected in all piezophiles examined, ranging from 8 to 27% of total fatty acids. M. japonica DSK1 produced 22:6n-3 (cis-4,7,10,13,16,19-docosahexaenoic acid, DHA), whereas the three Shewanella strains produced 20:5n-3 (cis-5,8,11,14,17-eicosapentaenoic acid, EPA) with trace amounts of DHA. The total concentrations of PLFA were higher in strains grown at low pressure (DSK1, 10 Megapascal or MPa, 26,983μ g/g dry wt cells; DSS12, 50 MPa, 23,986 μ g/g), and lower in strains grown at high pressure (DB6705, 85 MPa, 1,901μ g/g; DB21MT-2, 100 MPa, 3,014 μ g/g). When growth media were supplemented with arachidonic acid (AA; C20:4n-6), there was active uptake and cellular incorporation of AA in the hyperpiezophilic bacteria DB21MT-2 (14.7%) and DB21MT-5 (1.4%). No uptake was observed in DSS12. When cells were treated with antibiotic cerulenin, all three strains incorporated AA into cell membranes (13 to 19%). These results suggest that piezophilic bacteria can be an important contributor in producing and reworking of PUFAs in the deep sea, and that that caution must be exercised in using PUFAs in deducing sources

Biochemical and pathogenic properties of the natural isolate of Shewanella algae from Peter the great bay, sea of Japan.

PubMed

Beleneva, Irina A; Magarlamov, T Yu; Eliseikina, Marina G; Zhukova, Natalia V

2009-11-01

Pathogenic properties of the natural isolate of Shewanella algae from the coelomic fluid of the sea cucumber Apostichopus japonicus (Peter the Great Bay, Sea of Japan) were investigated. The isolate had oxydative metabolism, was positive for ornithine decarboxylase, cytochrome oxidase, catalase, DNase and gelatinase, hemolytically active, did not produce acid from carbohydrates, and did not hydrolyze urea and esculin. The strain was resistant to penicillin, amoxicillin, and ampicillin and susceptible to tetracycline and carbenicillin. Among cellular fatty acids, 13:0-i, 15:0-i, 16:0, 16:1(n-7), 17:0-i, and 17:0-ai dominated. These biochemical properties made it possible to attribute the isolated bacteria to the genus Shewanella and identified as S. algae. The cells of this bacterium were introduced into the coelomic cavity of another echinoderm, the sea urchin Strongylocentrotus nudus. As a result, in about 24h the animals became slow and 3-8days after the inoculation died. Dividing bacteria were being found during the experiment in the coelomic fluid as well as in the phagosomes of amoebocytes, i.e. cells acting as phagocytes in the coelomic fluid. The studies of the invasive properties of strain 156 showed that bacterial cells entered the subcuticular space of S. nudus and A. japonicus through the cuticle and stayed there for a long time without penetrating epithelium and exerting toxic effect upon the organisms of the laboratory animals. Pathogenic effect of S. algae can be manifested only if the cutaneous epithelium is destroyed permitting it to penetrate the lower tissue layers. The toxicity of S. algae is confirmed by in vitro experiments. The inoculation of the embryonic cells of S. nudus with samples of this bacterium caused the death of 10% of cells within an hour and 100% of cells within 12h after inoculation. The results of the investigations demonstrate that S. algae could produce opportunistic infection in the sea cucumber A. japonicus and the sea

Sorption and precipitation of Mn2+ by viable and autoclaved Shewanella putrefaciens: Effect of contact time

NASA Astrophysics Data System (ADS)

Chubar, Natalia; Visser, Tom; Avramut, Cristina; de Waard, Helen

2013-01-01

The sorption of Mn(II) by viable and inactivated cells of Shewanella putrefaciens, a non-pathogenic, facultative anaerobic, gram-negative bacterium characterised as a Mn(IV) and Fe(III) reducer, was studied under aerobic conditions, as a function of pH, bacterial density and metal loading. During a short contact time (3-24 h), the adsorptive behaviour of live and dead bacteria toward Mn(II) was sufficiently similar, an observation that was reflected in the studies on adsorption kinetics at various metal loadings, effects of pH, bacteria density, isotherms and drifting of pH during adsorption. Continuing the experiment for an additional 2-30 days demonstrated that the Mn(II) sorption by suspensions of viable and autoclaved cells differed significantly from one another. The sorption to dead cells was characterised by a rapid equilibration and was described by an isotherm. In contrast, the sorption (uptake) to live bacteria exhibited a complex time-dependent uptake. This uptake began as adsorption and ion exchange processes followed by bioprecipitation, and it was accompanied by the formation of polymeric sugars (EPS) and the release of dissolved organic substances. FTIR, EXAFS/XANES and XPS demonstrated that manganese(II) phosphate was the main precipitate formed in 125 ml batches, which is the first evidence of the ability of microbes to synthesise manganese phosphates. XPS and XANES spectra did not detect Mn(II) oxidation. Although the release of protein-like compounds by the viable bacteria increased in the presence of Mn2+ (and, by contrast, the release of carbohydrates did not change), electrochemical analyses did not indicate any aqueous complexation of Mn(II) by the organic ligands.

A comparative analysis of tellurite detoxification by members of the genus Shewanella.

PubMed

Valdivia-González, M A; Díaz-Vásquez, W A; Ruiz-León, D; Becerra, A A; Aguayo, D R; Pérez-Donoso, J M; Vásquez, C C

2018-03-01

The increasing industrial utilization of tellurium has resulted in an important environmental pollution with the soluble, extremely toxic oxyanion tellurite. In this context, the use of microorganisms for detoxifying tellurite or tellurium biorecovery has gained great interest. The ability of different Shewanella strains to reduce tellurite to elemental tellurium was assessed; the results showed that the reduction process is dependent on electron transport and the ∆pH gradient. While S. baltica OS155 showed the highest tellurite resistance, S. putrefaciens was the most efficient in reducing tellurite. Moreover, pH-dependent tellurite transformation was associated with tellurium precipitation as tellurium dioxide. In summary, this work highlights the high tellurite reduction/detoxification ability exhibited by a number of Shewanella species, which could represent the starting point to develop friendly methods for the recovery of elemental tellurium (or tellurium dioxide).

Whole-genome sequencing reveals that Shewanella haliotis Kim et al. 2007 can be considered a later heterotypic synonym of Shewanella algae Simidu et al. 1990.

PubMed

Szeinbaum, Nadia; Kellum, Cailin E; Glass, Jennifer B; Janda, J Michael; DiChristina, Thomas J

2018-04-01

Previously, experimental DNA-DNA hybridization (DDH) between Shewanellahaliotis JCM 14758 T and Shewanellaalgae JCM 21037 T had suggested that the two strains could be considered different species, despite minimal phenotypic differences. The recent isolation of Shewanella sp. MN-01, with 99 % 16S rRNA gene identity to S. algae and S. haliotis, revealed a potential taxonomic problem between these two species. In this study, we reassessed the nomenclature of S. haliotis and S. algae using available whole-genome sequences. The whole-genome sequence of S. haliotis JCM 14758 T and ten S. algae strains showed ≥97.7 % average nucleotide identity and >78.9 % digital DDH, clearly above the recommended species thresholds. According to the rules of priority and in view of the results obtained, S. haliotis is to be considered a later heterotypic synonym of S. algae. Because the whole-genome sequence of Shewanella sp. strain MN-01 shares >99 % ANI with S. algae JCM 14758 T , it can be confidently identified as S. algae.

Application Of Bacterial Iron Reduction For The Removal Of Iron Impurities From Industrial Silica Sand And Kaolin

NASA Astrophysics Data System (ADS)

Zegeye, A.; Yahaya, S.; Fialips, C. I.; White, M.; Manning, D. A.; Gray, N.

2008-12-01

Biogeochemical evidence exists to support the potential importance of crystalline or amorphous Fe minerals as electron acceptor for Fe reducing bacteria in soils and subsurface sediments. This microbial metabolic activity can be exploited as alternative method in different industrial applications. For instance, the removal of ferric iron impurities from minerals for the glass and paper industries currently rely on physical and chemical treatments having substantial economical and environmental disadvantages. The ability to remove iron by other means, such as bacterial iron reduction, may reduce costs, allow lower grade material to be mined, and improve the efficiency of mineral processing. Kaolin clay and silica sand are used in a wide range of industrial applications, particularly in paper, ceramics and glass manufacturing. Depending on the geological conditions of deposition, they are often associated with iron (hydr)oxides that are either adsorbed to the mineral surfaces or admixed as separate iron bearing minerals. In this study, we have examined the Fe(III) removal efficiency from kaolin and silica sand by a series of iron- reducing bacteria from the Shewanella species (S. alga BrY, S. oneidensis MR-1, S. putrefaciens CN32 and S. putrefaciens ATCC 8071) in the presence of anthraquinone 2,6 disulfonate (AQDS). We have also investigated the effectiveness of a natural organic matter, extracted with the silica sand, as a substitute to AQDS for enhancing Fe(III) reduction kinetics. The microbial reduction of Fe(III) was achieved using batch cultures under non-growth conditions. The rate and the extent of Fe(III) reduction was monitored as a function of the initial Fe(III) content, Shewanella species and temperature. The bacterially- treated minerals were analyzed by transmission electron microscopy (TEM) and X-ray diffraction (XRD) to observe any textural and mineralogical transformation. The whiteness and ISO brightness of the kaolin was also measured by

Cr isotope fractionation factors for Cr(VI) reduction by a metabolically diverse group of bacteria

NASA Astrophysics Data System (ADS)

Basu, Anirban; Johnson, Thomas M.; Sanford, Robert A.

2014-10-01

Reduction of Cr(VI) is an important process that determines the geochemical behavior, mobility and bioavailability of Cr in both terrestrial and marine environments. Many metabolically diverse microorganisms possess Cr(VI) reduction capacity. Cr(VI) reduction fractionates Cr isotopes and thus 53Cr/52Cr ratios can be used to monitor Cr(VI) reduction and redox conditions. The magnitude of isotopic fractionation (ε) for a variety of microbial reduction mechanisms must be known for accurate interpretation of observed shifts in 53Cr/52Cr ratios. We determined isotopic fractionation factors for Cr(VI) reduction by metal reducers Geobacter sulfurreducens and Shewanella sp. strain NR, a denitrifying soil bacterium Pseudomonas stutzeri DCP-Ps1, and a sulfate reducer Desulfovibrio vulgaris. All bacteria investigated in this study produced significant Cr isotope fractionation. The fractionation (ε) for G. sulfurreducens, Shewanella sp. (NR), P. stutzeri DCP-Ps1, and D. vulgaris were -3.03‰ ± 0.12‰, -2.17‰ ± 0.22‰, -3.14‰ ± 0.13‰, and -3.01‰ ± 0.11‰, respectively. Despite differences in microbial strains in this study, the ε did not vary significantly except for Shewanella sp. (NR). Our results suggest that strong isotopic fractionation is induced during Cr(VI) reduction under electron donor poor (∼300 μM) conditions.

Rapid electron exchange between surface-exposed bacterial cytochromes and Fe(III) minerals

PubMed Central

White, Gaye F.; Shi, Zhi; Shi, Liang; Wang, Zheming; Dohnalkova, Alice C.; Marshall, Matthew J.; Fredrickson, James K.; Zachara, John M.; Butt, Julea N.; Richardson, David J.; Clarke, Thomas A.

2013-01-01

The mineral-respiring bacterium Shewanella oneidensis uses a protein complex, MtrCAB, composed of two decaheme cytochromes, MtrC and MtrA, brought together inside a transmembrane porin, MtrB, to transport electrons across the outer membrane to a variety of mineral-based electron acceptors. A proteoliposome system containing a pool of internalized electron carriers was used to investigate how the topology of the MtrCAB complex relates to its ability to transport electrons across a lipid bilayer to externally located Fe(III) oxides. With MtrA facing the interior and MtrC exposed on the outer surface of the phospholipid bilayer, the established in vivo orientation, electron transfer from the interior electron carrier pool through MtrCAB to solid-phase Fe(III) oxides was demonstrated. The rates were 103 times higher than those reported for reduction of goethite, hematite, and lepidocrocite by S. oneidensis, and the order of the reaction rates was consistent with those observed in S. oneidensis cultures. In contrast, established rates for single turnover reactions between purified MtrC and Fe(III) oxides were 103 times lower. By providing a continuous flow of electrons, the proteoliposome experiments demonstrate that conduction through MtrCAB directly to Fe(III) oxides is sufficient to support in vivo, anaerobic, solid-phase iron respiration. PMID:23538304

Biotic and abiotic reduction and solubilization of Pu(IV)O₂•xH₂O(am) as affected by anthraquinone-2,6-disulfonate (AQDS) and ethylenediaminetetraacetate (EDTA).

PubMed

Plymale, Andrew E; Bailey, Vanessa L; Fredrickson, James K; Heald, Steve M; Buck, Edgar C; Shi, Liang; Wang, Zheming; Resch, Charles T; Moore, Dean A; Bolton, Harvey

2012-02-21

This study measured reductive solubilization of plutonium(IV) hydrous oxide (Pu(IV)O(2)·xH(2)O((am))) with hydrogen (H(2)) as electron donor, in the presence or absence of dissimilatory metal-reducing bacteria (DMRB), anthraquinone-2,6-disulfonate (AQDS), and ethylenediaminetetraacetate (EDTA). In PIPES buffer at pH 7 with excess H(2), Shewanella oneidensis and Geobacter sulfurreducens both solubilized <0.001% of 0.5 mM Pu(IV)O(2)·xH(2)O((am)) over 8 days, with or without AQDS. However, Pu((aq)) increased by an order of magnitude in some treatments, and increases in solubility were associated with production of Pu(III)((aq)). The solid phase of these treatments contained Pu(III)(OH)(3(am)), with more in the DMRB treatments compared with abiotic controls. In the presence of EDTA and AQDS, PuO(2)·xH(2)O((am)) was completely solubilized by S. oneidensis and G. sulfurreducens in ∼24 h. Without AQDS, bioreductive solubilization was slower (∼22 days) and less extensive (∼83-94%). In the absence of DMRB, EDTA facilitated reductive solubilization of 89% (without AQDS) to 98% (with AQDS) of the added PuO(2)·xH(2)O((am)) over 418 days. An in vitro assay demonstrated electron transfer to PuO(2)·xH(2)O((am)) from the S. oneidensis outer-membrane c-type cytochrome MtrC. Our results (1) suggest that PuO(2)·xH(2)O((am)) reductive solubilization may be important in reducing environments, especially in the presence of complexing ligands and electron shuttles, (2) highlight the environmental importance of polynuclear, colloidal Pu, (3) provide additional evidence that Pu(III)-EDTA is a more likely mobile form of Pu than Pu(IV)-EDTA, and (4) provide another example of outer-membrane cytochromes and electron-shuttling compounds facilitating bioreduction of insoluble electron acceptors in geologic environments.

Culturable diversity of halophilic bacteria in foreshore soils

PubMed Central

Irshad, Aarzoo; Ahmad, Irshad; Kim, Seung Bum

2014-01-01

Halophilic bacteria are commonly found in natural environments containing significant concentration of NaCl such as inland salt lakes and evaporated sea-shore pools, as well as environments such as curing brines, salted food products and saline soils. Dependence on salt is an important phenotypic characteristic of halophilic bacteria, which can be used in the polyphasic characterization of newly discovered microorganisms. In this study the diversity of halophilic bacteria in foreshore soils of Daecheon, Chungnam, and Saemangeum, Jeonbuk, was investigated. Two types of media, namely NA and R2A supplemented with 3%, 5%, 9%, 15%, 20% and 30% NaCl were used. More than 200 halophilic bacteria were isolated and BOX-PCR fingerprinting analysis was done for the typing of the isolates. The BLAST identification results showed that isolated strains were composed of 4 phyla, Firmicutes (60%), Proteobacteria (31%), Bacteriodetes (5%) and Actinobacteria (4%). Isolates were affiliated with 16 genera and 36 species. Bacillus was the dominant genus in the phylum Firmicutes, comprising 24% of the total isolates. Halomonas (12%) and Shewanella (12%) were also found as the main genera. These findings show that the foreshore soil of Daecheon Beach and Saemangeum Sea of Korea represents an untapped source of bacterial biodiversity. PMID:25242943

Culturable diversity of halophilic bacteria in foreshore soils.

PubMed

Irshad, Aarzoo; Ahmad, Irshad; Kim, Seung Bum

2014-01-01

Halophilic bacteria are commonly found in natural environments containing significant concentration of NaCl such as inland salt lakes and evaporated sea-shore pools, as well as environments such as curing brines, salted food products and saline soils. Dependence on salt is an important phenotypic characteristic of halophilic bacteria, which can be used in the polyphasic characterization of newly discovered microorganisms. In this study the diversity of halophilic bacteria in foreshore soils of Daecheon, Chungnam, and Saemangeum, Jeonbuk, was investigated. Two types of media, namely NA and R2A supplemented with 3%, 5%, 9%, 15%, 20% and 30% NaCl were used. More than 200 halophilic bacteria were isolated and BOX-PCR fingerprinting analysis was done for the typing of the isolates. The BLAST identification results showed that isolated strains were composed of 4 phyla, Firmicutes (60%), Proteobacteria (31%), Bacteriodetes (5%) and Actinobacteria (4%). Isolates were affiliated with 16 genera and 36 species. Bacillus was the dominant genus in the phylum Firmicutes, comprising 24% of the total isolates. Halomonas (12%) and Shewanella (12%) were also found as the main genera. These findings show that the foreshore soil of Daecheon Beach and Saemangeum Sea of Korea represents an untapped source of bacterial biodiversity.

The Phantom Menace for Patients with Hepatobiliary Diseases: Shewanella haliotis, Often Misidentified as Shewanella algae in Biochemical Tests and MALDI-TOF Analysis.

PubMed

Byun, Jung-Hyun; Park, Hyunwoong; Kim, Sunjoo

2017-03-24

Although Shewanella algae has been known to have weak pathogenicity, case reports on infections with this species have been steadily increasing. S. algae and S. haliotis are difficult to distinguish from each other with conventional phenotypic methods. We reviewed the microbiological and clinical features of S. algae and S. haliotis infections at our institute. Bacterial culture and identification reports from patient samples from 2010 to 2014 were reviewed to screen the cases of Shewanella infections. In addition to conventional biochemical tests, 16S rRNA gene sequence analysis and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry were performed for 19 stored bacterial isolates. Medical records were reviewed for clinical characteristics and laboratory findings. All isolates were identified as S. algae by using VITEK 2. MALDI-TOF also identified all isolates as S. algae with a 99.9 confidence value. In contrast, 16S rRNA analysis identified 10 isolates as S. algae and 9 isolates as S. haliotis. Both S. algae (60%) and S. haliotis (77%) infections were strongly associated with diseases of the hepatobiliary tract and pancreas. To distinguish between S. algae and S. haliotis, 16S rRNA gene sequence analysis seems more accurate than biochemical tests or MALDI-TOF. Patients with underlying diseases in the hepatobiliary tract and pancreas seem to be susceptible to these marine pathogens.

Occurrence and role of lactic acid bacteria in seafood products.

PubMed

Françoise, Leroi

2010-09-01

Lactic acid bacteria (LAB) in fish flesh has long been disregarded because the high post-mortem pH, the low percentage of sugars, the high content of low molecular weight nitrogenous molecules and the low temperature of temperate waters favor the rapid growth of pH-sensitive psychrotolerant marine Gram-negative bacteria like Pseudomonas, Shewanella and Photobacterium. In seafood packed in both vacuum (VP) and modified atmosphere (MAP) packaging commonly CO(2) enriched, the growth of the Gram-negative aerobic bacteria group (predominantly pseudomonads) is effectively inhibited and the number reached by LAB during storage is higher than that achieved in air but always several log units lower than the trimethylamine oxide (TMA-O) reducing and CO(2)-resistant organisms (Shewanella putrefaciens and Photobacterium phosphoreum). Accordingly, LAB are not of much concern in seafood neither aerobically stored nor VP and MAP. However, they may acquire great relevance in lightly preserved fish products (LPFP), including those VP or MAP. Fresh fish presents a very high water activity (aw) value (0.99). However, aw is reduced to about 0.96 when salt (typically 6% WP) is added to the product. As a result, aerobic Gram-negative bacteria are inhibited, which allows the growth of other organisms more resistant to reduced aw, i.e. LAB, and then they may acquire a central role in the microbial events occurring in the product. Changes in consumers' habits have led to an increase of convenient LPFP with a relative long shelf-life (at least 3 weeks) which, on the other hand, may constitute a serious problem from a safety perspective since Listeria monocytogenes and sometimes Clostridium botulinum (mainly type E) may able to grow. In any case the LAB function in marine products is complex, depending on species, strains, interaction with other bacteria and the food matrix. They may have no particular effect or they may be responsible for spoilage and, in certain cases, they may even exert

[A rare cause of pneumonia: Shewanella putrefaciens].

PubMed

Durdu, Bülent; Durdu, Yasemin; Güleç, Nuray; Islim, Filiz; Biçer, Mualla

2012-01-01

Shewanella putrefaciens is a gram-negative, non-fermentative, oxidase positive, motile bacillus that produces hydrogen sulphide. It is found widely in the nature especially in marine environments. Although it is accepted as saprophytic, different clinical syndromes, most commonly skin or soft tissue infections, have been associated with S.putrefaciens, mainly in immunocompromised cases and patients with underlying diseases. However, pneumonia cases due to S.putrefaciens are quite limited in the literature. In this report, a case of pneumonia caused by S.putrefaciens was presented. A 43-year-old female patient was admitted to our hospital with the complaints of fever, cough, sputum and weakness. The patient has had brochiectasis since childhood and has used periodical antibiotic therapies due to pneumoniae episodes. She was diagnosed to have pneumonia based on the clinical, radiological and laboratory findings, and empirical antibiotic treatment with ciprofloxacin and ceftazidime combination was initiated. Gram-stained smear of sputum yielded abundant leucocytes and gram-negative bacteria, and the isolate grown in the sputum culture was identified as S.putrefaciens by conventional methods and API 20 NE (BioMerieux, France) system. The isolate was found susceptible to ceftriaxone, ceftazidime, cefepime, ciprofloxacin, piperacillin-tazobactam, cephoperazon-sulbactam, imipenem, amikacin, gentamicin and trimethoprime-sulphametoxazole; whereas resistant to ampicillin, amoxycillin-clavulanate, cefazolin and cefuroxime, by Kirby-Bauer disk diffusion method. According to the antibiogram results, the therapy was changed to ceftriaxone (1 x 2 g, intravenous). The patient was discharged with complete cure after 14 days of therapy. In conclusion, S.putrefaciens should be considered in patients with predisposing factors as an unusual cause of pneumonia and the characteristics such as H2S production and sensitivity to third generation cephalosporins and penicillins should be used

Exploring the biochemistry at the extracellular redox frontier of bacterial mineral Fe(III) respiration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richardson, David J.; Edwards, Marcus; White, Gaye F.

2012-06-01

Many species of the bacterial Shewanella genus are notable for their ability to respire in anoxic environments utilizing insoluble minerals of Fe(III) and Mn(IV) as extracellular electron acceptors. In Shewanella oneidensis, the process is dependent on the decahaem electron-transport proteins that lie at the extracellular face of the outer membrane where they can contact the insoluble mineral substrates. These extracellular proteins are charged with electrons provided by an inter-membrane electron-transfer pathway that links the extracellular face of the outer membrane with the inner cytoplasmic membrane and thereby intracellular electron sources. In the present paper, we consider the common structural featuresmore » of two of these outermembrane decahaem cytochromes, MtrC and MtrF, and bring this together with biochemical, spectroscopic and voltammetric data to identify common and distinct properties of these prototypical members of different clades of the outer-membrane decahaem cytochrome superfamily.« less

Structural and Biochemical Characterization of a Bifunctional Ketoisomerase/N-acetyltransferase from Shewanella denitrificans¶

PubMed Central

Chantigian, Daniel P.; Thoden, James B.; Holden, Hazel M.

2014-01-01

Unusual N-acetylated sugars have been observed on the O-antigens of some Gram-negative bacteria and on the S-layers of both Gram-positive and Gram-negative bacteria. One such sugar is 3-acetamido-3,6-dideoxy-α-d-galactose or Fuc3NAc. The pathway for its production requires five enzymes with the first step involving the attachment of dTMP to glucose-1-phosphate. Here we report a structural and biochemical characterization of a bifunctional enzyme from Shewanella denitificans thought to be involved in the biosynthesis of dTDP-Fuc3NAc. On the basis of a bioinformatics analysis, the enzyme, hereafter referred to as FdtD, has been postulated to catalyze the third and fifth steps in the pathway, namely a 3,4-keto isomerization and an N-acetyltransferase reaction. For the X-ray analysis reported here, the enzyme was crystallized in the presence of dTDP and CoA. The crystal structure shows that FdtD adopts a hexameric quaternary structure with 322 symmetry. Each subunit of the hexamer folds into two distinct domains connected by a flexible loop. The N-terminal domain adopts a left-handed β-helix motif and is responsible for the N-acetylation reaction. The C-terminal domain folds into an antiparallel flattened β-barrel that harbors the active site responsible for the isomerization reaction. Biochemical assays verify the two proposed catalytic activities of the enzyme and reveal that the 3,4-keto isomerization event leads to inversion of configuration about the hexose C-4' carbon. PMID:24128043

Contribution of Extracellular Polymeric Substances from Shewanella sp. HRCR-1 Biofilms to U(VI) Immobilization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao, Bin; Ahmed, B.; Kennedy, David W.

2011-06-05

The goal of this study was to quantify the contribution of extracellular polymeric substances (EPS) in U(VI) immobilization by Shewanella sp. HRCR-1. Through comparison of U(VI) immobilization using cells with bound EPS (bEPS) and cells without EPS, we showed that i) bEPS from Shewanella sp. HRCR-1 biofilms contributed significantly to U(VI) immobilization, especially at low initial U(VI) concentrations, through both sorption and reduction; ii) bEPS could be considered as a functional extension of the cells for U(VI) immobilization and they likely play more important roles at initial U(VI) concentrations; and iii) U(VI) reduction efficiency was found to be dependent uponmore » initial U(VI) concentration and the efficiency decreased at lower concentrations. To quantify relative contribution of sorption and reduction in U(VI) immobilization by EPS fractions, we isolated loosely associated EPS (laEPS) and bEPS from Shewanella sp. HRCR-1 biofilms grown in a hollow fiber membrane biofilm reactor and tested their reactivity with U(V). We found that, when in reduced form, the isolated cell-free EPS fractions could reduce U(VI). Polysaccharides in the EPS likely contributed to U(VI) sorption and dominated reactivity of laEPS while redox active components (e.g., outer membrane c-type cytochromes), especially in bEPS, might facilitate U(VI) reduction.« less

Contribution of extracellular polymeric substances from Shewanella sp. HRCR-1 biofilms to U(VI) immobilization.

PubMed

Cao, Bin; Ahmed, Bulbul; Kennedy, David W; Wang, Zheming; Shi, Liang; Marshall, Matthew J; Fredrickson, Jim K; Isern, Nancy G; Majors, Paul D; Beyenal, Haluk

2011-07-01

The goal of this study was to quantify the contribution of extracellular polymeric substances (EPS) to U(VI) immobilization by Shewanella sp. HRCR-1. Through comparison of U(VI) immobilization using cells with bound EPS (bEPS) and cells with minimal EPS, we show that (i) bEPS from Shewanella sp. HRCR-1 biofilms contribute significantly to U(VI) immobilization, especially at low initial U(VI) concentrations, through both sorption and reduction; (ii) bEPS can be considered a functional extension of the cells for U(VI) immobilization and they likely play more important roles at lower initial U(VI) concentrations; and (iii) the U(VI) reduction efficiency is dependent upon the initial U(VI) concentration and decreases at lower concentrations. To quantify the relative contributions of sorption and reduction to U(VI) immobilization by EPS fractions, we isolated loosely associated EPS (laEPS) and bEPS from Shewanella sp. HRCR-1 biofilms grown in a hollow fiber membrane biofilm reactor and tested their reactivity with U(VI). We found that, when reduced, the isolated cell-free EPS fractions could reduce U(VI). Polysaccharides in the EPS likely contributed to U(VI) sorption and dominated the reactivity of laEPS, while redox active components (e.g., outer membrane c-type cytochromes), especially in bEPS, possibly facilitated U(VI) reduction.

Biogenic formation of photoactive arsenic-sulfide nanotubes by Shewanella sp. strain HN-41

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ji-Hoon; Kim, Min-Gyu; Yoo, Bongyoung

2007-12-18

Microorganisms facilitate the formation of a wide range of minerals that have unique physical and chemical properties as well as morphologies that are not produced by abiotic processes. Here, we report the production of an extensive extracellular network of filamentous, arsenic-sulfide (As-S) nanotubes (20–100 nm in diameter by 30 µm in length) by the dissimilatory metal-reducing bacterium Shewanella sp. HN-41. The As-S nanotubes, formed via the reduction of As(V) and S2O, were initially amorphous As2S3 but evolved with increasing incubation time toward polycrystalline phases of the chalcogenide minerals realgar (AsS) and duranusite (As4S). Upon maturation, the As-S nanotubes behaved asmore » metals and semiconductors in terms of their electrical and photoconductive properties, respectively. The As-S nanotubes produced by Shewanella may provide useful materials for novel nano- and opto-electronic devices.« less

Modeling of Sustainable Base Production by Microbial Electrolysis Cell.

PubMed

Blatter, Maxime; Sugnaux, Marc; Comninellis, Christos; Nealson, Kenneth; Fischer, Fabian

2016-07-07

A predictive model for the microbial/electrochemical base formation from wastewater was established and compared to experimental conditions within a microbial electrolysis cell. A Na2 SO4 /K2 SO4 anolyte showed that model prediction matched experimental results. Using Shewanella oneidensis MR-1, a strong base (pH≈13) was generated using applied voltages between 0.3 and 1.1 V. Due to the use of bicarbonate, the pH value in the anolyte remained unchanged, which is required to maintain microbial activity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

In situ nuclear magnetic resonance microimaging of live biofilms in a microchannel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renslow, R. S.; Marshall, M. J.; Tucker, A. E.

Nuclear magnetic resonance (NMR) microimaging and spectroscopy was used to interrogate fluids of biological importance (e.g., water, buffer, medium solution) and live biofilms in a microchannel compatible for analyses at ambient pressure and under vacuum. Studies using buffer, growth medium, and actively growing Shewanella oneidensis biofilms were used to demonstrate in situ NMR microimaging measurement capabilities including velocity mapping, diffusion coefficient mapping, relaxometry, localized spectroscopy, and 2D and 3D imaging within a microchannel suitable for different analytical platforms. This technique is promising for diverse applications of correlative imaging using a portable microfluidic platform.

Enhanced eicosapentaenoic acid production by a new deep-sea marine bacterium Shewanella electrodiphila MAR441T.

PubMed

Zhang, Jinwei; Burgess, J Grant

2017-01-01

Omega-3 fatty acids are products of secondary metabolism, essential for growth and important for human health. Although there are numerous reports of bacterial production of omega-3 fatty acids, less information is available on the biotechnological production of these compounds from bacteria. The production of eicosapentaenoic acid (EPA, 20:5ω3) by a new species of marine bacteria Shewanella electrodiphila MAR441T was investigated under different fermentation conditions. This strain produced a high percentage (up to 26%) of total fatty acids and high yields (mg / g of biomass) of EPA at or below the optimal growth temperature. At higher growth temperatures these values decreased greatly. The amount of EPA produced was affected by the carbon source, which also influenced fatty acid composition. This strain required Na+ for growth and EPA synthesis and cells harvested at late exponential or early stationary phase had a higher EPA content. Both the highest amounts (20 mg g-1) and highest percent EPA content (18%) occurred with growth on L-proline and (NH4)2SO4. The addition of cerulenin further enhanced EPA production to 30 mg g-1. Chemical mutagenesis using NTG allowed the isolation of mutants with improved levels of EPA content (from 9.7 to 15.8 mg g-1) when grown at 15°C. Thus, the yields of EPA could be substantially enhanced without the need for recombinant DNA technology, often a commercial requirement for food supplement manufacture.

Enhanced eicosapentaenoic acid production by a new deep-sea marine bacterium Shewanella electrodiphila MAR441T

PubMed Central

Burgess, J. Grant

2017-01-01

Omega-3 fatty acids are products of secondary metabolism, essential for growth and important for human health. Although there are numerous reports of bacterial production of omega-3 fatty acids, less information is available on the biotechnological production of these compounds from bacteria. The production of eicosapentaenoic acid (EPA, 20:5ω3) by a new species of marine bacteria Shewanella electrodiphila MAR441T was investigated under different fermentation conditions. This strain produced a high percentage (up to 26%) of total fatty acids and high yields (mg / g of biomass) of EPA at or below the optimal growth temperature. At higher growth temperatures these values decreased greatly. The amount of EPA produced was affected by the carbon source, which also influenced fatty acid composition. This strain required Na+ for growth and EPA synthesis and cells harvested at late exponential or early stationary phase had a higher EPA content. Both the highest amounts (20 mg g-1) and highest percent EPA content (18%) occurred with growth on L-proline and (NH4)2SO4. The addition of cerulenin further enhanced EPA production to 30 mg g-1. Chemical mutagenesis using NTG allowed the isolation of mutants with improved levels of EPA content (from 9.7 to 15.8 mg g-1) when grown at 15°C. Thus, the yields of EPA could be substantially enhanced without the need for recombinant DNA technology, often a commercial requirement for food supplement manufacture. PMID:29176835

Electron acceptor redox potential globally regulates transcriptomic profiling in Shewanella decolorationis S12

NASA Astrophysics Data System (ADS)

Lian, Yingli; Yang, Yonggang; Guo, Jun; Wang, Yan; Li, Xiaojing; Fang, Yun; Gan, Lixia; Xu, Meiying

2016-08-01

Electron acceptor redox potential (EARP) was presumed to be a determining factor for microbial metabolism in many natural and engineered processes. However, little is known about the potentially global effects of EARP on bacteria. In this study, we compared the physiological and transcriptomic properties of Shewanella decolorationis S12 respiring with different EARPs in microbial electrochemical systems to avoid the effects caused by the other physicochemical properties of real electron acceptor. Results showed that the metabolic activities of strain S12 were nonlinear responses to EARP. The tricarboxylic acid cycle for central carbon metabolism was down-regulated while glyoxylate shunt was up-regulated at 0.8 V compared to 0.2 and -0.2 V, which suggested that EARP is an important but not the only determinant for metabolic pathways of strain S12. Moreover, few cytochrome c genes were differentially expressed at different EARPs. The energy intensive flagella assembly and assimilatory sulfur metabolism pathways were significantly enriched at 0.8 V, which suggested strain S12 had stronger electrokinesis behavior and oxidative stress-response at high EARP. This study provides the first global information of EARP regulations on microbial metabolism, which will be helpful for understanding microorganism respiration.

Microbes under pressure: A comparison of CO2 stress responses on three model organisms and their implications for geologic carbon sequestration

NASA Astrophysics Data System (ADS)

Santillan, E. U.; Franks, M. A.; Omelon, C. R.; Bennett, P.

2011-12-01

When carbon dioxide is captured and stored in deep saline aquifers, many biogeochemical changes will occur in these reservoirs. High concentrations of aqueous CO2 itself can be toxic to microorganisms as the gas easily enters cell membranes and alters intracellular cell functions. Because of this, we expect CO2 to be a perturbation that will alter microbial community composition. Microbes that are capable of withstanding CO2 stress will be selected for and their subsequent growth and metabolism will further affect brine chemistry. For this study, we examined three organisms representing metabolic functions and cellular structures potentially found in deep saline aquifers: the Gram-negative dissimilatory iron reducing bacterium Shewanella oneidensis strain MR-1, the aerobic Gram-positive hydrocarbon degrading Geobacillus stearothermophilus, and the methanogenic archaeon Methanothermobacter thermoautotrophicus. Organisms were grown in batch cultures and subsequently exposed to high PCO2 ranging from 25 atm to 60 atm for 2 to 24 hours. Cultures were then plated for viability or tested for metabolic activity such as methane production. Following CO2 stress, organisms were also examined for membrane changes through phospholipid fatty acid analysis and for morphological changes by transmission electron microscopy. After only 2 hours of incubation in 30 atm of CO2, no viable cells were found in planktonic cultures of Shewanella. In contrast, cultures of Geobacillus remained viable (less than a log 2 reduction from initial counts) even after exposure to double the CO2 pressure and for 17 hours. However, when grown in the presence of quartz sandstone, biofilm formation on the rock surface occurred in Shewanella cultures, resulting in survival times greater than 8 hours. Our results suggest that biofilm formation and cell wall thickness may be two very important factors in resisting CO2 toxicity as they create a reactive barrier that slows the diffusion of CO2 into

Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy

Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less

Diffusion in biofilms respiring on electrodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renslow, Ryan S.; Babauta, Jerome T.; Majors, Paul D.

2012-11-15

The goal of this study was to measure spatially and temporally resolved effective diffusion coefficients (De) in biofilms respiring on electrodes. Two model electrochemically active biofilms, Geobacter sulfurreducens PCA and Shewanella oneidensis MR-1, were investigated. A novel nuclear magnetic resonance microimaging perfusion probe capable of simultaneous electrochemical and pulsed-field gradient nuclear magnetic resonance (PFG-NMR) techniques was used. PFG-NMR allowed for noninvasive, nondestructive, high spatial resolution in situ De measurements in living biofilms respiring on electrodes. The electrodes were polarized so that they would act as the sole terminal electron acceptor for microbial metabolism. We present our results as both two-dimensionalmore » De heat maps and surface-averaged relative effective diffusion coefficient (Drs) depth profiles. We found that (1) Drs decreases with depth in G. sulfurreducens biofilms, following a sigmoid shape; (2) Drs at a given location decreases with G. sulfurreducens biofilm age; (3) average De and Drs profiles in G. sulfurreducens biofilms are lower than those in S. oneidensis biofilms—the G. sulfurreducens biofilms studied here were on average 10 times denser than the S. oneidensis biofilms; and (4) halting the respiration of a G. sulfurreducens biofilm decreases the De values. Density, reflected by De, plays a major role in the extracellular electron transfer strategies of electrochemically active biofilms.« less

Flavins secreted by bacterial cells of Shewanella catalyze cathodic oxygen reduction.

PubMed

Liu, Huan; Matsuda, Shoichi; Hashimoto, Kazuhito; Nakanishi, Shuji

2012-06-01

On Her Majesty's Secrete Service: Oxygen reduction is an important process for microbial fuel cells (MFCs) and microbiologically-influenced corrosion (MIC). We demonstrate that flavins secreted by anode-respiring Shewanella cells can catalyze cathodic oxygen reduction via adsorption on the cathode. The findings will provide new insight for developing methods to improve MFC performance and to prevent MIC. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biogenic tellurium nanorods as a novel antivirulence agent inhibiting pyoverdine production in Pseudomonas aeruginosa.

PubMed

Mohanty, Anee; Kathawala, Mustafa Hussain; Zhang, Jianhua; Chen, Wei Ning; Loo, Joachim Say Chye; Kjelleberg, Staffan; Yang, Liang; Cao, Bin

2014-05-01

While antibiotic resistance in bacteria is rapidly increasing, the development of new antibiotics has decreased in recent years. Antivirulence drugs disarming rather than killing pathogens have been proposed to alleviate the problem of resistance inherent to existing biocidal antibiotics. Here, we report a nontoxic biogenic nanomaterial as a novel antivirulence agent to combat bacterial infections caused by Pseudomonas aeruginosa. We synthesized, in an environmentally benign fashion, tellurium nanorods (TeNRs) using the metal-reducing bacterium Shewanella oneidensis, and found that the biogenic TeNRs could effectively inhibit the production of pyoverdine, one of the most important virulence factors in P. aeruginosa. Our results suggest that amyloids and extracellular polysaccharides Pel and Psl are not involved in the interactions between P. aeruginosa and the biogenic TeNRs, while flagellar movement plays an important role in the cell-TeNRs interaction. We further showed that the TeNRs (up to 100 µg/mL) did not exhibit cytotoxicity to human bronchial epithelial cells and murine macrophages. Thus, biogenic TeNRs hold promise as a novel antivirulence agent against P. aeruginosa. © 2013 Wiley Periodicals, Inc.

Electron Transfer Strategies Regulate Carbonate Mineral and Micropore Formation

NASA Astrophysics Data System (ADS)

Zeng, Zhirui; Tice, Michael M.

2018-01-01

Some microbial carbonates are robust biosignatures due to their distinct morphologies and compositions. However, whether carbonates induced by microbial iron reduction have such features is unknown. Iron-reducing bacteria use various strategies to transfer electrons to iron oxide minerals (e.g., membrane-bound enzymes, soluble electron shuttles, nanowires, as well as different mechanisms for moving over or attaching to mineral surfaces). This diversity has the potential to create mineral biosignatures through manipulating the microenvironments in which carbonate precipitation occurs. We used Shewanella oneidensis MR-1, Geothrix fermentans, and Geobacter metallireducens GS-15, representing three different strategies, to reduce solid ferric hydroxide in order to evaluate their influence on carbonate and micropore formation (micro-size porosity in mineral rocks). Our results indicate that electron transfer strategies determined the morphology (rhombohedral, spherical, or long-chained) of precipitated calcium-rich siderite by controlling the level of carbonate saturation and the location of carbonate formation. Remarkably, electron transfer strategies also produced distinctive cell-shaped micropores in both carbonate and hydroxide minerals, thus producing suites of features that could potentially serve as biosignatures recording information about the sizes, shapes, and physiologies of iron-reducing organisms.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Seema; Simpson, David C.; Tolic, Nikola

We investigated the combination of weak anion exchange (WAX) fractionation and on-line reversed phase liquid chromatography (RPLC) separation using a 12 T FTICR mass spectrometer for the detection of intact proteins from a Shewanella oneidensis MR-1 cell lysate. 715 intact proteins were detected and the combined results from the WAX fractions and the unfractionated cell lysate were aligned using LC-MS features to facilitate protein abundance measurements. Protein identifications and post translational modifications were assigned for ~10% of the detected proteins by comparing intact protein mass measurements to proteins identified in peptide MS/MS analysis of an aliquot of the same fraction.more » Intact proteins were also detected for S. oneidensis lysates obtained from cells grown on 13C, 15N depleted media under aerobic and sub-oxic conditions. This work aimed at optimizing intact protein detection for profiling proteins at a level that incorporates their modification complement. The strategy can be readily applied for measuring differential protein abundances, and provides a platform for high-throughput selection of biologically relevant targets for further characterization.« less

Polyunsaturated fatty acids in marine bacteria and strategies to enhance their production.

PubMed

Moi, Ibrahim Musa; Leow, Adam Thean Chor; Ali, Mohd Shukuri Mohamad; Rahman, Raja Noor Zaliha Raja Abd; Salleh, Abu Bakar; Sabri, Suriana

2018-05-10

Polyunsaturated fatty acids (PUFAs) play an important role in human diet. Despite the wide-ranging importance and benefits from heart health to brain functions, humans and mammals cannot synthesize PUFAs de novo. The primary sources of PUFA are fish and plants. Due to the increasing concerns associated with food security as well as issues of environmental contaminants in fish oil, there has been considerable interest in the production of polyunsaturated fatty acids from alternative resources which are more sustainable, safer, and economical. For instance, marine bacteria, particularly the genus of Shewanella, Photobacterium, Colwellia, Moritella, Psychromonas, Vibrio, and Alteromonas, are found to be one among the major microbial producers of polyunsaturated fatty acids. Recent developments in the area with a focus on the production of polyunsaturated fatty acids from marine bacteria as well as the metabolic engineering strategies for the improvement of PUFA production are discussed.

Enhance wastewater biological treatment through the bacteria induced graphene oxide hydrogel.

PubMed

Shen, Liang; Jin, Ziheng; Wang, Dian; Wang, Yuanpeng; Lu, Yinghua

2018-01-01

The interaction between bacteria and graphene-family materials like pristine graphene, graphene oxide (GO) and reduced graphene oxide (rGO) is such an elusive issue that its implication in environmental biotechnology is unclear. Herein, two kinds of self-assembled bio-rGO-hydrogels (BGHs) were prepared by cultivating specific Shewanella sp. strains with GO solution for the first time. The microscopic examination by SEM, TEM and CLSM indicated a porous 3D structure of BGHs, in which live bacteria firmly anchored and extracellular polymeric substances (EPS) abundantly distributed. Spectra of XRD, FTIR, XPS and Raman further proved that GO was reduced to rGO by bacteria along with the gelation process, which suggests a potential green technique to produce graphene. Based on the characterization results, four mechanisms for the BGH formation were proposed, i.e., stacking, bridging, rolling and cross-linking of rGO sheets, through the synergistic effect of activities and EPS from special bacteria. More importantly, the BGHs obtained in this study were found able to achieve unique cleanup performance that the counterpart free bacteria could not fulfill, as exemplified in Congo red decolorization and Cr(VI) bioreduction. These findings therefore enlighten a prospective application of graphene materials for the biological treatment of wastewaters in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Riboflavin-mediated RDX transformation in the presence of Shewanella putrefaciens CN32 and lepidocrocite.

PubMed

Bae, Sungjun; Lee, Yoonhwa; Kwon, Man Jae; Lee, Woojin

2014-06-15

The potential of riboflavin for the reductive degradation of a cyclic nitramine, hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), was investigated in the presence of lepidocrocite and/or Shewanella putrefaciens CN32. RDX reduction by CN32 alone or CN32 with lepidocrocite was insignificant, while 110 μM RDX was completely reduced by CN32 with riboflavin in 78 h. The transformation products identified included nitroso metabolites, formaldehyde, and ammonium, indicating the ring cleavage of RDX. UV and visible light analysis revealed that riboflavin was microbially reduced by CN32, and that the reduced riboflavin was linked to the complete degradation of RDX. In the presence of both CN32 and lepidocrocite (γ-FeOOH), 100 μM-riboflavin increased the rate and extent of Fe(II) production as well as RDX reduction. An abiotic study also showed that Fe(II)-riboflavin complex, and Fe(II) adsorbed on lepidocrocite, reduced RDX by 48% and 21%, respectively. The findings in this study suggest that riboflavin-mediated RDX degradation pathways in subsurface environments are diverse and complex. However, riboflavin, either from bacteria or exogenous sources, can significantly increase RDX degradation. This will provide a sustainable clean-up option for explosive-contaminated subsurface environments. Copyright © 2014 Elsevier B.V. All rights reserved.

Mechanism(s) of Electricity Production by Shewanella and Other Microbes: Understanding and Optimization

DTIC Science & Technology

2012-01-01

Kan, J. B. Flood, J.P. McCrow, J.S. Kim, L. Tan , and K.H. Nealson. 2011. A rapid fingerprinting approach to distinguish between closely related...strains of Shewanella. J. Microbiol. Methods. 86: 62-68. 33. Kan, J. Wang, Y., A. Obraztsova, G. Rosen, J. Leather , K.G. Scheckel, K.H. Nealson, and Y.M

Three-dimensional graphene/Pt nanoparticle composites as freestanding anode for enhancing performance of microbial fuel cells

PubMed Central

Zhao, Shenlong; Li, Yuchen; Yin, Huajie; Liu, Zhouzhou; Luan, Enxiao; Zhao, Feng; Tang, Zhiyong; Liu, Shaoqin

2015-01-01

Microbial fuel cells (MFCs) are able to directly convert about 50 to 90% of energy from oxidation of organic matters in waste to electricity and have great potential application in broad fields such as wastewater treatment. Unfortunately, the power density of the MFCs at present is significantly lower than the theoretical value because of technical limitations including low bacteria loading capacity and difficult electron transfer between the bacteria and the electrode. We reported a three-dimensional (3D) graphene aerogel (GA) decorated with platinum nanoparticles (Pt NPs) as an efficient freestanding anode for MFCs. The 3D GA/Pt–based anode has a continuous 3D macroporous structure that is favorable for microorganism immobilization and efficient electrolyte transport. Moreover, GA scaffold is homogenously decorated with Pt NPs to further enhance extracellular charge transfer between the bacteria and the anode. The MFCs constructed with 3D GA/Pt–based anode generate a remarkable maximum power density of 1460 mW/m2, 5.3 times higher than that based on carbon cloth (273 mW/m2). It deserves to be stressed that 1460 mW/m2 obtained from the GA/Pt anode shows the superior performance among all the reported MFCs inoculated with Shewanella oneidensis MR-1. Moreover, as a demonstration of the real application, the MFC equipped with the freestanding GA/Pt anode has been successfully applied in driving timer for the first time, which opens the avenue toward the real application of the MFCs. PMID:26702430

Assessment of data processing to improve reliability of microarray experiments using genomic DNA reference.

PubMed

Yang, Yunfeng; Zhu, Mengxia; Wu, Liyou; Zhou, Jizhong

2008-09-16

Using genomic DNA as common reference in microarray experiments has recently been tested by different laboratories. Conflicting results have been reported with regard to the reliability of microarray results using this method. To explain it, we hypothesize that data processing is a critical element that impacts the data quality. Microarray experiments were performed in a gamma-proteobacterium Shewanella oneidensis. Pair-wise comparison of three experimental conditions was obtained either with two labeled cDNA samples co-hybridized to the same array, or by employing Shewanella genomic DNA as a standard reference. Various data processing techniques were exploited to reduce the amount of inconsistency between both methods and the results were assessed. We discovered that data quality was significantly improved by imposing the constraint of minimal number of replicates, logarithmic transformation and random error analyses. These findings demonstrate that data processing significantly influences data quality, which provides an explanation for the conflicting evaluation in the literature. This work could serve as a guideline for microarray data analysis using genomic DNA as a standard reference.

Development and application of reverse transcription loop-mediated isothermal amplification for detecting live Shewanella putrefaciens in preserved fish sample.

PubMed

Li, Chenghua; Ying, Qi; Su, Xiurong; Li, Taiwu

2012-04-01

Given that live Shewanella putrefaciens is one of the major causes of spoilage for aquatic products even in chill storage, the rapid and accurate detection process is the first priority. In the present study, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) detecting assay was developed by targeting internal transcribed spacer (ITS) sequence between 16S and 23S rRNA. At the same time, a new procaryotic mRNA isolation strategy was also established by introducing a polyA tail to RNA during cDNA synthesis step. Under the optimal reaction time (60 min) and temperature (64.1 °C), S. putrefaciens could be specially identified from a variety of other tested bacteria by RT-LAMP. The sensitivity analysis showed that RT-LAMP could be identified as lower as 5.4 copies per reaction, which is over 200-fold higher than that of standard PCR (1.08 × 10³ copies per reaction). The method could be effectively identified S. putrefaciens in artificially contaminated or spoilaged fish samples with dose-dependent manners. To our knowledge, this is the first report using RT-LAMP assay to detect live S. putrefaciens in fish. The study provided a rapid and accurate detection method for live bacteria in aquatic food and established a new procaryotic mRNA isolation strategy at the same time, which will be useful for food preservation. © 2012 Institute of Food Technologists®

Molecular insights into the enzymatic diversity of flavin-trafficking protein (Ftp; formerly ApbE) in flavoprotein biogenesis in the bacterial periplasm.

PubMed

Deka, Ranjit K; Brautigam, Chad A; Liu, Wei Z; Tomchick, Diana R; Norgard, Michael V

2016-02-01

We recently reported a flavin-trafficking protein (Ftp) in the syphilis spirochete Treponema pallidum (Ftp_Tp) as the first bacterial metal-dependent FAD pyrophosphatase that hydrolyzes FAD into AMP and FMN in the periplasm. Orthologs of Ftp_Tp in other bacteria (formerly ApbE) appear to lack this hydrolytic activity; rather, they flavinylate the redox subunit, NqrC, via their metal-dependent FMN transferase activity. However, nothing has been known about the nature or mechanism of metal-dependent Ftp catalysis in either Nqr- or Rnf-redox-containing bacteria. In the current study, we identified a bimetal center in the crystal structure of Escherichia coli Ftp (Ftp_Ec) and show via mutagenesis that a single amino acid substitution converts it from an FAD-binding protein to a Mg(2+)-dependent FAD pyrophosphatase (Ftp_Tp-like). Furthermore, in the presence of protein substrates, both types of Ftps are capable of flavinylating periplasmic redox-carrying proteins (e.g., RnfG_Ec) via the metal-dependent covalent attachment of FMN. A high-resolution structure of the Ftp-mediated flavinylated protein of Shewanella oneidensis NqrC identified an essential lysine in phosphoester-threonyl-FMN bond formation in the posttranslationally modified flavoproteins. Together, these discoveries broaden our understanding of the physiological capabilities of the bacterial periplasm, and they also clarify a possible mechanism by which flavoproteins are generated. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Detection of Fatty Acids from Intact Microorganisms by Molecular Beam Static Secondary Ion Mass Spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ingram, Jani Cheri; Lehman, Richard Michael; Bauer, William Francis

We report the use of a surface analysis approach, static secondary ion mass spectrometry (SIMS) equipped with a molecular (ReO4-) ion primary beam, to analyze the surface of intact microbial cells. SIMS spectra of 28 microorganisms were compared to fatty acid profiles determined by gas chromatographic analysis of transesterfied fatty acids extracted from the same organisms. The results indicate that surface bombardment using the molecular primary beam cleaved the ester linkage characteristic of bacteria at the glycerophosphate backbone of the phospholipid components of the cell membrane. This cleavage enables direct detection of the fatty acid conjugate base of intact microorganismsmore » by static SIMS. The limit of detection for this approach is approximately 107 bacterial cells/cm2. Multivariate statistical methods were applied in a graded approach to the SIMS microbial data. The results showed that the full data set could initially be statistically grouped based upon major differences in biochemical composition of the cell wall. The gram-positive bacteria were further statistically analyzed, followed by final analysis of a specific bacterial genus that was successfully grouped by species. Additionally, the use of SIMS to detect microbes on mineral surfaces is demonstrated by an analysis of Shewanella oneidensis on crushed hematite. The results of this study provide evidence for the potential of static SIMS to rapidly detect bacterial species based on ion fragments originating from cell membrane lipids directly from sample surfaces.« less

Biological characteristics and pathogenicity of a highly pathogenic Shewanella marisflavi infected sea cucumber (Apostichopus uaponicus)

USDA-ARS?s Scientific Manuscript database

Shewanella marisflavi isolate AP629 was characterized as a novel pathogen of sea cucumber. The LD50 values (14 days) in sea cucumber and swordtail fish were 3.89 × 106 and 4.85 × 104 CFU g-1 body weight, respectively. Studies on S. marisflavi had been conducted, including morphology, physiological a...

Differential biofilms characteristics of Shewanella decolorationis microbial fuel cells under open and closed circuit conditions.

PubMed

Yang, Yonggang; Sun, Guoping; Guo, Jun; Xu, Meiying

2011-07-01

Biofilms formation capacities of Shewanella species in microbial fuel cells (MFCs) and their roles in current generation have been documented to be species-dependent. Understandings of the biofilms growth and metabolism are essential to optimize the current generation of MFCs. Shewanella decolorationis S12 was used in both closed-circuit and open-circuit MFCs in this study. The anodic S. decolorationis S12 biofilms could generate fivefold more current than the planktonic cells, playing a dominant role in current generation. Anodic biofilms viability was sustained at 98 ± 1.2% in closed-circuit while biofilms viability in open-circuit decreased to 72 ± 7% within 96 h. The unviable domain in open-circuit MFCs biofilms majorly located at the inner layer of biofilm. The decreased biofilms viability in open-circuit MFCs could be recovered by switching into closed-circuit, indicating that the current-generating anode in MFCs could serve as a favorable electron acceptor and provide sufficient energy to support cell growth and metabolism inside biofilms. Copyright © 2011 Elsevier Ltd. All rights reserved.

Bacterial decolorization of textile dyes is an extracellular process requiring a multicomponent electron transfer pathway

PubMed Central

Brigé, Ann; Motte, Bart; Borloo, Jimmy; Buysschaert, Géraldine; Devreese, Bart; Van Beeumen, Jozef J.

2008-01-01

Summary Many studies have reported microorganisms as efficient biocatalysts for colour removal of dye‐containing industrial wastewaters. We present the first comprehensive study to identify all molecular components involved in decolorization by bacterial cells. Mutants from the model organism Shewanella oneidensis MR‐1, generated by random transposon and targeted insertional mutagenesis, were screened for defects in decolorization of an oxazine and diazo dye. We demonstrate that decolorization is an extracellular reduction process requiring a multicomponent electron transfer pathway that consists of cytoplasmic membrane, periplasmic and outer membrane components. The presence of melanin, a redox‐active molecule excreted by S. oneidensis, was shown to enhance the dye reduction rates. Menaquinones and the cytochrome CymA are the crucial cytoplasmic membrane components of the pathway, which then branches off via a network of periplasmic cytochromes to three outer membrane cytochromes. The key proteins of this network are MtrA and OmcB in the periplasm and outer membrane respectively. A model of the complete dye reduction pathway is proposed in which the dye molecules are reduced by the outer membrane cytochromes either directly or indirectly via melanin. PMID:21261820

Antimicrobial peptide AMPNT-6 from Bacillus subtilis inhibits biofilm formation by Shewanella putrefaciens and disrupts its preformed biofilms on both abiotic and shrimp shell surfaces.

PubMed

Deng, Qi; Pu, Yuehua; Sun, Lijun; Wang, Yaling; Liu, Yang; Wang, Rundong; Liao, Jianmeng; Xu, Defeng; Liu, Ying; Ye, Riying; Fang, Zhijia; Gooneratne, Ravi

2017-12-01

Shewanella putrefaciens biofilm formation is of great concern for the shrimp industry because it adheres easily to food and food-contact surfaces and is a source of persistent and unseen contamination that causes shrimp spoilage and economic losses to the shrimp industry. Different concentrations of an antimicrobial lipopeptide, the fermentation product of Bacillus subtilis, AMPNT-6, were tested for the ability to reduce adhesion and disrupt S. putrefaciens preformed biofilms on two different contact surfaces (shrimp shell, stainless steel sheet). AMPNT-6 displayed a marked dose- and time-dependent anti-adhesive effect>biofilm removal. 3MIC AMPNT-6 was able both to remove biofilm and prevent bacteria from forming biofilm in a 96-well polystyrene microplate used as the model surface. 2MIC AMPNT-6 prevented bacteria from adhering to the microplate surface to form biofilm for 3h and removed already existing biofilm within 24h. Secretion of extracellular polymeric substances incubated in LB broth for 24h by S. putrefaciens was minimal at 3× MIC AMPNT-6. Scanning electron microscopy showed that damage to S. putrefaciens bacteria by AMPNT-6 possibly contributed to the non-adherence to the surfaces. Disruption of the mature biofilm structure by AMPNT-6 contributed to biofilm removal. It is concluded that AMPNT-6 can be used effectively to prevent attachment and also detach S. putrefaciens biofilms from shrimp shells, stainless steel sheets and polystyrene surfaces. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of member of DUF1888 protein family, self-cleaving and self-assembling endopeptidase.

PubMed

Osipiuk, Jerzy; Mulligan, Rory; Bargassa, Monireh; Hamilton, John E; Cunningham, Mark A; Joachimiak, Andrzej

2012-06-01

The crystal structure of SO1698 protein from Shewanella oneidensis was determined by a SAD method and refined to 1.57 Å. The structure is a β sandwich that unexpectedly consists of two polypeptides; the N-terminal fragment includes residues 1-116, and the C-terminal one includes residues 117-125. Electron density also displayed the Lys-98 side chain covalently linked to Asp-116. The putative active site residues involved in self-cleavage were identified; point mutants were produced and characterized structurally and in a biochemical assay. Numerical simulations utilizing molecular dynamics and hybrid quantum/classical calculations suggest a mechanism involving activation of a water molecule coordinated by a catalytic aspartic acid.

Characterization of Member of DUF1888 Protein Family, Self-cleaving and Self-assembling Endopeptidase*

PubMed Central

Osipiuk, Jerzy; Mulligan, Rory; Bargassa, Monireh; Hamilton, John E.; Cunningham, Mark A.; Joachimiak, Andrzej

2012-01-01

The crystal structure of SO1698 protein from Shewanella oneidensis was determined by a SAD method and refined to 1.57 Å. The structure is a β sandwich that unexpectedly consists of two polypeptides; the N-terminal fragment includes residues 1–116, and the C-terminal one includes residues 117–125. Electron density also displayed the Lys-98 side chain covalently linked to Asp-116. The putative active site residues involved in self-cleavage were identified; point mutants were produced and characterized structurally and in a biochemical assay. Numerical simulations utilizing molecular dynamics and hybrid quantum/classical calculations suggest a mechanism involving activation of a water molecule coordinated by a catalytic aspartic acid. PMID:22493430

Ratiometric Gas Reporting: A Nondisruptive Approach To Monitor Gene Expression in Soils.

PubMed

Cheng, Hsiao-Ying; Masiello, Caroline A; Del Valle, Ilenne; Gao, Xiaodong; Bennett, George N; Silberg, Jonathan J

2018-03-16

Fluorescent proteins are ubiquitous tools that are used to monitor the dynamic functions of natural and synthetic genetic circuits. However, these visual reporters can only be used in transparent settings, a limitation that complicates nondisruptive measurements of gene expression within many matrices, such as soils and sediments. We describe a new ratiometric gas reporting method for nondisruptively monitoring gene expression within hard-to-image environmental matrices. With this approach, C 2 H 4 is continuously synthesized by ethylene forming enzyme to provide information on viable cell number, and CH 3 Br is conditionally synthesized by placing a methyl halide transferase gene under the control of a conditional promoter. We show that ratiometric gas reporting enables the creation of Escherichia coli biosensors that report on acylhomoserine lactone (AHL) autoinducers used for quorum sensing by Gram-negative bacteria. Using these biosensors, we find that an agricultural soil decreases the bioavailable concentration of a long-chain AHL up to 100-fold. We also demonstrate that these biosensors can be used in soil to nondisruptively monitor AHLs synthesized by Rhizobium leguminosarum and degraded by Bacillus thuringiensis. Finally, we show that this new reporting approach can be used in Shewanella oneidensis, a bacterium that lives in sediments.

Electron Transfer Strategies Regulate Carbonate Mineral and Micropore Formation.

PubMed

Zeng, Zhirui; Tice, Michael M

2018-01-01

Some microbial carbonates are robust biosignatures due to their distinct morphologies and compositions. However, whether carbonates induced by microbial iron reduction have such features is unknown. Iron-reducing bacteria use various strategies to transfer electrons to iron oxide minerals (e.g., membrane-bound enzymes, soluble electron shuttles, nanowires, as well as different mechanisms for moving over or attaching to mineral surfaces). This diversity has the potential to create mineral biosignatures through manipulating the microenvironments in which carbonate precipitation occurs. We used Shewanella oneidensis MR-1, Geothrix fermentans, and Geobacter metallireducens GS-15, representing three different strategies, to reduce solid ferric hydroxide in order to evaluate their influence on carbonate and micropore formation (micro-size porosity in mineral rocks). Our results indicate that electron transfer strategies determined the morphology (rhombohedral, spherical, or long-chained) of precipitated calcium-rich siderite by controlling the level of carbonate saturation and the location of carbonate formation. Remarkably, electron transfer strategies also produced distinctive cell-shaped micropores in both carbonate and hydroxide minerals, thus producing suites of features that could potentially serve as biosignatures recording information about the sizes, shapes, and physiologies of iron-reducing organisms. Key Words: Microbial iron reduction-Micropore-Electron transfer strategies-Microbial carbonate. Astrobiology 18, 28-36.

The effect of natural organic matter on the adsorption of mercury to bacterial cells

NASA Astrophysics Data System (ADS)

Dunham-Cheatham, Sarrah; Mishra, Bhoopesh; Myneni, Satish; Fein, Jeremy B.

2015-02-01

We investigated the ability of non-metabolizing Bacillus subtilis, Shewanella oneidensis MR-1, and Geobacter sulfurreducens bacterial species to adsorb mercury in the absence and presence of Suwanee River fulvic acid (FA). Bulk adsorption and X-ray absorption spectroscopy (XAS) experiments were conducted at three pH conditions, and the results indicate that the presence of FA decreases the extent of Hg adsorption to biomass under all of the pH conditions studied. Hg XAS results show that the presence of FA does not alter the binding environment of Hg adsorbed onto the biomass regardless of pH or FA concentration, indicating that ternary bacteria-Hg-FA complexes do not form to an appreciable extent under the experimental conditions, and that Hg binding on the bacteria is dominated by sulfhydryl binding. We used the experimental results to calculate apparent partition coefficients, Kd, for Hg under each experimental condition. The calculations yield similar coefficients for Hg onto each of the bacterial species studies, suggesting there is no significant difference in Hg partitioning between the three bacterial species. The calculations also indicate similar coefficients for Hg-bacteria and Hg-FA complexes. S XAS measurements confirm the presence of sulfhydryl sites on both the FA and bacterial cells, and demonstrate the presence of a wide range of S moieties on the FA in contrast to the bacterial biomass, whose S sites are dominated by thiols. Our results suggest that although FA can compete with bacterial binding sites for aqueous Hg, because of the relatively similar partition coefficients for the types of sorbents, the competition is not dominated by either bacteria or FA unless the concentration of one type of site greatly exceeds that of the other.

Evolution of Mudstone Porosity, Permeability, and Microstructure in the Presence of Microorganisms During Vertical Compression

NASA Astrophysics Data System (ADS)

Mills, T.; Reece, J. S.

2016-12-01

Here we investigate the influence of microbial activity on the mechanical and transport properties of mudstones during early diagenesis. Despite the proven presence of microbial communities in marine sediments to depths of >500 meters below sea floor (mbsf), little is known about the interactions between microorganisms and sediments, especially during the early stages of burial and compression. To characterize and quantify the impact of microbial activity on mudstone properties, we compare natural mudstone samples treated with iron reducing bacteria Shewanella Oneidensis MR-1 and those without bacteria. Two bulk mudstones are experimentally prepared using sediments from Integrated Ocean Drilling Program Sites U1319 and U1324 in the Gulf of Mexico. The sediments originated from 4-13 mbsf in the Brazos-Trinity Basin and from three depth intervals (3-14 mbsf, 23-32 mbsf, and 493-502 mbsf) in the Ursa Basin. The sediments are dried and ground to clay- and silt-sized particles and homogenized into two natural mudstone powders. These powders are then used to make reproducible mudstone samples through a process called resedimentation, which replicates natural deposition and burial. Changes in microstructure, porosity, compressibility, and permeability are measured while the biotic (with bacteria) and abiotic (without bacteria) mudstones are being uniaxially compressed over several weeks to a maximum stress of 100 kPa. We anticipate that biofilm growth in pore spaces will decrease porosity, compressibility, and permeability, and the resultant microstructural changes created by microorganisms will be evident in high-resolution scanning electron microscope (SEM) images. Recognition of the micro-scale processes that take place during the early stages of mudstone diagenesis, especially those mediated by microbial activity, and their long-term effects on mudstone properties can lead to better identification and more effective production of unconventional hydrocarbon reservoirs.

Time-course analysis of the Shewanella amazonensis SB2B proteome in response to sodium chloride shock.

PubMed

Parnell, J Jacob; Callister, Stephen J; Rompato, Giovanni; Nicora, Carrie D; Paša-Tolić, Ljiljana; Williamson, Ashley; Pfrender, Michael E

2011-01-01

Shewanellae are microbial models for environmental stress response; however, the sequential expression of mechanisms in response to stress is poorly understood. Here we experimentally determine the response mechanisms of Shewanella amazonensis SB2B during sodium chloride stress using a novel liquid chromatography and accurate mass-time tag mass spectrometry time-course proteomics approach. The response of SB2B involves an orchestrated sequence of events comprising increased signal transduction associated with motility and restricted growth. Following a metabolic shift to branched chain amino acid degradation, motility and cellular replication proteins return to pre-perturbed levels. Although sodium chloride stress is associated with a change in the membrane fatty acid composition in other organisms, this is not the case for SB2B as fatty acid degradation pathways are not expressed and no change in the fatty acid profile is observed. These findings suggest that shifts in membrane composition may be an indirect physiological response to high NaCl stress.

The Influence of Acidity on Microbial Fuel Cells Containing Shewanella Oneidensis (PREPRINT)

DTIC Science & Technology

2008-09-01

d a fi b i s a h t s p t o m d C H p F 8 ig. 4. Cyclic voltammetry of filter sterilized media after 4 days of growth of S. neidensis MR-1 or S...of autologous mediators in the rowthmedium changeswith pH.We analyzed filter sterilized cul- ure supernatants by cyclic voltammetry (Fig. 4), and HPLC...Marsili et al., 2008). Cyclic voltammetrywas used to detect redox-active compounds n growthmedia supernatants fromMR-1 andDSP10 cultures. Fig. 4 hows

Characterization and application of monoclonal antibodies against Shewanella marisflavi, a novel pathogen of Apostichopus japonicus

USDA-ARS?s Scientific Manuscript database

Shewanella marisflavi strain AP629 was certified as a novel pathogen of the sea cucumber Apostichopus japonicus. In this study, four monoclonal antibodies (MAbs) (3C1, 3D9, 2F2, 2A8) against strain AP629 were developed by immunizing Balb/C mice. 3C1 and 3D9 recognized S. marisflavi only, showing no ...

Biotic and Abiotic Reduction and Solubilization of Pu(IV)O2•xH2O(am) as Affected by Anthraquinone-2,6-disulfonate (AQDS) and Ethylenediaminetetraacetate (EDTA)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Plymale, Andrew E.; Bailey, Vanessa L.; Fredrickson, Jim K.

2012-01-24

In the presence of hydrogen (H{sub 2}), the synthetic chelating agent ethylenediaminetetraacetate (EDTA), and the electron shuttle anthraquinone-2,6-disulfonate (AQDS), the dissimilatory metal-reducing bacteria (DMRB) Shewanella oneidensis and Geobacter sulfurreducens both reductively solubilized 100% of added 0.5 mM plutonium (IV) hydrous oxide (Pu(IV)O{sub 2} {lg_bullet} xH{sub 2}O{sub (am)}) in {approx}24 h at pH 7 in a non-complexing buffer. In the absence of AQDS, bioreduction was much slower ({approx}22 days) and less extensive ({approx}83-94%). In the absence of DMRB but under comparable conditions, 89% (without AQDS) to 98% (with AQDS) of added 0.5 mM PuO{sub 2} {lg_bullet} xH{sub 2}O{sub (am)} was reductivelymore » solubilized over 418 days. Under comparable conditions but in the absence of EDTA, <0.001% of the 0.5 mM PuO{sub 2} {lg_bullet} xH{sub 2}O{sub (am)} was solubilized, with or without bacteria. However, Pu(aq) increased by as much as an order of magnitude in some EDTA-free treatments, both biotic and abiotic, and increases in solubility were associated with the production of both Pu(OH)3(am) and Pu(III)(aq). Incubation with DMRB in the absence of EDTA increased the polymeric and crystalline content of the PuO{sub 2} {lg_bullet} xH{sub 2}O{sub (am)} and also decreased Pu solubility in 6-N HCl. Results from an in vitro assay demonstrated electron transfer to PuO{sub 2} {lg_bullet} xH{sub 2}O{sub (am)} from the S. oneidensis outer-membrane c-type cytochrome MtrC, and EDTA increased the oxidation of MtrC by PuO{sub 2} {lg_bullet} xH{sub 2}O{sub (am)}. Our results suggest that PuO{sub 2} {lg_bullet} xH{sub 2}O{sub (am)} biotic and abiotic reduction and solubilization may be important in anoxic, reducing environments, especially where complexing ligands and electron shuttling compounds are present.« less

Nile Red Detection of Bacterial Hydrocarbons and Ketones in a High-Throughput Format

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pinzon, NM; Aukema, KG; Gralnick, JA

A method for use in high-throughput screening of bacteria for the production of long-chain hydrocarbons and ketones by monitoring fluorescent light emission in the presence of Nile red is described. Nile red has previously been used to screen for polyhydroxybutyrate (PHB) and fatty acid esters, but this is the first report of screening for recombinant bacteria making hydrocarbons or ketones. The microtiter plate assay was evaluated using wild-type and recombinant strains of Shewanella oneidensis and Escherichia coli expressing the enzyme OleA, previously shown to initiate hydrocarbon biosynthesis. The strains expressing exogenous Stenotrophomonas maltophilia oleA, with increased levels of ketone productionmore » as determined by gas chromatography-mass spectrometry, were distinguished with Nile red fluorescence. Confocal microscopy images of S. oneidensis oleA-expressing strains stained with Nile red were consistent with a membrane localization of the ketones. This differed from Nile red staining of bacterial PHB or algal lipid droplets that showed intracellular inclusion bodies. These results demonstrated the applicability of Nile red in a high-throughput technique for the detection of bacterial hydrocarbons and ketones. IMPORTANCE In recent years, there has been renewed interest in advanced biofuel sources such as bacterial hydrocarbon production. Previous studies used solvent extraction of bacterial cultures followed by gas chromatography-mass spectrometry (GC-MS) to detect and quantify ketones and hydrocarbons (Beller HR, Goh EB, Keasling JD, Appl. Environ. Microbiol. 76: 1212-1223, 2010; Sukovich DJ, Seffernick JL, Richman JE, Gralnick JA, Wackett LP, Appl. Environ. Microbiol. 76: 3850-3862, 2010). While these analyses are powerful and accurate, their labor-intensive nature makes them intractable to high-throughput screening; therefore, methods for rapid identification of bacterial strains that are overproducing hydrocarbons are needed. The use of high

Diversity of protease-producing marine bacteria from sub-antarctic environments.

PubMed

Cristóbal, Héctor Antonio; López, Maria Alejandra; Kothe, Erika; Abate, Carlos Mauricio

2011-12-01

From seawater and the intestines of benthonic organisms collected from the Beagle Channel, Argentina, 230 marine bacteria were isolated. Cultivable bacteria were characterized and classified as psychrotolerant, whereas few isolates were psychrophiles. These isolates were capable of producing proteases at 4 and 15 °C under neutral (pH 7.0), alkaline (pH 10.0) and acidic (pH 4.5) conditions on different media, revealing 62, 33 and 22% producers at cold and 84, 47 and 33% producers at low temperatures, respectively. More protease-producing strains (67%) were detected when isolated from benthic invertebrates as compared to seawater (33%), with protease production under neutral conditions resulting in milk protein hydrolysis halos between 27 and 30 ± 2 mm in diameter. Using sterile 0.22 μm membrane filters, 29 isolates exhibiting extracellular protease activity were detected. These were grouped into six operational taxonomic units by restriction analysis and identified based on 16S rDNA as γ-proteobacteria of the genera Pseudoalteromonas, Pseudomonas, Shewanella, Alteromonas, Aeromonas, and Serratia. Plasmids were found to be harbored by eight strains, mainly within the isolates from benthonic organisms. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

IDENTIFICATION OF NICOTINAMIDE MONONUCLEOTIDE DEAMIDASE OF THE BACTERIAL PYRIDINE NUCLEOTIDE CYCLE REVEALS A NOVEL BROADLY CONSERVED AMIDOHYDROLASE FAMILY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galeazzi, Luca; Bocci, Paolo; Amici, Adolfo

2011-09-27

The pyridine nucleotide cycle (PNC) is a network of salvage and recycling routes maintaining homeostasis of NAD(P) cofactor pool in the cell. Nicotinamide mononucleotide (NMN) deamidase (EC 3.5.1.42), one of the key enzymes of the bacterial PNC was originally described in Enterobacteria, but the corresponding gene eluded identification for over 30 years. A genomics-based reconstruction of NAD metabolism across hundreds bacterial species suggested that NMN deamidase reaction is the only possible way of nicotinamide salvage in the marine bacterium Shewanella oneidensis. This prediction was verified via purification of native NMN deamidase from S. oneidensis followed by the identification of themore » respective gene, termed pncC. Enzymatic characterization of the PncC protein, as well as phenotype analysis of deletion mutants, confirmed its proposed biochemical and physiological function in S. oneidensis. Of the three PncC homologs present in E. coli, NMN deamidase activity was confirmed only for the recombinant purified product of the ygaD gene. A comparative analysis at the level of sequence and three dimensional structure, which is available for one of the PncC family member, shows no homology with any previously described amidohydrolases. Multiple alignment analysis of functional and non functional PncC homologs, together with NMN docking experiments, allowed us to tentatively identify the active site area and conserved residues therein. An observed broad phylogenomic distribution of predicted functional PncCs in bacterial kingdom is consistent with a possible role in detoxification of NMN, resulting from NAD utilization by DNA ligase.« less

Kinetic Monte Carlo Simulations and Molecular Conductance Measurements of the Bacterial Decaheme Cytochrome MtrF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Byun, H. S.; Pirbadian, S.; Nakano, Aiichiro

2014-09-05

Microorganisms overcome the considerable hurdle of respiring extracellular solid substrates by deploying large multiheme cytochrome complexes that form 20 nanometer conduits to traffic electrons through the periplasm and across the cellular outer membrane. Here we report the first kinetic Monte Carlo simulations and single-molecule scanning tunneling microscopy (STM) measurements of the Shewanella oneidensis MR-1 outer membrane decaheme cytochrome MtrF, which can perform the final electron transfer step from cells to minerals and microbial fuel cell anodes. We find that the calculated electron transport rate through MtrF is consistent with previously reported in vitro measurements of the Shewanella Mtr complex, asmore » well as in vivo respiration rates on electrode surfaces assuming a reasonable (experimentally verified) coverage of cytochromes on the cell surface. The simulations also reveal a rich phase diagram in the overall electron occupation density of the hemes as a function of electron injection and ejection rates. Single molecule tunneling spectroscopy confirms MtrF's ability to mediate electron transport between an STM tip and an underlying Au(111) surface, but at rates higher than expected from previously calculated heme-heme electron transfer rates for solvated molecules.« less

Enrichment and identification of naphthalene-degrading bacteria from the Persian Gulf.

PubMed

Hassanshahian, Mehdi; Boroujeni, Negar Amini

2016-06-15

Naphthalene is a ubiquitous pollutant of the marine environment, and naphthalene biodegradation has been receiving constant scientific consideration. For cleanup of aromatic contaminated sites, bioremediation methods are considered as economical and safe approaches for the marine environment. The aims of this research are isolation and characterization of naphthalene-degrading bacteria from some marine samples of the Persian Gulf. Fifty four naphthalene-degrading bacteria were isolated from marine samples (sediment and seawater) that are enriched in ONR7a medium with naphthalene as the only carbon source. Some screening tests such as growth at high concentration of naphthalene, bioemulsifier production and surface hydrophobicity were done to select the best and prevalent strains for naphthalene degradation. Determination of the nucleotide sequence of the gene encoding for 16S rRNA shows that these isolated strains belong to these genera: Shewanella, Salegentibacter, Halomonas, Marinobacter, Oceanicola, Idiomarina and Thalassospira. These strains can degrade half of the percentage of naphthalene in 10days of incubation. This research is the first report on isolation of these genera from the Persian Gulf as naphthalene-degrader. Copyright © 2016 Elsevier Ltd. All rights reserved.

Large-Scale Comparative Phenotypic and Genomic Analyses Reveal Ecological Preferences of Shewanella Species and Identify Metabolic Pathways Conserved at the Genus Level ▿ †

PubMed Central

Rodrigues, Jorge L. M.; Serres, Margrethe H.; Tiedje, James M.

2011-01-01

The use of comparative genomics for the study of different microbiological species has increased substantially as sequence technologies become more affordable. However, efforts to fully link a genotype to its phenotype remain limited to the development of one mutant at a time. In this study, we provided a high-throughput alternative to this limiting step by coupling comparative genomics to the use of phenotype arrays for five sequenced Shewanella strains. Positive phenotypes were obtained for 441 nutrients (C, N, P, and S sources), with N-based compounds being the most utilized for all strains. Many genes and pathways predicted by genome analyses were confirmed with the comparative phenotype assay, and three degradation pathways believed to be missing in Shewanella were confirmed as missing. A number of previously unknown gene products were predicted to be parts of pathways or to have a function, expanding the number of gene targets for future genetic analyses. Ecologically, the comparative high-throughput phenotype analysis provided insights into niche specialization among the five different strains. For example, Shewanella amazonensis strain SB2B, isolated from the Amazon River delta, was capable of utilizing 60 C compounds, whereas Shewanella sp. strain W3-18-1, isolated from deep marine sediment, utilized only 25 of them. In spite of the large number of nutrient sources yielding positive results, our study indicated that except for the N sources, they were not sufficiently informative to predict growth phenotypes from increasing evolutionary distances. Our results indicate the importance of phenotypic evaluation for confirming genome predictions. This strategy will accelerate the functional discovery of genes and provide an ecological framework for microbial genome sequencing projects. PMID:21642407

Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces.

PubMed

Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth

2013-01-01

This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces.

PubMed

Gross, Benjamin J; El-Naggar, Mohamed Y

2015-06-01

Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.

A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces

NASA Astrophysics Data System (ADS)

Gross, Benjamin J.; El-Naggar, Mohamed Y.

2015-06-01

Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe an experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.

Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daly, Michael J.

2006-05-01

Ionizing Radiation (IR) Resistance in Bacteria. Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR) and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny,more » where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR.« less

Impact of a static magnetic field on the electricity production of Shewanella-inoculated microbial fuel cells.

PubMed

Li, Wen-Wei; Sheng, Guo-Ping; Liu, Xian-Wei; Cai, Pei-Jie; Sun, Min; Xiao, Xiang; Wang, Yun-Kun; Tong, Zhong-Hua; Dong, Fang; Yu, Han-Qing

2011-06-15

The electricity production of Shewanella-inoculated microbial fuel cells (MFCs) under magnetic field (MF) exposure was investigated in different reactor systems. The persistency of the MF effect and the influences of MF intensity and direction on MFC performance were also studied. Application of a 100-mT static MF to the MFCs improved electricity production considerably, with an increase in the maximum voltage by 20-27% in both single- and two-chamber MFCs, while a more conspicuous improvement in the electricity generation was observed in a three-electrode cell. The MF effects were found to be immediate and reversible, and adverse effects seemed to occur when the MF was suddenly removed. The medium components analysis demonstrated that the application of MF led to an enhanced bioelectrochemical activity of Shewanella, and no significant promotion in mediator secretion was found. The improvement in the electricity production of MFCs under MF was mainly attributed to the enhanced bioelectrochemical activity, possibly through the oxidative stress mechanism. An accelerated cell growth under MF might also contribute to the enhanced substrate degradation and power generation. Copyright © 2010 Elsevier B.V. All rights reserved.

Facile method to stain the bacterial cell surface for super-resolution fluorescence microscopy†

PubMed Central

Gunsolus, Ian L.; Hu, Dehong; Mihai, Cosmin; Lohse, Samuel E.; Lee, Chang-soo; Torelli, Marco D.; Hamers, Robert J.; Murhpy, Catherine J.; Orr, Galya

2015-01-01

A method to fluorescently stain the surfaces of both Gram-negative and Gram-positive bacterial cells compatible with super-resolution fluorescence microscopy is presented. This method utilizes a commercially-available fluorescent probe to label primary amines at the surface of the cell. We demonstrate eficient staining of two bacterial strains, the Gram-negative Shewanella oneidensis MR-1 and the Gram-positive Bacillus subtilis 168. Using structured illumination microscopy and stochastic optical reconstruction microscopy, which require high quantum yield or specialized dyes, we show that this staining method may be used to resolve the bacterial cell surface with sub-diffraction-limited resolution. We further use this method to identify localization patterns of nanomaterials, specifically cadmium selenide quantum dots, following interaction with bacterial cells. PMID:24816810

Facile method to stain the bacterial cell surface for super-resolution fluorescence microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gunsolus, Ian L.; Hu, Dehong; Mihai, Cosmin

A method to fluorescently stain the surfaces of both Gram-negative and Gram-positive bacterial cells compatible with super-resolution fluorescence microscopy is presented. This method utilizes a commercially-available fluorescent probe to label primary amines at the surface of the cell. We demonstrate efficient staining of two bacterial strains, the Gram-negative Shewanella oneidensis MR-1 and the Gram-positive Bacillus subtilis 168. Using structured illumination microscopy and stochastic optical reconstruction microscopy, which require high quantum yield or specialized dyes, we show that this staining method may be used to resolve the bacterial cell surface with sub-diffraction-limited resolution. We further use this method to identify localizationmore » patterns of nanomaterials, specifically cadmium selenide quantum dots, following interaction with bacterial cells.« less

Bion M1. Peculiarities of life activities of microbes in 30-day spaceflight

NASA Astrophysics Data System (ADS)

Viacheslav, Ilyin; Korshunov, Denis; Morozova, Julia; Voeikova, Tatiana; Tyaglov, Boris; Novikova, Liudmila; Krestyanova, Irina; Emelyanova, Lydia

The aim of this work was to analyze the influence of space flight factors ( SFF) to microorganism strains , exposed inside unmanned spacecraft Bion M-1 during the 30- day space flight. Objectives of the work - the study of the influence of the SFF exchange chromosomal DNA in crosses microorganisms of the genus Streptomyces; the level of spontaneous phage induction of lysogenic strains fS31 from Streptomyces lividans 66 and Streptomyces coelicolor A3 ( 2 ) on the biosynthesis of the antibiotic tylosin strain of Streptomyces fradiae; survival electrogenic bacteria Shewanella oneidensis MR- 1 is used in the microbial fuel cell As a result of this work it was found that the SFF affect the exchange of chromosomal DNA by crossing strains of Streptomyces. Was detected polarity crossing , expressed in an advantageous contribution chromosome fragment of one of the parent strains in recombinant offspring. This fact may indicate a more prolonged exposure of cells in microgravity and , as a consequence, the transfer of longer fragments of chromosomal DNA This feature is the transfer of genetic material in microgravity could lead to wider dissemination and horizontal transfer of chromosomal and plasmid DNA of symbiotic microflora astronauts and other strains present in the spacecraft. It was shown no effect on the frequency of recombination PCF and the level of mutation model reversion of auxotrophic markers to prototrophy It was demonstrated that PCF increase the level of induction of cell actinophage fS31 lysogenic strain of S. lividans 66, but did not affect the level of induction of this phage cells S. coelicolor A3 ( 2). It is shown that the lower the level of synthesis PCF antibiotic aktinorodina (actinorhodin) in lysogenic strain S. coelicolor A3 ( 2). 66 Strains of S. lividans and S. coelicolor A3 ( 2 ) can be used as a biosensor for studying the effect on microorganisms PCF It is shown that the effect of the PCF reduces synthesis of tylosin and desmicosyn S. fradiae at

Differential Regulation of the Two Ferrochelatase Paralogues in Shewanella loihica PV-4 in Response to Environmental Stresses

DOE PAGES

Qiu, Dongru; Xie, Ming; Dai, Jingcheng; ...

2016-06-10

biosynthesis of heme and cytochromes is poorly understood. In conclusion, our study has demonstrated that two ferrochelatase genes involved in heme biosynthesis are differentially regulated in response to environmental stresses, including light and reactive oxygen species. This is an excellent example showing how bacteria have evolved to maintain cellular heme homeostasis. More interestingly, the high yields of extracellular protoporphyrin IX by theShewanella loihicaPV-4 mutants could be utilized for commercial production of this valuable chemical via bacterial fermentation.« less

Differential Regulation of the Two Ferrochelatase Paralogues in Shewanella loihica PV-4 in Response to Environmental Stresses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, Dongru; Xie, Ming; Dai, Jingcheng

biosynthesis of heme and cytochromes is poorly understood. In conclusion, our study has demonstrated that two ferrochelatase genes involved in heme biosynthesis are differentially regulated in response to environmental stresses, including light and reactive oxygen species. This is an excellent example showing how bacteria have evolved to maintain cellular heme homeostasis. More interestingly, the high yields of extracellular protoporphyrin IX by theShewanella loihicaPV-4 mutants could be utilized for commercial production of this valuable chemical via bacterial fermentation.« less

Mercury capture into biogenic amorphous selenium nanospheres produced by mercury resistant Shewanella putrefaciens 200.

PubMed

Jiang, Shenghua; Ho, Cuong Tu; Lee, Ji-Hoon; Duong, Hieu Van; Han, Seunghee; Hur, Hor-Gil

2012-05-01

Shewanella putrefaciens 200, resistant to high concentration of Hg(II), was selected for co-removal of mercury and selenium from aqueous medium. Biogenic Hg(0) reduced from Hg(II) by S. putrefaciens 200 was captured into extracellular amorphous selenium nanospheres, resulting in the formation of stable HgSe nanoparticles. This bacterial reduction could be a new strategy for mercury removal from aquatic environments without secondary pollution of mercury methylation or Hg(0) volatilization. Copyright © 2012 Elsevier Ltd. All rights reserved.

Biosupported Bimetallic Pd Au Nanocatalysts for Dechlorination of Environmental Contaminants

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Corte, S.; Fitts, J.; Hennebel, T.

2011-08-30

Biologically produced monometallic palladium nanoparticles (bio-Pd) have been shown to catalyze the dehalogenation of environmental contaminants, but fail to efficiently catalyze the degradation of other important recalcitrant halogenated compounds. This study represents the first report of biologically produced bimetallic Pd/Au nanoparticle catalysts. The obtained catalysts were tested for the dechlorination of diclofenac and trichloroethylene. When aqueous bivalent Pd(II) and trivalent Au(III) ions were both added to concentrations of 50 mg L{sup -1} and reduced simultaneously by Shewanella oneidensis in the presence of H{sub 2}, the resulting cell-associated bimetallic nanoparticles (bio-Pd/Au) were able to dehalogenate 78% of the initially added diclofenacmore » after 24 h; in comparison, no dehalogenation was observed using monometallic bio-Pd or bio-Au. Other catalyst-synthesis strategies did not show improved dehalogenation of TCE and diclofenac compared with bio-Pd. Synchrotron-based X-ray diffraction, (scanning) transmission electron microscopy and energy dispersive X-ray spectroscopy indicated that the simultaneous reduction of Pd and Au supported on cells of S. oneidensis resulted in the formation of a unique bimetallic crystalline structure. This study demonstrates that the catalytic activity and functionality of possibly environmentally more benign biosupported Pd-catalysts can be improved by coprecipitation with Au.« less

Changes in Microbial Energy Metabolism Measured by Nanocalorimetry during Growth Phase Transitions

PubMed Central

Robador, Alberto; LaRowe, Douglas E.; Finkel, Steven E.; Amend, Jan P.; Nealson, Kenneth H.

2018-01-01

Calorimetric measurements of the change in heat due to microbial metabolic activity convey information about the kinetics, as well as the thermodynamics, of all chemical reactions taking place in a cell. Calorimetric measurements of heat production made on bacterial cultures have recorded the energy yields of all co-occurring microbial metabolic reactions, but this is a complex, composite signal that is difficult to interpret. Here we show that nanocalorimetry can be used in combination with enumeration of viable cell counts, oxygen consumption rates, cellular protein content, and thermodynamic calculations to assess catabolic rates of an isolate of Shewanella oneidensis MR-1 and infer what fraction of the chemical energy is assimilated by the culture into biomass and what fraction is dissipated in the form of heat under different limiting conditions. In particular, our results demonstrate that catabolic rates are not necessarily coupled to rates of cell division, but rather, to physiological rearrangements of S. oneidensis MR-1 upon growth phase transitions. In addition, we conclude that the heat released by growing microorganisms can be measured in order to understand the physiochemical nature of the energy transformation and dissipation associated with microbial metabolic activity in conditions approaching those found in natural systems. PMID:29449836

Monitoring structural transformation of hydroxy-sulphate green rust in the presence of sulphate reducing bacteria

NASA Astrophysics Data System (ADS)

Abdelmoula, M.; Zegeye, A.; Jorand, F.; Carteret, C.

2006-01-01

The activities of bacterial consortia enable organisms to maximize their metabolic capabilities. This article assesses the synergetic relationship between iron reducing bacteria (IRB), Shewanella putrefaciens and sulphate reducing bacteria (SRB) Desulfovibrio alaskensis. Thus, the aim of this study was first to form a biogenic hydroxy-sulpahte green rust GR2( {text{SO}}_{{text{4}}} ^{{2 - }} ) through the bioreduction of lepidocrocite by S. putrefaciens and secondly to investigate if sulfate anions intercalated in the biogenic GR2( {text{SO}}_{{text{4}}} ^{{2 - }} ) could serve as final electron acceptor for a sulfate reducing bacterium, D. alaskensis. The results indicate that the IRB lead to the formation of GR2( {text{SO}}_{{text{4}}} ^{{2 - }} ) and this mineral serve as an electron acceptor for SRB. GR2( {text{SO}}_{{text{4}}} ^{{2 - }} ) precipitation and its transformation was demonstrated by using X-ray diffraction (DRX), Mössbauer spectroscopy (TMS) and transmission electron spectroscopy (TEM). These observations point out the possible acceleration of steel corrosion in marine environment in presence of IRB/SRB consortia.

The potential for iron reduction in upland soils in Calhoun Critical Zone Observatory

NASA Astrophysics Data System (ADS)

Thompson, A.; Chen, C.; Noor, N.; Hodges, C. A.; Barcellos, D.; Richter, D. D., Jr.

2017-12-01

Fe redox cycling plays an important role in organic matter preservation and degradation, and the fate of nutrients and contaminants. Despite its importance, Fe redox cycling in non-flooded upland soils has been underappreciated, although many upland terrestrial ecosystems have episodes of low redox events and an abundance of anoxic microsites. Soil Fe reduction is generally constrained by C availability, the reactivity of Fe(III) oxyhydroxides, and the abundance of Fe reducing bacteria. The goal of this study was to determine the potential for Fe reduction in upland soils under varying land-uses (Hardwood, Pine and Cultivated soils) from Calhoun Critical Zone Observatory. Fresh field soils from multiple depths were incubated in the lab without amendments under anoxic conditions for 3 weeks to determine the native potential for soil Fe reduction and to assess the limiting factors, the soils were amended with factorial mixtures of the following: (1) organic substrates (glucose and alanine); (2) bioavailable Fe (ferrihydrite); and (3) Fe reducing bacteria (Shewanella oneidensis strain MR-1). Results showed that Fe reduction potential generally decreased with soil depth. Fe reduction potential is very minimal below 1m of soil profile. The availability of Fe(III) minerals did not constrain pine and hardwood soil Fe reduction potential. Fe(III) availability only slightly limited the potential for Fe reduction the cultivated soils, which have the lowest extractable Fe by ascorbate-citrate. Labile C constrained Fe reduction in the hardwood and cultivated soils, but not in the pine soils, which had the highest extractable C by K2SO4. In addition, we found the more energetic C source (glucose) facilitated more Fe reduction in the subsurface soil than did Alanine. Finally, the abundance of Fe-reducing bacteria limited Fe reduction potential in almost all of these soils, particularly the pine soils.

Draft genome sequence of carbapenem-resistant Shewanella algae strain AC isolated from small abalone (Haliotis diversicolor).

PubMed

Huang, Yao-Ting; Cheng, Jan-Fang; Chen, Shi-Yu; Hong, Yu-Kai; Wu, Zong-Yen; Liu, Po-Yu

2018-06-19

Shewanella algae is an environmental marine bacteria and an emerging opportunistic human pathogen. Moreover, there are increasing reports of strains showing multi-drug resistance, particularly carbapenem-resistant isolates. Although S. algae have been found in bivalve shellfish aquaculture, there is very little genome-wide data on resistant determinants in S. algae from shellfish. In the study, we aimed to determine the whole genome sequence of carbapenem-resistant S. algae strain AC isolated from small abalone in Taiwan. Genome DNA was sequenced using an Illumina MiSeq platform using 250bp paired-end reads. De novo genome assembly was performed using Velvet v1.2.07. The whole genome was annotated and several candidate genes for antimicrobial resistance were identified. The genome size was calculated at 4,751,156bp, with a mean G＋C content of 53.09%. A total of 4,164 protein-coding sequences, 7 rRNAs, 85 tRNAs, and 5 non-coding RNAs were identified. The genome contains genes associated with resistance to β-lactams, trimethoprim, tetracycline, colistin, and quinolone resistance. Multiple efflux pump genes were also detected. Small abalone is a potential source of foodborne drug resistant S. algae. The genome sequence of a carbapenem-resistant S. algae strain AC isolated from small abalone will provide valuable information for further study of the dissemination of resistance genes at the human-animal interface. Copyright © 2018. Published by Elsevier Ltd.

Lipopolysaccharide Density and Structure Govern the Extent and Distance of Nanoparticle Interaction with Actual and Model Bacterial Outer Membranes

DOE PAGES

Jacobson, Kurt H.; Gunsolus, Ian L.; Kuech, Thomas R.; ...

2015-07-24

We report that design of nanomedicines and nanoparticle-based antimicrobial and antifouling formulations, and assessment of the potential implications of nanoparticle release into the environment require understanding nanoparticle interaction with bacterial surfaces. Here we demonstrate electrostatically driven association of functionalized nanoparticles with lipopolysaccharides of Gram-negative bacterial outer membranes and find that lipopolysaccharide structure influences the extent and location of binding relative to the lipid-solution interface. By manipulating the lipopolysaccharide content in Shewanella oneidensis outer membranes, we observed electrostatically driven interaction of cationic gold nanoparticles with the lipopolysaccharide-containing leaflet. We probed this interaction by quartz crystal microbalance with dissipation monitoring (QCM-D) andmore » second harmonic generation (SHG) using solid-supported lipopolysaccharide-containing bilayers. Association of cationic nanoparticles increased with lipopolysaccharide content, while no association of anionic nanoparticles was observed. The harmonic-dependence of QCM-D measurements suggested that a population of the cationic nanoparticles was held at a distance from the outer leaflet-solution interface of bilayers containing smooth lipopolysaccharides (those bearing a long O-polysaccharide). Additionally, smooth lipopolysaccharides held the bulk of the associated cationic particles outside of the interfacial zone probed by SHG. Lastly, our results demonstrate that positively charged nanoparticles are more likely to interact with Gram-negative bacteria than are negatively charged particles, and this interaction occurs primarily through lipopolysaccharides.« less

Characterisation of volatile compounds produced by bacteria isolated from the spoilage flora of cold-smoked salmon.

PubMed

Joffraud, J J; Leroi, F; Roy, C; Berdagué, J L

2001-06-15

This study investigated the volatile compounds produced by bacteria belonging to nine different bacterial groups: Lactobacillus sake, L. farciminis, L. alimentarius, Carnobacterium piscicola, Aeromonas sp., Shewanella putrefaciens, Brochothrix thermosphacta, Photobacterium phosphoreum and Enterobacteriaceae isolated from cold-smoked salmon. Each bacterial group was represented by several strains. In addition, combinations of the groups were examined as well. Sterile blocks of cold-smoked salmon were inoculated, vacuum-packed and stored at 6 degrees C. After 40 days of storage at 6 degrees C, aerobic viable count and pH were recorded, the volatile fraction of the samples was analysed by gas chromatography-mass spectrometry (GC-MS), and spoilage was assessed by sensory evaluation. Among the 81 volatile compounds identified by GC-MS, 30 appeared to be released as a result of bacterial metabolism. Some of the effects of inoculated bacterial strains on the composition of the volatile fraction seemed to be characteristic of certain bacterial species. Sensory analysis showed relationships between bacteria, the composition of the volatile fraction and the organoleptic quality of smoked salmon.

Sponge-Associated Bacteria Produce Non-cytotoxic Melanin Which Protects Animal Cells from Photo-Toxicity.

PubMed

Vijayan, Vijitha; Jasmin, Chekidhenkuzhiyil; Anas, Abdulaziz; Parakkaparambil Kuttan, Sreelakshmi; Vinothkumar, Saradavey; Perunninakulath Subrayan, Parameswaran; Nair, Shanta

2017-09-01

Melanin is a photo-protective polymer found in many organisms. Our research shows that the bacteria associated with darkly pigmented sponges (Haliclona pigmentifera, Sigmadocia pumila, Fasciospongia cavernosa, Spongia officinalis, and Callyspongia diffusa) secrete non-cytotoxic melanin, with antioxidant activity that protects animal cells from photo-toxicity. Out of 156 bacterial strains screened, 22 produced melanin and these melanin-producing bacteria (MPB) were identified as Vibrio spp., Providencia sp., Bacillus sp., Shewanella sp., Staphylococcus sp., Planococcus sp., Salinococcus sp., and Glutamicibacter sp. Maximum melanin production was exhibited by Vibrio alginolyticus Marine Microbial Reference Facility (MMRF) 534 (50 mg ml -1 ), followed by two isolates of Vibrio harveyi MMRF 535 (40 mg ml -1 ) and MMRF 546 (30 mg ml -1 ). Using pathway inhibition assay and FT-IR spectral analysis, we identified the melanin secreted into the culture medium of MPB as 1,8-dihydroxynaphthalene-melanin. The bacterial melanin was non-cytotoxic to mouse fibroblast L929 cells and brine shrimps up to a concentration of 200 and 500 ppm, respectively. Bacterial melanin showed antioxidant activity at very low concentration (IC 50 -9.0 ppm) and at 50 ppm, melanin protected L929 cells from UV-induced intracellular reactive oxygen stress. Our study proposes sponge-associated bacteria as a potential source of non-cytotoxic melanin with antioxidant potentials.

MicroSPE-nanoLC-ESI-MS/MS Using 10-μm-i.d. Silica-Based Monolithic Columns for Proteomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luo, Quanzhou; Page, Jason S.; Tang, Keqi

2007-01-01

Silica-based monolithic narrow bore capillary columns (25 cm x 10 µm i.d.) with an integrated nanoESI emitter has been developed to provide high quality and robust microSPE-nanoLC-ESI-MS analyses. The integrated nanoESI emitter adds no dead volume to the LC separation, allowing stable electrospray performance to be obtained at flow rates of ~10 nL/min. In an initial application we identified 5510 unique peptides covering 1443 distinct Shewanella oneidensis proteins from a 300 ng tryptic digest sample in a single 4-h LC-MS/MS analysis using a linear ion trap MS (LTQ). We found the use of an integrated monolithic ESI emitter provided enhancedmore » resistance to clogging and good run-to-run reproducibility.« less

High-throughput protein concentration and buffer exchange: comparison of ultrafiltration and ammonium sulfate precipitation.

PubMed

Moore, Priscilla A; Kery, Vladimir

2009-01-01

High-throughput protein purification is a complex, multi-step process. There are several technical challenges in the course of this process that are not experienced when purifying a single protein. Among the most challenging are the high-throughput protein concentration and buffer exchange, which are not only labor-intensive but can also result in significant losses of purified proteins. We describe two methods of high-throughput protein concentration and buffer exchange: one using ammonium sulfate precipitation and one using micro-concentrating devices based on membrane ultrafiltration. We evaluated the efficiency of both methods on a set of 18 randomly selected purified proteins from Shewanella oneidensis. While both methods provide similar yield and efficiency, the ammonium sulfate precipitation is much less labor intensive and time consuming than the ultrafiltration.

Biofilms and antibiotic susceptibility of multidrug-resistant bacteria from wild animals.

PubMed

Dias, Carla; Borges, Anabela; Oliveira, Diana; Martinez-Murcia, Antonio; Saavedra, Maria José; Simões, Manuel

2018-01-01

The "One Health" concept recognizes that human health and animal health are interdependent and bound to the health of the ecosystem in which they (co)exist. This interconnection favors the transmission of bacteria and other infectious agents as well as the flow of genetic elements containing antibiotic resistance genes. This problem is worsened when pathogenic bacteria have the ability to establish as biofilms. Therefore, it is important to understand the characteristics and behaviour of microorganisms in both planktonic and biofilms states from the most diverse environmental niches to mitigate the emergence and dissemination of resistance. The purpose of this work was to assess the antibiotic susceptibility of four bacteria ( Acinetobacter spp., Klebsiella pneumoniae , Pseudomonas fluorescens and Shewanella putrefaciens ) isolated from wild animals and their ability to form biofilms. The effect of two antibiotics, imipenem (IPM) and ciprofloxacin (CIP), on biofilm removal was also assessed. Screening of resistance genetic determinants was performed by PCR. Biofilm tests were performed by a modified microtiter plate method. Bacterial surface hydrophobicity was determined by sessile drop contact angles. The susceptibility profile classified the bacteria as multidrug-resistant. Three genes coding for β-lactamases were detected in K. pneumoniae (TEM, SHV, OXA-aer) and one in P. fluorescens (OXA-aer). K. pneumoniae was the microorganism that carried more β-lactamase genes and it was the most proficient biofilm producer, while P. fluorescens demonstrated the highest adhesion ability. Antibiotics at their MIC, 5 × MIC and 10 × MIC were ineffective in total biofilm removal. The highest biomass reductions were found with IPM (54% at 10 × MIC) against K. pneumoniae biofilms and with CIP (40% at 10 × MIC) against P. fluorescens biofilms. The results highlight wildlife as important host reservoirs and vectors for the spread of multidrug-resistant bacteria and genetic

Biofilms and antibiotic susceptibility of multidrug-resistant bacteria from wild animals

PubMed Central

Dias, Carla; Borges, Anabela; Oliveira, Diana; Martinez-Murcia, Antonio; Saavedra, Maria José

2018-01-01

Background The “One Health” concept recognizes that human health and animal health are interdependent and bound to the health of the ecosystem in which they (co)exist. This interconnection favors the transmission of bacteria and other infectious agents as well as the flow of genetic elements containing antibiotic resistance genes. This problem is worsened when pathogenic bacteria have the ability to establish as biofilms. Therefore, it is important to understand the characteristics and behaviour of microorganisms in both planktonic and biofilms states from the most diverse environmental niches to mitigate the emergence and dissemination of resistance. Methods The purpose of this work was to assess the antibiotic susceptibility of four bacteria (Acinetobacter spp., Klebsiella pneumoniae, Pseudomonas fluorescens and Shewanella putrefaciens) isolated from wild animals and their ability to form biofilms. The effect of two antibiotics, imipenem (IPM) and ciprofloxacin (CIP), on biofilm removal was also assessed. Screening of resistance genetic determinants was performed by PCR. Biofilm tests were performed by a modified microtiter plate method. Bacterial surface hydrophobicity was determined by sessile drop contact angles. Results The susceptibility profile classified the bacteria as multidrug-resistant. Three genes coding for β-lactamases were detected in K. pneumoniae (TEM, SHV, OXA-aer) and one in P. fluorescens (OXA-aer). K. pneumoniae was the microorganism that carried more β-lactamase genes and it was the most proficient biofilm producer, while P. fluorescens demonstrated the highest adhesion ability. Antibiotics at their MIC, 5 × MIC and 10 × MIC were ineffective in total biofilm removal. The highest biomass reductions were found with IPM (54% at 10 × MIC) against K. pneumoniae biofilms and with CIP (40% at 10 × MIC) against P. fluorescens biofilms. Discussion The results highlight wildlife as important host reservoirs and vectors for the spread of

A combined electrochemical and optical trapping platform for measuring single cell respiration rates at electrode interfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gross, Benjamin J.; El-Naggar, Mohamed Y., E-mail: mnaggar@usc.edu; Molecular and Computational Biology Section, Department of Biological Sciences, University of Southern California, Los Angeles, California 90089-0484

2015-06-15

Metal-reducing bacteria gain energy by extracellular electron transfer to external solids, such as naturally abundant minerals, which substitute for oxygen or the other common soluble electron acceptors of respiration. This process is one of the earliest forms of respiration on earth and has significant environmental and technological implications. By performing electron transfer to electrodes instead of minerals, these microbes can be used as biocatalysts for conversion of diverse chemical fuels to electricity. Understanding such a complex biotic-abiotic interaction necessitates the development of tools capable of probing extracellular electron transfer down to the level of single cells. Here, we describe anmore » experimental platform for single cell respiration measurements. The design integrates an infrared optical trap, perfusion chamber, and lithographically fabricated electrochemical chips containing potentiostatically controlled transparent indium tin oxide microelectrodes. Individual bacteria are manipulated using the optical trap and placed on the microelectrodes, which are biased at a suitable oxidizing potential in the absence of any chemical electron acceptor. The potentiostat is used to detect the respiration current correlated with cell-electrode contact. We demonstrate the system with single cell measurements of the dissimilatory-metal reducing bacterium Shewanella oneidensis MR-1, which resulted in respiration currents ranging from 15 fA to 100 fA per cell under our measurement conditions. Mutants lacking the outer-membrane cytochromes necessary for extracellular respiration did not result in any measurable current output upon contact. In addition to the application for extracellular electron transfer studies, the ability to electronically measure cell-specific respiration rates may provide answers for a variety of fundamental microbial physiology questions.« less

A survey of culturable aerobic and anaerobic marine bacteria in de novo biofilm formation on natural substrates in St. Andrews Bay, Scotland.

PubMed

Finnegan, Lucy; Garcia-Melgares, Manuel; Gmerek, Tomasz; Huddleston, W Ryan; Palmer, Alexander; Robertson, Andrew; Shapiro, Sarah; Unkles, Shiela E

2011-10-01

This study reports a novel study of marine biofilm formation comprising aerobic and anaerobic bacteria. Samples of quartz and feldspar, minerals commonly found on the earth, were suspended 5 m deep in the North Sea off the east coast of St. Andrews, Scotland for 5 weeks. The assemblage of organisms attached to these stones was cultivated under aerobic and anaerobic conditions in the laboratory. Bacteria isolated on Marine Agar 2216 were all Gram-negative and identified to genus level by sequencing the gene encoding 16S rRNA. Colwellia, Maribacter, Pseudoaltermonas and Shewanella were observed in aerobically-grown cultures while Vibrio was found to be present in both aerobic and anaerobic cultures. The obligate anaerobic bacterium Psychrilyobacter atlanticus, a recently defined genus, was identified as a close relative of isolates grown anaerobically. The results provide valuable information as to the main players that attach and form de novo biofilms on common minerals in sea water.

XAFS and X-Ray and Electron Microscopy Investigations of Radionuclide Transformations at the Mineral-Microbe Interface

NASA Astrophysics Data System (ADS)

Kemner, Ken; O'Loughlin, Ed; Kelly, Shelly; Ravel, Bruce; Boyanov, Maxim; Sholto-Douglas, Deirdre; Lai, Barry; Cook, Russ; Carpenter, Everett; Harris, Vince; Nealson, Ken

2007-02-01

The microenvironment at and adjacent to surfaces of actively metabolizing cells, whether in a planktonic state or adhered to mineral surfaces, can be significantly different from the bulk environment. Microbial polymers (polysaccharides, DNA, RNA, and proteins), whether attached to or released from the cell, can contribute to the development of steep chemical gradients over very short distances. It is currently difficult to predict the behavior of contaminant radionuclides and metals in such microenvironments, because the chemistry there has been difficult or impossible to define. The behavior of contaminants in such microenvironments can ultimately affect their macroscopic fates. We have successfully performed a series of U LIII edge x-ray absorption fine structure (XAFS) spectroscopy, hard x-ray fluorescence (XRF) microprobe (150 nm resolution), and electron microscopy (EM) measurements on lepidocrocite thin films (˜1 micron thickness) deposited on kapton films that have been inoculated with the dissimilatory metal reducing bacterium Shewanella oneidensis MR-1 and exposed to 0.05 mM uranyl acetate under anoxic conditions. Similarly, we have performed a series of U LIII edge EXAFS measurements on lepidocrocite powders exposed to 0.05 mM uranyl acetate and exopolymeric components harvested from S. oneidensis MR-1 grown under aerobic conditions. These results demonstrate the utility of combining bulk XAFS with x-ray and electron microscopies.

Bioelectrochemical biosensor for water toxicity detection: generation of dual signals for electrochemical assay confirmation.

PubMed

Yang, Yuan; Wang, Yan-Zhai; Fang, Zhen; Yu, Yang-Yang; Yong, Yang-Chun

2018-02-01

Toxicity assessment of water is of great important to the safety of human health and to social security because of more and more toxic compounds that are spilled into the aquatic environment. Therefore, the development of fast and reliable toxicity assessment methods is of great interest and attracts much attention. In this study, by using the electrochemical activity of Shewanella oneidensis MR-1 cells as the toxicity indicator, 3,5-dichlorophenol (DCP) as the model toxic compound, a new biosensor for water toxicity assessment was developed. Strikingly, the presence of DCP in the water significantly inhibited the maximum current output of the S. oneidensis MR-1 in a three-electrode system and also retarded the current evolution by the cells. Under the optimized conditions, the maximum current output of the biosensor was proportional to the concentration of DCP up to 30 mg/L. The half maximal inhibitory concentration of DCP determined by this biosensor is about 14.5 mg/L. Furthermore, simultaneous monitoring of the retarded time (Δt) for current generation allowed the identification of another biosensor signal in response to DCP which could be employed to verify the electrochemical result by dual confirmation. Thus, the present study has provided a reliable and promising approach for water quality assessment and risk warning of water toxicity.

Relative Frequency, Characteristics, and Antimicrobial Susceptibility Patterns of Vibrio spp., Aeromonas spp., Chromobacterium violaceum, and Shewanella spp. in the Northern Territory of Australia, 2000–2013

PubMed Central

McAuliffe, Gary N.; Hennessy, Jann; Baird, Robert W.

2015-01-01

Vibrio, Aeromonas, Chromobacterium violaceum, and Shewanella (VACS) are water-associated Gram-negative organisms that can cause a variety of infections. The frequency, patient characteristics, and antimicrobial susceptibilities for 468 isolates from 442 patients from the Northern Territory were reviewed. Aeromonas spp. (312 of 468; 67%) were most commonly isolated followed by Vibrio spp. (71 of 468; 15%), Shewanella spp. (61 of 468; 13%), and C. violaceum (24 of 468; 5%). A strong male predominance was found (male to female ratio of 2.3:1). Skin and soft tissue isolations (373 of 468; 80%) from lower limb infections (222 of 371; 60%) were the most common clinical manifestation. The episodes were usually polymicrobial (281 of 468; 60%). Coisolates included Staphylococcus aureus (137 of 468; 29%), β-hemolytic streptococci (74 of 468; 16%), enterobacteriaceae (111 of 468; 24%), non-fermentative Gram-negative bacilli (35 of 468; 7%), and other VACS organisms (37 of 468; 8%). Antimicrobial resistance of VACS organisms to ciprofloxacin (0–4%), cefepime (0–3%), and gentamicin (0–0.8%) and Vibrio spp., Aeromonas spp., and Shewanella to cotrimoxazole (0–3%) was rarely shown. For water-associated lower limb skin and soft tissue infections in the tropics, clinicians should consider empirical antimicrobial therapy with agents active against S. aureus and VACS organisms. PMID:25548380

Discrimination of Four Marine Biofilm-Forming Bacteria by LC-MS Metabolomics and Influence of Culture Parameters.

PubMed

Favre, Laurie; Ortalo-Magné, Annick; Greff, Stéphane; Pérez, Thierry; Thomas, Olivier P; Martin, Jean-Charles; Culioli, Gérald

2017-05-05

Most marine bacteria can form biofilms, and they are the main components of biofilms observed on marine surfaces. Biofilms constitute a widespread life strategy, as growing in such structures offers many important biological benefits. The molecular compounds expressed in biofilms and, more generally, the metabolomes of marine bacteria remain poorly studied. In this context, a nontargeted LC-MS metabolomics approach of marine biofilm-forming bacterial strains was developed. Four marine bacteria, Persicivirga (Nonlabens) mediterranea TC4 and TC7, Pseudoalteromonas lipolytica TC8, and Shewanella sp. TC11, were used as model organisms. The main objective was to search for some strain-specific bacterial metabolites and to determine how culture parameters (culture medium, growth phase, and mode of culture) may affect the cellular metabolism of each strain and thus the global interstrain metabolic discrimination. LC-MS profiling and statistical partial least-squares discriminant analyses showed that the four strains could be differentiated at the species level whatever the medium, the growth phase, or the mode of culture (planktonic vs biofilm). A MS/MS molecular network was subsequently built and allowed the identification of putative bacterial biomarkers. TC8 was discriminated by a series of ornithine lipids, while the P. mediterranea strains produced hydroxylated ornithine and glycine lipids. Among the P. mediterranea strains, TC7 extracts were distinguished by the occurrence of diamine derivatives, such as putrescine amides.

Characterization of a New M13 Metallopeptidase from Deep-Sea Shewanella sp. E525-6 and Mechanistic Insight into Its Catalysis

PubMed Central

Yang, Jin-Yu; Wang, Peng; Li, Chun-Yang; Dong, Sheng; Song, Xiao-Yan; Zhang, Xi-Ying; Xie, Bin-Bin; Zhou, Bai-Cheng; Zhang, Yu-Zhong; Chen, Xiu-Lan

2016-01-01

Bacterial extracellular peptidases are important for bacterial nutrition and organic nitrogen degradation in the ocean. While many peptidases of the M13 family from terrestrial animals and bacteria are studied, there has been no report on M13 peptidases from marine bacteria. Here, we characterized an M13 peptidase, PepS, from the deep-sea sedimentary strain Shewanella sp. E525-6, and investigated its substrate specificity and catalytic mechanism. The gene pepS cloned from strain E525-6 contains 2085 bp and encodes an M13 metallopeptidase. PepS was expressed in Escherichia coli and purified. Among the characterized M13 peptidases, PepS shares the highest sequence identity (47%) with Zmp1 from Mycobacterium tuberculosis, indicating that PepS is a new member of the M13 family. PepS had the highest activity at 30°C and pH 8.0. It retained 15% activity at 0°C. Its half life at 40°C was only 4 min. These properties indicate that PepS is a cold-adapted enzyme. The smallest substrate for PepS is pentapeptide, and it is probably unable to cleave peptides of more than 30 residues. PepS prefers to hydrolyze peptide bonds with P1′ hydrophobic residues. Structural and mutational analyses suggested that His531, His535 and Glu592 coordinate the catalytic zinc ion in PepS, Glu532 acts as a nucleophile, and His654 is probably involved in the transition state stabilization. Asp538 and Asp596 can stablize the orientations of His531 and His535, and Arg660 can stablize the orientation of Asp596. These results help in understanding marine bacterial peptidases and organic nitrogen degradation. PMID:26779153

Characterization of a New M13 Metallopeptidase from Deep-Sea Shewanella sp. E525-6 and Mechanistic Insight into Its Catalysis.

PubMed

Yang, Jin-Yu; Wang, Peng; Li, Chun-Yang; Dong, Sheng; Song, Xiao-Yan; Zhang, Xi-Ying; Xie, Bin-Bin; Zhou, Bai-Cheng; Zhang, Yu-Zhong; Chen, Xiu-Lan

2015-01-01

Bacterial extracellular peptidases are important for bacterial nutrition and organic nitrogen degradation in the ocean. While many peptidases of the M13 family from terrestrial animals and bacteria are studied, there has been no report on M13 peptidases from marine bacteria. Here, we characterized an M13 peptidase, PepS, from the deep-sea sedimentary strain Shewanella sp. E525-6, and investigated its substrate specificity and catalytic mechanism. The gene pepS cloned from strain E525-6 contains 2085 bp and encodes an M13 metallopeptidase. PepS was expressed in Escherichia coli and purified. Among the characterized M13 peptidases, PepS shares the highest sequence identity (47%) with Zmp1 from Mycobacterium tuberculosis, indicating that PepS is a new member of the M13 family. PepS had the highest activity at 30°C and pH 8.0. It retained 15% activity at 0°C. Its half life at 40°C was only 4 min. These properties indicate that PepS is a cold-adapted enzyme. The smallest substrate for PepS is pentapeptide, and it is probably unable to cleave peptides of more than 30 residues. PepS prefers to hydrolyze peptide bonds with P1' hydrophobic residues. Structural and mutational analyses suggested that His531, His535 and Glu592 coordinate the catalytic zinc ion in PepS, Glu532 acts as a nucleophile, and His654 is probably involved in the transition state stabilization. Asp538 and Asp596 can stablize the orientations of His531 and His535, and Arg660 can stablize the orientation of Asp596. These results help in understanding marine bacterial peptidases and organic nitrogen degradation.

Development of species-specific hybridization probes for marine luminous bacteria by using in vitro DNA amplification.

PubMed Central

Wimpee, C F; Nadeau, T L; Nealson, K H

1991-01-01

By using two highly conserved region of the luxA gene as primers, polymerase chain reaction amplification methods were used to prepare species-specific probes against the luciferase gene from four major groups of marine luminous bacteria. Laboratory studies with test strains indicated that three of the four probes cross-reacted with themselves and with one or more of the other species at low stringencies but were specific for members of their own species at high stringencies. The fourth probe, generated from Vibrio harveyi DNA, cross-reacted with DNAs from two closely related species, V. orientalis and V. vulnificus. When nonluminous cultures were tested with the species-specific probes, no false-positive results were observed, even at low stringencies. Two field isolates were correctly identified as Photobacterium phosphoreum by using the species-specific hybridization probes at high stringency. A mixed probe (four different hybridization probes) used at low stringency gave positive results with all of the luminous bacteria tested, including the terrestrial species, Xenorhabdus luminescens, and the taxonomically distinct marine bacterial species Shewanella hanedai; minimal cross-hybridization with these species was seen at higher stringencies. Images PMID:1854194

Effects of Fab' fragments of specific egg yolk antibody (IgY-Fab') against Shewanella putrefaciens on the preservation of refrigerated turbot.

PubMed

Zhang, Qian; Lin, Hong; Sui, Jianxin; Wang, Jingxue; Cao, Limin

2015-01-01

In our previous studies the specific egg yolk antibody (IgY) against Shewanella putrefaciens (one of the specific spoilage organisms for marine products during aerobic chilling storage) demonstrated significant activity to prolong the shelf life of refrigerated fish. The exploitation of the antigen-binding fragment plus the hinge region (IgY-Fab') is now considered a promising method for improving the efficiency of such natural antimicrobial agents. The antimicrobial activity of IgY-Fab' against S. putrefaciens was investigated using refrigerated turbot as samples. By microbial, chemical and sensory tests, it was shown to be able to effectively inhibit bacterial growth and prolong the shelf life of samples, with an efficiency evaluated significantly higher than that of whole IgY with the same molarity. The interaction between IgY agents and S. putrefaciens cells was also investigated, and the IgY-Fab' showed a much greater ability to damage cell membranes than the whole IgY. Compared to whole IgY with the same molarity, IgY-Fab' demonstrated higher and more durable antimicrobial efficiency. Such a result was assumed to be closely related to its structural properties (such as the much lower molecular weight), which may enhance its ability to influence physiological activities of antigen bacteria, especially the property or/and structure of cell membranes. © 2014 Society of Chemical Industry.

Electrokinesis is a microbial behavior that requires extracellular electron transport

PubMed Central

Harris, H. W.; El-Naggar, M. Y.; Bretschger, O.; Ward, M. J.; Romine, M. F.; Obraztsova, A. Y.; Nealson, K. H.

2009-01-01

We report a previously undescribed bacterial behavior termed electrokinesis. This behavior was initially observed as a dramatic increase in cell swimming speed during reduction of solid MnO2 particles by the dissimilatory metal-reducing bacterium Shewanella oneidensis MR-1. The same behavioral response was observed when cells were exposed to small positive applied potentials at the working electrode of a microelectrochemical cell and could be tuned by adjusting the potential on the working electrode. Electrokinesis was found to be different from both chemotaxis and galvanotaxis but was absent in mutants defective in electron transport to solid metal oxides. Using in situ video microscopy and cell tracking algorithms, we have quantified the response for different strains of Shewanella and shown that the response correlates with current-generating capacity in microbial fuel cells. The electrokinetic response was only exhibited by a subpopulation of cells closest to the MnO2 particles or electrodes. In contrast, the addition of 1 mM 9,10-anthraquinone-2,6-disulfonic acid, a soluble electron shuttle, led to increases in motility in the entire population. Electrokinesis is defined as a behavioral response that requires functional extracellular electron transport and that is observed as an increase in cell swimming speeds and lengthened paths of motion that occur in the proximity of a redox active mineral surface or the working electrode of an electrochemical cell. PMID:20018675

Identities of epilithic hydrocarbon-utilizing diazotrophic bacteria from the Arabian Gulf Coasts, and their potential for oil bioremediation without nitrogen supplementation.

PubMed

Radwan, Samir; Mahmoud, Huda; Khanafer, Majida; Al-Habib, Aamar; Al-Hasan, Redha

2010-08-01

Gravel particles from four sites along the Arabian Gulf coast in autumn, winter, and spring were naturally colonized with microbial consortia containing between 7 and 400 × 10(2) cm(-2) of cultivable oil-utilizing bacteria. The 16S rRNA gene sequences of 70 representatives of oil-utilizing bacteria revealed that they were predominantly affiliated with the Gammaproteobacteria and the Actinobacteria. The Gammaproteobacteria comprised among others, the genera Pseudomonas, Pseudoalteromonas, Shewanella, Marinobacter, Psychrobacter, Idiomarina, Alcanivorax, Cobetia, and others. Actinobacteria comprised the genera Dietzia, Kocuria, Isoptericola, Rhodococcus, Microbacterium, and others. In autumn, Firmicutes members were isolated from bay and nonbay stations while Alphaproteobacteria were detected only during winter from Anjefa bay station. Fingerprinting by denaturing gradient gel electrophoresis of amplified 16S rRNA genes of whole microbial consortia confirmed the culture-based bacterial diversities in the various epilithons in various sites and seasons. Most of the representative oil-utilizing bacteria isolated from the epilithons were diazotrophic and could attenuate oil also in nitrogen-rich (7.9-62%) and nitrogen-free (4-54%) cultures, which, makes the microbial consortia suitable for oil bioremediation in situ, without need for nitrogen supplementation. This was confirmed in bench-scale experiments in which unfertilized oily seawater was bioremediated by epilithon-coated gravel particles.

Facilitated extracellular electron transfer of Shewanella loihica PV-4 by antimony-doped tin oxide nanoparticles as active microelectrodes.

PubMed

Zhang, Xiaojian; Liu, Huan; Wang, Jinrong; Ren, Guangyuan; Xie, Beizhen; Liu, Hong; Zhu, Ying; Jiang, Lei

2015-11-28

Dissimilatory metal reducing bacteria are capable of extracellular electron transfer (EET) to insoluble metal oxides as external electron acceptors for their anaerobic respiration, which is recognized as an important energy-conversion process in natural and engineered environments, such as in mineral cycling, bioremediation, and microbial fuel/electrolysis cells. However, the low EET efficiency remains one of the major bottlenecks for its practical application. We report firstly that the microbial current generated by Shewanella loihica PV-4 (S. loihica PV-4) could be greatly improved that is up to ca. 115 fold, by adding antimony-doped tin oxide (ATO) nanoparticles in the electrochemical reactor. The results demonstrate that the biocompatible, electrically conductive ATO nanoparticles acted as active microelectrodes could facilitate the formation of a cells/ATO composite biofilm and the reduction of the outer membrane c-type cytochromes (OM c-Cyts) that are beneficial for the electron transfer from cells to electrode. Meanwhile, a synergistic effect between the participation of OM c-Cyts and the accelerated EET mediated by cell-secreted flavins may play an important role for the enhanced current generation in the presence of ATO nanoparticles. Moreover, it is worth noting that the TCA cycle in S. loihica PV-4 cells is activated by adding ATO nanoparticles, even if the potential is poised at +0.2 V, thereby also improving the EET process. The results presented here may provide a simple and effective strategy to boost the EET of S. loihica PV-4 cells, which is conducive to providing potential applications in bioelectrochemical systems.

Phylogenentic and enzymatic characterization of psychrophilic and psychrotolerant marine bacteria belong to γ-Proteobacteria group isolated from the sub-Antarctic Beagle Channel, Argentina.

PubMed

Cristóbal, Héctor A; Benito, Juliana; Lovrich, Gustavo A; Abate, Carlos M

2015-05-01

The phylogenetic and physiological characteristics of cultivable-dependent approaches were determined to establish the diversity of marine bacteria associated with the intestines of benthonic organisms and seawater samples from the Argentina's Beagle Channel. A total of 737 isolates were classified as psychrophlic and psychrotolerant culturable marine bacteria. These cold-adapted microorganisms are capable of producing cold-active glycosyl hydrolases, such as β-glucosidases, celulases, β-galactosidases, xylanases, chitinases, and proteases. These enzymes could have potential biotechnological applications for use in low-temperature manufacturing processes. According to polymerase chain reaction-restriction fragment length polymorphism analysis of part of genes encoding 16S ribosomal DNA (ARDRA) and DNA gyrase subunit B (gyrB-RFLP), 11 operational taxonomic units (OTU) were identified and clustered in known genera using InfoStat software. The 50 isolates selected were sequenced based on near full sequence analysis of 16S rDNA and gyrB sequences and identified by their nearest neighbors ranging between 96 and 99 % of identities. Phylogenetic analyses using both genes allowed relationships between members of the cultured marine bacteria belonging to the γ-Proteobacteria group (Aeromonas, Halteromonas, Pseudomonas, Pseudoalteromonas, Shewanella, Serratia, Colwellia, Glacielocola, and Psychrobacter) to be evaluated. Our research reveals a high diversity of hydrolytic bacteria, and their products actuality has an industrial use in several bioprocesses at low-temperature manufacturing.

Bacterial survival following shock compression in the GigaPascal range

NASA Astrophysics Data System (ADS)

Hazael, Rachael; Fitzmaurice, Brianna C.; Foglia, Fabrizia; Appleby-Thomas, Gareth J.; McMillan, Paul F.

2017-09-01

The possibility that life can exist within previously unconsidered habitats is causing us to expand our understanding of potential planetary biospheres. Significant populations of living organisms have been identified at depths extending up to several km below the Earth's surface; whereas laboratory experiments have shown that microbial species can survive following exposure to GigaPascal (GPa) pressures. Understanding the degree to which simple organisms such as microbes survive such extreme pressurization under static compression conditions is being actively investigated. The survival of bacteria under dynamic shock compression is also of interest. Such studies are being partly driven to test the hypothesis of potential transport of biological organisms between planetary systems. Shock compression is also of interest for the potential modification and sterilization of foodstuffs and agricultural products. Here we report the survival of Shewanella oneidensis bacteria exposed to dynamic (shock) compression. The samples examined included: (a) a "wild type" (WT) strain and (b) a "pressure adapted" (PA) population obtained by culturing survivors from static compression experiments to 750 MPa. Following exposure to peak shock pressures of 1.5 and 2.5 GPa the proportion of survivors was established as the number of colony forming units (CFU) present after recovery to ambient conditions. The data were compared with previous results in which the same bacterial samples were exposed to static pressurization to the same pressures, for 15 minutes each. The results indicate that shock compression leads to survival of a significantly greater proportion of both WT and PA organisms. The significantly shorter duration of the pressure pulse during the shock experiments (2-3 μs) likely contributes to the increased survival of the microbial species. One reason for this can involve the crossover from deformable to rigid solid-like mechanical relaxational behavior that occurs for

Structure-function analyses reveal the molecular architecture and neutralization mechanism of a bacterial HEPN-MNT toxin-antitoxin system.

PubMed

Jia, Xuanyan; Yao, Jianyun; Gao, Zengqiang; Liu, Guangfeng; Dong, Yu-Hui; Wang, Xiaoxue; Zhang, Heng

2018-05-04

Toxin-antitoxin (TA) loci in bacteria are small genetic modules that regulate various cellular activities, including cell growth and death. The two-gene module encoding a HEPN (higher eukaryotes and prokaryotes nucleotide-binding) domain and a cognate MNT (minimal nucleotidyltransferase) domain have been predicted to represent a novel type II TA system prevalent in archaea and bacteria. However, the neutralization mechanism and cellular targets of the TA family remain unclear. The toxin SO_3166 having a HEPN domain and its cognate antitoxin SO_3165 with an MNT domain constitute a typical type II TA system that regulates cell motility and confers plasmid stability in the bacterium Shewanella oneidensis Here, we report the crystal structure and solution conformation of the SO_3166-SO_3165 pair, representing the first complex structures in this TA family. The structures revealed that SO_3165 and SO_3166 form a tight heterooctamer (at a 2:6 ratio), an organization that is very rare in other TA systems. We also observed that SO_3166 dimerization enables the formation of a deep cleft at the HEPN-domain interface harboring a composite R X 4-6H active site that functions as an RNA-cleaving RNase. SO_3165 bound SO_3166 mainly through its two α-helices (α2 and α4), functioning as molecular recognition elements. Moreover, their insertion into the SO_3166 cleft sterically blocked the R X 4-6H site or narrowed the cleft to inhibit RNA substrate binding. Structure-based mutagenesis confirmed the important roles of these α-helices in SO_3166 binding and inhibition. Our structure-function analysis provides first insights into the neutralization mechanism of the HEPN-MNT TA family. © 2018 Jia et al.

Polymicrobial bacteremia caused by Escherichia coli, Edwardsiella tarda, and Shewanella putrefaciens.

PubMed

Wang, I-Kuan; Lee, Ming-Hsun; Chen, Yu-Ming; Huang, Chiu-Ching

2004-09-01

Edwardsiella tarda, a member of Enterobacteriaceae, is found in freshwater and marine environments and in animals living in these environments. This bacterium is primarily associated with gastrointestinal diseases, and has been isolated from stool specimens obtained from persons with or without clinical infectious diseases. Shewanella putrefaciens, a saprophytic gram-negative rod, is rarely responsible for clinical syndromes in humans. Debilitated status and exposure to aquatic environments are the major predisposing factors for E. tarda or S. putrefaciens infection. A 61-year-old woman was febrile with diarrhea 8 hours after ingesting shark meat, and two sets of blood cultures grew Escherichia coli, E. tarda and S. putrefaciens at the same time. She was successfully treated with antibiotics. We present this rare case of polymicrobial bacteremia caused by E. coli, E. tarda and S. putrefaciens without underlying disease, which is the first found in Taiwan. This rare case of febrile diarrhea with consequent polymicrobial bacteremia emphasizes that attention should always be extended to these unusual pathogens.

Bacteria exploit a polymorphic instability of the flagellar filament to escape from traps.

PubMed

Kühn, Marco J; Schmidt, Felix K; Eckhardt, Bruno; Thormann, Kai M

2017-06-13

Many bacterial species swim by rotating single polar helical flagella. Depending on the direction of rotation, they can swim forward or backward and change directions to move along chemical gradients but also to navigate their obstructed natural environment in soils, sediments, or mucus. When they get stuck, they naturally try to back out, but they can also resort to a radically different flagellar mode, which we discovered here. Using high-speed microscopy, we monitored the swimming behavior of the monopolarly flagellated species Shewanella putrefaciens with fluorescently labeled flagellar filaments at an agarose-glass interface. We show that, when a cell gets stuck, the polar flagellar filament executes a polymorphic change into a spiral-like form that wraps around the cell body in a spiral-like fashion and enables the cell to escape by a screw-like backward motion. Microscopy and modeling suggest that this propagation mode is triggered by an instability of the flagellum under reversal of the rotation and the applied torque. The switch is reversible and bacteria that have escaped the trap can return to their normal swimming mode by another reversal of motor direction. The screw-type flagellar arrangement enables a unique mode of propagation and, given the large number of polarly flagellated bacteria, we expect it to be a common and widespread escape or motility mode in complex and structured environments.

CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

DOE PAGES

Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.; ...

2016-03-22

Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.

Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renslow, Ryan S.; Babauta, Jerome T.; Kuprat, Andrew P.

Electrochemically active biofilms have a unique form of respiration in which they utilize solid external materials as terminal electron acceptors for their metabolism. Currently, two primary mechanisms have been identified for long-range extracellular electron transfer (EET): a diffusion- and a conduction-based mechanism. Evidence in the literature suggests that some biofilms, particularly Shewanella oneidensis, produce the requisite components for both mechanisms. In this study, a generic model is presented that incorporates the diffusion- and the conduction-based mechanisms and allows electrochemically active biofilms to utilize both simultaneously. The model was applied to S. oneidensis and Geobacter sulfurreducens biofilms using experimentally generated datamore » found in the literature. Our simulation results show that 1) biofilms having both mechanisms available, especially if they can interact, may have a metabolic advantage over biofilms that can use only a single mechanism; 2) the thickness of G. sulfurreducens biofilms is likely not limited by conductivity; 3) accurate intrabiofilm diffusion coefficient values are critical for current generation predictions; and 4) the local biofilm potential and redox potential are two distinct parameters and cannot be assumed to have identical values. Finally, we determined that simulated cyclic and squarewave voltammetry based on our model are currently not capable of determining the specific percentages of extracellular electron transfer mechanisms in a biofilm. The developed model will be a critical tool for designing experiments to explain EET mechanisms.« less

An innovative miniature microbial fuel cell fabricated using photolithography.

PubMed

Chen, You-Peng; Zhao, Yue; Qiu, Ke-Qiang; Chu, Jian; Lu, Rui; Sun, Min; Liu, Xian-Wei; Sheng, Guo-Ping; Yu, Han-Qing; Chen, Jie; Li, Wen-Jie; Liu, Gang; Tian, Yang-Chao; Xiong, Ying

2011-02-15

Recently microbial fuel cells (MFCs) have attracted increasing interests in both environmental and energy fields. Among the various MFC configurations, miniature microbial fuel cell (mini-MFC) has a great potential for the application in medical, communication and other areas because of its miniature volume and high output power density. In this work, a 25-μL single-chamber mini-MFC was fabricated using the photolithography technique. The plate-shaped gold anodic electrode in the mini-MFC showed a higher electrochemical activity than the stripe-shaped one. A biofilm of Shewanella oneidensis MR-1 was formed on the surface of gold electrode in this micro-liter-scale MFCs. As a result, a maximum power density of 29 mW/m(2) and a maximum current density of 2148 mA/m(2) were achieved by this single-chamber mini-MFC. Copyright © 2010 Elsevier B.V. All rights reserved.

High Performance Reduction of H2O2 with an Electron Transport Decaheme Cytochrome on a Porous ITO Electrode

PubMed Central

2017-01-01

The decaheme cytochrome MtrC from Shewanella oneidensis MR-1 immobilized on an ITO electrode displays unprecedented H2O2 reduction activity. Although MtrC showed lower peroxidase activity in solution compared to horseradish peroxidase, the ten heme cofactors enable excellent electronic communication and a superior activity on the electrode surface. A hierarchical ITO electrode enabled optimal immobilization of MtrC and a high current density of 1 mA cm–2 at 0.4 V vs SHE could be obtained at pH 6.5 (Eonset = 0.72 V). UV–visible and Resonance Raman spectroelectrochemical studies suggest the formation of a high valent iron-oxo species as the catalytic intermediate. Our findings demonstrate the potential of multiheme cytochromes to catalyze technologically relevant reactions and establish MtrC as a new benchmark in biotechnological H2O2 reduction with scope for applications in fuel cells and biosensors. PMID:28221032

Connection between nitrogen and manganese cycles revealed by transcriptomic analysis in Shewanella algae C6G3

NASA Astrophysics Data System (ADS)

Michotey, V.; Aigle, A.; Armougom, F.; Mejean, V.; Guasco, S.; Bonin, P.

2016-02-01

In sedimentary systems, the repartition of terminal electron-accepting molecules is often stratified on a permanent or seasonal basis. Just below to oxic zone, the suboxic one is characterized by high concentrations of oxidized inorganic compounds such as nitrate, manganese oxides (MnIII/IV) and iron oxides that are in close vicinity. Several studies have reported unexpected anaerobic nitrite/nitrate production at the expense of ammonium mediated by MnIII/IV, however this transient processes is difficult to discern and poorly understood. In the frame of this study, genes organization of nitrate and MnIII/IV respiration was investigated in S.algae. Additional genes were identified in S. algae compare to S. oneidensis: genes coding for nitrate and nitrite reductase (napA-a and nrfA-2) and an OMC protein (mtrH). In contrast to S. oneidensis, an anaerobic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during growth with MnIII/IV, concomitantly with expression of nitrate/nitrite reductase genes (napA, nrfA, nrfA-2). Among the hypothesis explaining this data, the potential putative expression of unidentified gene able to perform ammonium oxidation was not observed on the global transcriptional level, however several signs of oxidative stress were detected and the existence of a secondary reaction generated by a putative oxidative s could not be excluded. Another option could be the action of reverse reaction by an enzyme such as NrfA or NrfA-2 due to the electron flow equilibrium. Whatever the electron acceptor (Nitrate/ MnIII/IV), the unexpected expression level of of omcA, mtrF, mtrH, mtrC was observed and peaked at the end of the exponential phase. Different expression patterns of the omc genes were observed depending on electron acceptor and growth phase. Only mtrF-2 gene was specifically expressed in Mn(III/IV) condition. Nitrate and Mn(III/IV) respirations seem connected at physiological as well as at transcriptional level

Culturable bacterial communities associated to Brazilian Oscarella species (Porifera: Homoscleromorpha) and their antagonistic interactions.

PubMed

Laport, Marinella Silva; Bauwens, Mathieu; de Oliveira Nunes, Suzanne; Willenz, Philippe; George, Isabelle; Muricy, Guilherme

2017-04-01

Sponges offer an excellent model to investigate invertebrate-microorganism interactions. Furthermore, bacteria associated with marine sponges represent a rich source of bioactive metabolites. The aim of this study was to characterize the bacteria inhabiting a genus of sponges, Oscarella, and their potentiality for antimicrobial production. Bacterial isolates were recovered from different Oscarella specimens, among which 337 were phylogenetically identified. The culturable community was dominated by Proteobacteria and Firmicutes, and Vibrio was the most frequently isolated genus, followed by Shewanella. When tested for antimicrobial production, bacteria of the 12 genera isolated were capable of producing antimicrobial substances. The majority of strains were involved in antagonistic interactions and inhibitory activities were also observed against bacteria of medical importance. It was more pronounced in some isolated genera (Acinetobacter, Bacillus, Photobacterium, Shewanella and Vibrio). These findings suggest that chemical antagonism could play a significant role in shaping bacterial communities within Oscarella, a genus classified as low-microbial abundance sponge. Moreover, the identified strains may contribute to the search for new sources of antimicrobial substances, an important strategy for developing therapies to treat infections caused by multidrug-resistant bacteria. This study was the first to investigate the diversity and antagonistic activity of bacteria isolated from Oscarella spp. It highlights the biotechnological potential of sponge-associated bacteria.

Assessing the potential of spectral induced polarization to detect in situ changes in iron reduction

NASA Astrophysics Data System (ADS)

Rosier, C. L.; Price, A.; Sharma, S.; Atekwana, E. A.

2016-12-01

The near surface geophysical technique Spectral Induced Polarization (SIP), provides promise as an effective method measuring in situ biofilm formation/development. Yet, potential mechanisms responsible for observed shifts in SIP response due to biofilm are not clearly understood. In order to address possible mechanisms we assessed the influence of Shewanella oneidensis (MR1) cell density (colony forming units; CFU), biofilm production (Bradford assay) and iron reduction metabolism (colorimetric assay) on SIP response. Laboratory measurements were collected over three months on columns packed with either iron-coated or iron-free sands and amended with artificial ground water and acetate in order to stimulate biofilm production and microbial iron reduction. Additionally, scanning electron microscopy (SEM) was used to confirm the presence of S. oneidensis cells and biofilm. Our results suggest that during early/initial stage (<30 days) of the iron-coated column incubations, both phase and imaginary conductivity response increased 4-fold as concentrations of reduced iron increased from 0-50 mM. In the later stages (>75 days) of column incubation, SIP measurements revealed that phase and imaginary conductivity responses decreased as the concentration of reduced iron decreased below 2.0 mM. In contrast, we observed only a moderate increase in phase and imaginary conductivity ( 30%) within iron-free columns as a result of increases in S. oneidensis cells (CFU 1.5 x 1011) and biofilm production (7.0 mg ml-1). SEM analysis confirmed the presence of biofilm and cells within both iron-coated and iron-free columns. We hypothesize that the production of microbial metabolic byproducts is a potential mechanism explaining large phase shits observed in previous studies ( 50 mrads) rather than the conductivity of cells or biofilm. Our findings provide support for the following: i) ratio of cells to biofilm production only moderately influences both phase and imaginary conductivity

Characterization of the microbial community composition and the distribution of Fe-metabolizing bacteria in a creek contaminated by acid mine drainage.

PubMed

Sun, Weimin; Xiao, Enzong; Krumins, Valdis; Dong, Yiran; Xiao, Tangfu; Ning, Zengping; Chen, Haiyan; Xiao, Qingxiang

2016-10-01

A small watershed heavily contaminated by long-term acid mine drainage (AMD) from an upstream abandoned coal mine was selected to study the microbial community developed in such extreme system. The watershed consists of AMD-contaminated creek, adjacent contaminated soils, and a small cascade aeration unit constructed downstream, which provide an excellent contaminated site to study the microbial response in diverse extreme AMD-polluted environments. The results showed that the innate microbial communities were dominated by acidophilic bacteria, especially acidophilic Fe-metabolizing bacteria, suggesting that Fe and pH are the primary environmental factors in governing the indigenous microbial communities. The distribution of Fe-metabolizing bacteria showed distinct site-specific patterns. A pronounced shift from diverse communities in the upstream to Proteobacteria-dominated communities in the downstream was observed in the ecosystem. This location-specific trend was more apparent at genus level. In the upstream samples (sampling sites just below the coal mining adit), a number of Fe(II)-oxidizing bacteria such as Alicyclobacillus spp., Metallibacterium spp., and Acidithrix spp. were dominant, while Halomonas spp. were the major Fe(II)-oxidizing bacteria observed in downstream samples. Additionally, Acidiphilium, an Fe(III)-reducing bacterium, was enriched in the upstream samples, while Shewanella spp. were the dominant Fe(III)-reducing bacteria in downstream samples. Further investigation using linear discriminant analysis (LDA) effect size (LEfSe), principal coordinate analysis (PCoA), and unweighted pair group method with arithmetic mean (UPGMA) clustering confirmed the difference of microbial communities between upstream and downstream samples. Canonical correspondence analysis (CCA) and Spearman's rank correlation indicate that total organic carbon (TOC) content is the primary environmental parameter in structuring the indigenous microbial communities

Quantification of the Genetic Expression of bgl-A, bgl, and CspA and Enzymatic Characterization of β-Glucosidases from Shewanella sp. G5.

PubMed

Cristóbal, Héctor Antonio; Poma, Hugo Ramiro; Abate, Carlos Mauricio; Rajal, Verónica Beatriz

2016-06-01

Shewanella sp. G5, a psychrotolerant marine bacterium, has a cold-shock protein (CspA) and three β-glucosidases, two of which were classified in the glycosyl hydrolase families 1 and 3 and are encoded by bgl-A and bgl genes, respectively. Shewanella sp. G5 was cultured on Luria-Bertani (LB) and Mineral Medium Brunner (MMB) media with glucose and cellobiose at various temperatures and pH 6 and 8. Relative quantification of the expression levels of all three genes was studied by real-time PCR with the comparative Ct method (2(-ΔΔCt)) using the gyrB housekeeping gene as a normalizer. Results showed that the genes had remarkably different genetic expression levels under the conditions evaluated, with increased expression of all genes obtained on MMB with cellobiose at 30 °C. Specific growth rate and specific β-glucosidase activity were also determined for all the culture conditions. Shewanella sp. G5 was able to grow on both media at 4 °C, showing the maximum specific growth rate on LB with cellobiose at 37 °C. The specific β-glucosidase activity obtained on MMB with cellobiose at 30 °C was 25 to 50 % higher than for all other conditions. At pH 8, relative activity was 34, 60, and 63 % higher at 30 °C than at 10 °C, with three peaks at 10, 25, and 37 °C on both media. Enzyme activity increased by 61 and 47 % in the presence of Ca(2+) and by 24 and 31 % in the presence of Mg(2+) on LB and MMB at 30 °C, respectively, but it was totally inhibited by Hg(2+), Cu(2+), and EDTA. Moreover, this activity was slightly decreased by SDS, Zn(2+), and DTT, all at 5 mM. Ethanol (14 % v/v) and glucose (100 mM) also reduced the activity by 63 and 60 %, respectively.

Plant Carbohydrate Scavenging through TonB-Dependent Receptors: A Feature Shared by Phytopathogenic and Aquatic Bacteria

PubMed Central

Boulanger, Alice; Lautier, Martine; Guynet, Catherine; Denancé, Nicolas; Vasse, Jacques

2007-01-01

TonB-dependent receptors (TBDRs) are outer membrane proteins mainly known for the active transport of iron siderophore complexes in Gram-negative bacteria. Analysis of the genome of the phytopathogenic bacterium Xanthomonas campestris pv. campestris (Xcc), predicts 72 TBDRs. Such an overrepresentation is common in Xanthomonas species but is limited to only a small number of bacteria. Here, we show that one Xcc TBDR transports sucrose with a very high affinity, suggesting that it might be a sucrose scavenger. This TBDR acts with an inner membrane transporter, an amylosucrase and a regulator to utilize sucrose, thus defining a new type of carbohydrate utilization locus, named CUT locus, involving a TBDR for the transport of substrate across the outer membrane. This sucrose CUT locus is required for full pathogenicity on Arabidopsis, showing its importance for the adaptation to host plants. A systematic analysis of Xcc TBDR genes and a genome context survey suggested that several Xcc TBDRs belong to other CUT loci involved in the utilization of various plant carbohydrates. Interestingly, several Xcc TBDRs and CUT loci are conserved in aquatic bacteria such as Caulobacter crescentus, Colwellia psychrerythraea, Saccharophagus degradans, Shewanella spp., Sphingomonas spp. or Pseudoalteromonas spp., which share the ability to degrade a wide variety of complex carbohydrates and display TBDR overrepresentation. We therefore propose that TBDR overrepresentation and the presence of CUT loci designate the ability to scavenge carbohydrates. Thus CUT loci, which seem to participate to the adaptation of phytopathogenic bacteria to their host plants, might also play a very important role in the biogeochemical cycling of plant-derived nutrients in marine environments. Moreover, the TBDRs and CUT loci identified in this study are clearly different from those characterized in the human gut symbiont Bacteroides thetaiotaomicron, which allow glycan foraging, suggesting a convergent

Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fredrickson, Jim K.; Daly, Michael J.

2006-06-01

Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR), desiccation, and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and verymore » low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR (http://cfyn.ifas.ufl.edu/radiation.pdf).« less

Development of a real-time PCR assay with an internal amplification control for detection of Gram-negative histamine-producing bacteria in fish.

PubMed

Bjornsdottir-Butler, Kristin; Jones, Jessica L; Benner, Ronald; Burkhardt, William

2011-05-01

Prompt detection of bacteria that contribute to scombrotoxin (histamine) fish poisoning can aid in the detection of potentially toxic fish products and prevent the occurrence of illness. We report development of the first real-time PCR method for rapid detection of Gram-negative histamine-producing bacteria (HPB) in fish. The real-time PCR assay was 100% inclusive for detecting high-histamine producing isolates and did not detect any of the low- or non-histamine producing isolates. The efficiency of the assay with/without internal amplification control ranged from 96-104% and in the presence of background flora and inhibitory matrices was 92/100% and 73-96%, respectively. This assay was used to detect HPB from naturally contaminated yellowfin tuna, bluefish, and false albacore samples. Photobacterium damselae (8), Plesiomonas shigelloides (2), Shewanella sp. (1), and Morganella morganii (1) were subsequently isolated from the real-time PCR positive fish samples. These results indicate that the real-time PCR assay developed in this study is a rapid and sensitive method for detecting high-HPB. The assay may be adapted for quantification of HPB, either directly or with an MPN-PCR method. Copyright © 2010. Published by Elsevier Ltd.

Phenazines and Other Redox-Active Antibiotics Promote Microbial Mineral Reduction

PubMed Central

Hernandez, Maria E.; Kappler, Andreas; Newman, Dianne K.

2004-01-01

Natural products with important therapeutic properties are known to be produced by a variety of soil bacteria, yet the ecological function of these compounds is not well understood. Here we show that phenazines and other redox-active antibiotics can promote microbial mineral reduction. Pseudomonas chlororaphis PCL1391, a root isolate that produces phenazine-1-carboxamide (PCN), is able to reductively dissolve poorly crystalline iron and manganese oxides, whereas a strain carrying a mutation in one of the phenazine-biosynthetic genes (phzB) is not; the addition of purified PCN restores this ability to the mutant strain. The small amount of PCN produced relative to the large amount of ferric iron reduced in cultures of P. chlororaphis implies that PCN is recycled multiple times; moreover, poorly crystalline iron (hydr)oxide can be reduced abiotically by reduced PCN. This ability suggests that PCN functions as an electron shuttle rather than an iron chelator, a finding that is consistent with the observation that dissolved ferric iron is undetectable in culture fluids. Multiple phenazines and the glycopeptidic antibiotic bleomycin can also stimulate mineral reduction by the dissimilatory iron-reducing bacterium Shewanella oneidensis MR1. Because diverse bacterial strains that cannot grow on iron can reduce phenazines, and because thermodynamic calculations suggest that phenazines have lower redox potentials than those of poorly crystalline iron (hydr)oxides in a range of relevant environmental pH (5 to 9), we suggest that natural products like phenazines may promote microbial mineral reduction in the environment. PMID:14766572

High-pressure-induced water penetration into 3-­isopropylmalate dehydrogenase

PubMed Central

Nagae, Takayuki; Kawamura, Takashi; Chavas, Leonard M. G.; Niwa, Ken; Hasegawa, Masashi; Kato, Chiaki; Watanabe, Nobuhisa

2012-01-01

Hydrostatic pressure induces structural changes in proteins, including denaturation, the mechanism of which has been attributed to water penetration into the protein interior. In this study, structures of 3-isopropylmalate dehydrogenase (IPMDH) from Shewanella oneidensis MR-1 were determined at about 2 Å resolution under pressures ranging from 0.1 to 650 MPa using a diamond anvil cell (DAC). Although most of the protein cavities are monotonically compressed as the pressure increases, the volume of one particular cavity at the dimer interface increases at pressures over 340 MPa. In parallel with this volume increase, water penetration into the cavity could be observed at pressures over 410 MPa. In addition, the generation of a new cleft on the molecular surface accompanied by water penetration could also be observed at pressures over 580 MPa. These water-penetration phenomena are considered to be initial steps in the pressure-denaturation process of IPMDH. PMID:22349232

Cell-secreted flavins bound to membrane cytochromes dictate electron transfer reactions to surfaces with diverse charge and pH.

PubMed

Okamoto, Akihiro; Kalathil, Shafeer; Deng, Xiao; Hashimoto, Kazuhito; Nakamura, Ryuhei; Nealson, Kenneth H

2014-07-11

The variety of solid surfaces to and from which microbes can deliver electrons by extracellular electron transport (EET) processes via outer-membrane c-type cytochromes (OM c-Cyts) expands the importance of microbial respiration in natural environments and industrial applications. Here, we demonstrate that the bifurcated EET pathway of OM c-Cyts sustains the diversity of the EET surface in Shewanella oneidensis MR-1 via specific binding with cell-secreted flavin mononucleotide (FMN) and riboflavin (RF). Microbial current production and whole-cell differential pulse voltammetry revealed that RF and FMN enhance EET as bound cofactors in a similar manner. Conversely, FMN and RF were clearly differentiated in the EET enhancement by gene-deletion of OM c-Cyts and the dependency of the electrode potential and pH. These results indicate that RF and FMN have specific binding sites in OM c-Cyts and highlight the potential roles of these flavin-cytochrome complexes in controlling the rate of electron transfer to surfaces with diverse potential and pH.

Stoichiometry of mercury-thiol complexes on bacterial cell envelopes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, Bhoopesh; Shoenfelt, Elizabeth; Yu, Qiang

We have examined the speciation of Hg(II) complexed with intact cell suspensions (1013 cells L- 1) of Bacillus subtilis, a common gram-positive soil bacterium, Shewanella oneidensis MR-1, a facultative gram-negative aquatic organism, and Geobacter sulfurreducens, a gram-negative anaerobic bacterium capable of Hg-methylation at Hg(II) loadings spanning four orders of magnitude (120 nM to 350 μM) at pH 5.5 (± 0.2). The coordination environments of Hg on bacterial cells were analyzed using synchrotron based X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) spectroscopy at the Hg LIII edge. The abundance of thiols on intact cells wasmore » determined by a fluorescence-spectroscopy based method using a soluble bromobimane, monobromo(trimethylammonio)bimane (qBBr) to block thiol sites, and potentiometric titrations of biomass with and without qBBr treatment. The chemical forms of S on intact bacterial cells were determined using S k-edge XANES spectroscopy.« less

Flavin redox bifurcation as a mechanism for controlling the direction of electron flow during extracellular electron transfer.

PubMed

Okamoto, Akihiro; Hashimoto, Kazuhito; Nealson, Kenneth H

2014-10-06

The iron-reducing bacterium Shewanella oneidensis MR-1 has a dual directional electronic conduit involving 40 heme redox centers in flavin-binding outer-membrane c-type cytochromes (OM c-Cyts). While the mechanism for electron export from the OM c-Cyts to an anode is well understood, how the redox centers in OM c-Cyts take electrons from a cathode has not been elucidated at the molecular level. Electrochemical analysis of live cells during switching from anodic to cathodic conditions showed that altering the direction of electron flow does not require gene expression or protein synthesis, but simply redox potential shift about 300 mV for a flavin cofactor interacting with the OM c-Cyts. That is, the redox bifurcation of the riboflavin cofactor in OM c-Cyts switches the direction of electron conduction in the biological conduit at the cell-electrode interface to drive bacterial metabolism as either anode or cathode catalysts. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analysis of Structural MtrC Models Based on Homology with the Crystal Structure of MtrF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Edwards, Marcus; Fredrickson, Jim K.; Zachara, John M.

2012-12-01

The outer-membrane decahaem cytochrome MtrC is part of the transmembrane MtrCAB complex required for mineral respiration by Shewanella oneidensis. MtrC has significant sequence similarity to the paralogous decahaem cytochrome MtrF, which has been structurally solved through X-ray crystallography. This now allows for homology-based models of MtrC to be generated. The structure of these MtrC homology models contain ten bis-histidine-co-ordinated c-type haems arranged in a staggered cross through a four-domain structure. This model is consistent with current spectroscopic data and shows that the areas around haem 5 and haem 10, at the termini of an octahaem chain, are likely to havemore » functions similar to those of the corresponding haems in MtrF. The electrostatic surfaces around haem 7, close to the β-barrels, are different in MtrF and MtrC, indicating that these haems may have different potentials and interact with substrates differently.« less

Characterization of microbial current production as a function of microbe-electrode-interaction.

PubMed

Dolch, Kerstin; Danzer, Joana; Kabbeck, Tobias; Bierer, Benedikt; Erben, Johannes; Förster, Andreas H; Maisch, Jan; Nick, Peter; Kerzenmacher, Sven; Gescher, Johannes

2014-04-01

Microbe-electrode-interactions are keys for microbial fuel cell technology. Nevertheless, standard measurement routines to analyze the interplay of microbial physiology and material characteristics have not been introduced yet. In this study, graphite anodes with varying surface properties were evaluated using pure cultures of Shewanella oneidensis and Geobacter sulfurreducens, as well as defined and undefined mixed cultures. The evaluation routine consisted of a galvanostatic period, a current sweep and an evaluation of population density. The results show that surface area correlates only to a certain extent with population density and anode performance. Furthermore, the study highlights a strain-specific microbe-electrode-interaction, which is affected by the introduction of another microorganism. Moreover, evidence is provided for the possibility of translating results from pure culture to undefined mixed species experiments. This is the first study on microbe-electrode-interaction that systematically integrates and compares electrochemical and biological data. Copyright © 2014 Elsevier Ltd. All rights reserved.

Metagenomic insights into the ecology and physiology of microbes in bioelectrochemical systems.

PubMed

Kouzuma, Atsushi; Ishii, Shun'ichi; Watanabe, Kazuya

2018-05-01

In bioelectrochemical systems (BESs), electrons are transferred between electrochemically active microbes (EAMs) and conductive materials, such as electrodes, via extracellular electron transfer (EET) pathways, and electrons thus transferred stimulate intracellular catabolic reactions. Catabolic and EET pathways have extensively been studied for several model EAMs, such as Shewanella oneidensis MR-1 and Geobacter sulfurreducens PCA, whereas it is also important to understand the ecophysiology of EAMs in naturally occurring microbiomes, such as those in anode biofilms in microbial fuel cells treating wastewater. Recent studies have exploited metagenomics and metatranscriptomics (meta-omics) approaches to characterize EAMs in BES-associated microbiomes. Here we review recent BES studies that used meta-omics approaches and show that these studies have discovered unexpected features of EAMs and deepened our understanding of functions and behaviors of microbes in BESs. It is desired that more studies will employ meta-omics approaches for advancing our knowledge on microbes in BESs. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effect of quorum sensing signals produced by seaweed-associated bacteria on carpospore liberation from Gracilaria dura

PubMed Central

Singh, Ravindra Pal; Baghel, Ravi S.; Reddy, C. R. K.; Jha, Bhavanath

2015-01-01

Epiphytic and endophytic bacteria associated with green macroalgae Ulva (U. fasciata and U. lactuca) and red macroalgae Gracilaria (G. corticata and G. dura) have been identified from three different seasons to evaluate the effect of quorum sensing (QS) molecules on carpospores liberation from Gracilaria dura. The bacterial isolates belonging to the orders Bacillales, Pseudomonadales, Alteromonadales, and Vibrionales were present in all seasons, whereas Actinomycetales and Enterobacteriales were confined to pre-monsoon and post-monsoon seasons, respectively. Among all the Gram-negative bacteria, seven isolates were found to produce different types of N-acyl homoserine lactones (AHLs). Interestingly, Shewanella algae produced five types of AHL: C4-HSL, HC4-HSL, C6-HSL, 3-oxo-C6-HSL, and 3-oxo-C12-HSL. Subsequently, the AHLs producing bacterial isolates were screened for carpospore liberation from G. dura and these isolates were found to positively induce carpospore liberation over the control. Also, observed that carpospore liberation increased significantly in C4- and C6-HSL treated cystocarps. Sodium dodecyl sulfate and native polyacrylamide gel electrophoresis of the total protein of the C4- and C6-HSL treated cystocarps showed two specific peptide bands of different molecular weights (50 kDa and 60 kDa) as compared to the control, confirming their indirect effect on carpospore liberation. PMID:25788899

Dissolution of Arsenic Minerals Mediated by Dissimilatory Arsenate Reducing Bacteria: Estimation of the Physiological Potential for Arsenic Mobilization

PubMed Central

Lukasz, Drewniak; Liwia, Rajpert; Aleksandra, Mantur; Aleksandra, Sklodowska

2014-01-01

The aim of this study was characterization of the isolated dissimilatory arsenate reducing bacteria in the context of their potential for arsenic removal from primary arsenic minerals through reductive dissolution. Four strains, Shewanella sp. OM1, Pseudomonas sp. OM2, Aeromonas sp. OM4, and Serratia sp. OM17, capable of anaerobic growth with As (V) reduction, were isolated from microbial mats from an ancient gold mine. All of the isolated strains: (i) produced siderophores that promote dissolution of minerals, (ii) were resistant to dissolved arsenic compounds, (iii) were able to use the dissolved arsenates as the terminal electron acceptor, and (iii) were able to use copper minerals containing arsenic minerals (e.g., enargite) as a respiratory substrate. Based on the results obtained in this study, we postulate that arsenic can be released from some As-bearing polymetallic minerals (such as copper ore concentrates or middlings) under reductive conditions by dissimilatory arsenate reducers in indirect processes. PMID:24724102

Dissolution of arsenic minerals mediated by dissimilatory arsenate reducing bacteria: estimation of the physiological potential for arsenic mobilization.

PubMed

Lukasz, Drewniak; Liwia, Rajpert; Aleksandra, Mantur; Aleksandra, Sklodowska

2014-01-01

The aim of this study was characterization of the isolated dissimilatory arsenate reducing bacteria in the context of their potential for arsenic removal from primary arsenic minerals through reductive dissolution. Four strains, Shewanella sp. OM1, Pseudomonas sp. OM2, Aeromonas sp. OM4, and Serratia sp. OM17, capable of anaerobic growth with As (V) reduction, were isolated from microbial mats from an ancient gold mine. All of the isolated strains: (i) produced siderophores that promote dissolution of minerals, (ii) were resistant to dissolved arsenic compounds, (iii) were able to use the dissolved arsenates as the terminal electron acceptor, and (iii) were able to use copper minerals containing arsenic minerals (e.g., enargite) as a respiratory substrate. Based on the results obtained in this study, we postulate that arsenic can be released from some As-bearing polymetallic minerals (such as copper ore concentrates or middlings) under reductive conditions by dissimilatory arsenate reducers in indirect processes.

Impact of Sodium Tungstate and Tungsten Alloys on the Growth of Selected Microorganisms with Environmental Significance

DTIC Science & Technology

2010-07-30

TUNGSTEN ALLOYS ON THE GROWTH OF SELECTED MICROORGANISMS WITH ENVIROMENTAL SIGNIFICANCE 5a. Contract Number: 5b. Grant Number: 5c. Program Element...lower tolerances. Interestingly, bacteria cultivated from the environment displayed only minor delays and reduction in growth relative to pure...settings where nutrients may be limited. 15. SUBJECT TERMS Tungsten, sodium tungstate, microbial growth , environmental microbiology, bacteria , Shewanella

Biological Recovery of Platinum Complexes from Diluted Aqueous Streams by Axenic Cultures

PubMed Central

Maes, Synthia; Props, Ruben; Fitts, Jeffrey P.; De Smet, Rebecca; Vanhaecke, Frank; Boon, Nico; Hennebel, Tom

2017-01-01

The widespread use of platinum in high-tech and catalytic applications has led to the production of diverse Pt loaded wastewaters. Effective recovery strategies are needed for the treatment of low concentrated waste streams to prevent pollution and to stimulate recovery of this precious resource. The biological recovery of five common environmental Pt-complexes was studied under acidic conditions; the chloro-complexes PtCl42- and PtCl62-, the amine-complex Pt(NH3)4Cl2 and the pharmaceutical complexes cisplatin and carboplatin. Five bacterial species were screened on their platinum recovery potential; the Gram-negative species Shewanella oneidensis MR-1, Cupriavidus metallidurans CH34, Geobacter metallireducens, and Pseudomonas stutzeri, and the Gram-positive species Bacillus toyonensis. Overall, PtCl42- and PtCl62- were completely recovered by all bacterial species while only S. oneidensis and C. metallidurans were able to recover cisplatin quantitatively (99%), all in the presence of H2 as electron donor at pH 2. Carboplatin was only partly recovered (max. 25% at pH 7), whereas no recovery was observed in the case of the Pt-tetraamine complex. Transmission electron microscopy (TEM) revealed the presence of both intra- and extracellular platinum particles. Flow cytometry based microbial viability assessment demonstrated the decrease in number of intact bacterial cells during platinum reduction and indicated C. metallidurans to be the most resistant species. This study showed the effective and complete biological recovery of three common Pt-complexes, and estimated the fate and transport of the Pt-complexes in wastewater treatment plants and the natural environment. PMID:28046131

Biological Recovery of Platinum Complexes from Diluted Aqueous Streams by Axenic Cultures.

PubMed

Maes, Synthia; Props, Ruben; Fitts, Jeffrey P; De Smet, Rebecca; Vanhaecke, Frank; Boon, Nico; Hennebel, Tom

2017-01-01

The widespread use of platinum in high-tech and catalytic applications has led to the production of diverse Pt loaded wastewaters. Effective recovery strategies are needed for the treatment of low concentrated waste streams to prevent pollution and to stimulate recovery of this precious resource. The biological recovery of five common environmental Pt-complexes was studied under acidic conditions; the chloro-complexes PtCl42- and PtCl62-, the amine-complex Pt(NH3)4Cl2 and the pharmaceutical complexes cisplatin and carboplatin. Five bacterial species were screened on their platinum recovery potential; the Gram-negative species Shewanella oneidensis MR-1, Cupriavidus metallidurans CH34, Geobacter metallireducens, and Pseudomonas stutzeri, and the Gram-positive species Bacillus toyonensis. Overall, PtCl42- and PtCl62- were completely recovered by all bacterial species while only S. oneidensis and C. metallidurans were able to recover cisplatin quantitatively (99%), all in the presence of H2 as electron donor at pH 2. Carboplatin was only partly recovered (max. 25% at pH 7), whereas no recovery was observed in the case of the Pt-tetraamine complex. Transmission electron microscopy (TEM) revealed the presence of both intra- and extracellular platinum particles. Flow cytometry based microbial viability assessment demonstrated the decrease in number of intact bacterial cells during platinum reduction and indicated C. metallidurans to be the most resistant species. This study showed the effective and complete biological recovery of three common Pt-complexes, and estimated the fate and transport of the Pt-complexes in wastewater treatment plants and the natural environment.

A freshwater bacterial strain, Shewanella sp. Lzh-2, isolated from Lake Taihu and its two algicidal active substances, hexahydropyrrolo[1,2-a]pyrazine-1,4-dione and 2, 3-indolinedione.

PubMed

Li, Zhenghua; Lin, Shengqin; Liu, Xianglong; Tan, Jing; Pan, Jianliang; Yang, Hong

2014-05-01

Cyanobacterial blooms have become a serious problem in Lake Taihu during the last 20 years, and Microcystis aeruginosa and Synechococcus sp. are the two dominant species in cyanobacterial blooms of Lake Taihu. A freshwater bacterial strain, Shewanella sp. Lzh-2, with strong algicidal properties against harmful cyanobacteria was isolated from Lake Taihu. Two substances with algicidal activity secreted extracellularly by Shewanella sp. Lzh-2, S-2A and S-2B, were purified from the bacterial culture of strain Lzh-2 using ethyl acetate extraction, column chromatography, and high performance liquid chromatography (HPLC) in turn. The substances S-2A and S-2B were identified as hexahydropyrrolo[1,2-a]pyrazine-1,4-dione and 2, 3-indolinedione (isatin), respectively, based on liquid chromatography-mass spectrometry (LC-MS), gas chromatography-mass spectrometry (GC-MS), and hydrogen-nuclear magnetic resonance (H-NMR) analyses, making this the first report of their algicidal activity toward cyanobacteria. S-2A (hexahydropyrrolo[1,2-a]pyrazine-1,4-dione) had no algicidal effects against Synechococcus sp. BN60, but had a high level of algicidal activity against M. aeruginosa 9110. The LD50 value of S-2A against M. aeruginosa 9110 was 5.7 μg/ml. S-2B (2, 3-indolinedione) showed a potent algicidal effect against both M. aeruginosa 9110 and Synechococcus sp. BN60, and the LD50 value of S-2B against M. aeruginosa 9110 and Synechococcus sp. BN60 was 12.5 and 34.2 μg/ml, respectively. Obvious morphological changes in M. aeruginosa 9110 and Synechococcus sp. BN60 were observed after they were exposed to S-2A (or S-2B) for 24 h. Approximately, the algicidal activity, the concentration of S-2A and S-2B, and the cell density of Lzh-2 were positively related to each other during the cocultivation process. Overall, these findings increase our knowledge about algicidal substances secreted by algicidal bacteria and indicate that strain Lzh-2 and its two algicidal substances have the

The acid-tolerant L-arabinose isomerase from the mesophilic Shewanella sp. ANA-3 is highly active at low temperatures

PubMed Central

2011-01-01

Background L-arabinose isomerases catalyse the isomerization of L-arabinose into L-ribulose at insight biological systems. At industrial scale of this enzyme is used for the bioconversion of D-galactose into D-tagatose which has many applications in pharmaceutical and agro-food industries. The isomerization reaction is thermodynamically equilibrated, and therefore the bioconversion rates is shifted towards tagatose when the temperature is increased. Moreover, to prevent secondary reactions it will be of interest to operate at low pH. The profitability of this D-tagatose production process is mainly related to the use of lactose as cheaper raw material. In many dairy products it will be interesting to produce D-tagatose during storage. This requires an efficient L-arabinose isomerase acting at low temperature and pH values. Results The gene encoding the L-arabinose isomerase from Shewanella sp. ANA-3 was cloned and overexpressed in Escherichia coli. The purified protein has a tetrameric arrangement composed by four identical 55 kDa subunits. The biochemical characterization of this enzyme showed that it was distinguishable by its maximal activity at low temperatures comprised between 15-35°C. Interestingly, this biocatalyst preserves more than 85% of its activity in a broad range of temperatures from 4.0 to 45°C. Shewanella sp. ANA-3 L-arabinose isomerase was also optimally active at pH 5.5-6.5 and maintained over 80% of its activity at large pH values from 4.0 to 8.5. Furthermore, this enzyme exhibited a weak requirement for metallic ions for its activity evaluated at 0.6 mM Mn2+. Stability studies showed that this protein is highly stable mainly at low temperature and pH values. Remarkably, T268K mutation clearly enhances the enzyme stability at low pH values. Use of this L-arabinose isomerase for D-tagatose production allows the achievement of attractive bioconversion rates of 16% at 4°C and 34% at 35°C. Conclusions Here we reported the purification and the

Plutonium Oxidation State Distribution under Aerobic and Anaerobic Subsurface Conditions for Metal-Reducing Bacteria

NASA Astrophysics Data System (ADS)

Reed, D. T.; Swanson, J.; Khaing, H.; Deo, R.; Rittmann, B.

2009-12-01

The fate and potential mobility of plutonium in the subsurface is receiving increased attention as the DOE looks to cleanup the many legacy nuclear waste sites and associated subsurface contamination. Plutonium is the near-surface contaminant of concern at several DOE sites and continues to be the contaminant of concern for the permanent disposal of nuclear waste. The mobility of plutonium is highly dependent on its redox distribution at its contamination source and along its potential migration pathways. This redox distribution is often controlled, especially in the near-surface where organic/inorganic contaminants often coexist, by the direct and indirect effects of microbial activity. The redox distribution of plutonium in the presence of facultative metal reducing bacteria (specifically Shewanella and Geobacter species) was established in a concurrent experimental and modeling study under aerobic and anaerobic conditions. Pu(VI), although relatively soluble under oxidizing conditions at near-neutral pH, does not persist under a wide range of the oxic and anoxic conditions investigated in microbiologically active systems. Pu(V) complexes, which exhibit high chemical toxicity towards microorganisms, are relatively stable under oxic conditions but are reduced by metal reducing bacteria under anaerobic conditions. These facultative metal-reducing bacteria led to the rapid reduction of higher valent plutonium to form Pu(III/IV) species depending on nature of the starting plutonium species and chelating agents present in solution. Redox cycling of these lower oxidation states is likely a critical step in the formation of pseudo colloids that may lead to long-range subsurface transport. The CCBATCH biogeochemical model is used to explain the redox mechanisms and final speciation of the plutonium oxidation state distributions observed. These results for microbiologically active systems are interpreted in the context of their importance in defining the overall migration

Physiology and enzymology involved in denitrification by Shewanella putrefaciens

NASA Technical Reports Server (NTRS)

Krause, B.; Nealson, K. H.

1997-01-01

Nitrate reduction to N2O was investigated in batch cultures of Shewanella putrefaciens MR-1, MR-4, and MR-7. All three strains reduced nitrate to nitrite to N2O, and this reduction was coupled to growth, whereas ammonium accumulation was very low (0 to 1 micromol liter-1). All S. putrefaciens isolates were also capable of reducing nitrate aerobically; under anaerobic conditions, nitrite levels were three- to sixfold higher than those found under oxic conditions. Nitrate reductase activities (31 to 60 micromol of nitrite min-1 mg of protein-1) detected in intact cells of S. putrefaciens were equal to or higher than those seen in Escherichia coli LE 392. Km values for nitrate reduction ranged from 12 mM for MR-1 to 1.3 mM for MR-4 with benzyl viologen as an artifical electron donor. Nitrate and nitrite reductase activities in cell-free preparations were demonstrated in native gels by using reduced benzyl viologen. Detergent treatment of crude and membrane extracts suggested that the nitrate reductases of MR-1 and MR-4 are membrane bound. When the nitrate reductase in MR-1 was partially purified, three subunits (90, 70, and 55 kDa) were detected in denaturing gels. The nitrite reductase of MR-1 is also membrane bound and appeared as a 60-kDa band in sodium dodecyl sulfate-polyacrylamide gels after partial purification.

Identification and characterization of a highly variable region in mitochondrial genomes of fusarium species and analysis of power generation from microbial fuel cells

NASA Astrophysics Data System (ADS)

Hamzah, Haider Mousa

In the microbial fuel cell (MFC) project, power generation from Shewanella oneidensis MR-1 was analyzed looking for a novel system for both energy generation and sustainability. The results suggest the possibility of generating electricity from different organic substances, which include agricultural and industrial by-products. Shewanella oneidensis MR-1 generates usable electrons at 30°C using both submerged and solid state cultures. In the MFC biocathode experiment, most of the CO2 generated at the anodic chamber was converted into bicarbonate due the activity of carbonic anhydrase (CA) of the Gluconobacter sp.33 strain. These findings demonstrate the possibility of generation of electricity while at the same time allowing the biomimetic sequestration of CO2 using bacterial CA. In the mitochondrial genomes project, the filamentous fungal species Fusarium oxysporum was used as a model. This species causes wilt of several important agricultural crops. A previous study revealed that a highly variable region (HVR) in the mitochondrial DNA (mtDNA) of three species of Fusarium contained a large, variable unidentified open reading frame (LV-uORF). Using specific primers for two regions of the LV-uORF, six strains were found to contain the ORF by PCR and database searches identified 18 other strains outside of the Fusarium oxysporum species complex. The LV-uORF was also identified in three isolates of the F. oxysporum species complex. Interestingly, several F. oxysporum isolates lack the LV-uORF and instead contain 13 ORFs in the HVR, nine of which are unidentified. The high GC content and codon usage of the LV-uORF indicate that it did not co-evolve with other mt genes and was horizontally acquired and was introduced to the Fusarium lineage prior to speciation. The nonsynonymous/synonymous (dN/dS) ratio of the LV-uORFs (0.43) suggests it is under purifying selection and the putative polypeptide is predicted to be located in the mitochondrial membrane. Growth assays

Electrochemically Active Soluble Mediators from Shewanella oneidensis: Relevance to Microbial Fuel Cells and Extracellular Electron Transfer

DTIC Science & Technology

2008-05-01

A second approach is the use of soluble mediators such as, quinones, phenazines , and riboflavin, which are able to shuttle electrons from the cell...done using the equivalent graphite felt or graphite felt coated with platinum nanoparticles . Fuel cell chambers were separated using a gas-permeable

One Enzyme, Three Metabolites: Shewanella algae Controls Siderophore Production via the Cellular Substrate Pool.

PubMed

Rütschlin, Sina; Gunesch, Sandra; Böttcher, Thomas

2017-05-18

Shewanella algae B516 produces avaroferrin, an asymmetric hydroxamate siderophore, which has been shown to inhibit swarming motility of Vibrio alginolyticus. We aimed to elucidate the biosynthesis of this siderophore and to investigate how S. algae coordinates the production of avaroferrin and its two symmetric counterparts. We reconstituted the reaction in vitro with the main enzyme AvbD and the putative biosynthetic precursors, and demonstrate that multispecificity of this enzyme results in the production of all three cyclic hydroxamate siderophores that were previously isolated as natural products from S. algae. Surprisingly, purified AvbD exhibited a clear preference for the larger cadaverine-derived substrate. In live cells, however, siderophore ratios are maximized toward avaroferrin production, and we demonstrate that these siderophore ratios are the result of a regulation on substrate pool level, which may allow rapid evolutionary adaptation to environmental changes. Our results thereby give insights into a unique evolutionary strategy toward metabolite diversity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparative systems biology across an evolutionary gradient within the Shewanella genus.

PubMed

Konstantinidis, Konstantinos T; Serres, Margrethe H; Romine, Margaret F; Rodrigues, Jorge L M; Auchtung, Jennifer; McCue, Lee-Ann; Lipton, Mary S; Obraztsova, Anna; Giometti, Carol S; Nealson, Kenneth H; Fredrickson, James K; Tiedje, James M

2009-09-15

To what extent genotypic differences translate to phenotypic variation remains a poorly understood issue of paramount importance for several cornerstone concepts of microbiology including the species definition. Here, we take advantage of the completed genomic sequences, expressed proteomic profiles, and physiological studies of 10 closely related Shewanella strains and species to provide quantitative insights into this issue. Our analyses revealed that, despite extensive horizontal gene transfer within these genomes, the genotypic and phenotypic similarities among the organisms were generally predictable from their evolutionary relatedness. The power of the predictions depended on the degree of ecological specialization of the organisms evaluated. Using the gradient of evolutionary relatedness formed by these genomes, we were able to partly isolate the effect of ecology from that of evolutionary divergence and to rank the different cellular functions in terms of their rates of evolution. Our ranking also revealed that whole-cell protein expression differences among these organisms, when the organisms were grown under identical conditions, were relatively larger than differences at the genome level, suggesting that similarity in gene regulation and expression should constitute another important parameter for (new) species description. Collectively, our results provide important new information toward beginning a systems-level understanding of bacterial species and genera.

A new methodology to assess antimicrobial resistance of bacteria in coastal waters; pilot study in a Mediterranean hydrosystem

NASA Astrophysics Data System (ADS)

Almakki, Ayad; Estèves, Kevin; Vanhove, Audrey S.; Mosser, Thomas; Aujoulat, Fabien; Marchandin, Hélène; Toubiana, Mylène; Monfort, Patrick; Jumas-Bilak, Estelle; Licznar-Fajardo, Patricia

2017-10-01

The global resistome of coastal waters has been less studied than that of other waters, including marine ones. Here we develop an original method for characterizing the antimicrobial resistance of bacterial communities in coastal waters. The method combines the determination of a new parameter, the community Inhibitory Concentration (c-IC) of antibiotics (ATBs), and the description of the taxonomic richness of the resistant bacteria. We test the method in a Mediterranean hydrosystem, in the Montpellier region, France. Three types of waters are analyzed: near coastal river waters (Lez), lagoon brackish waters (Mauguio), and lake freshwaters (Salagou). Bacterial communities are grown in vitro in various conditions of temperature, salinity, and ATB concentrations. From these experiments, we determine the concentrations of ATB that decrease the bacterial community abundance by 50% (c-IC50) and by 90% (c-IC90). In parallel, we determine the taxonomic repertory of the resistant growing bacteria communities (repertory of Operational Taxonomic Units [OTU]). Temperature and salinity influence the abundance of the cultivable bacteria in presence of ATBs and hence the c-ICs. Very low ATB concentrations can decrease the bacterial abundance significantly. Beside a few ubiquitous genera (Bacillus, Pseudomonas, Shewanella, Vibrio), most resistant OTUs are specific of a type of water. In brackish water, resistant OTUs are more diverse and their community structure less vulnerable to ATBs than those in freshwater. We anticipate that c-IC measurement combined with taxonomic description can be applied to any littoral region to characterize the resistant bacterial communities in the coastal waters. This would help us to evaluate the vulnerability of aquatic ecosystems to antimicrobial pressure.

Flavin binding to the deca-heme cytochrome MtrC: Insights from computational molecular simulation

DOE PAGES

Breuer, Marian; Rosso, Kevin  M.; Blumberger, Jochen

2015-12-15

Here, certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as “extracellular respiration”. Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrCmore » from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (K d) = 490 μM, in good agreement with recent experimental estimates, K d = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration.« less

Uranium speciation and stability after reductive immobilization in aquifer sediments

NASA Astrophysics Data System (ADS)

Sharp, Jonathan O.; Lezama-Pacheco, Juan S.; Schofield, Eleanor J.; Junier, Pilar; Ulrich, Kai-Uwe; Chinni, Satya; Veeramani, Harish; Margot-Roquier, Camille; Webb, Samuel M.; Tebo, Bradley M.; Giammar, Daniel E.; Bargar, John R.; Bernier-Latmani, Rizlan

2011-11-01

It has generally been assumed that the bioreduction of hexavalent uranium in groundwater systems will result in the precipitation of immobile uraninite (UO 2). In order to explore the form and stability of uranium immobilized under these conditions, we introduced lactate (15 mM for 3 months) into flow-through columns containing sediments derived from a former uranium-processing site at Old Rifle, CO. This resulted in metal-reducing conditions as evidenced by concurrent uranium uptake and iron release. Despite initial augmentation with Shewanella oneidensis, bacteria belonging to the phylum Firmicutes dominated the biostimulated columns. The immobilization of uranium (˜1 mmol U per kg sediment) enabled analysis by X-ray absorption spectroscopy (XAS). Tetravalent uranium associated with these sediments did not have spectroscopic signatures representative of U-U shells or crystalline UO 2. Analysis by microfocused XAS revealed concentrated micrometer regions of solid U(IV) that had spectroscopic signatures consistent with bulk analyses and a poor proximal correlation (μm scale resolution) between U and Fe. A plausible explanation, supported by biogeochemical conditions and spectral interpretations, is uranium association with phosphoryl moieties found in biomass; hence implicating direct enzymatic uranium reduction. After the immobilization phase, two months of in situ exposure to oxic influent did not result in substantial uranium remobilization. Ex situ flow-through experiments demonstrated more rapid uranium mobilization than observed in column oxidation studies and indicated that sediment-associated U(IV) is more mobile than biogenic UO 2. This work suggests that in situ uranium bioimmobilization studies and subsurface modeling parameters should be expanded to account for non-uraninite U(IV) species associated with biomass.

Sulfur-Mediated Electron Shuttling Sustains Microbial Long-Distance Extracellular Electron Transfer with the Aid of Metallic Iron Sulfides.

PubMed

Kondo, Katsuhito; Okamoto, Akihiro; Hashimoto, Kazuhito; Nakamura, Ryuhei

2015-07-07

In addition to serving as an energy source for microbial growth, iron sulfides are proposed to act as naturally occurring electrical wires that mediate long-distance extracellular electron transfer (EET) and bridge spatially discrete redox environments. These hypothetical EET reactions stand on the abilities of microbes to use the interfacial electrochemistry of metallic/semiconductive iron sulfides to maintain metabolisms; however, the mechanisms of these phenomena remain unexplored. To obtain insight into EET to iron sulfides, we monitored EET at the interface between Shewanella oneidensis MR-1 cells and biomineralized iron sulfides in an electrochemical cell. Respiratory current steeply increased with the concomitant formation of poorly crystalline mackinawite (FeS) minerals, indicating that S. oneidensis has the ability to exploit extracellularly formed metallic FeS for long-distance EET. Deletion of major proteins of the metal-reduction (Mtr) pathway (OmcA, MtrC, CymA, and PilD) caused only subtle effects on the EET efficiency, a finding that sharply contrasts the majority of studies that report that the Mtr pathway is indispensable for the reduction of metal oxides and electrodes. The gene expression analyses of polysulfide and thiosulfate reductase suggest the existence of a sulfur-mediated electron-shuttling mechanism by which HS(-) ions and water-soluble polysulfides (HS(n)(-), where n ≥ 2) generated in the periplasmic space deliver electrons from cellular metabolic processes to cell surface-associated FeS. The finding of this Mtr-independent pathway indicates that polysulfide reductases complement the function of outer-membrane cytochromes in EET reactions and, thus, significantly expand the number of microbial species potentially capable of long-distance EET in sulfur-rich anoxic environments.

Monitoring microbial growth and activity using spectral induced polarization and low-field nuclear magnetic resonance

NASA Astrophysics Data System (ADS)

Zhang, Chi; Keating, Kristina; Revil, Andre

2015-04-01

Microbes and microbial activities in the Earth's subsurface play a significant role in shaping subsurface environments and are involved in environmental applications such as remediation of contaminants in groundwater and oil fields biodegradation. Stimulated microbial growth in such applications could cause wide variety of changes of physical/chemical properties in the subsurface. It is critical to monitor and determine the fate and transportation of microorganisms in the subsurface during such applications. Recent geophysical studies demonstrate the potential of two innovative techniques, spectral induced polarization (SIP) and low-field nuclear magnetic resonance (NMR), for monitoring microbial growth and activities in porous media. The SIP measures complex dielectric properties of porous media at low frequencies of exciting electric field, and NMR studies the porous structure of geologic media and characterizes fluids subsurface. In this laboratory study, we examined both SIP and NMR responses from bacterial growth suspension as well as suspension mixed with silica sands. We focus on the direct contribution of microbes to the SIP and NMR signals in the absence of biofilm formation or biomineralization. We used Zymomonas mobilis and Shewanella oneidensis (MR-1) for SIP and NMR measurements, respectively. The SIP measurements were collected over the frequency range of 0.1 - 1 kHz on Z. mobilis growth suspension and suspension saturated sands at different cell densities. SIP data show two distinct peaks in imaginary conductivity spectra, and both imaginary and real conductivities increased as microbial density increased. NMR data were collected using both CPMG pulse sequence and D-T2 mapping to determine the T2-distribution and diffusion properties on S. oneidensis suspension, pellets (live and dead), and suspension mixed with silica sands. NMR data show a decrease in the T2-distribution in S. oneidensis suspension saturated sands as microbial density increase. A

Functional characterization of Gram-negative bacteria from different genera as multiplex cadmium biosensors.

PubMed

Bereza-Malcolm, Lara; Aracic, Sanja; Kannan, Ruban; Mann, Gülay; Franks, Ashley E

2017-08-15

Widespread presence of cadmium in soil and water systems is a consequence of industrial and agricultural processes. Subsequent accumulation of cadmium in food and drinking water can result in accidental consumption of dangerous concentrations. As such, cadmium environmental contamination poses a significant threat to human health. Development of microbial biosensors, as a novel alternative method for in situ cadmium detection, may reduce human exposure by complementing traditional analytical methods. In this study, a multiplex cadmium biosensing construct was assembled by cloning a single-output cadmium biosensor element, cadRgfp, and a constitutively expressed mrfp1 onto a broad-host range vector. Incorporation of the duplex fluorescent output [green and red fluorescence proteins] allowed measurement of biosensor functionality and viability. The biosensor construct was tested in several Gram-negative bacteria including Pseudomonas, Shewanella and Enterobacter. The multiplex cadmium biosensors were responsive to cadmium concentrations ranging from 0.01 to 10µgml -1 , as well as several other heavy metals, including arsenic, mercury and lead at similar concentrations. The biosensors were also responsive within 20-40min following exposure to 3µgml -1 cadmium. This study highlights the importance of testing biosensor constructs, developed using synthetic biology principles, in different bacterial genera. Copyright © 2017 Elsevier B.V. All rights reserved.

The Detoxification and Degradation of Benzothiazole from the Wastewater in Microbial Electrolysis Cells

PubMed Central

Liu, Xianshu; Ding, Jie; Ren, Nanqi; Tong, Qingyue; Zhang, Luyan

2016-01-01

In this study, the high-production-volume chemical benzothiazole (BTH) from synthetic water was fully degraded into less toxic intermediates of simple organic acids using an up-flow internal circulation microbial electrolysis reactor (UICMER) under the hydraulic retention time (HRT) of 24 h. The bioelectrochemical system was operated at 25 ± 2 °C and continuous-flow mode. The BTH loading rate varied during experiments from 20 g·m−3·day−1 to 110 g·m−3·day−1. BTH and soluble COD (Chemical Oxygen Demand) removal efficiency reached 80% to 90% under all BTH loading rates. Bioluminescence based Shewanella oneidensis strain MR-1 ecotoxicity testing demonstrated that toxicity was largely decreased compared to the BTH wastewater influent and effluent of two control experiments. The results indicated that MEC (Microbial Electrolysis Cell) was useful and reliable for improving BTH wastewater treatment efficiency, enabling the microbiological reactor to more easily respond to the requirements of higher loading rate, which is meaningful for economic and efficient operation in future scale-up. PMID:27999421

The Detoxification and Degradation of Benzothiazole from the Wastewater in Microbial Electrolysis Cells.

PubMed

Liu, Xianshu; Ding, Jie; Ren, Nanqi; Tong, Qingyue; Zhang, Luyan

2016-12-20

In this study, the high-production-volume chemical benzothiazole (BTH) from synthetic water was fully degraded into less toxic intermediates of simple organic acids using an up-flow internal circulation microbial electrolysis reactor (UICMER) under the hydraulic retention time (HRT) of 24 h. The bioelectrochemical system was operated at 25 ± 2 °C and continuous-flow mode. The BTH loading rate varied during experiments from 20 g·m -3 ·day -1 to 110 g·m -3 ·day -1 . BTH and soluble COD (Chemical Oxygen Demand) removal efficiency reached 80% to 90% under all BTH loading rates. Bioluminescence based Shewanella oneidensis strain MR-1 ecotoxicity testing demonstrated that toxicity was largely decreased compared to the BTH wastewater influent and effluent of two control experiments. The results indicated that MEC (Microbial Electrolysis Cell) was useful and reliable for improving BTH wastewater treatment efficiency, enabling the microbiological reactor to more easily respond to the requirements of higher loading rate, which is meaningful for economic and efficient operation in future scale-up.

Remediation of trichloroethylene by bio-precipitated and encapsulated palladium nanoparticles in a fixed bed reactor.

PubMed

Hennebel, Tom; Verhagen, Pieter; Simoen, Henri; De Gusseme, Bart; Vlaeminck, Siegfried E; Boon, Nico; Verstraete, Willy

2009-08-01

Trichloroethylene is a toxic and recalcitrant groundwater pollutant. Palladium nanoparticles bio-precipitated on Shewanella oneidensis were encapsulated in polyurethane, polyacrylamide, alginate, silica or coated on zeolites. The reactivity of these bio-Pd beads and zeolites was tested in batch experiments and trichloroethylene dechlorination followed first order reaction kinetics. The calculated k-values of the encapsulated catalysts were a factor of six lower compared to non-encapsulated bio-Pd. Bio-Pd, used as a catalyst, was able to dechlorinate 100 mgL(-1) trichloroethylene within a time period of 1h. The main reaction product was ethane; yet small levels of chlorinated intermediates were detected. Subsequently polyurethane cubes empowered with bio-Pd were implemented in a fixed bed reactor for the treatment of water containing trichloroethylene. The influent recycle configuration resulted in a cumulative removal of 98% after 22 h. The same reactor in a flow through configuration achieved removal rates up to 1059 mg trichloroethylene g Pd(-1)d(-1). This work showed that fixed bed reactors with bio-Pd polyurethane cubes can be instrumental for remediation of water contaminated with trichloroethylene.

A framework for stochastic simulations and visualization of biological electron-transfer dynamics

NASA Astrophysics Data System (ADS)

Nakano, C. Masato; Byun, Hye Suk; Ma, Heng; Wei, Tao; El-Naggar, Mohamed Y.

2015-08-01

Electron transfer (ET) dictates a wide variety of energy-conversion processes in biological systems. Visualizing ET dynamics could provide key insight into understanding and possibly controlling these processes. We present a computational framework named VizBET to visualize biological ET dynamics, using an outer-membrane Mtr-Omc cytochrome complex in Shewanella oneidensis MR-1 as an example. Starting from X-ray crystal structures of the constituent cytochromes, molecular dynamics simulations are combined with homology modeling, protein docking, and binding free energy computations to sample the configuration of the complex as well as the change of the free energy associated with ET. This information, along with quantum-mechanical calculations of the electronic coupling, provides inputs to kinetic Monte Carlo (KMC) simulations of ET dynamics in a network of heme groups within the complex. Visualization of the KMC simulation results has been implemented as a plugin to the Visual Molecular Dynamics (VMD) software. VizBET has been used to reveal the nature of ET dynamics associated with novel nonequilibrium phase transitions in a candidate configuration of the Mtr-Omc complex due to electron-electron interactions.

Cometabolic degradation of chloramphenicol via a meta-cleavage pathway in a microbial fuel cell and its microbial community.

PubMed

Zhang, Qinghua; Zhang, Yanyan; Li, Daping

2017-04-01

The performance of a microbial fuel cell (MFC) in terms of degradation of chloramphenicol (CAP) was investigated. Approximately 84% of 50mg/L CAP was degraded within 12h in the MFC. A significant interaction of pH, temperature, and initial CAP concentration was found on removal of CAP, and a maximum degradation rate of 96.53% could theoretically be achieved at 31.48°C, a pH of 7.12, and an initial CAP concentration of 106.37mg/L. Moreover, CAP was further degraded through a ring-cleavage pathway. The antibacterial activity of CAP towards Escherichia coli ATCC 25922 and Shewanella oneidensis MR-1 was largely eliminated by MFC treatment. High-throughput sequencing analysis indicated that Azonexus, Comamonas, Nitrososphaera, Chryseobacterium, Azoarcus, Rhodococcus, and Dysgonomonas were the predominant genera in the MFC anode biofilm. In conclusion, the MFC shows potential for the treatment of antibiotic residue-containing wastewater due to its high rates of CAP removal and energy recovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

Microbial fuel cells using Cellulomonas spp. with cellulose as fuel.

PubMed

Takeuchi, Yuya; Khawdas, Wichean; Aso, Yuji; Ohara, Hitomi

2017-03-01

Cellulomonas fimi, Cellulomonas biazotea, and Cellulomonas flavigena are cellulose-degrading microorganisms chosen to compare the degradation of cellulose. C. fimi degraded 2.5 g/L of cellulose within 4 days, which was the highest quantity among the three microorganisms. The electric current generation by the microbial fuel cell (MFC) using the cellulose-containing medium with C. fimi was measured over 7 days. The medium in the MFC was sampled every 24 h to quantify the degradation of cellulose, and the results showed that the electric current increased with the degradation of cellulose. The maximum electric power generated by the MFC was 38.7 mW/m 2 , and this numeric value was 63% of the electric power generated by an MFC with Shewanella oneidensis MR-1, a well-known current-generating microorganism. Our results showed that C. fimi was an excellent candidate to produce the electric current from cellulose via MFCs. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Simultaneous microbial reduction of vanadium (V) and chromium (VI) by Shewanella loihica PV-4.

PubMed

Wang, Guangyu; Zhang, Baogang; Li, Shuang; Yang, Meng; Yin, Changcheng

2017-03-01

Toxic vanadium (V) and chromium (VI) often co-exist in wastewater from vanadium ore smelting and their reductions by bacterial strain Shewanella loihica PV-4 is realized simultaneously. After 27-d operation, 71.3% of V(V) and 91.2% of Cr(VI) were removed respectively, with citrate as organic carbon source. Enhancement of Cr(VI) bioreduction was observed with the suppressed V(V) reduction. V(IV) and Cr(III), the main reduction products, precipitated inside the organisms and attached on cell surfaces. Both membrane components containing cytochrome c and cytoplasmic fractions containing soluble proteins as well as NADH may contribute to these microbial reductions. Most Cr(VI) were reduced extracellularly and V(V) tended to be reduced through intracellular process, as revealed by mapping the microbial surface and a line scan across the cell, performed by scanning transmission electron microscopy. This study provides an efficient alternative for controlling combined pollution caused by these two metals based on microbial technology. Copyright © 2016 Elsevier Ltd. All rights reserved.

Rapid Precipitation of Amorphous Silica in Experimental Systems with Nontronite (NAu-1) and Shewanella oneidensis MR-1

DTIC Science & Technology

2007-01-15

law, no person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB...report, we focus on the rapid bio- life because much of our current understanding of early life mineralization of amorphous silica. comes from...matter. The Nanoplast-embedded sample was atomic emission spectroscopy (ICP). After pH analysis ultrathin-sectioned, and examined with JEOL3010 TEM with a

Bound Flavin-Cytochrome Model of Extracellular Electron Transfer in Shewanella oneidensis: Analysis by Free Energy Molecular (Postprint)

DTIC Science & Technology

2016-06-06

toxic chemicals,4 protection of steel from corrosion,5 or in bioremediation .6 Of special interest is the potential use of the exoelectrogens in... Bioremediation of Uranium-Contaminated Groundwater: A Systems Approach to Subsurface Biogeochemistry. Curr. Opin. Biotechnol. 2013, 24, 489−497. (7

Respiration-linked proton translocation coupled to anaerobic reduction of manganese(IV) and iron(III) in Shewanella putrefaciens MR-1.

PubMed Central

Myers, C R; Nealson, K H

1990-01-01

An oxidant pulse technique, with lactate as the electron donor, was used to study respiration-linked proton translocation in the manganese- and iron-reducing bacterium Shewanella putrefaciens MR-1. Cells grown anaerobically with fumarate or nitrate as the electron acceptor translocated protons in response to manganese (IV), fumarate, or oxygen. Cells grown anaerobically with fumarate also translocated protons in response to iron(III) and thiosulfate, whereas those grown with nitrate did not. Aerobically grown cells translocated protons only in response to oxygen. Proton translocation with all electron acceptors was abolished in the presence of the protonophore carbonyl cyanide m-chlorophenylhydrazone (20 microM) and was partially to completely inhibited by the electron transport inhibitor 2-n-heptyl-4-hydroxyquinoline N-oxide (50 microM). PMID:2172208

The quest to achieve the detailed structural and functional characterization of CymA.

PubMed

Louro, Ricardo O; Paquete, Catarina M

2012-12-01

Shewanella oneidensis MR-1 is a sediment organism capable of dissimilatory reduction of insoluble metal compounds such as those of Fe(II) and Mn(IV). This bacterium has been used as a model organism for potential applications in bioremediation of contaminated environments and in the production of energy in microbial fuel cells. The capacity of Shewanella to perform extracellular reduction of metals is linked to the action of several multihaem cytochromes that may be periplasmic or can be associated with the inner or outer membrane. One of these cytochromes is CymA, a membrane-bound tetrahaem cytochrome localized in the periplasm that mediates the electron transfer between the quinone pool in the cytoplasmic membrane and several periplasmic proteins. Although CymA has the capacity to regulate multiple anaerobic respiratory pathways, little is known about the structure and functional mechanisms of this focal protein. Understanding the structure and function of membrane proteins is hampered by inherent difficulties associated with their purification since the choice of the detergents play a critical role in the protein structure and stability. In the present mini-review, we detail the current state of the art in the characterization of CymA, and add recent information on haem structural behaviour for CymA solubilized in different detergents. These structural differences are deduced from NMR spectroscopy data that provide information on the geometry of the haem axial ligands. At least two different conformational forms of CymA are observed for different detergents, which seem to be related to the micelle size. These results provide guidance for the discovery of the most promising detergent that mimics the native lipid bilayer and is compatible with biochemical and structural studies.

Determination of Spoilage Microbiota of Pacific White Shrimp During Ambient and Cold Storage Using Next-Generation Sequencing and Culture-Dependent Method.

PubMed

Yang, Sheng-Ping; Xie, Jing; Qian, Yun-Fang

2017-05-01

This study was conducted to determine the initial and spoilage microbiota of Pacific white shrimp during ambient and cold storage using next-generation sequencing (NGS) and a culture-dependent method. The quality changes were also evaluated by sensory analysis and total volatile basic nitrogen (TVB-N) values. After 1 d of storage, the psychrotrophic bacteria were only 5.97 log CFU/g, accounting for 1.1% of the mesophilic bacteria counts (7.94 log CFU/g). The psychrotrophic bacteria counts exceeded the counts of mesophilic bacteria for shrimp stored at 4 °C after 6 d of storage, indicating that psychrotrophic bacteria became predominant. The NGS was used to identify the bacterial species in samples stored at 25 and 4 °C. The results showed that the dominant microorganisms were Vibrio at 25 °C, and Acinetobacter, Psychrobacter, and Shewanella at 4 °C. By the culture-dependent method based on 16S rRNA gene and VITEK®2 CompactA system, it showed that the dominant microorganisms were Proteus spp. at 25 °C, and Shewanella putrefaciens, Acinetobacter johnsonii, and Aeromonas sobria at 4 °C. In conclusion, differences in results of microbiota analyzed by culture dependent and independent approaches were observed. The combination of both methodologies may provide more comprehensive information about the dominant spoilage microbiota in Pacific white shrimp during ambient and cold storage. © 2017 Institute of Food Technologists®.

Isolation and Characterization of a Shewanella Phage–Host System from the Gut of the Tunicate, Ciona intestinalis

PubMed Central

Leigh, Brittany; Karrer, Charlotte; Cannon, John P.; Breitbart, Mya; Dishaw, Larry J.

2017-01-01

Outnumbering all other biological entities on earth, bacteriophages (phages) play critical roles in structuring microbial communities through bacterial infection and subsequent lysis, as well as through horizontal gene transfer. While numerous studies have examined the effects of phages on free-living bacterial cells, much less is known regarding the role of phage infection in host-associated biofilms, which help to stabilize adherent microbial communities. Here we report the cultivation and characterization of a novel strain of Shewanella fidelis from the gut of the marine tunicate Ciona intestinalis, inducible prophages from the S. fidelis genome, and a strain-specific lytic phage recovered from surrounding seawater. In vitro biofilm assays demonstrated that lytic phage infection affects biofilm formation in a process likely influenced by the accumulation and integration of the extracellular DNA released during cell lysis, similar to the mechanism that has been previously shown for prophage induction. PMID:28327522

Removal of methylmercury and tributyltin (TBT) using marine microorganisms.

PubMed

Lee, Seong Eon; Chung, Jin Wook; Won, Ho Shik; Lee, Dong Sup; Lee, Yong-Woo

2012-02-01

Two marine species of bacteria were isolated that are capable of degrading organometallic contaminants: Pseudomonas balearica, which decomposes methylmercury; and Shewanella putrefaciens, which decomposes tributyltin. P. balearica decomposed 97% of methylmercury (20.0 μg/L) into inorganic mercury after 3 h, while S. putrefaciens decomposed 88% of tributyltin (55.3 μg Sn/L) in real wastewater after 36 h. These data indicate that the two bacteria efficiently decomposed the targeted substances and may be applied to real wastewater.

Deep-Sea Bacterium Shewanella piezotolerans WP3 Has Two Dimethyl Sulfoxide Reductases in Distinct Subcellular Locations

PubMed Central

Xiong, Lei; Jian, Huahua

2017-01-01

ABSTRACT Dimethyl sulfoxide (DMSO) acts as a substantial sink for dimethyl sulfide (DMS) in deep waters and is therefore considered a potential electron acceptor supporting abyssal ecosystems. Shewanella piezotolerans WP3 was isolated from west Pacific deep-sea sediments, and two functional DMSO respiratory subsystems are essential for maximum growth of WP3 under in situ conditions (4°C/20 MPa). However, the relationship between these two subsystems and the electron transport pathway underlying DMSO reduction by WP3 remain unknown. In this study, both DMSO reductases (type I and type VI) in WP3 were found to be functionally independent despite their close evolutionary relationship. Moreover, immunogold labeling of DMSO reductase subunits revealed that the type I DMSO reductase was localized on the outer leaflet of the outer membrane, whereas the type VI DMSO reductase was located within the periplasmic space. CymA, a cytoplasmic membrane-bound tetraheme c-type cytochrome, served as a preferential electron transport protein for the type I and type VI DMSO reductases, in which type VI accepted electrons from CymA in a DmsE- and DmsF-independent manner. Based on these results, we proposed a core electron transport model of DMSO reduction in the deep-sea bacterium S. piezotolerans WP3. These results collectively suggest that the possession of two sets of DMSO reductases with distinct subcellular localizations may be an adaptive strategy for WP3 to achieve maximum DMSO utilization in deep-sea environments. IMPORTANCE As the dominant methylated sulfur compound in deep oceanic water, dimethyl sulfoxide (DMSO) has been suggested to play an important role in the marine biogeochemical cycle of the volatile anti-greenhouse gas dimethyl sulfide (DMS). Two sets of DMSO respiratory systems in the deep-sea bacterium Shewanella piezotolerans WP3 have previously been identified to mediate DMSO reduction under in situ conditions (4°C/20 MPa). Here, we report that the two DMSO

The Role of Clonal Interference in the Evolutionary Dynamics of Plasmid-Host Adaptation

PubMed Central

Hughes, Julie M.; Lohman, Brian K.; Deckert, Gail E.; Nichols, Eric P.; Settles, Matt; Abdo, Zaid; Top, Eva M.

2012-01-01

ABSTRACT Promiscuous plasmids replicate in a wide range of bacteria and therefore play a key role in the dissemination of various host-beneficial traits, including antibiotic resistance. Despite the medical relevance, little is known about the evolutionary dynamics through which drug resistance plasmids adapt to new hosts and thereby persist in the absence of antibiotics. We previously showed that the incompatibility group P-1 (IncP-1) minireplicon pMS0506 drastically improved its stability in novel host Shewanella oneidensis MR-1 after 1,000 generations under antibiotic selection for the plasmid. The only mutations found were those affecting the N terminus of the plasmid replication initiation protein TrfA1. Our aim in this study was to gain insight into the dynamics of plasmid evolution. Changes in stability and genotype frequencies of pMS0506 were monitored in evolving populations of MR-1 (pMS0506). Genotypes were determined by sequencing trfA1 amplicons from individual clones and by 454 pyrosequencing of whole plasmids from entire populations. Stability of pMS0506 drastically improved by generation 200. Many evolved plasmid genotypes with point mutations as well as in-frame and frameshift deletions and duplications in trfA1 were observed in all lineages with both sequencing methods. Strikingly, multiple genotypes were simultaneously present at high frequencies (>10%) in each population. Their relative abundances changed over time, but after 1,000 generations only one or two genotypes dominated the populations. This suggests that hosts with different plasmid genotypes were competing with each other, thus affecting the evolutionary trajectory. Plasmids can thus rapidly improve their stability, and clonal interference plays a significant role in plasmid-host adaptation dynamics. PMID:22761390

Inference of gene regulatory networks from genome-wide knockout fitness data

PubMed Central

Wang, Liming; Wang, Xiaodong; Arkin, Adam P.; Samoilov, Michael S.

2013-01-01

Motivation: Genome-wide fitness is an emerging type of high-throughput biological data generated for individual organisms by creating libraries of knockouts, subjecting them to broad ranges of environmental conditions, and measuring the resulting clone-specific fitnesses. Since fitness is an organism-scale measure of gene regulatory network behaviour, it may offer certain advantages when insights into such phenotypical and functional features are of primary interest over individual gene expression. Previous works have shown that genome-wide fitness data can be used to uncover novel gene regulatory interactions, when compared with results of more conventional gene expression analysis. Yet, to date, few algorithms have been proposed for systematically using genome-wide mutant fitness data for gene regulatory network inference. Results: In this article, we describe a model and propose an inference algorithm for using fitness data from knockout libraries to identify underlying gene regulatory networks. Unlike most prior methods, the presented approach captures not only structural, but also dynamical and non-linear nature of biomolecular systems involved. A state–space model with non-linear basis is used for dynamically describing gene regulatory networks. Network structure is then elucidated by estimating unknown model parameters. Unscented Kalman filter is used to cope with the non-linearities introduced in the model, which also enables the algorithm to run in on-line mode for practical use. Here, we demonstrate that the algorithm provides satisfying results for both synthetic data as well as empirical measurements of GAL network in yeast Saccharomyces cerevisiae and TyrR–LiuR network in bacteria Shewanella oneidensis. Availability: MATLAB code and datasets are available to download at http://www.duke.edu/∼lw174/Fitness.zip and http://genomics.lbl.gov/supplemental/fitness-bioinf/ Contact: wangx@ee.columbia.edu or mssamoilov@lbl.gov Supplementary information

Diversity of the Sediment Microbial Community in the Aha Watershed (Southwest China) in Response to Acid Mine Drainage Pollution Gradients

PubMed Central

Sun, Weimin; Sun, Min; Dong, Yiran; Ning, Zengping; Xiao, Enzong; Tang, Song; Li, Jiwei

2015-01-01

Located in southwest China, the Aha watershed is continually contaminated by acid mine drainage (AMD) produced from upstream abandoned coal mines. The watershed is fed by creeks with elevated concentrations of aqueous Fe (total Fe > 1 g/liter) and SO42− (>6 g/liter). AMD contamination gradually decreases throughout downstream rivers and reservoirs, creating an AMD pollution gradient which has led to a suite of biogeochemical processes along the watershed. In this study, sediment samples were collected along the AMD pollution sites for geochemical and microbial community analyses. High-throughput sequencing found various bacteria associated with microbial Fe and S cycling within the watershed and AMD-impacted creek. A large proportion of Fe- and S-metabolizing bacteria were detected in this watershed. The dominant Fe- and S-metabolizing bacteria were identified as microorganisms belonging to the genera Metallibacterium, Aciditerrimonas, Halomonas, Shewanella, Ferrovum, Alicyclobacillus, and Syntrophobacter. Among them, Halomonas, Aciditerrimonas, Metallibacterium, and Shewanella have previously only rarely been detected in AMD-contaminated environments. In addition, the microbial community structures changed along the watershed with different magnitudes of AMD pollution. Moreover, the canonical correspondence analysis suggested that temperature, pH, total Fe, sulfate, and redox potentials (Eh) were significant factors that structured the microbial community compositions along the Aha watershed. PMID:25979900

The nature of electron acceptor (MnIV/NO3) triggers differential expression of genes associated with stress and ammonium limitation responses in Shewanella algae C6G3.

PubMed

Aigle, Axel; Bonin, Patricia; -Nunez, Nicolas Fernandez; Loriod, Béatrice; Guasco, Sophie; Bergon, Aurélie; Armougom, Fabrice; Iobbi-Nivol, Chantal; Imbert, Jean; Michotey, Valérie

2018-03-16

Shewanella algae C6G3 can reduce dissimilatively nitrate into ammonium and manganese-oxide (MnIV) into MnII. It has the unusual ability to produce anaerobically nitrite from ammonium in the presence of MnIV. To gain insight into their metabolic capabilities, global mRNA expression patterns were investigated by RNA-seq and qRT-PCR in cells growing with lactate and ammonium as carbon and nitrogen sources and with either MnIV or nitrate as electron acceptors. Gene exhibiting higher expression levels in the presence of MnIV belonged to functional categories of carbohydrate, coenzyme, lipid metabolisms and inorganic ion transport. Comparative transcriptomic pattern between MnIV and NO3 revealed that the strain presented an ammonium limitation status with MnIV, despite the presence of non-limiting concentration of ammonium under both culture conditions. In addition, in presence of MnIV, ntrB/nrtC regulators, ammonium channel, nitrogen regulatory protein P-II, glutamine synthetase and asparagine synthetase glutamine dependent genes were over-represented. Under nitrate condition, the expression of genes involved in the synthesis of several amino acids was increased. Finally, expression level of genes associated with the general stress response was also amplified and among them, katE, a putative catalase/peroxidase present on several Shewanella genomes, was highly expressed with a relative median value higher in MnIV condition.

Microbial profiles of commercial, vacuum-packaged, fresh pork of normal or short storage life.

PubMed

Holley, Richard A; Peirson, Michael D; Lam, Jocelyn; Tan, Kit Bee

2004-12-01

The microbial ecology of fresh vacuum-packed pork cuts during storage at -1.5 degrees C for up to 45 days was examined to characterize rates of microbial growth and pH changes in commercially prepared products of normal storage quality. Pork loins in commercial distribution with odour defects were also studied to determine a possible cause of the defects and avoid future problems. In addition, microbial profiles of pork cuts from two plants were compared, after storage for 25 days at -1.5 degrees C, to identify possible reasons for differences in the storage life of product from the plants. The effects of a change in sanitation procedures on the microbial populations of products stored for 25 days were also studied. With normal product, microbial growth in different packages progressed at different rates, reflecting differences in initial levels of bacterial contamination. All samples in the study reached 8 weeks without apparent organoleptic change and samples carried 5.8+/-1.2 log bacteria cm(-2) (mean+/-S.D.). The flora of loins with the odour defect were predominately lactic acid bacteria (LAB) and carnobacteria, but they contained large fractions of Enterobacteriaceae <35 days after packaging. Aeromonas spp. and Shewanella spp. were likely responsible for the sulfide-putrid smell of these spoiled products, but species of Enterobacteriaceae and lactic acid bacteria could have contributed to spoilage. Comparison of microbial groups present in 16 other cuts, half from each of two commercial plants, which were stored for 25 days at -1.5 degrees C, showed that larger fractions of Enterobacteriaceae were present in samples from the plant having difficulty achieving the desired storage life. Additional bacterial samples from 12 cuts supplied by the latter plant obtained after adoption of an acid sanitizer step in the plant cleaning regimen, and also stored for 25 days at -1.5 degrees C, yielded few Enterobacteriaceae, Aeromonas or Shewanella. Use of an acid sanitizer

Immunogenicity and ecotoxicity of engineered nanoparticles

NASA Astrophysics Data System (ADS)

Maurer-Jones, Melissa Ann

-induced oxidative stress. The generalizability of the mechanism of TiO2 toxicity, as detailed in Chapter Two and Three, is explored in Chapter Four in a bacteria model, Shewanella oneidensis, studying the functions of biofilm formation using a quartz crystal microbalance (QCM) and flavin secretion using high performance liquid chromatography (HPLC). This study revealed that the proximity of the TiO 2 nanoparticles to S. oneidensis caused changes in gene expression resulting in an observed delay in biofilm growth and increase in riboflavin secretion. Chapter Five works to develop an in situ Ag nanoparticle characterization tool using fluorous-phase ion selective electrodes to measure dissolved Ag+, with preliminary investigation into the toxicity of Ag nanoparticles and Ag+ ions to S. oneidensis, resulting in one of the first in situ characterization tools for nanoparticles during toxicity assessments. Moving beyond laboratory work, Chapter Six examines bench scientists' perspective on the regulation of nanotherapies moving from pre-clinical to first-in-human trials and the ethical considerations for the implementation of nanotechnology. Finally, Chapter Seven details the development of a 3-day nanotoxicity laboratory for introductory chemistry classes to introduce students to interdisciplinary science and the cutting edge research field of nanotoxicology. In total, my project has considered the scientific, ethical, and educational implications for nanotoxicology and has ultimately contributed to a better understanding of the nanoparticle-cell interaction.

Effects of disinfectant and biofilm on the corrosion of cast iron pipes in a reclaimed water distribution system.

PubMed

Wang, Haibo; Hu, Chun; Hu, Xuexiang; Yang, Min; Qu, Jiuhui

2012-03-15

The effects of disinfection and biofilm on the corrosion of cast iron pipe in a model reclaimed water distribution system were studied using annular reactors (ARs). The corrosion scales formed under different conditions were characterized by X-ray diffraction (XRD), energy dispersive spectroscopy (EDS), and scanning electron microscopy (SEM), while the bacterial characteristics of biofilm on the surface were determined using several molecular methods. The corrosion scales from the ARs with chlorine included predominantly α-FeOOH and Fe2O3, while CaPO3(OH)·2H2O and α-FeOOH were the predominant phases after chloramines replaced chlorine. Studies of the consumption of chlorine and iron release indicated that the formation of dense oxide layers and biofilm inhibited iron corrosion, causing stable lower chlorine decay. It was verified that iron-oxidizing bacteria (IOB) such as Sediminibacterium sp., and iron-reducing bacteria (IRB) such as Shewanella sp., synergistically interacted with the corrosion product to prevent further corrosion. For the ARs without disinfection, α-FeOOH was the predominant phase at the primary stage, while CaCO3 and α-FeOOH were predominant with increasing time. The mixed corrosion-inducing bacteria, including the IRB Shewanella sp., the IOB Sediminibacterium sp., and the sulfur-oxidizing bacteria (SOB) Limnobacter thioxidans strain, promoted iron corrosion by synergistic interactions in the primary period, while anaerobic IRB became the predominant corrosion bacteria, preventing further corrosion via the formation of protective layers. Copyright © 2011 Elsevier Ltd. All rights reserved.

Distinct Osmoadaptation Strategies in the Strict Halophilic and Halotolerant Bacteria Isolated from Lunsu Salt Water Body of North West Himalayas.

PubMed

Vaidya, Shivani; Dev, Kamal; Sourirajan, Anuradha

2018-07-01

Two strict halophilic bacterial strains, Halobacillus trueperi SS1, and Halobacillus trueperi SS3, and three halotolerant bacterial strains, Shewanella algae SS2, Halomonas venusta SS5, and Marinomonas sp. SS8 of Lunsu salt water body, Himachal Pradesh, India, were selected to study the mechanism of salt tolerance and the role of osmolytes therein. A combination of flame photometry, chromatographic and colorimetric assays was used to study the mechanism of salt tolerance in the selected strict halophilic and halotolerant bacterial strains. The strict halophiles and, one of the halotolerants, Marinomonas sp. SS8 were found to utilize both "salt-in strategy" and "accumulation of compatible solutes strategy" for osmoregulation in hypersaline conditions. On the contrary, the remaining two halotolerants used "accumulation of compatible solutes strategy" under saline stress and not the "salt-in strategy". The present study suggests towards distinct mechanisms of salt tolerance in the two classes, wherein strict halophiles accumulate compatible solutes as well as adopt salt-in strategy, while the halotolerant bacteria accumulate a range of compatible solutes, except Marinomonas sp. SS8, which utilizes both the strategies to combat salt stress.

Exploring the molecular mechanisms of electron shuttling across the microbe/metal space

PubMed Central

Paquete, Catarina M.; Fonseca, Bruno M.; Cruz, Davide R.; Pereira, Tiago M.; Pacheco, Isabel; Soares, Cláudio M.; Louro, Ricardo O.

2014-01-01

Dissimilatory metal reducing organisms play key roles in the biogeochemical cycle of metals as well as in the durability of submerged and buried metallic structures. The molecular mechanisms that support electron transfer across the microbe-metal interface in these organisms remain poorly explored. It is known that outer membrane proteins, in particular multiheme cytochromes, are essential for this type of metabolism, being responsible for direct and indirect, via electron shuttles, interaction with the insoluble electron acceptors. Soluble electron shuttles such as flavins, phenazines, and humic acids are known to enhance extracellular electron transfer. In this work, this phenomenon was explored. All known outer membrane decaheme cytochromes from Shewanella oneidensis MR-1 with known metal terminal reductase activity and a undecaheme cytochrome from Shewanella sp. HRCR-6 were expressed and purified. Their interactions with soluble electron shuttles were studied using stopped-flow kinetics, NMR spectroscopy, and molecular simulations. The results show that despite the structural similarities, expected from the available structural data and sequence homology, the detailed characteristics of their interactions with soluble electron shuttles are different. MtrC and OmcA appear to interact with a variety of different electron shuttles in the close vicinity of some of their hemes, and with affinities that are biologically relevant for the concentrations typical found in the medium for this type of compounds. All data support a view of a distant interaction between the hemes of MtrF and the electron shuttles. For UndA a clear structural characterization was achieved for the interaction with AQDS a humic acid analog. These results provide guidance for future work of the manipulation of these proteins toward modulation of their role in metal attachment and reduction. PMID:25018753

[Effects of iron on azoreduction by Shewanella decolorationis S12].

PubMed

Chen, Xing-Juan; Xu, Mei-Ying; Sun, Guo-Ping

2010-01-01

The effects of soluble and insoluble Fe(III) on anaerobic azoreduction by Shewanella decolorationis S12 were examined in a series of experiments. Results showed that the effects of iron on anaerobic azoreduction depended on the solubility and concentration of the compounds. Azoreduction was inhibited by insoluble Fe(III) and 0.05-2 mmol/L Fe2 O3 all decelerated the azoreduction activity of 0.2 mmol/L amaranth, but the increase in the concentrations of Fe2O3 did not cause an increasing inhibition. Soluble Fe(III) of which concentration less than 0.4 mmol/L enhanced azoreduction activity of 0.2 mmol/L amaranth but there was no linear relationship between the concentration of soluble Fe(III) and azoreduction activity. Soluble Fe(III) of which concentration more than 1 mmol/L inhibited azoreduction activity of 0.2 mmol/L amaranth and an increasing concentration resulted in an increased inhibition. The inhibition was strengthened under the conditions of limited electron donor. On the other hand, soluble Fe(III) and Fe(II) could relieve the inhibition of azoreduction by dicumarol which blocked quinone cycle. It suggests that in addition to quinone cycle, there is a Fe(III) <--> Fe(II) cycle shuttling electrons in cytoplasmic and periplasmic environment. That is the reason why low concentration of soluble Fe(III) or Fe (II) can enhance azoreduction of S. decolorationis S12. It also indicates that insoluble Fe(III) and high concentration of soluble Fe(III) do compete with azo dye for electrons once it acts as electron acceptor. Thus, when iron and azo dye coexisted, iron could serve as an electron transfer agent or electron competitive inhibitor for anaerobic azoreduction under different conditions. High efficiency of azoreduction can be achieved through controlling the solubility and concentration of irons.

Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens

PubMed Central

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-01-01

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210

Comparative multi-goal tradeoffs in systems engineering of microbial metabolism

PubMed Central

2012-01-01

Background Metabolic engineering design methodology has evolved from using pathway-centric, random and empirical-based methods to using systems-wide, rational and integrated computational and experimental approaches. Persistent during these advances has been the desire to develop design strategies that address multiple simultaneous engineering goals, such as maximizing productivity, while minimizing raw material costs. Results Here, we use constraint-based modeling to systematically design multiple combinations of medium compositions and gene-deletion strains for three microorganisms (Escherichia coli, Saccharomyces cerevisiae, and Shewanella oneidensis) and six industrially important byproducts (acetate, D-lactate, hydrogen, ethanol, formate, and succinate). We evaluated over 435 million simulated conditions and 36 engineering metabolic traits, including product rates, costs, yields and purity. Conclusions The resulting metabolic phenotypes can be classified into dominant clusters (meta-phenotypes) for each organism. These meta-phenotypes illustrate global phenotypic variation and sensitivities, trade-offs associated with multiple engineering goals, and fundamental differences in organism-specific capabilities. Given the increasing number of sequenced genomes and corresponding stoichiometric models, we envisage that the proposed strategy could be extended to address a growing range of biological questions and engineering applications. PMID:23009214

Improving the Molecular Ion Signal Intensity for In Situ Liquid SIMS Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Yufan; Yao, Juan; Ding, Yuanzhao

In situ liquid secondary ion mass spectrometry (SIMS) enabled by system for analysis at the liquid vacuum interface (SALVI) has proven to be a promising new tool to provide molecular information at solid–liquid and liquid–vacuum interfaces. However, the initial data showed that useful signals in positive ion spectra are too weak to be meaningful in most cases. In addition, it is difficult to obtain strong negative molecular ion signals when m/z>200. These two drawbacks have been the biggest obstacle towards practical use of this new analytical approach. In this study, we report that strong and reliable positive and negative molecularmore » signals are achievable after optimizing the SIMS experimental conditions. Four model systems, including a 1,8-diazabicycloundec-7-ene (DBU)-base switchable ionic liquid, a live Shewanella oneidensis biofilm, a hydrated mammalian epithelia cell, and an electrolyte popularly used in Li ion batteries were studied. A signal enhancement of about two orders of magnitude was obtained in comparison with non-optimized conditions. Therefore, molecular ion signal intensity has become very acceptable to use for in situ liquid SIMS to study solid–liquid and liquid–vacuum interfaces.« less

Kinetics of microbial reduction of Solid phase U(VI).

PubMed

Liu, Chongxuan; Jeon, Byong-Hun; Zachara, John M; Wang, Zheming; Dohnalkova, Alice; Fredrickson, James K

2006-10-15

Sodium boltwoodite (NaUO2SiO3OH x 1.5 H2O) was used to assess the kinetics of microbial reduction of solid-phase U(VI) by a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1. The bioreduction kinetics was studied with Na-boltwoodite in suspension or within alginate beads in a nongrowth medium with lactate as electron donor at pH 6.8 buffered with PIPES. Concentrations of U(VI)tot and cell number were varied to evaluate the coupling of U(VI) dissolution, diffusion, and microbial activity. Microscopic and spectroscopic analyses with transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and laser-induced fluorescence spectroscopy (LIFS) collectively indicated that solid-phase U(VI) was first dissolved and diffused out of grain interiors before it was reduced on bacterial surfaces and/or within the periplasm. The kinetics of solid-phase U(VI) bioreduction was well described by a coupled model of bicarbonate-promoted dissolution of Na-boltwoodite, intragrain uranyl diffusion, and Monod type bioreduction kinetics with respect to dissolved U(VI) concentration. The results demonstrated that microbial reduction of solid-phase U(VI) is controlled by coupled biological, chemical, and physical processes.

Improving the Molecular Ion Signal Intensity for In Situ Liquid SIMS Analysis.

PubMed

Zhou, Yufan; Yao, Juan; Ding, Yuanzhao; Yu, Jiachao; Hua, Xin; Evans, James E; Yu, Xiaofei; Lao, David B; Heldebrant, David J; Nune, Satish K; Cao, Bin; Bowden, Mark E; Yu, Xiao-Ying; Wang, Xue-Lin; Zhu, Zihua

2016-12-01

In situ liquid secondary ion mass spectrometry (SIMS) enabled by system for analysis at the liquid vacuum interface (SALVI) has proven to be a promising new tool to provide molecular information at solid-liquid and liquid-vacuum interfaces. However, the initial data showed that useful signals in positive ion spectra are too weak to be meaningful in most cases. In addition, it is difficult to obtain strong negative molecular ion signals when m/z>200. These two drawbacks have been the biggest obstacle towards practical use of this new analytical approach. In this study, we report that strong and reliable positive and negative molecular signals are achievable after optimizing the SIMS experimental conditions. Four model systems, including a 1,8-diazabicycloundec-7-ene (DBU)-base switchable ionic liquid, a live Shewanella oneidensis biofilm, a hydrated mammalian epithelia cell, and an electrolyte popularly used in Li ion batteries were studied. A signal enhancement of about two orders of magnitude was obtained in comparison with non-optimized conditions. Therefore, molecular ion signal intensity has become very acceptable for use of in situ liquid SIMS to study solid-liquid and liquid-vacuum interfaces. Graphical Abstract ᅟ.

Direct determination of oxidation state of gold deposits in metal-reducing bacterium Shewanella algae using X-ray absorption near-edge structure spectroscopy (XANES).

PubMed

Konishi, Yasuhiro; Tsukiyama, Takeshi; Saitoh, Norizoh; Nomura, Toshiyuki; Nagamine, Shinsuke; Takahashi, Yoshio; Uruga, Tomoya

2007-06-01

X-ray absorption near-edge structure spectroscopy (XANES) was successfully employed to determine the gold valence in the metal-reducing bacterium Shewanella algae after exposure to a 1 mM aqueous HAuCl4 solution for 10-120 min. XANES spectra revealed the oxidation state of gold in the bacterial cells to be Au(0) without any contribution from Au(III), demonstrating that S. algae cells can reduce AuCl4- ions to elemental gold. Transmission electron microscopy (TEM) and energy dispersive X-ray (EDX) analysis confirmed that gold nanoparticles 5-15 nm in size were deposited in the periplasmic space of the bacterial cells; a preferable, cell surface location for the easy recovery of biogenic nanoparticles.

Mineral Influence on Microbial Survival During Carbon Sequestration

NASA Astrophysics Data System (ADS)

Santillan, E. U.; Shanahan, T. M.; Wolfe, W. W.; Bennett, P.

2012-12-01

CO2 sequestered in a deep saline aquifer will perturb subsurface biogeochemistry by acidifying the groundwater and accelerating mineral diagenesis. Subsurface microbial communities heavily influence geochemistry through their metabolic processes, such as with dissimilatory iron reducing bacteria (DIRB). However, CO2 also acts as a sterilant and will perturb these communities. We investigated the role of mineralogy and its effect on the survival of microbes at high PCO2 conditions using the model DIRB Shewanella oneidensis MR-1. Batch cultures of Shewanella were grown to stationary phase and exposed to high PCO2 using modified Parr reactors. Cell viability was then determined by plating cultures after exposure. Results indicate that at low PCO2 (2 bar), growth and iron reduction are decreased and cell death occurs within 1 hour when exposed to CO2 pressures of 10 bar or greater. Further, fatty acid analysis indicates microbial lipid degradation with C18 fatty acids being the slowest lipids to degrade. When cultures were grown in the presence of rocks or minerals representative of the deep subsurface such as carbonates and silicates and exposed to 25 bar CO2, survival lasted beyond 2 hours. The most effective protecting substratum was quartz sandstone, with cultures surviving beyond 8 hours of CO2 exposure. Scanning electron microscope images reveal biofilm formation on the mineral surfaces with copious amounts of extracellular polymeric substances (EPS) present. EPS from these biofilms acts as a reactive barrier to the CO2, slowing the penetration of CO2 into cells and resulting in increased survival. When biofilm cultures were grown with Al and As to simulate the release of toxic metals from minerals such as feldspars and clays, survival time decreased, indicating mineralogy may also enhance microbial death. Biofilms were then grown on iron-coated quartz sand to determine conversely what influence biofilms may have on mineral dissolution during CO2 perturbation

Diversity of the Sediment Microbial Community in the Aha Watershed (Southwest China) in Response to Acid Mine Drainage Pollution Gradients.

PubMed

Sun, Weimin; Xiao, Tangfu; Sun, Min; Dong, Yiran; Ning, Zengping; Xiao, Enzong; Tang, Song; Li, Jiwei

2015-08-01

Located in southwest China, the Aha watershed is continually contaminated by acid mine drainage (AMD) produced from upstream abandoned coal mines. The watershed is fed by creeks with elevated concentrations of aqueous Fe (total Fe > 1 g/liter) and SO4 (2-) (>6 g/liter). AMD contamination gradually decreases throughout downstream rivers and reservoirs, creating an AMD pollution gradient which has led to a suite of biogeochemical processes along the watershed. In this study, sediment samples were collected along the AMD pollution sites for geochemical and microbial community analyses. High-throughput sequencing found various bacteria associated with microbial Fe and S cycling within the watershed and AMD-impacted creek. A large proportion of Fe- and S-metabolizing bacteria were detected in this watershed. The dominant Fe- and S-metabolizing bacteria were identified as microorganisms belonging to the genera Metallibacterium, Aciditerrimonas, Halomonas, Shewanella, Ferrovum, Alicyclobacillus, and Syntrophobacter. Among them, Halomonas, Aciditerrimonas, Metallibacterium, and Shewanella have previously only rarely been detected in AMD-contaminated environments. In addition, the microbial community structures changed along the watershed with different magnitudes of AMD pollution. Moreover, the canonical correspondence analysis suggested that temperature, pH, total Fe, sulfate, and redox potentials (Eh) were significant factors that structured the microbial community compositions along the Aha watershed. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Anaerobic bacteria

MedlinePlus

Anaerobic bacteria are bacteria that do not live or grow when oxygen is present. In humans, these bacteria ... Brook I. Diseases caused by non-spore-forming anaerobic bacteria. In: Goldman L, Schafer AI, eds. Goldman-Cecil ...

X-ray Microprobe Investigations of Elemental Distributions and Concentrations at Mineral-Microbe Interfaces

NASA Astrophysics Data System (ADS)

Kemner, K. M.; Kelly, S. D.; O'Loughlin, E. J.; Lai, B.; Maser, J.; Cai, Z.; Londer, Y.; Schiffer, M.; Nealson, K.

2003-12-01

in Pseudomonas fluorescens cells in both planktonic and surface-adhered states. We have used x-ray fluorescence spectromicroscopy to investigate the chemical speciation and distribution of Cr that was introduced to these cells as Cr(VI). Additionally, we have used these techniques to identify the distribution of an over expressed cytochrome c7 in individual E. coli. Finally, we have used x-ray fluorescence microscopy to investigate Shewanella oneidensis MR-1 cells adhered to iron oxyhydroxide thin films. The zone plate used in these microscopy experiments produced a focused beam with a cross section (and hence spatial resolution) of 100-300 nanometers. Results from x-ray fluorescence imaging experiments indicate that the distribution of P, S, Cl, Ca, Fe, Ni, Cu, and Zn can define the location of the microbe. Additionally, quantitative elemental analysis of individual microbes identified significant changes in concentration of 3d transition elements depending on the age of the culture and the type of electron acceptor presented to the microbes. These results and a discussion of the use of this technique for identifying metabolic states of individual microbes within communities and the chemical speciation of metal contaminants at the mineral-microbe interface will be presented.

Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.

PubMed

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-10-15

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Fatty acid and hydrocarbon composition in tropical marine Shewanella amazonensis strain SB2B(T).

PubMed

Motoigi, Taro; Okuyama, Hidetoshi

2011-10-01

Shewanella amazonensis strain SB2B(T) is an isolate from shallow-water marine sediments derived from the Amazon River delta. This bacterium contained a long-chain polyunsaturated hydrocarbon, all-cis -3,6,9,12,16,19,22,25,28 hentriacontanonaene (C31:9), constituting 1-2% of the total fatty acid methyl ester and hydrocarbon fraction, which was produced dependently of decreased growth temperature. Analysis of its cellular fatty acid composition demonstrated that isopentadecanoic acid was the major fatty acid component and that all the main monounsaturated fatty acids had straight chains with a cis configuration. However, monoenoic cyclopropyl fatty acids, which were previously reported to be present in this bacterium, were not detected by mass spectrometric analysis. The growth temperature affected the content of Δ9-cis -hexadecenoic [16:1(Δ9c)], palmitic, and heptadecanoic acids. These results suggest that C31:9, as well as 16:1(Δ9c) might be involved in adaptation to low temperature in S. amazonensis strain SB2B(T) . Our result suggests that polyunsaturated fatty acid synthase protein complex may be involved in synthesis of C31:9 but not in production of eicosapentaenoic acid. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

PubMed Central

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin

2016-01-01

Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855

Larval settlement and metamorphosis of the mussel Mytilus coruscus in response to monospecific bacterial biofilms.

PubMed

Yang, Jin-Long; Shen, Pei-Jing; Liang, Xiao; Li, Yi-Feng; Bao, Wei-Yang; Li, Jia-Le

2013-01-01

The effects of bacterial biofilms (BFs) on larval settlement and metamorphosis of the mussel, Mytilus coruscus, were investigated in the laboratory. Of nine different isolates, Shewanella sp.1 BF induced the highest percentage of larval settlement and metamorphosis, whereas seven other isolates had a moderate inducing activity and one isolate, Pseudoalteromonas sp. 4, had a no inducing activity. The inducing activity of individual bacterial isolates was not correlated either with their phylogenetic relationship or with the surfaces from which they were isolated. Among the eight bacterial species that demonstrated inducing activity, bacterial density was significantly correlated with the inducing activity for each strain, with the exception of Vibrio sp. 1. The Shewanella sp. 1 BF cue that was responsible for inducing larval settlement and metamorphosis was further investigated. Treatment of the BFs with formalin, antibiotics, ultraviolet irradiation, heat, and ethanol resulted in a significant decrease in their inducing activities and cell survival. BF-conditioned water (CW) did not induce larval metamorphosis, but it triggered larval settlement behavior. A synergistic effect of CW with formalin-fixed Shewanella sp. 1 BF significantly promoted larval metamorphosis. Thus, a cocktail of chemical cues derived from bacteria may be necessary to stimulate larval settlement and metamorphosis in this species.

An investigation of the sensitivity of low-field nuclear magnetic resonance to microbial growth and activity

NASA Astrophysics Data System (ADS)

Zhang, C.; Keating, K.

2014-12-01

Microbes and microbial processes play a significant role in shaping subsurface environments and are involved in applications ranging from microbially enhanced oil recovery to soil and groundwater contaminant remediation. Stimulated microbial growth in such applications could cause wide variety of changes of physical/chemical properties in the subsurface; however, due to the complexity of subsurface systems,it is difficult to monitor the growth of microbes and microbial activity in porous media. The focus of this research is to determine if low-field nuclear magnetic resonance (NMR), a method used in well logging to characterize fluids in hydrocarbon reservoirs or water in aquifers, can be used to directly detect the presence and the growth of microbes in geologic media. In this laboratory study, low-field NMR (2 MHz) relaxation measurements were collected on microbial suspensions with measured densities (i.e. biomasses), microbial pellets (live and dead), and inoculated silica. We focus on the direct contribution of microbes to the NMR signals in the absence of biomineralization. Shewanella oneidensis (MR-1), a facultative metal reducer known to play an important role in subsurface environments, were used as a model organism and were inoculated under aerobic condition. Data were collected using a CPMG pulse sequence, which was to determine the T2-distribution, and using a gradient spin-echo (PGSE) plus CPMG pulse sequence, which was used to encode diffusion properties and determine the effective diffusion-spin-spin relaxation correlation (D-T2) plot. Our data show no obvious change in the T2-distribution as S. oneidensis density varied in suspension, but show a clear distinction in the T2-distribution and D-T2 plots between live and dead cell pellets. A decrease in the T2-distribution is observed in the inoculated sand column. These results will provide a basis for understanding the effect of microbes within geologic media on low-field NMR measurements. This

On the influence of the culture conditions in bacterial antifouling bioassays and biofilm properties: Shewanella algae, a case study

PubMed Central

2014-01-01

Background A variety of conditions (culture media, inocula, incubation temperatures) are employed in antifouling tests with marine bacteria. Shewanella algae was selected as model organism to evaluate the effect of these parameters on: bacterial growth, biofilm formation, the activity of model antifoulants, and the development and nanomechanical properties of the biofilms. The main objectives were: 1) To highlight and quantify the effect of these conditions on relevant parameters for antifouling studies: biofilm morphology, thickness, roughness, surface coverage, elasticity and adhesion forces. 2) To establish and characterise in detail a biofilm model with a relevant marine strain. Results Both the medium and the temperature significantly influenced the total cell densities and biofilm biomasses in 24-hour cultures. Likewise, the IC50 of three antifouling standards (TBTO, tralopyril and zinc pyrithione) was significantly affected by the medium and the initial cell density. Four media (Marine Broth, MB; 2% NaCl Mueller-Hinton Broth, MH2; Luria Marine Broth, LMB; and Supplemented Artificial Seawater, SASW) were selected to explore their effect on the morphological and nanomechanical properties of 24-h biofilms. Two biofilm growth patterns were observed: a clear trend to vertical development, with varying thickness and surface coverage in MB, LMB and SASW, and a horizontal, relatively thin film in MH2. The Atomic Force Microscopy analysis showed the lowest Young modulii for MB (0.16 ± 0.10 MPa), followed by SASW (0.19 ± 0.09 MPa), LMB (0.22 ± 0.13 MPa) and MH2 (0.34 ± 0.16 MPa). Adhesion forces followed an inverted trend, being higher in MB (1.33 ± 0.38 nN) and lower in MH2 (0.73 ± 0.29 nN). Conclusions All the parameters significantly affected the ability of S. algae to grow and form biofilms, as well as the activity of antifouling molecules. A detailed study has been carried out in order to establish a biofilm model for further assays. The morphology and

Bacteria isolated from amoebae/bacteria consortium

DOEpatents

Tyndall, R.L.

1995-05-30

New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

Bacteria isolated from amoebae/bacteria consortium

DOEpatents

Tyndall, Richard L.

1995-01-01

New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

Mixed-Isotope Labeling with LC-IMS-MS for Characterization of Protein–Protein Interactions by Chemical Cross-Linking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Merkley, Eric D.; Baker, Erin S.; Crowell, Kevin L.

2013-02-20

Chemical cross-linking of proteins followed by proteolysis and mass spectrometric analysis of the resulting cross-linked peptides can provide insights into protein structure and protein-protein interactions. However, cross-linked peptides are by necessity of low stoichometry and have different physicochemical properties than linear peptides, routine unambiguous identification of the cross-linked peptides has remained difficult. To address this challenge, we demonstrated the use of liquid chromatography and ion mobility separations coupled with mass spectrometry in combination with a heavy-isotope labeling method. The combination of mixed-isotope cross-linking and ion mobility provided unique and easily interpretable spectral multiplet features for the intermolecular cross-linked peptides. Applicationmore » of the method to two different homodimeric proteins - SrfN, a virulence factor from Salmonella Typhimurium and SO_2176, a protein of unknown function from Shewanella oneidensis- revealed several cross-linked peptides from both proteins that were identified with a low false discovery rate (estimated using a decoy approach). A greater number of cross-linked peptides were identified using ion mobility drift time information in the analysis than when the data were summed across the drift time dimension before analysis. The identified cross-linked peptides migrated more quickly in the ion mobility drift tube than the unmodified peptides.« less

Kinetics of Microbial Reduction of Solid Phase U(VI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Chongxuan; Jeon, Byong Hun; Zachara, John M.

2006-10-01

Sodium boltwoodite (NaUO2SiO3OH ?1.5H2O) was used to assess the kinetics of microbial reduction of solid phase U(VI) by a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1. The bioreduction kinetics was studied with Na-boltwoodite in suspension or within alginate beads. Concentrations of U(VI)tot and cell number were varied to evaluate the coupling of U(VI) dissolution, diffusion, and microbial activity. Batch experiments were performed in a non-growth medium with lactate as electron donor at pH 6.8 buffered with PIPES. Microscopic and spectroscopic analyses with transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and laser-induced fluorescence spectroscopy (LIFS) collectively indicated that solidmore » phase U(VI) was first dissolved and diffused out of grain interiors before it was reduced on bacterial surfaces and/or within the periplasm. The kinetics of solid phase U(VI) bioreduction was well described by a coupled model of bicarbonate-promoted dissolution of Na-boltwoodite, intraparticle uranyl diffusion, and Monod type bioreduction kinetics with respect to dissolved U(VI) concentration. The results demonstrated the intimate coupling of biological, chemical, and physical processes in microbial reduction of solid phase U(VI).« less

Single-Cell Imaging and Spectroscopic Analyses of Cr(VI) Reduction on the Surface of Bacterial Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yuanmin; Sevinc, Papatya C.; Belchik, Sara M.

2013-01-22

We investigate single-cell reduction of toxic Cr(VI) by the dissimilatory metal-reducing bacterium Shewanella oneidensis MR-1 (MR-1), an important bioremediation process, using Raman spectroscopy and scanning electron microscopy (SEM) combined with energy-dispersive X-ray spectroscopy (EDX). Our experiments indicate that the toxic and highly soluble Cr(VI) can be efficiently reduced to the less toxic and non-soluble Cr2O3 nanoparticles by MR-1. Cr2O3 is observed to emerge as nanoparticles adsorbed on the cell surface and its chemical nature is identified by EDX imaging and Raman spectroscopy. Co-localization of Cr2O3 and cytochromes by EDX imaging and Raman spectroscopy suggests a terminal reductase role for MR-1more » surface-exposed cytochromes MtrC and OmcA. Our experiments revealed that the cooperation of surface proteins OmcA and MtrC makes the reduction reaction most efficient, and the sequence of the reducing reactivity of the MR-1 is: wild type > single mutant @mtrC or mutant @omcA > double mutant (@omcA-@mtrC). Moreover, our results also suggest that the direct microbial Cr(VI) reduction and Fe(II) (hematite)-mediated Cr(VI) reduction mechanisms may co-exist in the reduction processes.« less

Integrated Microfluidic Flow-Through Microbial Fuel Cells

PubMed Central

Jiang, Huawei; Ali, Md. Azahar; Xu, Zhen; Halverson, Larry J.; Dong, Liang

2017-01-01

This paper reports on a miniaturized microbial fuel cell with a microfluidic flow-through configuration: a porous anolyte chamber is formed by filling a microfluidic chamber with three-dimensional graphene foam as anode, allowing nutritional medium to flow through the chamber to intimately interact with the colonized microbes on the scaffolds of the anode. No nutritional media flow over the anode. This allows sustaining high levels of nutrient utilization, minimizing consumption of nutritional substrates, and reducing response time of electricity generation owing to fast mass transport through pressure-driven flow and rapid diffusion of nutrients within the anode. The device provides a volume power density of 745 μW/cm3 and a surface power density of 89.4 μW/cm2 using Shewanella oneidensis as a model biocatalyst without any optimization of bacterial culture. The medium consumption and the response time of the flow-through device are reduced by 16.4 times and 4.2 times, respectively, compared to the non-flow-through counterpart with its freeway space volume six times the volume of graphene foam anode. The graphene foam enabled microfluidic flow-through approach will allow efficient microbial conversion of carbon-containing bioconvertible substrates to electricity with smaller space, less medium consumption, and shorter start-up time. PMID:28120875

A universal TagModule collection for parallel genetic analysis of microorganisms

PubMed Central

Oh, Julia; Fung, Eula; Price, Morgan N.; Dehal, Paramvir S.; Davis, Ronald W.; Giaever, Guri; Nislow, Corey; Arkin, Adam P.; Deutschbauer, Adam

2010-01-01

Systems-level analyses of non-model microorganisms are limited by the existence of numerous uncharacterized genes and a corresponding over-reliance on automated computational annotations. One solution to this challenge is to disrupt gene function using DNA tag technology, which has been highly successful in parallelizing reverse genetics in Saccharomyces cerevisiae and has led to discoveries in gene function, genetic interactions and drug mechanism of action. To extend the yeast DNA tag methodology to a wide variety of microorganisms and applications, we have created a universal, sequence-verified TagModule collection. A hallmark of the 4280 TagModules is that they are cloned into a Gateway entry vector, thus facilitating rapid transfer to any compatible genetic system. Here, we describe the application of the TagModules to rapidly generate tagged mutants by transposon mutagenesis in the metal-reducing bacterium Shewanella oneidensis MR-1 and the pathogenic yeast Candida albicans. Our results demonstrate the optimal hybridization properties of the TagModule collection, the flexibility in applying the strategy to diverse microorganisms and the biological insights that can be gained from fitness profiling tagged mutant collections. The publicly available TagModule collection is a platform-independent resource for the functional genomics of a wide range of microbial systems in the post-genome era. PMID:20494978

In Situ Molecular Imaging of the Biofilm and Its Matrix.

PubMed

Ding, Yuanzhao; Zhou, Yufan; Yao, Juan; Szymanski, Craig; Fredrickson, James; Shi, Liang; Cao, Bin; Zhu, Zihua; Yu, Xiao-Ying

2016-11-15

Molecular mapping of live biofilms at submicrometer resolution presents a grand challenge. Here, we present the first chemical mapping results of biofilm extracellular polymeric substance (EPS) in biofilms using correlative imaging between super resolution fluorescence microscopy and liquid time-of-flight secondary ion mass spectrometry (TOF-SIMS). Shewanella oneidensis is used as a model organism. Heavy metal chromate (Cr 2 O 7 2- ) anions consisting of chromium Cr(VI) was used as a model environmental stressor to treat the biofilms. Of particular interest, biologically relevant water clusters have been first observed in the biofilms. Characteristic fragments of biofilm matrix components such as proteins, polysaccharides, and lipids can be spatially imaged. Furthermore, characteristic fatty acids (e.g., palmitic acid), quinolone signal, and riboflavin fragments were found to respond after the biofilm is treated with Cr(VI), leading to biofilm dispersal. Significant changes in water clusters and quorum sensing signals indicative of intercellular communication in the aqueous environment were observed, suggesting that they might result in fatty acid synthesis and inhibition of riboflavin production. The Cr(VI) reduction seems to follow the Mtr pathway leading to Cr(III) formation. Our approach potentially opens a new avenue for mechanistic insight of microbial community processes and communications using in situ imaging mass spectrometry and super resolution optical microscopy.

Integrated Microfluidic Flow-Through Microbial Fuel Cells

NASA Astrophysics Data System (ADS)

Jiang, Huawei; Ali, Md. Azahar; Xu, Zhen; Halverson, Larry J.; Dong, Liang

2017-01-01

This paper reports on a miniaturized microbial fuel cell with a microfluidic flow-through configuration: a porous anolyte chamber is formed by filling a microfluidic chamber with three-dimensional graphene foam as anode, allowing nutritional medium to flow through the chamber to intimately interact with the colonized microbes on the scaffolds of the anode. No nutritional media flow over the anode. This allows sustaining high levels of nutrient utilization, minimizing consumption of nutritional substrates, and reducing response time of electricity generation owing to fast mass transport through pressure-driven flow and rapid diffusion of nutrients within the anode. The device provides a volume power density of 745 μW/cm3 and a surface power density of 89.4 μW/cm2 using Shewanella oneidensis as a model biocatalyst without any optimization of bacterial culture. The medium consumption and the response time of the flow-through device are reduced by 16.4 times and 4.2 times, respectively, compared to the non-flow-through counterpart with its freeway space volume six times the volume of graphene foam anode. The graphene foam enabled microfluidic flow-through approach will allow efficient microbial conversion of carbon-containing bioconvertible substrates to electricity with smaller space, less medium consumption, and shorter start-up time.

Comparative analysis of microbial fuel cell based biosensors developed with a mixed culture and Shewanella loihica PV-4 and underlying biological mechanism.

PubMed

Yi, Yue; Xie, Beizhen; Zhao, Ting; Liu, Hong

2018-06-13

Microbial fuel cell based biosensors (MFC-biosensors) utilize anode biofilms as biological recognition elements to monitor biochemical oxygen demand (BOD) and biotoxicity. However, the relatively poor sensitivity constrains the application of MFC-biosensors. To address this limitation, this study provided a systematic comparison of sensitivity between the MFC-biosensors constructed with two inocula. Higher biomass density and viability were both observed in the anode biofilm of the mixed culture MFC, which resulted in better sensitivity for BOD assessment. Compared with using mixed culture as inoculum, the anode biofilm developed with Shewanella loihica PV-4 presented lower content of extracellular polymeric substances and poorer ability to secrete protein under toxic shocks. Moreover, the looser structure in the S. loihica PV-4 biofilm further facilitated its susceptibilities to toxic agents. Therefore, the MFC-biosensor with a pure culture of S. loihica PV-4 delivered higher sensitivity for biotoxicity monitoring. This study proposed a new perspective to enhance sensor performance. Copyright © 2018 Elsevier Ltd. All rights reserved.

Enhanced biofilm formation and melanin synthesis by the oyster settlement-promoting Shewanella colwelliana is related to hydrophobic surface and simulated intertidal environment.

PubMed

Mitra, Sayani; Gachhui, Ratan; Mukherjee, Joydeep

2015-01-01

A direct relationship between biofilm formation and melanogenesis in Shewanella colwelliana with increased oyster recruitment is already established. Previously, S. colwelliana was grown in a newly patented biofilm-cultivation device, the conico-cylindrical flask (CCF), offering interchangeable hydrophobic/hydrophilic surfaces. Melanization was enhanced when S. colwelliana was cultivated in a hydrophobic vessel compared with a hydrophilic vessel. In the present study, melanogenesis in the CCF was positively correlated with increased architectural parameters of the biofilm (mean thickness and biovolume obtained by confocal laser scanning microscopy) and melanin gene (melA) expression observed by densitometry. Niche intertidal conditions were mimicked in a process operated in an ultra-low-speed rotating disk bioreactor, which demonstrated enhanced biofilm formation, melanogenesis, exopolysaccharide synthesis and melA gene expression compared with a process where 12-h periodic immersion and emersion was prevented. The wettability properties of the settling plane as well as intermittent wetting and drying, which influenced biofilm formation and melA expression, may affect oyster settlement in nature.

Microbial community analysis in rice paddy soils irrigated by acid mine drainage contaminated water.

PubMed

Sun, Min; Xiao, Tangfu; Ning, Zengping; Xiao, Enzong; Sun, Weimin

2015-03-01

Five rice paddy soils located in southwest China were selected for geochemical and microbial community analysis. These rice fields were irrigated with river water which was contaminated by Fe-S-rich acid mine drainage. Microbial communities were characterized by high-throughput sequencing, which showed 39 different phyla/groups in these samples. Among these phyla/groups, Proteobacteria was the most abundant phylum in all samples. Chloroflexi, Acidobacteria, Nitrospirae, and Bacteroidetes exhibited higher relative abundances than other phyla. A number of rare and candidate phyla were also detected. Moreover, canonical correspondence analysis suggested that pH, sulfate, and nitrate were significant factors that shaped the microbial community structure. In addition, a wide diversity of Fe- and S-related bacteria, such as GOUTA19, Shewanella, Geobacter, Desulfobacca, Thiobacillus, Desulfobacterium, and Anaeromyxobacter, might be responsible for biogeochemical Fe and S cycles in the tested rice paddy soils. Among the dominant genera, GOUTA19 and Shewanella were seldom detected in rice paddy soils.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yee, Nathan; Barkay, Tamar; Reinfelder, John

Mercury (Hg) associated with mixed waste generated by nuclear weapons manufacturing has contaminated vast areas of the Oak Ridge Reservation (ORR). Neurotoxic methylmercury (MeHg) has been formed from the inorganic Hg wastes discharged into headwaters of East Fork Poplar Creek (EFPC). Thus, understanding the processes and mechanisms that lead to Hg methylation along the flow path of EFPC is critical to predicting the impacts of the contamination and the design of remedial action at the ORR. In part I of our project, we investigated Hg(0) oxidation and methylation by anaerobic bacteria. We discovered that the anaerobic bacterium Desulfovibrio desulfuricans ND132more » can oxidize elemental mercury [Hg(0)]. When provided with dissolved elemental mercury, D. desulfuricans ND132 converts Hg(0) to Hg(II) and neurotoxic methylmercury [MeHg]. We also demonstrated that diverse species of subsurface bacteria oxidizes dissolved elemental mercury under anoxic conditions. The obligate anaerobic bacterium Geothrix fermentans H5, and the facultative anaerobic bacteria Shewanella oneidensis MR-1 and Cupriavidus metallidurans AE104 can oxidize Hg(0) to Hg(II) under anaerobic conditions. In part II of our project, we established anaerobic enrichment cultures and obtained new bacterial strains from the DOE Oak Ridge site. We isolated three new bacterial strains from subsurface sediments collected from Oak Ridge. These isolates are Bradyrhizobium sp. strain FRC01, Clostridium sp. strain FGH, and a novel Negativicutes strain RU4. Strain RU4 is a completely new genus and species of bacteria. We also demonstrated that syntrophic interactions between fermentative bacteria and sulfate-reducing bacteria in Oak Ridge saprolite mediate iron reduction via multiple mechanisms. Finally, we tested the impact of Hg on denitrification in nitrate reducing enrichment cultures derived from subsurface sediments from the Oak Ridge site, where nitrate is a major contaminant. We showed that there is an

Plants as sources of airborne bacteria, including ice nucleation-active bacteria.

PubMed

Lindemann, J; Constantinidou, H A; Barchet, W R; Upper, C D

1982-11-01

Vertical wind shear and concentration gradients of viable, airborne bacteria were used to calculate the upward flux of viable cells above bare soil and canopies of several crops. Concentrations at soil or canopy height varied from 46 colony-forming units per m over young corn and wet soil to 663 colony-forming units per m over dry soil and 6,500 colony-forming units per m over a closed wheat canopy. In simultaneous samples, concentrations of viable bacteria in the air 10 m inside an alfalfa field were fourfold higher than those over a field with dry, bare soil immediately upwind. The upward flux of viable bacteria over alfalfa was three- to fourfold greater than over dry soil. Concentrations of ice nucleation-active bacteria were higher over plants than over soil. Thus, plant canopies may constitute a major source of bacteria, including ice nucleation-active bacteria, in the air.

Direct electrochemistry of Shewanella loihica PV-4 on gold nanoparticles-modified boron-doped diamond electrodes fabricated by layer-by-layer technique.

PubMed

Wu, Wenguo; Xie, Ronggang; Bai, Linling; Tang, Zuming; Gu, Zhongze

2012-05-01

Microbial Fuel Cells (MFCs) are robust devices capable of taping biological energy, converting pollutants into electricity through renewable biomass. The fabrication of nanostructured electrodes with good bio- and electrochemical activity, play a profound role in promoting power generation of MFCs. Au nanoparticles (AuNPs)-modified Boron-Doped Diamond (BDD) electrodes are fabricated by layer-by-layer (LBL) self-assembly technique and used for the direct electrochemistry of Shewanella loihica PV-4 in an electrochemical cell. Experimental results show that the peak current densities generated on the Au/PAH multilayer-modified BDD electrodes increased from 1.25 to 2.93 microA/cm(-2) as the layer increased from 0 to 6. Different cell morphologies of S. loihica PV-4 were also observed on the electrodes and the highest density of cells was attached on the (Au/PAH)6/BDD electrode with well-formed three-dimensional nanostructure. The electrochemistry of S. loihica PV-4 was enhanced on the (Au/PAH)4/BDD electrode due to the appropriate amount of AuNPsand thickness of PAH layer.

Recovery of Elemental Palladium by Shewanella putrefaciens

NASA Astrophysics Data System (ADS)

Akasaka, S.; Xia, X.; Sawada, K.; Enokida, Y.; Yamamoto, I.; Ohnuki, T.

2006-12-01

Microbial reduction of metals plays an important role in environmental behavior and provides a technique for the recovery of metals from industrial wastewater. Recently, demand for platinum group metals (PGMs) increases by their catalytic properties. The extreme rarity of PGMs have led to a growing interest in their recovery. Palladium, one of PGMs, has different oxidation states of Pd(II) and Pd(0). The oxidized form of Pd(II) is soluble, while the reduced form of Pd(0) is insoluble. In this study, microbial reduction of palladium by Fe(III)- reducing bacterium, Shewanella putrefaceins was conducted. This bacterium is known to be capable of reducing metals, such as Mn(IV), U(VI), or Tc(VII) with organic C or H2 as an electron donor. In order to investigate the potential of S. putrefaciens to reduce Pd(II) in solution, resting cells or heat-killed cells were suspended under anaerobic conditions with lactate or H2 as an electron donor. The cells of S. putrefaciens (NBRC3908) were grown in aerobic medium, harvested by centrifugation, and then washed with 25 mmol/dm3 HEPES and 100 mmol/dm3 NaCl (HEPES-NaCl) solution (pH 7.0). The heat-killed cells were autoclaved for 20 min at 121 degrees C. The cell suspension (21.5 mg in dry weight) was resuspended in the HEPES-NaCl solution which contained 1.0 mmol/dm3 Na2PdCl4 (Wako Pure chemical Industries, Ltd). The suspensions were bubbled with N2 for 15 min before 10 mmol/dm3 lactate or 4.8 v/v% H2 was added. The suspensions were then incubated at 30 degrees C. Redox potential (Eh) and pH of the solutions were measured in an inert glove box with Ar gas. Concentration of Pd(II) was measured by Inductively Coupled Plasma Atomic Emission Spectrometer (ICP-AES). Deposited Pd and cells were analyzed by X-ray powder diffraction (XRD) and Scanning Electron Microscope (SEM) with Energy-Dispersive Spectroscopy (EDS). Approximately 86% of Pd(II) of the initial concentration was removed from solution by the resting cells within 24 h when

Microbiological spoilage of fish and fish products.

PubMed

Gram, L; Huss, H H

1996-11-01

Spoilage of fresh and lightly preserved fish products is caused by microbial action. This paper reviews the current knowledge in terms of the microbiology of fish and fish products with particular emphasis on identification of specific spoilage bacteria and the qualitative and quantitative biochemical indicators of spoilage. Shewanella putrefaciens and Pseudomonas spp. are the specific spoilage bacteria of iced fresh fish regardless of the origin of the fish. Modified atmosphere stored marine fish from temperate waters are spoiled by the CO2 resistant Photobacterium phosphoreum whereas Gram-positive bacteria are likely spoilers of CO2 packed fish from fresh or tropical waters. Fish products with high salt contents may spoil due to growth of halophilic bacteria (salted fish) or growth of anaerobic bacteria and yeasts (barrel salted fish). Whilst the spoilage of fresh and highly salted fish is well understood, much less is known about spoilage of lightly preserved fish products. It is concluded that the spoilage is probably caused by lactic acid bacteria, certain psychotrophic Enterobacteriaceae and/or Photobacterium phosphoreum. However, more work is needed in this area.

Methanotrophic bacteria.

PubMed Central

Hanson, R S; Hanson, T E

1996-01-01

Methane-utilizing bacteria (methanotrophs) are a diverse group of gram-negative bacteria that are related to other members of the Proteobacteria. These bacteria are classified into three groups based on the pathways used for assimilation of formaldehyde, the major source of cell carbon, and other physiological and morphological features. The type I and type X methanotrophs are found within the gamma subdivision of the Proteobacteria and employ the ribulose monophosphate pathway for formaldehyde assimilation, whereas type II methanotrophs, which employ the serine pathway for formaldehyde assimilation, form a coherent cluster within the beta subdivision of the Proteobacteria. Methanotrophic bacteria are ubiquitous. The growth of type II bacteria appears to be favored in environments that contain relatively high levels of methane, low levels of dissolved oxygen, and limiting concentrations of combined nitrogen and/or copper. Type I methanotrophs appear to be dominant in environments in which methane is limiting and combined nitrogen and copper levels are relatively high. These bacteria serve as biofilters for the oxidation of methane produced in anaerobic environments, and when oxygen is present in soils, atmospheric methane is oxidized. Their activities in nature are greatly influenced by agricultural practices and other human activities. Recent evidence indicates that naturally occurring, uncultured methanotrophs represent new genera. Methanotrophs that are capable of oxidizing methane at atmospheric levels exhibit methane oxidation kinetics different from those of methanotrophs available in pure cultures. A limited number of methanotrophs have the genetic capacity to synthesize a soluble methane monooxygenase which catalyzes the rapid oxidation of environmental pollutants including trichloroethylene. PMID:8801441

Effects of atmospheric air plasma treatment of graphite and carbon felt electrodes on the anodic current from Shewanella attached cells.

PubMed

Epifanio, Monica; Inguva, Saikumar; Kitching, Michael; Mosnier, Jean-Paul; Marsili, Enrico

2015-12-01

The attachment of electrochemically active microorganisms (EAM) on an electrode is determined by both the chemistry and topography of the electrode surface. Pre-treatment of the electrode surface by atmospheric air plasma introduces hydrophilic functional groups, thereby increasing cell attachment and electroactivity in short-term experiments. In this study, we use graphite and carbon felt electrodes to grow the model EAM Shewanella loihica PV-4 at oxidative potential (0.2 V vs. Ag/AgCl). Cell attachment and electroactivity are measured through electrodynamic methods. Atmospheric air plasma pre-treatment increases cell attachment and current output at graphite electrodes by 25%, while it improves the electroactivity of the carbon felt electrodes by 450%. Air plasma pre-treatment decreased the coulombic efficiency on both carbon felt and graphite electrodes by 60% and 80%, respectively. Microbially produced flavins adsorb preferentially at the graphite electrode, and air plasma pre-treatment results in lower flavin adsorption at both graphite and carbon felt electrodes. Results show that air plasma pre-treatment is a feasible option to increase current output in bioelectrochemical systems. Copyright © 2015 Elsevier B.V. All rights reserved.

The life cycle of iron Fe(III) oxide: impact of fungi and bacteria

NASA Astrophysics Data System (ADS)

Bonneville, Steeve

2014-05-01

Iron oxides are ubiquitous reactive constituents of soils, sediments and aquifers. They exhibit vast surface areas which bind a large array of trace metals, nutrients and organic molecules hence controlling their mobility/reactivity in the subsurface. In this context, understanding the "life cycle" of iron oxide in soils is paramount to many biogeochemical processes. Soils environments are notorious for their extreme heterogeneity and variability of chemical, physical conditions and biological agents at play. Here, we present studies investigating the role of two biological agents driving iron oxide dynamics in soils, root-associated fungi (mycorrhiza) and bacteria. Mycorrhiza filaments (hypha) grow preferentially around, and on the surface of nutrient-rich minerals, making mineral-fungi contact zones, hot-spots of chemical alteration in soils. However, because of the microscopic nature of hyphae (only ~ 5 µm wide for up to 1 mm long) and their tendency to strongly adhere to mineral surface, in situ observations of this interfacial micro-environment are scarce. In a microcosm, ectomycorrhiza (Paxillus involutus) was grown symbiotically with a pine tree (Pinus sylvestris) in the presence of freshly-cleaved biotite under humid, yet undersaturated, conditions typical of soils. Using spatially-resolved ion milling technique (FIB), transmission electron microscopy and spectroscopy (TEM/STEM-EDS), synchrotron based X-ray microscopy (STXM), we were able to quantify the speciation of Fe at the biotite-hypha interface. The results shows that substantial oxidation of biotite structural-Fe(II) into Fe(III) subdomains occurs at the contact zone between mycorrhiza and biotite. Once formed, iron(III) oxides can reductively dissolve under suboxic conditions via several abiotic and microbial pathways. In particular, they serve as terminal electron acceptors for the oxidation of organic matter by iron reducing bacteria. We aimed here to understand the role of Fe(III) mineral

A solvent-free microbial-activated air cathode battery paper platform made with pencil-traced graphite electrodes.

PubMed

Lee, Seung Ho; Ban, Ju Yeon; Oh, Chung-Hun; Park, Hun-Kuk; Choi, Samjin

2016-06-23

We present the fabrication of an ultra-low cost, disposable, solvent-free air cathode all-paper microbial fuel cell (MFC) that does not utilize any chemical treatments. The anode and cathode were fabricated by depositing graphite particles by drawing them on paper with a pencil (four strokes). Hydrophobic parchment paper was used as a proton exchange membrane (PEM) to allow only H(+) to pass. Air cathode MFC technology, where O2 was used as an electron acceptor, was implemented on the paper platform. The bioelectric current was generated by an electrochemical process involving the redox couple of microbial-activated extracellular electron transferred electrons, PEM-passed H(+), and O2 in the cathode. A fully micro-integrated pencil-traced MFC showed a fast start-time, producing current within 10 s after injection of bacterial cells. A single miniaturized all-paper air cathode MFC generated a maximum potential of 300 mV and a maximum current of 11 μA during 100 min after a single injection of Shewanella oneidensis. The micro-fabricated solvent-free air cathode all-paper MFC generated a power of 2,270 nW (5.68 mW/m(2)). The proposed solvent-free air cathode paper-based MFC device could be used for environmentally-friendly energy storage as well as in single-use medical power supplies that use organic matter.

A solvent-free microbial-activated air cathode battery paper platform made with pencil-traced graphite electrodes

PubMed Central

Lee, Seung Ho; Ban, Ju Yeon; Oh, Chung-Hun; Park, Hun-Kuk; Choi, Samjin

2016-01-01

We present the fabrication of an ultra-low cost, disposable, solvent-free air cathode all-paper microbial fuel cell (MFC) that does not utilize any chemical treatments. The anode and cathode were fabricated by depositing graphite particles by drawing them on paper with a pencil (four strokes). Hydrophobic parchment paper was used as a proton exchange membrane (PEM) to allow only H+ to pass. Air cathode MFC technology, where O2 was used as an electron acceptor, was implemented on the paper platform. The bioelectric current was generated by an electrochemical process involving the redox couple of microbial-activated extracellular electron transferred electrons, PEM-passed H+, and O2 in the cathode. A fully micro-integrated pencil-traced MFC showed a fast start-time, producing current within 10 s after injection of bacterial cells. A single miniaturized all-paper air cathode MFC generated a maximum potential of 300 mV and a maximum current of 11 μA during 100 min after a single injection of Shewanella oneidensis. The micro-fabricated solvent-free air cathode all-paper MFC generated a power of 2,270 nW (5.68 mW/m2). The proposed solvent-free air cathode paper-based MFC device could be used for environmentally-friendly energy storage as well as in single-use medical power supplies that use organic matter. PMID:27333815

Influence of Calcium on Microbial Reduction of Solid Phase Uranium (VI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Chongxuan; Jeon, Byong-Hun; Zachara, John M.

2007-06-27

The effect of calcium on microbial reduction of a solid phase U(VI), sodium boltwoodite (NaUO2SiO3OH ∙1.5H2O), was evaluated in a culture of a dissimilatory metal-reducing bacterium (DMRB), Shewanella oneidensis strain MR-1. Batch experiments were performed in a non-growth bicarbonate medium with lactate as electron donor at pH 7 buffered with PIPES. Calcium increased both the rate and extent of Na-boltwoodite dissolution by increasing its solubility through the formation of a ternary aqueous calcium-uranyl-carbonate species. The ternary species, however, decreased the rates of microbial reduction of aqueous U(VI). Laser-induced fluorescence spectroscopy (LIFS) and transmission electron microscopy (TEM) revealed that microbial reductionmore » of solid phase U(VI) is a sequentially coupled process of Na-boltwoodite dissolution, U(VI) aqueous speciation, and microbial reduction of dissolved U(VI) to U(IV) that accumulated on bacterial surfaces/periplasm. The overall rates of microbial reduction of solid phase U(VI) can be described by the coupled rates of dissolution and microbial reduction that were both influenced by calcium. The results demonstrated that dissolved U(VI) concentration during microbial reduction was a complex function of solid phase U(VI) dissolution kinetics, aqueous U(VI) speciation, and microbial activity.« less

Linking Spectral Induced Polarization (SIP) and Subsurface Microbial Processes: Results from Sand Column Incubation Experiments.

PubMed

Mellage, Adrian; Smeaton, Christina M; Furman, Alex; Atekwana, Estella A; Rezanezhad, Fereidoun; Van Cappellen, Philippe

2018-02-20

Geophysical techniques, such as spectral induced polarization (SIP), offer potentially powerful approaches for in situ monitoring of subsurface biogeochemistry. The successful implementation of these techniques as monitoring tools for reactive transport phenomena, however, requires the deconvolution of multiple contributions to measured signals. Here, we present SIP spectra and complementary biogeochemical data obtained in saturated columns packed with alternating layers of ferrihydrite-coated and pure quartz sand, and inoculated with Shewanella oneidensis supplemented with lactate and nitrate. A biomass-explicit diffusion-reaction model is fitted to the experimental biogeochemical data. Overall, the results highlight that (1) the temporal response of the measured imaginary conductivity peaks parallels the microbial growth and decay dynamics in the columns, and (2) SIP is sensitive to changes in microbial abundance and cell surface charging properties, even at relatively low cell densities (<10 8 cells mL -1 ). Relaxation times (τ) derived using the Cole-Cole model vary with the dominant electron accepting process, nitrate or ferric iron reduction. The observed range of τ values, 0.012-0.107 s, yields effective polarization diameters in the range 1-3 μm, that is, 2 orders of magnitude smaller than the smallest quartz grains in the columns, suggesting that polarization of the bacterial cells controls the observed chargeability and relaxation dynamics in the experiments.

A miniature microbial fuel cell operating with an aerobic anode chamber

NASA Astrophysics Data System (ADS)

Ringeisen, Bradley R.; Ray, Ricky; Little, Brenda

A miniature microbial fuel cell (mini-MFC) is described that utilizes an aerobic culture of Shewanella oneidensis DSP10 as the active electrochemical species in the anode chamber. We find that the maximum aerobic mini-MFC power without the addition of exogenous mediators was 0.40 mW, a 33% decrease when compared with an anaerobic DSP10 culture (0.6 mW) operating in the mini-MFC. This decrease is most likely due to the presence of dissolved oxygen in the anode chamber that scavenges electrons to form water, thereby reducing the number of electrons donated to the anode. Aerobic power and current density at maximum power using the true surface area of the anode (611 cm 2) were calculated to be 6.5 mW m -2 and 13 mA m -2. The power density rises to 2.0 W m -2 and 330 W m -3 when calculated using the cross-sectional area and volume of the device (2 cm 2, 1.2 cm 3). The Coulombic efficiency was also reduced from 11 to 5% when using the aerobic versus anaerobic culture. Similar results were found when the external mediator anthraquinone-2,6-disulfonate (AQDS) was added to the aerobic culture, resulting in a maximum power of 0.54 mW, a 37% drop in power when compared to the anaerobic mediated system.

In Situ Molecular Imaging of the Biofilm and Its Matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, Yuanzhao; Zhou, Yufan; Yao, Juan

2016-11-15

Molecular mapping of live biofilms at submicron resolution presents a grand challenge. Here, we present the first chemical mapping results of biofilm extracellular polymeric sub-stance (EPS) components in biofilms using correlative imaging be-tween super resolution florescence microscopy and liquid time-of-flight secondary ion mass spectrometry (ToF-SIMS). Shewanella oneidensis is used as a model organism. Heavy metal anions chro-mate (Cr2O72-) consisting of chromium Cr (VI) was a model envi-ronmental stressor used to treat the biofilms. Of particular interest, biologically relevant water clusters have been first observed in the biofilms. Characteristic fragments of biofilm matrix components such as proteins, polysaccharides, and lipids canmore » be spatially im-aged. Furthermore, characteristic fatty acids (e.g., palmitic acid), quinolone signal, and riboflavin fragments are found to respond af-ter the biofilm is treated with Cr (VI), leading to biofilm dispersion. Significant changes in water clusters and quorum sensing signals indicative of intercellular communication in the aqueous environ-ment are observed, suggesting that they might result in fatty acid synthesis and inhibit riboflavin production. The Cr (VI) reduction seems to follow the Mtr pathway leading to Cr (III) formation. Our approach potentially opens a new avenue for mechanistic insight of microbial community processes and communications using in situ imaging mass spectrometry and superresolution optical micros-copy.« less

A Decaheme Cytochrome as a Molecular Electron Conduit in Dye-Sensitized Photoanodes

PubMed Central

Hwang, Ee Taek; Sheikh, Khizar; Orchard, Katherine L; Hojo, Daisuke; Radu, Valentin; Lee, Chong-Yong; Ainsworth, Emma; Lockwood, Colin; Gross, Manuela A; Adschiri, Tadafumi; Reisner, Erwin; Butt, Julea N; Jeuken, Lars J C

2015-01-01

In nature, charge recombination in light-harvesting reaction centers is minimized by efficient charge separation. Here, it is aimed to mimic this by coupling dye-sensitized TiO2 nanocrystals to a decaheme protein, MtrC from Shewanella oneidensis MR-1, where the 10 hemes of MtrC form a ≈7-nm-long molecular wire between the TiO2 and the underlying electrode. The system is assembled by forming a densely packed MtrC film on an ultra-flat gold electrode, followed by the adsorption of approximately 7 nm TiO2 nanocrystals that are modified with a phosphonated bipyridine Ru(II) dye (RuP). The step-by-step construction of the MtrC/TiO2 system is monitored with (photo)electrochemistry, quartz-crystal microbalance with dissipation (QCM-D), and atomic force microscopy (AFM). Photocurrents are dependent on the redox state of the MtrC, confirming that electrons are transferred from the TiO2 nanocrystals to the surface via the MtrC conduit. In other words, in these TiO2/MtrC hybrid photodiodes, MtrC traps the conduction-band electrons from TiO2 before transferring them to the electrode, creating a photobioelectrochemical system in which a redox protein is used to mimic the efficient charge separation found in biological photosystems. PMID:26180522

Dehydrochlorination of 1,1,1-trichloroethane and pentachloroethane by microbially reduced ferruginous smectite.

PubMed

Cervini-Silva, Javiera; Kostka, Joel E; Larson, Richard A; Stucki, Joseph W; Wu, Jun

2003-05-01

Reduction of structural Fe(III) in smectite clay minerals has been identified as a means to promote dechlorination of polychlorinated ethanes, but its environmental significance has yet to be fully assessed because Fe reduction has normally been achieved by agents uncommon in the environment (e.g., dithionite). This study reports the dehydrochlorination of pentachloroethane and 1,1,1-trichloroethane in the presence of ferruginous smectite reduced by two cultures of microorganisms, Shewanella oneidensis strain MR-1 (MR-R) and an enrichment culture from rice paddy soils (PS-R), in aqueous suspension under anoxic conditions. Microbially reduced ferruginous smectite facilitated dehydrochlorination of 1,1,1-trichloroethane to 1,1-dichloroethene with up to 60% conversion within 3 h of incubation time. In contrast, no formation of 1,1-dichloroethene was observed after incubation of 1,1,1-trichloroethane with chemically reduced ferruginous smectite for 24 h. Microbially reduced ferruginous smectite by MR-R and PS-R promoted the dehydrochlorination of pentachloroethane to tetrachloroethene by 80 and 15%, respectively, after 3 h of incubation time. The conversion of pentachloroethane to tetrachloroethene in the presence of chemically reduced ferruginous smectite after 24 h was 65%. These results indicate that structural Fe(II) in clay minerals has the potential to be an important reductant controlling the fate of organic chemicals in contaminated sediments.

A solvent-free microbial-activated air cathode battery paper platform made with pencil-traced graphite electrodes

NASA Astrophysics Data System (ADS)

Lee, Seung Ho; Ban, Ju Yeon; Oh, Chung-Hun; Park, Hun-Kuk; Choi, Samjin

2016-06-01

We present the fabrication of an ultra-low cost, disposable, solvent-free air cathode all-paper microbial fuel cell (MFC) that does not utilize any chemical treatments. The anode and cathode were fabricated by depositing graphite particles by drawing them on paper with a pencil (four strokes). Hydrophobic parchment paper was used as a proton exchange membrane (PEM) to allow only H+ to pass. Air cathode MFC technology, where O2 was used as an electron acceptor, was implemented on the paper platform. The bioelectric current was generated by an electrochemical process involving the redox couple of microbial-activated extracellular electron transferred electrons, PEM-passed H+, and O2 in the cathode. A fully micro-integrated pencil-traced MFC showed a fast start-time, producing current within 10 s after injection of bacterial cells. A single miniaturized all-paper air cathode MFC generated a maximum potential of 300 mV and a maximum current of 11 μA during 100 min after a single injection of Shewanella oneidensis. The micro-fabricated solvent-free air cathode all-paper MFC generated a power of 2,270 nW (5.68 mW/m2). The proposed solvent-free air cathode paper-based MFC device could be used for environmentally-friendly energy storage as well as in single-use medical power supplies that use organic matter.

Heterogeneity of the electron exchange capacity of kitchen waste compost-derived humic acids based on fluorescence components.

PubMed

Yuan, Ying; Tan, Wen-Bing; He, Xiao-Song; Xi, Bei-Dou; Gao, Ru-Tai; Zhang, Hui; Dang, Qiu-Ling; Li, Dan

2016-11-01

Composting is widely used for recycling of kitchen waste to improve soil properties, which is mainly attributed to the nutrient and structural functions of compost-derived humic acids (HAs). However, the redox properties of compost-derived HAs are not fully explored. Here, a unique framework is employed to investigate the electron exchange capacity (EEC) of HAs during kitchen waste composting. Most components of compost-derived HAs hold EEC, but nearly two-thirds of them are found to be easily destroyed by Shewanella oneidensis MR-1 and thus result in an EEC lower than the electron - donating capacity in compost-derived HAs. Fortunately, a refractory component also existed within compost-derived HAs and could serve as a stable and effective electron shuttle to promote the MR-1 involved in Fe(III) reduction, and its EEC was significantly correlated with the aromaticity and the amount of quinones. Nevertheless, with the increase of composting time, the EEC of the refractory component did not show an increasing trend. These results implied that there was an optimal composting time to maximize the production of HAs with more refractory and redox molecules. Recognition of the heterogeneity of EEC of the compost-derived HAs enables an efficient utilization of the composts for a variety of environmental applications. Graphical abstract Microbial reduction of compost-derived HAs.

Back To Bacteria.

ERIC Educational Resources Information Center

Flannery, Maura C.

1997-01-01

Explores new research about bacteria. Discusses bacterial genomes, archaea, unusual environments, evolution, pathogens, bacterial movement, biofilms, bacteria in the body, and a bacterial obsession. Contains 29 references. (JRH)

Winter kill in intensively stocked channel catfish (Ictalurus punctatus): Coinfection with Aeromonas veronii, Streptococcus parauberis and Shewanella putrefaciens.

PubMed

Mohammed, Haitham H; Peatman, Eric

2018-06-07

Unusual persistent natural mortality occurred in a floating in-pond raceway system intensively stocked with channel and hybrid catfish beginning in early November 2016 up until March 2017. The temperature during the period of outbreak ranged from 7.2 to 23.7°C. Gross examination of freshly dead and moribund fish revealed pale gills, slight abdominal distension and swollen inflamed vents. Comprehensive necropsy of 20 fish demonstrated vast amounts of bloody ascitic fluid in the coelomic cavity, visceral congestion, splenomegaly and pale friable livers but macroscopically normal kidneys, suggesting systemic bacterial infection. Bacterial cultures were initiated from skin, gills and major internal organs. Following incubation, a mixture of three bacterial colony phenotypes was observed on agar plates. Presumptive biochemical characterization of the isolates followed by 16S-rRNA sequence analysis resulted in the identification of Aeromonas veronii, Streptococcus parauberis and Shewanella putrefaciens. Channel catfish juveniles were experimentally infected with the recovered isolates to fulfil Koch's postulates. Moreover, an antibiogram was used to evaluate the susceptibility of the isolates to antimicrobial drugs approved for use in aquaculture. Aquaflor was used successfully for treatment. Here, we report bacterial coinfection lead by A. veronii and the first identification of S. parauberis and S. putrefaciens from cultured catfish in North America. © 2018 John Wiley & Sons Ltd.

Inactivation of biofilm bacteria.

PubMed Central

LeChevallier, M W; Cawthon, C D; Lee, R G

1988-01-01

The current project was developed to examine inactivation of biofilm bacteria and to characterize the interaction of biocides with pipe surfaces. Unattached bacteria were quite susceptible to the variety of disinfectants tested. Viable bacterial counts were reduced 99% by exposure to 0.08 mg of hypochlorous acid (pH 7.0) per liter (1 to 2 degrees C) for 1 min. For monochloramine, 94 mg/liter was required to kill 99% of the bacteria within 1 min. These results were consistent with those found by other investigators. Biofilm bacteria grown on the surfaces of granular activated carbon particles, metal coupons, or glass microscope slides were 150 to more than 3,000 times more resistant to hypochlorous acid (free chlorine, pH 7.0) than were unattached cells. In contrast, resistance of biofilm bacteria to monochloramine disinfection ranged from 2- to 100-fold more than that of unattached cells. The results suggested that, relative to inactivation of unattached bacteria, monochloramine was better able to penetrate and kill biofilm bacteria than free chlorine. For free chlorine, the data indicated that transport of the disinfectant into the biofilm was a major rate-limiting factor. Because of this phenomenon, increasing the level of free chlorine did not increase disinfection efficiency. Experiments where equal weights of disinfectants were used suggested that the greater penetrating power of monochloramine compensated for its limited disinfection activity. These studies showed that monochloramine was as effective as free chlorine for inactivation of biofilm bacteria. The research provides important insights into strategies for control of biofilm bacteria. Images PMID:2849380

Simultaneous Transformation of Commingled Trichloroethylene, Tetrachloroethylene, and 1,4-Dioxane by a Microbially Driven Fenton Reaction in Batch Liquid Cultures.

PubMed

Sekar, Ramanan; Taillefert, Martial; DiChristina, Thomas J

2016-11-01

Improper disposal of 1,4-dioxane and the chlorinated organic solvents trichloroethylene (TCE) and tetrachloroethylene (also known as perchloroethylene [PCE]) has resulted in widespread contamination of soil and groundwater. In the present study, a previously designed microbially driven Fenton reaction system was reconfigured to generate hydroxyl (HO˙) radicals for simultaneous transformation of source zone levels of single, binary, and ternary mixtures of TCE, PCE, and 1,4-dioxane. The reconfigured Fenton reaction system was driven by fed batch cultures of the Fe(III)-reducing facultative anaerobe Shewanella oneidensis amended with lactate, Fe(III), and contaminants and exposed to alternating anaerobic and aerobic conditions. To avoid contaminant loss due to volatility, the Fe(II)-generating, hydrogen peroxide-generating, and contaminant transformation phases of the microbially driven Fenton reaction system were separated. The reconfigured Fenton reaction system transformed TCE, PCE, and 1,4-dioxane either as single contaminants or as binary and ternary mixtures. In the presence of equimolar concentrations of PCE and TCE, the ratio of the experimentally derived rates of PCE and TCE transformation was nearly identical to the ratio of the corresponding HO˙ radical reaction rate constants. The reconfigured Fenton reaction system may be applied as an ex situ platform for simultaneous degradation of commingled TCE, PCE, and 1,4-dioxane and provides valuable information for future development of in situ remediation technologies. A microbially driven Fenton reaction system [driven by the Fe(III)-reducing facultative anaerobe S. oneidensis] was reconfigured to transform source zone levels of TCE, PCE, and 1,4-dioxane as single contaminants or as binary and ternary mixtures. The microbially driven Fenton reaction may thus be applied as an ex situ platform for simultaneous degradation of at least three (and potentially more) commingled contaminants. Additional targets for

Simultaneous Transformation of Commingled Trichloroethylene, Tetrachloroethylene, and 1,4-Dioxane by a Microbially Driven Fenton Reaction in Batch Liquid Cultures

PubMed Central

Sekar, Ramanan; Taillefert, Martial

2016-01-01

ABSTRACT Improper disposal of 1,4-dioxane and the chlorinated organic solvents trichloroethylene (TCE) and tetrachloroethylene (also known as perchloroethylene [PCE]) has resulted in widespread contamination of soil and groundwater. In the present study, a previously designed microbially driven Fenton reaction system was reconfigured to generate hydroxyl (HO˙) radicals for simultaneous transformation of source zone levels of single, binary, and ternary mixtures of TCE, PCE, and 1,4-dioxane. The reconfigured Fenton reaction system was driven by fed batch cultures of the Fe(III)-reducing facultative anaerobe Shewanella oneidensis amended with lactate, Fe(III), and contaminants and exposed to alternating anaerobic and aerobic conditions. To avoid contaminant loss due to volatility, the Fe(II)-generating, hydrogen peroxide-generating, and contaminant transformation phases of the microbially driven Fenton reaction system were separated. The reconfigured Fenton reaction system transformed TCE, PCE, and 1,4-dioxane either as single contaminants or as binary and ternary mixtures. In the presence of equimolar concentrations of PCE and TCE, the ratio of the experimentally derived rates of PCE and TCE transformation was nearly identical to the ratio of the corresponding HO˙ radical reaction rate constants. The reconfigured Fenton reaction system may be applied as an ex situ platform for simultaneous degradation of commingled TCE, PCE, and 1,4-dioxane and provides valuable information for future development of in situ remediation technologies. IMPORTANCE A microbially driven Fenton reaction system [driven by the Fe(III)-reducing facultative anaerobe S. oneidensis] was reconfigured to transform source zone levels of TCE, PCE, and 1,4-dioxane as single contaminants or as binary and ternary mixtures. The microbially driven Fenton reaction may thus be applied as an ex situ platform for simultaneous degradation of at least three (and potentially more) commingled contaminants

[Immobilization of introduced bacteria and degradation of pyrene and benzo(alpha) pyrene in soil by immobilized bacteria].

PubMed

Wang, Xin; Li, Peijun; Song, Shouzhi; Zhong, Yong; Zhang, Hui; Verkhozina, E V

2006-11-01

In this study, introduced bacteria were applied in the bioremediation of pyrene and benzo (alpha) pyrene in organic pollutants-contaminated soils, aimed to test whether it was feasible to introduce bacteria to environmental engineering. Three introduced bacteria were immobilized separately or together to degrade the pyrene and benzo (alpha) pyrene in soil, taking dissociated bacteria as the control, and comparing with three indigenous bacteria. The results showed that immobilized introduced bacteria, either single or mixed, had higher degradation efficiency than dissociated bacteria. Compared with indigenous bacteria, some introduced bacteria had predominance to some degree. The introduced bacteria-mixture had better degradation efficiency after being immobilized. The degradation rate of pyrene and benzo(alpha) pyrene after treated with immobilized bacteria-( B61-B67)-mixture for 96 hours was 43.49% and 38.55%, respectively.

The fecal bacteria

USGS Publications Warehouse

Sadowsky, Michael J.; Whitman, Richard L.

2011-01-01

The Fecal Bacteria offers a balanced, integrated discussion of fecal bacteria and their presence and ecology in the intestinal tract of mammals, in the environment, and in the food supply. This volume covers their use in examining and assessing water quality in order to offer protection from illnesses related to swimming in or ingesting contaminated water, in addition to discussing their use in engineering considerations of water quality, modeling, monitoring, and regulations. Fecal bacteria are additionally used as indicators of contamination of ready-to-eat foods and fresh produce. The intestinal environment, the microbial community structure of the gut microbiota, and the physiology and genomics of this broad group of microorganisms are explored in the book. With contributions from an internationally recognized group of experts, the book integrates medicine, public health, environmental, and microbiological topics in order to provide a unique, holistic understanding of fecal bacteria. Moreover, it shows how the latest basic science and applied research findings are helping to solve problems and develop effective management strategies. For example, readers will discover how the latest tools and molecular approaches have led to our current understanding of fecal bacteria and enabled us to improve human health and water quality. The Fecal Bacteria is recommended for microbiologists, clinicians, animal scientists, engineers, environmental scientists, food safety experts, water quality managers, and students. It will help them better understand fecal bacteria and use their knowledge to protect human and environmental health. They can also apply many of the techniques and molecular tools discussed in this book to the study of a broad range of microorganisms in a variety of habitats.

[Darwin and bacteria].

PubMed

Ledermann D, Walter

2009-02-01

As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never took knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.

Bleach vs. Bacteria

MedlinePlus

... Inside Life Science > Bleach vs. Bacteria Inside Life Science View All Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds ... For Proteins, Form Shapes Function This Inside Life Science article also appears on LiveScience . Learn about related ...

Effects of temperature and dissolved oxygen on Se(IV) removal and Se(0) precipitation by Shewanella sp. HN-41.

PubMed

Lee, Ji-Hoon; Han, Jaehong; Choi, Heechul; Hur, Hor-Gil

2007-08-01

Facultative anaerobic Shewanella sp. strain HN-41 was able to utilize selenite (Se(IV)) as a sole electron acceptor for respiration in anaerobic condition, resulting in reduction of Se(IV) and then precipitation of elemental Se nano-sized spherical particles, which were identified using energy-dispersive X-ray spectroscopy and X-ray absorption near-edge structure spectroscopy. When the effects on Se(IV) reduction to elemental Se were studied by varying incubation temperatures and dissolved oxygen contents, Se(IV) reduction occurred more actively with higher removal rate of Se(IV) in aqueous phase and well-shaped spherical Se(0) nanoparticles were formed from the incubations under N(2) (100%) or N(2):O(2) (80%:20%) at 30 degrees C with average diameter values of 181+/-40 nm and 164+/-24 nm, respectively, while relatively less amounts of irregular-shaped Se(0) nanoparticles were produced with negligible amount of Se(IV) reduction and removal under 100% of O(2). The Se particle size distributions based on scanning electron microscopy also showed a general tendency towards decreased Se particle size as oxygen content increased, whereas the particle size seemed uncorrelated to the change in the incubation temperature. These results also suggest that the size-controlled biological Se(0) nanospheres production may be achieved simply by changing the culture conditions.

Sequence and Genetic Characterization of etrA, an fnr Analog that Regulates Anaerobic Respiration in Shewanella putrefaciens MR-1

NASA Technical Reports Server (NTRS)

Saffarini, Daad A.; Nelson, Kenneth H.

1993-01-01

An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.

Living bacteria in silica gels

NASA Astrophysics Data System (ADS)

Nassif, Nadine; Bouvet, Odile; Noelle Rager, Marie; Roux, Cécile; Coradin, Thibaud; Livage, Jacques

2002-09-01

The encapsulation of enzymes within silica gels has been extensively studied during the past decade for the design of biosensors and bioreactors. Yeast spores and bacteria have also been recently immobilized within silica gels where they retain their enzymatic activity, but the problem of the long-term viability of whole cells in an inorganic matrix has never been fully addressed. It is a real challenge for the development of sol-gel processes. Generic tests have been performed to check the viability of Escherichia coli bacteria in silica gels. Surprisingly, more bacteria remain culturable in the gel than in an aqueous suspension. The metabolic activity of the bacteria towards glycolysis decreases slowly, but half of the bacteria are still viable after one month. When confined within a mineral environment, bacteria do not form colonies. The exchange of chemical signals between isolated bacteria rather than aggregates can then be studied, a point that could be very important for 'quorum sensing'.

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.

The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less

Functional genomics to discover antibiotic resistance genes: The paradigm of resistance to colistin mediated by ethanolamine phosphotransferase in Shewanella algae MARS 14.

PubMed

Telke, Amar A; Rolain, Jean-Marc

2015-12-01

Shewanella algae MARS 14 is a colistin-resistant clinical isolate retrieved from bronchoalveolar lavage of a hospitalised patient. A functional genomics strategy was employed to discover the molecular support for colistin resistance in S. algae MARS 14. A pZE21 MCS-1 plasmid-based genomic expression library was constructed in Escherichia coli TOP10. The estimated library size was 1.30×10(8) bp. Functional screening of colistin-resistant clones was carried out on Luria-Bertani agar containing 8 mg/L colistin. Five colistin-resistant clones were obtained after complete screening of the genomic expression library. Analysis of DNA sequencing results found a unique gene in all selected clones. Amino acid sequence analysis of this unique gene using the Integrated Microbial Genomes (IMG) and KEGG databases revealed that this gene encodes ethanolamine phosphotransferase (EptA, or so-called PmrC). Reverse transcription PCR analysis indicated that resistance to colistin in S. algae MARS 14 was associated with overexpression of EptA (27-fold increase), which plays a crucial role in the arrangement of outer membrane lipopolysaccharide. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Lipopolysaccharides in diazotrophic bacteria.

PubMed

Serrato, Rodrigo V

2014-01-01

Biological nitrogen fixation (BNF) is a process in which the atmospheric nitrogen (N2) is transformed into ammonia (NH3) by a select group of nitrogen-fixing organisms, or diazotrophic bacteria. In order to furnish the biologically useful nitrogen to plants, these bacteria must be in constant molecular communication with their host plants. Some of these molecular plant-microbe interactions are very specific, resulting in a symbiotic relationship between the diazotroph and the host. Others are found between associative diazotrophs and plants, resulting in plant infection and colonization of internal tissues. Independent of the type of ecological interaction, glycans, and glycoconjugates produced by these bacteria play an important role in the molecular communication prior and during colonization. Even though exopolysaccharides (EPS) and lipochitooligosaccharides (LCO) produced by diazotrophic bacteria and released onto the environment have their importance in the microbe-plant interaction, it is the lipopolysaccharides (LPS), anchored on the external membrane of these bacteria, that mediates the direct contact of the diazotroph with the host cells. These molecules are extremely variable among the several species of nitrogen fixing-bacteria, and there are evidences of the mechanisms of infection being closely related to their structure.

Lipopolysaccharides in diazotrophic bacteria

PubMed Central

Serrato, Rodrigo V.

2014-01-01

Biological nitrogen fixation (BNF) is a process in which the atmospheric nitrogen (N2) is transformed into ammonia (NH3) by a select group of nitrogen-fixing organisms, or diazotrophic bacteria. In order to furnish the biologically useful nitrogen to plants, these bacteria must be in constant molecular communication with their host plants. Some of these molecular plant-microbe interactions are very specific, resulting in a symbiotic relationship between the diazotroph and the host. Others are found between associative diazotrophs and plants, resulting in plant infection and colonization of internal tissues. Independent of the type of ecological interaction, glycans, and glycoconjugates produced by these bacteria play an important role in the molecular communication prior and during colonization. Even though exopolysaccharides (EPS) and lipochitooligosaccharides (LCO) produced by diazotrophic bacteria and released onto the environment have their importance in the microbe-plant interaction, it is the lipopolysaccharides (LPS), anchored on the external membrane of these bacteria, that mediates the direct contact of the diazotroph with the host cells. These molecules are extremely variable among the several species of nitrogen fixing-bacteria, and there are evidences of the mechanisms of infection being closely related to their structure. PMID:25232535

Acid base activity of live bacteria: Implications for quantifying cell wall charge

NASA Astrophysics Data System (ADS)

Claessens, Jacqueline; van Lith, Yvonne; Laverman, Anniet M.; Van Cappellen, Philippe

2006-01-01

To distinguish the buffering capacity associated with functional groups in the cell wall from that resulting from metabolic processes, base or acid consumption by live and dead cells of the Gram-negative bacterium Shewanella putrefaciens was measured in a pH stat system. Live cells exhibited fast consumption of acid (pH 4) or base (pH 7, 8, 9, and 10) during the first few minutes of the experiments. At pH 5.5, no acid or base was required to maintain the initial pH constant. The initial amounts of acid or base consumed by the live cells at pH 4, 8, and 10 were of comparable magnitudes as those neutralized at the same pHs by intact cells killed by exposure to gamma radiation or ethanol. Cells disrupted in a French press required higher amounts of acid or base, due to additional buffering by intracellular constituents. At pH 4, acid neutralization by suspensions of live cells stopped after 50 min, because of loss of viability. In contrast, under neutral and alkaline conditions, base consumption continued for the entire duration of the experiments (5 h). This long-term base neutralization was, at least partly, due to active respiration by the cells, as indicated by the build-up of succinate in solution. Qualitatively, the acid-base activity of live cells of the Gram-positive bacterium Bacillus subtilis resembled that of S. putrefaciens. The pH-dependent charging of ionizable functional groups in the cell walls of the live bacteria was estimated from the initial amounts of acid or base consumed in the pH stat experiments. From pH 4 to 10, the cell wall charge increased from near-zero values to about -4 × 10 -16 mol cell -1 and -6.5 × 10 -16 mol cell -1 for S. putrefaciens and B. subtilis, respectively. The similar cell wall charging of the two bacterial strains is consistent with the inferred low contribution of lipopolysaccharides to the buffering capacity of the Gram-negative cell wall (of the order of 10%).

Microbes Enhance Mobility of Arsenic in Pleistocene Aquifer Sand from Bangladesh

PubMed Central

Dhar, Ratan K.; Zheng, Yan; Saltikov, Chad W.; Radloff, Kathleen A.; Mailloux, Brian; Ahmed, Kazi. M.; van Geen, Alexander

2018-01-01

Dissimilatory metal-reducing bacteria can mobilize As, but few studies have studied such processes in deeper orange-colored Pleistocene sands containing 1–2 mg kg−1 As that are associated with low-As groundwater in Bangladesh. To address this gap, anaerobic incubations were conducted in replicate over 90 days using natural orange sands initially containing 0.14 mg kg−1 of 1 M phosphate-extractable As (24 hr), >99% as As(V), and 0.8 g kg−1 of 1.2 M HCl-leachable Fe (1 hr at 80°C), 95% as Fe(III). The sediment was resuspended in artificial groundwater, with or without lactate as a labile carbon source, and inoculated with metal-reducing Shewanella sp. ANA-3. Within 23 days, dissolved As concentrations increased to 17 μg L−1 with lactate, 97% as As(III), and 2 μg L−1 without lactate. Phosphate-extractable As concentrations increased 4-fold to 0.6 mg kg−1 in the same incubations, even without the addition of lactate. Dissolved As levels in controls without Shewanella, both with and without lactate, instead remained <1 μg L−1. These observations indicate that metal-reducers such as Shewanella can trigger As release to groundwater by converting sedimentary As to a more mobilizable form without the addition of high levels of labile carbon. Such interactions need to be better understood to determine the vulnerability of low-As aquifers from which drinking water is increasingly drawn in Bangladesh. PMID:21405115

Increases of heat shock proteins and their mRNAs at high hydrostatic pressure in a deep-sea piezophilic bacterium, Shewanella violacea.

PubMed

Sato, Hiroshi; Nakasone, Kaoru; Yoshida, Takao; Kato, Chiaki; Maruyama, Tadashi

2015-07-01

When non-extremophiles encounter extreme environmental conditions, which are natural for the extremophiles, stress reactions, e.g., expression of heat shock proteins (HSPs), are thought to be induced for survival. To understand how the extremophiles live in such extreme environments, we studied the effects of high hydrostatic pressure on cellular contents of HSPs and their mRNAs during growth in a piezophilic bacterium, Shewanella violacea. HSPs increased at high hydrostatic pressures even when optimal for growth. The mRNAs and proteins of these HSPs significantly increased at higher hydrostatic pressure in S. violacea. In the non-piezophilic Escherichia coli, however, their mRNAs decreased, while their proteins did not change. Several transcriptional start sites (TSSs) for HSP genes were determined by the primer extension method and some of them showed hydrostatic pressure-dependent increase of the mRNAs. A major refolding target of one of the HSPs, chaperonin, at high hydrostatic pressure was shown to be RplB, a subunit of the 50S ribosome. These results suggested that in S. violacea, HSPs play essential roles, e.g., maintaining protein complex machinery including ribosomes, in the growth and viability at high hydrostatic pressure, and that, in their expression, the transcription is under the control of σ(32).

The Interaction between Heterotrophic Bacteria and Coliform, Fecal Coliform, Fecal Streptococci Bacteria in the Water Supply Networks.

PubMed

Amanidaz, Nazak; Zafarzadeh, Ali; Mahvi, Amir Hossein

2015-12-01

This study investigated the interaction between heterotrophic bacteria and coliform, fecal coliforms, fecal streptococci bacteria in water supply networks. This study was conducted during 2013 on water supply distribution network in Aq Qala City, Golestan Province, Northern Iran and standard methods were applied for microbiological analysis. The surface method was applied to test the heterotrophic bacteria and MPN method was used for coliform, fecal coliform and fecal streptococci bacteria measurements. In 114 samples, heterotrophic bacteria count were over 500 CFU/ml, which the amount of fecal coliform, coliform, and fecal streptococci were 8, 32, and 20 CFU/100 ml, respectively. However, in the other 242 samples, with heterotrophic bacteria count being less than 500 CFU/ml, the amount of fecal coliform, coliform, and fecal streptococci was 7, 23, and 11 CFU/100ml, respectively. The relationship between heterotrophic bacteria, coliforms and fecal streptococci was highly significant (P<0.05). We observed the concentration of coliforms, fecal streptococci bacteria being high, whenever the concentration of heterotrophic bacteria in the water network systems was high. Interaction between heterotrophic bacteria and coliform, fecal coliforms, fecal streptococci bacteria in the Aq Qala City water supply networks was not notable. It can be due to high concentrations of organic carbon, bio-films and nutrients, which are necessary for growth, and survival of all microorganisms.

The Interaction between Heterotrophic Bacteria and Coliform, Fecal Coliform, Fecal Streptococci Bacteria in the Water Supply Networks

PubMed Central

AMANIDAZ, Nazak; ZAFARZADEH, Ali; MAHVI, Amir Hossein

2015-01-01

Background: This study investigated the interaction between heterotrophic bacteria and coliform, fecal coliforms, fecal streptococci bacteria in water supply networks. Methods: This study was conducted during 2013 on water supply distribution network in Aq Qala City, Golestan Province, Northern Iran and standard methods were applied for microbiological analysis. The surface method was applied to test the heterotrophic bacteria and MPN method was used for coliform, fecal coliform and fecal streptococci bacteria measurements. Results: In 114 samples, heterotrophic bacteria count were over 500 CFU/ml, which the amount of fecal coliform, coliform, and fecal streptococci were 8, 32, and 20 CFU/100 ml, respectively. However, in the other 242 samples, with heterotrophic bacteria count being less than 500 CFU/ml, the amount of fecal coliform, coliform, and fecal streptococci was 7, 23, and 11 CFU/100ml, respectively. The relationship between heterotrophic bacteria, coliforms and fecal streptococci was highly significant (P<0.05). We observed the concentration of coliforms, fecal streptococci bacteria being high, whenever the concentration of heterotrophic bacteria in the water network systems was high. Conclusion: Interaction between heterotrophic bacteria and coliform, fecal coliforms, fecal streptococci bacteria in the Aq Qala City water supply networks was not notable. It can be due to high concentrations of organic carbon, bio-films and nutrients, which are necessary for growth, and survival of all microorganisms. PMID:26811820

Bacteria-surface interactions.

PubMed

Tuson, Hannah H; Weibel, Douglas B

2013-05-14

The interaction of bacteria with surfaces has important implications in a range of areas, including bioenergy, biofouling, biofilm formation, and the infection of plants and animals. Many of the interactions of bacteria with surfaces produce changes in the expression of genes that influence cell morphology and behavior, including genes essential for motility and surface attachment. Despite the attention that these phenotypes have garnered, the bacterial systems used for sensing and responding to surfaces are still not well understood. An understanding of these mechanisms will guide the development of new classes of materials that inhibit and promote cell growth, and complement studies of the physiology of bacteria in contact with surfaces. Recent studies from a range of fields in science and engineering are poised to guide future investigations in this area. This review summarizes recent studies on bacteria-surface interactions, discusses mechanisms of surface sensing and consequences of cell attachment, provides an overview of surfaces that have been used in bacterial studies, and highlights unanswered questions in this field.

Genomics of Probiotic Bacteria

NASA Astrophysics Data System (ADS)

O'Flaherty, Sarah; Goh, Yong Jun; Klaenhammer, Todd R.

Probiotic bacteria from the Lactobacillus and Bifidobacterium species belong to the Firmicutes and the Actinobacteria phylum, respectively. Lactobacilli are members of the lactic acid bacteria (LAB) group, a broadly defined family of microorganisms that ferment various hexoses into primarily lactic acid. Lactobacilli are typically low G + C gram-positive species which are phylogenetically diverse, with over 100 species documented to date. Bifidobacteria are heterofermentative, high G + C content bacteria with about 30 species of bifidobacteria described to date.

Biotechnology of Anoxygenic Phototrophic Bacteria.

PubMed

Frigaard, Niels-Ulrik

Anoxygenic phototrophic bacteria are a diverse collection of organisms that are defined by their ability to grow using energy from light without evolving oxygen. The dominant groups are purple sulfur bacteria, purple nonsulfur bacteria, green sulfur bacteria, and green and red filamentous anoxygenic phototrophic bacteria. They represent several bacterial phyla but they all have bacteriochlorophylls and carotenoids and photochemical reaction centers which generate ATP and cellular reductants used for CO 2 fixation. They typically have an anaerobic lifestyle in the light, although some grow aerobically in the dark. Some of them oxidize inorganic sulfur compounds for light-dependent CO 2 fixation; this ability can be exploited for photobiological removal of hydrogen sulfide from wastewater and biogas. The anoxygenic phototrophic bacteria also perform bioremediation of recalcitrant dyes, pesticides, and heavy metals under anaerobic conditions. Finally, these organisms may be useful for overexpression of membrane proteins and photobiological production of H 2 and other valuable compounds.

Role of Sulfhydryl Sites on Bacterial Cell Walls in the Biosorption, Mobility and Bioavailability of Mercury and Uranium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myneni, Satish C.; Mishra, Bhoopesh; Fein, Jeremy

2009-04-01

The goal of this exploratory study is to provide a quantitative and mechanistic understanding of the impact of bacterial sulfhydryl groups on the bacterial uptake, speciation, methylation and bioavailability of Hg and redox changes of uranium. The relative concentration and reactivity of different functional groups present on bacterial surfaces will be determined, enabling quantitative predictions of the role of biosorption of Hg under the physicochemical conditions found at contaminated DOE sites.The hypotheses we propose to test in this investigation are as follows- 1) Sulfhydryl groups on bacterial cell surfaces modify Hg speciation and solubility, and play an important role, specificallymore » in the sub-micromolar concentration ranges of metals in the natural and contaminated systems. 2) Sulfhydryl binding of Hg on bacterial surfaces significantly influences Hg transport into the cell and the methylation rates by the bacteria. 3) Sulfhydryls on cell membranes can interact with hexavalent uranium and convert to insoluble tetravalent species. 4) Bacterial sulfhydryl surface groups are inducible by the presence of metals during cell growth. Our studies focused on the first hypothesis, and we examined the nature of sulfhydryl sites on three representative bacterial species: Bacillus subtilis, a common gram-positive aerobic soil species; Shewanella oneidensis, a facultative gram-negative surface water species; and Geobacter sulfurreducens, an anaerobic iron-reducing gram-negative species that is capable of Hg methylation; and at a range of Hg concentration (and Hg:bacterial concentration ratio) in which these sites become important. A summary of our findings is as follows- Hg adsorbs more extensively to bacteria than other metals. Hg adsorption also varies strongly with pH and chloride concentration, with maximum adsorption occurring under circumneutral pH conditions for both Cl-bearing and Cl-free systems. Under these conditions, all bacterial species tested

Membrane-active macromolecules kill antibiotic-tolerant bacteria and potentiate antibiotics towards Gram-negative bacteria

PubMed Central

Uppu, Divakara S. S. M.; Konai, Mohini M.; Sarkar, Paramita; Samaddar, Sandip; Fensterseifer, Isabel C. M.; Farias-Junior, Celio; Krishnamoorthy, Paramanandam; Shome, Bibek R.; Franco, Octávio L.

2017-01-01

Chronic bacterial biofilms place a massive burden on healthcare due to the presence of antibiotic-tolerant dormant bacteria. Some of the conventional antibiotics such as erythromycin, vancomycin, linezolid, rifampicin etc. are inherently ineffective against Gram-negative bacteria, particularly in their biofilms. Here, we report membrane-active macromolecules that kill slow dividing stationary-phase and antibiotic tolerant cells of Gram-negative bacteria. More importantly, these molecules potentiate antibiotics (erythromycin and rifampicin) to biofilms of Gram-negative bacteria. These molecules eliminate planktonic bacteria that are liberated after dispersion of biofilms (dispersed cells). The membrane-active mechanism of these molecules forms the key for potentiating the established antibiotics. Further, we demonstrate that the combination of macromolecules and antibiotics significantly reduces bacterial burden in mouse burn and surgical wound infection models caused by Acinetobacter baumannii and Carbapenemase producing Klebsiella pneumoniae (KPC) clinical isolate respectively. Colistin, a well-known antibiotic targeting the lipopolysaccharide (LPS) of Gram-negative bacteria fails to kill antibiotic tolerant cells and dispersed cells (from biofilms) and bacteria develop resistance to it. On the contrary, these macromolecules prevent or delay the development of bacterial resistance to known antibiotics. Our findings emphasize the potential of targeting the bacterial membrane in antibiotic potentiation for disruption of biofilms and suggest a promising strategy towards developing therapies for topical treatment of Gram-negative infections. PMID:28837596

Interactions between Diatoms and Bacteria

PubMed Central

Amin, Shady A.; Parker, Micaela S.

2012-01-01

Summary: Diatoms and bacteria have cooccurred in common habitats for hundreds of millions of years, thus fostering specific associations and interactions with global biogeochemical consequences. Diatoms are responsible for one-fifth of the photosynthesis on Earth, while bacteria remineralize a large portion of this fixed carbon in the oceans. Through their coexistence, diatoms and bacteria cycle nutrients between oxidized and reduced states, impacting bioavailability and ultimately feeding higher trophic levels. Here we present an overview of how diatoms and bacteria interact and the implications of these interactions. We emphasize that heterotrophic bacteria in the oceans that are consistently associated with diatoms are confined to two phyla. These consistent bacterial associations result from encounter mechanisms that occur within a microscale environment surrounding a diatom cell. We review signaling mechanisms that occur in this microenvironment to pave the way for specific interactions. Finally, we discuss known interactions between diatoms and bacteria and exciting new directions and research opportunities in this field. Throughout the review, we emphasize new technological advances that will help in the discovery of new interactions. Deciphering the languages of diatoms and bacteria and how they interact will inform our understanding of the role these organisms have in shaping the ocean and how these interactions may change in future oceans. PMID:22933565

Method of Detecting Coliform Bacteria and Escherichia Coli Bacteria from Reflected Light

NASA Technical Reports Server (NTRS)

Vincent, Robert (Inventor)

2013-01-01

The present invention relates to a method of detecting coliform bacteria in water from reflected light and a method of detecting Eschericha Coli bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

Ice-Nucleating Bacteria

NASA Astrophysics Data System (ADS)

Obata, Hitoshi

Since the discovery of ice-nucleating bacteria in 1974 by Maki et al., a large number of studies on the biological characteristics, ice-nucleating substance, ice nucleation gene and frost damage etc. of the bacteria have been carried out. Ice-nucleating bacteria can cause the freezing of water at relatively warm temperature (-2.3°C). Tween 20 was good substrates for ice-nucleating activity of Pseudomonas fluorescens KUIN-1. Major fatty acids of Isolate (Pseudomonas fluorescens) W-11 grown at 30°C were palmitic, cis-9-hexadecenoic and cis-11-octadecenoic which amounted to 90% of the total fatty acids. Sequence analysis shows that an ice nucleation gene from Pseudomonas fluorescens is related to the gene of Pseudomonas syringae.

A Versatile Strategy for Characterization and Imaging of Drip Flow Microbial Biofilms.

PubMed

Li, Bin; Dunham, Sage J B; Ellis, Joseph F; Lange, Justin D; Smith, Justin R; Yang, Ning; King, Travis L; Amaya, Kensey R; Arnett, Clint M; Sweedler, Jonathan V

2018-06-05

The inherent architectural and chemical complexities of microbial biofilms mask our understanding of how these communities form, survive, propagate, and influence their surrounding environment. Here we describe a simple and versatile workflow for the cultivation and characterization of model flow-cell-based microbial ecosystems. A customized low-shear drip flow reactor was designed and employed to cultivate single and coculture flow-cell biofilms at the air-liquid interface of several metal surfaces. Pseudomonas putida F1 and Shewanella oneidensis MR-1 were selected as model organisms for this study. The utility and versatility of this platform was demonstrated via the application of several chemical and morphological imaging techniques-including matrix-assisted laser desorption/ionization mass spectrometry imaging, secondary ion mass spectrometry imaging, and scanning electron microscopy-and through the examination of model systems grown on iron substrates of varying compositions. Implementation of these techniques in combination with tandem mass spectrometry and a two-step imaging principal component analysis strategy resulted in the identification and characterization of 23 lipids and 3 oligosaccharides in P. putida F1 biofilms, the discovery of interaction-specific analytes, and the observation of several variations in cell and substrate morphology present during microbially influenced corrosion. The presented workflow is well-suited for examination of both single and multispecies drip flow biofilms and offers a platform for fundamental inquiries into biofilm formation, microbe-microbe interactions, and microbially influenced corrosion.

Effects of Humic and Fulvic Acids on Silver Nanoparticle Stability, Dissolution, and Toxicity

PubMed Central

Gunsolus, Ian L.; Mousavi, Maral P. S.; Hussein, Kadir; Bühlmann, Philippe; Haynes, Christy L.

2015-01-01

The colloidal stability of silver nanoparticles (AgNPs) in natural aquatic environments influences their transport and environmental persistence, while their dissolution to Ag+ influences their toxicity to organisms. Here, we characterize the colloidal stability, dissolution behavior, and toxicity of two industrially relevant classes of AgNPs (i.e., AgNPs stabilized by citrate or polyvinylpyrrolidone) after exposure to natural organic matter (NOM, i.e., Suwannee River Humic and Fulvic Acid Standards and Pony Lake Fulvic Acid Reference). We show that NOM interaction with the nanoparticle surface depends on (i) the NOM’s chemical composition, where sulfur- and nitrogen-rich NOM more significantly increases colloidal stability, and (ii) the affinity of the capping agent for the AgNP surface, where nanoparticles with loosely bound capping agents are more effectively stabilized by NOM. Adsorption of NOM is shown to have little effect on AgNP dissolution under most experimental conditions, the exception being when the NOM is rich in sulfur and nitrogen. Similarly, the toxicity of AgNPs to a bacterial model (Shewanella oneidensis MR-1) decreases most significantly in the presence of sulfur- and nitrogen-rich NOM. Our data suggest that the rate of AgNP aggregation and dissolution in aquatic environments containing NOM will depend on the chemical composition of the NOM, and that the toxicity of AgNPs to aquatic microorganisms is controlled primarily by the extent of nanoparticle dissolution. PMID:26047330

A Novel Nano/Micro-Fluidic Reactor for Evaluation of Pore-Scale Reactive Transport

NASA Astrophysics Data System (ADS)

Werth, C. J.; Alcalde, R.; Ghazvini, S.; Sanford, R. A.; Fouke, B. W.; Valocchi, A. J.

2017-12-01

The reactive transport of pollutants in groundwater can be affected by the presence of stressor chemicals, which inhibit microbial functions. The stressor can be a primary reactant (e.g., trichloroethene), a reaction product (e.g., nitrite from nitrate), or some other chemical present in groundwater (e.g., antibiotic). In this work, a novel nano/microfluidic cell was developed to examine the effect of the antibiotic ciprofloxacin on nitrate reduction coupled to lactate oxidation. The reactor contains parallel boundary channels that deliver flow and solutes on either side of a pore network. The boundary channels are separated from the pore network by one centimeter-long, one micrometer-thick walls perforated by hundreds of nanoslits. The nanoslits allow solute mass transfer from the boundary channels to the pore network, but not microbial passage. The pore network was inoculated with a pure culture of Shewanella oneidensis MR-1, and this was allowed to grow on lactate and nitrate in the presence of ciprofloxacin, all delivered through the boundary channels. Microbial growth patterns suggest inhibition from ciprofloxacin and the nitrate reduction product nitrite, and a dependence on nitrate and lactate mass transfer rates from the boundary channels. A numerical model was developed to interpret the controlling mechanisms, and results indicate cell chemotaxis also affects nitrate reduction and microbial growth. The results are broadly relevant to bioremediation efforts where one or more chemicals that inhibit microbial growth are present and inhibit pollutant degradation rates.

Geothrix fermentans Secretes Two Different Redox-Active Compounds To Utilize Electron Acceptors across a Wide Range of Redox Potentials

PubMed Central

Mehta-Kolte, Misha G.

2012-01-01

The current understanding of dissimilatory metal reduction is based primarily on isolates from the proteobacterial genera Geobacter and Shewanella. However, environments undergoing active Fe(III) reduction often harbor less-well-studied phyla that are equally abundant. In this work, electrochemical techniques were used to analyze respiratory electron transfer by the only known Fe(III)-reducing representative of the Acidobacteria, Geothrix fermentans. In contrast to previously characterized metal-reducing bacteria, which typically reach maximal rates of respiration at electron acceptor potentials of 0 V versus standard hydrogen electrode (SHE), G. fermentans required potentials as high as 0.55 V to respire at its maximum rate. In addition, G. fermentans secreted two different soluble redox-active electron shuttles with separate redox potentials (−0.2 V and 0.3 V). The compound with the lower midpoint potential, responsible for 20 to 30% of electron transfer activity, was riboflavin. The behavior of the higher-potential compound was consistent with hydrophilic UV-fluorescent molecules previously found in G. fermentans supernatants. Both electron shuttles were also produced when cultures were grown with Fe(III), but not when fumarate was the electron acceptor. This study reveals that Geothrix is able to take advantage of higher-redox-potential environments, demonstrates that secretion of flavin-based shuttles is not confined to Shewanella, and points to the existence of high-potential-redox-active compounds involved in extracellular electron transfer. Based on differences between the respiratory strategies of Geothrix and Geobacter, these two groups of bacteria could exist in distinctive environmental niches defined by redox potential. PMID:22843516

DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria.

PubMed

Peng, Yun-Feng; Chen, Wen-Chao; Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

2016-01-01

The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of four pfaE genes from bacteria producing arachidonic acid (ARA, 20:4ω6), eicosapentaenoic acid (EPA, 20:5ω3) or DHA, respectively. Substitution of the pfaE gene from different strain source in E. coli did not influence the function of the PKS pathway producing DHA, although they led to different DHA yields and fatty acid profiles. This result suggested that the pfaE gene could be switchable between these strains for the production of DHA. The DHA production by expressing the reconstituted PKS pathway was also investigated in different E. coli strains, at different temperatures, or with the treatment of cerulenin. The highest DHA production, 2.2 mg of DHA per gram of dry cell weight or 4.1% of total fatty acids, was obtained by co-expressing pfaE(EPA) from the EPA-producing strain Shewanella baltica with pfaABCD in DH5α. Incubation at low temperature (10-15°C) resulted in higher accumulation of DHA compared to higher temperatures. The addition of cerulenin to the medium increased the proportion of DHA and saturated fatty acids, including C12:0, C14:0 and C16:0, at the expense of monounsaturated fatty acids, including C16:1 and C18:1. Supplementation with 1 mg/L cerulenin resulted in the highest DHA yield of 2.4 mg/L upon co-expression of pfaE(DHA) from C. psychrerythraea.

Re-engineering bacteria for ethanol production

DOEpatents

Yomano, Lorraine P; York, Sean W; Zhou, Shengde; Shanmugam, Keelnatham; Ingram, Lonnie O

2014-05-06

The invention provides recombinant bacteria, which comprise a full complement of heterologous ethanol production genes. Expression of the full complement of heterologous ethanol production genes causes the recombinant bacteria to produce ethanol as the primary fermentation product when grown in mineral salts medium, without the addition of complex nutrients. Methods for producing the recombinant bacteria and methods for producing ethanol using the recombinant bacteria are also disclosed.

Denitrification by extremely halophilic bacteria

NASA Technical Reports Server (NTRS)

Hochstein, L. I.; Tomlinson, G. A.

1985-01-01

Extremely halophilic bacteria were isolated from widely separated sites by anaerobic enrichment in the presence of nitrate. The anaerobic growth of several of these isolates was accompanied by the production of nitrite, nitrous oxide, and dinitrogen. These results are a direct confirmation of the existence of extremely halophilic denitrifying bacteria, and suggest that such bacteria may be common inhabitants of hypersaline environments.

Effect of air pollution on the total bacteria and pathogenic bacteria in different sizes of particulate matter.

PubMed

Liu, Huan; Zhang, Xu; Zhang, Hao; Yao, Xiangwu; Zhou, Meng; Wang, Jiaqi; He, Zhanfei; Zhang, Huihui; Lou, Liping; Mao, Weihua; Zheng, Ping; Hu, Baolan

2018-02-01

In recent years, air pollution events have occurred frequently in China during the winter. Most studies have focused on the physical and chemical composition of polluted air. Some studies have examined the bacterial bioaerosols both indoors and outdoors. But few studies have focused on the relationship between air pollution and bacteria, especially pathogenic bacteria. Airborne PM samples with different diameters and different air quality index values were collected in Hangzhou, China from December 2014 to January 2015. High-throughput sequencing of 16S rRNA was used to categorize the airborne bacteria. Based on the NCBI database, the "Human Pathogen Database" was established, which is related to human health. Among all the PM samples, the diversity and concentration of total bacteria were lowest in the moderately or heavily polluted air. However, in the PM2.5 and PM10 samples, the relative abundances of pathogenic bacteria were highest in the heavily and moderately polluted air respectively. Considering the PM samples with different particle sizes, the diversities of total bacteria and the proportion of pathogenic bacteria in the PM10 samples were different from those in the PM2.5 and TSP samples. The composition of PM samples with different sizes range may be responsible for the variances. The relative humidity, carbon monoxide and ozone concentrations were the main factors, which affected the diversity of total bacteria and the proportion of pathogenic bacteria. Among the different environmental samples, the compositions of the total bacteria were very similar in all the airborne PM samples, but different from those in the water, surface soil, and ground dust samples. Which may be attributed to that the long-distance transport of the airflow may influence the composition of the airborne bacteria. This study of the pathogenic bacteria in airborne PM samples can provide a reference for environmental and public health researchers. Copyright © 2017 Elsevier Ltd

Culturable Aerobic and Facultative Anaerobic Intestinal Bacterial Flora of Black Cobra (Naja naja karachiensis) in Southern Pakistan

PubMed Central

Iqbal, Junaid; Sagheer, Mehwish; Tabassum, Nazneen; Siddiqui, Ruqaiyyah; Khan, Naveed Ahmed

2014-01-01

Using morphological analysis and biochemical testing, here for the first time, we determined the culturable gut bacterial flora (aerobes and facultative anaerobes) in the venomous Black Cobra (Naja naja karachiensis) from South Asia. The findings revealed that these snakes inhabit potentially pathogenic bacteria including Serratia marcescens, Pseudomonas aeruginosa, Shewanella putrefaciens, Aeromonas hydrophila, Salmonella sp., Moraxella sp., Bacillus sp., Ochrobactrum anthropi, and Providencia rettgeri. These findings are of concern, as injury from snake bite can result in wound infections and tissue necrosis leading to sepsis/necrotizing fasciitis and/or expose consumers of snake meat/medicine in the community to infections. PMID:25002979

Bacteria entombed in the center of cholesterol gallstones induce fewer infectious manifestations than bacteria in the matrix of pigment stones.

PubMed

Stewart, Lygia; Griffiss, J McLeod; Jarvis, Gary A; Way, Lawrence W

2007-10-01

The clinical significance of bacteria in the pigment centers of cholesterol stones is unknown. We compared the infectious manifestations and characteristics of bacteria from pigment stones and predominantly cholesterol stones. Three hundred forty patients were studied. Bile was cultured. Gallstones were cultured and examined with scanning electron microscopy. Level of bacterial immunoglobulin G (bile, serum), complement killing, and tumor necrosis factor-alpha production were determined. Twenty-three percent of cholesterol stones and 68% of pigment stones contained bacteria (P < 0.0001). Stone culture correlated with scanning electron microscopy results. Pigment stone bacteria were more often present in bile and blood. Cholesterol stone bacteria caused more severe infections (19%) than sterile stones (0%), but less than pigment stone bacteria (57%) (P < 0.0001). Serum and bile from patients with cholesterol stone bacteria had less bacterial-specific immunoglobulin G. Cholesterol stone bacteria produced more slime. Pigment stone bacteria were more often killed by a patient's serum. Tumor necrosis factor-alpha production of the groups was similar. Bacteria are readily cultured from cholesterol stones with pigment centers, allowing for analysis of their virulence factors. Bacteria sequestered in cholesterol stones cause infectious manifestations, but less than bacteria in pigment stones. Possibly because of their isolation, cholesterol stone bacteria were less often present in bile and blood, induced less immunoglobulin G, were less often killed by a patient's serum, and demonstrated fewer infectious manifestations than pigment stone bacteria. This is the first study to analyze the clinical relevance of bacteria within cholesterol gallstones.

An ice-binding and tandem beta-sandwich domain-containing protein in Shewanella frigidimarina is a potential new type of ice adhesin.

PubMed

Vance, Tyler D R; Graham, Laurie A; Davies, Peter L

2018-04-01

Out of the dozen different ice-binding protein (IBP) structures known, the DUF3494 domain is the most widespread, having been passed many times between prokaryotic and eukaryotic microorganisms by horizontal gene transfer. This ~25-kDa β-solenoid domain with an adjacent parallel α-helix is most commonly associated with an N-terminal secretory signal peptide. However, examples of the DUF3494 domain preceded by tandem Bacterial Immunoglobulin-like (BIg) domains are sometimes found, though uncharacterized. Here, we present one such protein (SfIBP_1) from the Antarctic bacterium Shewanella frigidimarina. We have confirmed and characterized the ice-binding activity of its ice-binding domain using thermal hysteresis measurements, fluorescent ice plane affinity analysis, and ice recrystallization inhibition assays. X-ray crystallography was used to solve the structure of the SfIBP_1 ice-binding domain, to further characterize its ice-binding surface and unique method of stabilizing or 'capping' the ends of the solenoid structure. The latter is formed from the interaction of two loops mediated by a combination of tandem prolines and electrostatic interactions. Furthermore, given their domain architecture and membrane association, we propose that these BIg-containing DUF3494 IBPs serve as ice-binding adhesion proteins that are capable of adsorbing their host bacterium onto ice. Submitted new structure to the Protein Data Bank (PDB: 6BG8). © 2018 Federation of European Biochemical Societies.

Human body may produce bacteria.

PubMed

Salerian, Alen J

2017-06-01

"Human body may produce bacteria" proposes that human body may produce bacteria and represent an independent source of infections contrary to the current paradigm of infectious disorders proposed by Louis Pasteur in 1880. The following observations are consistent with this hypothesis: A. Bidirectional transformations of both living and nonliving things have been commonly observed in nature. B. Complex multicellular organisms harbor the necessary properties to produce bacteria (water, nitrogen and oxygen). C. Physical laws suggest any previously observed phenomenon or action will occur again (life began on earth; a non living thing). D. Animal muscle cells may generate energy (fermentation). E. Sterilized food products (i.e. boiled eggs), may produce bacteria and fungus under special conditions and without any exposure to foreign living cells. "Human body may produce bacteria" may challenge the current medical paradigm that views human infectious disorders as the exclusive causative byproducts of invading foreign cells. It may also introduce new avenues to treat infectious disorders. Copyright © 2017 Elsevier Ltd. All rights reserved.

Some bacteria are beneficial!

USGS Publications Warehouse

McMahon, Peter B.

1995-01-01

Most people would agree that bacteria usually spell trouble where the quality of drinking water is con cerned. However, recent studies conducted by the U.S. Geological Survey (USGS) under the National Water-Quality Assessment (NAWQA) program have shown that some bacteria can improve the quality of water.

Enteric bacteria in aerobically digested sludge.

PubMed Central

Farrah, S R; Bitton, G

1984-01-01

Indicator bacteria, Salmonella spp., and total aerobic bacteria were determined in samples of undigested sludge and sludge that had been treated by one or two stages of aerobic digestion. Aerobic sludge digestion reduced the level of indicator bacteria by 1 to 2 log10 per g. The level of Salmonella spp. was also reduced during aerobic treatment of sludge. In general, aerobic treatment of sludge reduced, but did not eliminate, indicator bacteria and Salmonella spp. PMID:6721492

Antibiotic Production by Anaerobic Bacteria1

PubMed Central

Sturgen, Nancy O.; Casida, L. E.

1962-01-01

Soils from aerobic and anaerobic sources were investigated for the possible presence of bacteria which produce antibiotics under anaerobic conditions of growth. The screening techniques devised for this study yielded 157 soil bacteria which, during anaerobic growth, produced antibiotic activity against aerobic test bacteria. Studies on choice of media, presence of oxygen, and changes in antibiotic activity during growth indicated that representative strains of these bacteria produced mixtures of antibiotics. The activity was heat labile. PMID:13918037

Effects on intestinal microbiota and immune genes of Solea senegalensis after suspension of the administration of Shewanella putrefaciens Pdp11.

PubMed

Vidal, Sara; Tapia-Paniagua, Silvana Teresa; Moriñigo, Jesús Miguel; Lobo, Carmen; García de la Banda, Inés; Balebona, María Del Carmen; Moriñigo, Miguel Ángel

2016-11-01

The interaction host-intestinal microbiota is essential for the immunological homeostasis of the host. Probiotics, prebiotics and synbiotics are promising tools for the manipulation of the intestinal microbiota towards beneficial effects to the host. The objective of this study was to evaluate the modulation effect on the intestinal microbiota and the transcription of genes involved in the immune response in head kidney of Solea senegalensis after administration of diet supplemented with the prebiotic alginate and the probiotic Shewanella putrefaciens Pdp11 CECT 7627 (SpPdp11). The results showed higher adaptability to dietary changes in the intestinal microbiota of fish fed diet with alginate and SpPdp11 together compared to those fish that received an alginate-supplemented diet. The alginate-supplemented diet produced up-regulation of genes encoding proteins involved in immunological responses, such as complement, lysozyme G and transferrin, and oxidative stress, such as NADPH oxidase and glutation peroxidase. On the other hand, the administration of alginate combined with SpPdp11 resulted in a significant increase of the transcription of genes encoding for glutation peroxidase and HSP70, indicating a potential protective effect of SpPdp11 against oxidative stress. In addition, these effects were maintained after the suspension of the probiotic treatment. The relationship between the modulation of the intestinal microbiota and the expression of genes with protective effect against the oxidative stress was demonstrated by the Principal Components Analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

High power density microbial fuel cell with flexible 3D graphene-nickel foam as anode

NASA Astrophysics Data System (ADS)

Wang, Hanyu; Wang, Gongming; Ling, Yichuan; Qian, Fang; Song, Yang; Lu, Xihong; Chen, Shaowei; Tong, Yexiang; Li, Yat

2013-10-01

The structure and electrical conductivity of anode play a significant role in the power generation of microbial fuel cells (MFCs). In this study, we developed a three-dimensional (3D) reduced graphene oxide-nickel (denoted as rGO-Ni) foam as an anode for MFC through controlled deposition of rGO sheets onto the nickel foam substrate. The loading amount of rGO sheets and electrode surface area can be controlled by the number of rGO loading cycles. 3D rGO-Ni foam anode provides not only a large accessible surface area for microbial colonization and electron mediators, but also a uniform macro-porous scaffold for effective mass diffusion of the culture medium. Significantly, at a steady state of the power generation, the MFC device with flexible rGO-Ni electrodes produced an optimal volumetric power density of 661 W m-3 calculated based on the volume of anode material, or 27 W m-3 based on the volume of the anode chamber. These values are substantially higher than that of plain nickel foam, and other conventional carbon based electrodes (e.g., carbon cloth, carbon felt, and carbon paper) measured in the same conditions. To our knowledge, this is the highest volumetric power density reported for mL-scale MFC device with a pure strain of Shewanella oneidensis MR-1. We also demonstrated that the MFC device can be operated effectively in a batch-mode at least for a week. These new 3D rGO-Ni electrodes show great promise for improving the power generation of MFC devices.The structure and electrical conductivity of anode play a significant role in the power generation of microbial fuel cells (MFCs). In this study, we developed a three-dimensional (3D) reduced graphene oxide-nickel (denoted as rGO-Ni) foam as an anode for MFC through controlled deposition of rGO sheets onto the nickel foam substrate. The loading amount of rGO sheets and electrode surface area can be controlled by the number of rGO loading cycles. 3D rGO-Ni foam anode provides not only a large accessible

Shewanella oneidensis in a lactate-fed pure-culture and a glucose-fed co-culture with Lactococcus lactis with an electrode as electron acceptor

USDA-ARS?s Scientific Manuscript database

Bioelectrochemical systems (BESs) employing mixed microbial communities as biocatalysts are gaining importance as potential renewable energy, bioremediation, or biosensing devices. While we are beginning to understand how individual microbial species interact with an electrode as electron donor, li...